US20050153047A1 - Novel melon plants - Google Patents
Novel melon plants Download PDFInfo
- Publication number
- US20050153047A1 US20050153047A1 US11/031,578 US3157805A US2005153047A1 US 20050153047 A1 US20050153047 A1 US 20050153047A1 US 3157805 A US3157805 A US 3157805A US 2005153047 A1 US2005153047 A1 US 2005153047A1
- Authority
- US
- United States
- Prior art keywords
- fruit
- plant
- plant according
- melo
- melo plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L19/00—Products from fruits or vegetables; Preparation or treatment thereof
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/08—Fruits
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/34—Cucurbitaceae, e.g. bitter melon, cucumber or watermelon
- A01H6/344—Cucumis melo [melon]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
Definitions
- the present invention relates to novel plants, in particular to melon plants capable of producing fruits with a new pleasant taste.
- the fruits of the melon plants of the present invention have altered organic acid contents, lower pH when compared to current commercial sweet melon fruits, and high sugar contents.
- Cucumis melo L. is a commercial crop grown worldwide.
- Cucumis melo is a member of the family Cucurbitaceae.
- the Cucurbitaceae comprises about 90 genera and 700 to 760 species, mostly of the tropics.
- the family includes pumpkins, squashes, gourds, watermelon, loofah and several weeds.
- Cucumis melo L. includes a very wide variety of cultivars producing fruits of different shape, external appearance and flesh color.
- Commercial melons generally produce sweet fruits known for example as Charentais, cantaloupe, honeydew, amarello, Piel de sapo, Kirkagak, Hamy, Ananas, Galia, Oriental that are usually consumed as dessert fruits.
- Cucumis melo L. also includes non-sweet, commercial cultivars consumed in the Middle to Far East in salad, cooking or pickling, as for example Alficoz, Faqqous, Chito, Conomon (Pitrat et al (2000) Eucarpia meeting Proceedings: 29-36).
- the taste and aroma of melon fruits is determined by a number of factors, including sugars, aroma volatiles, free amino acids, organic acids, pH and soluble minerals (Wang et al. (1996) J. Agric. Food Chem. 44: 210-216).
- sweetness is considered to be a very important component of good tasting melon fruits.
- sucrose is accumulated at the end of fruit development, during ripening process (Shaffer et al (1987) Phytochemistry 26: 1883-1887).
- Melon fruits also initially accumulate hexoses, mainly fructose and glucose, which are the dominant reducing sugars (Stepanski et al (1999) Genetic Resources and Crop Evolution 46: 53-62).
- An important taste component in melon fruits is sweetness, which is mainly the result of sugars accumulation. Sweetness correlates not only with the total sugars content, but also with the type of sugars.
- 1 gram of glucose is the sweet equivalent of 0.7 gram of sucrose; 1 gram of fructose is the sweet equivalent of 1.7 gram of sucrose; 1 gram of inverted sugar, i.e. glucose plus fructose generated from 1 gram of sucrose, is the sweet equivalent of 1.3 gram of sucrose (J. A. BABOR et J.IBARZ (1935) Quimica General Moderna).
- the flesh of sweet melon fruits has a pH usually above 6.0, but melon accessions are also known to have a much lower pH, as low as below 5.0. This low pH is widespread over many different melon types as for example Faqqous, Chito, Conomon, Momordica, Agrestis (Stepanski et al). In most of these cases, these melon types combine low pH and low sugar content, e.g. sucrose (Stepanski et al). These fruits are generally not edible in fresh consumption without dressing or cooking and, in some cases, they are even bitter.
- the mesocarp which is the edible part of the fruit, represents a minor part of the total fruit, while the seed cavity and placenta represent a major part of the total fruit fresh weight. This is in contrast to sweet dessert melons, where the mesocarp represents a major part of the fruit. Also, in many cases, the fruit size or weight of the melon having low pH is below commercially acceptable ranges.
- the fruit flesh of some melons has a sour taste (Kubicki (1962) Genetica Polonica 3:265-274).
- the cause for the sour taste remains unclear, but it has been linked with low pH in the fruit flesh (U.S. Pat. No. 5,476,998 and Danin-Poleg et al. (2002) Euphytica 125: 373-384).
- Single genes for sour taste (So) and pH have also been reported, although their genetic association is not clear (Danin-Poleg et al.).
- the instant invention addresses the need for melon fruits with alternative or improved tastes. Accordingly, the instant invention discloses melon plants capable of producing fruits with novel combinations of organic acid contents and compositions, pH, and sugars contents and compositions. The invention also discloses methods of making and methods of using plants of the present invention and their fruits.
- the inventors of the instant application have identified that there is a wide variability in the contents and composition of organic acids in melon fruits.
- the inventors of the present invention have identified that melon plants produce fruits with varying contents of citric acid and varying ratios of citric acid to malic acid.
- the inventors of the present invention have combined appropriate content of organic acids, low pH and desired sugar contents in a melon fruit to obtain novel and extremely pleasant tastes.
- the instant invention discloses melon plants capable of producing fruit with low pH and desired combinations of citric and malic acid contents, while maintaining or increasing levels of sugars currently observed in sweet melons.
- the instant invention discloses melon plants capable of producing fruit with low pH and desired combinations of citric and malic acid contents, combined with desired combinations of sucrose and hexoses contents.
- the present invention provides melon plants capable of producing fruits with elevated contents of citric acid and lower pH, when compared to current commercial melons.
- melon plants of the present invention are obtained by introducing a low pH trait in a melon plant not comprising said trait.
- melon plants of the present invention are obtained by introducing a low pH gene in a melon plant not comprising said gene.
- the low pH gene is obtainable from line IND-35, deposited with NCIMB under Accession number NCIMB 41202.
- the present invention discloses melon plants comprising a low pH trait, and producing fruit comprising desired contents and compositions of organic acids, pH and contents and compositions of sugars.
- increased citric acid contents are achieved while maintaining low levels of malic acid in the fruit.
- fruits of melon plant of the instant invention have high ratios of citric acid to malic acid.
- the melon plants of the instant invention are capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fresh weight (fwt). In one embodiment, melon plants of the instant invention are capable of producing fruit with a pH of about 4.2 to about 5.6. In one embodiment, melon plants of the instant invention are capable of producing fruit with a sugar content equal or higher than about 5.0 g per 100 g fwt. In one embodiment, melon plants of the instant invention are capable of producing fruit with a sugar content equal or higher than about 7.0 g per 100 g fwt.
- the present invention discloses melon plants capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fwt, pH of about 4.2 to about 5.6, and sugar content equal or higher than about 5.0 g per 100 g fwt.
- the present invention discloses a C. melo plant capable of producing a fruit comprising at maturity:
- the citric acid content of a fruit of a plant according to the present invention is about 400 mg to about 1,000 mg citric acid per 100 g fwt.
- melon plants of the present invention produce edible fruits, preferably with a round or oval shape, and preferably weighting over 450 grams.
- the flesh of the melons of the present invention is preferably green, yellow, white or orange.
- the instant invention discloses melon plants capable of producing a very sweet juicy fruit with tart-refreshing sour taste, and referred herein to as “Citric+” plants or fruits.
- Such fruits comprise high contents of citric acid and low pH, increasing the acid taste and providing a tart perception, which covers still too flat and poor flavors of early mature fruits.
- a fruit of a Citric+plant of the present invention at maturity comprises:
- the citric acid content of a fruit of a plant according to the present invention is about 600 mg to about 1,000 mg citric acid per 100 g fwt.
- the present invention discloses a melon plant capable of producing a sweet aromatic fruit with mild-fruity sour taste, referred herein as “Citric ⁇ ” melon plant or fruit.
- Such fruits comprise relatively high contents of citric acid and mildly low pH. This mild low pH makes a fruity sour perception, which covers other still too flat and poor flavors of early mature fruits.
- the fruit of a Citric ⁇ plant of the present invention at maturity comprises:
- the present invention discloses a melon plant capable of producing fruit with low pH and a flesh of deep orange color. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit with pH of about 4.5 to about 5.6, wherein said fruit has orange flesh rated 4 or higher.
- characteristics of melon fruits described herein are measured on fruits of melon plants grown in open fields or in plastic houses, and harvested at maturity.
- fruits are harvested from early maturity to late maturity (stages 2-4, as described herein).
- a fruit of the present invention is at maturity when its sucrose contents is at or over 2 g sucrose per 100 g fwt.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.8 and a sugar savor of about 4.3 to about 5.8. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 2.5 to about 3.8 and a sugar savor of about 4.3 to about 5.6. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.0 and a sugar savor of about 5.2 to about 5.8.
- the acid savor and sugar savor are determined by an Expert panel, for example as described in Example 12 herein.
- such fruit comprises a pH and citric acid content as described herein.
- such fruit comprises a pH, organic acid contents and compositions and sugar contents and compositions as described herein.
- the present invention discloses a C. melo plant comprising a DNA sequence, which co-segregates with a low pH trait.
- the DNA sequence is a template for amplification of a DNA fragment described herein using the primers described herein.
- the present invention discloses such primers and DNA fragments amplified using these primers.
- a DNA fragment described herein is amplified from DNA of said plant using the primers described herein.
- the DNA fragments are used as molecular markers for a low pH trait.
- a DNA fragment of about 168 bp to about 178 bp is amplified from the DNA of said plant when the primers capable of identifying the CMAT141 marker are used.
- a DNA fragment of 168 bp, 173 bp, 169 bp, 172 bp or 178 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 176 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 175 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of about 218 bp to about 253 bp is amplified when the primers capable of identifying the NE0585 marker are used.
- a DNA fragment of 230 bp, 232 bp, 218 bp, 229 bp, 234 bp or 239 bp is amplified when the primers capable of identifying the NE0585 marker are used. In one embodiment, a DNA fragment of about 121 bp to about 145 bp is amplified when the primers capable of identifying the NE1746 marker are used. In one embodiment, a DNA fragment of 124 bp, 127 bp, 133 bp, 142 bp or 145 bp is amplified when the primers capable of identifying the NE1746 marker are used.
- the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a DNA fragment indicative for the presence of a low pH trait in said plant (acid fragment) or for the absence of the low pH trait (basic fragment) in said plant.
- the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a basic fragment linked to a low pH trait, wherein said DNA sequence is linked to said low pH trait.
- the C. melo plant comprises such a DNA sequence on one side of a low pH gene.
- the C. melo plant comprises such a DNA sequence on both sides of a low pH gene.
- a fruit of such a plant comprise a pH within the ranges disclosed herein. In one embodiment, fruits of such a plant comprise the contents and compositions of sugars as described herein. In one embodiment, fruits of such a plant comprise the contents and compositions of organic acids as described herein. In one embodiment, fruits of such a plant comprise the pH, contents and compositions of sugars and contents and compositions of organic acids as described herein.
- the characteristics of a fruit according to the present invention described herein remain stable after the fruit reaches maturity. In one embodiment, such characteristics remain stable after a fruit reaches maturity when the fruit is kept on the plant. In one embodiment, such characteristics remain stable when the fruit is harvested and kept in storage after harvest. This allows for a reduced harvest frequency, and to store or ship a fruit of the present invention without loosing its organoleptic characteristics and aroma.
- the pH of a fruit of the instant invention remains stable after a fruit reaches maturity.
- the citric acid content of a fruit of the present invention remains stable after a fruit reaches maturity.
- the malic acid content of a fruit of the present invention remains stable after a fruit reaches maturity.
- the ratio citric acid to malic acid of a fruit of the present invention remains stable after a fruit reaches maturity.
- the pH and organic acid contents and composition of a fruit of the present invention remain stable after a fruit reaches maturity. In one embodiment, such characteristics remain within the ranges described herein after a fruit reaches maturity.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 2 days when the fruit is kept on the plant, in one embodiment for at least 3 days when the fruit is kept on the plant, in one embodiment for at least 4 days when the fruit is kept on the plant.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 5 days when kept in storage at 20° C., in one embodiment for at least 7 days when kept in storage at 20° C., in one embodiment for at least 9 days when kept in storage at 20° C.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 7 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 12 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 26 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C.
- a plant of the instant invention is capable of producing a long shelf-life fruit (LSL) or a medium shelf-life fruit (MSL). In one embodiment, a plant of the instant invention is capable of producing a non-turning fruit or low turning fruit. In one embodiment, a plant of the instant invention is capable of producing a non-climacteric fruit or a low climacteric fruit.
- the instant invention further discloses seeds of a C. melo plant of the present invention, and seeds of the progeny thereof, wherein said progeny seed is capable of producing a plant of the present invention.
- the instant invention further discloses parts of a C. melo plant of the present invention, e.g. ovules or pollen, and fruits of a C. melo plant of the present invention.
- the instant invention further discloses the flesh of a fruit of a C. melo plant of the present invention.
- the instant invention further discloses the juice of a fruit of a C. melo plant of the present invention.
- the present invention further discloses the use of the flesh of a fruit according to the present invention in a fresh cut product.
- the present invention further discloses the use of the juice of a fruit according to the present invention in a soft drink.
- the present invention further discloses methods of increasing the citric acid content of a plant comprising obtaining a first C. melo plant; crossing said first C. melo plant with a second C. melo plant comprising a low pH trait, obtaining a progeny C. melo plant, determining the pH and citric acid content of a fruit of said progeny plant, selecting a fruit of said progeny C. melo plant which has increased citric acid content, when compared to a fruit of said first C. melo plant.
- said progeny C. melo plant has a lower pH, when compared to a fruit of said first C. melo plant.
- the method comprises detecting a DNA fragment described herein using the primers described herein.
- the present invention further discloses the use of a melon plant comprising a low pH trait to obtain a melon plant of the present invention.
- the melon plant comprising a low pH trait further has the ability of accumulating relevant levels of sugars, for example sucrose.
- the melon plant comprising a low pH accumulates high levels of citric acid.
- the melon plant comprising a low pH accumulates low levels of malic acid.
- the melon plant comprising a low pH trait further has the ability of accumulating relevant levels of sugars, for example sucrose and of accumulating high levels of citric acid and of accumulating low levels of malic acid.
- the melon plant comprising a low pH is a plant of line IND-35 or a descendent thereof.
- the present invention further discloses a method to produce seed of a plant according to the instant invention comprising obtaining a plant of the present invention, self-pollinating said plant or crossing said plant with another melon plant, and harvesting progeny seed.
- the present invention further discloses a method to vegetatively propagate a melon plant according to the present invention.
- the present invention further discloses a method for producing a fruit comprising planting a plant according to the present invention, growing said plant and harvesting a fruit, wherein said fruit comprises the characteristics described herein.
- the method further comprises storing said fruit, for example as described herein.
- the method further comprises shipping said fruit.
- the characteristics of said fruit described herein remain stable during the storage of said fruit.
- the characteristics of said fruit described herein remain stable during the storage of said fruit.
- a plant of the present invention is an inbred line, a hybrid, a dihaploid, or a vegetatively propagated clone.
- the present invention thus provides melon fruits offering a pleasant acid component but avoiding an astringent taste. This enhances or complements melon flavors to their maximum potential.
- These combinations of organic acid content and low pH with high sugars provide new ranges and classes of appealing tastes for fresh consumption or the fresh cut or fresh juice industry.
- Low pH in fruit flesh also prevents bacterial contamination in fresh cut and juice industrial processes.
- a low pH trait confers a low pH, for example from about 4.2 to about 5.6, to the flesh of a melon fruit.
- a trait may be inherited in a dominant or recessive manner, or in a partial or incomplete-dominant manner.
- a trait may be monogenic or polygenic, or may also result from the interaction of one or more genes with the environment.
- Monogenic determined by a single locus.
- Polygenic determined by more than one locus.
- Dominant results in a complete phenotypic manifestation at heterozygous or homozygous state.
- Partial or incomplete-dominance when present at the heterozygous stage determines a phenotype that is intermediate to that of the homozygous stage or when the trait is absent.
- Backcrossing is a process in which a hybrid progeny is repeatedly crossed back to one of the parents.
- Locus region on a chromosome, which comprises a gene contributing to a trait.
- Quantitative Trait Loci Quantitative trait loci (QTL) refer to genetic loci that control to some degree numerically representable traits that are usually continuously distributed.
- Isogenic plants, which are genetically identical, except that they may differ by the presence or absence of a gene, a locus conferring a trait or heterologous DNA sequence.
- Marker assisted selection refers to the process of selecting a desired trait or desired traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is associated with the desired trait.
- Dihaploid doubling of haploid (single chromosome) status of the genome (e.g. through anther culture or microspore culture) giving a complete homozygous plant.
- Tester plant plant used to characterize genetically a trait in a plant to be tested. Typically, the plant to be tested is crossed with a “tester” plant and the segregation ratio of the trait in the progeny of the cross is scored.
- Gene Unit of inheritance. Genes are located at fixed loci in chromosomes and can exist in a series of alternative forms called alleles.
- Allele One of a pair or series of forms of a gene, which are alternative in inheritance because they are situated at the same locus in homologous chromosomes.
- Homozygous Having like alleles at one or more corresponding loci on homologous chromosomes.
- Heterozygous Having unlike alleles at one or more corresponding loci on homologous chromosomes.
- Low pH gene gene, which when present in the genome of a plant leads to a lower pH of the flesh of a fruit of said plant, when-compared to a plant not comprising said gene.
- Low pH melon plant melon plant comprising a low pH trait.
- the pH of a fruit of a low pH melon plant is from about 4.2 to about 5.6.
- Cucumis melo L also referred herein to as C. melo or melon.
- Cavity refers to the center of the melon fruit containing seeds and maternal tissues.
- Soluble Solids refers to the percent of solid material found in the fruit tissue, the vast majority of which is sugars.
- Climacteric/non-climacteric as for example defined in Watkins (2002) “Ethylene synthesis, mode of action, consequences and control” In: Michael Knee (ed) “Fruit Quality and its Biological Basis”. Sheffield Academic Press, Sheffield, UK. Chapter 8 pp. 180-224, in particular at page 181, section 8.2.1, first two paragraphs.
- Turning melon refers to the marked change in rind color of a melon fruit when it reaches maturity, for example from green to yellow rind in Galia types, or from gray to creamy-yellow rind in Charentais types. This change of color is related to the degradation of green pigments occurring when the fruit reaches maturity.
- Non-turning/low-turning melon the rind color of a fruit of a non-turning or low turning melon does not dramatically change upon maturation.
- the rind of the fruit of non-turning or low turning melon there may be a continuous slight increase in yellow component in the stable background of the rind, as for example in Piel de Sapo type or in honeydew types.
- a slight pigment degradation may also be observed in connection with senescence of the fruit rather than with reaching maturity, which occurs earlier.
- the present invention provides C. melo plants capable of producing fruits with novel tastes.
- the present invention provides melon plants capable of producing fruits with novel combinations of organic acid contents, pH and sugar contents.
- the inventors of the instant application have identified that melon fruits contain various levels of organic acid, e.g. citric acid.
- the inventors of the instant application also have identified that melon fruits contain various relative contents citric acid and malic acid.
- the inventors of the instant application have determined that by introducing a low pH trait into a sweet melon background, a reduction in pH and an increase in the citric acid content in the fruit are obtained, further expanding the ability to manipulate the taste of a melon fruit.
- melon fruits of the present invention have low contents of malic acid.
- the present invention discloses melon plants producing fruits having elevated citric acid contents and lower pH, as described herein.
- sugar levels observed in fruits of plants of the instant invention are maintained at levels present in currently available sweet melons or increased.
- plants of the present invention are capable of producing fruits with novel, pleasant tastes. Measurements of pH, citric acid and malic acid contents, and sugar contents described herein were carried out are shown in Examples 1 to 5.
- Tables 1A and 1B herein disclose representative melon plants according to the present invention and their fruits.
- the melon plants of the instant invention are capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fresh weight (fwt). In one embodiment, melon plants of the instant invention are capable of producing fruit with a pH of about 4.2 to about 5.6. In one embodiment, melon plants of the instant invention are capable of producing fruit with a sugar content equal or higher that about 5.0 g per 100 g fwt. In one embodiment, the present invention discloses melon plants capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fwt, pH of about 4.2 to about 5.6, and sugar content equal or higher that about 5.0 g per 100 g fwt.
- the present invention discloses a C. melo plant capable of producing a fruit comprising at maturity:
- the fruit comprises about 400 mg to about 1,000 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises about 450 mg to about 950 mg citric acid per 100 g fwt, in one embodiment about 475 mg to about 900 mg citric acid per 100 g fwt. In one embodiment, the fruit has a pH of about 4.3 to about 5.4, in one embodiment about 4.4 to about 5.1. In one embodiment, the fruit comprises about 5.5 g to about 13.0 g sugar per 100 g fwt. In one embodiment, the fruit comprises about 7.0 g to about 15.0 g sugar per 100 g fwt.
- the ratio citric acid to malic acid in a fruit of said plant is greater than 4.4, in one embodiment greater than 5, in one embodiment greater than 10. In one embodiment, the ratio citric acid to malic acid in a fruit of said plant is less than 450, in one embodiment less than 200, in one embodiment less than 150. In one embodiment, a fruit of said plant comprises less than about 85 mg malic acid per 100 g fwt, in one embodiment less than about 75 mg malic acid per 100 g fwt.
- the ratio sucrose to hexoses in a fruit of said plant is about 1:1, in one embodiment between about 1:1 and about 1:2, in one embodiment between about 1:1 and about 2:1.
- the flesh of a fruit of said plant is orange, white, green or yellow. In one embodiment, said fruit is edible in fresh consumption. In one embodiment, the mesocarp of a fruit of said plant represents more than 50% of the total fresh fruit weight.
- the C. melo plant comprises a low pH trait.
- the low pH trait is obtainable from a plant of line IND-35, representative seeds of which is deposited under Accession number NCIMB 41202, or a descendent of said line IND-35.
- the low pH trait is homozygous or heterozygous in said plant.
- melon plants referred to as “Citric+” plants are disclosed. Such plants are capable of producing a very sweet juicy fruit with tart-refreshing sour taste. Such fruits comprise high contents of citric acid and low pH, increasing the acid taste and providing a tart perception. This is compensated by a high sugar content, in one embodiment by elevated levels of reducing sugars (glucose and fructose). The high reducing sugar content is particularly pronounced in early mature stages. The combination of tart and sweet tastes, which cannot be obtained by currently available sweet melon, is appreciated by consumers. The tart-refreshing sour sweet melon combination satisfies this need. This fruity tart perception also cover still too flat and poor flavors of early mature fruits.
- Citric+plants are generally obtained by introducing a low pH trait, for example from line IND-35, into an oriental melon background.
- the oriental melon background is selected for one or more of the following criteria: high citric acid content, low malic acid content, high citric acid to malic acid content, high sugar content, high hexose content, high ratio hexoses to sucrose, high juiciness.
- careful selection for the above characteristics is maintained until a desired progeny is obtained.
- Examples 9, 10 and 11 describe the construction of such plants.
- Alternative C. melo plants can also be screened for desired characteristics and are used as starting materials as described herein.
- a fruit of a Citric+plant of the present invention at maturity comprises:
- the fruit comprises about 600 to about 1,000 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises about 650 to about 950 mg citric acid per 100 g fwt.
- the pH of the fruit is about 4.4 to about 5.0.
- said fruit comprises about 7.0 g to about 13.0 g sugar per 100 g fwt.
- the ratio citric acid to malic acid in a fruit of said plant is greater than 6, in one embodiment greater than 7, in one embodiment greater than 10.
- the ratio citric acid to malic acid in a fruit of said plant is less than 450, in one embodiment less than 200.
- a fruit of said plant comprising less than about 85 mg malic acid per 100 g fwt, in one embodiment less than about 75 mg malic acid per 100 g fwt, in one embodiment less than about 60 mg malic acid per 100 g fwt.
- a fruit of a plant of the present invention has a green or white flesh and at maturity comprises:
- the fruit comprises about 600 to about 1,000 mg citric acid per 100 g fwt. In one embodiment, said fruit with green or white flesh comprises at maturity about 8.0 g to about 12.0 g sugar per 100 g fwt. In one embodiment, said fruit with green or white flesh has at maturity a ratio citric acid to malic acid between about 25 and 200. In one embodiment the malic acid content of said fruit is less than about 50 mg malic acid per 100 g fwt, in one embodiment less than about 30 mg malic acid per 100 g fwt. In one embodiment, the ratio sucrose to hexoses in a fruit of said plant is about 1:1, in one embodiment between about 1:1 and about 2:1.
- a fruit of a plant of the present invention has orange flesh and comprises at maturity:
- the ratio citric acid to malic acid in said fruit is between about 4.4 and 30. In one embodiment, the fruit comprises about 7.0 g to about 13.0 g sugar per 100 g fwt.
- the present invention discloses a melon plant capable of producing a sweet aromatic fruit with mild-fruity sour taste, referred herein as “Citric ⁇ ” melon plant or fruit.
- Such fruits comprise relatively high contents of citric acid and mildly low pH. This mild low pH makes a fruity sour perception that cover other still too flat and poor flavors of early mature fruits and without affecting the full expression of fruit flesh flavors and colors of further fully mature fruits.
- Melon flavor is based primarily on sweetness and aromas that usually get the full expression on really advanced fruit ripening stages. Early ripe melons are often described as unpleasant tasteless as sugars and aromas are below expectation and not any other component of flavor is present. In other fruits, such as strawberry, peach, or oranges, acid taste makes a well appreciated complement in this early ripe stages. The mild-fruity sour and sweet melon combination avoids or limits the tasteless risk on early ripe melons.
- Citric ⁇ plants are obtained by introducing a low pH trait, for example from line IND-35, into a Charentais melon background.
- the Charentais melon background is selected for one or more of the following criteria: low citric acid content, low malic acid content, relatively high citric acid to malic acid content, high sugar content, high sucrose content.
- low citric acid content low malic acid content
- relatively high citric acid to malic acid content high sugar content
- sucrose content high sucrose content
- Example 11 describes the preparation of such plants.
- Alternative C. melo plants can also be screened for desired characteristics and can be used as starting materials as described herein.
- the fruit of a Citric ⁇ plant of the present invention at maturity comprises:
- the fruit comprises about 450 to about 600 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises a pH of about 4.8 to about 5.4, in one embodiment to about 5.2. In one embodiment, the fruit comprises about 5.0 g to about 13.0 g sugar per 100 g fwt, in one embodiment about 6.0 g to about 12.0 g sugar per 100 g fwt. In one embodiment, the fruit comprises about 7.0 g to about 13.0 g sugar per 100 g fwt.
- a fruit of a plant of the present invention has orange flesh and comprises at maturity:
- the ratio citric acid to malic acid in said fruit is between about 4.4 and 10.
- the fruit comprises about 7.0 g to about 11.0 g sugar per 100 g fwt.
- Table 1A Summary of data for lines Table 1A discloses representative lines of the present invention. The data shown in Table 1A are averages based on measurements from individual trials. The data for the individual trials are disclosed in Tables 9-13 in the Examples below. tot. sugar sucrose hexose hex/suc citric malic LINES (averages) avg avg avg inv pH avg citric/ avg Plastic house data nr.
- Table 1B discloses representative hybrids of the present invention.
- the data shown in Table 1B are averages based on measurements from individual trials. The data for the individual trials are disclosed in Tables 9-13 in the Examples below.
- Mehari means the female parent of hybrid MEHARI. tot. sugar sucrose hexose hex/suc citric malic HYBRIDS (average) nr.
- the instant invention demonstrates that the manipulation of the degree of sourness in a fruit produce valuable taste variations. Sourness is a result of the interaction between several parameters, pH being one of the most important ones along with organic acids contents and compositions.
- the pH greatly influences the degree of dissociation of acids involved in taste.
- Each acid has a different dissociation constant (pKa), which refers to the pH, at which 50% of the acid is dissociated in its relative ions and H+.
- pKa dissociation constant
- a lower pH results in more of the acid that is not in dissociated form.
- the sourness perception comes mainly from the undissociated form of the acid. This explains why, at higher pH levels, weaker acids such as organic acids with a higher pKa are perceived as sourer than stronger acids.
- the pH of a solution is correlated with the concentration and pKa of the acid. Equinormal solutions of stronger acids are sourer than weaker ones, since they have a much lower pH. The higher the concentration of the acid (titratable acidity), the more sour the acid will be perceived. Sourness is also correlated with the chemical structure of the acidulant, the number of carboxylic groups, the molecular weight, and polarity of the molecule (see e.g. PURAC Biochem, Gorinchen, The Netherlands, “Flavor Special”, www.Purac.com). Besides sourness, each food acid has its own flavor characteristics in terms of lasting time, flavor intensity and the contribution to other non-sour flavor notes such as astringency, bitterness and sweetness.
- the major organic acids in melon fruits are succinic acid, malic acid and citric acid (Wang et al. (1996) J. Agric. Food Chem. 44: 210-216).
- Malic acid tends to be associated either with very unripe phases or with senescence and degenerative phases of fruit over-ripening, and its dominance in the taste is generally not preferred.
- Citric acid has a lower pKa than malic acid.
- Citric acid has more tart and a clean effect, which often overpowers other taste or aromas notes.
- fruit flesh gradients of decreasing citric acid contents are observed from more ripe areas close to seed cavity to areas close to the fruit rind. Such a gradient is also observed for sugars.
- the sour perception is higher when the pH is low and the citric acid content high.
- fruits according to the instant invention were tested by an Expert panel of trained tasters. Sensory characteristics of the fruits were measured on a scale of quotation from 0 to 9. The pH, organic acid contents and sugar contents of the fruits were also measured. The results of the Expert panel are described in Example 12, Tables 14 and 15. The sensory analysis shows that the acid savor in fruits of the instant invention is a function of the pH and of the citric acid content in the fruit.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor above about 0.5 as determined by an Expert panel.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 or above.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor above about 0.5 and a sugar savor of about 4.3 or above.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.8 and a sugar savor of about 4.3 to about 5.8.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 2.5 to about 3.8 and a sugar savor of about 4.3 to about 5.6.
- Hybrids YUSOL X SOLAZ and Mehari X L53 AZ B are representative examples of such plant.
- such fruit comprises a pH and citric acid content as described herein.
- the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.0 and a sugar savor of about 5.2 to about 5.8.
- Hybrids YUSAZ X YUSOL, Mehari X L53 AZ A and TD X L53 AZ A are representative examples of such plant.
- such fruit comprises a pH and citric acid content as described herein. In one embodiment, such fruit comprises a pH, organic acid contents and compositions and sugar contents and compositions as described herein.
- the inventors of the present invention have screened melon entries and accessions for the content in citric acid and sugars and compositions and have determined variations within C. melo types (see Table 2). For example, some Charentais-type melons were found to have low citric acid contents (for example Lunastar in Table 2). Some Charentais type fruits were also found to have a relatively low citric acid to malic acid ratio and a high ratio of sucrose to hexoses. On the other hand, Oriental-type melons, such as Japanese rocky types melon, were found to have higher contents in citric acid (for example YUCA in Table 2). A representative of YUCA has been deposited with NCIMB, Aberdeen, AB24 3RY, Scotland on Dec.
- Deviation 2.34 0.30 2.72 0.37 in brix Minimum 2.40 3.80 2.40 5.50 Populations IND35/OGEL-17 NR plts 98 98 39 39 P 0.65 F2 Maximum 13.00 5.45 12.20 7.50 No Significant Average 7.75 4.70 7.93 5.97 Difference Std. Deviation 2.16 0.33 1.89 0.35 in brix Minimum 2.80 3.90 4.20 5.50 Populations IND.35 NR plts 29 29 Maximum 7.60 5.40 Average 5.45 4.63 Std. Deviation 1.18 0.31 Minimum 3.00 4.10
- the present invention further discloses the incorporation of a low pH trait in sweet C. melo backgrounds.
- the presence of the low pH trait in sweet C. melo backgrounds allowed to lower the pH and increase concentrations of organic acids in the fruit flesh and to combine desirable pH and citric acid contents with appropriate sugar concentrations and contents, resulting in pleasant, new tastes.
- a low pH trait is determined by a low pH gene.
- a low pH gene is obtained from a wild melon accession or cultivar.
- a wild melon accession or cultivar used as donor for the low pH gene comprises traits that facilitate the construction of commercial melons with acceptable agronomic characteristics and producing fruits with desirable taste.
- such donor has the ability to accumulate relevant levels of sugars, such as sucrose.
- such wild melon accession or cultivar has at least one of the following characteristics: non climacteric behavior, relative bigger fruit size and mesocarp component, crispy flesh.
- the low pH trait is obtained from line IND-35, representative seeds of which was deposited with NCIMB, Aberdeen, AB24 3RY, Scotland on Dec. 17, 2003 under Accession Number NCIMB 41202.
- This is a C. melo accession from India, which could be classified within botanical Var. chito, but it may be better classified as var. acidulus (Naudin, Pitrat et al.) because of its bigger size.
- Citric acid is the main organic acid in the fruits of line IND-35 (up to 911 mg citric acid per 100 g fwt), while malic acid contents are below 50 mg per 100 g fwt.
- fruits of IND-35 also have the ability to accumulate relevant levels of sucrose (up to 1.7 g sucrose per 100 g fwt and 5.6 g total sugars 100 g fwt after long fruit cycles, i.e after late harvest 50 or 53 days after fruit set).
- Table 2 also reports analysis of fruits of IND-35 showing a pH of about 4.9, a citric acid content of about 340 mg/100 g fresh weight (fwt), and a sugar content of about 4.0 g/100 g fwt.
- the low pH trait co-segregates with a molecular marker.
- a molecular marker is a DNA fragment amplified by PCR, e.g. a SSR marker or a RAPDS marker.
- the presence or absence of an amplified DNA fragment is indicative of the presence or absence of the trait itself or of a particular allele of the trait.
- a difference in the length of an amplified DNA fragment is indicative of the presence of a particular allele of a trait, and thus enables to distinguish between different alleles of a trait.
- the instant invention discloses markers, which distinguish between different sources of low pH trait, and for the presence or absence of a low pH trait in a plant.
- such marker is CMAT 141, described in Danin-Poleg et al. (2001) Theor. Appl. Genet. 102: 61-72 and Danin-Poleg et al. (2002) Euphytica 125: 373-384.
- Other examples of molecular markers are NE0585 and NE1746 disclosed herein (see Example 13). These markers are closely linked to the locus of the pH gene. Markers CMAT141 and NE0585 are on one side of the low pH gene, while marker NE1746 is on the other side of the low pH gene.
- the inventors of the instant invention have determined that various sources of low pH trait amplify DNA fragments of different length when the primers for the markers are used (acid fragments, see Example 14, Table 16). For example, in plants of Faggous as fragment of about 176 bp is amplified using for CMAT141. In plants of accessions PI414723, PI414724, PI161375 and PI124112 a fragment of about 175 bp is amplified. In contrast, in plants of IND-35, described herein, unique fragments of about 168 bp and of about 173 bp are amplified.
- marker NE0585 unique fragments of about 230 bp and about 232 bp are amplified for IND-35.
- marker NE1746 a unique fragments of about 127 bp is amplified for IND-35.
- Another fragment of about 124 bp is amplified for IND-35, which is for example absent in Faggous.
- plants not comprising the low pH trait were also analyzed using the primers described herein.
- a number of DNA fragments associated with the absence of the low pH trait were determined (basic fragments). For example, using the primers of CMAT141, fragments of about 169 bp, about 172 bp and about 178 bp long were detected in plants not comprising a low pH trait.
- fragments of NE0585 fragments of about 218 bp, about 229 bp, about 234 bp and about 239 bp long were detected.
- fragments of 133 bp, about 142 bp and about 145 bp long were detected.
- the skilled person would know how to analyze further plants not comprising the low pH trait and determine additional DNA fragments associated with the absence of the low pH trait.
- the indicated sizes (in bp) are not absolute but relative to the other size products detected with the same primer pair.
- the real (exact) size of the amplified fragments e.g. determined by sequencing
- the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a DNA fragment described herein using the primers described herein.
- a DNA fragment of about 168 bp to about 178 bp is amplified from the DNA of said plant when the primers capable of identifying the CMAT141 marker are used.
- a DNA fragment of 168 bp, 173 bp, 169 bp, 172 bp or 178 bp is amplified when the primers capable of identifying the CMAT141 marker are used.
- a DNA fragment of less than 176 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 175 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of about 218 bp to about 253 bp is amplified when the primers capable of identifying the NE0585 marker are used. In one embodiment, a DNA fragment of 230 bp, 232 bp, 218 bp, 229 bp, 234 bp or 239 bp is amplified when the primers capable of identifying the NE0585 marker are used.
- a DNA fragment of about 121 bp to about 145 bp is amplified when the primers capable of identifying the NE 1746 marker are used. In one embodiment, a DNA fragment of 124 bp, 127 bp, 133 bp, 142 bp or 145 bp is amplified when the primers capable of identifying the NE1746 marker are used.
- the inventors of the instant invention have separated the link between a DNA fragment indicative of a low pH trait and a low pH gene.
- a DNA sequence which is a template for amplification of a basic fragment, is linked to a low pH trait.
- the instant invention discloses a plant comprising a low pH trait co-segregating with markers indicative for a basic allele, in particular when using the markers disclosed herein.
- a marker on one side of the pH gene is basic.
- markers on both sides of the pH gene are basic.
- fruits of such a plant comprise a pH within the ranges disclosed herein.
- fruits of such a plant comprise the contents and compositions of sugars as described herein. In one embodiment, fruits of such a plant comprise the contents and compositions of organic acids as described herein. In one embodiment, fruits of such a plant comprise the pH, contents and compositions of sugars and contents and compositions of organic acids as described herein.
- the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a basic DNA fragment, linked to a low pH gene.
- the present invention discloses a C. melo plant comprising a chromosome fragment comprising a DNA sequence, which is a template for amplification of a basic DNA fragment and a low pH gene.
- such chromosome fragment is heterozygous or homozygous in said plant.
- Line SOLAZ/2 described herein is a representative example of such a C. melo plant. In SOLAZ/2, fragments of about 172 bp, about 229 bp and about 124 bp are amplified using the primers of markers CMAT141, NE0585 and NE1746, respectively.
- the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a basic DNA fragment, on one side of a low pH gene, a low pH gene, and a DNA sequence, which is a template for amplification of a basic DNA fragment, on the other side of the low pH gene, wherein both DNA sequence are linked to the pH gene in said plant.
- the present invention discloses a C.
- melo plant comprising a chromosome fragment comprising a DNA sequence, which is a template for amplification of a basic DNA fragment, on one side of a low pH gene, the low pH gene and a DNA sequence, which is a template for amplification of a basic DNA fragment, on the other side of the low pH gene.
- chromosome fragment is heterozygous or homozygous in said plant.
- Line SOLAZ/1 described herein is a representative example of such a C. melo plant. In SOLAZ/1, fragments of about 172 bp, about 239 bp and about 142 bp are amplified using the primers of markers CMAT141, NE0585 and NE1746, respectively.
- Line YUSOL/3 described herein is another representative example of such a C. melo plant.
- fragments of about 172 bp, about 239 bp and about 145 bp are amplified using the primers of markers CMAT141, NE0585 and NE1746, respectively.
- the present invention discloses the use of a melon plant comprising a low pH trait to obtain a melon plant of the present invention.
- the melon plant comprising a low pH trait further has the ability of accumulating relevant levels of sugars, for example sucrose.
- the melon plant comprising a low pH accumulates high levels of citric acid.
- the melon plant comprising a low pH accumulates low levels of malic acid.
- the melon plant comprising a low pH is a plant of line IND-35 or a descendent thereof.
- the low pH trait is obtained from a descendent of said line IND-35.
- a low pH trait can also be obtained from other sources.
- the low pH trait in such other sources is allelic to the low pH trait in IND-35.
- a test is conducted to determine whether a line to be tested for a low pH gene comprises an allelic gene to that of line IND-35.
- Line IND-35 is used as a tester line in a cross with a line to be tested and the segregation ratio of the low pH phenotype is determined in the resulting progeny.
- a plant of line IND-35 is crossed with breeding melon lines, preferably having high citric acid contents and high levels of sugar. After each cross plants producing fruits having low pH are selected. Selection is also carried out for increased citric acid contents and high sugar contents. Examples of the introduction of the low pH trait into elite lines are disclosed in Examples 7-11.
- a molecular marker as disclosed hereinabove is used to transfer the pH trait in a desired background, in particular in method of increasing the citric acid content of a fruit of a melon plants as described herein.
- plants for which a fragment corresponding to a low pH trait is amplified are selected and further used.
- a reduction of about 1 to about 2.5 pH units, in one embodiment about 1.5 to about 2.0 pH units, is obtained after the introduction of the low pH trait in a sweet C. melo plant, when compared to fruits of a melon not comprising the low pH trait, for example when compared to an isogenic or near-isogenic line not comprising the low pH trait.
- the citric acid content in the flesh of a melon plant is multiplied by a factor of about 1.5 to about 3 upon introduction of a low pH trait in said melon plant, when compared to fruits of a melon not comprising the low pH trait, for example when compared to an isogenic or near-isogenic line not comprising the low pH trait. Mature fruits of the various plants are compared.
- Table 1A and 1B show comparisons between melon comprising a low pH trait and melons not comprising a low pH trait, for example between YUSAZ X YUSOL and MILENIUM-DENEV F1, SOLAZ X YUSOL and SOLAR F1, Mehari/L53-L53 AZ A-L53 AZ B.
- melon fruits of the present invention have higher concentrations of organic acids than comparable currently available melons not comprising the low pH trait (titratable acidity).
- variations in pH are more correlated with the composition (pKa of dominant acids) than with total concentration of organic acids.
- An increase in pH is generally observed during the late ripening process, and is concurrent with sucrose accumulation. This increase in pH is buffered by the content in organic acids.
- Low contents in organic acids result in high increases in pH and reduction in sour taste perception.
- melons with low citric content as some currently available Charentais-type melons, for example of climacteric turning type
- this increase in pH can be over 1.0 pH unit (from pH 6.0 to 7.0).
- higher contents in organic acids lead to reduced pH increases during the ripening process, and thus prevent or reduce the decline in sour taste perception, as for example in less climacteric, less turning melons.
- the present invention discloses melons fruits with more stable sour tart taste based on stable low pH and high citric acid content.
- the present invention discloses melons fruits with an improved stability of the taste after ripening or post-harvest.
- the present invention also discloses a method of delaying or reducing the increase in pH in the fruit of a melon plant comprising increasing the content of organic acids in said fruit and introducing a low pH trait in a melon plant.
- such method comprises introducing the low pH trait in a plant with low or non climacteric behaviour.
- such method comprises introducing the low pH trait in a plant capable of producing a low or non turning fruit.
- the present invention also discloses melons fruits, which mature from an initial early ripe mild sour taste to a fruity and full flavored taste based on a moderate increase of pH (up to 0.5 pH units) and moderately elevated citric acid contents.
- a low pH trait is introduced in melon plants producing fruits with various contents and composition of sugars.
- plants from the Japanese-Oriental type such as YUCA
- YUCA Japanese-Oriental type
- accumulation of sugars, particularly sucrose is a question of fruit cycle time understood as days after pollination, from fruit setting to fruit ripening.
- melon plants producing fruits having an early and relevant sugar accumulation are used in the instant invention.
- plants of the Galia type such as cultivar OGEL
- melon plants producing fruits having potential for a high and fast accumulation of sucrose independently from the initial levels of hexoses are used in the instant invention.
- plants of the Charentais type such as L53, are used as a source of such a potential for sucrose accumulation.
- a C. melo plant comprising a low pH trait is crossed to a C. melo plant of the Oriental type or of the Galia-type.
- the C. melo plant comprising a low pH gene is line IND-35.
- the C. melo plant of the Oriental type is YUCA
- the C. melo plant of the Galia-type is OGEL, as described in Example 7 below.
- the resulting progenies are for example further crossed to C. melo plants of the Oriental type or of the Galia-type to obtain desired pH and contents and compositions of organic acids and sugars. This process is assisted by measurement of pH, organic acids and sugars, as disclosed herein.
- Alternative C. melo plants of the Oriental type or of the Galia-type can also be screened for desired characteristics and used as starting materials to obtain C. melo plants as described herein.
- a C. melo plant comprising a low pH trait is crossed to a C. melo plant of the Charentais-type, such as L53 as described in Example 11.
- Alternative C. melo plants of the Charentais-type can also be screened for desired characteristics and used as starting materials to obtain C. melo plants as described herein.
- C. melo plants are also crossed to a C. melo plant comprising a low pH trait to obtain melo plants as described herein.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable after a fruit reaches maturity and is kept on the plant or when the fruit is harvested and kept in sotrage.
- the characteristics of a fruit described herein remain stable during the commercial post-harvest life of the fruit. This allows storing or shipping a fruit of the present invention for extended periods of time without loosing its organoleptic characteristics and aromas.
- the pH of a fruit of the instant invention remains stable after a fruit reaches maturity. In one embodiment, the pH of a fruit of the instant invention remains within a range of about 4.2 to about 5.6. after a fruit reaches maturity. In one embodiment, the citric acid content of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the citric acid content of a fruit of the present invention remains at or above 400 mg per 100 g fwt after a fruit reaches maturity. In one embodiment, the malic acid content of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the ratio citric acid to malic acid of a fruit of the present invention remains stable after a fruit reaches maturity.
- the ratio citric acid to malic acid remains greater than 4.4 after a fruit reaches maturity. In one embodiment, such characteristics remain with the ranges described herein after a fruit reaches maturity. In one embodiment, these characteristics remain on within about 70% to about 130% of the values of the characteristics measured when the fruit reaches maturity, in one embodiment within about 80% to about 120% of the values of the characteristics measured when the fruit reaches maturity, in one embodiment within about 90% to about 110% of the values of the characteristics measured when the fruit reaches maturity.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable after a fruit reaches maturity when kept on the plant, or when harvested and kept in storage In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 2 days when the fruit is kept on the plant, in one embodiment for at least 3 days when the fruit is kept on the plant, in one embodiment for at least 4 days when the fruit is kept on the plant.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 5 days when kept in storage at 20° C., in one embodiment for at least 7 days when kept in storage at 20° C., in one embodiment for at least 9 days when kept in storage at 20° C.
- the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 7 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 12 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 26 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C.
- a fruit may remain under field conditions for several hours until its is stored in the conditions set forth herein.
- Example 15 Examples of the evolution of the characteristics of a fruit of a plant of the present invention when kept on the plant are shown in Example 15, Table 17. Examples of the evolution of the characteristics of a fruit of a plant of the present invention after post harvest storage are shown in Example 16, Tables 18 and 19.
- melons can be described as short shelf life (SLS), medium shelf life (MSL) or long shelf life (LSL).
- LSL melons are Milenium, Piel de Sapo, Italo and non turning Charentais LSL.
- MSL melons are Galia and turning Charentais MSL.
- SSL short shelf life melons are classical Charentais.
- the life of a fruit of a SSL melon on the plant is about 1 to about 2 days. This means that fruits have to be harvested about every 1 to 2 days to avoid losses.
- the life of a fruit of a MSL melon on the plant is about 3 to about 4 days. This means that fruits are harvested about every 3 to 4 days to avoid losses.
- the life of a fruit of a LSL melon on the plant is more than about 5 days
- a SSL melon can be stored for about 4 to about 7 days at 8-12° C. followed by an aditional 2 days at 20° C., or for about 3 to 4 days at 20° C.
- a MSL melon can be stored for about 7 to about 12 days at 8-12° C.
- a LSL melon can be stored for more than about 12 days at 8-12° C. followed by an aditional 2 days at 20° C., or for more than about 10 days at 20° C.
- a plant of the instant invention is capable of producing a long shelf-life fruit (LSL) or a medium shelf-life fruit (MSL).
- LSL long shelf-life fruit
- MSL medium shelf-life fruit
- a plant of the present invention is of a non-turning or low turning melon genotype. In one embodiment, a plant of the present invention is capable of producing a non-climacteric or low-climacteric fruit.
- the present invention discloses a C. melo plant with low or non-climacteric behaviour comprising a low pH gene.
- a fruit of such C. melo plant further comprises the characteristic of sugar contents and compositions described herein.
- a fruit of such C. melo plant further comprises the characteristic of organic acid contents and compositions described herein.
- a fruit of such C. melo plant comprises a ratio of citric acid to malic acid as described herein.
- a fruit of such plant further comprises a pH as described herein.
- the present invention discloses a C. melo plant capable of producing a low-turning or non-turning fruit, wherein said plant comprises a low pH gene.
- a fruit of such C. melo plant further comprises the characteristic of sugar contents and compositions described herein.
- a fruit of such C. melo plant further comprises the characteristic of organic acid contents and compositions described herein.
- a fruit of such C. melo plant comprises a ratio of citric acid to malic acid as described herein.
- a fruit of such plant further comprises a pH as described herein.
- the inventors of the instant invention have identified that a low pH in the flesh of a melon fruit is associated with a very poor color intensity of the flesh of fruits with orange flesh.
- a slightly orange or pale orange color was observed (see e.g. Table 4).
- the inventors of the present invention have been able to combine low pH and deep orange color in the fruit of a melon plant.
- Table 4 shows that the color intensity of the fruits of line L53, a parent of Syngenta hybrid MEHARI, is deep to very deep orange (average of 5.17). Plants originating from a back-cross program to introduce the low pH trait in L53 but not comprising the low pH trait (L53*High pH) showed a slight decrease in both color intensity and pH (4.71 and 6.46). Plants originating from the back-cross program and comprising the low pH trait showed a further decrease in color intensity and pH. Plants with the low pH trait in homozygote stage (L53*Low pH) had the lowest rate for orange flesh color: 4.04. Plants with the low pH trait in heterozygote stage (L53* acid) have the intermediate rate for orange flesh color: 4.36.
- the present invention discloses a C. melo plant capable of producing fruit with pH of about 4.5 to about 5.6, wherein said fruit has orange flesh rated 4 or higher.
- the orange color of said fruits is rated 5 and higher, in one embodiment 6.
- the pH of said fruit is about 4.5 to about 5.4, in one embodiment about 4.8 to about 5.2.
- said fruit comprises about 400 mg to about 900 mg citric acid per 100 g fwt.
- the fruit comprises about 450 mg to about 750 mg citric acid per 100 g fwt.
- said fruit comprises a sugar content equal or above about 5 g per 100 g fwt, in one embodiment about 5.0 g to about 13.0 g sugar per 100 g fwt. In one embodiment, the fruit comprises about 6.0 g to about 12.0 g sugar per 100 g fwt. In one embodiment, the ratio citric acid to malic acid in said fruit is between about 4 and 30, in one embodiment between about 5 and about 15. In one embodiment, the ratio sucrose to hexoses in a fruit of said plant is about 1:1 and about 1:2.
- the color of the fruit is assessed using a spectrophotometer, such as a Minolta CM-2500d spectrophotometer.
- a spectrophotometer such as a Minolta CM-2500d spectrophotometer.
- characteristics of melon fruits of the present invention are measured on fruits harvested at maturity, i.e. mature or ripe fruits.
- the concrete composition of a melon fruit, and therefore its taste, is affected by the ripening stage, at which it is harvested.
- Sugars and organic acids accumulation in melon fruits are dynamic processes. As the fruit is approaching maturity their accumulation starts. As the ripening process advances, each of these compounds follows a time-specific pattern of accumulation or degradation, which is also affected by environmental and growth conditions. The person skilled in the art knows how to recognize a mature melon fruit and understand criteria defining the maturity of a melon fruit.
- one of the following external maturity markers is used for identification of ripening in sweet melon:
- “maturity” includes the ripening physiological process between the stages identified as “2” for “Early-Partial mature” and “4” for “Late-Fully mature”.
- the Early-Partial mature stage in melons is identified with the initial accumulation of sucrose contents at or over 2 g per 100 g fwt of sucrose. In one embodiment, this is associated with the peaking of citric acid and reducing sugars (glucose plus fructose) contents, and a typical ripe fruit flesh pigments and texture.
- the Late-Fully mature stage in melons is defined with the end of peaking sucrose sugars contents.
- maturity of a fruit starts when the sucrose content in the fruit reaches 2 g per 100 g fwt. In one embodiment, maturity lasts until no more increase in sucrose content is observed.
- the measurements disclosed herein are usually averages of measurements or data taken from a number of fruits. It is understood that, in any sample, individual fruits of a plant or fruits from individual plants do not lie within the ranges described, because of variations generally observed while growing melon plants.
- the characteristics of melon fruits described herein are measured using fruits grown in the conditions described herein or under similar conditions (e.g. in Example 6, Tables 5-7 below).
- a figure for a characteristic according to the instant invention is an average taken from fruits grown from plastic house staked plants (one fruit per plant in staked plants).
- a plant of the instant invention is an inbred line, a dihaploid or a hybrid.
- an inbred line comprises a low pH trait and the characteristics of organic acids, pH and sugars described herein.
- such inbred line is crossed with another melon plant, preferably another inbred line, to obtain a hybrid plant according to the instant invention.
- the other inbred line in the cross is also capable of producing fruit having high citric acid contents and/or high sugar contents. Representative inbred lines according to the present invention are disclosed in Table 1A.
- a plant of the instant invention is a hybrid plant.
- some of the characteristics of low pH, high citric acid content and high sugar content are contributed from one of the parent, while the remaining ones are contributed by the other parent.
- one parent in the cross produces fruit having high citric acid content, high sugar content but having high pH (e.g. around pH 6.5), while the other parent in the cross produces fruit having low pH.
- fruits of the other parent also have high citric acid content.
- Representative hybrids according to the present invention are disclosed in Table 1B.
- a plant of the instant invention is capable of producing edible melon fruits.
- the mesocarp represents the edible part of the melon fruit (flesh).
- the mesocarp surrounds the seed cavity, which is itself surrounded by the rind (or shell).
- the mesocarp of a fruit according to the present invention preferably has a thickness of more than 2 cm and preferably represents more than 50% of the total fruit fresh weight.
- the flesh of a fruit of a melon plant of the present invention has a green, white, yellow or orange flesh.
- the present invention provides regenerable cells for use in tissue culture of a plant of the present invention.
- the tissue culture is capable of regenerating plants having the characteristics of a plant of the present invention.
- the regenerable cells in such tissue cultures are immature embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, or flowers.
- the present invention provides melon plants regenerated from the tissue cultures of the invention. Examples of regeneration protocols are disclosed in U.S. Pat. No. 6,420,631.
- the present invention further provides a method of asexually propagating a plant of the present invention comprising collecting a tissue of a plant of the present invention, cultivating said tissue to obtain proliferated shoots, rooting said proliferated shoots to obtain rooted plantlets.
- the present invention further discloses a method to produce seed of a plant according to the instant invention comprising obtaining a plant of the present invention, self-pollinating said plant or crossing said plant with another melon plant, and harvesting progeny seed.
- the present invention further discloses a method for producing a fruit comprising planting a plant according to the present invention, growing said plant and harvesting a fruit, wherein said fruit comprises the characteristics described herein.
- the method further comprises storing said fruit, for example as described herein.
- the method further comprises shipping said fruit.
- the characteristics of said fruit described herein remain stable during the storage of said fruit.
- the characteristics of said fruit described herein remain stable during the storage of said fruit.
- Var LUNASTAR Lunastar is monoecious hybrid from Nunhems in Charentais type.
- Var YUCA Andromonoecious hybrid in Japanese type green flesh.
- Var PRINCE Andromonoecious hybrid in Japanese type orange flesh.
- Fruit Shape Ovoid to oblong-eliptic; Size 2 to 5 Kgrs; Rind: Golden Green spotted, few longitudinal netted skin. White, crispy, juicy and aromatic sweet flesh. Medium fruit cycle Long shelf life, Non climacteric.
- IND 35 Fruit: Shape Long pear-ovoid; Size 300 to 1000 grs; Rind: Light Green spoted skin yellow at maturity. White, crispy, non sweet flesh. For consumption green in salad. Monoecious. Syngenta Seeds line, non climacteric.
- YUSOL Shape round to hight round; Size 600 to 1300 grs; Rind: Yellow few netted with light green sutures skin. Green-white, melty, few aromatic sweet non acid flesh. Short cycle Medium shelf life, non turning low climacteric. Andromonoecious Syngenta Seeds Line.
- YUSAZ A Shape round to hight round; Size 600 to 1300 grs; Rind: White-gray few netted with Green-Gray sutures skin. Green, specially crispy, few aromatic, sweet and acid flesh. Short cycle Medium-long self life, non turning, low to medium climacteric. Andromonoecious Syngenta Seeds Line.
- YUSAZ B Shape round to hight round; Size 600 to 1300 grs; Rind: Yellow netted with Green-Gray sutures skin. Green, specially crispy, few aromatic, sweet and acid flesh. Long cycle, long self life, non turning low climacteric. Andromonoecious Syngenta Seeds Line.
- MILENIUN-DENEV Shape round to hight round; Size 600 to 1500 grs; Rind: Yellow netted non sutured skin. Green-White, crispy, non aromatic, non acid and sweet flesh. Long cycle, non turning, long self life, non climacteric. Andromonoecious Syngenta Seeds Hybrid.
- SOLAZ/1 Shape round to hight round; Size 700 to 1400 grs; Rind: Yellow few netted with light green sutures skin. White, crispy, few aromatic sweet and acid flesh. Short cycle, long self life, non turning, very low climacteric. Andromonoecious Syngenta Seeds Line.
- SOLAZ/2 Shape round to hight round; Size 600 to 1300 grs; Rind: Yellow few netted with light green sutures skin. White, crispy, few aromatic sweet and acid flesh. Short cycle long self life, non turning, very low climacteric. Andromonoecious Syngenta Seeds Line.
- MEHARI monoecious hybrid from Syngenta in Charentais type. Turning medium shelf life.
- L53 andromonoecious line from Syngenta in Charentais type. Turning medium shelf life. Small size round flat shape. Derived from var LUNASTAR, a monoecious hybrid of Nunhems in turning Charentais type.
- TD monoecious line from Syngenta in Charentais type. Non turning and long shelf life. Derived from var TORNADO, a monoecious hybrid from Limagrain in non turning Charentais type.
- a wedge of ca. 400 g was taken from a melon fruit, the seeds and the skin (1 cm thickness) were removed. The flesh was cut in small parts, which were blended for 30 seconds in a Warring blender until a smooth slurry was obtained. The slurry was filtrated over a Whatman paper filter, the juice centrifugated in an Eppendorf centrifuge at 10.000 g and stored at ⁇ 20 degrees Celcius.
- Example 1 Samples as prepared in Example 1 were incubated with citrate lyase (CL) to convert citric acid to oxaloactate and acetate.
- CL citrate lyase
- MDH malate dehydrogenase
- LDH lactate dehydrogenase
- oxaloacetate and its decarboxylated derivative pyruvate were reduced with NADH to respectively L-malate and L-lactate.
- the decrease of NADH is proportional with the quantity of citric acid in the sample and can be determined at 340 nm.
- the assay was conducted in microplates. 20 ⁇ l of diluted sample was added to a microtiterplate.
- Example 1 Samples as prepared in Example 1 were incubated with L-malate dehydrogenase (MDH) and NAD + to convert L-malate to oxaloacetate.
- MDH L-malate dehydrogenase
- NAD + NAD + to convert L-malate to oxaloacetate.
- the equilibrium of the reaction is on the side of malate but was forced to the side of oxaloacetate with hydrazine by means of derivatization.
- NADH formed during the assay is proportional with the malic acid content in the samples. NADH can be determined at 340 nm as a measure for malic acid.
- the assay was conducted in microplates. 20 ⁇ l of diluted sample was added to a microtiterplate. The reaction was started by adding 200 ⁇ l of assay mixture containing hydrazine, MDH and NAD + at pH 10.
- the plate was mixed and the reaction was allowed to proceed for 1 hour. Absorbance values were measured at 340 nm with a microtiterplate reader (Biotek EL808 reader with KCJunior software and computer). A calibration curve was used to calculate the concentration malic acid in the samples. MDH was purchased from Roche Diagnostics.
- Glucose was determined with the enzymes hexokinase and glucose-6-phosphate dehydrogenase (G-6-PDH). Glucose was phosphorylated with hexokinase to glucose-6-phosphate (G-6-P) and subsequently dehydrated to 6-phosphogluconate with the aid of NADP and G-6-PDH (reactions 1 and 2, respectively). The concentration of formed NADPH (the H-acceptor) is quantitatively related to the initial glucose concentration and was measured at 340 nm in the UV range of the light spectrum.
- Fructose was determined in the same assay. Fructose was phosphorylated to fructose-6-phosphate (F-6-P) with the enzyme hexokinase. F-6-P was converted to G-6-P with the enzyme phosphoglucose-isomerase (PGI) and subsequently in 6-PG as described in reaction 2 above.
- F-6-P fructose-6-phosphate
- PGI phosphoglucose-isomerase
- Sucrose was converted to glucose and fructose with the enzyme ⁇ -fructosidase.
- Formed glucose was determined according to the reactions 1 and 2 as described above. The determinations were conducted in microtiterplates, absorbance values are measured with a microtiterplate reader (Biotek ELx808 with data collection software and computer). Enzymes were purchased from Roche Diagnostics.
- Example 1 The pH of samples as described in Example 1 was determined using a CRIMSON GLP21 pHmeter calibrated to pH 4 and pH 7 with standard solutions.
- Line IND-35 was crossed with a selected set of Syngenta elite lines in the El Ejido Trial Station (Spain).
- the selected lines were:
- YUCA- 15 Selected because of high potential for sugars accumulation in medium long cycle (time from fruit set to fruit ripening).
- YUCA is a proprietary Syngenta Seeds line obtained through 5 generations of self-pollination. It is a Japanese Rocky melon type, non turning and very low climacteric.
- the Low pH trait was introgressed in white flesh non climacteric LSL melons with round shape and yellow sutured skin.
- Selected SN8OGLIND- 103 progeny plants were crossed with IOTYU, a proprietary Syngenta Seeds line obtained through generations of self-pollination from the traditional open pollinated Japanese variety Makuwauri EIJYU (Nanto seed Co. Ltd, Kashiwara, Nara, Japan). It was selected because of non-climacteric, non turning, very high sugar content, high citric acid content, yellow rind.
- SOLAZ 1 selected as Low pH in combination for high sugar accumulation, powdery mildew tolerance, and plant with Summer growing adaptation (Table 8E and F).
- SOLAZ 2 selected as Low pH with combination for medium sugar accumulation, and plant with Spring growing adaptation (Table 8E and F).
- Progenies SOLAZ 1 and SOLAZ 2 were used as males pollinators for crosses with three proprietary Syngenta Seeds lines, YUSOL 1, 2 & 3, obtained through 6 generations of self-pollination from a breeding hybrid MD.997 F1 from cross YUCA-15 ⁇ SOLAR-48 both proprietary Syngenta Lines with origin indicated before.
- the Low pH trait was introgressed in green flesh non climacteric LSL melons with round shape and yellow sutured skin.
- This line was selected because of green flesh, non turning, non climacteric long-shelf life, very high sugars very crispy watermelon texture and sutures.
- YUSAZ A lines were used as males pollinators for crosses with three proprietary Syngenta Seeds lines, YUSOL 1 a proprietary Syngenta Seeds line described above.
- the Low pH trait was introgressed in green flesh non climacteric LSL melons with round shape and yellow sutured skin.
- This line was selected because of green flesh, non climacteric long-shelf life, very high sugars very crispy watermelon texture and sutures.
- Self-pollination progenies were selected for green flesh, crispy watermelon texture, high citric acid content and yellow rind.
- YUSAZ B is an example of a “Citric+” melon plant.
- YUSAZ B lines were used as males pollinators for crosses with three proprietary Syngenta Seeds lines, YUSOL 1 a proprietary Syngenta Seeds line described above.
- Example 6 The plants were grown under the conditions described in Example 6. The number of fruits tested in each experiment is shown (nr. Frt). The measurements were carried out as described in Example 1-5.
- the figures for sucrose (suc), hexoses (hex), and total sugars are in g per 100 g fresh weight (fwt).
- the figures for citric acid and malic acid are in mg per 100 g fresh weight (fwt). TABLE 12 YUSAZ B tot. tot.
- the low pH trait was introgressed in orange flesh melons.
- the selected target was the conversion of the commercial hybrid MEHARI (Syngenta Seeds) into two low pH versions, one with higher citric acid content and one with lower citric acid content.
- L53 is a Charentais melon type selected for the purpose because of high sugars, low citric content.
- L53 is a parent of the commercial hybrid MEHARI (see Table 8F).
- L53AZ A selected from previous population a) and fixed for low citric acid content and low pH and, for other traits, close to the recurrent L53.
- Line L53AZ A is an example of a “Citric ⁇ ” melon plant.
- L53AZ B selected from previous population b) and fixed for low pH and high citric acid content and, for other traits, close to the recurrent L53.
- Plants were also selected for intense orange flesh color in presence of the low pH trait.
- the intensity of the orange color in the flesh had to be particularly selected for, as a generally poor orange color intensity tended to be associated within low pH acid in the fruit flesh (see Table 4).
- Progenies lines L53AZ A and L53AZ B, and line L53 were used in crosses with the other parent line of MEHARI to obtain MEHARI AZ A, MEHARI AZ B and MEHARI the current commercial F1, respectively.
- the sensory analysis was carried out in an air-conditioned sensory analysis laboratory equipped with individual cabins.
- a structured scale of quotation in 10 points was used with the following descriptors:
- Tables 14 and 15 show the results of two sensory analysis conducted on different fruits.
- plants were sown in early March and transplanted to open protected fields as vine crops in early April. Fruits were harvested in early July.
- fruits were stored for 7 to 12 days at 10° C. followed by 2 days at 20° C.
- fruits were stored for 4 to 8 days at 10° C. followed by 2 days at 20° C.
- PCR cycling conditions were: 15 s denaturation at 94° C. followed by 15 s annealing at 54° C. and 30 s extension at 72° C. for 40 cycles. Sample's DNA was initially denatured for 2 minutes at 94° C. and extended for 2 min at 72° C. after PCR.
- the PCR mix contained 1.65 mM MgCl 2 , 60 mM of each deoxyribonucleotide, 1 ⁇ Taq Buffer, 0.2 unit Taq polymerase, 15-20 ng template DNA and 400 nM of each non-fluorescent primer or 200 nM of each fluorescently labeled primer.
- Fluorescent primers were labeled with 6-FAM, NED or HEX. Fluorescent PCR products were separated on an ABI3700 capillary sequencer and their sizes measured using Applied Biosystem's Genescan and Genotyper fragment analysis software.
- Non-fluorescent PCR products were separated by electrophoresis in 3% agarose gels (Resophor, Eurobio) at 400V with cooling system. Gels were stained with ethidium bromide. Three markers were used, CMAT141 (described in Danin-Poleg et al. (2001) Theor. Appl. Genet. 102: 61-72 and Danin-Poleg et al. (2002) Euphytica 125: 373-384) and NE0585 and NE1746. The primers for these markers are shown below.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Nutrition Science (AREA)
- Chemical & Material Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Physiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Polymers & Plastics (AREA)
- Food Science & Technology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Preparation Of Fruits And Vegetables (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Seasonings (AREA)
Abstract
The present invention relates to novel plants, in particular to melon plants capable of producing fruits with a new pleasant taste and to seeds thereof. The present invention further relates to fruits of melon plants of the present invention, wherein such fruits have organic acid content, low pH and high sugar contents. The present invention further relates to methods of making and using plants and fruits disclosed herein.
Description
- This application claims the benefit of U.S. Provisional Application No. 60/535,631, filed Jan. 9, 2004. The above application is incorporated herein by reference.
- The present invention relates to novel plants, in particular to melon plants capable of producing fruits with a new pleasant taste. In particular, the fruits of the melon plants of the present invention have altered organic acid contents, lower pH when compared to current commercial sweet melon fruits, and high sugar contents.
- Melon (Cucumis melo L.) is a commercial crop grown worldwide. Cucumis melo is a member of the family Cucurbitaceae. The Cucurbitaceae comprises about 90 genera and 700 to 760 species, mostly of the tropics. The family includes pumpkins, squashes, gourds, watermelon, loofah and several weeds. Cucumis melo L. includes a very wide variety of cultivars producing fruits of different shape, external appearance and flesh color. Commercial melons generally produce sweet fruits known for example as Charentais, cantaloupe, honeydew, amarello, Piel de sapo, Kirkagak, Hamy, Ananas, Galia, Oriental that are usually consumed as dessert fruits. Cucumis melo L. also includes non-sweet, commercial cultivars consumed in the Middle to Far East in salad, cooking or pickling, as for example Alficoz, Faqqous, Chito, Conomon (Pitrat et al (2000) Eucarpia meeting Proceedings: 29-36). The taste and aroma of melon fruits is determined by a number of factors, including sugars, aroma volatiles, free amino acids, organic acids, pH and soluble minerals (Wang et al. (1996) J. Agric. Food Chem. 44: 210-216). Among the four primary tastes (sweet, sour, bitter, salty), sweetness is considered to be a very important component of good tasting melon fruits. In commercial melon fruits the sweet taste mostly results from high levels of sucrose (Burger et al. (2002) J. Amer. Soc. Hort. Sci. 127(6): 938-943). Sucrose is accumulated at the end of fruit development, during ripening process (Shaffer et al (1987) Phytochemistry 26: 1883-1887). Melon fruits also initially accumulate hexoses, mainly fructose and glucose, which are the dominant reducing sugars (Stepanski et al (1999) Genetic Resources and Crop Evolution 46: 53-62). An important taste component in melon fruits is sweetness, which is mainly the result of sugars accumulation. Sweetness correlates not only with the total sugars content, but also with the type of sugars. For example, 1 gram of glucose is the sweet equivalent of 0.7 gram of sucrose; 1 gram of fructose is the sweet equivalent of 1.7 gram of sucrose; 1 gram of inverted sugar, i.e. glucose plus fructose generated from 1 gram of sucrose, is the sweet equivalent of 1.3 gram of sucrose (J. A. BABOR et J.IBARZ (1935) Quimica General Moderna).
- The flesh of sweet melon fruits has a pH usually above 6.0, but melon accessions are also known to have a much lower pH, as low as below 5.0. This low pH is widespread over many different melon types as for example Faqqous, Chito, Conomon, Momordica, Agrestis (Stepanski et al). In most of these cases, these melon types combine low pH and low sugar content, e.g. sucrose (Stepanski et al). These fruits are generally not edible in fresh consumption without dressing or cooking and, in some cases, they are even bitter. In most of these melon accessions with low pH, the mesocarp, which is the edible part of the fruit, represents a minor part of the total fruit, while the seed cavity and placenta represent a major part of the total fruit fresh weight. This is in contrast to sweet dessert melons, where the mesocarp represents a major part of the fruit. Also, in many cases, the fruit size or weight of the melon having low pH is below commercially acceptable ranges.
- The fruit flesh of some melons has a sour taste (Kubicki (1962) Genetica Polonica 3:265-274). The cause for the sour taste remains unclear, but it has been linked with low pH in the fruit flesh (U.S. Pat. No. 5,476,998 and Danin-Poleg et al. (2002) Euphytica 125: 373-384). Single genes for sour taste (So) and pH have also been reported, although their genetic association is not clear (Danin-Poleg et al.).
- Attempts have been made to produce melon fruits combining sour and sweet tastes. For example, Najd melons based on Arabic wild varieties have been reported (Ibrahim and Al-Zeir (1992) HortScience 27: 276-277). U.S. Pat. No. 5,476,998 also described melons with a sour taste, with a mean pH value of 4.8 and a total soluble content of about 11. The melons in U.S. Pat. No. 5,476,998 are derived from MR-1, also known as PI124111 (Thomas, Eucarpia '92 pp 142), which is a C. melo Var. Momordica (Roxburg). Fruits of this melon showed low pH (Danin-Poleg et al.). This melon variety also involves poor fruit traits such as very mealy, non-aromatic and non-sweet flesh, very climacteric behavior and thin skin bursting at ripening. These undesired traits are difficult to remove by breeding and it is therefore expected that the development of commercial products from such a variety would be lengthy and difficult. Accordingly, there is an unmet need for melons producing fruits with alternative or improved tastes. In particular, there is an unmet need for melon fruits having new combinations of organoleptic characteristics and aroma.
- The instant invention addresses the need for melon fruits with alternative or improved tastes. Accordingly, the instant invention discloses melon plants capable of producing fruits with novel combinations of organic acid contents and compositions, pH, and sugars contents and compositions. The invention also discloses methods of making and methods of using plants of the present invention and their fruits.
- The inventors of the instant application have identified that there is a wide variability in the contents and composition of organic acids in melon fruits. In particular, the inventors of the present invention have identified that melon plants produce fruits with varying contents of citric acid and varying ratios of citric acid to malic acid. Accordingly, the inventors of the present invention have combined appropriate content of organic acids, low pH and desired sugar contents in a melon fruit to obtain novel and extremely pleasant tastes.
- Accordingly, in one embodiment, the instant invention discloses melon plants capable of producing fruit with low pH and desired combinations of citric and malic acid contents, while maintaining or increasing levels of sugars currently observed in sweet melons. In one embodiment, the instant invention discloses melon plants capable of producing fruit with low pH and desired combinations of citric and malic acid contents, combined with desired combinations of sucrose and hexoses contents. In one embodiment, the present invention provides melon plants capable of producing fruits with elevated contents of citric acid and lower pH, when compared to current commercial melons. In one embodiment, melon plants of the present invention are obtained by introducing a low pH trait in a melon plant not comprising said trait. In one embodiment, melon plants of the present invention are obtained by introducing a low pH gene in a melon plant not comprising said gene. In one embodiment, the low pH gene is obtainable from line IND-35, deposited with NCIMB under Accession number NCIMB 41202. Accordingly, the present invention discloses melon plants comprising a low pH trait, and producing fruit comprising desired contents and compositions of organic acids, pH and contents and compositions of sugars. In one embodiment, increased citric acid contents are achieved while maintaining low levels of malic acid in the fruit. In one embodiment, fruits of melon plant of the instant invention have high ratios of citric acid to malic acid.
- In one embodiment, the melon plants of the instant invention are capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fresh weight (fwt). In one embodiment, melon plants of the instant invention are capable of producing fruit with a pH of about 4.2 to about 5.6. In one embodiment, melon plants of the instant invention are capable of producing fruit with a sugar content equal or higher than about 5.0 g per 100 g fwt. In one embodiment, melon plants of the instant invention are capable of producing fruit with a sugar content equal or higher than about 7.0 g per 100 g fwt.
- In one embodiment, the present invention discloses melon plants capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fwt, pH of about 4.2 to about 5.6, and sugar content equal or higher than about 5.0 g per 100 g fwt.
- In one embodiment, the present invention discloses a C. melo plant capable of producing a fruit comprising at maturity:
- a) about 400 mg to about 1,200 mg citric acid per 100 g fwt;
- b) pH of about 4.2 to about 5.6; and
- c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the citric acid content of a fruit of a plant according to the present invention is about 400 mg to about 1,000 mg citric acid per 100 g fwt. In one embodiment, melon plants of the present invention produce edible fruits, preferably with a round or oval shape, and preferably weighting over 450 grams. The flesh of the melons of the present invention is preferably green, yellow, white or orange.
- In one embodiment, the instant invention discloses melon plants capable of producing a very sweet juicy fruit with tart-refreshing sour taste, and referred herein to as “Citric+” plants or fruits. Such fruits comprise high contents of citric acid and low pH, increasing the acid taste and providing a tart perception, which covers still too flat and poor flavors of early mature fruits.
- In one embodiment, a fruit of a Citric+plant of the present invention at maturity comprises:
- a) about 600 to about 1,200 mg citric acid per 100 g fwt;
- b) pH of about 4.2 to about 5.1; and
- c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the citric acid content of a fruit of a plant according to the present invention is about 600 mg to about 1,000 mg citric acid per 100 g fwt.
- In one embodiment, the present invention discloses a melon plant capable of producing a sweet aromatic fruit with mild-fruity sour taste, referred herein as “Citric−” melon plant or fruit. Such fruits comprise relatively high contents of citric acid and mildly low pH. This mild low pH makes a fruity sour perception, which covers other still too flat and poor flavors of early mature fruits.
- In one embodiment, the fruit of a Citric−plant of the present invention at maturity comprises:
- a) about 400 to about 650 mg citric acid per 100 g fwt;
- b) pH of about 4.6 to about 5.6; and
- c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the present invention discloses a melon plant capable of producing fruit with low pH and a flesh of deep orange color. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit with pH of about 4.5 to about 5.6, wherein said fruit has orange flesh rated 4 or higher.
- In one embodiment, characteristics of melon fruits described herein are measured on fruits of melon plants grown in open fields or in plastic houses, and harvested at maturity. In one embodiment fruits are harvested from early maturity to late maturity (stages 2-4, as described herein). In one embodiment, a fruit of the present invention is at maturity when its sucrose contents is at or over 2 g sucrose per 100 g fwt.
- In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.8 and a sugar savor of about 4.3 to about 5.8. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 2.5 to about 3.8 and a sugar savor of about 4.3 to about 5.6. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.0 and a sugar savor of about 5.2 to about 5.8. In one embodiment, the acid savor and sugar savor are determined by an Expert panel, for example as described in Example 12 herein. In one embodiment, such fruit comprises a pH and citric acid content as described herein. In one embodiment, such fruit comprises a pH, organic acid contents and compositions and sugar contents and compositions as described herein.
- In one embodiment, the present invention discloses a C. melo plant comprising a DNA sequence, which co-segregates with a low pH trait. In one embodiment, the DNA sequence is a template for amplification of a DNA fragment described herein using the primers described herein. In one embodiment, the present invention discloses such primers and DNA fragments amplified using these primers. In one embodiment, a DNA fragment described herein is amplified from DNA of said plant using the primers described herein. The DNA fragments are used as molecular markers for a low pH trait. In one embodiment, a DNA fragment of about 168 bp to about 178 bp is amplified from the DNA of said plant when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of 168 bp, 173 bp, 169 bp, 172 bp or 178 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 176 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 175 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of about 218 bp to about 253 bp is amplified when the primers capable of identifying the NE0585 marker are used. In one embodiment, a DNA fragment of 230 bp, 232 bp, 218 bp, 229 bp, 234 bp or 239 bp is amplified when the primers capable of identifying the NE0585 marker are used. In one embodiment, a DNA fragment of about 121 bp to about 145 bp is amplified when the primers capable of identifying the NE1746 marker are used. In one embodiment, a DNA fragment of 124 bp, 127 bp, 133 bp, 142 bp or 145 bp is amplified when the primers capable of identifying the NE1746 marker are used.
- In one embodiment, the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a DNA fragment indicative for the presence of a low pH trait in said plant (acid fragment) or for the absence of the low pH trait (basic fragment) in said plant. In one embodiment, the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a basic fragment linked to a low pH trait, wherein said DNA sequence is linked to said low pH trait. In one embodiment, the C. melo plant comprises such a DNA sequence on one side of a low pH gene. In one embodiment, the C. melo plant comprises such a DNA sequence on both sides of a low pH gene. In one embodiment, a fruit of such a plant comprise a pH within the ranges disclosed herein. In one embodiment, fruits of such a plant comprise the contents and compositions of sugars as described herein. In one embodiment, fruits of such a plant comprise the contents and compositions of organic acids as described herein. In one embodiment, fruits of such a plant comprise the pH, contents and compositions of sugars and contents and compositions of organic acids as described herein.
- In one embodiment, the characteristics of a fruit according to the present invention described herein remain stable after the fruit reaches maturity. In one embodiment, such characteristics remain stable after a fruit reaches maturity when the fruit is kept on the plant. In one embodiment, such characteristics remain stable when the fruit is harvested and kept in storage after harvest. This allows for a reduced harvest frequency, and to store or ship a fruit of the present invention without loosing its organoleptic characteristics and aroma. In one embodiment, the pH of a fruit of the instant invention remains stable after a fruit reaches maturity. In one embodiment, the citric acid content of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the malic acid content of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the ratio citric acid to malic acid of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the pH and organic acid contents and composition of a fruit of the present invention remain stable after a fruit reaches maturity. In one embodiment, such characteristics remain within the ranges described herein after a fruit reaches maturity. In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 2 days when the fruit is kept on the plant, in one embodiment for at least 3 days when the fruit is kept on the plant, in one embodiment for at least 4 days when the fruit is kept on the plant. In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 5 days when kept in storage at 20° C., in one embodiment for at least 7 days when kept in storage at 20° C., in one embodiment for at least 9 days when kept in storage at 20° C. In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 7 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 12 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 26 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C. In one embodiment, a plant of the instant invention is capable of producing a long shelf-life fruit (LSL) or a medium shelf-life fruit (MSL). In one embodiment, a plant of the instant invention is capable of producing a non-turning fruit or low turning fruit. In one embodiment, a plant of the instant invention is capable of producing a non-climacteric fruit or a low climacteric fruit.
- The instant invention further discloses seeds of a C. melo plant of the present invention, and seeds of the progeny thereof, wherein said progeny seed is capable of producing a plant of the present invention. The instant invention further discloses parts of a C. melo plant of the present invention, e.g. ovules or pollen, and fruits of a C. melo plant of the present invention. The instant invention further discloses the flesh of a fruit of a C. melo plant of the present invention. The instant invention further discloses the juice of a fruit of a C. melo plant of the present invention.
- The present invention further discloses the use of the flesh of a fruit according to the present invention in a fresh cut product. The present invention further discloses the use of the juice of a fruit according to the present invention in a soft drink.
- The present invention further discloses methods of increasing the citric acid content of a plant comprising obtaining a first C. melo plant; crossing said first C. melo plant with a second C. melo plant comprising a low pH trait, obtaining a progeny C. melo plant, determining the pH and citric acid content of a fruit of said progeny plant, selecting a fruit of said progeny C. melo plant which has increased citric acid content, when compared to a fruit of said first C. melo plant. In one embodiment, said progeny C. melo plant has a lower pH, when compared to a fruit of said first C. melo plant. In one embodiment, the method comprises detecting a DNA fragment described herein using the primers described herein. The present invention further discloses the use of a melon plant comprising a low pH trait to obtain a melon plant of the present invention. In one embodiment, the melon plant comprising a low pH trait further has the ability of accumulating relevant levels of sugars, for example sucrose. In one embodiment, the melon plant comprising a low pH accumulates high levels of citric acid. In one embodiment, the melon plant comprising a low pH accumulates low levels of malic acid. In one embodiment, the melon plant comprising a low pH trait further has the ability of accumulating relevant levels of sugars, for example sucrose and of accumulating high levels of citric acid and of accumulating low levels of malic acid. In one embodiment, the melon plant comprising a low pH is a plant of line IND-35 or a descendent thereof.
- The present invention further discloses a method to produce seed of a plant according to the instant invention comprising obtaining a plant of the present invention, self-pollinating said plant or crossing said plant with another melon plant, and harvesting progeny seed. The present invention further discloses a method to vegetatively propagate a melon plant according to the present invention. The present invention further discloses a method for producing a fruit comprising planting a plant according to the present invention, growing said plant and harvesting a fruit, wherein said fruit comprises the characteristics described herein. The method further comprises storing said fruit, for example as described herein. The method further comprises shipping said fruit. In one embodiment, the characteristics of said fruit described herein remain stable during the storage of said fruit. In one embodiment, the characteristics of said fruit described herein remain stable during the storage of said fruit. In one embodiment, a plant of the present invention is an inbred line, a hybrid, a dihaploid, or a vegetatively propagated clone.
- The present invention thus provides melon fruits offering a pleasant acid component but avoiding an astringent taste. This enhances or complements melon flavors to their maximum potential. These combinations of organic acid content and low pH with high sugars provide new ranges and classes of appealing tastes for fresh consumption or the fresh cut or fresh juice industry. Low pH in fruit flesh also prevents bacterial contamination in fresh cut and juice industrial processes.
- Trait: characteristic or phenotype. For example, in the context of the present invention a low pH trait confers a low pH, for example from about 4.2 to about 5.6, to the flesh of a melon fruit. A trait may be inherited in a dominant or recessive manner, or in a partial or incomplete-dominant manner. A trait may be monogenic or polygenic, or may also result from the interaction of one or more genes with the environment.
- Monogenic: determined by a single locus.
- Polygenic: determined by more than one locus.
- Dominant: results in a complete phenotypic manifestation at heterozygous or homozygous state.
- Recessive: manifests itself only when present at homozygous state.
- Partial or incomplete-dominance: when present at the heterozygous stage determines a phenotype that is intermediate to that of the homozygous stage or when the trait is absent.
- Backcrossing: backcrossing is a process in which a hybrid progeny is repeatedly crossed back to one of the parents.
- Locus: region on a chromosome, which comprises a gene contributing to a trait.
- Genetic linkage: association of characters in inheritance due to location of genes in proximity on the same chromosome. Measured by percent recombination between loci (centi-Morgan, cM).
- Quantitative Trait Loci (QTL): Quantitative trait loci (QTL) refer to genetic loci that control to some degree numerically representable traits that are usually continuously distributed.
- Isogenic: plants, which are genetically identical, except that they may differ by the presence or absence of a gene, a locus conferring a trait or heterologous DNA sequence.
- Marker assisted selection: refers to the process of selecting a desired trait or desired traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is associated with the desired trait.
- Dihaploid: doubling of haploid (single chromosome) status of the genome (e.g. through anther culture or microspore culture) giving a complete homozygous plant.
- “Tester” plant: plant used to characterize genetically a trait in a plant to be tested. Typically, the plant to be tested is crossed with a “tester” plant and the segregation ratio of the trait in the progeny of the cross is scored.
- Gene: Unit of inheritance. Genes are located at fixed loci in chromosomes and can exist in a series of alternative forms called alleles.
- Allele: One of a pair or series of forms of a gene, which are alternative in inheritance because they are situated at the same locus in homologous chromosomes.
- Homozygous: Having like alleles at one or more corresponding loci on homologous chromosomes.
- Heterozygous: Having unlike alleles at one or more corresponding loci on homologous chromosomes.
- Low pH gene: gene, which when present in the genome of a plant leads to a lower pH of the flesh of a fruit of said plant, when-compared to a plant not comprising said gene.
- Low pH melon plant: melon plant comprising a low pH trait. In one embodiment, the pH of a fruit of a low pH melon plant is from about 4.2 to about 5.6.
- Cucumis melo L: also referred herein to as C. melo or melon.
- Cavity: refers to the center of the melon fruit containing seeds and maternal tissues.
- Soluble Solids: refers to the percent of solid material found in the fruit tissue, the vast majority of which is sugars.
- Climacteric/non-climacteric: as for example defined in Watkins (2002) “Ethylene synthesis, mode of action, consequences and control” In: Michael Knee (ed) “Fruit Quality and its Biological Basis”. Sheffield Academic Press, Sheffield, UK. Chapter 8 pp. 180-224, in particular at page 181, section 8.2.1, first two paragraphs.
- Turning melon: turning refers to the marked change in rind color of a melon fruit when it reaches maturity, for example from green to yellow rind in Galia types, or from gray to creamy-yellow rind in Charentais types. This change of color is related to the degradation of green pigments occurring when the fruit reaches maturity.
- Non-turning/low-turning melon: the rind color of a fruit of a non-turning or low turning melon does not dramatically change upon maturation. In the rind of the fruit of non-turning or low turning melon, there may be a continuous slight increase in yellow component in the stable background of the rind, as for example in Piel de Sapo type or in honeydew types. In low-turning melons, a slight pigment degradation may also be observed in connection with senescence of the fruit rather than with reaching maturity, which occurs earlier.
- The present invention provides C. melo plants capable of producing fruits with novel tastes. In particular, the present invention provides melon plants capable of producing fruits with novel combinations of organic acid contents, pH and sugar contents. The inventors of the instant application have identified that melon fruits contain various levels of organic acid, e.g. citric acid. The inventors of the instant application also have identified that melon fruits contain various relative contents citric acid and malic acid. Moreover, the inventors of the instant application have determined that by introducing a low pH trait into a sweet melon background, a reduction in pH and an increase in the citric acid content in the fruit are obtained, further expanding the ability to manipulate the taste of a melon fruit. In one embodiment, melon fruits of the present invention have low contents of malic acid. Accordingly, the present invention discloses melon plants producing fruits having elevated citric acid contents and lower pH, as described herein. In one embodiment, sugar levels observed in fruits of plants of the instant invention are maintained at levels present in currently available sweet melons or increased. Accordingly, plants of the present invention are capable of producing fruits with novel, pleasant tastes. Measurements of pH, citric acid and malic acid contents, and sugar contents described herein were carried out are shown in Examples 1 to 5. Tables 1A and 1B herein disclose representative melon plants according to the present invention and their fruits.
- In one embodiment, the melon plants of the instant invention are capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fresh weight (fwt). In one embodiment, melon plants of the instant invention are capable of producing fruit with a pH of about 4.2 to about 5.6. In one embodiment, melon plants of the instant invention are capable of producing fruit with a sugar content equal or higher that about 5.0 g per 100 g fwt. In one embodiment, the present invention discloses melon plants capable of producing fruit with citric acid content equal or higher than about 400 mg per 100 g fwt, pH of about 4.2 to about 5.6, and sugar content equal or higher that about 5.0 g per 100 g fwt.
- In one embodiment, the present invention discloses a C. melo plant capable of producing a fruit comprising at maturity:
- a) about 400 mg to about 1,200 mg citric acid per 100 g fwt;
- b) pH of about 4.2 to about 5.6; and
- c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the fruit comprises about 400 mg to about 1,000 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises about 450 mg to about 950 mg citric acid per 100 g fwt, in one embodiment about 475 mg to about 900 mg citric acid per 100 g fwt. In one embodiment, the fruit has a pH of about 4.3 to about 5.4, in one embodiment about 4.4 to about 5.1. In one embodiment, the fruit comprises about 5.5 g to about 13.0 g sugar per 100 g fwt. In one embodiment, the fruit comprises about 7.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the ratio citric acid to malic acid in a fruit of said plant is greater than 4.4, in one embodiment greater than 5, in one embodiment greater than 10. In one embodiment, the ratio citric acid to malic acid in a fruit of said plant is less than 450, in one embodiment less than 200, in one embodiment less than 150. In one embodiment, a fruit of said plant comprises less than about 85 mg malic acid per 100 g fwt, in one embodiment less than about 75 mg malic acid per 100 g fwt.
- In one embodiment, the ratio sucrose to hexoses in a fruit of said plant is about 1:1, in one embodiment between about 1:1 and about 1:2, in one embodiment between about 1:1 and about 2:1.
- In one embodiment, the flesh of a fruit of said plant is orange, white, green or yellow. In one embodiment, said fruit is edible in fresh consumption. In one embodiment, the mesocarp of a fruit of said plant represents more than 50% of the total fresh fruit weight.
- In one embodiment, the C. melo plant comprises a low pH trait. In one embodiment, the low pH trait is obtainable from a plant of line IND-35, representative seeds of which is deposited under Accession number NCIMB 41202, or a descendent of said line IND-35. In one embodiment, the low pH trait is homozygous or heterozygous in said plant.
- In one embodiment of the instant invention, melon plants referred to as “Citric+” plants are disclosed. Such plants are capable of producing a very sweet juicy fruit with tart-refreshing sour taste. Such fruits comprise high contents of citric acid and low pH, increasing the acid taste and providing a tart perception. This is compensated by a high sugar content, in one embodiment by elevated levels of reducing sugars (glucose and fructose). The high reducing sugar content is particularly pronounced in early mature stages. The combination of tart and sweet tastes, which cannot be obtained by currently available sweet melon, is appreciated by consumers. The tart-refreshing sour sweet melon combination satisfies this need. This fruity tart perception also cover still too flat and poor flavors of early mature fruits. In one embodiment, Citric+plants are generally obtained by introducing a low pH trait, for example from line IND-35, into an oriental melon background. In one embodiment, the oriental melon background is selected for one or more of the following criteria: high citric acid content, low malic acid content, high citric acid to malic acid content, high sugar content, high hexose content, high ratio hexoses to sucrose, high juiciness. During the introduction of the low pH trait, careful selection for the above characteristics is maintained until a desired progeny is obtained.
- For example, Examples 9, 10 and 11 describe the construction of such plants. Alternative C. melo plants can also be screened for desired characteristics and are used as starting materials as described herein.
- In one embodiment, a fruit of a Citric+plant of the present invention at maturity comprises:
- a) about 600 to about 1,200 mg citric acid per 100 g fwt;
- b) pH of about 4.2 to about 5.1; and
- c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the fruit comprises about 600 to about 1,000 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises about 650 to about 950 mg citric acid per 100 g fwt.
- In one embodiment, the pH of the fruit is about 4.4 to about 5.0.
- In one embodiment, said fruit comprises about 7.0 g to about 13.0 g sugar per 100 g fwt. In one embodiment, the ratio citric acid to malic acid in a fruit of said plant is greater than 6, in one embodiment greater than 7, in one embodiment greater than 10. In one embodiment, the ratio citric acid to malic acid in a fruit of said plant is less than 450, in one embodiment less than 200. In one embodiment, a fruit of said plant comprising less than about 85 mg malic acid per 100 g fwt, in one embodiment less than about 75 mg malic acid per 100 g fwt, in one embodiment less than about 60 mg malic acid per 100 g fwt.
- In one embodiment, a fruit of a plant of the present invention has a green or white flesh and at maturity comprises:
- a) about 600 to about 1,200 mg citric acid per 100 g fwt;
- b) pH of about 4.2 to about 5.1; and
- c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
- In one embodiment, the fruit comprises about 600 to about 1,000 mg citric acid per 100 g fwt. In one embodiment, said fruit with green or white flesh comprises at maturity about 8.0 g to about 12.0 g sugar per 100 g fwt. In one embodiment, said fruit with green or white flesh has at maturity a ratio citric acid to malic acid between about 25 and 200. In one embodiment the malic acid content of said fruit is less than about 50 mg malic acid per 100 g fwt, in one embodiment less than about 30 mg malic acid per 100 g fwt. In one embodiment, the ratio sucrose to hexoses in a fruit of said plant is about 1:1, in one embodiment between about 1:1 and about 2:1.
- In one embodiment, a fruit of a plant of the present invention has orange flesh and comprises at maturity:
- a) about 600 mg to about 750 mg citric acid per 100 g fwt;
- b) pH of about 4.5 to about 5.1; and
- c) about 6.0 g to about 13.0 g sugar per 100 g fwt.
- In one embodiment, the ratio citric acid to malic acid in said fruit is between about 4.4 and 30. In one embodiment, the fruit comprises about 7.0 g to about 13.0 g sugar per 100 g fwt.
- In one embodiment, the present invention discloses a melon plant capable of producing a sweet aromatic fruit with mild-fruity sour taste, referred herein as “Citric−” melon plant or fruit. Such fruits comprise relatively high contents of citric acid and mildly low pH. This mild low pH makes a fruity sour perception that cover other still too flat and poor flavors of early mature fruits and without affecting the full expression of fruit flesh flavors and colors of further fully mature fruits. Further during ripening (early to late mature), fruits follow relevant increases of pH, decrease of acidity, in line with the weak buffer potential from the low citric acid content. This provides fully mature fruits with a very slight sour note to the full expression of very sweet and aromatic melon flavors. Melon flavor is based primarily on sweetness and aromas that usually get the full expression on really advanced fruit ripening stages. Early ripe melons are often described as unpleasant tasteless as sugars and aromas are below expectation and not any other component of flavor is present. In other fruits, such as strawberry, peach, or oranges, acid taste makes a well appreciated complement in this early ripe stages. The mild-fruity sour and sweet melon combination avoids or limits the tasteless risk on early ripe melons.
- In one embodiment, Citric−plants are obtained by introducing a low pH trait, for example from line IND-35, into a Charentais melon background. In one embodiment, the Charentais melon background is selected for one or more of the following criteria: low citric acid content, low malic acid content, relatively high citric acid to malic acid content, high sugar content, high sucrose content. During the introduction of the low pH trait, careful selection for the above characteristics is maintained until a desired progeny is obtained.
- For example, Example 11 describes the preparation of such plants. Alternative C. melo plants can also be screened for desired characteristics and can be used as starting materials as described herein.
- In one embodiment, the fruit of a Citric−plant of the present invention at maturity comprises:
- a) about 400 to about 650 mg citric acid per 100 g fwt;
- b) pH of about 4.6 to about 5.6; and
- c) about 5.0 g to about 13.0 g sugar per 100 g fwt.
- In one embodiment, the fruit comprises about 450 to about 600 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises a pH of about 4.8 to about 5.4, in one embodiment to about 5.2. In one embodiment, the fruit comprises about 5.0 g to about 13.0 g sugar per 100 g fwt, in one embodiment about 6.0 g to about 12.0 g sugar per 100 g fwt. In one embodiment, the fruit comprises about 7.0 g to about 13.0 g sugar per 100 g fwt.
- In one embodiment, a fruit of a plant of the present invention has orange flesh and comprises at maturity:
- a) about 400 mg to about 550 mg citric acid per 100 g fwt;
- b) pH of about 4.8 to about 5.6; and
- c) about 5.0 g to about 11.0 g sugar per 100 g fwt.
- In one embodiment, the ratio citric acid to malic acid in said fruit is between about 4.4 and 10. In one embodiment, the fruit comprises about 7.0 g to about 11.0 g sugar per 100 g fwt.
TABLE 1A Summary of data for lines Table 1A discloses representative lines of the present invention. The data shown in Table 1A are averages based on measurements from individual trials. The data for the individual trials are disclosed in Tables 9-13 in the Examples below. tot. sugar sucrose hexose hex/suc citric malic LINES (averages) avg avg avg inv pH avg citric/ avg Plastic house data nr. frt g/100 g g/100 g g/100 g activity avg mg/100 g malic mg/100 g Green YUSOL High pH 34 9.85 4.50 5.34 1.1 6.05 265 24 11 Flesh YUSAZ A Low pH, Citric− 246 8.92 3.24 5.68 1.8 4.67 577 19 31 YUSAZ B Low pH, Citric+ 30 8.70 2.16 6.54 3.0 4.59 832 16 53 White SOLAZ/1 Line 71 6.97 2.16 4.81 2.2 4.59 579 23 25 Flesh SOLAZ/2 Line 43 6.19 1.92 4.27 2.2 4.64 590 47 13 Orange L53AZ A Low pH, Citric− 76 7.09 2.51 4.42 1.8 4.89 509 3 153 Flesh L53AZ B Low pH, Citric+ 52 8.11 4.24 3.87 0.9 4.81 701 10 67 L53 High pH 10 8.29 5.05 3.23 0.6 6.67 92 1 93 -
TABLE 1B Summary of data for hybrids Table 1B discloses representative hybrids of the present invention. The data shown in Table 1B are averages based on measurements from individual trials.The data for the individual trials are disclosed in Tables 9-13 in the Examples below. Mehari means the female parent of hybrid MEHARI. tot. sugar sucrose hexose hex/suc citric malic HYBRIDS (average) nr. avg avg avg inv pH avg citric/ avg Plastic house (PS) & Open Field (OP) data frt g/100 g g/100 g g/100 g activity avg mg/100 g malic mg/100 g Green YUSAZ A X YUSOL Low pH, Citric + 17 9.70 4.46 5.24 1.2 4.77 692 46 15 PS Flesh MILENIUM-DENEV High pH 12 7.61 3.47 4.13 1.4 5.88 444 X 0 OP F1 White SOLAZ/1 X YUSOL Solaz1 x Yusol 26 9.71 6.40 3.31 0.5 4.75 760 58 13 OP Flesh SOLAZ/2 X YUSOL Solaz2 x Yusol 13 9.08 6.26 2.82 0.5 4.70 782 162 6 OP SOLAR F1 High pH 8 8.93 4.39 4.54 1.2 6.48 305 35 9 PS Orange Mehari/L53AZ A Low pH, Citric − 13 7.34 2.24 5.10 2.3 4.98 487 6 78 PS Flesh Mehari/L53AZ B Low pH, Citric + 17 8.35 3.37 4.97 1.5 4.76 663 11 60 OP Mehari/L53 High pH 14 8.80 3.96 4.84 1.2 6.31 274 5 54 PS - The instant invention demonstrates that the manipulation of the degree of sourness in a fruit produce valuable taste variations. Sourness is a result of the interaction between several parameters, pH being one of the most important ones along with organic acids contents and compositions. The pH greatly influences the degree of dissociation of acids involved in taste. Each acid has a different dissociation constant (pKa), which refers to the pH, at which 50% of the acid is dissociated in its relative ions and H+. A lower pH results in more of the acid that is not in dissociated form. The sourness perception comes mainly from the undissociated form of the acid. This explains why, at higher pH levels, weaker acids such as organic acids with a higher pKa are perceived as sourer than stronger acids.
- The pH of a solution is correlated with the concentration and pKa of the acid. Equinormal solutions of stronger acids are sourer than weaker ones, since they have a much lower pH. The higher the concentration of the acid (titratable acidity), the more sour the acid will be perceived. Sourness is also correlated with the chemical structure of the acidulant, the number of carboxylic groups, the molecular weight, and polarity of the molecule (see e.g. PURAC Biochem, Gorinchen, The Netherlands, “Flavor Special”, www.Purac.com). Besides sourness, each food acid has its own flavor characteristics in terms of lasting time, flavor intensity and the contribution to other non-sour flavor notes such as astringency, bitterness and sweetness.
- The major organic acids in melon fruits are succinic acid, malic acid and citric acid (Wang et al. (1996) J. Agric. Food Chem. 44: 210-216). Malic acid tends to be associated either with very unripe phases or with senescence and degenerative phases of fruit over-ripening, and its dominance in the taste is generally not preferred. In the fruit flesh, gradients of increasing malic acid contents are observed from close to the seed cavity to close to the fruit rind. Citric acid has a lower pKa than malic acid. Citric acid has more tart and a clean effect, which often overpowers other taste or aromas notes. In contrast to malic acid, fruit flesh gradients of decreasing citric acid contents are observed from more ripe areas close to seed cavity to areas close to the fruit rind. Such a gradient is also observed for sugars.
- Thus, in melon fruits of the instant invention, higher sugar contents and high citric acid contents tend to be associated in the fruit flesh to provide high contents of both in the most flavorful areas of the fruit, resulting in a very pleasant new taste.
- Also, in the melon fruits of the instant invention, the sour perception is higher when the pH is low and the citric acid content high.
- In one embodiment, fruits according to the instant invention were tested by an Expert panel of trained tasters. Sensory characteristics of the fruits were measured on a scale of quotation from 0 to 9. The pH, organic acid contents and sugar contents of the fruits were also measured. The results of the Expert panel are described in Example 12, Tables 14 and 15. The sensory analysis shows that the acid savor in fruits of the instant invention is a function of the pH and of the citric acid content in the fruit. Based on data gathered from mature and unripe fruits, the Expert panel determined the following formula for the correlation between the acid savor and pH and citric acid contents in a fruit: Acid savor=13, 12−(2.97×pH)+(0,00587×citric acid content (mg/100 g fwt)), with r2=0.70.
- Accordingly, in one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor above about 0.5 as determined by an Expert panel. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 or above. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor above about 0.5 and a sugar savor of about 4.3 or above. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.8 and a sugar savor of about 4.3 to about 5.8.
- In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 2.5 to about 3.8 and a sugar savor of about 4.3 to about 5.6. Hybrids YUSOL X SOLAZ and Mehari X L53 AZ B are representative examples of such plant.
- In one embodiment, such fruit comprises a pH and citric acid content as described herein. In one embodiment, the present invention discloses a C. melo plant capable of producing fruit comprising an acid savor of about 1.6 to about 3.0 and a sugar savor of about 5.2 to about 5.8. Hybrids YUSAZ X YUSOL, Mehari X L53 AZ A and TD X L53 AZ A are representative examples of such plant.
- In one embodiment, such fruit comprises a pH and citric acid content as described herein. In one embodiment, such fruit comprises a pH, organic acid contents and compositions and sugar contents and compositions as described herein.
- It is understood that values of Expert panels vary depending on the pH, citric acid content and sugar content of a fruit.
- The inventors of the present invention have screened melon entries and accessions for the content in citric acid and sugars and compositions and have determined variations within C. melo types (see Table 2). For example, some Charentais-type melons were found to have low citric acid contents (for example Lunastar in Table 2). Some Charentais type fruits were also found to have a relatively low citric acid to malic acid ratio and a high ratio of sucrose to hexoses. On the other hand, Oriental-type melons, such as Japanese rocky types melon, were found to have higher contents in citric acid (for example YUCA in Table 2). A representative of YUCA has been deposited with NCIMB, Aberdeen, AB24 3RY, Scotland on Dec. 17, 2003 as YUC-15 under Accession number NCIMB 41203. These melons were also found to have high ratios of citric acid to malic acid and high ratios of hexose to sucrose. Some Galia type melons, such as MG 755, were also found to have high citric acid contents. Surprisingly, according to the present invention, in a cross between a Japanese-type melon and a Charentais-type melon (Prince PF in Table 2), the high citric acid content of the Japanese-type melon could be disssociated from the high hexose to sucrose ratio and combined with the high sucrose to hexose ratio of the Charentais-type melon. The invention further recognized that variations in citric acid contents also exist among non-sweet accessions such as Faqqous and IND-35 (low citric acid content in Faqqous when compared to IND-35, table 2).
- Also, although it was generally assumed in the art that low pH and high sugar accumulation were not frequent or even compatible in the same melon fruit (Stepanski et al (1999)), the inventors of the present invention have been able to combine that characteristics of pH and organic acid described above with desired sugars contents in the fruits (see e.g. Table 3).
TABLE 2 Variation in citric acid contents in various melon types and varieties (Fruit analysis data trial Sarrians August 1997) No. Citric acid Sucrose Hexoses Glucose Fructose Total Sugar Name fruits Ri pH (mg/100 g) (g/100 g) Glucose (g/100 g) (g/100 g) (g/100 g) Lunastar (Charentais) 6 11.8 6.8 159 6.7 3.2 1.6 1.6 9.2 Yuca-18-3-8 8 10.5 6.7 286 3.8 4.2 2.3 1.9 8.0 MG 755 OA 4 6.8 294 11.4 3.7 2.1 1.7 15.1 Prince PF (Japanese X 5 6.1 438 10.0 3.3 1.2 2.1 13.3 Charentais) Sancho 4 409 3.7 4.1 2.1 1.9 7.8 Fagouss Egypt 10 3.8 5.6 35 0.1 1.9 0.9 1.0 1.9 Fagouss Jim MC Greigt 6 3.3 5.2 62 0.1 2.1 0.9 1.2 2.2 Fagouss Jordany 11 3.7 5.1 125 0.1 2.1 0.9 1.2 2.2 IND35-1 8 4.5 4.9 340 0.6 3.4 1.8 1.7 4.0
Ri: Brix, refractometer index, measuring soluble solids
-
TABLE 3 Sugar accumulation vs. pH Statistical analysis of sugar accumulation (brix) versus pH in F2 populations of a cross between IND-35 and YUCA or OGEL (Agadir'98). The analysis shows no negative correlation between brix values and the pH. pH < 5.5 pH > 5.5 ANOVA RI(Brix) pH RI(Brix) pH P = 0.05 IND35/YUCA-15 NR plts 68 68 22 22 P = 0.98 F2 Maximum 13.00 5.40 13.60 7.00 No Significant Average 8.03 4.53 8.01 5.85 Difference Std. Deviation 2.34 0.30 2.72 0.37 in brix Minimum 2.40 3.80 2.40 5.50 Populations IND35/OGEL-17 NR plts 98 98 39 39 P = 0.65 F2 Maximum 13.00 5.45 12.20 7.50 No Significant Average 7.75 4.70 7.93 5.97 Difference Std. Deviation 2.16 0.33 1.89 0.35 in brix Minimum 2.80 3.90 4.20 5.50 Populations IND.35 NR plts 29 29 Maximum 7.60 5.40 Average 5.45 4.63 Std. Deviation 1.18 0.31 Minimum 3.00 4.10 - The present invention further discloses the incorporation of a low pH trait in sweet C. melo backgrounds. The presence of the low pH trait in sweet C. melo backgrounds allowed to lower the pH and increase concentrations of organic acids in the fruit flesh and to combine desirable pH and citric acid contents with appropriate sugar concentrations and contents, resulting in pleasant, new tastes.
- In one embodiment, a low pH trait is determined by a low pH gene. In one embodiment, a low pH gene is obtained from a wild melon accession or cultivar. In one embodiment, a wild melon accession or cultivar used as donor for the low pH gene comprises traits that facilitate the construction of commercial melons with acceptable agronomic characteristics and producing fruits with desirable taste. In one embodiment, such donor has the ability to accumulate relevant levels of sugars, such as sucrose. In one embodiment, such wild melon accession or cultivar has at least one of the following characteristics: non climacteric behavior, relative bigger fruit size and mesocarp component, crispy flesh.
- In one embodiment, the low pH trait is obtained from line IND-35, representative seeds of which was deposited with NCIMB, Aberdeen, AB24 3RY, Scotland on Dec. 17, 2003 under Accession Number NCIMB 41202. This is a C. melo accession from India, which could be classified within botanical Var. chito, but it may be better classified as var. acidulus (Naudin, Pitrat et al.) because of its bigger size.
- Citric acid is the main organic acid in the fruits of line IND-35 (up to 911 mg citric acid per 100 g fwt), while malic acid contents are below 50 mg per 100 g fwt. Surprisingly, fruits of IND-35 also have the ability to accumulate relevant levels of sucrose (up to 1.7 g sucrose per 100 g fwt and 5.6 g total sugars 100 g fwt after long fruit cycles, i.e after late harvest 50 or 53 days after fruit set). Table 2 also reports analysis of fruits of IND-35 showing a pH of about 4.9, a citric acid content of about 340 mg/100 g fresh weight (fwt), and a sugar content of about 4.0 g/100 g fwt.
- In one embodiment, the low pH trait co-segregates with a molecular marker. In one embodiment, a molecular marker is a DNA fragment amplified by PCR, e.g. a SSR marker or a RAPDS marker. In one embodiment, the presence or absence of an amplified DNA fragment is indicative of the presence or absence of the trait itself or of a particular allele of the trait. In one embodiment, a difference in the length of an amplified DNA fragment is indicative of the presence of a particular allele of a trait, and thus enables to distinguish between different alleles of a trait. In one embodiment, the instant invention discloses markers, which distinguish between different sources of low pH trait, and for the presence or absence of a low pH trait in a plant. For example, such marker is CMAT 141, described in Danin-Poleg et al. (2001) Theor. Appl. Genet. 102: 61-72 and Danin-Poleg et al. (2002) Euphytica 125: 373-384. Other examples of molecular markers are NE0585 and NE1746 disclosed herein (see Example 13). These markers are closely linked to the locus of the pH gene. Markers CMAT141 and NE0585 are on one side of the low pH gene, while marker NE1746 is on the other side of the low pH gene.
- In one embodiment, the inventors of the instant invention have determined that various sources of low pH trait amplify DNA fragments of different length when the primers for the markers are used (acid fragments, see Example 14, Table 16). For example, in plants of Faggous as fragment of about 176 bp is amplified using for CMAT141. In plants of accessions PI414723, PI414724, PI161375 and PI124112 a fragment of about 175 bp is amplified. In contrast, in plants of IND-35, described herein, unique fragments of about 168 bp and of about 173 bp are amplified. Using marker NE0585, unique fragments of about 230 bp and about 232 bp are amplified for IND-35. Using marker NE1746, a unique fragments of about 127 bp is amplified for IND-35. Another fragment of about 124 bp is amplified for IND-35, which is for example absent in Faggous.
- In one embodiment, plants not comprising the low pH trait were also analyzed using the primers described herein. A number of DNA fragments associated with the absence of the low pH trait were determined (basic fragments). For example, using the primers of CMAT141, fragments of about 169 bp, about 172 bp and about 178 bp long were detected in plants not comprising a low pH trait. Using the primers of NE0585, fragments of about 218 bp, about 229 bp, about 234 bp and about 239 bp long were detected. Using the primers of NE1746, fragments of about 133 bp, about 142 bp and about 145 bp long were detected. The skilled person would know how to analyze further plants not comprising the low pH trait and determine additional DNA fragments associated with the absence of the low pH trait. The indicated sizes (in bp) are not absolute but relative to the other size products detected with the same primer pair. The real (exact) size of the amplified fragments (e.g. determined by sequencing) could be slightly different (+/−1 bp) of those indicated herein.
- Accordingly, in one embodiment, the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a DNA fragment described herein using the primers described herein. In one embodiment, a DNA fragment of about 168 bp to about 178 bp is amplified from the DNA of said plant when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of 168 bp, 173 bp, 169 bp, 172 bp or 178 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 176 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of less than 175 bp is amplified when the primers capable of identifying the CMAT141 marker are used. In one embodiment, a DNA fragment of about 218 bp to about 253 bp is amplified when the primers capable of identifying the NE0585 marker are used. In one embodiment, a DNA fragment of 230 bp, 232 bp, 218 bp, 229 bp, 234 bp or 239 bp is amplified when the primers capable of identifying the NE0585 marker are used. In one embodiment, a DNA fragment of about 121 bp to about 145 bp is amplified when the primers capable of identifying the NE 1746 marker are used. In one embodiment, a DNA fragment of 124 bp, 127 bp, 133 bp, 142 bp or 145 bp is amplified when the primers capable of identifying the NE1746 marker are used.
- In one embodiment, the inventors of the instant invention have separated the link between a DNA fragment indicative of a low pH trait and a low pH gene. In this case, a DNA sequence, which is a template for amplification of a basic fragment, is linked to a low pH trait. Accordingly, in one embodiment, the instant invention discloses a plant comprising a low pH trait co-segregating with markers indicative for a basic allele, in particular when using the markers disclosed herein. In one embodiment, a marker on one side of the pH gene is basic. In one embodiment, markers on both sides of the pH gene are basic. In one embodiment, fruits of such a plant comprise a pH within the ranges disclosed herein. In one embodiment, fruits of such a plant comprise the contents and compositions of sugars as described herein. In one embodiment, fruits of such a plant comprise the contents and compositions of organic acids as described herein. In one embodiment, fruits of such a plant comprise the pH, contents and compositions of sugars and contents and compositions of organic acids as described herein.
- Accordingly, in one embodiment, the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a basic DNA fragment, linked to a low pH gene. In one embodiment, the present invention discloses a C. melo plant comprising a chromosome fragment comprising a DNA sequence, which is a template for amplification of a basic DNA fragment and a low pH gene. In one embodiment, such chromosome fragment is heterozygous or homozygous in said plant. Line SOLAZ/2 described herein is a representative example of such a C. melo plant. In SOLAZ/2, fragments of about 172 bp, about 229 bp and about 124 bp are amplified using the primers of markers CMAT141, NE0585 and NE1746, respectively.
- In one embodiment, the present invention discloses a C. melo plant comprising a DNA sequence, which is a template for amplification of a basic DNA fragment, on one side of a low pH gene, a low pH gene, and a DNA sequence, which is a template for amplification of a basic DNA fragment, on the other side of the low pH gene, wherein both DNA sequence are linked to the pH gene in said plant. In one embodiment, the present invention discloses a C. melo plant comprising a chromosome fragment comprising a DNA sequence, which is a template for amplification of a basic DNA fragment, on one side of a low pH gene, the low pH gene and a DNA sequence, which is a template for amplification of a basic DNA fragment, on the other side of the low pH gene. In one embodiment, such chromosome fragment is heterozygous or homozygous in said plant. Line SOLAZ/1 described herein is a representative example of such a C. melo plant. In SOLAZ/1, fragments of about 172 bp, about 239 bp and about 142 bp are amplified using the primers of markers CMAT141, NE0585 and NE1746, respectively. Line YUSOL/3 described herein is another representative example of such a C. melo plant. In YUSOL/3, fragments of about 172 bp, about 239 bp and about 145 bp are amplified using the primers of markers CMAT141, NE0585 and NE1746, respectively.
- Accordingly, the present invention discloses the use of a melon plant comprising a low pH trait to obtain a melon plant of the present invention. In one embodiment, the melon plant comprising a low pH trait further has the ability of accumulating relevant levels of sugars, for example sucrose. In one embodiment, the melon plant comprising a low pH accumulates high levels of citric acid. In one embodiment, the melon plant comprising a low pH accumulates low levels of malic acid. In one embodiment, the melon plant comprising a low pH is a plant of line IND-35 or a descendent thereof.
- In one embodiment, the low pH trait is obtained from a descendent of said line IND-35. The skilled person recognizes that a low pH trait can also be obtained from other sources. In one embodiment, the low pH trait in such other sources is allelic to the low pH trait in IND-35. In one embodiment, a test is conducted to determine whether a line to be tested for a low pH gene comprises an allelic gene to that of line IND-35. Line IND-35 is used as a tester line in a cross with a line to be tested and the segregation ratio of the low pH phenotype is determined in the resulting progeny.
- In one embodiment, a plant of line IND-35 is crossed with breeding melon lines, preferably having high citric acid contents and high levels of sugar. After each cross plants producing fruits having low pH are selected. Selection is also carried out for increased citric acid contents and high sugar contents. Examples of the introduction of the low pH trait into elite lines are disclosed in Examples 7-11.
- In one embodiment, a molecular marker as disclosed hereinabove is used to transfer the pH trait in a desired background, in particular in method of increasing the citric acid content of a fruit of a melon plants as described herein. In one embodiment, plants for which a fragment corresponding to a low pH trait is amplified are selected and further used.
- In one embodiment, a reduction of about 1 to about 2.5 pH units, in one embodiment about 1.5 to about 2.0 pH units, is obtained after the introduction of the low pH trait in a sweet C. melo plant, when compared to fruits of a melon not comprising the low pH trait, for example when compared to an isogenic or near-isogenic line not comprising the low pH trait. In one embodiment, the citric acid content in the flesh of a melon plant is multiplied by a factor of about 1.5 to about 3 upon introduction of a low pH trait in said melon plant, when compared to fruits of a melon not comprising the low pH trait, for example when compared to an isogenic or near-isogenic line not comprising the low pH trait. Mature fruits of the various plants are compared. For example, Table 1A and 1B show comparisons between melon comprising a low pH trait and melons not comprising a low pH trait, for example between YUSAZ X YUSOL and MILENIUM-DENEV F1, SOLAZ X YUSOL and SOLAR F1, Mehari/L53-L53 AZ A-L53 AZ B.
- Accordingly, melon fruits of the present invention have higher concentrations of organic acids than comparable currently available melons not comprising the low pH trait (titratable acidity). In melon fruits of the present invention, variations in pH are more correlated with the composition (pKa of dominant acids) than with total concentration of organic acids. An increase in pH is generally observed during the late ripening process, and is concurrent with sucrose accumulation. This increase in pH is buffered by the content in organic acids. Low contents in organic acids result in high increases in pH and reduction in sour taste perception. For example, in melons with low citric content as some currently available Charentais-type melons, for example of climacteric turning type, this increase in pH can be over 1.0 pH unit (from pH 6.0 to 7.0). By contrast, higher contents in organic acids lead to reduced pH increases during the ripening process, and thus prevent or reduce the decline in sour taste perception, as for example in less climacteric, less turning melons.
- Accordingly, in one embodiment, the present invention discloses melons fruits with more stable sour tart taste based on stable low pH and high citric acid content. In one embodiment, the present invention discloses melons fruits with an improved stability of the taste after ripening or post-harvest. The present invention also discloses a method of delaying or reducing the increase in pH in the fruit of a melon plant comprising increasing the content of organic acids in said fruit and introducing a low pH trait in a melon plant. In one embodiment, such method comprises introducing the low pH trait in a plant with low or non climacteric behaviour. In one embodiment, such method comprises introducing the low pH trait in a plant capable of producing a low or non turning fruit.
- In one embodiment, the present invention also discloses melons fruits, which mature from an initial early ripe mild sour taste to a fruity and full flavored taste based on a moderate increase of pH (up to 0.5 pH units) and moderately elevated citric acid contents.
- According to the present invention, a low pH trait is introduced in melon plants producing fruits with various contents and composition of sugars. In one embodiment, plants from the Japanese-Oriental type, such as YUCA, are used as a source of sugars. It is generally observed that accumulation of sugars, particularly sucrose, is a question of fruit cycle time understood as days after pollination, from fruit setting to fruit ripening. In one embodiment, melon plants producing fruits having an early and relevant sugar accumulation are used in the instant invention. For example, plants of the Galia type, such as cultivar OGEL, are used as a source of sugars. In one embodiment, melon plants producing fruits having potential for a high and fast accumulation of sucrose independently from the initial levels of hexoses are used in the instant invention. For example, plants of the Charentais type, such as L53, are used as a source of such a potential for sucrose accumulation.
- Examples of the transfer of a low pH trait to elite lines are disclosed in the Examples below. Table 8 below also discloses melon plants obtained during the transfer to elite lines. However, other types of melons or other melons cultivars or varieties of the types mentioned above are used in the context of the present invention to construct melon plants according to the instant invention.
- In one embodiment, a C. melo plant comprising a low pH trait is crossed to a C. melo plant of the Oriental type or of the Galia-type. For example the C. melo plant comprising a low pH gene is line IND-35. For example, the C. melo plant of the Oriental type is YUCA, and the C. melo plant of the Galia-type is OGEL, as described in Example 7 below. The resulting progenies are for example further crossed to C. melo plants of the Oriental type or of the Galia-type to obtain desired pH and contents and compositions of organic acids and sugars. This process is assisted by measurement of pH, organic acids and sugars, as disclosed herein. Alternative C. melo plants of the Oriental type or of the Galia-type can also be screened for desired characteristics and used as starting materials to obtain C. melo plants as described herein.
- In one embodiment, a C. melo plant comprising a low pH trait is crossed to a C. melo plant of the Charentais-type, such as L53 as described in Example 11. Alternative C. melo plants of the Charentais-type can also be screened for desired characteristics and used as starting materials to obtain C. melo plants as described herein.
- Other types of C. melo plants are also crossed to a C. melo plant comprising a low pH trait to obtain melo plants as described herein.
- In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable after a fruit reaches maturity and is kept on the plant or when the fruit is harvested and kept in sotrage. In one embodiment, the characteristics of a fruit described herein remain stable during the commercial post-harvest life of the fruit. This allows storing or shipping a fruit of the present invention for extended periods of time without loosing its organoleptic characteristics and aromas.
- In one embodiment, the pH of a fruit of the instant invention remains stable after a fruit reaches maturity. In one embodiment, the pH of a fruit of the instant invention remains within a range of about 4.2 to about 5.6. after a fruit reaches maturity. In one embodiment, the citric acid content of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the citric acid content of a fruit of the present invention remains at or above 400 mg per 100 g fwt after a fruit reaches maturity. In one embodiment, the malic acid content of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the ratio citric acid to malic acid of a fruit of the present invention remains stable after a fruit reaches maturity. In one embodiment, the ratio citric acid to malic acid remains greater than 4.4 after a fruit reaches maturity. In one embodiment, such characteristics remain with the ranges described herein after a fruit reaches maturity. In one embodiment, these characteristics remain on within about 70% to about 130% of the values of the characteristics measured when the fruit reaches maturity, in one embodiment within about 80% to about 120% of the values of the characteristics measured when the fruit reaches maturity, in one embodiment within about 90% to about 110% of the values of the characteristics measured when the fruit reaches maturity. In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable after a fruit reaches maturity when kept on the plant, or when harvested and kept in storage In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 2 days when the fruit is kept on the plant, in one embodiment for at least 3 days when the fruit is kept on the plant, in one embodiment for at least 4 days when the fruit is kept on the plant. In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 5 days when kept in storage at 20° C., in one embodiment for at least 7 days when kept in storage at 20° C., in one embodiment for at least 9 days when kept in storage at 20° C. In one embodiment, the present invention discloses a plant capable of producing a fruit, the characteristics of which remain stable for at least 7 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 12 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C., in one embodiment for at least 26 days when kept in storage at 8-12° C. followed by at least 2 days at 20° C. Typically, after its harvest a fruit may remain under field conditions for several hours until its is stored in the conditions set forth herein.
- Examples of the evolution of the characteristics of a fruit of a plant of the present invention when kept on the plant are shown in Example 15, Table 17. Examples of the evolution of the characteristics of a fruit of a plant of the present invention after post harvest storage are shown in Example 16, Tables 18 and 19.
- In one embodiment, melons can be described as short shelf life (SLS), medium shelf life (MSL) or long shelf life (LSL). Examples of LSL melons are Milenium, Piel de Sapo, Italo and non turning Charentais LSL. Examples of MSL melons are Galia and turning Charentais MSL. Examples of short shelf life (SSL) melons are classical Charentais.
- Typically, the life of a fruit of a SSL melon on the plant is about 1 to about 2 days. This means that fruits have to be harvested about every 1 to 2 days to avoid losses. Typically, the life of a fruit of a MSL melon on the plant is about 3 to about 4 days. This means that fruits are harvested about every 3 to 4 days to avoid losses. Typically, the life of a fruit of a LSL melon on the plant is more than about 5 days Typically a SSL melon can be stored for about 4 to about 7 days at 8-12° C. followed by an aditional 2 days at 20° C., or for about 3 to 4 days at 20° C. Typically a MSL melon can be stored for about 7 to about 12 days at 8-12° C. followed by an aditional 2 days at 20° C., or for about 5 to 10 days at 20° C. Typically a LSL melon can be stored for more than about 12 days at 8-12° C. followed by an aditional 2 days at 20° C., or for more than about 10 days at 20° C.
- In one embodiment, a plant of the instant invention is capable of producing a long shelf-life fruit (LSL) or a medium shelf-life fruit (MSL).
- The inventors of the present invention have determined that the low pH trait and high citric accelerates the climacteric rise in a melon fruit after a fruit reaches maturity, especially in turning and climacteric melons. This leads to degration of the fruit for example shown by a rapid increase in pH and malic acid content and a decrease in citric acid content. This is also shown by the appearance of mealy texture and alcoholic degradation. In turning and climacteric melons, the shelf life of the fruit is reduced, while this phenomenon is less perceptible in non-turning or/and non-climacteric melons. Accordingly, in one embodiment, a plant of the present invention is of a non-turning or low turning melon genotype. In one embodiment, a plant of the present invention is capable of producing a non-climacteric or low-climacteric fruit.
- Accordingly, in one embodiment, the present invention discloses a C. melo plant with low or non-climacteric behaviour comprising a low pH gene. In one embodiment, a fruit of such C. melo plant further comprises the characteristic of sugar contents and compositions described herein. In one embodiment, a fruit of such C. melo plant further comprises the characteristic of organic acid contents and compositions described herein. In one embodiment, a fruit of such C. melo plant comprises a ratio of citric acid to malic acid as described herein. In one embodiment, a fruit of such plant further comprises a pH as described herein.
- In one embodiment, the present invention discloses a C. melo plant capable of producing a low-turning or non-turning fruit, wherein said plant comprises a low pH gene. In one embodiment, a fruit of such C. melo plant further comprises the characteristic of sugar contents and compositions described herein. In one embodiment, a fruit of such C. melo plant further comprises the characteristic of organic acid contents and compositions described herein. In one embodiment, a fruit of such C. melo plant comprises a ratio of citric acid to malic acid as described herein. In one embodiment, a fruit of such plant further comprises a pH as described herein.
- In one embodiment, the inventors of the instant invention have identified that a low pH in the flesh of a melon fruit is associated with a very poor color intensity of the flesh of fruits with orange flesh. In particular, in the case of melon plants producing fruit with orange flesh, a slightly orange or pale orange color was observed (see e.g. Table 4). Surprisingly, the inventors of the present invention have been able to combine low pH and deep orange color in the fruit of a melon plant.
- Table 4 shows that the color intensity of the fruits of line L53, a parent of Syngenta hybrid MEHARI, is deep to very deep orange (average of 5.17). Plants originating from a back-cross program to introduce the low pH trait in L53 but not comprising the low pH trait (L53*High pH) showed a slight decrease in both color intensity and pH (4.71 and 6.46). Plants originating from the back-cross program and comprising the low pH trait showed a further decrease in color intensity and pH. Plants with the low pH trait in homozygote stage (L53*Low pH) had the lowest rate for orange flesh color: 4.04. Plants with the low pH trait in heterozygote stage (L53* acid) have the intermediate rate for orange flesh color: 4.36. This indicates a linkage or phenotypic effect between low pH and pale orange flesh color. Plants were therefore selected for intense orange flesh color in presence of the low pH trait (rated in one embodiment at 4 or higher in the scale below, in one embodiment at 5 and higher, in one embodiment at 6).
- In one embodiment, the present invention discloses a C. melo plant capable of producing fruit with pH of about 4.5 to about 5.6, wherein said fruit has orange flesh rated 4 or higher. In one embodiment, the orange color of said fruits is rated 5 and higher, in one embodiment 6. In one embodiment, the pH of said fruit is about 4.5 to about 5.4, in one embodiment about 4.8 to about 5.2. In one embodiment, said fruit comprises about 400 mg to about 900 mg citric acid per 100 g fwt. In one embodiment, the fruit comprises about 450 mg to about 750 mg citric acid per 100 g fwt. In one embodiment said fruit comprises a sugar content equal or above about 5 g per 100 g fwt, in one embodiment about 5.0 g to about 13.0 g sugar per 100 g fwt. In one embodiment, the fruit comprises about 6.0 g to about 12.0 g sugar per 100 g fwt. In one embodiment, the ratio citric acid to malic acid in said fruit is between about 4 and 30, in one embodiment between about 5 and about 15. In one embodiment, the ratio sucrose to hexoses in a fruit of said plant is about 1:1 and about 1:2.
- A scale of: 1: white, 2: slightly orange, 3: pale orange, 4: orange, 5: deep orange, 6: very deep orange was used for the color rating (see table 4). In one embodiment, the color of the fruit is assessed using a spectrophotometer, such as a Minolta CM-2500d spectrophotometer.
TABLE 4 % of flesh colour intensity class per Fruits Pale Orange Deep Orange Nr. 2 3 4 5 6 Col avg 5 True L53 83% 17% 5.17 14 L53*High pH 29% 71% 4.71 91 L53* acid 0% 7% 55% 34% 4% 4.36 244 L53* low pH 2% 19% 48% 27% 3% 4.04 pH average per flesh colour intensity class Fruits Pale Orange Deep Orange Nr. 2 3 4 5 6 pH avg 5 True L53 6.90 6.64 6.85 14 L53*High pH 6.28 6.53 6.46 91 L53* acid 4.75 4.81 4.87 4.94 4.83 244 L53* low pH 4.53 4.64 4.76 4.73 4.65 4.72
“L53* acid”: means acid phenotype excluded proved fix Low pH homozigotes
- In one embodiment, characteristics of melon fruits of the present invention are measured on fruits harvested at maturity, i.e. mature or ripe fruits. The concrete composition of a melon fruit, and therefore its taste, is affected by the ripening stage, at which it is harvested. Sugars and organic acids accumulation in melon fruits are dynamic processes. As the fruit is approaching maturity their accumulation starts. As the ripening process advances, each of these compounds follows a time-specific pattern of accumulation or degradation, which is also affected by environmental and growth conditions. The person skilled in the art knows how to recognize a mature melon fruit and understand criteria defining the maturity of a melon fruit.
- In one embodiment, one of the following external maturity markers is used for identification of ripening in sweet melon:
-
- Senescence of the side fruit leaf (the melon fruit sets in flower axillar to the peduncle insertion of one leaf named side leaf fruit). The side fruit leaf becomes necrotic.
- Fruit skin color changes (turning color green to yellow in Galia type, gray to creamy-yellow in Charentais type, or increase in yellow component in Piel de Sapo type).
- Peduncle dehiscence (specially for Shipper melon, less for Charentais, less for Galia).
- Decline in fruit shell firmness, particularly in the blossom end area.
- In one embodiment, “maturity” includes the ripening physiological process between the stages identified as “2” for “Early-Partial mature” and “4” for “Late-Fully mature”. In one embodiment, the Early-Partial mature stage in melons is identified with the initial accumulation of sucrose contents at or over 2 g per 100 g fwt of sucrose. In one embodiment, this is associated with the peaking of citric acid and reducing sugars (glucose plus fructose) contents, and a typical ripe fruit flesh pigments and texture. In one embodiment, the Late-Fully mature stage in melons is defined with the end of peaking sucrose sugars contents. It is also defined as before the degradation process starts, such as loss of fruit flesh consistency, fast declines in glucose, citric acid contents or increases in malic acid contents. Accordingly, in one embodiment, maturity of a fruit starts when the sucrose content in the fruit reaches 2 g per 100 g fwt. In one embodiment, maturity lasts until no more increase in sucrose content is observed.
- The measurements disclosed herein are usually averages of measurements or data taken from a number of fruits. It is understood that, in any sample, individual fruits of a plant or fruits from individual plants do not lie within the ranges described, because of variations generally observed while growing melon plants. In one embodiment, the characteristics of melon fruits described herein are measured using fruits grown in the conditions described herein or under similar conditions (e.g. in Example 6, Tables 5-7 below). In one embodiment, a figure for a characteristic according to the instant invention is an average taken from fruits grown from plastic house staked plants (one fruit per plant in staked plants).
- In one embodiment, a plant of the instant invention is an inbred line, a dihaploid or a hybrid. In one embodiment, an inbred line comprises a low pH trait and the characteristics of organic acids, pH and sugars described herein. In this case, such inbred line is crossed with another melon plant, preferably another inbred line, to obtain a hybrid plant according to the instant invention. In one embodiment, the other inbred line in the cross is also capable of producing fruit having high citric acid contents and/or high sugar contents. Representative inbred lines according to the present invention are disclosed in Table 1A.
- In one embodiment, a plant of the instant invention is a hybrid plant. In this case, some of the characteristics of low pH, high citric acid content and high sugar content are contributed from one of the parent, while the remaining ones are contributed by the other parent. In a one embodiment, one parent in the cross produces fruit having high citric acid content, high sugar content but having high pH (e.g. around pH 6.5), while the other parent in the cross produces fruit having low pH. In one embodiment, fruits of the other parent also have high citric acid content. Representative hybrids according to the present invention are disclosed in Table 1B. As used herein, the term “plant” includes plant cells, plant protoplasts, plant cell of tissue culture from which melon plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants, such as pollen, flowers, leaves, stalks, and the like. In one embodiment, a plant of the instant invention is capable of producing edible melon fruits. The mesocarp represents the edible part of the melon fruit (flesh). The mesocarp surrounds the seed cavity, which is itself surrounded by the rind (or shell). The mesocarp of a fruit according to the present invention preferably has a thickness of more than 2 cm and preferably represents more than 50% of the total fruit fresh weight. In one embodiment, the flesh of a fruit of a melon plant of the present invention has a green, white, yellow or orange flesh.
- In one embodiment, the present invention provides regenerable cells for use in tissue culture of a plant of the present invention. The tissue culture is capable of regenerating plants having the characteristics of a plant of the present invention. Preferably, the regenerable cells in such tissue cultures are immature embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, or flowers. Still further, the present invention provides melon plants regenerated from the tissue cultures of the invention. Examples of regeneration protocols are disclosed in U.S. Pat. No. 6,420,631. The present invention further provides a method of asexually propagating a plant of the present invention comprising collecting a tissue of a plant of the present invention, cultivating said tissue to obtain proliferated shoots, rooting said proliferated shoots to obtain rooted plantlets. The present invention further discloses a method to produce seed of a plant according to the instant invention comprising obtaining a plant of the present invention, self-pollinating said plant or crossing said plant with another melon plant, and harvesting progeny seed. The present invention further discloses a method for producing a fruit comprising planting a plant according to the present invention, growing said plant and harvesting a fruit, wherein said fruit comprises the characteristics described herein. The method further comprises storing said fruit, for example as described herein. The method further comprises shipping said fruit. In one embodiment, the characteristics of said fruit described herein remain stable during the storage of said fruit. In one embodiment, the characteristics of said fruit described herein remain stable during the storage of said fruit.
- Some charateristics of a number of C. melo types and lines are described below. These characteristics are examples for the various melon types and lines, and are not meant to be limiting but are illustrative of the various melon types and lines. Variations from these characteristics may occur.
- Melon Type Charentais:
- Fruit: Shape round to hight round; Size 600 to 1200 grs; Rind: White-Gray with Green-Gray sutures, smooth skin (smooth or slightly netted skin). Orange, melty, very aromatic sweet flesh, climacteric. Some Charentais varieties have reduced climateric phase and not turning rind colour.
- Var LUNASTAR: Lunastar is monoecious hybrid from Nunhems in Charentais type.
- Melon Type Japanese:
- Fruit: Shape round to hight round; Size 700 to 1500 grs; Rind: White-Gray netted skin, (exceptionally sutured). Green-Yellow (exceptionally orange), from cryspy to melty and few aromatic and very sweet flesh, only in cases. Long cycle non climacteric.
- Var YUCA: Andromonoecious hybrid in Japanese type green flesh.
- Var PRINCE: Andromonoecious hybrid in Japanese type orange flesh.
- Melon Type Galia:
- Fruit: Shape round to hight round; Size 600 to 1500 grs; Rind: Green tuning yellow netted skin. Green-White, melty, aromatic sweet flesh. Short cycle Medium shelf life, climacteric. Var MG.755: Andromonoecious hybrid in Galia type. Very short fruit cycle with high brix.
- Melon Type Piel De Sapo:
- Fruit: Shape Ovoid to oblong-eliptic; Size 2 to 5 Kgrs; Rind: Golden Green spotted, few longitudinal netted skin. White, crispy, juicy and aromatic sweet flesh. Medium fruit cycle Long shelf life, Non climacteric.
- Var Sancho:Andromonoecious hybrid in Piel de sapo type. Golden rind with high brix.
- Melon type Fagous:
- Fruit: Shape Medium short cilindrical; Size 300 to 1000 grs; Rind: Green skin. White, crispy, non sweet flesh. For comsumption green in salad. Monoecious
- IND 35: Fruit: Shape Long pear-ovoid; Size 300 to 1000 grs; Rind: Light Green spoted skin yellow at maturity. White, crispy, non sweet flesh. For consumption green in salad. Monoecious. Syngenta Seeds line, non climacteric.
- YUSOL: Shape round to hight round; Size 600 to 1300 grs; Rind: Yellow few netted with light green sutures skin. Green-white, melty, few aromatic sweet non acid flesh. Short cycle Medium shelf life, non turning low climacteric. Andromonoecious Syngenta Seeds Line.
- YUSAZ A: Shape round to hight round; Size 600 to 1300 grs; Rind: White-gray few netted with Green-Gray sutures skin. Green, specially crispy, few aromatic, sweet and acid flesh. Short cycle Medium-long self life, non turning, low to medium climacteric. Andromonoecious Syngenta Seeds Line.
- YUSAZ B: Shape round to hight round; Size 600 to 1300 grs; Rind: Yellow netted with Green-Gray sutures skin. Green, specially crispy, few aromatic, sweet and acid flesh. Long cycle, long self life, non turning low climacteric. Andromonoecious Syngenta Seeds Line.
- MILENIUN-DENEV: Shape round to hight round; Size 600 to 1500 grs; Rind: Yellow netted non sutured skin. Green-White, crispy, non aromatic, non acid and sweet flesh. Long cycle, non turning, long self life, non climacteric. Andromonoecious Syngenta Seeds Hybrid.
- SOLAZ/1: Shape round to hight round; Size 700 to 1400 grs; Rind: Yellow few netted with light green sutures skin. White, crispy, few aromatic sweet and acid flesh. Short cycle, long self life, non turning, very low climacteric. Andromonoecious Syngenta Seeds Line.
- SOLAZ/2: Shape round to hight round; Size 600 to 1300 grs; Rind: Yellow few netted with light green sutures skin. White, crispy, few aromatic sweet and acid flesh. Short cycle long self life, non turning, very low climacteric. Andromonoecious Syngenta Seeds Line.
- MEHARI: monoecious hybrid from Syngenta in Charentais type. Turning medium shelf life.
- L53: andromonoecious line from Syngenta in Charentais type. Turning medium shelf life. Small size round flat shape. Derived from var LUNASTAR, a monoecious hybrid of Nunhems in turning Charentais type.
- TD: monoecious line from Syngenta in Charentais type. Non turning and long shelf life. Derived from var TORNADO, a monoecious hybrid from Limagrain in non turning Charentais type.
- All references cited herein are incorporated by reference in the application in their entireties. When ranges are disclosed herein, it is understood that all the individual numbers falling within these ranges are also part of the invention.
- The following examples are intended to provide illustrations of the application of the present invention. The following examples are not intended to completely define or otherwise limit the scope of the invention.
- Preparation of Melon Extracts
- A wedge of ca. 400 g was taken from a melon fruit, the seeds and the skin (1 cm thickness) were removed. The flesh was cut in small parts, which were blended for 30 seconds in a Warring blender until a smooth slurry was obtained. The slurry was filtrated over a Whatman paper filter, the juice centrifugated in an Eppendorf centrifuge at 10.000 g and stored at −20 degrees Celcius.
- Determination of Citric Acid Content
- Samples as prepared in Example 1 were incubated with citrate lyase (CL) to convert citric acid to oxaloactate and acetate. In the presence of the enzymes malate dehydrogenase (MDH) and lactate dehydrogenase (LDH), oxaloacetate and its decarboxylated derivative pyruvate were reduced with NADH to respectively L-malate and L-lactate. The decrease of NADH is proportional with the quantity of citric acid in the sample and can be determined at 340 nm. The assay was conducted in microplates. 20 μl of diluted sample was added to a microtiterplate. 200 μl of assay mixture containing NADH, MDH and LDH was added and mixed to the plate. The reaction was started with 15 μl of start-solution containing CL. The plate was mixed and let the reaction proceed for 1 hour. Absorbance values were measured at 340 nm with a microtiterplate reader (Biotek EL808 reader with KCJunior software and computer). A calibration curve was used to calculate the concentration citric acid in the samples. The enzymes were purchased from Roche Diagnostics.
- Determination of Malic Acid Content
- Samples as prepared in Example 1 were incubated with L-malate dehydrogenase (MDH) and NAD+ to convert L-malate to oxaloacetate. The equilibrium of the reaction is on the side of malate but was forced to the side of oxaloacetate with hydrazine by means of derivatization. NADH formed during the assay is proportional with the malic acid content in the samples. NADH can be determined at 340 nm as a measure for malic acid. The assay was conducted in microplates. 20 μl of diluted sample was added to a microtiterplate. The reaction was started by adding 200 μl of assay mixture containing hydrazine, MDH and NAD+ at pH 10. The plate was mixed and the reaction was allowed to proceed for 1 hour. Absorbance values were measured at 340 nm with a microtiterplate reader (Biotek EL808 reader with KCJunior software and computer). A calibration curve was used to calculate the concentration malic acid in the samples. MDH was purchased from Roche Diagnostics.
- Determination of Glucose Fructose and Sucrose Contents
- Glucose:
- Glucose was determined with the enzymes hexokinase and glucose-6-phosphate dehydrogenase (G-6-PDH). Glucose was phosphorylated with hexokinase to glucose-6-phosphate (G-6-P) and subsequently dehydrated to 6-phosphogluconate with the aid of NADP and G-6-PDH (reactions 1 and 2, respectively). The concentration of formed NADPH (the H-acceptor) is quantitatively related to the initial glucose concentration and was measured at 340 nm in the UV range of the light spectrum.
- Fructose:
- Fructose was determined in the same assay. Fructose was phosphorylated to fructose-6-phosphate (F-6-P) with the enzyme hexokinase. F-6-P was converted to G-6-P with the enzyme phosphoglucose-isomerase (PGI) and subsequently in 6-PG as described in reaction 2 above.
- Sucrose:
- Sucrose was converted to glucose and fructose with the enzyme β-fructosidase. Formed glucose was determined according to the reactions 1 and 2 as described above. The determinations were conducted in microtiterplates, absorbance values are measured with a microtiterplate reader (Biotek ELx808 with data collection software and computer). Enzymes were purchased from Roche Diagnostics.
- Measurements of pH
- The pH of samples as described in Example 1 was determined using a CRIMSON GLP21 pHmeter calibrated to pH 4 and pH 7 with standard solutions.
- Growth Conditions of Melons Plants
- Melon plants were grown under different conditions at different locations (see table 5 below). The dates of the trials are shown in Table 6 and the growing conditions in the different trial are described in Table 7.
TABLE 5 Description of trials LOCATION IN SPAIN CROP TYPE CONDITIONS TORREPACHECO EL EJIDO VINE BEES STACKED HAND PLASTIC- SUBSTRATE T.St T.St. POLLINATION POLLINATION OPEN FIELD HOUSE SOIL HYDROPONIC FA02PS X X X X SP03PV X X X X SP03PS X X X X SP03OF X X X X SU03PS X X X X FA03PS X X X X
FA: Fall,
SP: Spring,
SU: Summer,
PS: Plastic house staked crop,
PV: Plastic house vine crop
-
TABLE 6 Trial dates TRIAL DATES SOWING TRANSPLANTING 1ST POLLINATION MEDIUM HARVEST FA02PS Aug. 1, 2002 Aug. 19, 2002 Sep. 1, 2002 Oct. 30, 2003 SP03PV Jan. 18, 2003 Feb. 18, 2003 Apr. 4, 2003 May 15, 2003 SP03PS Feb. 18, 2003 Mar. 18, 2003 Apr. 18, 2003 May 30, 2003 SP03OF Mar. 10, 2003 Apr. 11, 2003 May 20, 2003 Jun. 28, 2003 SU03PS Jul. 24, 2003 Aug. 8, 2003 Aug. 20, 2003 Oct. 6, 2003 FA03PS Aug. 7, 2003 Aug. 22, 2003 Sep. 8, 2003 Nov. 3, 2003
Herein, SP03OF1 refers to analytical data of fruits harvested on Jun. 20, 2003. SP03OF2 refers to fruits harvested July 4, 2003.
-
TABLE 7A Growing conditions for FA02PS Location: EL EJIDO T.St. PLASTIC-HOUSE Week no. 2002 29/30/31/32 33/34/35/36 37/38/39/40 41/42/43/44 45/46/47/48 temperature-day 31.5 31 28.6 22.4 18.4 temperature-night 25 23.1 22.4 17.8 14.4 temperature-24 hours 28.8 27.4 25.5 19.8 18 R.Humidity-day % 51 47 55 78 84 R.Humidity-night % 73 72 78 89 90 R.Humidity-24 h. % 60 69 66 84 88
Weeks are numbered starting on January 1, week 29 being the 29th week of the year.
-
TABLE 7B Growing conditions for SP03PV, SP03PS, SU03PS, FA03PS Location: EL EJIDO T.St., PLASTIC-HOUSE Week no. 2003 1/2/3/4 5/6/7/8 9/10/11/12 13/14/15/16 17/18/19/20 21/22/23/24 25/26/27/28 temperature-day 15.9 16.7 25.1 26.9 26.9 31.2 37.4 temperature-night 10.4 11.1 17.9 20.3 21.9 25.6 28.6 temperature-24 hours 12.6 13.5 21.4 23.8 24.8 28.9 33.9 R.Humidity-day % 71 59 46 53 63 54 38 R.Humidity-night % 91 83 64 68 73 67 57 R.Humidity-24 h. % 83 73 55 61 67 59 45 Week no. 2003 29/30/31/32 33/34/35/36 37/38/39/40 41/42/43/44 45/46/47/48 temperature-day 37.1 30.9 25.3 20.8 19 temperature-night 28.5 25.1 21.8 17.9 15 temperature-24 hours 33.5 28.3 23.6 19.2 16.7 R.Humidity-day % 32 60 82 89 86 R.Humidity-night % 46 80 89 96 99 R.Humidity-24 h. % 38 69 86 92 93 -
TABLE 1C Growing conditions for SP03OF TORREPACHECO T.St. OPEN FIELD Week no. 2003 9/10/11/12 13/14/15/16 17/18/19/20 21/22/23/24 25/26/27/28 Temperature Max 28.0 36.0 34.0 33.0 37.0 Temperature avg. Max 19.9 26.2 27.0 28.0 34.5 Temperature Med 14.3 20.1 19.9 22.1 27.1 Temperature avg. Min. 8.8 14.0 12.7 16.2 19.7 Temperature Min. 5.0 8.0 9.0 12.0 17.0 - Transfer of the Low pH Trait to Elite Lines
- 1. Line IND-35 was crossed with a selected set of Syngenta elite lines in the El Ejido Trial Station (Spain).
- The selected lines were:
- a).-YUCA- 15: Selected because of high potential for sugars accumulation in medium long cycle (time from fruit set to fruit ripening). YUCA is a proprietary Syngenta Seeds line obtained through 5 generations of self-pollination. It is a Japanese Rocky melon type, non turning and very low climacteric.
- b).-OGEL-17: Selected because of medium short cycle (time from fruit set to fruit ripening) and medium high potential for sugars accumulation. This line is a proprietary Syngenta Seeds line obtained through 10 generations of self-pollination from a breeding F1 from cross between parental lines of commercial hybrids GUSTAL and RADICAL (Syngenta Seeds). It is a GALIA melon type, turning and medium climacteric.
- F1 crosses produced self-pollinated F2 descendent generation. The F2 fruits were selected for low pH and sugar (Table 8A).
- 2. Both F2 populations were grown and cross pollinated plant by plant with a new selected set of Syngenta elite lines:
- a).-IND35/YUCA-15 F2 population was crossed with MG.755-68 (755), a proprietary Syngenta Seeds line obtained through 5 generations of self-pollination from a commercial hybrid BETULO (Syngenta Seeds). It is a GALIA turning and medium climacteric melon type selected for the purpose because of green flesh, high sugars, short cycle and relatively high citric acid content.
- b).-IND35/OGEL-17 F2 population was crossed with SEN19C8 (SN8). This line is a proprietary Syngenta Seeds line, non turning and very low climacteric, obtained through 6 generations of self-pollination of a commercial hybrid EARLS SEINU (Yae Nogey Seeds Co. Isahaya, Nagasaki, Japan). It is a Japanese Rocky melon type selected for the purpose because of high sugars and netting.
- In these populations, the single dominance genetic regulation for the Low pH trait was verified and that no linkage existed between sugar accumulation and said Low pH. (Table 3). From each populations (150 plants each), recombinants including the higher R.I. Brix degree and the lowest pH were selected. Cross-pollinated seed progeny was collected.
- The cross progenies selected from F2 population a) included the plants identified as: 755YUCIND-19, 755YUCIND-49, 755YUCIND-75.
- The one selected from F2 population b) included the plant identified as: SN8OGLIND-03.
- 755YUCIND lines were selected for sucrose accumulation. SN8OGLIND was selected for citric acid accumulation. These cross progenies were grown and produced data for pH, sugars and organic acid contents. Lines combining high sugars, low pH and high citric acid content were selected. The analysis of the selected plants is shown in Table 8B.
TABLE 8 Analysis of intermediates Table 8A: Analytical Data extract for selected plants in F2 (Agadir Autumn 1998) Geno FEMALE pH BRIX type YUCA-15.071.xIND35-1)-49. 4.30 13.0 Aa YUCA-15.071.xIND35-1)-75. 4.10 12.4 Aa YUCA-15.071.xIND35-1)-19. 4.05 10.4 AA OGEL-17.974.xIND35-1)-03. 4.57 11.8 Aa -
TABLE 8B Analytical Data extract for progeny B1F1 (El Ejido Spring 1999) Citric acid Malic acid Glucose Fructose Sucrose Total sugar Brix Nr. MALE FEMALE pH (mg/100 g) (mg/100 g) (g/100 g) (g/100 g) (g/100 g) (g/100 g) R.I. Fruits SN8 OGLIND-03. 4.7 773 52 2.3 2.4 1.7 6.3 10.0 5 4.5 930 48 1.8 2.0 4.4 8.2 12.0 4.7 809 56 2.0 2.2 2.4 6.6 10.2 755 YUCIND-49. 5.0 540 45 2.6 2.7 1.7 6.9 10.0 5 5.0 619 39 1.7 2.4 3.3 7.4 11.5 4.8 535 67 2.0 2.5 1.8 6.3 9.9 755 YUCIND-75. 5.0 549 38 2.5 2.7 2.7 7.9 12.0 3 5.4 564 52 2.6 2.7 2.2 7.4 11.0 5.3 568 40 2.3 2.5 2.6 7.5 10.7 755 YUCIND-19. 5.5 624 44 1.5 2.2 4.5 8.2 12.0 8 4.7 648 53 1.9 2.0 3.7 7.6 13.0 5.1 569 44 1.7 2.1 3.3 7.2 11.1 -
TABLE 8C Analytical Data extract for progeny B2&3F1 (El Ejido Autumn 1999) Citric acid Glucose Fructose Sucrose Total Sugar Brix Nr. MALE FEMALE pH (mg/100 g) (g/100 g) (g/100 g) (g/100 g) (g/100 g) R.I. Fruits IOTYU 4.7 802 2.5 2.5 2.9 7.9 12.5 4.7 1036 2.3 2.4 3.7 8.4 14.5 755 5.1 594 2.5 2.6 2.4 7.4 12.0 YUCA64 SN8 OGLIND-03. 4.7 771 2.3 2.4 2.4 7.1 12.6 9 755 YUCIND-19. 755)2 YUCIND-19. -
TABLE 8D Analytical Data extract for progeny B3F1&2 (Torrepacheco Spring 2000) Citric acid Glucose Fructose Sucrose Total Sugar Brix Nr. MALE FEMALE pH (mg/100 g) (g/100 g) (g/100 g) (g/100 g) (g/100g) R.I. Fruits SOLAR-19 IOTYU SN8 OGLIND-03. SOLAR-19 IOTYU SN8 OGLIND-03. 4.14 725 1.9 1.6 15.0 13 IOTYU IOTYU SN8 OGLIND-03. 4.73 523 1.8 1.2 14.3 3 YUCA64 755)2 YUCIND-19. 4.87 566 2.3 1.7 14.7 3 -
TABLE 8E Analytical Data extract (El Ejido Autumn 2000) Citric acid Glucose Fructose Sucrose Total Sugar Brix Nr. MALE FEMALE pH (mg/100 g) (g/100 g) (g/100 g) (g/100 g) (g/100 g) R.I. Fruits SOLAZ4.4.4 4.32 573 3.0 1.2 7.0 SOLAZ4.7.2. 4.44 564 3.3 1.1 11.0 SOLAZ2.4.2 4.52 494 2.9 1.4 11.0 SOLAZ2.4.5 4.43 474 2.7 1.0 10.0 YUCA-40 IOTYU)2 SN8 OGLIND-03. 4.48 453 2.5 1.0 12.0 YUCA64 755)2 YUCIND-19. 4.79 904 4.8 1.8 13.0 -
TABLE 8F Analytical Data extract (El Ejido 2001) Citric acid Glucose Fructose Sucrose Total Sugar Brix Nr. MALE FEMALE pH (mg/100 g) (g/100 g) (g/100 g) (g/100 g) (g/100g) R.I. Fruits SOLAZ 1 4.59 940 2.3 2.9 4.1 9.4 11.0 SOLAZ 2 4.63 770 2.5 2.7 1.3 6.6 8.0 YUSOL27 YUCA-40 IOTY SNC8OGLIN 4.6 741 3.4 2.5 4.6 10.4 14.0 U)2 D-03. YUSOL27 YUCA-64 755)2 YUCIND-19. 5.05 467 2.5 2.6 5.0 10.1 12.0 L53 755 YUCIND-75. 4.80 718 1.3 2.2 1.6 5.1 7.0 L53 755 YUCIND-49. 4.68 673 2.5 2.7 2.3 7.6 9.0 - Trait Introgresion Into SOLAZ
- The Low pH trait was introgressed in white flesh non climacteric LSL melons with round shape and yellow sutured skin.
- 1. Selected SN8OGLIND- 103 progeny plants were crossed with IOTYU, a proprietary Syngenta Seeds line obtained through generations of self-pollination from the traditional open pollinated Japanese variety Makuwauri EIJYU (Nanto seed Co. Ltd, Kashiwara, Nara, Japan). It was selected because of non-climacteric, non turning, very high sugar content, high citric acid content, yellow rind.
- 2. Selected plants of the progeny from previous cross were crossed with SOLAR-19 a proprietary Syngenta Seeds line obtained through 5 generations of self-pollination from a commercial hybrid SOLARKING F1 (Nunhems Zaden BV, Haelen, Holland). It is a long shelf life, non turning Galia melon type selected for the purpose because of non climacteric, very high sugar content, white flesh, yellow and netted rind.
- Seven cycles of self-pollination were carried out from these cross progenies. The selection and fixation on the self-pollination progenies was done with analytical data for pH, sugars and organic acid contents (Table 8C and 8D). Fixed lines progenies were selected:
- A) SOLAZ 1 selected as Low pH in combination for high sugar accumulation, powdery mildew tolerance, and plant with Summer growing adaptation (Table 8E and F).
- B) SOLAZ 2 selected as Low pH with combination for medium sugar accumulation, and plant with Spring growing adaptation (Table 8E and F).
- 3. Progenies SOLAZ 1 and SOLAZ 2 were used as males pollinators for crosses with three proprietary Syngenta Seeds lines, YUSOL 1, 2 & 3, obtained through 6 generations of self-pollination from a breeding hybrid MD.997 F1 from cross YUCA-15×SOLAR-48 both proprietary Syngenta Lines with origin indicated before.
- The following F1 combinations were obtained:
- A) YUSOL 1/SOLAZ 1; when using SOLAZ 1 as pollinator of lines YUSOL 1.
- B) YUSOL 2/SOLAZ 1; when using SOLAZ 1 as pollinator of lines YUSOL 2.
- C) YUSOL 3/SOLAZ 2; when using SOLAZ 2 as pollinator of lines YUSOL 3.
- The analysis of these selected plants and commercially available controls is shown in Tables 9 and 10. The plants were grown under the conditions described in Example 6. The number of fruits tested in each experiment is shown (nr. Frt). The measurements were carried out as described in Example 1-5. The figures for sucrose (suc), hexoses (hex), and total sugars are in g per 100 g fresh weight (fwt). The figures for citric acid and malic acid are in mg per 100 g fresh weight (fwt).
TABLE 9A SOLAZ tot. tot. hex/suc Growing nr suc suc hex hex sugar sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg stdev activity avg stdev avg stdev malic avg stdev SOLAZ/2 SP03PS 6 2.41 1.70 3.41 0.34 5.82 1.42 4.6 0.2 605 98 42 14 21 FA03PS 37 1.43 0.81 5.12 0.36 6.55 1.34 3.58 4.7 0.2 576 86 52 11 15 Average 43 1.92 4.27 6.19 2.50 4.6 590 47 13 SOLAZ/1 SP03PS 4 2.90 0.86 3.93 0.42 6.83 1.35 4.6 0.0 549 81 16 33 15 FA03PS 35 1.85 1.18 5.88 0.33 7.73 1.60 3.17 4.5 0.1 663 107 35 19 17.5 SOLAZ/1 SP03PS 4 2.01 0.22 3.82 0.20 5.83 1.90 4.6 0.1 513 53 20 26 11 FA03PS 16 1.80 0.74 5.32 0.27 7.13 1.25 2.95 4.5 0.1 591 83 52 11 10 SOLAZ/1 SP03PS 5 2.35 0.88 3.79 0.37 6.14 1.61 4.8 0.2 497 58 14 36 24 FA03PS 7 2.02 1.36 6.14 0.35 8.15 1.65 3.04 4.5 0.1 664 86 28 24 24 Average 71 2.16 4.81 6.97 2.34 4.6 579 27 25 average SOLAZ/1 and /2 114 2.10 4.68 6.77 4.6 582 27 22 -
TABLE 9B YUSOL tot. tot. hex/suc Growing nr suc suc hex hex sugar sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg stdev activity avg stdev avg stdev malic avg stdev YUSOL/1 SP03PS 8 4.25 1.18 4.77 0.82 9.02 1.12 6.0 0.3 295 85 47 6 10 FA03PS 8 5.01 0.58 5.33 0.85 10.34 1.16 1.07 6.3 0.1 214 49 13 16 10 Average/1 16 4.63 5.05 9.68 1.09 6.1 255 30 11 YUSOL/2 SP03PS 6 2.58 0.62 4.99 0.81 7.57 1.94 5.8 0.1 297 83 424 1 3 FA03PS 1 3.92 7.30 11.21 0.54 5.9 344 X 0 Average/2 7 3.25 6.14 9.39 1.24 5.9 320 1 YUSOL/3 SP03PS 6 5.04 1.43 4.04 0.81 9.08 0.80 6.1 0.2 225 97 12 18 21 FA03PS 5 6.23 0.67 5.64 0.47 11.87 0.54 0.91 6.2 0.2 218 62 9 24 10 Average/3 11 5.63 4.84 10.47 0.85 6.2 221 11 21 Average 1, 2, 3 34 4.50 5.34 9.85 1.06 6.05 265 24 11 -
TABLE 10A Hybrid SOLAZ X YUSOL tot. hex/suc Growing nr suc suc hex hex sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg activity avg stdev avg stdev malic avg stdev SOLAZ/1 X SP03PV 4 5.58 1.07 3.38 0.51 8.95 0.61 4.8 0.1 845 87 11240 0 2 YUSOL/1 SP03OF1 5 6.25 0.43 3.71 0.70 9.96 0.59 4.7 0.1 794 25 76 10 12 SP03OF2 5 6.90 0.60 2.55 0.19 9.44 0.37 4.8 0.1 679 50 47 14 8 average/1 14 6.24 3.21 9.45 0.52 4.8 773 97 8 SOLAZ/1 X SP03PS 3 3.45 0.24 4.68 0.52 8.14 1.36 4.7 0.1 697 32 45 16 12 YUSOL/2 SP03OF1 5 9.20 0.34 2.85 0.19 12.05 0.31 4.7 0.1 800 27 42 19 7 SP03OF2 4 7.01 1.30 2.69 0.40 9.70 0.38 4.8 0.1 744 46 39 19 4 average/2 12 6.56 3.41 9.97 0.68 4.7 747 42 18 SOLAZ/2 X SP03PV 4 4.41 0.72 3.20 0.44 7.61 0.73 4.7 0.2 863 62 100 9 18 YUSOL/3 SP03OF1 4 4.94 2.05 3.23 0.29 8.17 0.65 4.5 0.1 789 85 277 3 4 SP03OF2 5 9.42 1.09 2.04 0.37 11.46 0.22 4.9 0.1 694 63 109 6 2 average/3 13 6.26 2.82 9.08 0.53 4.7 782 162 6 Average 39 6.35 3.15 9.50 0.58 4.7 767 70 11 -
TABLE 10B Controls tot. tot. hex/suc Growing nr suc suc hex hex sugar sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg stdev activity avg stdev avg stdev malic avg stdev SOLAR F1 SP03PV 6 5.28 0.93 2.52 0.32 7.80 0.92 0.48 6.1 0.08 500 51 28 18 26 FA03PS 2 3.50 0.05 6.55 0.17 10.06 0.22 1.87 6.9 0.04 109 17 X 0 0 Average 8 4.39 4.54 8.93 1.17 6.48 305 35 9 MILENIUM SP03PV 4 2.99 1.23 4.94 0.67 7.93 1.57 1.65 5.8 0.1 546 25 X 0 0 SP03OF1 5 2.29 0.15 4.16 0.10 6.44 0.15 1.82 5.8 0.05 441 23 X 0 0 SP03OF2 3 5.15 3.82 3.30 0.99 8.45 4.81 0.64 6.1 0.4 345 40 X 0 0 Average 12 3.47 4.13 7.61 1.37 5.88 444 X 0 - Trait Introgresion Into YUSAZ A.
- The Low pH trait was introgressed in green flesh non climacteric LSL melons with round shape and yellow sutured skin.
- 1. Direct back-cross was made from line 755YUCIND-19 using as recurrent parent, line MG.755-68 indicated above.
- Selected plants of the progeny from previous cross were crossed with YUCA-64 a proprietary Syngenta Seeds line obtained through 5 generations of self-pollination from a same origin as the sister line indicated above.
- This line was selected because of green flesh, non turning, non climacteric long-shelf life, very high sugars very crispy watermelon texture and sutures.
- Three cycles of self-pollination from this cross progenies were carried out. The selection and fixation on the self-pollination progenies was made with analytical data for pH, sugars and organic acid contents (Table 8C-E).
- 2. Selected plants from progeny generated above were crossed with YUSOL.3 a proprietary Syngenta Seeds line described above. This line was selected because of green flesh, shorter cycle, very high sugars, yellow rind and sutures.
- Five cycles of self-pollination from the previous cross progenies was made. Selection and fixation breeding process concentrated on the self-pollination progenies for short cycle, green flesh, crispy watermelon texture and yellow rind. Selection and fixation was assisted with analytical data for pH, sugars and organic acid contents. There were so selected and fixed lines progeny YUSAZ A.
- 3. YUSAZ A lines were used as males pollinators for crosses with three proprietary Syngenta Seeds lines, YUSOL 1 a proprietary Syngenta Seeds line described above. The F1 combination: YUSOL 1/YUSAZ A was obtained.
- The analysis of these selected plants is shown in Table 11. The plants were grown under the conditions described in Example 6. The number of fruits tested in each experiment is shown (nr. Frt). The measurements were carried out as described in Example 1-5. The figures for sucrose (suc), hexoses (hex), and total sugars are in g per 100 g fresh weight (fwt). The figures for citric acid and malic acid are in mg per 100 g fresh weight (fwt).
TABLE 11A YUSAZ A tot. tot. hex/suc Growing Nr suc suc hex hex sugar sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg stdev activity avg stdev avg stdev malic avg stdev YUSAZ A/1 SP03PS 16 3.01 1.28 5.36 0.67 8.37 1.78 4.6 0.2 602 90 28 22 13 FA02PS 3 2.05 0.43 5.62 0.37 7.67 2.74 4.6 0.1 655 135 21 31 1 SU03PS 6 3.70 1.00 5.76 0.53 9.46 1.92 1.55 4.6 0.2 514 115 23 23 18 FA03PS 43 2.10 0.73 7.01 0.44 9.11 1.25 3.34 4.6 0.2 558 82 44 13 18 Average 68 2.72 5.94 8.65 2.35 4.6 582 29 22 YUSAZ A/2 SP03PS 25 3.81 0.99 5.03 0.54 8.84 1.32 4.8 0.2 586 55 17 35 14 FA02PS 6 3.53 0.83 5.74 0.38 9.27 1.63 4.6 0.1 582 70 10 56 15 SU03PS 95 3.99 1.42 4.82 0.41 8.80 1.72 1.21 4.8 0.3 543 80 16 33 19 FA03PS 52 3.70 1.30 6.12 0.35 9.81 1.28 1.66 4.7 0.1 578 63 18 33 13 Average 178 3.76 5.43 9.18 1.46 4.7 572 15 39 average YUSAZ A/1, /2 246 3.24 5.68 8.92 1.90 4.7 577 19 31 -
TABLE 11B F1 Hybrids using YUSAZ A tot. tot. hex/suc Growing Nr suc suc hex hex sugar sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg stdev activity avg stdev avg stdev malic avg stdev F1 Hybrid SP03PS 12 5.24 1.83 5.09 0.99 10.33 0.97 4.9 0.2 659 113 69 10 7 YUSAZ A1/ YUSOL F1 Hybrid SP03PS 5 3.68 0.46 5.40 0.63 9.08 1.47 4.6 0.1 724 87 35 21 8 YUSAZ A2/ YUSOL Average 17 4.46 5.24 9.70 1.22 4.8 692 46 15
Characteristics of line YUSAZ A are shown. YUSAZ A/1 and YUSAZ A/2 represent two sister lines. The F1 hybrids result from a cross with line YUSOL.
- Trait Introgresion Into YUSAZ B.
- The Low pH trait was introgressed in green flesh non climacteric LSL melons with round shape and yellow sutured skin.
- 1. Selected plants of cross SN8OGLIND-103×IOTYU progeny indicated above were back-crossed again with IOTYU, non turning and very low climacteric, green flesh melon (see Table 8D).
- Selected plants of the progeny from previous cross were crossed with YUCA-40 a proprietary Syngenta Seeds line obtained through 5 generations of self-pollination from a same origin as the sister line indicated above (see Table 8E).
- This line was selected because of green flesh, non climacteric long-shelf life, very high sugars very crispy watermelon texture and sutures.
- 2. Selected plants from progeny generated after one cycle of self-pollination from the one before were crossed with YUSOL.3 a proprietary Syngenta Seeds line described above. This line was selected because of green flesh, shorter cycle, very high sugars, yellow rind and sutures (see Table 8F).
- Five cycles of self-pollination from the previous cross progenies were carried out. Self-pollination progenies were selected for green flesh, crispy watermelon texture, high citric acid content and yellow rind.
- 3. The selection and fixation was assisted with analytical data for pH, sugars and organic acid contents. Fixed lines progeny YUSAZ B were selected (Table 12).
- YUSAZ B is an example of a “Citric+” melon plant.
- YUSAZ B lines were used as males pollinators for crosses with three proprietary Syngenta Seeds lines, YUSOL 1 a proprietary Syngenta Seeds line described above. The F1 combination: YUSOL 1/YUSAZ B was obtained (Table 12).
- The plants were grown under the conditions described in Example 6. The number of fruits tested in each experiment is shown (nr. Frt). The measurements were carried out as described in Example 1-5. The figures for sucrose (suc), hexoses (hex), and total sugars are in g per 100 g fresh weight (fwt). The figures for citric acid and malic acid are in mg per 100 g fresh weight (fwt).
TABLE 12 YUSAZ B tot. tot. hex/suc Growing nr sucr suc hex hex sugar sugar inv pH pH citric citric citric/ malic malic conditions frt avg stdev avg stdev avg stdev activity avg stdev avg stdev malic avg stdev YUSAZ B/0 SP03PS 7 3.16 0.66 4.99 0.60 8.14 1.58 4.7 0.1 891 73 17 73 12 FA02PS 2 2.46 0.01 5.75 0.42 8.20 2.34 4.3 0.0 848 14 11 75 2 FA03PS 6 1.61 0.61 6.63 0.39 8.24 1.02 4.12 4.4 0.1 878 169 11 78 57 Average 15 2.41 5.79 8.19 2.68 4.5 872 13 75 YUSAZ B/1 SP03PS 6 1.81 1.20 6.74 0.40 8.55 3.71 4.7 0.2 696 133 39 18 17 FA02PS 1 2.72 6.76 9.48 2.48 4.7 739 18 41 FA03PS 8 1.21 0.45 8.39 0.20 9.60 0.69 6.94 4.7 0.1 939 37 26 36 16 Average 15 1.91 7.30 9.21 4.38 4.7 791 28 32 average YUSAZ B/0, /1 30 2.16 6.54 8.70 3.53 4.6 832 16 53
Characteristics of line YUSAZ B are shown. YUSAZ B/1 and YUSAZ B/2 represent two sister lines. The F1 hybrids result from a cross with line YUSOL.
- Trait Introgresion to MEHARI F1
- The low pH trait was introgressed in orange flesh melons. The selected target was the conversion of the commercial hybrid MEHARI (Syngenta Seeds) into two low pH versions, one with higher citric acid content and one with lower citric acid content.
- 1. Direct backcrosses from lines 755YUCIND-49 and 755YUCIND-75 were conducted using as recurrent parent line L53, a proprietary Syngenta Seeds. L53 is a Charentais melon type selected for the purpose because of high sugars, low citric content. L53 is a parent of the commercial hybrid MEHARI (see Table 8F).
- During the backcross process and within the progeny of each cross plants with low pH and more or less acid perception (higher or lower citric content) were selected, in addition to other traits to be closer to the recurrent L53.
- After the second back-cross (third cross) the following progenies were obtained:
- a) L53)3)×755YUCIND75-15/03/06/, selected for low pH and low citric acid content
- b) L53)3+)×755YUCIND49-8/2/03/05/, selected for low pH and high citric acid content. Four cycles of self-pollination from these cross progenies and one further back-cross with L53 were carried out. The selection and fixation breeding process on the self-pollination progenies was assisted with analytical data for pH, sugars and organic acid contents.
- 2. Fixed lines progenies were selected:
- A) L53AZ A selected from previous population a) and fixed for low citric acid content and low pH and, for other traits, close to the recurrent L53.
- Line L53AZ A is an example of a “Citric−” melon plant.
- B) L53AZ B selected from previous population b) and fixed for low pH and high citric acid content and, for other traits, close to the recurrent L53.
- Plants were also selected for intense orange flesh color in presence of the low pH trait. The intensity of the orange color in the flesh had to be particularly selected for, as a generally poor orange color intensity tended to be associated within low pH acid in the fruit flesh (see Table 4).
- Progenies lines L53AZ A and L53AZ B, and line L53 were used in crosses with the other parent line of MEHARI to obtain MEHARI AZ A, MEHARI AZ B and MEHARI the current commercial F1, respectively.
- All these products, lines and crosses were tested in agronomic trials and analytical data were collected from fruits (Table 13).
- The plants were grown under the conditions described in Example 6. The number of fruits tested in each experiment is shown (nr. Frt). The measurements were carried out as described in Example 1-5. The figures for sucrose (suc), hexoses (hex), and total sugars are in g per 100 g fresh weight (fwt). The figures for citric acid and malic acid are in mg per 100 g fresh weight (fwt).
TABLE 13A MEHARI, low pH/high pH tot. tot. Hex/suc Growing nr suc Suc Hex hex sugar sugar inv pH pH citric citric citric/ Malic malic conditions frt avg Stdev Avg stdev avg stdev activity avg stdev avg stdev malic avg stdev Male high pH FA02PS 4 4.11 1.66 2.93 0.67 7.04 0.71 6.9 0.2 65 26 1 114 38 cit/− (L53) SP03PS 3 1.98 0.85 2.70 2.05 4.68 1.36 6.2 0 52 11 1 55 26 FA03PS 6 9.07 0.67 4.07 0.40 13.14 1.06 0.45 6.9 0.2 159 40 1 109 18 Average/High pH− 10 5.05 3.23 8.29 6.7 92 1 93 Male acid cit/− SP03PS 4 2.75 1.65 3.85 0.38 6.61 1.40 5.0 0.3 442 168 4 109 51 (L53AZ A) SU03PS 24 2.03 1.40 3.35 1.11 5.82 1.83 1.65 4.8 0.3 484 132 3 150 64 FA03PS 48 2.76 1.85 6.07 0.62 8.82 2.19 2.20 4.8 0.4 600 158 3 200 130 Average/low pH, citric− 76 2.51 4.42 7.09 4.9 509 3 153 Male acid SP03PS 3 4.82 1.37 2.72 0.30 7.54 0.56 5.0 0.1 654 86 9 75 23 (L53AZ B) SU03PS 12 3.74 1.50 3.33 0.89 7.08 1.64 0.89 4.7 0.1 670 95 10 64 26 FA03PS 37 4.14 1.64 5.57 0.70 9.71 1.76 1.35 4.7 0.2 779 74 12 63 20 Average/low pH, citric+ 52 4.24 3.87 8.11 4.8 701 11 67 -
TABLE 13B Hybrids of MEHARI, low pH/high pH Tot. tot. Hex/suc Growing nr suc Suc hex hex Sugar sugar Inv pH pH citric citric citric/ malic malic conditions frt avg Stdev avg stdev Avg stdev activity avg stdev avg stdev malic avg stdev F1 Hybrid SP03PS 7 5.06 1.26 3.15 0.69 8.21 0.62 6.6 0.2 233 70 3 73 10 MEHARI FA03PS 7 2.86 0.80 6.53 1.42 9.40 1.70 2.28 6.0 0.2 316 137 9 34 23 High pH Average 14 3.96 4.84 8.80 1.22 6.3 274 5 54 F1 Hybrid SP03PS 7 3.10 1.42 4.46 0.53 7.55 1.44 5.4 0.2 447 85 6 79 22 low pH, citric− FA03PS 6 1.39 1.46 5.75 0.66 7.14 1.99 4.14 4.6 0.2 527 80 7 76 27 Average 13 2.24 5.10 7.34 2.27 5.0 487 6 78 F1 Hybrid SP03PS 7 3.19 1.22 4.56 0.67 7.76 1.43 4.8 0.1 619 78 12 53 23 Low pH, citric+ SP03OF1 3 5.82 1.55 3.63 0.76 9.45 0.86 0.62 4.9 0.2 718 57 20 37 7 FA03PS 7 1.12 0.52 6.73 0.56 7.84 0.88 6.02 4.5 0.1 654 128 7 92 69 Average 17 3.37 4.97 8.35 1.47 4.76 663 11 60 - Sensory Analysis
- Sensory analysis of fruits of plants of the instant invention was performed by an Expert panel. The panel was composed of 12 persons, especially trained to describe melons texture, sugar and acid savours. Six sessions of training were carried out before the expert sessions. The training program of the study was:
-
- Training 1: Reading of the lexicon of tasting. Notation of 6 products in the assembly room and discussion in order to see which descriptor is difficult to agree about.
- Training 2: Notation of 2 products+2 repeated in laboratory of sensory analysis to see how the panel evaluate the descriptors personnally.
- Training 3: Results of the training 2 are presented to the panel. Notation of 2 products+2 repeated in the assembly room and discussion. Notation of 2 products in the individual cabins.
- Training 4: Works on sugar and acid solutions at different concentrations to evaluate the difficulties of the panel on these descriptors. Results of the training 3 are presented to the panel. Notation of 3 products+1 repeated in the assembly room and discussion. Notation of 3 products+1 repeated in individual cabins.
- Training 5: Notation of 4 products in the assembly room and notation of 2 products+2 repeated in the individual cabins. It allows us to check the repeatability of the tasters inside the session. Works on acid solutions.
- Training 6: Notation of 3 products in the assembly room and notation of 2 products+2 repeated in the individual cabins to check the repeatability of the tasters inside the session.
- The sensory analysis was carried out in an air-conditioned sensory analysis laboratory equipped with individual cabins. A structured scale of quotation in 10 points (from 0 to 9) was used with the following descriptors:
- Sweet Savor
- Definition: It is about the perception of the sweet savour perceived in mouth. Mode of evaluation: Chew the product until its disappearance. Estimate the intensity of the sweet savour. Notation: 0=not sweet, 9=very sweet
- Acid Savor
- Definition: It is about the perception of the acid savour perceived in mouth. Mode of evaluation: Chew the product until its disappearance. Estimate the intensity of the acid savour. Notation: 0=not acid, 9=very acid.
- Protocol of Preparation
-
-
-
- Wash of melons in the cold water
- Longitudinal cutting of the melon
- Removing of the pulp and the seeds
- Cutting each half of melons in 3 parts (longitudinal cutting)
- Removing of the extremities of 3 parts
- Cutting each part in 2 in order to have 6 parts on the half of the melon
Presentation of the Products - Samples are presented coded with random numbers and according to a plan of presentation (Latin Square) avoiding the effects of presentation order.
- The products are given one after the other.
-
- Tables 14 and 15 show the results of two sensory analysis conducted on different fruits. In Table 14, plants were sown in early March and transplanted to open protected fields as vine crops in early April. Fruits were harvested in early July. In Table 14 A, fruits were stored for 7 to 12 days at 10° C. followed by 2 days at 20° C. In Table 14 B, fruits were stored for 4 to 8 days at 10° C. followed by 2 days at 20° C.
- In Table 15, plants were sown in early August and transplanted to plastic houses as staked crops in late August. Fruits were harvested in early November. Fruits were stored for 4 to 8 days 5° C. followed by 3 days at 20° C.
- Sensory analysis was performed on the number of fruits indicated in the Tables. Each fruit was tested by the 12 qualified tasters. The figures for acid and sugar savors for each line represent the average of the number of fruit times 12 (for the 12 tasters). Tables 14 and 15 also show measurements of the pH and contents of sugars and organic acid for the fruits tested.
TABLE 14A FRT GLU SUC FRU Tot sug Citric Ac Malic Ac ACID SUGAR nr Brix pH g/100 g g/100 g g/100 g/100 g mg/100 g mg/100 g savor savor YUSOL/1 X Avg 10 11.7 6.24 1.2 7.2 2.1 10.6 309 4 0.5 5.6 SOLAZ/1 basic Std Dev 2.1 0.30 0.3 2.3 0.3 1.9 121 10 0.3 1.0 YUSAZA Avg 6 12.7 4.79 1.1 7.7 2.0 10.7 808 0 2.1 5.4 X YUSOL Std Dev 0.5 0.09 0.2 0.6 0.2 0.5 17 0 0.7 0.5 SOLAZ/2 Avg 10 13.5 4.68 1.5 7.9 2.0 11.3 832 18 3.6 4.7 X YUSOL/3 Std Dev 1.4 0.17 0.5 1.0 0.3 1.0 37 20 0.5 0.3 SOLAZ/1 Avg 10 13.2 4.58 1.8 7.2 2.4 11.4 816 41 3.1 4.7 X YUSOL/1 Std Dev 0.8 0.22 0.6 1.2 0.4 0.6 37 32 1.2 0.6 Average SOLAZ XYUSOL 20 13.4 4.63 1.7 7.6 2.2 11.4 824 30 3.4 4.7 -
TABLE 14B FRT GLU SUC FRU SUG Citric Ac Malic ACID SUGAR nr Brix pH g/100 g g/100 g g/100 g Tot mg/100 g mg/100 g savor savor Female Mehari Avg 6 13.2 6.64 1.0 8.5 1.7 11.2 272 63 0.5 5.8 X L53 Std Dev 1.7 0.09 0.1 1.5 0.2 1.5 54 32 0.2 0.6 Female Mehari Avg 7 13.4 5.20 1.1 7.8 1.9 10.8 652 88 1.7 5.2 X L53 AZ A/1 Std Dev 0.7 0.11 0.2 0.8 0.3 0.9 87 69 0.4 0.4 Female Mehari Avg 5 13.1 5.28 1.2 8.1 2.0 11.3 581 107 1.6 5.3 X L53 AZ A/2 Std Dev 0.8 0.08 0.2 0.9 0.1 0.8 50 40 0.4 0.6 AVG Female Mehari X L53 AZ A 12 13.3 5.24 1.2 8.0 2.0 11.1 617 98 1.7 5.3 Female Mehari Avg 6 12.2 4.98 1.2 7.1 1.9 10.2 708 107 3.2 4.6 X L53 AZ B Std Dev 1.0 0.21 0.1 0.7 0.2 0.9 78 44 0.6 0.3 -
TABLE 15 FRT GLU SUC FRU Tot sug Citric Ac Malic Ac ACID SUGAR nr Brix pH g/100g g/100 g g/100 g g/100g mg/100 g mg/100 g savor savor SOLAZ/2 Avg 3 9.60 4.53 1.97 2.98 2.47 7.41 717 0 3.78 4.31 X YUSOL/3 Std Dev 0.53 0.06 0.36 0.30 0.36 0.94 39 0 0.84 0.55 SOLAZ/1 Avg 2 11.00 4.74 2.14 4.04 3.05 9.24 574 0 2.54 5.63 X YUSOL/1 Std Dev 0.85 0.09 0.35 0.00 0.09 0.44 169 0 1.20 0.06 Average SOLAZ X YUSOL 5 10.2 4.6 2.0 3.4 2.7 8.1 660 0 3.3 4.8 YUSOLX Avg 5 12.40 4.71 3.04 4.02 3.59 10.65 713 18 2.95 5.47 YUSAZA Std Dev 1.04 0.17 0.56 1.04 0.67 0.68 42 15 0.40 0.75 TD X L53 Avg 8 12.13 4.97 1.23 5.53 2.06 8.82 696 74 2.56 5.72 AZ/A Std Dev 1.13 0.14 0.36 1.13 0.32 0.80 83 41 0.85 0.39 Mehari female Avg 3 9.50 5.10 1.48 3.48 2.52 7.48 632 62 2.17 5.50 X L53 AZ/A Std Dev 1.32 0.27 0.17 0.70 0.37 1.17 79 25 0.43 0.55 - Molecular Marker Analysis
- DNA was extracted from young leaves (15 day-old seedlings). Leaves were freeze-dried and DNA was extracted following the method of Dellaporta (Dellaporta 1983).
- PCR cycling conditions were: 15 s denaturation at 94° C. followed by 15 s annealing at 54° C. and 30 s extension at 72° C. for 40 cycles. Sample's DNA was initially denatured for 2 minutes at 94° C. and extended for 2 min at 72° C. after PCR.
- The PCR mix contained 1.65 mM MgCl2, 60 mM of each deoxyribonucleotide, 1×Taq Buffer, 0.2 unit Taq polymerase, 15-20 ng template DNA and 400 nM of each non-fluorescent primer or 200 nM of each fluorescently labeled primer. Fluorescent primers were labeled with 6-FAM, NED or HEX. Fluorescent PCR products were separated on an ABI3700 capillary sequencer and their sizes measured using Applied Biosystem's Genescan and Genotyper fragment analysis software.
- Non-fluorescent PCR products were separated by electrophoresis in 3% agarose gels (Resophor, Eurobio) at 400V with cooling system. Gels were stained with ethidium bromide. Three markers were used, CMAT141 (described in Danin-Poleg et al. (2001) Theor. Appl. Genet. 102: 61-72 and Danin-Poleg et al. (2002) Euphytica 125: 373-384) and NE0585 and NE1746. The primers for these markers are shown below.
Forward Primer Reverse Primer (5′-3′) (5′-3′) CMAT141 AAGCACACCACCACCCGTAA GTGAATGGTATGTTATCCTTG (SEQ ID NO:1) (SEQ ID NO:2) NE0585 GTATCATGTCGGAGAAACG CCTTTATCCCCACTTTTTC (SEQ ID NO:3) (SEQ ID NO:4) NE1746 TTCTCCGATGTGTCCTCTC GTCGCTTGGAATATATCGG (SEQ ID NO:5) (SEQ ID NO:6) - Analysis of Accessions
- A number of melon accessions comprising a low pH trait were analyzed using the markers above. The sizes of the amplified fragments are reported in Table 16 below. The indicated sizes (in bp) are not absolute but relative to the other size products detected with the same primer pair. The real (exact) size of the amplified fragments (e.g. determined by sequencing) could be slightly different (+/−1 bp) of those indicated herein.
TABLE 16 CMAT141 NE0585 NE1746 IND35-1.2. 173 230 127 IND35-2.3. 168 232 124 FAGOUS2:4- 176 228 253 121 FAGOUS2:5- 176 121 142 FAGOUS2:7- 176 253 142 PI414723 175 228 124 PI414724 175 124 PI161375 175 228 124 PI124112 175 239 124 - Evolution of Fruit Characteristics of Fruits Kept on the Plant
- Plants were grown as for the plants in Table 15 above. Fruits were harvested at different maturation times points (cycle) calculated by the difference between the harvest date (HDT) and the pollination date (PDT). Maturity was considered as reached at a particular time point in the cycle, when the average of the sucrose content for fruits at the particular time point in the cycle reached 2.0 g sucrose per 100 g fwt and using other ripening signs such as side leaf senescence. The results are shown in Table 17.
- The results are based on individual fruit measurements and it is understood that some fruits may yield deviating values because of damages, aberrant development or other environmental factors.
TABLE 17 Flesh Orange FRT Colour GLU SUC FRU HEX Tot sug Citric Ac Malic Ac nr PDT HDT Cycle 1 to 5 pH Brix g/100 g g/100 g g/100 g g/100 g g/100 g mg/100 g mg/100 g TD X 1 17 37 20 1 5.09 5.0 1.6 0.0 1.4 2.6 3.0 169 460 L53 AZ A/1 1 16 37 21 1 4.83 5.4 1.8 0.0 1.7 3.9 3.5 167 273 Maturity 1 14 37 23 1 4.94 4.6 1.4 0.0 1.4 2.7 2.8 128 243 reached between 1 16 40 24 1 4.55 4.8 1.4 0.0 1.2 2.8 2.6 387 314 cycle 33 and 40 1 16 40 24 1 4.66 5.0 1.2 0.0 1.7 2.9 2.9 387 114 1 14 40 26 2 4.88 6.5 1.9 0.0 1.4 2.3 3.3 498 255 1 14 40 26 2 4.44 7.0 1.4 0.6 2.7 4.1 4.7 852 119 1 14 44 30 2 4.36 6.7 2.3 0.4 2.0 3.2 4.6 776 178 1 14 44 30 2 4.47 7.0 1.7 0.5 2.2 3.9 4.3 528 77 1 14 44 30 2 4.70 7.0 2.3 0.2 2.4 4.7 5.0 649 11 1 14 47 33 2 4.37 6.5 2.0 0.0 1.6 3.2 3.6 730 174 1 14 47 33 2 4.59 7.0 1.2 1.0 1.7 2.9 3.9 453 117 1 14 47 33 3 4.85 13.6 2.3 3.9 1.9 4.0 8.2 876 199 1 14 54 40 3 5.02 13.0 1.0 7.3 2.2 3.2 10.5 663 89 1 17 57 40 3 4.83 11.5 1.5 4.5 2.4 3.9 8.4 590 155 1 16 57 41 3 4.79 14.0 1.8 6.9 2.1 3.9 10.9 890 31 1 16 58 42 4 4.75 13.3 2.1 5.2 2.0 3.1 9.2 985 104 1 14 57 43 3 4.96 12.7 1.7 5.5 1.9 4.3 9.0 893 167 1 14 57 43 4 5.24 14.0 1.4 8.4 2.3 3.7 12.1 648 40 1 14 57 43 4 5.06 12.5 1.0 5.9 1.8 2.8 8.7 623 48 1 14 57 43 4 5.00 12.5 1.3 5.7 2.2 3.4 9.2 758 29 TD X 1 17 37 20 1 4.45 4.8 1.7 0.1 1.8 3.5 3.5 307 319 L53 AZ A/2 1 17 37 20 1 4.53 5.2 1.9 0.0 2.0 5.0 3.9 331 332 Maturity 1 14 37 23 1 4.43 4.1 1.0 0.0 1.1 2.3 2.1 572 323 reached between 1 17 40 23 3 4.55 7.0 1.3 0.8 1.7 3.0 3.8 682 120 cycle 34 and 38 1 14 40 26 2 4.48 6.0 1.3 0.3 1.8 3.2 3.5 590 136 1 14 40 26 3 4.44 6.2 1.9 0.0 1.9 1.5 3.8 594 206 1 17 44 27 2 4.36 4.9 1.5 0.0 1.3 2.8 2.9 640 295 1 19 47 28 3 4.33 8.9 2.8 0.0 2.7 4.4 5.5 977 156 1 14 44 30 2 4.65 6.0 1.0 1.3 2.4 3.4 4.8 715 56 1 17 51 34 3 4.43 10.1 2.9 1.0 2.9 5.9 6.8 989 141 1 17 51 34 3 4.77 11.0 1.9 3.5 2.5 4.4 7.9 836 31 1 17 51 34 3 4.91 10.5 1.3 5.3 1.9 3.2 8.5 753 96 1 16 51 35 3 4.31 8.6 2.2 0.9 2.1 5.0 5.3 970 216 1 16 54 38 3 4.76 14.1 2.3 5.5 2.2 3.8 10.1 983 164 1 14 54 40 4 4.80 14.8 2.1 7.0 2.1 4.0 11.3 992 166 1 14 54 40 4 5.03 15.0 0.8 9.0 1.8 2.6 11.6 843 5 1 17 58 41 3 4.99 14.5 1.6 8.0 2.1 3.6 11.6 909 75 1 14 57 43 4 4.97 12.0 0.8 5.8 1.7 2.5 8.2 635 76 1 14 57 43 5 5.20 14.0 1.2 6.3 1.7 2.9 9.2 711 64 1 14 58 44 4 5.06 16.0 1.6 8.5 1.7 3.4 11.9 986 50 FRT GLU SUC FRU HEX Tot sug Citric Ac Malic Ac nr PDT HDT Cycle Colour pH Brix g/100 g g/100 g g/100 g g/100 g g/100 g mg/100 g mg/100 g Female Mehari 1 21 40 20 1 4.45 4.7 1.5 0.0 1.3 1.3 437 292 X L53 AZ A/1 1 17 37 20 1 4.62 4.5 1.1 0.1 1.4 2.5 2.6 295 98 Maturity 1 17 40 23 1 4.78 5.0 1.0 0.2 1.9 2.9 3.1 482 71 reached between 1 14 40 26 2 4.54 5.0 1.1 0.1 1.6 2.7 2.8 397 81 cycle 36 and 38 1 17 44 27 2 4.46 5.0 1.2 0.4 1.9 3.1 3.4 547 38 1 17 44 27 2 4.43 4.9 1.6 0.0 1.4 1.4 3.0 561 187 1 17 44 27 2 4.52 6.0 1.5 0.7 1.9 3.4 4.1 505 18 1 19 51 32 4 4.81 8.0 1.3 2.7 2.2 3.5 6.2 575 76 1 19 51 32 2 4.50 6.2 2.0 0.0 1.6 2.8 3.6 592 75 1 19 51 32 3 4.76 7.0 1.5 1.4 2.0 3.5 4.9 465 105 1 14 50 36 3 5.99 8.6 1.5 2.5 1.6 2.6 5.6 414 259 1 16 53 37 5 6.28 9.0 1.4 3.0 1.8 3.3 6.3 297 166 1 17 54 37 4 5.57 8.5 1.7 2.6 2.6 4.3 6.9 309 261 1 17 54 37 2 5.68 8.4 1.6 1.7 1.4 2.6 4.8 339 276 1 14 51 37 3 4.86 5.8 1.3 0.4 1.4 3.9 3.1 446 339 1 14 51 37 4 6.36 9.0 1.5 2.7 1.9 3.4 6.1 276 167 1 17 54 37 4 5.21 12.0 1.6 4.5 1.9 3.5 8.0 532 56 1 16 54 38 5 5.79 9.5 1.4 3.8 2.7 4.1 7.9 351 264 1 17 57 40 2 5.47 9.0 1.7 1.5 1.4 4.0 4.6 410 312 1 17 57 40 4 4.63 10.9 2.4 3.0 2.3 3.8 7.7 894 111 1 17 57 40 5 6.22 9.5 1.5 3.8 2.1 3.6 7.4 360 277 Female Mehari 1 17 37 20 1 4.84 4.5 0.7 0.3 1.7 2.5 2.7 368 33 X L53 AZ A/2 1 17 37 20 1 5.25 4.7 1.6 0.0 1.5 2.5 3.1 210 375 Maturity 1 17 37 20 1 5.31 4.3 1.4 0.0 1.2 2.6 2.6 200 288 reached between 1 17 44 27 2 4.52 4.9 1.7 0.0 1.4 2.4 3.1 320 190 cycle 35 and 37 1 17 44 27 2 4.49 5.0 0.8 0.3 1.7 2.5 2.8 423 5 1 17 44 27 2 6.69 5.3 1.5 0.0 0.8 3.4 2.4 238 160 1 17 44 27 2 4.47 6.0 2.1 0.0 1.7 7.5 3.8 437 183 1 21 51 30 3 4.63 9.5 2.6 1.4 2.4 4.3 6.4 548 150 1 17 47 30 2 4.53 7.4 2.4 0.1 2.1 4.0 4.6 672 126 1 17 47 30 3 4.60 6.5 1.5 1.0 2.3 3.8 4.8 562 44 1 17 51 34 2 4.68 6.5 2.0 0.2 1.9 2.6 4.1 713 99 1 17 51 34 3 4.50 9.9 2.7 1.5 2.5 4.9 6.7 944 118 1 16 51 35 4 5.35 10.5 1.7 4.0 2.9 4.6 8.6 723 32 1 16 51 35 4 4.77 11.7 2.2 3.2 2.2 3.7 7.6 904 133 1 14 50 36 2 5.84 7.1 1.4 0.6 1.5 2.6 3.5 224 168 1 14 50 36 4 6.09 7.0 1.1 2.1 2.1 3.2 5.3 273 201 1 14 50 36 2 5.95 8.3 1.6 1.7 1.8 3.7 5.1 279 235 1 14 50 36 5 6.51 9.5 1.7 2.9 2.7 4.4 7.3 336 202 1 14 51 37 4 5.13 10.0 1.5 3.8 2.4 3.9 7.7 599 77 1 19 57 38 3 5.60 13.1 2.3 4.1 2.2 3.3 8.6 613 150 1 19 57 38 3 4.62 12.2 3.0 3.7 2.7 5.2 9.4 1011 63 FRT GLU SUC FRU HEX Tot sug Citric Ac Malic Ac nr PDT HDT Cycle pH Brix g/100 g g/100 g g/100 g g/100 g g/100 g mg/100 g mg/100 g SOLAZ/2 x2 9 37 28 4.23 5.0 1.6 0.1 1.7 4.0 3.3 664 116 X YUSOL/3 x2 9 37 28 4.30 5.1 1.8 0.0 1.9 4.8 3.7 496 123 Maturity x2 9 37 28 4.21 5.9 2.4 0.0 2.0 3.7 4.4 674 77 reached between 1 9 37 28 4.53 6.0 2.3 1.0 2.6 4.8 5.9 675 102 cycle 38 and 41 x2 9 37 28 4.19 5.3 1.6 0.1 1.8 3.9 3.5 703 123 x2 9 37 28 4.37 4.6 1.4 0.0 1.4 2.9 2.8 509 264 x2 10 40 30 4.18 5.5 2.0 0.0 1.9 3.2 3.9 545 94 x2 9 40 31 4.21 6.4 2.1 0.0 2.1 3.5 4.1 795 71 1x 9 40 31 4.25 7.2 2.9 0.0 2.9 4.8 5.8 723 186 1 9 40 31 4.37 6.8 2.3 0.3 2.8 5.1 5.4 667 55 x2 9 40 31 4.15 5.5 1.9 0.0 2.0 4.7 3.9 728 146 1x 9 44 35 4.21 8.6 2.8 0.0 3.3 6.4 6.2 990 34 x2 9 44 35 4.70 7.0 2.1 1.7 3.0 5.0 6.7 706 0 x2 9 44 35 4.18 7.3 2.3 0.0 2.8 5.3 5.1 984 32 x2 9 44 35 4.17 7.3 2.1 0.0 2.7 5.8 4.8 992 28 x2 9 44 35 4.06 6.5 2.3 0.0 2.3 4.9 4.6 990 67 1 9 44 35 4.34 7.2 1.9 0.5 2.3 4.2 4.7 736 14 1 9 47 38 4.49 10.2 2.4 3.3 2.8 5.2 8.5 761 0 x2 9 47 38 4.24 9.0 2.6 0.6 3.1 6.7 6.2 782 15 x2 9 47 38 4.21 10.5 3.1 0.9 3.4 7.3 7.5 834 41 1 9 47 38 4.60 9.2 1.7 2.7 2.5 4.2 6.9 695 0 x2 9 47 38 4.21 10.3 2.9 1.2 3.0 6.2 7.1 1052 53 x2 9 50 41 4.44 9.2 2.2 2.0 2.4 4.7 6.6 701 24 x2 9 50 41 4.69 10.5 803 66 x2 9 50 41 4.76 10.2 853 37 x2 9 50 41 4.77 10.4 1.8 3.6 2.8 4.6 8.2 637 1 x2 9 50 41 4.56 12.2 943 0 1 9 50 41 4.51 9.4 1.8 2.9 2.1 3.9 6.9 694 0 x2 9 51 42 4.55 10.5 887 0 x2 9 54 45 4.28 12.4 2.7 3.3 2.6 5.0 8.7 982 48 x2 9 54 45 4.23 10.8 2.4 3.0 2.6 4.7 8.0 1026 61 1 9 54 45 4.44 12.9 2.7 4.7 2.4 3.6 9.8 997 52 SOLAZ/1 x2 10 37 27 4.36 4.8 1.7 0.0 1.7 3.7 3.3 526 136 X YUSOL/1 1 10 37 27 4.84 4.0 1.4 0.4 2.1 3.5 3.9 428 27 Maturity 1 9 37 28 4.51 4.5 2.1 0.0 2.1 4.2 4.2 476 86 reached between 1 9 37 28 4.49 5.4 2.1 1.1 2.4 4.5 5.6 524 55 cycle 38 and 41 1 9 40 31 4.42 6.2 1.8 0.4 2.8 4.6 5.1 598 62 1 9 40 31 4.38 5.0 1.6 0.1 2.0 3.6 3.7 546 94 1 9 40 31 4.25 5.8 1.9 0.0 2.1 3.6 3.9 642 91 1 9 44 35 4.53 7.0 2.2 1.6 3.2 5.4 7.0 654 0 1 9 44 35 4.24 8.7 2.7 0.5 3.0 5.3 6.1 977 70 1 9 44 35 4.44 7.6 2.0 0.8 2.6 4.6 5.4 498 0 1 9 44 35 4.38 8.6 2.3 1.4 3.1 5.5 6.9 640 6 1 9 47 38 4.42 10.4 1.8 2.4 2.6 4.4 6.9 733 0 1 9 47 38 4.53 8.0 2.0 1.8 3.0 4.9 6.7 540 0 1 9 47 38 4.74 8.5 2.2 1.6 2.7 5.4 6.5 600 3 1 9 47 38 4.50 10.1 2.3 1.8 2.5 3.4 6.7 568 15 1 9 50 41 4.45 10.2 1.7 2.6 2.2 4.0 6.6 676 8 1 9 50 41 4.80 10.4 1.9 4.0 3.0 4.9 8.9 455 0 1 9 50 41 4.67 11.6 2.4 4.0 3.1 5.5 9.5 694 0 x2 9 51 42 4.42 11.1 796 28 1 9 51 42 4.75 8.6 767 8 1 9 54 45 4.40 11.2 2.2 2.5 2.4 4.4 7.1 745 19 1 9 54 45 4.47 8.5 1.8 1.3 1.9 3.8 5.1 705 11 YUSAZ A/1 1 14 37 25 5.22 7.1 2.5 0.0 2.6 5.1 5.1 284 406 X YUSOL/1 x2 10 37 27 4.38 5.9 2.1 0.0 1.8 6.7 3.9 513 146 Maturity x2 9 37 28 4.67 5.5 2.0 0.0 2.7 4.7 4.7 530 93 reached between x2 9 37 28 4.37 6.2 2.1 0.0 2.0 4.0 4.1 695 104 cycle 35 and 42 1 19 47 28 5.23 5.8 1.9 0.6 3.1 5.0 5.6 410 0 1 9 37 28 4.65 7.2 2.8 0.0 3.4 6.2 6.2 594 22 x2 9 40 31 4.66 7.0 2.0 0.4 2.8 4.8 5.2 490 12 1 9 40 31 4.50 7.4 2.3 0.1 2.8 5.1 5.2 635 36 x2 9 40 31 4.32 5.9 2.2 0.0 2.1 4.0 4.3 495 102 x2 9 44 35 4.39 7.3 2.7 0.3 2.4 4.2 5.4 579 55 1 9 44 35 4.62 9.2 2.5 1.2 3.0 5.5 6.7 689 0 1 9 44 35 4.39 8.4 3.0 0.0 3.5 6.7 6.6 685 55 x2 9 44 35 4.41 8.8 3.0 0.3 3.0 5.4 6.3 702 27 1 9 44 35 4.77 9.6 2.7 1.6 3.4 6.2 7.8 736 4 x2 9 44 35 5.85 8.0 1.9 3.1 3.4 5.3 8.4 387 0 x2 9 47 38 4.46 8.9 3.1 0.3 3.6 6.9 7.1 653 37 x2 9 47 38 4.85 11.4 3.9 2.4 4.7 8.6 11.0 776 17 1 9 47 38 6.46 9.4 1.3 3.6 2.8 4.1 7.8 274 0 x2 9 47 38 4.75 9.2 2.8 1.4 3.1 5.9 7.3 525 0 1 9 51 42 4.87 12.4 2.8 4.3 3.1 5.9 10.2 696 19 x2 9 51 42 4.45 11.4 2.6 3.9 3.2 5.8 9.7 678 11 x2 9 51 42 4.57 14.4 791 47 x2 9 51 42 4.41 11.6 2.7 3.0 2.6 5.1 8.3 730 52 x2 9 51 42 4.73 13.8 2.5 5.3 3.5 6.0 11.3 679 0 1 10 53 43 6.24 11.0 410 47 x2 10 53 43 6.18 10.5 350 48 1 9 54 45 4.58 13.5 2.7 4.8 2.8 4.8 10.4 780 62 1x 9 54 45 4.54 13.2 2.5 4.2 2.3 4.4 9.0 751 34 YUSAZ A/2 x2 10 37 27 4.55 7.0 2.7 0.0 3.1 5.7 5.8 543 24 X YUSOL/3 x2 10 37 27 4.52 7.6 2.8 0.0 3.1 6.0 5.9 640 64 Maturity 1 9 37 28 5.46 8.3 2.2 1.1 2.9 4.9 6.2 457 166 reached between x2 9 37 28 4.40 6.1 2.5 0.0 2.5 4.4 5.0 630 64 cycle 34 to 38 1 9 37 28 4.67 9.4 2.9 2.5 4.1 7.0 9.5 618 30 1 10 40 30 4.71 9.5 3.1 1.3 3.3 6.4 7.7 610 54 x2 9 40 31 4.51 6.6 2.4 0.0 2.7 5.2 5.1 460 64 x2 9 40 31 4.62 7.7 3.0 0.0 3.2 6.1 6.1 569 50 x2 9 40 31 4.58 7.6 2.7 0.0 3.2 5.2 6.0 655 41 x2 9 40 31 4.48 8.3 2.9 0.0 3.4 2.6 6.3 721 48 1 10 44 34 4.76 11.2 3.4 1.0 4.0 7.2 8.5 844 74 1 10 44 34 4.69 13.1 3.1 3.1 3.9 9.7 10.0 825 90 1 17 51 34 4.72 10.1 612 22 x2 10 44 34 4.48 12.1 3.4 2.0 4.0 6.7 9.4 683 64 1 9 44 35 4.66 13.0 3.3 4.2 3.5 6.8 11.0 733 42 1 9 47 38 5.22 14.4 2.6 5.9 3.0 5.6 11.4 514 87 1 9 47 38 4.50 13.2 3.1 4.1 3.1 5.8 10.3 899 80 x2 9 47 38 4.89 12.4 2.2 4.1 3.2 6.7 9.5 696 21 1 9 47 38 4.57 14.2 3.3 4.3 3.3 6.2 10.9 725 66 1 9 47 38 4.66 15.2 2.8 5.7 2.9 4.8 11.4 774 141 x2 10 51 41 4.67 15.2 818 44 x2 9 51 42 4.74 13.6 754 65 1 9 51 42 4.97 15.4 2.1 7.0 2.6 4.7 11.7 507 1 1 9 51 42 5.60 15.2 2.0 8.6 2.3 4.3 12.9 462 97 1 11 54 43 4.94 15.8 2.9 6.0 2.8 8.1 11.7 680 66 x2 9 53 44 4.93 15.1 881 221 x2 9 54 45 4.80 15.3 2.3 7.4 2.7 5.1 12.4 831 103 x2 9 54 45 4.53 14.1 2.7 5.2 2.8 5.2 10.8 876 64 1 9 54 45 5.00 15.8 2.8 6.3 2.5 4.8 11.6 641 188 - Post Harvest Evolution of Fruit Characteristics
- A. Fruits of plants of trial SP03OF (see Tables 6 and 7C) were harvested and stored for 1 week at 12° C. followed by 3 days at 20° C. or for 6 weeks at 12° C. followed by 2 days at 20° C. The characteristics of the fruits were measured after storage and are shown in Table 18.
- B. Plants were grown as for the plants in Table 14 above. Fruits were harvested and stored for 1 week at 12° C. followed by 3 days at 20° C. The characteristics of the fruits were measured after storage and are shown in Table 19.
TABLE 18 FRT Glu Suc Fru Hex Total Citric Malic Post harvest protocol Hv Nr Brix pH g/100 g g/100 g g/100 g g/100 g Sugar mg/100 g mg/100 g Millenium 1 w 12° + 3 d 20° Avg 5 8.4 5.75 2.0 2.3 2.2 4.2 6.4 441 −8 Stdev 0.3 0.05 0.1 0.2 0.0 0.1 0.2 25 4 6 w 12° + 2 d 20° Avg 2 10.1 5.86 1.5 3.9 2.2 3.7 7.6 487 Stdev 0.6 0.03 0.3 0.9 0.2 0.5 0.4 4 YUSOL/1&2 1 w 12° + 3 d 20° Avg 4 12.0 4.71 1.0 6.7 2.1 3.1 9.8 802 −1 X SOLAZ/1 Stdev 0.7 0.05 0.1 0.7 0.1 0.2 0.7 33 6 6 w 12° + 2 d 20° Avg 2 13.2 4.77 0.5 8.1 1.8 2.3 10.4 808 Stdev 0.5 0.07 0.1 0.6 0.0 0.1 0.5 36 YUSOL/3 6 w 12° + 2 d 20° Avg 4 11.9 4.89 1.1 6.2 1.9 3.0 9.2 638 X SOLAZ/1 Stdev 0.9 0.07 0.4 1.6 0.3 0.7 1.1 72 YUSOL/1 1 w 12° + 3 d 20° Avg 9 9.5 4.46 1.0 4.5 1.9 2.9 7.4 773 −5 X SOLAZ/2 Stdev 1.4 0.12 0.2 1.5 0.2 0.4 1.2 85 5 6 w 12° + 2 d 20° Avg 4 9.5 4.65 1.1 3.7 2.0 3.1 6.7 669 Stdev 1.4 0.17 0.2 1.4 0.3 0.5 1.0 70 YUSOL/2 1 w 12° + 3 d 20° Avg 5 10.1 4.53 1.1 4.9 2.1 3.2 8.2 789 3 X SOLAZ/2 Stdev 2.3 0.13 0.2 2.3 0.2 0.3 2.1 95 6 w 12° + 2 d 20° Avg 2 10.6 4.70 1.1 5.5 2.0 3.1 8.6 697 Stdev 0.7 0.02 0.1 0.6 0.1 0.2 0.4 51 YUSOL/3 1 w 12° + 3 d 20° Avg 12 10.4 4.50 0.9 5.8 1.8 2.7 8.4 777 −4 X SOLAZ/2 Stdev 0.8 0.09 0.2 0.9 0.1 0.3 0.8 37 6 6 w 12° + 2 d 20° Avg 6 11.0 4.85 0.6 6.2 1.5 2.1 8.3 656 Stdev 0.8 0.14 0.3 1.1 0.3 0.6 0.7 46 -
TABLE 19 ratio FRT GLU SUC FRU Tot sug Citric Ac Malic Ac Citric Ac/ Nr Brix pH g/100 g g/100g g/100 g g/100 g mg/100 g mg/100 g Malic Ac SOLAZ/2 X YUSOL/3 51 13.1 4.75 1.4 7.2 2.0 10.6 771 23 35 SOLAZ/1 X YUSOL/1 51 13.8 4.71 1.8 7.9 2.3 12.0 778 21 53 YUSOL/1 X 51 13.4 6.14 1.4 8.0 2.3 11.7 354 14 31 SOLAZ/1 basic MEHARY 10 14.8 6.51 0.5 10.4 1.3 12.2 289 73 4 Female MEHARI 59 12.4 5.45 0.8 7.4 1.4 9.7 491 211 2 X L53 AZ/A TD x L53AZ/A 49 13.9 5.16 0.6 9.0 1.3 10.9 579 69 11 -
Claims (51)
1. A C. melo plant capable of producing fruit, wherein said fruit comprises at maturity:
a) at least about 400 mg citric acid per 100 g fwt;
b) pH of about 4.2 to about 5.6; and
c) at least about 5.0 g sugar per 100 g fwt.
2. The C. melo plant according to claim 1 , wherein the ratio of citric acid to malic acid in said fruit is greater than 4.4.
3. The C. melo plant according to claim 1 , wherein said fruit comprises less than about 85 mg malic acid per 100 g fwt.
4. The C. melo plant according to claim 1 , wherein said fruit comprises an average acid savor of about 1.6 to about 3.8 and an average sugar savor of about 4.3 to about 5.8.
5. The C. melo plant according to claim 4 , wherein said fruit comprises an average acid savor of about 2.5 to about 3.8 and an average sugar savor of about 4.3 to about 5.6.
6. The C. melo plant according to claim 4 , wherein said fruit comprises an average acid savor of about 1.6 to about 3.0 and an average sugar savor of about 5.2 to about 5.8.
7. The C. melo plant according to claim 1 , wherein a DNA fragment of about 168 bp to about 178 bp is amplified from DNA of said plant when the primers of marker CMAT141 are used.
8. The C. melo plant according to claim 7 , wherein said DNA fragment is 168 bp, 173 bp, 169 bp, 172 bp or 178 bp long.
9. The C. melo plant according to claim 1 , wherein a DNA fragment of about 218 bp to about 253 bp is amplified from DNA of said plant when the primers of marker NE0585 are used.
10. The C. melo plant according to claim 9 , wherein said DNA fragment is of 230 bp, 232 bp, 218 bp, 229 bp, 234 bp or 239 bp long.
11. The C. melo plant according to claim 1 , wherein a DNA fragment of about 121 bp to about 145 bp is amplified from DNA of said plant when the primers of marker NE1746 are used.
12. The C. melo plant according to claim 11 , wherein said DNA fragment is 124 bp, 127 bp, 133 bp, 142 bp or 145 bp long.
13. The C. melo plant according to claim 1 , wherein the pH of said fruit remains within said range of about 4.2 to about 5.6 for at least 2 days after said fruit reaches maturity when said fruit is kept on the plant.
14. The C. melo plant according to claim 1 , wherein the pH of said fruit remains within said range of about 4.2 to about 5.6 for at least 3 days after said fruit reaches maturity when said fruit is kept on the plant.
15. The C. melo plant according to claim 1 , wherein the pH of said fruit remains within said range of about 4.2 to about 5.6 when said fruit is harvested and kept in storage for at least 5 days at 20° C. or for at least 7 days at 8-12° C. followed by 3 days at 20° C.
16. The C. melo plant according to claim 1 , wherein the pH of said fruit remains within said range of about 4.2 to about 5.6 when said fruit is harvested and kept in storage for at least 7 days at 20° C. or for at least 12 days at 8-12° C. followed by 3 days at 20° C.
17. The C. melo plant according to claim 1 , wherein the citric acid of said fruit remains at or above about 400 mg per 100 g fwt for at least 2 days after said fruit reaches maturity when said fruit is kept on the plant.
18. The C. melo plant according to claim 1 , wherein the citric acid of said fruit remains at or above about 400 mg per 100 g fwt for at least 3 days after said fruit reaches maturity when said fruit is kept on the plant.
19. The C. melo plant according to claim 1 , wherein the citric acid of said fruit remains at or above about 400 mg per 100 g fwt when said fruit is harvested and kept in storage for at least 5 days at 20° C. or for at least 7 days at 8-12° C. followed by 3 days at 20° C.
20. The C. melo plant according to claim 1 , wherein the citric acid of said fruit remains at or above about 400 mg per 100 g fwt when said fruit is harvested and kept in storage for at least 7 days at 20° C. or for at least 12 days at 8-12° C. followed by 3 days at 20° C.
21. The C. melo plant according to claim 2 , wherein the ratio of citric acid to malic acid of said fruit remains greater than 4.4 for at least 2 days after said fruit reaches maturity when said fruit is kept on the plant.
22. The C. melo plant according to claim 2 , wherein the ratio of citric acid to malic acid of said fruit remains greater than 4.4 for at least 3 days after said fruit reaches maturity when said fruit is kept on the plant.
23. The C. melo plant according to claim 2 , wherein the ratio of citric acid to malic acid of said fruit remains greater than 4.4 when said fruit is harvested and kept in storage for at least 5 days at 20° C. or for at least 7 days at 8-12° C. followed by 3 days at 20° C.
24. The C. melo plant according to claim 2 , wherein the ratio of citric acid to malic acid of said fruit remains greater than 4.4 when said fruit is harvested and kept in storage for at least 7 days at 20° C. or for at least 12 days at 8-12° C. followed by 3 days at 20° C.
25. The C. melo plant according to claim 1 , wherein said plant is capable of producing a low-turning or a non-turning fruit.
26. The C. melo plant according to claim 1 , wherein said plant is capable of producing a low-climacteric or a non-climacteric fruit.
27. The C. melo plant according to claim 1 , wherein the flesh of said fruit is orange, white, green or yellow.
28. The C. melo plant according to claim 1 , wherein the mesocarp of said fruit represents more than 50% of the total fresh weight of said fruit.
29. The C. melo plant according to claim 1 , wherein said C. melo plant comprises a low pH gene.
30. The C. melo plant according to claim 1 , wherein said low pH gene is homozygous or heterozygous in said plant.
31. The C. melo plant according to claim 1 , wherein said low pH trait is obtainable from a plant of line IND-35, representative seeds of which is deposited under Accession number NCIMB 41202, or a descendent of said line IND-35.
32. The C. melo plant according to claim 1 , wherein said fruit comprises at maturity:
a) about 600 mg to about 1,200 mg citric acid per 100 g fwt;
b) pH of about 4.2 to about 5.1;
c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
33. The C. melo plant according to claim 1 , wherein said fruit comprises at maturity:
a) about 400 mg to about 650 mg citric acid per 100 g fwt;
b) pH of about 4.6 to about 5.6; and
c) about 5.0 g to about 15.0 g sugar per 100 g fwt.
34. The C. melo plant according to claim 1 , wherein said plant is an inbred line.
35. The C. melo plant according to claim 1 , wherein said plant is a hybrid.
36. The C. melo plant according to claim 1 , wherein said plant is a dihaploid.
37. Seed of a C. melo plant according to claim 1 .
38. Fruit of a C. melo plant according to claim 1 .
39. Flesh of a C. melo plant according to claim 1 .
40. A method of increasing the citric acid content of a fruit of a first C. melo plant comprising:
a) obtaining a first C. melo plant;
b) crossing said first C. melo plant with a second C. melo plant comprising a low pH trait;
c) obtaining a progeny C. melo plant;
d) determining the pH of a fruit of said progeny C. melo plant, and
e) selecting a fruit of said progeny C. melo plant which has increased citric acid content and lower pH, when compared to a fruit of said first C. melo plant.
41. The method according to claim 40 , wherein the citric acid content of a fruit of said progeny C. melo plant is increased by about 1.5 to about 3 times and the pH of said fruit reduced by about 1 to about 2.5 pH units, when compared to a fruit of said first C. melo plant.
42. The method of claim 40 , wherein said second C. melo plant is a plant of line IND-35, representative seeds of which is deposited under Accession number NCIMB 41202, or a descendent of said line IND-35.
43. A C. melo plant capable of producing a fruit, wherein said fruit comprises at maturity an average acid savor of about 1.6 to about 3.8 and an average sugar savor of about 4.3 to about 5.8.
44. The C. melo plant according to claim 43 , wherein said fruit comprises at maturity an average acid savor of about 2.5 to about 3.8 and an average sugar savor of about 4.3 to about 5.6.
45. The C. melo plant according to claim 43 , wherein said fruit comprises at maturity an average acid savor of about 1.6 to about 3.0 and an average sugar savor of about 5.2 to about 5.8.
46. The C. melo plant according to claim 43 , wherein said fruit has a pH of about 4.2 to about 5.6.
47. The plant according to claim 43 , wherein said fruit has a citric acid content of at least about 400 mg per 100 g fwt.
48. The plant according to claim 43 , wherein said fruit has a sugar content of at least about 5.0 g sugar per 100 g fwt.
49. Seed of a C. melo plant according to claim 43 .
50. Fruit of a C. melo plant according to claim 43 .
51. Flesh of a C. melo plant according to claim 43.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/031,578 US20050153047A1 (en) | 2004-01-09 | 2005-01-07 | Novel melon plants |
US12/549,728 US8829265B2 (en) | 2004-01-09 | 2009-08-28 | Melon plants |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US53563104P | 2004-01-09 | 2004-01-09 | |
ES200400473 | 2004-02-27 | ||
US11/031,578 US20050153047A1 (en) | 2004-01-09 | 2005-01-07 | Novel melon plants |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/549,728 Division US8829265B2 (en) | 2004-01-09 | 2009-08-28 | Melon plants |
Publications (1)
Publication Number | Publication Date |
---|---|
US20050153047A1 true US20050153047A1 (en) | 2005-07-14 |
Family
ID=35052265
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/031,578 Abandoned US20050153047A1 (en) | 2004-01-09 | 2005-01-07 | Novel melon plants |
US12/549,728 Active 2026-12-17 US8829265B2 (en) | 2004-01-09 | 2009-08-28 | Melon plants |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/549,728 Active 2026-12-17 US8829265B2 (en) | 2004-01-09 | 2009-08-28 | Melon plants |
Country Status (14)
Country | Link |
---|---|
US (2) | US20050153047A1 (en) |
EP (1) | EP1587933B2 (en) |
JP (1) | JP2007520216A (en) |
KR (1) | KR101235089B1 (en) |
CN (1) | CN1930297B (en) |
AT (1) | ATE404681T1 (en) |
AU (2) | AU2005205117B2 (en) |
BR (1) | BRPI0506720A (en) |
CA (1) | CA2551921C (en) |
DE (1) | DE602005008803D1 (en) |
ES (1) | ES2313273T5 (en) |
HK (1) | HK1099045A1 (en) |
NZ (2) | NZ548298A (en) |
WO (1) | WO2005068637A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114467943A (en) * | 2021-12-23 | 2022-05-13 | 广西壮族自治区亚热带作物研究所(广西亚热带农产品加工研究所) | Fertility-possessed amphoteric flower inducing composition for cassava and method for inducing flowering and seed setting twice in year |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014031770A2 (en) * | 2012-08-23 | 2014-02-27 | Seminis Vegetable Seeds, Inc. | Multiple-virus-resistant melon |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5354946A (en) * | 1990-07-27 | 1994-10-11 | Bio-Obtention Sc | Gene complex particularly useful for modifying plants such as Cucumis melo and Cucumis melo incorporating said gene complex |
US5476998A (en) * | 1992-10-06 | 1995-12-19 | Yurie Shintaku | Cultivated melon with a sour taste and a process for the production thereof |
US6420631B1 (en) * | 2000-05-15 | 2002-07-16 | Harris Moran Seed Company | Inbred cantaloupe GdM3 |
US20030177539A1 (en) * | 2002-03-07 | 2003-09-18 | Bill Copes | Inbred cantaloupe line 442 |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997042333A1 (en) | 1996-05-09 | 1997-11-13 | Pioneer Hi-Bred International, Inc. | Methods and compositions for production of plant foodstuffs with enhanced sweet component of flavor |
AU769932B2 (en) | 1998-12-02 | 2004-02-12 | Plant Research International B.V. | Fruit flavour related genes and use thereof |
US20030077549A1 (en) * | 2001-07-31 | 2003-04-24 | Eastman Kodak Company | High chloride emulsion doped with combination of metal complexes |
-
2005
- 2005-01-07 KR KR1020067016089A patent/KR101235089B1/en active IP Right Grant
- 2005-01-07 JP JP2006548228A patent/JP2007520216A/en active Pending
- 2005-01-07 US US11/031,578 patent/US20050153047A1/en not_active Abandoned
- 2005-01-07 CN CN2005800073923A patent/CN1930297B/en active Active
- 2005-01-07 ES ES05700744T patent/ES2313273T5/en active Active
- 2005-01-07 EP EP05700744A patent/EP1587933B2/en active Active
- 2005-01-07 DE DE602005008803T patent/DE602005008803D1/en active Active
- 2005-01-07 BR BRPI0506720-0A patent/BRPI0506720A/en not_active Application Discontinuation
- 2005-01-07 NZ NZ548298A patent/NZ548298A/en unknown
- 2005-01-07 AT AT05700744T patent/ATE404681T1/en not_active IP Right Cessation
- 2005-01-07 AU AU2005205117A patent/AU2005205117B2/en active Active
- 2005-01-07 WO PCT/EP2005/000091 patent/WO2005068637A1/en active IP Right Grant
- 2005-01-07 CA CA2551921A patent/CA2551921C/en active Active
-
2007
- 2007-06-07 HK HK07106053.4A patent/HK1099045A1/en unknown
-
2009
- 2009-08-05 NZ NZ578874A patent/NZ578874A/en unknown
- 2009-08-28 US US12/549,728 patent/US8829265B2/en active Active
-
2010
- 2010-06-23 AU AU2010202622A patent/AU2010202622B2/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5354946A (en) * | 1990-07-27 | 1994-10-11 | Bio-Obtention Sc | Gene complex particularly useful for modifying plants such as Cucumis melo and Cucumis melo incorporating said gene complex |
US5476998A (en) * | 1992-10-06 | 1995-12-19 | Yurie Shintaku | Cultivated melon with a sour taste and a process for the production thereof |
US6420631B1 (en) * | 2000-05-15 | 2002-07-16 | Harris Moran Seed Company | Inbred cantaloupe GdM3 |
US20030177539A1 (en) * | 2002-03-07 | 2003-09-18 | Bill Copes | Inbred cantaloupe line 442 |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114467943A (en) * | 2021-12-23 | 2022-05-13 | 广西壮族自治区亚热带作物研究所(广西亚热带农产品加工研究所) | Fertility-possessed amphoteric flower inducing composition for cassava and method for inducing flowering and seed setting twice in year |
Also Published As
Publication number | Publication date |
---|---|
NZ548298A (en) | 2009-09-25 |
KR101235089B1 (en) | 2013-02-20 |
AU2010202622A1 (en) | 2010-07-15 |
AU2005205117A1 (en) | 2005-07-28 |
US20100034952A1 (en) | 2010-02-11 |
JP2007520216A (en) | 2007-07-26 |
ES2313273T3 (en) | 2009-03-01 |
ATE404681T1 (en) | 2008-08-15 |
HK1099045A1 (en) | 2007-08-03 |
CA2551921A1 (en) | 2005-07-28 |
DE602005008803D1 (en) | 2008-09-25 |
CN1930297A (en) | 2007-03-14 |
WO2005068637A1 (en) | 2005-07-28 |
EP1587933A1 (en) | 2005-10-26 |
AU2005205117B2 (en) | 2010-04-22 |
US8829265B2 (en) | 2014-09-09 |
EP1587933B1 (en) | 2008-08-13 |
NZ578874A (en) | 2011-08-26 |
AU2010202622B2 (en) | 2012-04-12 |
CA2551921C (en) | 2014-04-08 |
ES2313273T5 (en) | 2012-08-17 |
BRPI0506720A (en) | 2007-11-13 |
CN1930297B (en) | 2010-04-14 |
KR20060109987A (en) | 2006-10-23 |
EP1587933B2 (en) | 2011-12-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10945396B2 (en) | Hybrid cantaloupe plant named Earlypac | |
US10945392B2 (en) | Hybrid cantaloupe plant named HM8970 | |
US11638407B2 (en) | Hybrid pumpkin plant named HMX0686 | |
US11202423B1 (en) | Hybrid cantaloupe plant named sweet spot | |
US11197439B1 (en) | Hybrid cantaloupe plant named HMX47D2514 | |
US11197441B1 (en) | Hybrid cantaloupe plant named SUN PAC | |
US11197440B1 (en) | Hybrid cantaloupe plant named PRIME PAC | |
US11191232B2 (en) | Hybrid cantaloupe plant named HMC454326 | |
US8829265B2 (en) | Melon plants | |
US11350586B2 (en) | Hybrid cucumber plant named DIXON | |
JP2007520216A6 (en) | New melon | |
US9516826B2 (en) | Melon variety NUN 35007 MEM | |
US11647712B2 (en) | Hybrid cantaloupe plant named HMC460066 | |
US11700807B2 (en) | Hybrid cantaloupe plant named HMC458279 | |
US11647713B2 (en) | Hybrid cantaloupe plant named deputy | |
US11089749B2 (en) | Melon variety NUN 16108 MEM | |
US10694697B2 (en) | Melon variety NUN 12105 MEM | |
US20220369585A1 (en) | Hybrid cantaloupe plant named prospector | |
US20220369588A1 (en) | Hybrid cantaloupe plant named outlaw |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: SYNGENTA PARTICIPATIONS AG, SWITZERLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CASANUEVA, JOSE IGNACIO ALVAREZ;FONCELLE, BRUNO;NICOLET, JEAN LOUIS MARIE EDOUARD;AND OTHERS;REEL/FRAME:016324/0699;SIGNING DATES FROM 20050211 TO 20050221 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |