US20050003460A1 - Detection of haematopoietic stem cells and progeny and uses thereof - Google Patents
Detection of haematopoietic stem cells and progeny and uses thereof Download PDFInfo
- Publication number
- US20050003460A1 US20050003460A1 US10/837,038 US83703804A US2005003460A1 US 20050003460 A1 US20050003460 A1 US 20050003460A1 US 83703804 A US83703804 A US 83703804A US 2005003460 A1 US2005003460 A1 US 2005003460A1
- Authority
- US
- United States
- Prior art keywords
- progeny
- hsc
- cells
- fragment
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
- G01N33/56972—White blood cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/91091—Glycosyltransferases (2.4)
- G01N2333/91097—Hexosyltransferases (general) (2.4.1)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2400/00—Assays, e.g. immunoassays or enzyme assays, involving carbohydrates
- G01N2400/10—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
- G01N2400/38—Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence, e.g. gluco- or galactomannans, Konjac gum, Locust bean gum or Guar gum
- G01N2400/40—Glycosaminoglycans, i.e. GAG or mucopolysaccharides, e.g. chondroitin sulfate, dermatan sulfate, hyaluronic acid, heparin, heparan sulfate, and related sulfated polysaccharides
Definitions
- the present invention relates to the identification of a specific population of cell types, in particular, haematopoietic stem cells (HSC) and cells deriving from HSC.
- HSC haematopoietic stem cells
- the invention also provides for methods of isolation and uses of the stem cells and their progeny derived from the methods. Methods of regulating development of the stem cells and their progeny are also provided.
- Stem cells give rise to cells, which ultimately contribute to various parts of the plant or animal.
- One type of stem cell is the haematopoietic stem cell.
- Hematopoietic cells are responsible for an extraordinarily diverse range of activities. They are divided into several lineages, including lymphoid, myeloid and erythroid.
- the lymphoid lineage comprising B cells and T cells, produces antibodies, regulates cellular immunity, and detects foreign agents such as disease-causing organisms in the blood.
- the myeloid lineage which includes monocytes, granulocytes, and megakaryocytes, monitors the blood for foreign bodies, protects against neoplastic cells, scavenges foreign materials, and produces platelets.
- the erythroid lineage includes red blood cells, which carry oxygen.
- Haematopoietic stem cells are capable of self-renewal, multilineage proliferation and differentiation, and long-term support of the haematopoietic and lymphoid systems. They form a subpopulation within the haematopoietic progenitor compartment (HPC), which mainly comprises cells of more limited potentiality. HPC cells are mainly located within the bone marrow stroma, where complex interaction with stromal cells, extracellular matrix components and cytokines, permits regulation of cell proliferation and differentiation. HPC cells are also present in the blood under a variety of physiological, pathological and iatrogenic circumstances.
- HPC haematopoietic progenitor compartment
- HPC can be harvested from bone marrow or peripheral blood, and will re-engraft the bone marrow following intravenous infusion in patients who have received ablative (i.e. destructive) doses of chemotherapy and/or radiotherapy, leading to regeneration of haematopoiesis and immunity.
- ablative i.e. destructive
- chemotherapy and/or radiotherapy leading to regeneration of haematopoiesis and immunity.
- HPC cell transplantation is of considerable clinical utility in the management of patients with haematological and solid malignancies, bone marrow failure, and inborn errors of haematopoiesis, immunity or metabolism.
- HPC cells are generally located within the bone marrow stroma.
- HPC cells are able to adhere to bone marrow stromal layers before proliferating and releasing more committed progenitors.
- Stem cells undergo marked proliferation and differentiation into multiple lineages, ultimately giving rise to fully differentiated cells or progeny, such as red blood cells, platelets, a variety of white blood cells, and also immune cells such as T lymphocytes and B lymphocytes.
- T lymphocytes and B lymphocytes immune cells
- hematopoietic stem cells The relative paucity of hematopoietic stem cells has prevented extensive research on stem cells and hematopoietic differentiation in general.
- the ready availability of a cell population enriched in hematopoietic stem cells would make possible the identification of biological modifiers affecting stem cell behavior. For example, there may be as yet undiscovered growth factors associated with (1) early steps of dedication of the stem cell to a particular lineage; (2) the prevention of such dedication; and (3) the ability to control stem cell proliferation.
- stem cells in an enriched population would also be extremely useful, for example, in reconstituting hematopoiesis in patients undergoing treatments which destroy stem cells, such as cancer chemotherapy.
- BM bone marrow
- HSC primitive hematopoietic stem cells
- HM stromal cell mediated hemopoietic microenvironment
- HPC lineage restricted clonogenic hemopoietic progenitor cells
- CFU-S colony-forming unit spleen
- the reestablishment of hemopoiesis by intravenously infused cells requires several coordinated events including homing, migration and lodgement of HPC within the BM HM.
- the initial event, homing is the specific recruitment of circulating HSC to the BM and involves the selective recognition of HSC by the microvascular endothelium of the marrow and trans-endothelial cell migration into the extravascular hemopoietic space.
- lodgement encompasses events following extravasation and is defined as the selective migration of cells to suitable HM niches in the extravascular compartment.
- Current data suggests that homing involves a similar cascade of cell adhesion molecules (CAMs) to those participating in the extravasation of mature leukocytes into tissues.
- CAMs cell adhesion molecules
- HSC hemopoietic stem cells
- HA hyaluronic acid
- HSC hematopoietic stem cells
- identifying the HA or HAS or equivalent or fragment thereof may be used.
- a method of identifying a HSC or progeny thereof comprising the steps of:
- identifying the HSCs or progeny thereof having HA or HAS or fragment thereof by detecting the presence of the antibody on the HSCs or progeny thereof.
- the antibody is any antibody specific for HA or HAS or fragment thereof.
- the antibody used in the present invention encompasses any antibody or fragment thereof, either native or recombinant, synthetic or naturally-derived, monoclonal or polyclonal which retains sufficient specificity to bind specifically to the HA or HAS or a fragment thereof which is indicative of HA.
- identifying the HSC or progeny thereof having HA or HAS or a fragment thereof by detecting the presence of the binding protein on the HSC or progeny thereof.
- Binding protein especially HA binding protein (HABP) is useful for detecting HA.
- HABP may be obtained from Seikagaku Corporation. However, any equivalent based on the binding protein properties may be used to identify the HA. It is conceivable that the binding portions of the binding protein are identified and synthetically prepared as an indicator or HA. Accordingly, synthetic indicators based on the HABP are within the scope of the present invention.
- the present invention also encompasses a method for obtaining a cell population enriched in HSCs or progeny thereof comprising the steps of
- the method of detection involves the use of an antibody to HA or HAS; or a binding protein (HABP) to HA can also be used to detect HA or equivalents thereof.
- HABP binding protein
- antibodies or HABP to detect HA or HAS prior to selection may also be employed.
- the methods described herein may also be used to isolate HSCs or progeny thereof from cell populations or measure HSC content in such populations. Once a HSC is isolated or identified, they may be used in methods of treating or diagnosing HSC related or associated conditions or further isolation techniques may be employed to isolate subpopulations within the HSC populations. Specific markers for specific cell lineages such as lymphoid, myeloid or erythroid cells may be used to identify and isolate the various cell lineages.
- FIG. 1 a shows expression of HA on murine HSC (Lin ⁇ Sca + Kit + cells).
- FIG. 1 b shows HA expression on Lin ⁇ Rh dull HSC and removal by HY treatment.
- FIG. 2 shows expression of HAS genes in murine cells.
- FIG. 3 shows HA expression on maturing CD34 + cells.
- FIG. 4 shows HAS gene expression in human HSC.
- FIG. 5 a (i) shows growth inhibition in murine HSC.
- FIG. 5 a (ii) shows growth inhibition in human HSC.
- FIG. 5 b (i) shows differentiation of cultured CD34 + CD38 ⁇ CB cell.
- FIG. 5 b (ii) shows phenotypic analysis of cultured CD34 + CD38 ⁇ CB cell.
- FIG. 6 shows maintenance of CD34 + expression of cells cultured in the presence of various concentrations of HABP.
- the carbohydrate sequences described herein have been found to be expressed specifically on HSC or progeny thereof.
- the sequence-in includes at least one repeat unit of disaccharide wherein the unit includes glucuronic acid and N-acetylglucosamine or an equivalent thereof.
- Several repeat disaccharide units may be joined as a continuous molecule of disaccharide repeats to provide a linear molecule or the carbohydrate repeats may be interspersed with molecules which are not disaccharides of glucuronic acid and N-acetylglucosamine or an equivalent thereof.
- the HSC or progeny thereof can be identified by at least one repeat disaccharide providing at least 2 disaccharide units are at least 4 saccharides comprising, in order, glucuronic acid and N-acetylglucosamine or an equivalent thereof, then glucuronic acid and N-acetylglucosamine or an equivalent thereof.
- equivalent means a sequence or molecule which functions in a similar way but may have deletions, additions or substitutions that do not substantially change the activity or function of the sequence or molecule.
- HSC and progeny thereof synthesize and express HA.
- HA synthesis and expression was found in multiple mammalian systems, and may be expressed mainly into primitive hematopoietic cells.
- HA was found to be critical in the lodgment of transplanted HSC within the bone marrow, with its specific removal using hyaluronidase significantly altering their spatial distribution.
- the binding of HA on the surface of HSC to a surrogate ligand in vitro results in a profound suppression of HSC proliferation and differentiation.
- the molecule or molecules associated with its production have not previously been connected to HSC nor for their identification.
- the molecule has not been associated with expression from a HSC or progeny thereof.
- HA is single-chain high molecular-mass polysaccharide of repeating disaccharide units (glucuronic acid and N-acetylglucosamine) which is synthesised by one of 3 hyaluronic acid synthases (HAS), encoded by one of 3 HAS genes (Has 1, Has 2, Has 3).
- HAS hyaluronic acid synthases
- HAS hyaluronic acid synthases
- HAS hyaluronic acid synthases
- HAS hyaluronic acid synthases
- Cell surface HA significantly affects the adhesion, motility and growth of a wide variety of cell types, both normal and neoplastic. Due to its multivalency (which allows cross bridging of multiple receptors on adjacent cells), the interaction of endogenous cell surface HA with its primary receptor, CD44, mediates aggregation of several cell types. Increased cell movement or invasion may follow either the exposure of cells to HA, or the ectopic expression of HA or HAS. Moreover, inhibition of cell movement also occurs as a consequence of either HA degradation or the blocking of HA receptors. HA also influences cell proliferation, differentiation and tissue repair and HA may be implicated in the pathogenesis and dissemination of tumours.
- HA or HAS or a fragment of HAS may be detected on the HSC.
- the HA or HAS molecule is detected.
- fragments of the HAS molecule may also be indicative of HA. Such fragments may include peptide sequences corresponding to portions of the HAS molecule or an equivalent thereof.
- the sample of HSC or progeny thereof may originate from any source including an embryonic or adult source.
- the HSC source is from the bone marrow including iliac crests, tibiae, femors, spine, periosteum, endosteum or other bone cavities.
- the HSC may also be derived from blood, embryonic yolk sac, fetal liver, spleen, peripheral, blood, skin, dermis, or may be derived from ES cells or ES cell cultures.
- the sample may be a tissue sample or a cell suspension or cells derived from either source grown in vitro which allows for interaction of a marker for HA or HAS or fragment thereof to identify the HSC or progeny thereof.
- the sample may also be enriched for CD34+ cells prior to detection of HA or HAS or fragment thereof.
- an appropriate solution can be used to flush the bone, including, but not limited to, salt solution, conveniently supplemented with fetal calf serum (FCS) or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, generally from about 5-25 mM.
- Convenient buffers include, but are not limited to, HEPES, phosphate buffers and lactate buffers. Otherwise bone marrow can be aspirated from the bone in accordance with conventional techniques.
- progeny includes all cells deriving from HSC and includes primitive cells which have not differentiated or specialized to any particular cell type.
- Various methods and products for manipulating haematopoietic stem cells and descriptions of such cells are described and disclosed in a number of publications including WO 02/44345 A1 published Jun. 6, 2002. Further, see descriptions for various means for regulating haematopoietic differentiation within published PCT application WO 00/47163 published Aug. 17, 2000. Still further, see a description of various non-haematopoeitic cells including cardiomyocytes, skeletal muscle cells, derived from human haematopoietic cells and methods of making and using them as described within published PCT WO 00/17326 published Mar. 30, 2000 all of which PCT published applications are incorporated herein by reference in their entirety as are the various patents and other publications cited within them in order to describe and disclose haematopoietic cells and their progeny and related technologies.
- the method of detecting HA or HAS or fragment thereof will be dependent upon the type of sample including the HSC or progeny thereof.
- the sample is exposed or combined with a marker for HA or HAS or fragment thereof in a manner which facilitates the marker interaction with the cells.
- the marker may simply be added to the cell suspension. This is applicable where the marker is intended to physically identify HA or HAS or fragment thereof.
- the marker for HA or HAS or fragments thereof may include any means which identifies HA or HAS or fragments thereof, preferably it is a marker which identifies HA or HAS or fragments thereof on a cell surface which includes but is not limited to antibodies to HA or HAS or fragments thereof, agonists and antagonists against HA or HAS or fragments thereof, binding proteins to HA such as hyaluronic binding protein (HABP) or HAS or fragments thereof, nucleic acid detection systems which can detect expression of HA or HAS either by the presence of DNA, RNA, mRNA or HA or HAS protein, and enzymatic, fluorescence or colourimetric assays for HA or HAS or fragments thereof.
- HABP hyaluronic binding protein
- Binding protein or ligands which bind to HA or HAS or fragments thereof and which may be immobilized may serve as a means for isolation and identification of HA positive cells. Techniques such as panning may utilize these approaches to isolation and identification of HA positive cells. The method of detection will be apparent to the skilled addressee for the type of marker selected.
- the marker may include the addition of labels to enhance the identification of the marker. For instance, fluorescence, radioactivity or enzymatic markers familiar to the skilled addressee may be linked to the marker to enhance detection.
- fragment thereof as it applies to HAS includes portions of HAS which can still identify HAS but is not the full HAS molecule. Examples of this includes epitopes of HAS or active portions of HAS which provide identity to HAS.
- identifying the HSC or progeny thereof having HA or HAS or a fragment thereof by detecting the presence of the binding protein on the HSC or progeny thereof.
- Binding protein especially HA binding protein (HABP) is useful for detecting HA.
- HABP may be obtained from Seikagaku Corporation. However, any equivalent based on the binding protein properties may be used to identify the HA. It is conceivable that the binding portions of the binding protein are identified and synthetically prepared as an indicator or HA. Accordingly, synthetic indicators based on the HABP are within the scope of the present invention.
- HABP HABP
- the binding protein may be further labelled to facilitate the identification of the bound HABP to HSC or their progeny.
- the antibody is any antibody specific for HA or HAS or a fragment thereof.
- the antibody used in the present invention encompasses any antibody or fragment thereof, either native or recombinant, synthetic or naturally-derived, monoclonal or polyclonal which retains sufficient specificity to bind specifically to the HA or HAS or a fragment thereof which is indicative of HA or HAS.
- the terms “antibody” or “antibodies” include the entire antibody and antibody fragments containing functional portions thereof.
- the term “antibody” includes any monospecific or bispecific compound comprised of a sufficient portion of the light chain variable region and/or the heavy chain variable region to effect binding to the epitope to which the whole antibody has binding specificity.
- the fragments can include the variable region of at least one heavy or light chain immunoglobulin polypeptide, and include, but are not limited to, Fab fragments, F(ab′) 2 fragments, and Fv fragments.
- the recombinant antibody can be produced by any recombinant means known in the art.
- Such recombinant antibodies include, but are not limited to, fragments produced in bacteria and non-human antibodies in which the majority of the constant regions have been replaced by human antibody constant regions.
- such “humanized” antibodies can be obtained by host vertebrates genetically engineered to express the recombinant antibody.
- the monospecific domains can be attached by any method known in the art to another suitable molecule compound.
- the attachment can be, for instance, chemical or by genetic engineering.
- the antibodies can be conjugated to other suitable molecules and compounds including, but not limited to, enzymes, magnetic beads, colloidal magnetic beads, haptens, fluorochromes, metal compounds, radioactive compounds, chromatography resins, solid supports or drugs.
- the enzymes that can be conjugated to the antibodies include, but are not limited to, alkaline phosphatase, peroxidase, urease and ⁇ -galactosidase.
- the fluorochromes that can be conjugated to the antibodies include, but are not limited to, fluorescein isothiocyanate, tetramethylrhodamine isothiocyanate, phycoerythrin, allophycocyanins and Texas Red.
- the metal compounds that can be conjugated to the antibodies include, but are not limited to, ferritin, colloidal gold, and particularly, colloidal superparamagnetic beads.
- the haptens that can be conjugated to the antibodies include, but are not limited to, biotin, digoxigenin, oxazalone, and nitrophenol.
- the radioactive compounds that can be conjugated or incorporated into the antibodies are known to the art, and include but are not limited to technetium 99m, 125 I and amino acids comprising any radionuclides, including, but not limited to 14 C, 3 H and 35 S.
- the antibodies to HA or HAS or fragments thereof may be obtained by methods known in the art for production of antibodies or functional portions thereof. Such methods include, but are not limited to, separating B cells with cell-surface antibodies of the desired specificity, cloning the DNA expressing the variable regions of the light and heavy chains and expressing the recombinant genes in a suitable host cell. Standard monoclonal antibody generation techniques can be used wherein the antibodies are obtained from immortalized antibody-producing hybridoma cells. These hybridomas can be produced by immunizing animals with HSCs or progeny thereof, and fusing B lymphocytes from the immunized animals, preferably isolated from the immunized host spleen, with compatible immortalized cells, preferably a B cell myeloma.
- Antibodies to HA or HAS or fragments thereof may be obtained from any source. They may be commercially available. Effectively, any means which detects the presence of HA or HAS or fragments of HA or HAS on the cells is with the scope of the present invention.
- An example of such an antibody is a pan-species ⁇ HA polyclonal sheep antibody from Biogenesis.
- a pre-enrichment step for CD34 + cells is made by methods used in the art. Following this step, HA or HAS determination may be made.
- the step of using additional markers may be applied separately or in combination with a marker for HA or HAS or a fragment thereof.
- the various sub-populations may be distinguished by levels of expression of HA or HAS. This may manifest as expressed HA on the cell surface which may be detected by the methods outlined herein.
- the present invention may be used to distinguish between various phenotypes of the HSC population including, but not limited to, the CD34 + , CD38 ⁇ , CD90 + (thy1) and Lin ⁇ cells.
- the cells identified are selected from the group including, but not limited to, CD34 + , CD38 ⁇ , CD90+ (thy 1), or Lin ⁇ .
- the present invention thus encompasses methods of enriching a population for HSCs or progeny thereof.
- the methods involve combining a mixture of HSCs or progeny thereof with an antibody or marker or binding protein that recognizes and binds to HA or HAS or fragments thereof under conditions which allow the antibody or marker to bind to HA or HAS or a fragment thereof and separating the cells recognized by the antibody or marker to obtain a population substantially enriched in HSCs or progeny thereof.
- the methods can be used as a diagnostic assay for the number of HSCs or progeny thereof in a sample.
- the cells and antibody or marker are combined under conditions sufficient to allow specific binding of the antibody or marker to HA or HAS and the HSCs or progeny thereof which are then quantitated.
- the HSCs or progeny thereof can be isolated or further purified.
- the marker is a HA binding protein (HABP) which binds to HA.
- HABP HA binding protein
- a suitable source of HABP is Seigaku Corporation.
- the cell population may be obtained from any source of HSCs or progeny thereof including those samples discussed above.
- the detection for the presence of HA or HAS or a fragment thereof may be conducted in any way to identify HA or HAS on the cells.
- the detection is by use of a marker or binding protein for HA or HAS.
- the marker for HA or HAS may be any of the markers discussed above.
- antibodies or binding proteins to HA or HAS are particularly useful as a marker for HA or HAS.
- HA or HAS or a fragment of HA or HAS may be detected.
- the whole molecule of HA or HAS will be detected.
- portions of the molecule which distinguish the molecule will be equally as effective.
- Monoclonal antibodies and binding proteins are particularly useful for identifying cell lineages and/or stages of differentiation.
- the antibodies can be attached to a solid support to allow for crude separation.
- the separation techniques employed should maximize the retention of viability of the fraction to be collected.
- Various techniques of different efficacy can be employed to obtain “relatively crude” separations. The particular technique employed will depend upon efficiency of separation, associated cytotoxicity, ease and speed of performance, and necessity for sophisticated equipment and/or technical skill.
- Procedures for separation or enrichment can include, but are not limited to, magnetic separation, using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents joined to a monoclonal antibody or used in conjunction with a monoclonal antibody, including, but not limited to, complement and cytotoxins, and “panning” with antibody attached to a solid matrix, e.g., plate, elutriation or any other convenient technique.
- separation or enrichment techniques include, but are not limited to, those based on differences in physical (density gradient centrifugation and counter-flow centrifugal elutriation), cell surface (lectin and antibody affinity), and vital staining properties (mitochondria-binding dye rho123 and DNA-binding dye, Hoescht 33342).
- Techniques providing accurate separation include, but are not limited to, FACS, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, impedence channels, etc. Any method which can isolate and distinguish these cells according to levels of expression of HA may be used.
- a first separation typically starting with about 1 ⁇ 10 10 , preferably at about 5 ⁇ 10 8-9 cells, antibodies or binding proteins to HA or HAS or fragments thereof can be labeled with at least one fluorochrome, while the antibodies or binding proteins for the various dedicated lineages, can be conjugated to at least one different fluorochrome. While each of the lineages can be separated in a separate step, desirably the lineages are separated at the same time as one is positively selecting for HA or HAS and/or other HSC markers.
- the cells can be selected against dead cells, by employing dyes associated with dead cells (including but not limited to, propidium iodide (PI)).
- PI propidium iodide
- cells are initially separated by a coarse separation, followed by a fine separation, with positive selection with antibodies to HA or HAS or fragments thereof. It is preferred that a pre-enrichment step is applied which enriches CD34+ cells prior to identification of HA or HAS.
- a method of obtaining a cell population enriched in HSCs or progeny thereof comprising the steps of:
- the binding protein is as described above.
- a method of obtaining a cell population enriched in HSCs or progeny thereof comprising the steps of:
- markers for those cell populations may be used.
- specific markers for specific cell lineages such as lymphoid, myeloid or erythroid lineages may be used to enrich for or against these cells. These markers may be used to enrich for HSCs or progeny thereof by removing or selecting out mesenchymal or keratinocyte stem cells.
- Suitable positive stem cell markers include, but are not limited to, CD34 + , Thy-1 + , and c-kit + .
- an enriched population of HSCs or progeny thereof prepared by the methods described herein.
- HA or HAS may be reversed to provide a population substantially devoid of HSCs or progeny thereof.
- the method used above to select for those cells expressing HA or HAS can be used to select out the same cells leaving a population stripped of the HSCs or progeny thereof.
- HA or HAS is detected by using an antibody or binding protein to HA or HAS or a fragment thereof. More preferably, the HA is detected by the binding protein HABP.
- the marker, binding protein or antibody is attached to the HSC or progeny thereof, any method described above for isolation may be used to distinguish and select out for HSC or progeny thereof.
- the HSCs or progeny thereof may be isolated by any of the methods used for enrichment as described above with the added step of isolating the HSC.
- Useful techniques include magnetic separation, using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents joined to a monoclonal antibody or used in conjunction with a monoclonal antibody, including, but not limited to, complement and cytotoxins, and “panning” with antibody attached to a solid matrix, e.g., plate, elutriation or any other convenient technique.
- a solid matrix e.g., plate, elutriation or any other convenient technique.
- Persons skilled in the art would be familiar with these techniques and can employ any known techniques providing HA or HAS is selected for.
- the binding protein is as described above.
- Any antibody presently available which is specific for HA or HAS may be used.
- a suitable antibody is a pan-species ⁇ HA polyclonal sheep antibody from Biogenesis.
- HSC or progeny thereof population is isolated, further isolation techniques may be employed to isolate sub-populations within the HSCs or progeny thereof.
- Specific markers including cell selection systems such as FACS for cell lineages may be used to identify and isolate the various cell lineages.
- the cell is CD34 + , HA + . More preferably, the cell is CD34 + , thy1, HA + . Most preferably, the cell is CD34 + , CD38 ⁇ , thy1 + , HA + .
- the present invention also provides in another aspect, a composition of enriched HSC and progeny thereof comprising an enriched population of cells including CD34 + , CD38 ⁇ , thy1 + , and HA + cells.
- compositions are enriched for HSC or progeny thereof, these may be used in autologous engraftment. Further, the use of autologous HSCs or progeny thereof will avoid graft-versus-host disease.
- the cells can be modified by appropriate gene transfer, to correct genetic defects or provide genetic capabilities naturally lacking in the HSCs or progeny thereof or their progeny, either as to the individual or as to the HSC generally.
- the HSC composition can be used to isolate and define factors associated with their regeneration and differentiation.
- the binding protein is as described above.
- obtaining a cell population comprising HSC or progeny thereof; combining the cell population with an antibody for HA or HAS or fragment thereof;
- Quantifying the amount of selected HSCs or progeny thereof provides for a means of diagnosis of a HSC associated condition such as, but not limited to normal and malignant conditions or more specifically, leukaemia, carcinomas, or sarcomas or general infections which can cause an increase in the activity of HSC or their progeny, particularly in the haematopoietic stem cell populations, more specifically in the lymphoid lineages of those populations.
- the quantitation may provide an indication of the B and T cells which may differentiate from the lymphoid lineages to provide for the production of antibodies, regulation of the cellular immune system, detection of foreign agents in the blood, detection of cells foreign to the host, and the like.
- the myeloid lineage which includes monocytes, granulocytes, megakaryocytes as well as other cells, monitors for the presence of foreign bodies in the blood stream, provides protection against neoplastic cells, scavenges foreign materials in the blood stream, produces platelets, and the like.
- the erythroid lineage provides the red blood cells, which act as oxygen carriers.
- the method may be performed by comparing the antibody treated sample having the HSC or their progeny identified from the cell population with a non-treated sample to identify that component which comprises the HSC.
- the whole cell numbers can be counted in the control. For diagnostic purposes it is considered that multiple samples may be measured and the fluctuations of cell numbers compared to monitor increasing or decreasing levels of HSC or their progeny.
- compositions for detecting HSC or progeny thereof in a population comprising an indicator of HA or HAS or a fragment thereof and a carrier.
- the indicator of HA or HAS or fragment thereof may include any detection means which can identify HA or HAS or a fragment thereof on a HSC or progeny thereof.
- the indicator is an antibody or binding protein to HA or HAS or a fragment thereof.
- the binding protein may be HABP.
- the antibody may detect the full molecule of HA or HAS or detect specific peptide sequences contained within HAS which are indicative of HAS.
- composition may also comprise additional markers to distinguish specific cell lineages.
- the invention also provides for methods of diagnosing conditions associated with HSCs or progeny thereof by identifying the presence of HSC or progeny thereof in a cell population. For instance, increased or decreased levels of haematopoietic stem cells may indicate abnormalities in the blood. This may be important in diseases such as leukaemia, similarly, increases may translate to increase in HSCs or progeny thereof differentiating to lymphoid lineages including T and B cells indicating infection. Other methods may measure HA or HAS expression on leukemia or other malignancies.
- HA or HAS modulating expression and/or activity of HA or HAS or a fragment thereof in a HSC or progeny thereof.
- HA or HAS is expressed in the HSC or progeny thereof. Prior to proliferation, levels of expression of HA or HAS change consistent with subsequent proliferation or differentiation of the cell. By modulating the expression and/or activity of HA or HAS in the cell, proliferation or differentiation of the cell may be controlled.
- modulating expression and/or activity of hyaluronic acid means modifying or altering the expression and/or activity of HA or HAS compared to unmodified levels.
- controlling proliferation and/or differentiation of a cell encompasses the step of increasing the extent of growth and/or reproduction of the cell or specialization of the cell relative to an unmodulated cell either in vitro or in vivo.
- An increase or decrease in cell proliferation in cell culture can be detected by counting the number of cells before and after exposure to a molecule of interest.
- the extent of proliferation can be quantified via microscopic examination of the degree of confluency.
- Cell proliferation can also be quantified using a thymidine incorporation assay.
- An increase or decrease in cell differentiation may be detected by identifying differentiated cell types which have specialized into various somatic or progenitor cell types. Identification may be carried out using cell markers known by the skilled addressee to identify cell types.
- “Activity” as used herein relates to a function of a HA or HAS in a HSC cell, and includes the ability of HAS to synthesize HA or of HA to bind to chaperone, or upstream or downstream effector molecules thereby activating or repressing upstream or downstream pathways which affect proliferation or differentiation.
- modulating expression and/or activity includes modifying or altering the expression and/or activity of HA or HAS, compared to unmodified levels of HA or HAS. Expression and/or activity may be increased or decreased compared to unmodified levels to increase or decrease proliferation or differentiation.
- Modulation of HA or HAS expression and/or activity in the HSC may be achieved using antagonists, inhibitors, mimetics or derivatives of the HA or HAS.
- antagonists or “inhibitor”, as used herein, refer to a molecule which, when bound to either HA or HAS, blocks or modulates the activity of HA or HAS.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, antibodies or any other molecules including ligands which bind to HA or HAS.
- a suitable ligand is HABP which may bind to HA.
- Proteins may include enzymes such as hyaluronidase which can break down HA and therefore affect the level of HA exposed on the HSC.
- Other modulators of the activity and/or expression of HA or HAS include a range of rationally-designed, synthetic inhibitors.
- a suitable concentration of HABP is in the range of 5-20 ⁇ g/ml. In the case of hyaluronidase this may be used at 0.1 units per ml for approximately 15 min at room temperature or equivalent condition.
- Modulation may be an increase or a decrease in expression and/or activity of an HAS gene or HAS activity, a change in binding characteristics, or any other change in the biological, functional or immunological properties.
- Modulators include, but are not limited to upstream and downstream regulators of HAS for expression and activity of the enzyme.
- mimetic refers to a molecule, the structure of which is developed from knowledge of the structure of HA or HAS or portions thereof and, as such, is able to effect some or all of the actions of HA or HAS-like molecules.
- Modulation of HA or HAS expression and/or activity may be achieved by direct or indirect methods. Modulation of expression and/or activity of HA or HAS may be achieved using direct methods known to those of skill in the art and include, but are not limited to, knockout technology, antisense technology, triple helix technology, targeted mutation, gene therapy, regulation by agents acting on transcription. Indirect methods for modulating expression and/or activity of HA or HAS may include targeting upstream or downstream regulators such as cytokines.
- Inhibition of expression and/or activity of HA or HAS may be achieved using a wide variety of inhibitors that target HA or HAS expression and/or activity either directly or indirectly. Inhibition may be achieved by inhibiting upstream or downstream targets involved in HA or HAS function.
- a method of treating a HSC associated condition comprising administering an effective amount of a composition comprising an enriched population of HSC or progeny thereof and wherein said HSC or progeny thereof, said enriched population of HSC or progeny thereof prepared by the methods described herein.
- HSC associated condition means any condition which results from an interaction with HSC or progeny thereof or is dependent upon HSC or progeny thereof.
- HSC associated conditions may include anemia (including macrocytic and aplastic anemia); thrombocytopenia; hypoplasia; disseminated intravascular coagulation (DIC); myelodysplasia; immune (autoimmune) thrombocytopenic purpura (ITP); and HIV induced ITP and malignant conditions including leukaemia.
- Treatment refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disease or disorder as well as those in which the disease or disorder is to be prevented.
- compositions of the present invention which comprise HSC or progeny hereof isolated by the described methods can find use in a number of ways.
- These cells can be used to fully reconstitute an immunocompromised host such as an irradiated host and/or a host subject to chemotherapy; or as a source of cells for specific lineages, by providing for their maturation, proliferation and differentiation into one or more selected lineages by employing a variety of factors, including, but not limited to, erythropoietin, colony stimulating factors, e.g., GM-CSF, G-CSF, or M-CSF, interleukins, e.g., IL-1, -2, -3, -4, -5, -6, -7, -8, etc., or the like, or stromal cells associated with the HSCs or progeny thereof becoming committed to a particular lineage, or with their proliferation, maturation and differentiation.
- factors including, but not limited to, erythropoietin, colony stimulating factors, e.g., GM-CSF, G-CSF, or M-CSF, interleukins, e.g
- HA and HAS has been found to be involved in the spatial distribution of the cells following transplantation.
- Treatment of the cells with hyaluronidase affects the spatial distribution of the cells.
- cells used for transplantation or reconstitution of patient's hematopoietic system may be pretreated with compounds which inhibit the removal of HA or preserve the level of expression of HA or HAS to achieve a normal cell type and distribution.
- the HSCs and progeny thereof can also be used in the isolation and evaluation of factors associated with the differentiation and maturation of hematopoietic cells.
- the invention encompasses the use of hematopoietic stem cells in assays to determine the activity of media, such as conditioned media, or to evaluate fluids for cell growth activity, involvement with dedication of particular lineages, or the like.
- the HSCs can be used for the treatment of genetic diseases.
- the invention encompasses treatment of genetic diseases associated with HSCs by genetic modification of autologous or allogeneic stem cells to correct the genetic defect.
- diseases including, but not limited to, beta.-thalassemia, sickle cell anemia, adenosine deaminase deficiency, recombinase deficiency, recombinase regulatory gene deficiency, etc. may be corrected by introduction of a wild-type gene into the haematopoietic stem cells, either by homologous or random recombination.
- Gene therapy includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA.
- Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo.
- Suitable drug resistance genes include, but are not limited to, the gene encoding the multi-drug resistance (MDR) protein.
- Diseases other than those associated with hematopoietic cells can also be treated by genetic modification, where the disease is related to the lack of a particular secreted product including, but not limited to, hormones, enzymes, interferons, growth factors, or the like.
- a particular secreted product including, but not limited to, hormones, enzymes, interferons, growth factors, or the like.
- inducible production of the deficient protein can be achieved, so that production of the protein will parallel natural production, even though production will be in a different cell type from the cell type that normally produces such protein.
- a method of treating a HSC associated condition wherein said condition results from uncontrolled proliferation of HSCs or progeny thereof comprising
- HA or HAS reducing expression and/or activity of HA or HAS or a fragment thereof in a HSC or progeny thereof.
- Typical conditions in which uncontrolled proliferation occurs is in malignant conditions such as leukaemia including acute myeloid leukaemia (AML) and chronic myeloid leukaemia (CML).
- AML acute myeloid leukaemia
- CML chronic myeloid leukaemia
- human leukaemic cells exhibit elevated levels of HA.
- human leukaemic cell lines (HL-60, Mo7e and K562) express one or more HAS genes and synthesise high levels of HA which is efficiently removed by hyaluronidase.
- increased HA synthesis by leukaemic blasts from patient AML, CML, acute lymphoid leukaemia (ALL), chronic lymphoid leukaemia (CLL), PLL, chronic monmoylocytic leukaemia (CMML), bi-phenotypic, and Hairy Cell leukaemic samples (Table 1 has been shown).
- HA and HAS are expressed at high levels. Controlling the level of HA expression can affect the proliferation of these cells. Decreasing the level of expression of HA can decrease the level of proliferation. This may be achieved by any of the methods described above for modulating the expression and/or activity of HA or HAS.
- a suitable modulator may be administered.
- the modulator may be administered by a variety of routes, including but not limited to, nasally, orally, transdermally, intramuscularly, intraperitoneally, subcutaneously, or intravenously.
- cells may be retrovirally transduced cells with HAS antisense.
- a method of treating a HSC associated condition wherein said condition results from differentiation of HSCs or progeny thereof comprising controlling expression and/or activity of HA or HAS or a fragment thereof in a HSC or progeny thereof .
- a method of treating a HSC associated condition wherein said condition results from differentiation of HSCs or progeny thereof comprising reducing expression and/or activity of HA or HAS or a fragment thereof in a HSC or progeny thereof.
- differentiation can be controlled particularly in cancers which result from uncontrolled differentiation. Modulation may be conducted as described above.
- mice Six to 8 week old BALB/c H-2D, and congenic C57B1/6J (Ly5.2) and PTRPA (Ly5.1) mice were purchased from Animal Resources Center (Perth, WA, Australia) and housed clean conventionally for at least a week prior to experimental use.
- CD44 ⁇ / ⁇ mice (2) were kindly donated by Dr Tak Mak (Amgen Institute, Ontario Cancer Institute, University of Toronto). All mice received mouse chow (Barastok, St. Arnaud, Victoria, Australia) and acidified water ad libitum.
- Murine Bone marrow mononuclear cells of low density ( ⁇ 1.0777 g/cm 3 ) were isolated by discontinuous density centrifugation using Nycoprep for animals (Accurate Chemical and Scientific Corporation, Westbury, N.Y.). The isolated cells were washed in buffer prior to further manipulation. Lin ⁇ cells were isolated in a similar manner to that previously described (1).
- low density cells were labelled with a cocktail of biotinylated or unconjugated primary rat anti-mouse antibodies: anti-B220 (CD45R; B cells); anti-Mac-1 (CD11b; macrophages); anti-Gr-1 (Ly-6G; neutrophils); anti-Lyt-2 (CD8), anti-L3T4 (CD4), anti CD3, and anti CD5 (T cells); and anti-Ter119 (erythroid cells).
- Each batch of antibody was evaluated by flow cytometric analysis for the concentration that resulted in the greatest shift in mean channel fluorescence and/or the percentage positive cells detected.
- the cells were washed in buffer, and resuspended in 1.5 ml of PBS, 5 mM EDTA, and 1% bovine serum albumin (BSA)/10 8 cells. Up to 2 ml of the cells were then added to the column (D column, maximum capacity 1 ⁇ 10 9 cells, generally not run at more than half the maximum stated capacity), run into the mesh, and left to magnetize for 5 minutes.
- the Lin ⁇ cells (non-magnetic fraction) were collected by eluting the cells through a 20-gauge needle with 50 mls of PBS, 5 mM EDTA, and 1% BSA.
- Rhodaminel23 (Rh) labelling Lin ⁇ cells were washed in buffer, resuspended at 1 ⁇ 10 6 /ml and incubated in a final Rh (Molecular Probes, Eugene, Oreg.) concentration of 0.1 ⁇ g/ml (diluted in buffer) for 20 minutes at 37° C. in the dark. The cells were centrifuged, resuspended at 10 6 cells/ml, allowed to efflux for 15 min at 37° C. in the dark, centrifuged, and resuspended at 10 8 cells/ml in PBS 0.5% HI FCS.
- cells were labeled with a cocktail of lineage antibodies including anti CD19, CD20, and CD24 (B cells and erythroid cells); anti CD3, CD2 and CD56 (T cells and NK cells); anti CD16, CD66b and CD11b (granulocytes and monocytes); anti CD14, CD36 (monocytes, platelets and erythroid cells).
- Lin + cells were removed by immunomagnetic selection using goat anti-mouse IgG microbeads and the MACS system as described above.
- Hyaluronic acid labeling The presence of hyaluronic acid (HA) on the cell surface was detected using a final concentration of 20 ⁇ g/ml of biotinylated hyaluronic acid binding protein (HABP; Seikagaku, Tokyo, Japan) on ice for 20 min. Cells were washed, and labeled with strepavidin-PE or Red-670 (Gibco BRL, Grand Island, N.Y.) as described above.
- HABP biotinylated hyaluronic acid binding protein
- Hyaluronidase Treatment To ensure that HABP labeling was specific, as well as to assess the importance of cell surface HA on the spatial distribution of engrafting cells, marrow sub-populations were treated with 0.1U hyaluronidase (HY) (Sigma Aldrich) for 15 min at 21° C. to remove HA. Cells were washed in PBS 0.5% HI FCS.
- HY hyaluronidase
- Cell Culture Cells to be cultured were sorted directly into 96 well plates containing 100 ⁇ l of serum deprived media containing multiple cytokines and various concentrations of HABP.
- Murine cells were cultured in Iscove's Modified Dulbecco's Medium (Gibco BRL) containing 1% BSA, 10 ⁇ g/ml human insulin, 200 ⁇ g/ml human transferin, 0.05 mM 2-Mwrcaptoethanol and 21 ⁇ g/ml LDL.
- Human cells were cultured in X Vivo 10 media (Bio Whittaker, Verviers, Belgium) containing 0.5% buminate (Baxter, Glendale, Calif.).
- the spatial distribution of transplanted cells was determined by analysing the location of CFSE labeled cells (positive cells) from at least 6 longitudinal sections per transplant recipient. Central longitudinal sections were analyzed as opposed to transverse sections, as each individual section encompasses more of the entire femur. To ensure that individual cells were only analyzed once, every alternate 3.5 ⁇ m section was analyzed.
- the location of positive cells were designated as either endosteal (previously arbitrarily defined as within 12 cells of the endosteum (3)) or central (greater than 12 cells from either endosteum) (1).
- RNA extraction was extracted using an RNAzol B (Bresatec, SA, Australia) extraction method. Briefly, cells were centrifuged, and RNA prepared by lysing the cells with 0.2 ml/10 6 cells of RNAzol B. The homogenate was chloroform extracted and isopropanol precipitated. RNA was washed, dried and resuspended in sterile water.
- RT-PCR Reverse transcriptase-polymerase chain reaction
- PCR was performed using the following oligonucleatide primers: murine Has-1 sense (5′ CGTGGACTACGTGCAGGTCTGTG 3′) (Seq ID No: 1) and antisense (5′ GAGCGCGAGGTATACTTGGTAGC 3′) (Seq ID No: 2), murine Has-2 sense (5′ GACCACACAGACAGGCGGA 3′) (Seq ID No:3) and antisense (5′ TCCCAGGGTAGGTCAGCCTT 3′) (Seq ID No:4), murine Has-3 sense 3′ 5 ′ (5′ GAGCGTGTGC GAGCTGTGGT GTG 3′) (Seq ID No:5) and antisense (5′ GAAGCATCTCAATGGTGCAGGCT 3′) (Seq ID No:6), human HAS-1 sense (5′ GCTACCAAGTACACCTCCAGGTC 3′) (Seq ID No:7) and antisense (5′ CGCGTAGAACAGACGCAGCACAG 3′) (Seq ID No:
- PCR were performed in a 25 ⁇ l volume under 30 ⁇ l of paraffin oil in a gene machine (Innovonics, Melbourne, Australia). Each PCR consisted of 1 ⁇ Taq gold buffer, 200 ⁇ M dNTPS (Boehringer Mannheim, Branchburg, N.J.), 4 ⁇ g/ml of each primer, 1.5 mM MgCl 2 , 10% DMSO, and 0.5 U Taq Gold (Boehringer Mannheim). PCRs were performed with a profile of 10 min of Taq gold activation at 94° C. for the first cycle and 30 sec denaturing for subsequent cycles, 30 sec of annealing at 60° C. for 10 cycles followed by 30 sec of annealing at 55° C. for a further 25 cycles, and 30 sec extension at 72° C. for the 35 cycles followed by a final 5 min extension at 72° C.
- HABP hyaluronic acid binding protein
- Lin ⁇ Rh123 dull cells isolated from CD44 ⁇ / ⁇ mice (2) exhibited binding of HABP (25.0% compared to 26.5%), demonstrating that HA detected on the cell surface is not due to the binding of exogenous HA to its major receptor CD44 (19) but due to de-novo synthesis by primitive hemopoietic cells themselves.
- RT-PCR analysis demonstrated that Lin ⁇ Sca + Kit + , Lin ⁇ HABP + but not HABP ⁇ cells express Has-1, Has-2 and Has-3 ( FIG. 2 a+b ).
- HA is synthesized by and expressed on murine and human hemopoietic populations enriched for HSC.
- mice were injected with either 5000-6000 Lin ⁇ HABP + cells (4 mice) or 500 Lin ⁇ Sca + HABP + cells (2 mice) and analyzed 4-8 weeks post-transplant.
- Peripheral blood was collected, and the red blood cells lysed using ammonium chloride.
- the percentage donor cells was determined using LY5.1 antibody labeling, and was 9 ⁇ 1.7% and 9.4 ⁇ 0.02% following a transplant of 5000-6000 Lin ⁇ HABP + cells or 500 Lin ⁇ Sca + HABP + cells respectively.
- White blood cells were labeled for macrophages and granulocytes (MAC-1/GR-1), B cells (B220) and T cells (CD4/CD8) and the proportion of donor analyzed using an Ly5.1 antibody*.
- Both murine and putative human HSC (Lin ⁇ Sca + Kit + and Lin ⁇ CD34 + CD38 ⁇ cells respectively) were cultured in serum free conditions in the presence of multiple cytokines consisting of either SCF (75ng/ml), IL-11, FLT3 Ligand and IL-6 (all 100 ng/ml) or G-CSF, SCF, FLT3 Ligand, MGDF (all 100 ng/ml), Il-6 and IL-3 (both 10 ng/ml) for murine and human HSC respectively, and various concentrations of HABP. As shown in FIG. 5 this resulted in a significant inhibition of cell proliferation corresponding to the presence of increasing concentrations of HABP.
- HA was thought to be regulating hemopoiesis through a progenitor ancestral to the common myeloid and lymphoid progenitor.
- this observed growth regulatory role of HA is very similar to that recently described for the sialomucin PSGL-1: P-Selectin interaction (9).
- PSGL-1 has now been shown to be a potent negative regulator of human hemopoietic progenitors.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Virology (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Developmental Biology & Embryology (AREA)
- Diabetes (AREA)
- General Engineering & Computer Science (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Oncology (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11/933,633 US7718379B2 (en) | 2001-10-30 | 2007-11-01 | Identifying haematopoietic stem cells based on cell surface markers |
| US12/727,697 US20110020314A1 (en) | 2001-10-30 | 2010-03-19 | Identifying haematopoietic stem cells based on cell surface markers |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPR8565 | 2001-10-30 | ||
| AUPR8565A AUPR856501A0 (en) | 2001-10-30 | 2001-10-30 | Detection of haematopoietic stem cells and progeny and uses thereof |
| PCT/AU2002/001443 WO2003038071A1 (en) | 2001-10-30 | 2002-10-24 | Detection of haematopoietic stem cells and progeny and uses thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2002/001443 Continuation-In-Part WO2003038071A1 (en) | 2001-10-30 | 2002-10-24 | Detection of haematopoietic stem cells and progeny and uses thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/933,633 Continuation US7718379B2 (en) | 2001-10-30 | 2007-11-01 | Identifying haematopoietic stem cells based on cell surface markers |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20050003460A1 true US20050003460A1 (en) | 2005-01-06 |
Family
ID=3832387
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/837,038 Abandoned US20050003460A1 (en) | 2001-10-30 | 2004-04-30 | Detection of haematopoietic stem cells and progeny and uses thereof |
| US11/933,633 Expired - Fee Related US7718379B2 (en) | 2001-10-30 | 2007-11-01 | Identifying haematopoietic stem cells based on cell surface markers |
| US12/727,697 Abandoned US20110020314A1 (en) | 2001-10-30 | 2010-03-19 | Identifying haematopoietic stem cells based on cell surface markers |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/933,633 Expired - Fee Related US7718379B2 (en) | 2001-10-30 | 2007-11-01 | Identifying haematopoietic stem cells based on cell surface markers |
| US12/727,697 Abandoned US20110020314A1 (en) | 2001-10-30 | 2010-03-19 | Identifying haematopoietic stem cells based on cell surface markers |
Country Status (7)
| Country | Link |
|---|---|
| US (3) | US20050003460A1 (https=) |
| EP (1) | EP1451303A4 (https=) |
| JP (2) | JP4354275B2 (https=) |
| AU (2) | AUPR856501A0 (https=) |
| CA (1) | CA2464956A1 (https=) |
| IL (2) | IL161690A0 (https=) |
| WO (1) | WO2003038071A1 (https=) |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030228635A1 (en) * | 2002-02-15 | 2003-12-11 | Renovar, Inc. | Cell proliferation assays and methods |
| US20100145032A1 (en) * | 2007-01-18 | 2010-06-10 | Suomen Punainen Risti, Veripalelu | Novel carbohydrate profile compositions from human cells and methods for analysis and modification thereof |
| US9228952B2 (en) | 2012-07-11 | 2016-01-05 | Canon Kabushiki Kaisha | Hematopoietic stem cell identification probe |
| US11608486B2 (en) | 2015-07-02 | 2023-03-21 | Terumo Bct, Inc. | Cell growth with mechanical stimuli |
| US11613727B2 (en) | 2010-10-08 | 2023-03-28 | Terumo Bct, Inc. | Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system |
| US11624046B2 (en) | 2017-03-31 | 2023-04-11 | Terumo Bct, Inc. | Cell expansion |
| US11629332B2 (en) | 2017-03-31 | 2023-04-18 | Terumo Bct, Inc. | Cell expansion |
| US11634677B2 (en) | 2016-06-07 | 2023-04-25 | Terumo Bct, Inc. | Coating a bioreactor in a cell expansion system |
| US11667876B2 (en) | 2013-11-16 | 2023-06-06 | Terumo Bct, Inc. | Expanding cells in a bioreactor |
| US11667881B2 (en) | 2014-09-26 | 2023-06-06 | Terumo Bct, Inc. | Scheduled feed |
| US11685883B2 (en) | 2016-06-07 | 2023-06-27 | Terumo Bct, Inc. | Methods and systems for coating a cell growth surface |
| US11795432B2 (en) | 2014-03-25 | 2023-10-24 | Terumo Bct, Inc. | Passive replacement of media |
| US11965175B2 (en) | 2016-05-25 | 2024-04-23 | Terumo Bct, Inc. | Cell expansion |
| US12043823B2 (en) | 2021-03-23 | 2024-07-23 | Terumo Bct, Inc. | Cell capture and expansion |
| US12152699B2 (en) | 2022-02-28 | 2024-11-26 | Terumo Bct, Inc. | Multiple-tube pinch valve assembly |
| US12234441B2 (en) | 2017-03-31 | 2025-02-25 | Terumo Bct, Inc. | Cell expansion |
| USD1099116S1 (en) | 2022-09-01 | 2025-10-21 | Terumo Bct, Inc. | Display screen or portion thereof with a graphical user interface for displaying cell culture process steps and measurements of an associated bioreactor device |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170318781A1 (en) * | 2016-05-03 | 2017-11-09 | Cattle Time, Llc | Combined visual and rf identification (rfid) tag |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030032621A1 (en) * | 2000-02-11 | 2003-02-13 | Florence Smadja-Joffe | Means for regulating hematopoietic differentiation |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6875753B1 (en) * | 1996-03-14 | 2005-04-05 | The Governors Of The University Of Alberta | Methods for cell mobilization using in vivo treatment with hyaluronan (HA) |
| EP1064011A1 (en) * | 1998-03-13 | 2001-01-03 | EntreMed, Inc. | Metastatin and hyaluronate binding proteins and methods of use |
| WO2000017326A1 (en) | 1998-09-21 | 2000-03-30 | Musc Foundation For Research Development | Non-hematopoietic cells, including cardiomyocytes and skeletal muscle cells, derived from hematopoietic stem cells and methods of making and using them |
| FR2789587B1 (fr) * | 1999-02-11 | 2003-01-24 | Inst Nat Sante Rech Med | Moyens pour la regulation de la differenciation hematopoietique |
| WO2002044345A1 (en) * | 2000-12-01 | 2002-06-06 | The General Hospital Corporation | Methods and products for manipulating hematopoietic stem cells |
-
2001
- 2001-10-30 AU AUPR8565A patent/AUPR856501A0/en not_active Abandoned
-
2002
- 2002-10-24 JP JP2003540336A patent/JP4354275B2/ja not_active Expired - Fee Related
- 2002-10-24 EP EP02769779A patent/EP1451303A4/en not_active Withdrawn
- 2002-10-24 CA CA002464956A patent/CA2464956A1/en not_active Abandoned
- 2002-10-24 IL IL16169002A patent/IL161690A0/xx unknown
- 2002-10-24 WO PCT/AU2002/001443 patent/WO2003038071A1/en not_active Ceased
- 2002-10-24 AU AU2002335921A patent/AU2002335921B2/en not_active Ceased
-
2004
- 2004-04-30 US US10/837,038 patent/US20050003460A1/en not_active Abandoned
-
2007
- 2007-11-01 US US11/933,633 patent/US7718379B2/en not_active Expired - Fee Related
-
2009
- 2009-06-08 JP JP2009136863A patent/JP2009232853A/ja active Pending
-
2010
- 2010-03-19 US US12/727,697 patent/US20110020314A1/en not_active Abandoned
- 2010-04-28 IL IL205407A patent/IL205407A0/en unknown
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030032621A1 (en) * | 2000-02-11 | 2003-02-13 | Florence Smadja-Joffe | Means for regulating hematopoietic differentiation |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030228635A1 (en) * | 2002-02-15 | 2003-12-11 | Renovar, Inc. | Cell proliferation assays and methods |
| US20100145032A1 (en) * | 2007-01-18 | 2010-06-10 | Suomen Punainen Risti, Veripalelu | Novel carbohydrate profile compositions from human cells and methods for analysis and modification thereof |
| US11773363B2 (en) | 2010-10-08 | 2023-10-03 | Terumo Bct, Inc. | Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system |
| US11613727B2 (en) | 2010-10-08 | 2023-03-28 | Terumo Bct, Inc. | Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system |
| US11746319B2 (en) | 2010-10-08 | 2023-09-05 | Terumo Bct, Inc. | Customizable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system |
| US9228952B2 (en) | 2012-07-11 | 2016-01-05 | Canon Kabushiki Kaisha | Hematopoietic stem cell identification probe |
| US11667876B2 (en) | 2013-11-16 | 2023-06-06 | Terumo Bct, Inc. | Expanding cells in a bioreactor |
| US11708554B2 (en) | 2013-11-16 | 2023-07-25 | Terumo Bct, Inc. | Expanding cells in a bioreactor |
| US11795432B2 (en) | 2014-03-25 | 2023-10-24 | Terumo Bct, Inc. | Passive replacement of media |
| US11667881B2 (en) | 2014-09-26 | 2023-06-06 | Terumo Bct, Inc. | Scheduled feed |
| US12065637B2 (en) | 2014-09-26 | 2024-08-20 | Terumo Bct, Inc. | Scheduled feed |
| US11608486B2 (en) | 2015-07-02 | 2023-03-21 | Terumo Bct, Inc. | Cell growth with mechanical stimuli |
| US11965175B2 (en) | 2016-05-25 | 2024-04-23 | Terumo Bct, Inc. | Cell expansion |
| US11634677B2 (en) | 2016-06-07 | 2023-04-25 | Terumo Bct, Inc. | Coating a bioreactor in a cell expansion system |
| US11999929B2 (en) | 2016-06-07 | 2024-06-04 | Terumo Bct, Inc. | Methods and systems for coating a cell growth surface |
| US11685883B2 (en) | 2016-06-07 | 2023-06-27 | Terumo Bct, Inc. | Methods and systems for coating a cell growth surface |
| US12077739B2 (en) | 2016-06-07 | 2024-09-03 | Terumo Bct, Inc. | Coating a bioreactor in a cell expansion system |
| US11629332B2 (en) | 2017-03-31 | 2023-04-18 | Terumo Bct, Inc. | Cell expansion |
| US11702634B2 (en) | 2017-03-31 | 2023-07-18 | Terumo Bct, Inc. | Expanding cells in a bioreactor |
| US11624046B2 (en) | 2017-03-31 | 2023-04-11 | Terumo Bct, Inc. | Cell expansion |
| US12234441B2 (en) | 2017-03-31 | 2025-02-25 | Terumo Bct, Inc. | Cell expansion |
| US12359170B2 (en) | 2017-03-31 | 2025-07-15 | Terumo Bct, Inc. | Expanding cells in a bioreactor |
| US12570960B2 (en) | 2017-03-31 | 2026-03-10 | Terumo Bct, Inc. | Expanding cells in a bioreactor |
| US12043823B2 (en) | 2021-03-23 | 2024-07-23 | Terumo Bct, Inc. | Cell capture and expansion |
| US12152699B2 (en) | 2022-02-28 | 2024-11-26 | Terumo Bct, Inc. | Multiple-tube pinch valve assembly |
| US12209689B2 (en) | 2022-02-28 | 2025-01-28 | Terumo Kabushiki Kaisha | Multiple-tube pinch valve assembly |
| USD1099116S1 (en) | 2022-09-01 | 2025-10-21 | Terumo Bct, Inc. | Display screen or portion thereof with a graphical user interface for displaying cell culture process steps and measurements of an associated bioreactor device |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2464956A1 (en) | 2003-05-08 |
| IL205407A0 (en) | 2011-07-31 |
| EP1451303A4 (en) | 2006-03-08 |
| JP4354275B2 (ja) | 2009-10-28 |
| IL161690A0 (en) | 2004-09-27 |
| US20080076148A1 (en) | 2008-03-27 |
| EP1451303A1 (en) | 2004-09-01 |
| AUPR856501A0 (en) | 2001-11-29 |
| JP2005506849A (ja) | 2005-03-10 |
| US20110020314A1 (en) | 2011-01-27 |
| JP2009232853A (ja) | 2009-10-15 |
| US7718379B2 (en) | 2010-05-18 |
| WO2003038071A1 (en) | 2003-05-08 |
| AU2002335921B2 (en) | 2008-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7718379B2 (en) | Identifying haematopoietic stem cells based on cell surface markers | |
| Nilsson et al. | Hyaluronan is synthesized by primitive hemopoietic cells, participates in their lodgment at the endosteum following transplantation, and is involved in the regulation of their proliferation and differentiation in vitro | |
| AU2002335921A1 (en) | Detection of haematopoietic stem cells and progeny and uses thereof | |
| Siena et al. | Therapeutic relevance of CD34 cell dose in blood cell transplantation for cancer therapy | |
| EP0787181B1 (en) | Methods of obtaining compositions enriched for hematopoietic stem cells, compositions derived therefrom and methods of use thereof | |
| US7101708B1 (en) | Hematopoietic cell composition for use in transplantation | |
| Sharpe III et al. | The origin and in vivo significance of murine and human culture-expanded endothelial progenitor cells | |
| Adamiak et al. | Evidence for the involvement of sphingosine-1-phosphate in the homing and engraftment of hematopoietic stem cells to bone marrow | |
| US20240011988A1 (en) | Cell preparation, use of protein in characterizing hematopoietic stem cells, and method for determining hematopoietic stem cells | |
| Tong et al. | Expression and clinical significance of stem cell marker CD133 in human neuroblastoma | |
| Zhang et al. | Recruitment of CD8+ T cells into bone marrow might explain the suppression of megakaryocyte apoptosis through high expression of CX3CR1+ in prolonged isolated thrombocytopenia after allogeneic hematopoietic stem cell transplantation | |
| WO2009146495A1 (en) | Method for predicting engraftment potential | |
| van Pel et al. | CD97 is differentially expressed on murine hematopoietic stem-and progenitor-cells | |
| US20240272156A1 (en) | Compositions and methods for identifying and isolating human hematopoietic stem and progenitor cells | |
| Basu et al. | Role of thrombomodulin expression on hematopoietic stem cells | |
| US20200138871A1 (en) | Selection and use of umbilical cord cell fractions suitable for transplantation | |
| JPWO2004005496A1 (ja) | 臍帯血、骨髄、末梢血等に含まれる新規な未分化幹細胞集団 | |
| US20140154219A1 (en) | Methods and compositions for large-scale isolation of very small embryonic-like (vsel) stem cells | |
| US12357659B2 (en) | Production of megakaryocytes or platelets from monocytes | |
| De Boer et al. | Homing and clonogenic outgrowth of CD34+ peripheral blood stem cells: A role for L-selectin? | |
| US20040029188A1 (en) | Method for the detection of human hematopoietic short term repopulating cells | |
| Pedrazzoli et al. | Negative immunomagnetic purging of peripheral blood stem cell harvests from breast carcinoma patients reduces tumor cell contamination while not affecting hematopoietic recovery | |
| HK40076006A (en) | Cell preparation, use of protein in characterizing hematopoietic stem cells, and method for determining hematopoietic stem cells | |
| Al-Amoodi et al. | Little Goes a Long Way in Cord Blood Transplantation as Adhesion Treatment of CD34-Negative HSCs Improves Navigation | |
| Vercauteren et al. | CD33 Expression is Absent on Primitive Acute Myeloid Leukemia Progenitors from Most Patients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: THE PETER MACCALLUM CANCER INSTITUTE, AUSTRALIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:NILSSON, SUSAN KAYE;SIMMONS, PAUL JOHN;HAYLOCK, DAVID NORMAN;REEL/FRAME:015213/0058 Effective date: 20040521 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |