US20040259214A1 - Process for the preparation of D-pantothenic acid and/or salts thereof - Google Patents

Process for the preparation of D-pantothenic acid and/or salts thereof Download PDF

Info

Publication number
US20040259214A1
US20040259214A1 US10/167,645 US16764502A US2004259214A1 US 20040259214 A1 US20040259214 A1 US 20040259214A1 US 16764502 A US16764502 A US 16764502A US 2004259214 A1 US2004259214 A1 US 2004259214A1
Authority
US
United States
Prior art keywords
gene
process according
codes
pantothenic acid
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/167,645
Inventor
Thomas Hermann
Birgit Witteck
Mechthild Rieping
Daniela Kruse
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Operations GmbH
Original Assignee
Degussa GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Degussa GmbH filed Critical Degussa GmbH
Publication of US20040259214A1 publication Critical patent/US20040259214A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/174—Vitamins

Definitions

  • the present invention relates to a process for the preparation of D-pantothenic acid and salts thereof or mixtures comprising these compounds using microorganisms of the Enterobacteriaceae family in which at least the cysK gene is enhanced.
  • Pantothenic acid is produced worldwide in an order of magnitude of several thousand tons a year. It is used inter alia in human medicine, in the pharmaceuticals industry and in the foodstuffs industry. A large portion of the pantothenic acid produced is used for nutrition of stock animals such as poultry and pigs.
  • Pantothenic acid can be prepared by chemical synthesis, or biotechnologically by fermentation of suitable microorganisms in suitable nutrient solutions.
  • chemical synthesis DL-pantolactone is an important precursor. It is prepared in a multi-stage process from formaldehyde, isobutylaldehyde and cyanide, and in further process steps, the racemic mixture is separated, D-pantolactone is subjected to a condensation reaction with ⁇ -alanine, and D-pantothenic acid is obtained in this way.
  • the typical commercial form is the calcium salt of D-pantothenic acid.
  • the calcium salt of the racemic mixture of D,L-pantothenic acid is also customary.
  • the advantage of the fermentative preparation by microorganisms lies in the direct formation of the desired stereoisomeric form, that is to say the D-form, which is free from L-pantothenic acid.
  • E. coli Escherichia coli
  • Arthrobacter ureafaciens Corynebacterium erythrogenes
  • Brevibacterium ammoniagenes and also yeasts, such as e.g. Debaromyces castellii
  • yeasts such as e.g. Debaromyces castellii
  • D-pantothenic acid in a nutrient solution which comprises glucose, DL-pantoic acid and ⁇ -alanine, as shown in EP-A 0 493 060.
  • EP-A 0 493 060 furthermore shows that in the case of E. coli , the formation of D-pantothenic acid is improved by amplification of pantothenic acid biosynthesis genes from E. coli which are contained on the plasmids pFV3 and pFV5 in a nutrient solution comprising glucose, DL-pantoic acid and ⁇ -alanine.
  • EP-A 0 590 857 and U.S. Pat. No. 5,518,906 describe mutants derived from E. coli strain IF03547, such as FV5714, FV525, FV814, FV521, FV221, FV6051 and FV5069, which carry resistances to various antimetabolites, such as salicylic acid, ⁇ -ketobutyric acid, ⁇ -hydroxyaspartic acid, O-methylthreonine and ⁇ -ketoisovaleric acid. They produce pantoic acid in a nutrient solution comprising glucose, and D-pantothenic acid in a nutrient solution comprising glucose and ⁇ -alanine.
  • panB, panC and panD which are said to be contained on the plasmid pFV31, in the above-mentioned strains the production of D-pantoic acid in nutrient solutions comprising glucose and the production of D-pantothenic acid in a nutrient solution comprising glucose and ⁇ -alanine is improved.
  • WO 97/10340 furthermore reports on the favorable effect of the enhancement of the ilvGM operon on the production of D-pantothenic acid.
  • EP-A-1001027 reports on the effect of the enhancement of the panE gene on the formation of D-pantothenic acid.
  • the D-pantothenic acid or the corresponding salt is isolated from the fermentation broth and purified (EP-A-0590857 and WO 96/33283) and used accordingly in purified form, or the fermentation broth comprising D-pantothenic acid is dried in total (EP-A-1050219) and used in particular as a feedstuffs additive.
  • the invention provides a process for the preparation of D-pantothenic acid and/or salts thereof using microorganisms of the Enterobacteriaceae family which in particular already produce D-pantothenic acid and in which at least one, preferably endogenous nucleotide sequence(s) which code(s) for the cysK gene is enhanced, in particular over-expressed.
  • the process is a process which is characterized in that the following steps are carried out:
  • the gene which codes for cysteine synthase A and optionally alleles of this gene are enhanced, in particular over-expressed, under conditions suitable for the formation of the gene product;
  • pantothenic acid biosynthesis pathway further genes of the pantothenic acid biosynthesis pathway are optionally attenuated or enhanced at the same time in order to increase the production of pantothenic acid;
  • the fermentation is optionally carried out in the presence of alkaline earth metal compounds, these being added to the fermentation broth continuously or discontinuously in preferably stoichiometric amounts;
  • the invention also provides a process in which, after conclusion of the fermentation, some or all ( ⁇ 0 to 100%) of the biomass remains in the fermentation broth, and the broth obtained in this way is processed, optionally after concentration, to a solid mixture which comprises D-pantothenic acid and/or salts thereof and preferably comprises further constituents from the fermentation broth.
  • FIG. 1 Map of the plasmid pTrc99AcysK containing the cysK gene.
  • lacI Gene for the repressor protein of the trc promoter
  • cysK Coding region of the cysK gene
  • rrnBT rRNA terminator region
  • HindIII Restriction endonuclease from Haemophilus influenzae R d
  • PvuII Restriction endonuclease from Proteus vulgaris
  • D-pantothenic acid or pantothenic acid or pantothenate are mentioned in the following text, this means not only the free acids but also the salts of D-pantothenic acid, such as e.g. the calcium, sodium, ammonium or potassium salt.
  • Endogenous genes or “endogenous nucleotide sequences” are understood as meaning the genes or nucleotide sequences present in the population of a species.
  • the term “enhancement” in this connection describes the increase in the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, of the ORF (Open Reading Frame) or ORFs, using a potent promoter or a gene or allele or ORF which codes for a corresponding enzyme or protein with a high activity, and optionally combining these measures.
  • ORF Open Reading Frame
  • the activity or concentration of the corresponding enzyme or protein is in general increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on that of the wild-type protein or wild-type enzyme or the activity or concentration of the protein or enzyme in the starting microorganism.
  • the microorganisms which the present invention provides can produce D-pantothenic acid from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. They are representatives of Enterobacteriaceae, in particular of the genus Escherichia . Of the genus Escherichia , the specie Escherichia coli is to be mentioned in particular. Within the species Escherichia coli the so-called K-12 strains, such as e. g. the strains MG1655 or W3110 (Neidhard et al.: Escherichia coli and Salmonella .
  • Suitable D-pantothenic acid-producing strains of the genus Escherichia in particular of the species Escherichia coli , are, for example
  • Enterobacteriaceae produce D-pantothenic acid in an improved manner after enhancement, in particular over-expression of the cysK gene.
  • the use of endogenous genes is preferred.
  • the number of copies of the corresponding genes can be increased, or the promoter and regulation region or the ribosome binding site upstream of the structural gene can be mutated.
  • Expression cassettes which are incorporated upstream of the structural gene act in the same way.
  • inducible promoters it is additionally possible to increase the expression in the course of fermentative D-pantothenic acid production.
  • the expression is likewise improved by measures to prolong the life of the m-RNA.
  • the enzyme activity is also increased by preventing the degradation of the enzyme protein.
  • the genes or gene constructs can either be present in plasmids with a varying number of copies, or can be integrated and amplified in the chromosome.
  • an over-expression of the genes in question can furthermore be achieved by changing the composition of the media and the culture procedure.
  • Plasmid vectors which are capable of replication in Enterobacteriaceae such as e.g. cloning vectors derived from pACYC184 (Bartolomé et al.; Gene 102, 75-78 (1991)), pTrc99A (Amann et al.; (Gene 69:301-315 (1988)) or pSC101 derivatives (Vocke and Bastia, Proceedings of the National Academy of Science USA 80 (21):6557-6561 (1983)) can be used.
  • a strain transformed with one or more plasmid vectors where the plasmid vector(s) carries at least one nucleotide sequence which codes for the cysK gene can be employed in a process according to the invention.
  • panB gene which codes for ketopantoate hydroxymethyl transferase (U.S. Pat. No. 5,518,906)
  • panE gene which codes for ketopantoate reductase (EP-A-1001027)
  • panD gene which codes for aspartate decarboxylase (U.S. Pat. No. 5,518,906)
  • panC gene which codes for pantothenate synthetase (U.S. Pat. No. 5,518,906)
  • aldH gene which codes for NADP-dependent aldehyde dehydrogenase (Heim and Strehler, Gene 99:15-23 (1991)) and
  • the term “attenuation” in this connection describes the reduction or elimination of the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by using a weak promoter or using a gene or allele which codes for a corresponding enzyme or protein with a low activity or inactivates the corresponding gene or enzyme (protein), and optionally combining these measures.
  • the activity or concentration of the corresponding protein is in general reduced to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein or of the activity or concentration of the protein in the starting microorganism.
  • the microorganisms produced according to the invention can be cultured in the batch process (batch culture), the fed batch (feed process) or the repeated fed batch process (repetitive feed process).
  • batch culture the fed batch
  • feed process the repeated fed batch process
  • Storhas Bioreaktoren und periphere Mahen [Bioreactors and Peripheral Equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).
  • the culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981).
  • Sugars and carbohydrates such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substances can be used individually or as a mixture.
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea
  • inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen.
  • the sources of nitrogen can be used individually or as a mixture.
  • Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
  • the culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth.
  • essential growth substances such as amino acids and vitamins, can be employed in addition to the abovementioned substances.
  • Precursors of pantothenic acid, such as aspartate, ⁇ -alanine, ketoisovalerate, ketopantoic acid or pantoic acid and optionally salts thereof, can moreover be added to the culture medium.
  • the starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture in a suitable manner.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds, such as phosphoric acid or sulfiric acid, can be employed in a suitable manner to control the pH of the culture.
  • alkaline earth metal salts of pantothenic acid in particular the calcium salt or magnesium salt
  • an inorganic compound containing an alkaline earth metal such as, for example, calcium hydroxide or MgO
  • an organic compound such as the alkaline earth metal salt of an organic acid, for example calcium acetate
  • the cation necessary for preparation of the desired alkaline earth metal salt of D-pantothenic acid is introduced into the fermentation broth directly in the desired amount, preferably in an amount of 0.95 to 1.1 equivalents.
  • the salts can also be formed after conclusion of the fermentation by addition of the inorganic or organic compounds to the fermentation broth, from which the biomass has optionally been removed beforehand.
  • Antifoams such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam. Suitable substances having a selective action, e.g. antibiotics, can be added to the medium to maintain the stability of plasmids.
  • oxygen or oxygen-containing gas mixtures such as e.g. air, are introduced into the culture.
  • the temperature of the culture is usually 25° C. to 45° C., and preferably 30° C. to 40° C.
  • the pH is in general between 5.0 to 8.0, preferably 5.5 to 7.6.
  • the fermentation is continued until a maximum of D-pantothenic acid has formed. This target is usually reached within 10 hours to 160 hours.
  • the D-pantothenic acid or the corresponding salts of D-pantothenic acid contained in the fermentation broth can then be isolated and purified in accordance with known procedures.
  • the fermentation broths comprising D-pantothenic acid and/or salts thereof preferably first to be freed from all or some of the biomass by known separation methods, such as, for example, centrifugation, filtration, decanting or a combination thereof.
  • known separation methods such as, for example, centrifugation, filtration, decanting or a combination thereof.
  • the biomass in its entirety in the fermentation broth.
  • the suspension or solution is preferably concentrated and then worked up to a powder, for example with the aid of a spray dryer or a freeze-drying unit. This powder is then in general converted by suitable compacting or granulating processes, e. g.
  • auxiliary substances or carriers such as starch, gelatin, cellulose derivatives or similar substances, such as are conventionally used as binders, gelling agents or thickeners in foodstuffs or feedstuffs processing, or further substances, such as, for example, silicas, silicates or stearates.
  • the fermentation product with or without further of the conventional fermentation constituents, can be absorbed, in particular sprayed, on to an organic or inorganic carrier substance which is known and conventional in feedstuffs processing, such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or stabilized with conventional thickeners or binders.
  • feedstuffs processing such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or stabilized with conventional thickeners or binders.
  • mixtures comprising the carrier substances can also be processed to a product with the desired particle size distribution by granulation processes.
  • D-Pantothenic acid and/or the desired salt of D-pantothenic acid or a formulation comprising these compounds is optionally added in a suitable process stage during or after the fermentation in order to achieve or establish the content of pantothenic acid desired in the product or the desired salt.
  • the desired content of pantothenic acid and/or the desired salt is in general in the range from 20 to 80 wt. % (based on the dry weight).
  • pantothenic acid can be determined with known chemical (Velisek; Chromatographic Science 60, 515-560 (1992)) or microbiological methods, such as e.g. the Lactobacillus plantarum test (DIFCO MANUAL, 10 th Edition, p. 1100-1102; Michigan, USA).
  • the cysK gene from E. coli K12 is amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides. Starting from the nucleotide sequence of the cysK gene in E. coli K12 MG1655 (Accession Number AE000329, Blattner et al. (Science 277, 1453-1462 (1997)), PCR primers are synthesized (MWG Biotech, Ebersberg, Germany). Primer cysK5′: 5′ - CAGTTAAGGACAGGCCATGAG - 3′ (SEQ ID No. 1) Primer cysK3′: 5′ - GCTGGCATTACTGTTGCAATTC - 3′ (SEQ ID No. 2)
  • the chromosomal E. coli K12 MG1655 DNA employed for the PCR is isolated according to the manufacturer's instructions with “Qiagen Genomic-tips 100/G” (QIAGEN, Hilden, Germany). A DNA fragment approx. 1000 bp in size can be amplified with the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) with Pfu-DNA polymerase (Promega Corporation, Madison, USA).
  • the PCR product is ligated according to the manufacturer's instructions with the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen, Groningen, The Netherlands) and transformed into the E. coli strain TOP10. Selection of plasmid-carrying cells takes place on LB agar, to which 50 ⁇ g/ml kanamycin are added.
  • the vector pCR-Blunt II-TOPO-cysK is cleaved with the restriction enzymes SpeI and XbaI and, after separation in 0.8% agarose gel, the cysK fragment is isolated with the aid of the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany).
  • the vector pTrc99A (Amersham Biosciences, Freiburg, Germany) is cleaved with the enzyme XbaI, subsequently dephosphorylated with alkaline phosphatase according to the manufacturer's instructions (Amersham Biosciences, Freiburg, Germany) and ligated with the cysK fragment isolated.
  • coli strain XL1-Blue MRF' (Stratagene, La Jolla, USA) is transformed with the ligation batch and plasmid-carrying cells are selected on LB agar, to which 50 ⁇ g/ml ampicillin is added. Successful cloning can be demonstrated after plasmid DNA isolation by control cleavage with the enzymes HindIII and PvuII. The plasmid is called pTrc99AcysK (FIG. 1).
  • a selected ⁇ -hydroxyaspartic acid-resistant individual colony is then incubated on minimal agar, which comprises 2 g/L glucose and 0.2 g/L O-methylthreonine, at 37° C.
  • minimal agar which comprises 2 g/L glucose and 0.2 g/L O-methylthreonine
  • FE6-1 is resistant to L-valines, ⁇ -ketoisovaleric acid, ⁇ -hydroxyaspartic acid and O-methylthreonine.
  • the plasmids pTrc99A and pTrc99AcysK are transformed individually into the strain FE6-1 and plasmid-carrying cells are selected on LB agar, to which 50 ⁇ g/ml ampicillin are added.
  • the strains obtained are called FE6-1/pTrc99A and FE6-1pTrc99AcysK.
  • pantothenate production of the E. coli strains FE6-1/pTrc99A and FE6-1/pTrc99AcysK is checked in batch cultures of 10 ml contained in 100 ml conical flasks.
  • the concentration of the D-pantothenate formed is then determined in the culture supernatant centrifuged off by means of High Performance Liquid Chromatography [column: Reversed Phase MZ-Aqua Perfect (diameter 4,6 mm), mobile Phase 25 mM acetate buffer with 10% methanol, flow rate 1 ml/min, RI detector].

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Animal Husbandry (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Fodder In General (AREA)
  • Feed For Specific Animals (AREA)

Abstract

A process for the preparation of D-pantothenic acid and/or salts thereof or feedstuffs additives comprising these by fermentation of microorganisms of the Enterobacteriaceae family, in particular those which already produce D-pantothenic acid, in which the nucleotide sequence(s) in the microorganisms which code(s) for the cysK gene is/are enhanced, in particular over-expressed.

Description

    BACKGROUND OF THE INVENTION
  • 1. Field of the Invention [0001]
  • The present invention relates to a process for the preparation of D-pantothenic acid and salts thereof or mixtures comprising these compounds using microorganisms of the Enterobacteriaceae family in which at least the cysK gene is enhanced. [0002]
  • 2. Description of the Background [0003]
  • Pantothenic acid is produced worldwide in an order of magnitude of several thousand tons a year. It is used inter alia in human medicine, in the pharmaceuticals industry and in the foodstuffs industry. A large portion of the pantothenic acid produced is used for nutrition of stock animals such as poultry and pigs. [0004]
  • Pantothenic acid can be prepared by chemical synthesis, or biotechnologically by fermentation of suitable microorganisms in suitable nutrient solutions. In the chemical synthesis, DL-pantolactone is an important precursor. It is prepared in a multi-stage process from formaldehyde, isobutylaldehyde and cyanide, and in further process steps, the racemic mixture is separated, D-pantolactone is subjected to a condensation reaction with β-alanine, and D-pantothenic acid is obtained in this way. [0005]
  • The typical commercial form is the calcium salt of D-pantothenic acid. The calcium salt of the racemic mixture of D,L-pantothenic acid is also customary. [0006]
  • The advantage of the fermentative preparation by microorganisms lies in the direct formation of the desired stereoisomeric form, that is to say the D-form, which is free from L-pantothenic acid. [0007]
  • Various types of bacteria, such as e.g. [0008] Escherichia coli (E. coli), Arthrobacter ureafaciens, Corynebacterium erythrogenes, Brevibacterium ammoniagenes, and also yeasts, such as e.g. Debaromyces castellii, can produce D-pantothenic acid in a nutrient solution which comprises glucose, DL-pantoic acid and β-alanine, as shown in EP-A 0 493 060. EP-A 0 493 060 furthermore shows that in the case of E. coli, the formation of D-pantothenic acid is improved by amplification of pantothenic acid biosynthesis genes from E. coli which are contained on the plasmids pFV3 and pFV5 in a nutrient solution comprising glucose, DL-pantoic acid and β-alanine.
  • EP-A 0 590 857 and U.S. Pat. No. 5,518,906 describe mutants derived from [0009] E. coli strain IF03547, such as FV5714, FV525, FV814, FV521, FV221, FV6051 and FV5069, which carry resistances to various antimetabolites, such as salicylic acid, α-ketobutyric acid, β-hydroxyaspartic acid, O-methylthreonine and α-ketoisovaleric acid. They produce pantoic acid in a nutrient solution comprising glucose, and D-pantothenic acid in a nutrient solution comprising glucose and β-alanine. It is furthermore stated in EP-A 0 590 857 and U.S. Pat. No. 5,518,906 that after amplification of the pantothenic acid biosynthesis genes panB, panC and panD, which are said to be contained on the plasmid pFV31, in the above-mentioned strains the production of D-pantoic acid in nutrient solutions comprising glucose and the production of D-pantothenic acid in a nutrient solution comprising glucose and β-alanine is improved.
  • WO 97/10340 furthermore reports on the favorable effect of the enhancement of the ilvGM operon on the production of D-pantothenic acid. Finally, EP-A-1001027 reports on the effect of the enhancement of the panE gene on the formation of D-pantothenic acid. [0010]
  • According to known procedures, the D-pantothenic acid or the corresponding salt is isolated from the fermentation broth and purified (EP-A-0590857 and WO 96/33283) and used accordingly in purified form, or the fermentation broth comprising D-pantothenic acid is dried in total (EP-A-1050219) and used in particular as a feedstuffs additive. [0011]
    • SUMMARY OF THE INVENTION
  • It is an object of the invention to provide new methods for improved fermentative preparation of D-pantothenic acid and/or salts thereof, and animal feedstuffs additives comprising these compounds. [0012]
  • The invention provides a process for the preparation of D-pantothenic acid and/or salts thereof using microorganisms of the Enterobacteriaceae family which in particular already produce D-pantothenic acid and in which at least one, preferably endogenous nucleotide sequence(s) which code(s) for the cysK gene is enhanced, in particular over-expressed. [0013]
  • In particular, the process is a process which is characterized in that the following steps are carried out: [0014]
  • a) fermentation of microorganisms of the Enterobacteriaceae family which produce D-pantothenic acid and in which at least the cysK gene is enhanced, in particular over-expressed; [0015]
  • the gene which codes for cysteine synthase A and optionally alleles of this gene are enhanced, in particular over-expressed, under conditions suitable for the formation of the gene product; [0016]
  • further genes of the pantothenic acid biosynthesis pathway are optionally attenuated or enhanced at the same time in order to increase the production of pantothenic acid; [0017]
  • b) the fermentation is optionally carried out in the presence of alkaline earth metal compounds, these being added to the fermentation broth continuously or discontinuously in preferably stoichiometric amounts; [0018]
  • c) concentration of the D-pantothenic acid or the corresponding salts in the medium or the fermentation broth or optionally in the cells of the microorganisms of the Enterobacteriaceae family; and [0019]
  • d) after conclusion of the fermentation, isolation of the D-pantothenic acid, and/or of the corresponding salt(s). [0020]
  • The invention also provides a process in which, after conclusion of the fermentation, some or all (≧0 to 100%) of the biomass remains in the fermentation broth, and the broth obtained in this way is processed, optionally after concentration, to a solid mixture which comprises D-pantothenic acid and/or salts thereof and preferably comprises further constituents from the fermentation broth. [0021]
  • These further constituents are, above all, the dissolved compounds which originate from the feed medium and soluble organic compounds which are formed. [0022]
  • A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following Figures in conjunction with the detailed description below.[0023]
    • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1: Map of the plasmid pTrc99AcysK containing the cysK gene. [0024]
  • The length data are to be understood as approx. data. The abbreviations and designations used have the following meaning: [0025]
  • Amp: Ampicillin resistance gene [0026]
  • lacI: Gene for the repressor protein of the trc promoter [0027]
  • Ptrc: trc promoter region, IPTG-inducible [0028]
  • cysK: Coding region of the cysK gene [0029]
  • 5S: 5S rRNA region [0030]
  • rrnBT: rRNA terminator region [0031]
  • bps Base pairs [0032]
  • The abbreviations for the restriction enzymes have the following meaning: [0033]
  • HindIII: Restriction endonuclease from [0034] Haemophilus influenzae Rd
  • PvuII: Restriction endonuclease from [0035] Proteus vulgaris
  • XbaI: Restriction endonuclease from [0036] Xanthomonas campestris
    • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • When D-pantothenic acid or pantothenic acid or pantothenate are mentioned in the following text, this means not only the free acids but also the salts of D-pantothenic acid, such as e.g. the calcium, sodium, ammonium or potassium salt. [0037]
  • “Endogenous genes” or “endogenous nucleotide sequences” are understood as meaning the genes or nucleotide sequences present in the population of a species. [0038]
  • The term “enhancement” in this connection describes the increase in the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, of the ORF (Open Reading Frame) or ORFs, using a potent promoter or a gene or allele or ORF which codes for a corresponding enzyme or protein with a high activity, and optionally combining these measures. [0039]
  • By enhancement measures, in particular over-expression, the activity or concentration of the corresponding enzyme or protein is in general increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on that of the wild-type protein or wild-type enzyme or the activity or concentration of the protein or enzyme in the starting microorganism. [0040]
  • The microorganisms which the present invention provides can produce D-pantothenic acid from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. They are representatives of Enterobacteriaceae, in particular of the genus [0041] Escherichia. Of the genus Escherichia, the specie Escherichia coli is to be mentioned in particular. Within the species Escherichia coli the so-called K-12 strains, such as e. g. the strains MG1655 or W3110 (Neidhard et al.: Escherichia coli and Salmonella. Cellular and Molecular Biology (ASM Press, Washington D.C.)) or the Escherichia coli wild type strain IFO3547 (Institute of Fermentation, Osaka, Japan) and mutants derived from these which have the ability to produce D-pantothenic acid are suitable.
  • Suitable D-pantothenic acid-producing strains of the genus [0042] Escherichia, in particular of the species Escherichia coli, are, for example
  • [0043] Escherichia coli FV5069/pFV31
  • [0044] Escherichia coli FV5069/pFV202
  • [0045] Escherichia coli FE6/pFE80 and
  • [0046] Escherichia coli KE3
  • It has been found that Enterobacteriaceae produce D-pantothenic acid in an improved manner after enhancement, in particular over-expression of the cysK gene. The use of endogenous genes is preferred. [0047]
  • The nucleotide sequences of the genes or open reading frames (ORF) of [0048] Escherichia coli are known, and can also be found in the genome sequence of Escherichia coli published by Blattner et al. (Science 277, 1453-1462 (1997)).
  • The following information, inter alia, on the cysK gene can be found in the following: [0049]
  • Description: Cysteine synthase A, O-acetylserine sulfhydrylase A [0050]
  • Alternative gene name: cysZ [0051]
  • EC No.: 4.2.99.8 [0052]
  • Reference: Boronat et al., Journal of General Microbiology [0053]
  • 130:673-685 (1984) [0054]
  • Accession No.: AE000329 [0055]
  • The gene described in the reference cited above can be used according to the invention. Alleles of the gene or open reading frames which result from the degeneracy of the genetic code or due to sense mutations of neutral function can furthermore be used, the activity of the proteins being substantially unchanged. [0056]
  • To achieve an over-expression, the number of copies of the corresponding genes can be increased, or the promoter and regulation region or the ribosome binding site upstream of the structural gene can be mutated. Expression cassettes which are incorporated upstream of the structural gene act in the same way. By inducible promoters, it is additionally possible to increase the expression in the course of fermentative D-pantothenic acid production. The expression is likewise improved by measures to prolong the life of the m-RNA. Furthermore, the enzyme activity is also increased by preventing the degradation of the enzyme protein. The genes or gene constructs can either be present in plasmids with a varying number of copies, or can be integrated and amplified in the chromosome. Alternatively, an over-expression of the genes in question can furthermore be achieved by changing the composition of the media and the culture procedure. [0057]
  • Instructions in this context can be found by one skilled in the art, inter alia, in Chang and Cohen (Journal of Bacteriology 134:1141-1156 (1978)), in Hartley and Gregori (Gene 13:347-353 (1981)), in Amann and Brosius (Gene 40:183-190 (1985)), in de Broer et al. (Proceedings of the National Academy of Sciences of the United States of America 80:21-25 (1983)), in LaVallie et al. (BIO/TECHNOLOGY 11, 187-193 (1993)), in PCT/US97/13359, in Llosa et al. (Plasmid 26:222-224 (1991)), in Quandt and Klipp (Gene 80:161-169 (1989)), in Hamilton (Journal of Bacteriology 171:4617-4622 (1989), in Jensen and Hammer (Biotechnology and Bioengineering 58, 191-195 (1998) and in known textbooks of genetics and molecular biology. [0058]
  • Plasmid vectors which are capable of replication in Enterobacteriaceae, such as e.g. cloning vectors derived from pACYC184 (Bartolomé et al.; Gene 102, 75-78 (1991)), pTrc99A (Amann et al.; (Gene 69:301-315 (1988)) or pSC101 derivatives (Vocke and Bastia, Proceedings of the National Academy of Science USA 80 (21):6557-6561 (1983)) can be used. A strain transformed with one or more plasmid vectors where the plasmid vector(s) carries at least one nucleotide sequence which codes for the cysK gene can be employed in a process according to the invention. [0059]
  • It may furthermore be advantageous for the production of D-pantothenic acid with strains of the Enterobacteriaceae family, in addition to the enhancement of the cysK gene, for one or more of the genes chosen from the group consisting of [0060]
  • the ilvGM operon which codes for acetohydroxy-acid synthase II (WO 97/10340), [0061]
  • the panB gene which codes for ketopantoate hydroxymethyl transferase (U.S. Pat. No. 5,518,906), [0062]
  • the panE gene which codes for ketopantoate reductase (EP-A-1001027), [0063]
  • the panD gene which codes for aspartate decarboxylase (U.S. Pat. No. 5,518,906), [0064]
  • the panC gene which codes for pantothenate synthetase (U.S. Pat. No. 5,518,906), [0065]
  • the glyA gene which codes for serine hydroxymethyl transferase (Plamann et al., Nucleic Acids Research 11(7):2065-2075(1983)), [0066]
  • the genes gcvT, gcvH and gcvP which code for the glycine cleavage system (Okamura-Ikeda et al., European Journal of Biochemistry 216, 539-548 (1993)), [0067]
  • the serA gene which codes for phosphoglyceric acid dehydrogenase (Tobey und Grant, Journal of Biological Chemistry 261:12179-12183 (1986)), [0068]
  • the serA(FBR) allele which codes for “feed back” resistant variants of phosphoglyceric acid dehydrogenase (DE-A-4232468), [0069]
  • the serC gene which codes for phosphoserine transaminase (Duncan und Coggins, Biochemical Journal 234:49-57 (1986)), [0070]
  • the bfr gene which codes for bacterioferrin (Andrews et al., Journal of Bacteriology 171:3940-3947 (1989)), [0071]
  • the hns gene which codes for the DNA-binding protein HLP-II (reference: Pon et al., Molecular and General Genetics 212:199-202 (1988)), [0072]
  • the pgm gene which codes for phosphoglucomutase (Lu and Kleckner, Journal of Bacteriology 176:5847-5851 (1994)), [0073]
  • the mdh gene which codes for malate dehydrogenase (Sutherland und McAlister-Henn, Journal of Bacteriology 1985 163:1074-1079 (1985)), [0074]
  • the fda gene which codes for fructose bisphosphate aldolase (class II) (Alefounder et al., Biochemical Journal 257:529-534 (1989)), [0075]
  • the dldH gene which codes for NADH-dependent lipoamide dehydrogenase (reference: Stephens et al., European Journal of Biochemistry 135:519-527 (1983)), [0076]
  • the pepB gene which codes for peptidase B (Hermsdorf et al., International Journal of Peptide and Protein Research 13:146-151 (1979); Suzuki et al., Journal of Fermentation and Bioengineering 82:392-397 (1996); Suzuki et at., Journal of Bacteriology 183(4):1489-1490, (2001)), [0077]
  • the aldH gene which codes for NADP-dependent aldehyde dehydrogenase (Heim and Strehler, Gene 99:15-23 (1991)) and [0078]
  • the adk gene which codes for adenylate kinase (Brune et al., Nucleic Acids Research 13:7139-7151 (1985)) [0079]
  • to be enhanced, in particular over-expressed, individually or together. The use of endogenous genes is preferred. [0080]
  • Finally, it may be advantageous for the production of D-pantothenic acid with strains of the Enterobacteriaceae family, in addition to the enhancement of the cysK gene, for one or more of the genes chosen from the group consisting of [0081]
  • the avtA gene which codes for transaminase C (EP-A-1001027) [0082]
  • the poxB gene which codes for pyruvate oxidase (Grabau and Cronan, Nucleic Acids Research. 14 (13), 5449-5460 (1986)) [0083]
  • the pckA gene which codes for PEP carboxykinase (Medina et al., Journal of Bacteriology 172, 7151-7156 (1990)) [0084]
  • to be attenuated, in particular eliminated or expressed at a low level, individually or together. [0085]
  • The term “attenuation” in this connection describes the reduction or elimination of the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by using a weak promoter or using a gene or allele which codes for a corresponding enzyme or protein with a low activity or inactivates the corresponding gene or enzyme (protein), and optionally combining these measures. [0086]
  • By attenuation measures, including reduction in expression, the activity or concentration of the corresponding protein is in general reduced to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein or of the activity or concentration of the protein in the starting microorganism. [0087]
  • In addition to over-expression of the cysK gene it may furthermore be advantageous for the production of D-pantothenic acid to eliminate undesirable side reactions (Nakayama: “Breeding of Amino Acid Producing Microorganisms”, in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982). Bacteria in which the metabolic pathways which reduce the formation of D-pantothenic acid are at least partly eliminated can be employed in the process according to the invention. [0088]
  • The microorganisms produced according to the invention can be cultured in the batch process (batch culture), the fed batch (feed process) or the repeated fed batch process (repetitive feed process). A summary of known culture methods is described in the textbook by Chmiel (Bioprozesstechnik 1. Einführung in die Bioverfahrenstechnik [Bioprocess Technology 1. Introduction to Bioprocess Technology (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and Peripheral Equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)). [0089]
  • The culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981). Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substances can be used individually or as a mixture. [0090]
  • Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen. The sources of nitrogen can be used individually or as a mixture. [0091]
  • Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus. The culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances, such as amino acids and vitamins, can be employed in addition to the abovementioned substances. Precursors of pantothenic acid, such as aspartate, β-alanine, ketoisovalerate, ketopantoic acid or pantoic acid and optionally salts thereof, can moreover be added to the culture medium. The starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture in a suitable manner. [0092]
  • Basic compounds, such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds, such as phosphoric acid or sulfiric acid, can be employed in a suitable manner to control the pH of the culture. [0093]
  • For the preparation of alkaline earth metal salts of pantothenic acid, in particular the calcium salt or magnesium salt, it is equally possible to add the suspension or solution of an inorganic compound containing an alkaline earth metal, such as, for example, calcium hydroxide or MgO, or of an organic compound, such as the alkaline earth metal salt of an organic acid, for example calcium acetate, continuously or discontinuously during the fermentation. For this purpose, the cation necessary for preparation of the desired alkaline earth metal salt of D-pantothenic acid is introduced into the fermentation broth directly in the desired amount, preferably in an amount of 0.95 to 1.1 equivalents. [0094]
  • However, the salts can also be formed after conclusion of the fermentation by addition of the inorganic or organic compounds to the fermentation broth, from which the biomass has optionally been removed beforehand. [0095]
  • Antifoams, such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam. Suitable substances having a selective action, e.g. antibiotics, can be added to the medium to maintain the stability of plasmids. To maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as e.g. air, are introduced into the culture. The temperature of the culture is usually 25° C. to 45° C., and preferably 30° C. to 40° C. The pH is in general between 5.0 to 8.0, preferably 5.5 to 7.6. The fermentation is continued until a maximum of D-pantothenic acid has formed. This target is usually reached within 10 hours to 160 hours. [0096]
  • The D-pantothenic acid or the corresponding salts of D-pantothenic acid contained in the fermentation broth can then be isolated and purified in accordance with known procedures. [0097]
  • It is also possible for the fermentation broths comprising D-pantothenic acid and/or salts thereof preferably first to be freed from all or some of the biomass by known separation methods, such as, for example, centrifugation, filtration, decanting or a combination thereof. However, it is also possible to leave the biomass in its entirety in the fermentation broth. In general, the suspension or solution is preferably concentrated and then worked up to a powder, for example with the aid of a spray dryer or a freeze-drying unit. This powder is then in general converted by suitable compacting or granulating processes, e. g. also build-up granulation, into a coarser-grained, free-flowing, storable and largely dust-free product with a particle size distribution of preferably 20 to 2000 μm, in particular 100 to 1400 μm. In the granulation or compacting it is advantageous to employ conventional organic or inorganic auxiliary substances or carriers, such as starch, gelatin, cellulose derivatives or similar substances, such as are conventionally used as binders, gelling agents or thickeners in foodstuffs or feedstuffs processing, or further substances, such as, for example, silicas, silicates or stearates. [0098]
  • Alternatively, the fermentation product, with or without further of the conventional fermentation constituents, can be absorbed, in particular sprayed, on to an organic or inorganic carrier substance which is known and conventional in feedstuffs processing, such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or stabilized with conventional thickeners or binders. Use examples and processes in this context are described in the literature (Die Mühle+Mischfuttertechnik 132 (1995) 49, page 817). [0099]
  • These mixtures comprising the carrier substances can also be processed to a product with the desired particle size distribution by granulation processes. [0100]
  • D-Pantothenic acid and/or the desired salt of D-pantothenic acid or a formulation comprising these compounds is optionally added in a suitable process stage during or after the fermentation in order to achieve or establish the content of pantothenic acid desired in the product or the desired salt. [0101]
  • The desired content of pantothenic acid and/or the desired salt is in general in the range from 20 to 80 wt. % (based on the dry weight). [0102]
  • The concentration of pantothenic acid can be determined with known chemical (Velisek; Chromatographic Science 60, 515-560 (1992)) or microbiological methods, such as e.g. the [0103] Lactobacillus plantarum test (DIFCO MANUAL, 10th Edition, p. 1100-1102; Michigan, USA).
  • The present invention is explained in more detail in the following with the aid of embodiment examples. [0104]
  • The minimal (M9) and complete media (LB) for [0105] Escherichia coli used are described by J. H. Miller (A Short Course in Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press). The isolation of plasmid DNA from Escherichia coli and all techniques of restriction, ligation, Klenow and alkaline phosphatase treatment are carried out by the method of Sambrook et al. (Molecular cloning—A laboratory manual (1989), Cold Spring Harbor Laboratory Press). The transformation of Escherichia coli is carried out by the method of Chung et al. (Proceedings of the National Academy of Sciences of the United States of America (1989) 86: 2172-2175) or by the method of Chuang et. al. (Nucleic Acids Research (1995) 23: 1641).
    • EXAMPLES
  • Having generally described this invention, a further understanding can be obtained by reference to certain specific examples which are provided herein for purposes of illustration only and are not intended to be limiting unless otherwise specified. [0106]
    • Example 1 Construction of the Expression Plasmid pTrc99AcysK
  • The cysK gene from [0107] E. coli K12 is amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides. Starting from the nucleotide sequence of the cysK gene in E. coli K12 MG1655 (Accession Number AE000329, Blattner et al. (Science 277, 1453-1462 (1997)), PCR primers are synthesized (MWG Biotech, Ebersberg, Germany).
    Primer cysK5′:
    5′ - CAGTTAAGGACAGGCCATGAG - 3′ (SEQ ID No. 1)
    Primer cysK3′:
    5′ - GCTGGCATTACTGTTGCAATTC - 3′ (SEQ ID No. 2)
  • The chromosomal [0108] E. coli K12 MG1655 DNA employed for the PCR is isolated according to the manufacturer's instructions with “Qiagen Genomic-tips 100/G” (QIAGEN, Hilden, Germany). A DNA fragment approx. 1000 bp in size can be amplified with the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) with Pfu-DNA polymerase (Promega Corporation, Madison, USA). The PCR product is ligated according to the manufacturer's instructions with the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen, Groningen, The Netherlands) and transformed into the E. coli strain TOP10. Selection of plasmid-carrying cells takes place on LB agar, to which 50 μg/ml kanamycin are added. After isolation of the plasmid DNA, the vector pCR-Blunt II-TOPO-cysK is cleaved with the restriction enzymes SpeI and XbaI and, after separation in 0.8% agarose gel, the cysK fragment is isolated with the aid of the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany). The vector pTrc99A (Amersham Biosciences, Freiburg, Germany) is cleaved with the enzyme XbaI, subsequently dephosphorylated with alkaline phosphatase according to the manufacturer's instructions (Amersham Biosciences, Freiburg, Germany) and ligated with the cysK fragment isolated. The E. coli strain XL1-Blue MRF' (Stratagene, La Jolla, USA) is transformed with the ligation batch and plasmid-carrying cells are selected on LB agar, to which 50 μg/ml ampicillin is added. Successful cloning can be demonstrated after plasmid DNA isolation by control cleavage with the enzymes HindIII and PvuII. The plasmid is called pTrc99AcysK (FIG. 1).
    • Example 2 Preparation of the Strains FE6-1/pTrc99A and FE6-1/pTrc99AcysK
  • The [0109] E. coli strain FE6 is a valine-resistant mutant of E. coli K12 MG 1655 (U.S. Pat. No. 6,171,845) and is deposited as DSM12379 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ=German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany). Starting from FE6, after incubation at 37° C. on minimal agar, to which 2 g/L glucose and 1 g/L β-hydroxyaspartic acid are added, spontaneous mutants are isolated. A selected β-hydroxyaspartic acid-resistant individual colony is then incubated on minimal agar, which comprises 2 g/L glucose and 0.2 g/L O-methylthreonine, at 37° C. After this step, a mutant called FE6-1 is resistant to L-valines, α-ketoisovaleric acid, β-hydroxyaspartic acid and O-methylthreonine. A pure culture of the strain FE6-1 was deposited on 8 Sep. 2000 as DSM13721 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ=German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany).
  • The plasmids pTrc99A and pTrc99AcysK are transformed individually into the strain FE6-1 and plasmid-carrying cells are selected on LB agar, to which 50 μg/ml ampicillin are added. The strains obtained are called FE6-1/pTrc99A and FE6-1pTrc99AcysK. [0110]
    • Example 3 Preparation of D-Pantothenic Acid with Strains Derived From FE6-1
  • The pantothenate production of the [0111] E. coli strains FE6-1/pTrc99A and FE6-1/pTrc99AcysK is checked in batch cultures of 10 ml contained in 100 ml conical flasks. For this, 10 ml of preculture medium of the following composition: 2 g/l yeast extract, 10 g/l (NH4)2SO4, 1 g/l KH2PO4, 0,5 g/l MgSO4*7H2O, 15 g/l CaCO3, 20 g/l glucose, 50 mg/l ampicillin are inoculated with an individual colony and incubated for 20 hours at 33° C. and 200 rpm on an ESR incubator from Kühner AG (Birsfelden, Switzerland). In each case 200 μl of this preculture are transinoculated into 10 ml of production medium (25 g/l (NH4)2SO4, 2 g/l KH2PO4, 1 g/l MgSO4*7H2O, 0.03 g/l. glucose, 50 mg/l ampicillin are inoculated with an individual colony and incubated for 20 hours at 33° C. and 200 rpm on an ESR incubator from Kühner AG (Birsfelden, Switzerland). In each case 200 μl of this preculture are transinoculated into 10 ml of production medium (25 g/l (NH4)2SO4, 2 g/l KH2PO41 g/l MgSO4*7H2O, 0.03 g/l FeSO4*7H2O, 0.018 g/l MnSO4*1H2O, 30 g/l CaCO3, 20 g/l glucose, 20 g/l β-alanine, 250 mg/l thiamine) and the batch is incubated for 48 hours at 37° C. After the incubation the optical density (OD) of the culture suspension is determined with an LP2W photometer from Dr. Lange (Düsseldorf, Germany) at a measurement wavelength of 660 nm.
  • The concentration of the D-pantothenate formed is then determined in the culture supernatant centrifuged off by means of High Performance Liquid Chromatography [column: Reversed Phase MZ-Aqua Perfect (diameter 4,6 mm), mobile Phase 25 mM acetate buffer with 10% methanol, flow rate 1 ml/min, RI detector]. [0112]
  • The result of the experiment is shown in Table 1. [0113]
    TABLE 1
    OD Pantothenate
    Strain (660 nm) mg/l
    FE6-1/pTrc99A 8.7 47
    FE6- 8.35 55
    1/pTrc99AcysK
  • The publications cited in the Detailed Description of the Invention and the Examples above are incorporated herein by reference. [0114]
  • Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein. [0115]
  • This application is based on German Patent Application Serial No. 101 28 780.1, filed on Jun. 13, 2001, and incorporated herein by reference. [0116]
  • 1 2 1 21 DNA ARTIFICIAL SEQUENCE SYNTHETIC DNA 1 cagttaagga caggccatga g 21 2 22 DNA ARTIFICIAL SEQUENCE SYNTHETIC DNA 2 gctggcatta ctgttgcaat tc 22

Claims (30)

1. A process for the preparation of D-pantothenic acid and/or a salt thereof or a feedstuffs additive comprising this/these compound(s), comprising fermenting at least one microorganism of the Enterobacteriaceae family, in which at least the nucleotide sequence(s) which code(s) for the cysK gene is/are enhanced, under conditions suitable for the formation of the cysK gene product cysteine synthase A.
2. The process according to claim 1, wherein the microorganism naturally produces D-pantothenic acid.
3. The process according to claim 1, wherein the nucleotide sequence(s) which code(s) for the cysK gene is/are over-expressed.
4. The process according to claim 1, wherein the microorganism is transformed with at least one plasmid which carries the cysK gene.
5. The process according to claim 4, wherein the cysK gene is integrated into the chromosome in the transformed microorganism.
6. The process according to claim 1, wherein in the microorganism the promoter and regulation region upstream of the structural gene is mutated to achieve the enhancement.
7. The process according to claim 1, wherein in the microorganism at least one expression cassette is incorporated upstream of the structural gene to achieve the enhancement.
8. The process according to claim 1, wherein to achieve the enhancement, the life of the mRNA read off as the matrix from the above-mentioned sequences is prolonged and/or the breakdown of the corresponding enzyme protein(s) is prevented.
9. The process according to claim 1, wherein the microorganism has additional metabolite or antimetabolite resistance mutations, individually or together.
10. The process according to claim 1, wherein to achieve the over-expression the microorganisms are fermented in an appropriately modified culture medium or the fermentation procedure is modified.
11. The process according to claim 1, in which
a) the D-pantothenic acid and/or the salt thereof is concentrated in the fermentation broth or in the cells of the microorganism, and
b) after the end of the fermentation the desired product(s) is/are isolated, the biomass and/or further constituents of the fermentation broth being separated off in an amount of ≧0 to 100%.
12. The process according to claim 1, wherein the microorganism of the Enterobacteriaceae family belongs to the genus Escherichia.
13. The process according to claim 1, wherein the microorganism is an Escherichia coli.
14. The process according to claim 1, wherein one or more of the genes selected from the group consisting of the following is or are additionally enhanced:
the ilvGM operon which codes for acetohydroxy-acid synthase II,
the panB gene which codes for ketopantoate hydroxymethyl transferase,
the panE gene which codes for ketopantoate reductase,
the panD gene which codes for aspartate decarboxylase,
the panC gene which codes for pantothenate synthetase,
individually or together, the genes gcvT, gcvH and gcvP which code for the glycine cleavage system
the glyA gene which codes for serine hydroxymethyl transferase,
the serA gene which codes for phosphoglyceric acid dehydrogenase,
the serA(FBR) allele which codes for “feed back” resistant variants of phosphoglyceric acid dehydrogenase,
the serC gene which codes for phosphoserine transaminase,
the bfr gene which codes for bacterioferrin,
the hns gene which codes for the DNA-binding protein HLP-II,
the pgm gene which codes for phosphoglucomutase,
the mdh gene which codes for malate dehydrogenase,
the fda gene which codes for fructose bisphosphate aldolase (class II),
the dldH gene which codes for NADH-dependent lipoamide dehydrogenase,
the pepB gene which codes for peptidase,
the aldH gene which codes for NADP-dependent aldehyde dehydrogenase, and
the adk gene which codes for adenylate kinase.
15. The process according to claim 14, wherein said one or more of the genes is or are overexpressed.
16. The process according to claim 1, wherein in the microorganism one or more genes which code for the metabolic pathways which reduce the formation of D-pantothenic acid are at least partly eliminated.
17. The process according to claim 16, wherein said one or more genes which code for the metabolic pathways which reduce the formation of D-pantothenic acid are avtA gene which codes for transaminase C, and/or the pckA gene which codes for PEP carboxykinase.
18. The process according to claim 1, wherein the expression of the polynucleotide(s) which code(s) for the poxB gene is attenuated.
19. The process according to claim 1, wherein the expression of the polynucleotide(s) which code(s) for the poxB gene is eliminated.
20. A process for the preparation of a feedstuffs additive comprising D-pantothenic and/or a salt thereof comprising:
a) separating the biomass and/or a portion of the constituents in an amount of ≧0 to 100% from a fermentation broth obtained by fermenting at least one microorganism of the Enterobacteriaceae family, in which at least the nucleotide sequence(s) which code(s) for the cysK gene is/are enhanced, and comprising D-pantothenic acid,
b) optionally, concentrating the mixture from a), and
c) converting the mixture into a finely divided powder to produce a a free-flowing animal feedstuffs additive with a particle size distribution of 20 to 2000 μm.
21. The process according to claim 20, wherein the particle size distribution is100 to 1400 μm.
22. The process according to claim 20, wherein the animal feedstuffs additive contains a salt of D-pantothenic acid selected from the group consisting of the magnesium and the calcium salt, wherein the fermentation of the microorganism is carried out in the presence of compounds of Ca or Mg, these being fed in continuously or discontinuously.
23. The process according to claim 22, in which stoichiometric amounts of the compounds of Ca or Mg are fed in continuously or discontinuously.
24. The process according to claim 20, wherein the animal feedstuffs additive contains a salt of D-pantothenic acid selected from the group consisting of the magnesium and the calcium salt, wherein after the fermentation compounds of calcium or magnesium are added to the fermentation broth, optionally after separating off ≧0 to 100% of the biomass formed.
25. The process according to claim 24, wherein the compounds of calcium or magnesium are added to the fermentation broth in stoichiometric amounts.
26. The process according to claim 20, wherein before or after the concentration, D-pantothenic acid or one or more salts thereof is/are added to the fermentation broth, the amount of compounds added being such that the total concentration thereof in the animal feedstuffs additive is in the range from 20 to 80 wt. % (dry weight).
27. The process according to claim 20, wherein the animal feedstuffs additive with the desired particle size is obtained from the fermentation broth, optionally after addition of D-pantothenic acid and/or salts thereof, and optionally after addition of organic or inorganic auxiliaries, by
a) drying and compacting, or
b) spray drying, or
c) spray drying and granulation, or
d) spray drying and build-up granulation.
28. The process according to claim 20, wherein the fermentation broth is applied to an inorganic auxiliary, optionally after removal of the biomass.
29. The process according to claim 28, wherein the inorganic auxiliary is a silica or silicate.
30. A microorganism of the Enterobacteriaceae family which produces pantothenic acid and in which the cysK gene is present in enhanced form.
US10/167,645 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof Abandoned US20040259214A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10128780.1 2001-06-13
DE10128780A DE10128780A1 (en) 2001-06-13 2001-06-13 Production of D-pantothenic acid, optionally as salt and/or contained in feed additive, by fermenting Enterobacteriaceae strain in which specific nucleotide sequences have been amplified

Publications (1)

Publication Number Publication Date
US20040259214A1 true US20040259214A1 (en) 2004-12-23

Family

ID=7688209

Family Applications (10)

Application Number Title Priority Date Filing Date
US10/167,647 Abandoned US20030119151A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,457 Expired - Lifetime US6913912B2 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,645 Abandoned US20040259214A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,650 Abandoned US20030092138A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,427 Abandoned US20030124681A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,648 Abandoned US20030124682A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,580 Abandoned US20030104583A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,428 Abandoned US20030064485A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,656 Abandoned US20030100081A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,646 Abandoned US20030109012A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US10/167,647 Abandoned US20030119151A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,457 Expired - Lifetime US6913912B2 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof

Family Applications After (7)

Application Number Title Priority Date Filing Date
US10/167,650 Abandoned US20030092138A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,427 Abandoned US20030124681A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,648 Abandoned US20030124682A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,580 Abandoned US20030104583A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,428 Abandoned US20030064485A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,656 Abandoned US20030100081A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof
US10/167,646 Abandoned US20030109012A1 (en) 2001-06-13 2002-06-13 Process for the preparation of D-pantothenic acid and/or salts thereof

Country Status (7)

Country Link
US (10) US20030119151A1 (en)
EP (4) EP1395663A2 (en)
AT (3) ATE305973T1 (en)
AU (10) AU2002345769A1 (en)
DE (4) DE10128780A1 (en)
DK (3) DK1395662T3 (en)
WO (10) WO2002101065A2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8232081B2 (en) * 1999-09-21 2012-07-31 Basf Se Methods and microorganisms for production of panto-compounds
DE10128780A1 (en) * 2001-06-13 2002-12-19 Degussa Production of D-pantothenic acid, optionally as salt and/or contained in feed additive, by fermenting Enterobacteriaceae strain in which specific nucleotide sequences have been amplified
EP1404821B1 (en) * 2001-07-06 2009-11-18 Evonik Degussa GmbH Process for the preparation of l-amino acids using strains of the enterobacteriaceae family
WO2003076635A1 (en) * 2002-03-13 2003-09-18 Degussa Ag Process for the preparation of l-amino acids using strains of the family enterobacteriaceae
WO2003076637A1 (en) 2002-03-13 2003-09-18 Degussa Ag Process for the preparation of l-amino acids using strains of the family enterobacteriaceae
DE102004029639A1 (en) * 2003-08-12 2005-03-24 Degussa Ag Preparing L-threonine using bacteria of Enterobacteriaceae family which produces L-threonine, by culturing bacterium in nutrient medium comprising source of carbon, nitrogen and phosphorus, to produce L-threonine
CN112126666B (en) * 2020-09-22 2022-04-08 廊坊梅花生物技术开发有限公司 Nucleoside high-yield bacterium and construction method and application thereof
CN112195143B (en) * 2020-09-24 2022-10-14 浙江工业大学 Strain for producing D-pantothenic acid by fermentation method and method for producing D-pantothenic acid by fermentation method
CN114657221A (en) * 2020-12-22 2022-06-24 安徽华恒生物科技股份有限公司 Preparation method of D-pantothenic acid
KR102589135B1 (en) * 2021-05-10 2023-10-12 씨제이제일제당 (주) Microorganism having inhanced activity of 3-methyl-2-oxobutanoate hydroxymethyltransferase and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5518906A (en) * 1992-09-25 1996-05-21 Takeda Chemical Industries, Ltd. Production of d-pantoic acid and d-pantothenic acid

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0493060A3 (en) * 1990-12-25 1993-04-14 Takeda Chemical Industries, Ltd. Production method of d-pantothenic acid and plasmids and microorganisms thereof
JP3058504B2 (en) * 1992-03-30 2000-07-04 マルカン酢株式会社 Aldehyde dehydrogenase
KR100282076B1 (en) * 1995-04-21 2001-02-15 다께다 구니오 Process for producing calcium d-pantothenate
DE19846499A1 (en) * 1998-10-09 2000-04-20 Degussa Production of microorganisms that overproduce pantothenic acid, useful as vitamin in e.g. foods or medicines, by overexpressing sequences that encode ketopantothenate reductase
US6238714B1 (en) * 1999-05-05 2001-05-29 Degussa-Huls Ag Feedstuff additive which contains D-pantothenic acid and/or its salts and a process for the preparation thereof
ATE227938T1 (en) * 1999-05-05 2002-12-15 Degussa FEED ADDITIVES CONTAINING D-PANTOTHENIC ACID AND/OR ONE OF THE SALTS AND METHOD FOR THE PRODUCTION THEREOF
US6319528B1 (en) * 1999-05-05 2001-11-20 Degussa Aktiengesellschaft Feedstuff additive which contains D-pantothenic acid and/or its salts and a process for the preparation thereof
JP2004534501A (en) * 1999-06-25 2004-11-18 ビーエーエスエフ アクチェンゲゼルシャフト Corynebacterium glutamicum gene encoding a metabolic pathway protein
EP1263963A2 (en) * 1999-06-25 2002-12-11 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding proteins involved in carbon metabolism and energy production
JP2003144161A (en) * 1999-07-02 2003-05-20 Ajinomoto Co Inc Method for producing l-amino acid
DE19958160A1 (en) * 1999-12-02 2001-06-07 Degussa New nucleotide sequences coding for the gpm gene
DE10128780A1 (en) * 2001-06-13 2002-12-19 Degussa Production of D-pantothenic acid, optionally as salt and/or contained in feed additive, by fermenting Enterobacteriaceae strain in which specific nucleotide sequences have been amplified

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5518906A (en) * 1992-09-25 1996-05-21 Takeda Chemical Industries, Ltd. Production of d-pantoic acid and d-pantothenic acid

Also Published As

Publication number Publication date
WO2002101065A2 (en) 2002-12-19
US20030124681A1 (en) 2003-07-03
AU2002345769A1 (en) 2002-12-23
AU2002314098A1 (en) 2002-12-23
WO2002101066A2 (en) 2002-12-19
WO2002101062A2 (en) 2002-12-19
DK1395661T3 (en) 2006-02-20
WO2002101066A3 (en) 2003-07-17
US20030109012A1 (en) 2003-06-12
DE60206622T2 (en) 2006-06-22
AU2002312930A1 (en) 2002-12-23
DE60206498D1 (en) 2006-02-16
WO2002101062A3 (en) 2003-09-04
WO2002101055A2 (en) 2002-12-19
WO2002101064A2 (en) 2002-12-19
WO2002101054A3 (en) 2003-08-21
EP1395660A2 (en) 2004-03-10
US20030087404A1 (en) 2003-05-08
DE60206499T2 (en) 2006-06-22
WO2002101064A3 (en) 2003-12-11
US20030124682A1 (en) 2003-07-03
WO2002101054A2 (en) 2002-12-19
DE10128780A1 (en) 2002-12-19
US20030092138A1 (en) 2003-05-15
US20030119151A1 (en) 2003-06-26
DE60206499D1 (en) 2006-02-16
WO2002101063A3 (en) 2003-07-17
ATE306552T1 (en) 2005-10-15
EP1395660B1 (en) 2005-10-12
WO2002101065A3 (en) 2003-12-18
DK1395662T3 (en) 2006-02-20
EP1395661B1 (en) 2005-10-05
AU2002302623A1 (en) 2002-12-23
AU2002316916A1 (en) 2002-12-23
EP1395662A2 (en) 2004-03-10
WO2002101067A2 (en) 2002-12-19
AU2002316917A1 (en) 2002-12-23
US20030100081A1 (en) 2003-05-29
US20030104583A1 (en) 2003-06-05
US20030064485A1 (en) 2003-04-03
WO2002101055A3 (en) 2003-07-17
EP1395663A2 (en) 2004-03-10
DE60206622D1 (en) 2006-02-23
ATE305974T1 (en) 2005-10-15
AU2002314099A1 (en) 2002-12-23
AU2002302625A1 (en) 2002-12-23
WO2002101068A3 (en) 2003-09-04
AU2002314100A1 (en) 2002-12-23
WO2002101050A2 (en) 2002-12-19
ATE305973T1 (en) 2005-10-15
DK1395660T3 (en) 2006-02-20
AU2002302624A1 (en) 2002-12-23
US6913912B2 (en) 2005-07-05
WO2002101063A2 (en) 2002-12-19
WO2002101050A3 (en) 2003-10-16
WO2002101067A3 (en) 2003-07-17
EP1395661A2 (en) 2004-03-10
WO2002101068A2 (en) 2002-12-19
EP1395662B1 (en) 2005-10-05
DE60206498T2 (en) 2006-07-06

Similar Documents

Publication Publication Date Title
US6913912B2 (en) Process for the preparation of D-pantothenic acid and/or salts thereof
US20020173010A1 (en) Process for preparation of D-pantothenic acid and/or salts thereof
US6689592B2 (en) Process for the enzymatic production of D-pantothenic acid and/or its salts
US6682915B2 (en) Process for the fermentative preparation of D-pantothenic acid and/or its salts
US6686183B2 (en) Process for the fermentative preparation of D-pantothenic acid and/or its salts
US7338792B2 (en) Process for the preparation of D-pantothenic acid and/or salts thereof
EP1672073A1 (en) Process for the preparation of D-pantothenic acid and/or salts thereof

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION