US20040146528A1 - MVA expressing modified HIV envelope, gag, and pol genes - Google Patents

MVA expressing modified HIV envelope, gag, and pol genes Download PDF

Info

Publication number
US20040146528A1
US20040146528A1 US10/646,628 US64662803A US2004146528A1 US 20040146528 A1 US20040146528 A1 US 20040146528A1 US 64662803 A US64662803 A US 64662803A US 2004146528 A1 US2004146528 A1 US 2004146528A1
Authority
US
United States
Prior art keywords
gag
gene
hiv
pol
hiv env
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/646,628
Inventor
Bernard Moss
Linda Wyatt
Patricia Earl
Harriet Robinson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Emory University
US Department of Health and Human Services
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US10/646,628 priority Critical patent/US20040146528A1/en
Assigned to GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES reassignment GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: EARL, PATRICIA, MOSS, BERNARD, WYATT, LINDA
Assigned to EMORY UNIVERSITY reassignment EMORY UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ROBINSON, HARRIET L.
Publication of US20040146528A1 publication Critical patent/US20040146528A1/en
Priority to US12/018,150 priority patent/US7867982B2/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: EMORY UNIVERSITY
Priority to US12/987,791 priority patent/US8916172B2/en
Priority to US14/566,066 priority patent/US20150238593A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH -DIRECTOR DEITR reassignment NATIONAL INSTITUTES OF HEALTH -DIRECTOR DEITR CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: EMORY UNIVERSITY
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/21—Retroviridae, e.g. equine infectious anemia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24171—Demonstrated in vivo effect
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/60—Vector systems having a special element relevant for transcription from viruses

Definitions

  • the invention provides modified vaccinia Ankara (MVA), a replication-deficient strain of vaccinia virus, expressing human immunodeficiency virus (HIV) env, gag, and pol genes.
  • VAA modified vaccinia Ankara
  • HAV human immunodeficiency virus
  • FIG. 1 Phylogenetic relationships of HIV-1 and HIV-2 based on identity of pol gene sequences.
  • SIV cpz and SIV smm are subhuman primate lentiviruses recovered from a chimpanzee and sooty mangabey monkey, respectively.
  • FIG. 2 Phylogenetic relationships of HIV-1 groups M, N and O with four different SIV cpz isolates based on full-length pol gene sequences.
  • the bar indicates a genetic distance of 0.1 (10% nucleotide divergence) and the asterisk positions group N HIV-1 isolates based on env sequences.
  • FIG. 3 Tropic and biologic properties of HIV-1 isolates.
  • FIG. 4 HIV-encoded proteins. The location of the HIV genes, the sizes of primary translation products (in some cases polyproteins), and the processed mature viral proteins are indicated.
  • FIG. 5 Schematic representation of a mature HIV-1 virion.
  • FIG. 6 Linear representation of the HIV-1 Env glycoprotein. The arrow indicates the site of gp160 cleavage to gp120 and gp41. In gp120, cross-hatched areas represent variable domains (V 1 to V 5 ) and open boxes depict conserved sequences (C 1 to C 5 ). In the gp41 ectodomain, several domains are indicated: the N-terminal fusion peptide, and the two ectodomain helices (N- and C-helix). The membrane-spanning domain is represented by a black box.
  • FIG. 7 Temporal frequencies of Gag-specific T cells.
  • A Gag-specific CD8 T cell responses raised by DNA priming and rMVA booster immunizations. The schematic presents mean Gag-CM9-tetramer data generated in the high-dose i.d. DNA-immunized animals.
  • B Gag-specific IFN- ⁇ ELISPOTs in A*01 (open bars) and non-A*01 (filled bars) macaques at various times before challenge and at two weeks after challenge. Three pools of 10 to 13 Gag peptides (22-mers overlapping by 12) were used for the analyses. The numbers above data bars represent the arithmetic mean ⁇ SD for the ELISPOTs within each group.
  • FIG. 8 Temporal viral loads, CD4 counts, and survival after challenge of vaccinated and control animals.
  • A Geometric mean viral loads and
  • B geometric mean CD4 counts.
  • C Survival curve for vaccinated and control animals. The dotted line represents all 24 vaccinated animals.
  • D Viral loads and
  • E CD4 counts for individual animals in the vaccine and control groups. The key to animal numbers is presented in (E). Assays for the first 12 weeks after challenge had a detection level of 1000 copies of RNA per milliliter of plasma. Animals with loads below 1000 were scored with a load of 500. For weeks 16 and 20, the detection level was 300 copies of RNA per milliliter. Animals with levels of virus below 300 were scored at 300.
  • FIG. 9 Postchallenge T cell responses in vaccine and control groups.
  • A Temporal tetramer + cells (dashed line) and viral loads (solid line).
  • B Intracellular cytokine assays for IFN- ⁇ production in response to stimulation with the Gag-CM9 peptide at two weeks after challenge. This ex vivo assay allows evaluation of the functional status of the peak postchallenge tetramer + cells displayed in FIG. 7A.
  • C Proliferation assay at 12 weeks after challenge. Gag-Pol-Env (open bars) and Gag-Pol (hatched bars) produced by transient transfections were used for stimulation. Supernatants from mock-transfected cultures served as control antigen. Stimulation indices are the growth of cultures in the presence of viral antigens divided by the growth of cultures in the presence of mock antigen.
  • FIG. 10 Lymph node histomorphology at 12 weeks after challenge.
  • A Typical lymph node from a vaccinated macaque showing evidence of follicular hyperplasia characterized by the presence of numerous secondary follicles with expanded germinal centers and discrete dark and light zones.
  • B Typical lymph node from an infected control animal showing follicular depletion and paracortical lymphocellular atrophy.
  • C A representative lymph node from an age-matched, uninfected macaque displaying nonreactive germinal centers.
  • D The percentage of the total lymph node area occupied by germinal centers was measured to give a non-specific indicator of follicular hyperplasia. Data for uninfected controls are for four age-matched rhesus macaques.
  • FIG. 11 Temporal antibody responses. Micrograms of total Gag (A) or Env (B) antibody were determined with ELISAs. The titers of neutralizing antibody for SHIV-89.6 (C) and SHIV-89.6P (D) were determined with MT-2 cell killing and neutral red staining (D. C. Montefiori et al. 1988 J Clin Microbiol 26:231). Titers are the reciprocal of the serum dilution giving 50% neutralization of the indicated viruses grown in human PBMC. Symbols for animals are the same as in FIG. 8.
  • FIG. 12 Gag-CM9-Mamu-A*01 tetramer-specific T cells in Mamu-A*01 vaccinated and control macaques at various times before challenge and at two weeks after challenge.
  • the number at the upper right corner of each plot represents the frequency of tetramer-specific CD8 T cells as a % of total CD8 T cells.
  • the numbers above each column of FACS data designate individual animals.
  • FIG. 13 Map of plasmid transfer vector pLW-48.
  • FIG. 14 Sequence of plasmid transfer vector pLW-48.
  • FIG. 15 Sequences of plasmid transfer vector pLW-48, Psy II promoter (which controls ADA envelope expression), ADA envelope truncated, PmH5 promoter (which controls HXB2 gag pol expression), and HXB2 gag pol (with safety mutations, ⁇ integrase).
  • FIG. 16 Plasmid transfer vector pLW-48 and making MVA recombinant virus MVA/HIV 48.
  • FIG. 17 A clade B gag pol.
  • FIG. 18 Sequence of new Psyn II promoter.
  • Vaccinia virus a member of the genus Orthopoxvirus in the family of Poxviridae, was used as live vaccine to immunize against the human smallpox disease.
  • Successful worldwide vaccination with vaccinia virus culminated in the eradication of variola virus, the causative agent of the smallpox (The global eradication of smallpox. Final report of the global commission for the certification of smallpox eradication. History of Public Health, No. 4, Geneva: World Health Organization, 1980). Since that WHO declaration, vaccination has been universally discontinued except for people at high risk of poxvirus infections (e.g. laboratory workers).
  • vaccinia viruses have also been used to engineer viral vectors for recombinant gene expression and for the potential use as recombinant live vaccines (Mackett, M. et al. 1982 PNAS USA 79:7415-7419; Smith, G. L. et al. 1984 Biotech Genet Engin Rev 2:383-407). This entails DNA sequences (genes) which code for foreign antigens being introduced, with the aid of DNA recombination techniques, into the genome of the vaccinia viruses.
  • the gene is integrated at a site in the viral DNA which is non-essential for the life cycle of the virus, it is possible for the newly produced recombinant vaccinia virus to be infectious, that is to say able to infect foreign cells and thus to express the integrated DNA sequence (EP Patent Applications No. 83,286 and No. 110,385).
  • the recombinant vaccinia viruses prepared in this way can be used, on the one hand, as live vaccines for the prophylaxis of infectious diseases, on the other hand, for the preparation of heterologous proteins in eukaryotic cells.
  • MVA modified vaccinia Ankara
  • CVA Ankara strain of vaccinia virus
  • MVA is distinguished by its great attenuation, that is to say by diminished virulence and ability to replicate in primate cells while maintaining good immunogenicity.
  • the MVA virus has been analyzed to determine alterations in the genome relative to the parental CVA strain. Six major deletions of genomic DNA (deletion I, II, III, IV, V, and VI) totaling 31,000 base pairs have been identified (Meyer, H. et al. 1991 J Gen Virol 72:1031-1038). The resulting MVA virus became severely host cell restricted to avian cells.
  • MVA is characterized by its extreme attenuation. When tested in a variety of animal models, MVA was proven to be avirulent even in immunosuppressed animals. More importantly, the excellent properties of the MVA strain have been demonstrated in extensive clinical trials (Mayr A. et al. 1978 Monilial Bakteriol [B] 167:375-390; Stickl et al. 1974 Dtsch Med Wschr 99:2386-2392). During these studies in over 120,000 humans, including high-risk patients, no side effects were associated with the use of MVA vaccine.
  • MVA replication in human cells was found to be blocked late in infection preventing the assembly to mature infectious virions. Nevertheless, MVA was able to express viral and recombinant genes at high levels even in non-permissive cells and was proposed to serve as an efficient and exceptionally safe gene expression vector (Sutter, G. and Moss, B. 1992 PNAS USA 89:10847-10851). Additionally, novel vaccinia vector vaccines were established on the basis of MVA having foreign DNA sequences inserted at the site of deletion III within the MVA genome (Sutter, G. et al. 1994 Vaccine 12:1032-1040).
  • the recombinant MVA vaccinia viruses can be prepared as set out hereinafter.
  • a DNA-construct which contains a DNA-sequence which codes for a foreign polypeptide flanked by MVA DNA sequences adjacent to a naturally occurring deletion, e.g. deletion III, or other non-essential sites, within the MVA genome is introduced into cells infected with MVA, to allow homologous recombination.
  • Once the DNA-construct has been introduced into the eukaryotic cell and the foreign DNA has recombined with the viral DNA, it is possible to isolate the desired recombinant vaccinia virus in a manner known per se, preferably with the aid of a marker.
  • the DNA-construct to be inserted can be linear or circular.
  • a plasmid or polymerase chain reaction product is preferred.
  • the DNA-construct contains sequences flanking the left and the right side of a naturally occurring deletion, e.g. deletion III, within the MVA genome.
  • the foreign DNA sequence is inserted between the sequences flanking the naturally occurring deletion.
  • regulatory sequences which are required for the transcription of the gene, to be present on the DNA.
  • promoters are known to those skilled in the art, and include for example those of the vaccinia 11 kDa gene as are described in EP-A-198,328, and those of the 7.5 kDa gene (EP-A-110,385).
  • the DNA-construct can be introduced into the MVA infected cells by transfection, for example by means of calcium phosphate precipitation (Graham et al. 1973 Virol 52:456-467; Wigler et al. 1979 Cell 16:777-785), by means of electroporation (Neumann et al. 1982 EMBO J 1:841-845), by microinjection (Graessmann et al. 1983 Meth Enzymol 101:482-492), by means of liposomes (Straubinger et al. 1983 Meth Enzymol 101:512-527), by means of spheroplasts (Schaffner 1980 PNAS USA 77:2163-2167) or by other methods known to those skilled in the art.
  • transfection for example by means of calcium phosphate precipitation (Graham et al. 1973 Virol 52:456-467; Wigler et al. 1979 Cell 16:777-785), by means of electroporation (Neumann et al. 1982 EMBO J 1:841
  • HIV-2 is more closely related to SIV smm , a virus isolated from sooty mangabey monkeys in the wild, than to HIV-1. It is currently believed that HIV-2 represents a zoonotic transmission of SIV smm to man.
  • SIV cpz A series of lentiviral isolates from captive chimpanzees, designated SIV cpz , are close genetic relatives of HIV-1.
  • the M group of HIV-1 which includes over 95% of the global virus isolates, consists of at least eight discrete clades (A, B, C, D, F, G, H, and J), based on the sequence of complete viral genomes.
  • HIV-1 group O has been recovered from individuals living in Cameroon, Gabon, and Equatorial Guinea; their genomes share less than 50% identity in nucleotide sequence with group M viruses.
  • group N HIV-1strains have been identified in infected Cameroonians, fail to react serologically in standard whole-virus enzyme-linked immunosorbent assay (ELISA), yet are readily detectable by conventional Western blot analysis.
  • ELISA enzyme-linked immunosorbent assay
  • HIV-1 genetic variation comes from studies of group M viruses of diverse geographic origin. Data collected during the past decade indicate that the HIV-1 population present within an infected individual can vary from 6% to 10% in nucleotide sequence. HIV-1 isolates within a clade may exhibit nucleotide distances of 15% in gag and up to 30% in gp120 coding sequences. Interclade genetic variation may range between 30% and 40% depending on the gene analyzed.
  • Clade A viruses are genetically the most divergent and were the most common HIV-1 subtype in Africa early in the epidemic. With the rapid spread of HIV-1 to southern Africa during the mid to late 1990s, clade C viruses have become the dominant subtype and now account for 48% of HIV-1 infections worldwide. Clade B viruses, the most intensively studied HIV-1 subtype, remain the most prevalent isolates in Europe and North America.
  • HIV-1 recombinants have arisen in Africa and a majority contain segments originally derived from clade A viruses.
  • the composition of the predominant circulating strain consists of a clade A gag plus pol gene segment and a clade E env gene. Because the clade E env gene in Thai HIV-1 strains is closely related to the lade E env present in virus isolates from the Central African Republic, it is believed that the original recombination event occurred in Africa, with the subsequent introduction of a descendent virus into Thailand. Interestingly, no full-length HIV-1 subtype E isolate (i.e., with subtype E gag, pol, and env genes) has been reported to date.
  • HIV-1 isolates using the CXCR4 receptor are usually T cell line (TCL)-tropic syncytium inducing (SI) strains, whereas those exclusively utilizing the CCR5 receptor (R5 viruses) are predominantly macrophage (M)-tropic and non-syncytium inducing (NSI).
  • TCL T cell line
  • SI macrophage
  • NBI non-syncytium inducing
  • the three primary HIV-1 translation products are initially synthesized as polyprotein precursors, which are subsequently processed by viral or cellular proteases into mature particle-associated proteins (FIG. 4).
  • the 55-kd Gag precursor Pr55 Gag is cleaved into the matrix (MA), capsid (CA), nucleocapsid (NC), and p6 proteins.
  • Retroviral Gag proteins are generally synthesized as polyprotein precursors; the HIV-1 Gag precursor has been named, based on its apparent molecular mass, Pr55 Gag .
  • the mRNA for Pr55 Gag is the unspliced 9.2-kb transcript (FIG. 4) that requires Rev for its expression in the cytoplasm.
  • the viral protease (PR) cleaves Pr55 Gag during or shortly after budding from the cell to generate the mature Gag proteins p17 (MA), p24 (CA), p7 (NC), and p6 (see FIG. 4).
  • MA is localized immediately inside the lipid bilayer of the viral envelope
  • CA forms the outer portion of the cone-shaped core structure in the center of the particle
  • NC is present in the core in a ribonucleoprotein complex with the viral RNA genome (FIG. 5).
  • the HIV Pr55 Gag precursor oligomerizes following its translation and is targeted to the plasma membrane, where particles of sufficient size and density to be visible by EM are assembled.
  • Formation of virus-like particles by Pr55 Gag is a self-assembly process, with critical Gag-Gag interactions taking place between multiple domains along the Gag precursor.
  • the assembly of virus-like particles does not require the participation of genomic RNA (although the presence of nucleic acid appears to be essential), pol-encoded enzymes, or Env glycoproteins, but the production of infectious virions requires the encapsidation of the viral RNA genome and the incorporation of the Env glycoproteins and the Gag-Pol polyprotein precursor Pr160 Gag-Pol .
  • telomeres Downstream of gag lies the most highly conserved region of the HIV genome, the pol gene, which encodes three enzymes: PR, RT, and IN (see FIG. 4).
  • RT and IN are required, respectively, for reverse transcription of the viral RNA genome to a double-stranded DNA copy, and for the integration of the viral DNA into the host cell chromosome.
  • PR plays a critical role late in the life cycle by mediating the production of mature, infectious virions.
  • the pol gene products are derived by enzymatic cleavage of a 160-kd Gag-Pol fusion protein, referred to as Pr160 Gag-Pol . This fusion protein is produced by ribosomal frameshifting during translation of Pr55 Gag (see FIG. 4).
  • the frame-shifting mechanism for Gag-Pol expression also utilized by many other retroviruses, ensures that the pol-derived proteins are expressed at a low level, approximately 5% to 10% that of Gag.
  • the N-terminus of Pr160 Gag-Pol is myristylated and targeted to the plasma membrane.
  • retroviral Gag proteins are initially synthesized as polyprotein precursors that are cleaved to generate smaller products. Subsequent studies demonstrated that the processing function is provided by a viral rather than a cellular enzyme, and that proteolytic digestion of the Gag and Gag-Pol precursors is essential for virus infectivity. Sequence analysis of retroviral PRs indicated that they are related to cellular “aspartic” proteases such as pepsin and renin. Like these cellular enzymes, retroviral PRs use two apposed Asp residues at the active site to coordinate a water molecule that catalyzes the hydrolysis of a peptide bond in the target protein.
  • retroviral PRs function as true dimers.
  • X-ray crystallographic data from HIV-1 PR indicate that the two monomers are held together in part by a four-stranded antiparallel ⁇ -sheet derived from both N- and C-terminal ends of each monomer.
  • the substrate-binding site is located within a cleft formed between the two monomers.
  • the HIV PR dimer contains flexible “flaps” that overhang the binding site and may stabilize the substrate within the cleft; the active-site Asp residues lie in the center of the dimer.
  • the primary sequences of retroviral PRs are highly divergent, yet their structures are remarkably similar.
  • Retroviral RTs have three enzymatic activities: (a) RNA-directed DNA polymerization (for minus-strand DNA synthesis), (b) RNaseH activity (for the degradation of the tRNA primer and genomic RNA present in DNA-RNA hybrid intermediates), and (c) DNA-directed DNA polymerization (for second- or plus-strand DNA synthesis).
  • the mature HIV-1 RT holoenzyme is a heterodimer of 66 and 51 kd subunits.
  • the 51-kd subunit (p51) is derived from the 66-kd (p66) subunit by proteolytic removal of the C-terminal 15-kd RNaseH domain of p66 by PR (see FIG. 4).
  • the crystal structure of HIV-1 RT reveals a highly asymmetric folding in which the orientations of the p66 and p51 subunits differ substantially.
  • the p66 subunit can be visualized as a right hand, with the polymerase active site within the palm, and a deep template-binding cleft formed by the palm, fingers, and thumb subdomains.
  • the polymerase domain is linked to RNaseH by the connection subdomain.
  • the active site located in the palm, contains three critical Asp residues (110, 185, and 186) in close proximity, and two coordinated Mg 2+ ions. Mutation of these Asp residues abolishes RT polymerizing activity.
  • the orientation of the three active-site Asp residues is similar to that observed in other DNA polymerases (e.g., the Klenow fragment of E. coli DNA poll).
  • the p51 subunit appears to be rigid and does not form a polymerizing cleft; Asp 110, 185, and 186 of this subunit are buried within the molecule.
  • Approximately 18 base pairs of the primer-template duplex lie in the nucleic acid binding cleft, stretching from the polymerase active site to the RNaseH domain.
  • the presence of a dideoxynucleotide at the 3′ end of the primer allows visualization of the catalytic complex trapped just prior to attack on the incoming dNTP.
  • Comparison with previously obtained structures suggests a model whereby the fingers close in to trap the template and dNTP prior to nucleophilic attack of the 3′-OH of the primer on the incoming dNTP.
  • the fingers adopt a more open configuration, thereby releasing the pyrophosphate and enabling RT to bind the next dNTP.
  • the structure of the HIV-1 RNaseH has also been determined by x-ray crystallography; this domain displays a global folding similar to that of E. coli RNaseH.
  • a distinguishing feature of retrovirus replication is the insertion of a DNA copy of the viral genome into the host cell chromosome following reverse transcription.
  • the integrated viral DNA (the provirus) serves as the template for the synthesis of viral RNAs and is maintained as part of the host cell genome for the lifetime of the infected cell.
  • Retroviral mutants deficient in the ability to integrate generally fail to establish a productive infection.
  • Retroviral IN proteins are composed of three structurally and functionally distinct domains: an N-terminal, zinc-finger-containing domain, a core domain, and a relatively nonconserved C-terminal domain. Because of its low solubility, it has not yet been possible to crystallize the entire 288-amino-acid HIV-1 IN protein. However, the structure of all three domains has been solved independently by x-ray crystallography or NMR methods. The crystal structure of the core domain of the avian sarcoma virus IN has also been determined.
  • the N-terminal domain (residues 1 to 55), whose structure was solved by NMR spectroscopy, is composed of four helices with a zinc coordinated by amino acids His-12, His-16, Cys-40, and Cys-43.
  • the structure of the N-terminal domain is reminiscent of helical DNA binding proteins that contain a so-called helix-turn-helix motif; however, in the HIV-1 structure this motif contributes to dimer formation.
  • helix-turn-helix motif a so-called helix-turn-helix motif
  • this motif contributes to dimer formation.
  • poor solubility hampered efforts to solve the structure of the core domain.
  • attempts at crystallography were successful when it was observed that a Phe-to-Lys change at IN residue 185 greatly increased solubility without disrupting in vitro catalytic activity.
  • Each monomer of the HIV-1 IN core domain (IN residues 50 to 212) is composed of a five-stranded ⁇ -sheet flanked by helices; this structure bears striking resemblance to other polynucleotidyl transferases including RNaseH and the bacteriophage MuA transposase.
  • Three highly conserved residues are found in analogous positions in other polynucleotidyl transferases; in HIV-1 IN these are Asp-64, Asp-116 and Glu-152, the so-called D,D-35-E motif. Mutations at these positions block HIV IN function both in vivo and in vitro.
  • the HIV Env glycoproteins play a major role in the virus life cycle. They contain the determinants that interact with the CD4 receptor and coreceptor, and they catalyze the fusion reaction between the lipid bilayer of the viral envelope and the host cell plasma membrane. In addition, the HIV Env glycoproteins contain epitopes that elicit immune responses that are important from both diagnostic and vaccine development perspectives.
  • the HIV Env glycoprotein is synthesized from the singly spliced 4.3-kb Vpu/Env bicistronic mRNA (see FIG. 4); translation occurs on ribosomes associated with the rough endoplasmic reticulum (ER).
  • the 160-kd polyprotein precursor (gp160) is an integral membrane protein that is anchored to cell membranes by a hydrophobic stop-transfer signal in the domain destined to be the mature TM Env glycoprotein, gp41 (FIG. 6).
  • the gp160 is cotranslationally glycosylated, forms disulfide bonds, and undergoes oligomerization in the ER.
  • the predominant oligomeric form appears to be a trimer, although dimers and tetramers are also observed.
  • the gp160 is transported to the Golgi, where, like other retroviral envelope precursor proteins, it is proteolytically cleaved by cellular enzymes to the mature SU glycoprotein gp120 and TM glycoprotein gp41 (see FIG. 6).
  • the cellular enzyme responsible for cleavage of retroviral Env precursors following a highly conserved Lys/Arg-X-Lys/Arg-Arg motif is furin or a furin-like protease, although other enzymes may also catalyze gp160 processing. Cleavage of gp160 is required for Env-induced fusion activity and virus infectivity.
  • gp120 and gp41 form a noncovalent association that is critical for transport of the Env complex from the Golgi to the cell surface.
  • the gp120-gp41 interaction is fairly weak, and a substantial amount of gp120 is shed from the surface of Env-expressing cells.
  • the HIV Env glycoprotein complex in particular the SU (gp120) domain, is very heavily glycosylated; approximately half the molecular mass of gp160 is composed of oligosaccharide side chains.
  • SU gp120
  • oligosaccharide side chains During transport of Env from its site of synthesis in the ER to the plasma membrane, many of the side chains are modified by the addition of complex sugars.
  • the numerous oligosaccharide side chains form what could be imagined as a sugar cloud obscuring much of gp120 from host immune recognition.
  • gp120 contains interspersed conserved (C 1 to C 5 ) and variable (V 1 to V 5 ) domains.
  • the Cys residues present in the gp120s of different isolates are highly conserved and form disulfide bonds that link the first four variable regions in large loops.
  • a primary function of viral Env glycoproteins is to promote a membrane fusion reaction between the lipid bilayers of the viral envelope and host cell membranes. This membrane fusion event enables the viral core to gain entry into the host cell cytoplasm.
  • a number of regions in both gp120 and gp41 have been implicated, directly or indirectly, in Env-mediated membrane fusion.
  • C-terminal to the gp41 fusion peptide are two amphipathic helical domains (see FIG. 6) which play a central role in membrane fusion. Mutations in the N-terminal helix (referred to as the N-helix), which contains a Leu zipper-like heptad repeat motif, impair infectivity and membrane fusion activity, and peptides derived from these sequences exhibit potent antiviral activity in culture.
  • the structure of the ectodomain of HIV-1 and SIV gp41, the two helical motifs in particular, has been the focus of structural analyses in recent years.
  • gp41 adopts a hypothetical conformation that allows the fusion peptide to insert into the target lipid bilayer.
  • the formation of the gp41 six-helix bundle brings the viral and cellular membranes together and membrane fusion takes place.
  • the present invention relates to generation of a CD8 + T cell immune response against an antigen and also eliciting an antibody response. More particularly, the present invention relates to “prime and boost” immunization regimes in which the immune response induced by administration of a priming composition is boosted by administration of a boosting composition.
  • the present invention is based on inventors' experimental demonstration that effective boosting can be achieved using modified vaccinia Ankara (MVA) vectors, following priming with any of a variety of different types of priming compositions including recombinant MVA itself.
  • MVA modified vaccinia Ankara
  • a major protective component of the immune response against a number of pathogens is mediated by T lymphocytes of the CD8 + type, also known as cytotoxic T lymphocytes (CTL).
  • T lymphocytes of the CD8 + type also known as cytotoxic T lymphocytes (CTL).
  • An important function of CD8 + cells is secretion of gamma interferon (IFN ⁇ ), and this provides a measure of CD8 + T cell immune response.
  • IFN ⁇ gamma interferon
  • a second component of the immune response is antibody directed to the proteins of the pathogen.
  • the present invention employs MVA which, as the experiments described below show, has been found to be an effective means for providing a boost to a CD8 + T cell immune response primed to antigen using any of a variety of different priming compositions and also eliciting an antibody response.
  • the experimental work described below demonstrates that use of embodiments of the present invention allows for recombinant MVA virus expressing an HIV antigen to boost a CD8 + T cell immune response primed by a DNA vaccine and also eliciting an antibody response.
  • the MVA was found to induce a CD8 + T cell response after intradermal, intramuscular or mucosal immunization.
  • Recombinant MVA has also been shown to prime an immune response that is boosted by one or more inoculations of recombinant MVA.
  • Non-human primates immunized with plasmid DNA and boosted with the MVA were effectively protected against intramucosal challenge with live virus.
  • a vaccination regime used intradermal, intramuscular or mucosal immunization for both prime and boost can be employed, constituting a general immunization regime suitable for inducing CD8 + T cells and also eliciting an antibody response, e.g. in humans.
  • the present invention in various aspects and embodiments employs an MVA vector encoding an HIV antigen for boosting a CD8 + T cell immune response to the antigen primed by previous administration of nucleic acid encoding the antigen and also eliciting an antibody response.
  • a general aspect of the present invention provides for the use of an MVA vector for boosting a CD8 + T cell immune response to an HIV antigen and also eliciting an antibody response.
  • One aspect of the present invention provides a method of boosting a CD8 + T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method including provision in the individual of an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid, whereby a CD8 + T cell immune response to the antigen previously primed in the individual is boosted.
  • An immune response to an HIV antigen may be primed by immunization with plasmid DNA or by infection with an infectious agent.
  • a further aspect of the invention provides a method of inducing a CD8 + T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method comprising administering to the individual a priming composition comprising nucleic acid encoding the antigen and then administering a boosting composition which comprises an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid.
  • a further aspect provides for use of an MVA vector, as disclosed, in the manufacture of a medicament for administration to a mammal to boost a CD8 + T cell immune response to an HIV antigen, and also eliciting an antibody response.
  • a medicament is generally for administration following prior administration of a priming composition comprising nucleic acid encoding the antigen.
  • the priming composition may comprise any viral vector, such as a vaccinia virus vector such as a replication-deficient strain such as modified vaccinia Ankara (MVA) or NYVAC (Tartaglia et al. 1992 Virology 118:217-232), an avipox vector such as fowlpox or canarypox, e.g. the strain known as ALVAC (Paoletti et al. 1994 Dev Biol Stand 82:65-69), or an adenovirus vector or a vesicular stomatitis virus vector or an alphavirus vector.
  • a viral vector such as a vaccinia virus vector such as a replication-deficient strain such as modified vaccinia Ankara (MVA) or NYVAC (Tartaglia et al. 1992 Virology 118:217-232), an avipox vector such as fowlpox or canarypox, e.g. the strain
  • the priming composition may comprise DNA encoding the antigen, such DNA preferably being in the form of a circular plasmid that is not capable of replicating in mammalian cells.
  • Any selectable marker should not be resistance to an antibiotic used clinically, so for example Kanamycin resistance is preferred to Ampicillin resistance.
  • Antigen expression should be driven by a promoter which is active in mammalian cells, for instance the cytomegalovirus immediate early (CMV IE) promoter.
  • CMV IE cytomegalovirus immediate early
  • a priming composition is followed by boosting with a boosting composition, or first and second boosting compositions, the first and second boosting compositions being the same or different from one another.
  • Still further boosting compositions may be employed without departing from the present invention.
  • a triple immunization regime employs DNA, then adenovirus as a first boosting composition, then MVA as a second boosting composition, optionally followed by a further (third) boosting composition or subsequent boosting administration of one or other or both of the same or different vectors.
  • DNA then MVA then adenovirus, optionally followed by subsequent boosting administration of one or other or both of the same or different vectors.
  • the antigen to be encoded in respective priming and boosting compositions need not be identical, but should share at least one CD8 + T cell epitope.
  • the antigen may correspond to a complete antigen, or a fragment thereof.
  • Peptide epitopes or artificial strings of epitopes may be employed, more efficiently cutting out unnecessary protein sequence in the antigen and encoding sequence in the vector or vectors.
  • One or more additional epitopes may be included, for instance epitopes which are recognized by T helper cells, especially epitopes recognized in individuals of different HLA types.
  • An HIV antigen of the invention to be encoded by a recombinant MVA virus includes polypeptides having immunogenic activity elicited by an amino acid sequence of an HIV Env, Gag, Pol, Vif, Vpr, Tat, Rev, Vpu, or Nef amino acid sequence as at least one CD8 + T cell epitope.
  • This amino acid sequence substantially corresponds to at least one 10-900 amino acid fragment and/or consensus sequence of a known HIV Env or Pol; or at least one 10-450 amino acid fragment and/or consensus sequence of a known HIV Gag; or at least one 10-100 amino acid fragment and/or consensus sequence of a known HIV Vif, Vpr, Tat, Rev, Vpu, or Nef.
  • Env is optionally deleted of subsequences. For example, regions of the gp120 surface and gp41 transmembrane cleavage products can be deleted.
  • Gag is optionally deleted of subsequences.
  • regions of the matrix protein (p17), regions of the capsid protein (p24), regions of the nucleocapsid protein (p7), and regions of p6 (the C-terminal peptide of the Gag polyprotein) can be deleted.
  • Pol is optionally deleted of subsequences.
  • regions of the protease protein (p10), regions of the reverse transcriptase protein (p66/p51), and regions of the integrase protein (p32) can be deleted.
  • Such an HIV Env, Gag, or Pol can have overall identity of at least 50% to a known Env, Gag, or Pol protein amino acid sequence, such as 50-99% identity, or any range or value therein, while eliciting an immunogenic response against at least one strain of an HIV.
  • Percent identify can be determined, for example, by comparing sequence information using the GAP computer program, version 6.0, available from the University of Wisconsin Genetics Computer Group (UWGCG).
  • the GAP program utilizes the alignment method of Needleman and Wunsch ( J Mol Biol 1970 48:443), as revised by Smith and Waterman ( Adv Appl Math 1981 2:482). Briefly, the GAP program defines identity as the number of aligned symbols (i.e., nucleotides or amino acids) which are identical, divided by the total number of symbols in the shorter of the two sequences.
  • the preferred default parameters for the GAP program include: (1) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov and Burgess ( Nucl Acids Res 1986 14:6745), as described by Schwartz and Dayhoff (eds., Atlas of Protein Sequence and Structure , National Biomedical Research Foundation, Washington, D.C. 1979, pp. 353-358); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
  • an Env of the present invention is a variant form of at least one HIV envelope protein.
  • the Env is composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacks part or all of the cytoplasmic domain of gp41.
  • HIV sequences are readily available from commercial and institutional HIV sequence databases, such as GENBANK, or as published compilations, such as Myers et al. eds., Human Retroviruses and AIDS, A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences , Vol. I and II, Theoretical Biology and Biophysics, Los Alamos, N. Mex. (1993), or http://hiv-web.lanl.gov/.
  • Substitutions or insertions of an HIV Env, Gag, or Pol to obtain an additional HIV Env, Gag, or Pol, encoded by a nucleic acid for use in a recombinant MVA virus of the present invention can include substitutions or insertions of at least one amino acid residue (e.g., 1-25 amino acids).
  • at least one amino acid e.g., 1-25 amino acids
  • substitutions, insertions or deletions are identified based on safety features, expression levels, immunogenicity and compatibility with high replication rates of MVA.
  • Amino acid sequence variations in an HIV Env, Gag, or Pol of the present invention can be prepared e.g., by mutations in the DNA.
  • HIV Env, Gag, or Pol include, for example, deletions, insertions or substitutions of nucleotides coding for different amino acid residues within the amino acid sequence.
  • mutations that will be made in nucleic acid encoding an HIV Env, Gag, or Pol must not place the sequence out of reading frame and preferably will not create complementary domains that could produce secondary mRNA structures.
  • HIV Env, Gag, or Pol-encoding nucleic acid of the present invention can also be prepared by amplification or site-directed mutagenesis of nucleotides in DNA or RNA encoding an HIV Env, Gag, or Pol and thereafter synthesizing or reverse transcribing the encoding DNA to produce DNA or RNA encoding an HIV Env, Gag, or Pol, based on the teaching and guidance presented herein.
  • Recombinant MVA viruses expressing HIV Env, Gag, or Pol of the present invention include a finite set of HIV Env, Gag, or Pol-encoding sequences as substitution nucleotides that can be routinely obtained by one of ordinary skill in the art, without undue experimentation, based on the teachings and guidance presented herein.
  • substitution nucleotides can be routinely obtained by one of ordinary skill in the art, without undue experimentation, based on the teachings and guidance presented herein.
  • For a detailed description of protein chemistry and structure see Schulz, G. E. et al., 1978 Principles of Protein Structure , Springer-Verlag, New York, N.Y., and Creighton, T. E., 1983 Proteins: Structure and Molecular Properties , W. H. Freeman & Co., San Francisco, Calif.
  • regulatory sequences for expression of the encoded antigen will include a natural, modified or synthetic poxvirus promoter.
  • promoter is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3′ direction on the sense strand of double-stranded DNA).
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is “under transcriptional initiation regulation” of the promoter.
  • Terminator fragments include terminator fragments, polyadenylation sequences, marker genes and other sequences.
  • Other regulatory sequences including terminator fragments, polyadenylation sequences, marker genes and other sequences may be included as appropriate, in accordance with the knowledge and practice of the ordinary person skilled in the art: see, for example, Moss, B. (2001). Poxviridae: the viruses and their replication. In Fields Virology, D. M. Knipe, and P. M. Howley, eds. (Philadelphia, Lippincott Williams & Wilkins), pp. 2849-2883.
  • Promoters for use in aspects and embodiments of the present invention must be compatible with poxvirus expression systems and include natural, modified and synthetic sequences.
  • Either or both of the priming and boosting compositions may include an adjuvant, such as granulocyte macrophage-colony stimulating factor (GM-CSF) or encoding nucleic acid therefor.
  • an adjuvant such as granulocyte macrophage-colony stimulating factor (GM-CSF) or encoding nucleic acid therefor.
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • Administration of the boosting composition is generally about 1 to 6 months after administration of the priming composition, preferably about 1 to 3 months.
  • priming composition is intradermal, intramuscular or mucosal immunization.
  • boosting composition is intradermal, intramuscular or mucosal immunization.
  • Administration of MVA vaccines may be achieved by using a needle to inject a suspension of the virus.
  • a needleless injection device to administer a virus suspension (using, e.g., BiojectorTM needleless injector) or a resuspended freeze-dried powder containing the vaccine, providing for manufacturing individually prepared doses that do not need cold storage. This would be a great advantage for a vaccine that is needed in rural areas of Africa.
  • MVA is a virus with an excellent safety record in human immunizations.
  • the generation of recombinant viruses can be accomplished simply, and they can be manufactured reproducibly in large quantities.
  • Intradermal, intramuscular or mucosal administration of recombinant MVA virus is therefore highly suitable for prophylactic or therapeutic vaccination of humans against AIDS which can be controlled by a CD8 + T cell response.
  • the individual may have AIDS such that delivery of the antigen and generation of a CD8 + T cell immune response to the antigen is of benefit or has a therapeutically beneficial effect.
  • administration will have prophylactic aim to generate an immune response against HIV or AIDS before infection or development of symptoms.
  • compositions may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material may depend on the route of administration, e.g. intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • administration is preferably intradermal, intramuscular or mucosal.
  • Physiological saline solution dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection.
  • Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included as required.
  • a slow-release formulation may be employed.
  • the particles may be administered to an individual, particularly human or other primate. Administration may be to another mammal, e.g. rodent such as mouse, rat or hamster, guinea pig, rabbit, sheep, goat, pig, horse, cow, donkey, dog or cat.
  • rodent such as mouse, rat or hamster, guinea pig, rabbit, sheep, goat, pig, horse, cow, donkey, dog or cat.
  • Administration is preferably in a “prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual.
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, or in a veterinary context a veterinarian, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences , 16th edition, 1980, Osol, A. (ed.).
  • DNA is administered at a dose of 250 ⁇ g to 2.5 mg/injection, followed by MVA at a dose of 10 6 to 10 9 infectious virus particles/injection.
  • a composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • Delivery to a non-human mammal need not be for a therapeutic purpose, but may be for use in an experimental context, for instance in investigation of mechanisms of immune responses to an antigen of interest, e.g. protection against HIV or AIDS.
  • SHIV-89.6 The 89.6 chimera of simian and human immunodeficiency viruses (SHIV-89.6) was used for the construction of immunogens and its highly pathogenic derivative, SHIV-89.6P, for challenge (G. B. Karlsson et al. 1997 J Virol 71:4218). SHIV-89.6 and SHIV-89.6P do not generate cross-neutralizing antibody (D. C . . . Montefiori et al.
  • MVA Modified vaccinia Ankara
  • rMVA DNA and recombinant MVA
  • the DNA prime (DNA/89.6) expressed simian immunodeficiency virus (SIV) Gag, Pol, Vif, Vpx, and Vpr and human immunodeficiency virus-1 (HIV-1) Env, Tat, and Rev from a single transcript (R. J. Gorelick et al. 1999 Virology 253:259; M. M. Sauter et al. 1996 J Cell Biol 132:795).
  • SIV simian immunodeficiency virus
  • HIV-1 human immunodeficiency virus-1
  • SHIV-89.6 sequences were cloned into the vector pGA2 using ClaI and RsrII sites. This cloning deleted both long terminal repeats (LTRs) and nef.
  • the SHIV-89.6 sequences also were internally mutated for a 12-base pair region encoding the first four amino acids of the second zinc finger in nucleocapsid. This mutation renders SHIV viruses noninfectious (R. J. Gorelick et al. 1999 Virology 253:259).
  • a mutation in gp41 converted the tyrosine at position 710 to cysteine to achieve better expression of Env on the plasma membrane of DNA-expressing cells (M. M.
  • pGA2 uses the CMV immediate early promoter without intron A and the bovine growth hormone polyadenylation sequence to express vaccine inserts.
  • Vaccine DNA was produced by Althea (San Diego, Calif.). In transient transfections of 293T cells, DNA/89.6 produced about 300 ng of Gag and 85 ng of Env per 1 ⁇ 10 6 cells.
  • the rMVA booster (MVA/89.6) expressed SIV Gag, Pol, and HIV-1 Env under the control of vaccinia virus early/late promoters.
  • the MVA double recombinant virus expressed both the HIV 89.6 Env and the SIV 239 Gag-Pol, which were inserted into deletion II and deletion III of MVA, respectively.
  • the 89.6 Env protein was truncated for the COOH-terminal 115 amino acids of gp41.
  • the modified H5 promoter controlled the expression of both foreign genes.
  • Vaccination was accomplished by priming with DNA at 0 and 8 weeks and boosting with rMVA at 24 weeks (FIG. 7A).
  • DNA immunizations were delivered in phosphate-buffered saline (PBS) with a needleless jet injector (Bioject, Portland, Oreg.) to deliver five i.d. 100- ⁇ l injections to each outer thigh for the 2.5-mg dose of DNA or one i.d. 100- ⁇ l injection to the right outer thigh for the 250- ⁇ g dose of plasmid.
  • PBS phosphate-buffered saline
  • Bioject Bioject, Portland, Oreg.
  • I.m. deliveries of DNA were done with one 0.5-ml injection of DNA in PBS to each outer thigh for the 2.5-mg dose and one 100- ⁇ l injection to the right outer thigh for the 250- ⁇ g dose.
  • 1 ⁇ 10 8 pfu of MVA/89.6 was administered both i.d. and i.m. with a needle.
  • One 100- ⁇ l dose was delivered to each outer thigh for the i.d. dose and one 500- ⁇ l dose to each outer thigh for the i.m dose.
  • Control animals received 2.5 mg of the pGA2 vector without vaccine insert with the Bioject device to deliver five 100- ⁇ l doses i.d. to each outer thigh.
  • the control MVA booster immunization consisted of 2 ⁇ 10 8 pfu of MVA without an insert delivered i.d. and i.m. as described for MVA/89.6.
  • Animal numbers are as follows: 1, RBr-5*; 2, RIm-5*; 3, RQf-5*; 4, RZe-5; 5, ROm-5; 6, RDm-5; 7, RAj-5*; 8, RJi-5*; 9, RAl-5*; 10, RDe-5*; 11, RAi-5; 12, RPr-5; 13, RKw-4*; 14, RWz-5*; 15, RGo-5; 16, RLp-4; 17, RWd-6; 18, RAt-5; 19, RPb-5*; 20, RIi-5*; 21, RIq-5; 22, RSp-4; 23, RSn-5; 24, RGd-6; 25, RMb-5*; 26, RGy-5*; 27, RUs-4; and 28, RPm-5. Animals with the A*01 allele are indicated with asterisks.
  • DNA priming followed by rMVA boosting generated high frequencies of virus-specific T cells that peaked at one week following the rMVA booster (FIG. 7).
  • the frequencies of T cells recognizing the Gag-CM9 epitope were assessed by means of Mamu-A*01 tetramers, and the frequencies of T cells recognizing epitopes throughout Gag were assessed with pools of overlapping peptides and an enzyme-linked immunospot (ELISPOT) assay (C. A. Power et al. 1999 J Immunol Methods 227:99).
  • ELISPOT enzyme-linked immunospot
  • PBMC peripheral blood mononuclear cells
  • FITC fluorescein isothiocyanate
  • PerCP peridinin chlorophyl protein
  • SEQ ID NO: 6 Gag-CM9-Mamu-A*01 tetramer
  • Cells were washed twice with cold PBS containing 2% fetal bovine serum (FBS), fixed with 1% paraformaldehyde in PBS, and analyzed within 24 hrs on a FACScaliber (Becton Dickinson, San Jose, Calif.). Cells were initially gated on lymphocyte populations with forward scatter and side scatter and then on CD3 cells. The CD3 cells were then analyzed for CD8 and tetramer-binding cells. About 150,000 lymphocytes were acquired for each sample. Data were analyzed using FloJo software (Tree Star, San Carlos, Calif.).
  • IFN- ⁇ ELISPOTs For interferon- ⁇ (IFN- ⁇ ) ELISPOTs, MULTISCREEN 96 well filtration plates (Millipore Inc. Bedford, Mass.) were coated overnight with antibody to human IFN- ⁇ (Clone B27, Pharmingen, San Diego, Calif.) at a concentration of 2 ⁇ g/ml in sodium bicarbonate buffer (pH 9.6) at 8° to 10° C. Plates were washed two times with RPMI medium and then blocked for 1 hour with complete medium (RPMI containing 10% FBS) at 37° C. Plates were washed five more times with plain RPMI medium, and cells were seeded in duplicate in 100 ⁇ l complete medium at numbers ranging from 2 ⁇ 10 4 to 5 ⁇ 10 5 cells per well.
  • IFN- ⁇ interferon- ⁇
  • Peptide pools were added to each well to a final concentration of 2 ⁇ g/ml of each peptide in a volume of 100 ⁇ l in complete medium.
  • Cells were cultured at 37° C. for about 36 hrs under 5% CO 2 . Plates were washed six times with wash buffer (PBS with 0.05% Tween-20) and then incubated with 1 ⁇ g of biotinylated antibody to human IFN- ⁇ per milliliter (clone 7-86-1; Diapharma Group, West Chester, Ohio) diluted in wash buffer containing 2% FBS. Plates were incubated for 2 hrs at 37° C. and washed six times with wash buffer.
  • wash buffer PBS with 0.05% Tween-20
  • ELISPOTs The frequencies of ELISPOTs are approximate because different dilutions of cells have different efficiencies of spot formation in the absence of feeder cells (C. A. Power et al. 1999 J Immunol Methods 227: 99). The same dilution of cells was used for all animals at a given time point, but different dilutions were used to detect memory and acute responses.
  • Gag-CM9 tetramer analyses were restricted to macaques that expressed the Mamu-A*01 histocompatibility type, whereas ELISPOT responses did not depend on a specific histocompatibility type.
  • the DNA immunizations raised low levels of memory cells that expanded to high frequencies within 1 week of the rMVA booster (FIGS. 7 and 12).
  • CD8 cells specific to the Gag-CM9 epitope expanded to frequencies as high as 19% of total CD8 T cells (FIG. 12). This peak of specific cells underwent a 10- to 100-fold contraction into the DNA/MVA memory pool (FIGS. 7A and 12).
  • ELISPOTs for three pools of Gag peptides also underwent a major expansion (frequencies up to 4000 spots for 1 ⁇ 10 6 PBMC) before contracting from 5- to 20-fold into the DNA/MVA memory response (FIG. 7B).
  • the frequencies of ELISPOTs were the same in macaques with and without the A*01 histocompatibility type (P>0.2).
  • the rank order for the height of the ELISPOTs in the vaccine groups was 2.5 mg i.d.>2.5 mg i.m.>250 ⁇ g i.d.>250 ⁇ g i.m. (FIG. 7B).
  • the IFN- ⁇ ELISPOTs included both CD4 and CD8 cells. Gag-CM9-specific CD8 cells had good lytic activity after restimulation with peptide.
  • the challenge stock (5.7 ⁇ 10 9 copies of viral RNA per milliliter) was produced by one intravenous followed by one intrarectal passage in rhesus macaques of the original SHIV-89.6P stock (G. B. Karlsson et al. 1997 J Virol 71:4218). Lymphoid cells were harvested from the intrarectally infected animal at peak viremia, CD8-depleted, and mitogen-stimulated for stock production. Before intrarectal challenge, fasted animals were anesthetized (ketamine, 10 mg/kg) and placed on their stomach with the pelvic region slightly elevated. A feeding tube (8Fr (2.7 mm) ⁇ 16 inches (41 cm); Sherwood Medical, St.
  • a syringe containing 20 intrarectal infectious doses in 2 ml of RPMI-1640 plus 10% FBS was attached to the tube and the inoculum was slowly injected into the rectum.
  • the feeding tube was flushed with 3.0 ml of RPMI without FBS and then slowly withdrawn. Animals were left in place, with pelvic regions slightly elevated, for a period of ten minutes after the challenge.
  • the reaction mix was adjusted to a final volume of 50 ⁇ l containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 4 mM MgCl 2 , 0.4 mM each dNTP, 0.2 ⁇ M forward primer, 0.2 ⁇ M reverse primer, 0.1 ⁇ M probe, and 5 units AmpliTaq Gold DNA polymerase (all reagents from PerkinElmer Applied Biosystems, Foster City, Calif.).
  • the primer sequences within a conserved portion of the SIV gag gene are the same as those described previously (S. Staprans et al. in: Viral Genome Methods K. Adolph, ed. CRC Press, Boca Raton, Fla., 1996 pp.
  • PCR product accumulation was monitored with the 7700 sequence detector and a probe to an internal conserved gag gene sequence: 6FAM-CTGTCTGCGTCATTTGGTGC-Tamra (SEQ ID NO: 8), where FAM and Tamra denote the reporter and quencher dyes.
  • SHIV RNA copy number was determined by comparison with an external standard curve consisting of virion-derived SIVmac239 RNA quantified by the SIV bDNA method (Bayer Diagnostics, Emeryville, Calif.).
  • the intraassay coefficient of variation was ⁇ 20% for samples containing >10 4 SHIV RNA copies per milliliter, and ⁇ 25% for samples containing 10 3 to 10 4 SHIV RNA copies per milliliter.
  • both high-dose DNA-primed groups and the low-dose i.d. DNA-primed group had reduced their geometric mean loads to about 1000 copies of viral RNA per milliliter.
  • the low-dose i.m. DNA-primed group had a geometric mean of 6 ⁇ 10 3 copies of viral RNA and the nonvaccinated controls had a geometric mean of 2 ⁇ 10 6 .
  • the low-dose i.m. group had reduced its geometric mean copies of viral RNA to 1000.
  • the 24 vaccinated animals only one animal, animal number 22 in the low-dose i.m. group, had intermittent viral loads above 1 ⁇ 10 4 copies per milliliter (FIG. 8D).
  • PBMC peripheral blood mononuclear cells
  • CTPYDINQM Gag-CM9 peptide
  • SEQ ID NO: 6 Gag-CM9 peptide
  • RPMI RPMI containing 10% FBS and monensin (10 ⁇ g/ml) was added, and the cells were cultured for an additional 5 hrs at 37° C. at an angle of 5° under 5% CO 2 .
  • Cells were surface stained with antibodies to CD8 conjugated to PerCP (clone SK1, Becton Dickinson) at 8° to 10° C. for 30 min, washed twice with cold PBS containing 2% FBS, and fixed and permeabilized with Cytofix/Cytoperm solution (Pharmingen).
  • the tetramer + cells in the control group like those in the vaccine group, produced IFN- ⁇ after peptide stimulation (FIG. 9B).
  • IFN- ⁇ after peptide stimulation
  • three of the four controls had undetectable levels of IFN- ⁇ -producing ELISPOTs. This rapid loss of antiviral T cells in the presence of high viral loads may reflect the lack of CD4 help.
  • T cell proliferative responses demonstrated that virus-specific CD4 cells had survived the challenge and were available to support the antiviral immune response (FIG. 9C).
  • Stimulation indices are the counts of tritiated thymidine incorporated in PBMC stimulated with 89.6 antigens divided by the counts of tritiated thymidine incorporated by the same PBMC stimulated with mock antigen.
  • lymph nodes from the vaccinated animals were morphologically intact and responding to the infection, whereas those from the infected controls had been functionally destroyed (FIG. 10).
  • Nodes from vaccinated animals contained large numbers of reactive secondary follicles with expanded germinal centers and discrete dark and light zones (FIG. 10A).
  • lymph nodes from the non-vaccinated control animals showed follicular and paracortical depletion (FIG. 10B), while those from unvaccinated and unchallenged animals displayed normal numbers of minimally reactive germinal centers (FIG. 10C).
  • Germinal centers occupied ⁇ 0.05% of total lymph node area in the infected controls, 2% of the lymph node area in the uninfected controls, and up to 18% of the lymph node area in the vaccinated groups (FIG. 10 D). More vigorous immune reactivity in the low-dose than the high-dose DNA-primed animals was suggested by more extensive germinal centers in the low dose group (FIG. 10D).
  • in situ hybridization for viral RNA revealed rare virus-expressing cells in lymph nodes from 3 of the 24 vaccinated macaques, whereas virus-expressing cells were readily detected in lymph nodes from each of the infected control animals.
  • the cytomorphology of infected lymph node cells was consistent with a macrophage phenotype.
  • the prime/boost strategy raised low levels of antibody to Gag and undetectable levels of antibody to Env (FIG. 11).
  • Postchallenge antibodies to both Env and Gag underwent anamnestic responses with total Gag antibody reaching heights approaching 1 mg/ml and total Env antibody reaching heights of up to 100 ⁇ g/ml.
  • Enzyme-linked immunosorbent assays for total antibody to Gag used bacterially produced SIV gag p27 to coat wells (2 ⁇ g per milliliter in bicarbonate buffer).
  • ELISAs for antibody to Env antibody used 89.6 Env produced in transiently transfected 293T cells and captured with sheep antibody against Env (catalog number 6205; International Enzymes, Fairbrook Calif.).
  • Standard curves for Gag and Env ELISAs were produced with serum from a SHIV-89.6-infected macaque with known amounts of immunoglobulin G (IgG) specific for Gag or Env.
  • IgG immunoglobulin G
  • Bound antibody was detected with peroxidase-conjugated goat antibody to macaque IgG (catalog # YNGMOIGGFCP; Accurate Chemical, Westbury, N.Y.) and TMB substrate (Catalog # T3405; Sigma, St. Louis, Mo.). Sera were assayed at threefold dilutions in duplicate wells. Dilutions of test sera were performed in whey buffer (4% whey and 0.1% tween 20 in 1 ⁇ PBS). Blocking buffer consisted of whey buffer plus 0.5% nonfat dry milk. Reactions were stopped with 2M H 2 SO 4 and the optical density read at 450 nm. Standard curves were fitted and sample concentrations were interpolated as ⁇ g of antibody per ml of serum using SOFTmax 2.3 software (Molecular Devices, Sunnyvale, Calif.).
  • the high-dose DNA-primed animals had slightly lower geometric mean levels of viral RNA (7 ⁇ 10 2 and 5 ⁇ 10 2 ) than the low-dose DNA-primed animals (9 ⁇ 10 2 and 1 ⁇ 10 3 ).
  • the DNA/MVA vaccine controlled the infection, rapidly reducing viral loads to near or below 1000 copies of viral RNA per milliliter of blood. Containment, rather than prevention of infection, affords the opportunity to establish a chronic infection (H. L. Robinson et al. 1999 Nat Med 5:526). By rapidly reducing viral loads, a multiprotein DNA/MVA vaccine will extend the prospect for long-term non-progression and limit HIV transmission. (J. W. Mellors et al. 1996 Science 272:1167; T. C. Quinn et al. 2000 N Engl J Med 342:921).
  • This disclosure describes the construction of a modified vaccinia Ankara (MVA) recombinant virus, MVA/HIV clade B recombinant virus expressing the HIV strain ADA env and the HXB2 gag pol (MVA/HIV ADA env+HXB2 gag pol).
  • MVA/HIV 48 the lab name of MVA/HIV 48 will be used, which denotes the plasmid from which the construct comes.
  • the HIV gag-pol genes were derived from the Clade B infectious HXB2 virus.
  • the gag-pol gene was truncated so that most of the integrase coding sequences were removed and amino acids 185, 266, and 478 were mutated to inactivate reverse transcriptase, inhibit strand transfer activity, and inhibit the RNaseH activity, respectively.
  • the Clade B CCR5 tropic envelope gene was derived from the primary ADA isolate; TTTTTNT sequences were mutated without changing coding capacity to prevent premature transcription termination and the cytoplasmic tail was truncated in order to improve surface expression, immunogenicity, and stability of the MVA vector.
  • the HIV genes were inserted into a plasmid transfer vector so that gag-pol gene was regulated by the modified H5 early/late vaccinia virus promoter and the env gene was regulated by the newly designed early/late Psyn II promoter to provide similar high levels of expression.
  • a self-deleting GUS reporter gene was included to allow detection and isolation of the recombinant virus.
  • the HIV genes were flanked by MVA sequences to allow homologous recombination into the deletion 3 site so that the recombinant MVA would remain TK positive for stability and high expression in resting cells. The recombinant MVA was isolated and shown to express abundant amounts of gag-pol-env and to process gag.
  • the plasmid transfer vector used to make the MVA recombinant virus, pLW-48, (FIG. 16) by homologous recombination was constructed as follows:
  • flanking areas on either side of deletion III designated flank 1 and flank 2, containing 926 and 520 base pairs respectively, were amplified by PCR from the MVA stains of vaccinia virus.
  • a promoter, the mH5 which had been modified from the originally published sequence by changing two bases that had been shown by previously published work to increase the expression of the cloned gene, was added.
  • a clade B gag pol (FIG. 17) was truncated so that the integrase was removed and was cloned into the plasmid so that it was controlled by the mH5 promoter.
  • This gene contained the complete HXB2 sequence of the gag.
  • the pol gene has reverse transcriptase safety mutations in amino acid 185 within the active site of RT, in amino acid 266 which inhibits strand transfer activity, and at amino acid 478 which inhibits the RNaseH activity.
  • the integrase gene was deleted past EcoRI site.
  • MVA virus which may be obtained from ATCC Number VR-1508, was plaque purified three times by terminal dilutions in chicken embryo fibroblasts (CEF), which were made from 9 day old SPF Premium SPAFAS fertile chicken eggs, distributed by B and E Eggs, Stevens, Pa.
  • CEF chicken embryo fibroblasts
  • the recombinant virus was shown to produce gag particles in the supernatant of infected cells by pelleting the 35 S-labeled particles on a 20% sucrose cushion.
  • Gag particles were also visualized both outside and budding from cells as well as within vacuoles of cells in the electron microscope in thin sections. These gag particles had envelope protein on their surface.
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer, and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • MVA/HIV 48 which has high expression of the ADA truncated envelope and the HXB2 gag pol.
  • the MVA recombinant virus is made using a transiently expressed GUS marker that is deleted in the final virus.
  • High expression of the ADA envelope is possible because of a new hybrid early/late promoter, Psyn II.
  • the envelope has been truncated because we have shown truncation of the envelope enhances the amount of protein on the surface of the infected cells, and hence enhances immunogenicity; stability of the recombinant is also enhanced.
  • the MVA recombinant makes gag particles which has been shown by pelleting the particles through sucrose and analyzing by PAGE. Gag particles with envelope protein on the surface have also been visualized in the electron microscope.
  • Additional modified or synthetic promoters were designed for gene expression in MVA or other poxviruses. Promoters were modified to allow expression at early and late times after infection and to reduce possibility of homologous recombination between identical sequences when multiple promoters are used in same MVA vector. Promoters are placed upstream of protein coding sequence.
  • m7.5 promoter CGCTTTTTATAGTAAGTTTTTCACCCATAAATAATAAATACAATAATTAATTTC (SEQ ID NO:10) TCGTAAAAATTGAAAAACTATTCTAATTTATTGCACGGT Psyn II promoter: TAAAAAATGAAAAAATATTCTAATTTATAGGACGGTTTTGATTTTCTTTTTTTC (SEQ ID NO:2) TATGCTATAAATAATAAATA Psyn III promoter: TAAAAATTGAAAAAATATTCTAATTTATAGGACGGTTTTGATTTTCTTTTTTTC (SEQ ID NO:11) TATACTATAAATAATAAATA Psyn IV promoter: TAAAAATTGAAAAACTATTCTAATTTATAGGACGGTTTTGATTTTCTTTTTTTC (SEQ ID NO:12) TATACTATAAATAATAAATA Psyn V promoter: AAAAAATGATAAAGTAGGTTCAGTTTTATTGCTGGTTTAAAATCACGCTTTCG (SEQ ID NO:
  • Table A MVA/48 immunization—guinea pigs.
  • Table B Frequencies of HIV-1 gag-specific T cells following immunization of mice with MVA/48.
  • Table D Antibody response following immunization of macaques with MVA/SHIV KB9.
  • SHIV-89.6P and SHIV-89.6 were neutralized in an MT-2 cell assay. Titers are the reciprocal serum dilution at which 50% of the cells were protected from virus-induced killing.
  • SHIV-89.6P and SHIV-89.6 are heterologous, i.e. sera from animals infected with one of the viruses does not neutralize the other virus.
  • two immunizations with MVA/SHIV-KB9 elicited good ELISA binding antibodies in all animals and neutralizing antibodies to the homologous virus (SHIV-89.6P) in some animals.
  • heterologous neutralizing antibodies were observed in a subset of animals.
  • Nab titer Nab titer animals animals 598 tonsil 25,600 31,086 20,383 ⁇ 20 ⁇ 20 3 2 601 ′′ 51,200 ⁇ 20 ⁇ 20 606 ′′ 25,600 ⁇ 20 ⁇ 20 642 ′′ 51,200 75 31 646 ′′ 51,200 61 48 653 ′′ 6,400 ⁇ 20 ⁇ 20 654 ′′ 6,400 22 ⁇ 20 602 i.d.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Oncology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides modified virus Ankara (MVA), a replication-deficient strain of vaccinia virus, expressing human immunodeficiency virus (HIV) env, gag, and pol genes.

Description

    RELATED APPLICATIONS
  • This application is a continuation and claims the benefit of priority of International Application No. PCT/US02/06713 filed Mar. 1, 2002, designating the United States of America and published in English, which claims the benefit of priority of U.S. Provisional Application No. 60/274,434 filed Mar. 8, 2001, both of which are hereby expressly incorporated by reference in their entireties.[0001]
    • FIELD OF THE INVENTION
  • The invention provides modified vaccinia Ankara (MVA), a replication-deficient strain of vaccinia virus, expressing human immunodeficiency virus (HIV) env, gag, and pol genes. [0002]
    • BACKGROUND OF THE INVENTION
  • Cellular immunity plays an important role in the control of immunodeficiency virus infections (P. J. Goulder et al. 1999 [0003] AIDS 13:S121). Recently, a DNA vaccine designed to enhance cellular immunity by cytokine augmentation successfully contained a highly virulent immunodeficiency virus challenge (D. H. Barouch et al. 2000 Science 290:486). Another promising approach to raising cellular immunity is DNA priming followed by recombinant poxvirus boosters (H. L. Robinson et al. 2000 AIDS Rev 2:105). This heterologous prime/boost regimen induces 10- to 100-fold higher frequencies of T cells than priming and boosting with DNA or recombinant poxvirus vaccines alone. Previously, investigators showed that boosting a DNA-primed response with a poxvirus was superior to boosting with DNA or protein for the control of a non-pathogenic immunodeficiency virus (H. L. Robinson et al. 1999 Nat Med 5:526). There is a need for the control of a pathogenic immnunodeficiency virus.
    • SUMMARY OF THE INVENTION
  • Here we report that DNA priming followed by a recombinant modified vaccinia Ankara (rMVA) booster has controlled a highly pathogenic immunodeficiency virus challenge in a rhesus macaque model. Both the DNA and rMVA components of the vaccine expressed multiple immnunodeficiency virus proteins. Two DNA inoculations at 0 and 8 weeks and a single rMVA booster at 24 weeks effectively controlled an intrarectal challenge administered seven months after the booster. These findings are envisioned as indicating that a relatively simple multiprotein DNA/MVA vaccine can help to control the acquired immune deficiency syndrome (AIDS) epidemic. We also report that inoculations of rMVA induce good immune responses even without DNA priming.[0004]
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1. Phylogenetic relationships of HIV-1 and HIV-2 based on identity of pol gene sequences. SIV[0005] cpz and SIVsmm are subhuman primate lentiviruses recovered from a chimpanzee and sooty mangabey monkey, respectively.
  • FIG. 2. Phylogenetic relationships of HIV-1 groups M, N and O with four different SIV[0006] cpz isolates based on full-length pol gene sequences. The bar indicates a genetic distance of 0.1 (10% nucleotide divergence) and the asterisk positions group N HIV-1 isolates based on env sequences.
  • FIG. 3. Tropic and biologic properties of HIV-1 isolates. [0007]
  • FIG. 4. HIV-encoded proteins. The location of the HIV genes, the sizes of primary translation products (in some cases polyproteins), and the processed mature viral proteins are indicated. [0008]
  • FIG. 5. Schematic representation of a mature HIV-1 virion. [0009]
  • FIG. 6. Linear representation of the HIV-1 Env glycoprotein. The arrow indicates the site of gp160 cleavage to gp120 and gp41. In gp120, cross-hatched areas represent variable domains (V[0010] 1 to V5) and open boxes depict conserved sequences (C1 to C5). In the gp41 ectodomain, several domains are indicated: the N-terminal fusion peptide, and the two ectodomain helices (N- and C-helix). The membrane-spanning domain is represented by a black box. In the gp41 cytoplasmic domain, the Tyr-X-X-Leu (YXXL) endocytosis motif (SEQ ID NO: 9) and two predicted helical domains (helix-1 and -2) are shown. Amino acid numbers are indicated.
  • FIG. 7. Temporal frequencies of Gag-specific T cells. (A) Gag-specific CD8 T cell responses raised by DNA priming and rMVA booster immunizations. The schematic presents mean Gag-CM9-tetramer data generated in the high-dose i.d. DNA-immunized animals. (B) Gag-specific IFN-γ ELISPOTs in A*01 (open bars) and non-A*01 (filled bars) macaques at various times before challenge and at two weeks after challenge. Three pools of 10 to 13 Gag peptides (22-mers overlapping by 12) were used for the analyses. The numbers above data bars represent the arithmetic mean±SD for the ELISPOTs within each group. The numbers at the top of the graphs designate individual animals. *, data not available; #, <20 ELISPOTs per 1×10[0011] 6 peripheral blood mononuclear cells (PBMC). Temporal data for Gag-CM9-Mamu-A*01 tetramer-specific T cells can be found in FIG. 12.
  • FIG. 8. Temporal viral loads, CD4 counts, and survival after challenge of vaccinated and control animals. (A) Geometric mean viral loads and (B) geometric mean CD4 counts. (C) Survival curve for vaccinated and control animals. The dotted line represents all 24 vaccinated animals. (D) Viral loads and (E) CD4 counts for individual animals in the vaccine and control groups. The key to animal numbers is presented in (E). Assays for the first 12 weeks after challenge had a detection level of 1000 copies of RNA per milliliter of plasma. Animals with loads below 1000 were scored with a load of 500. For [0012] weeks 16 and 20, the detection level was 300 copies of RNA per milliliter. Animals with levels of virus below 300 were scored at 300.
  • FIG. 9. Postchallenge T cell responses in vaccine and control groups. (A) Temporal tetramer[0013] + cells (dashed line) and viral loads (solid line). (B) Intracellular cytokine assays for IFN-γ production in response to stimulation with the Gag-CM9 peptide at two weeks after challenge. This ex vivo assay allows evaluation of the functional status of the peak postchallenge tetramer+ cells displayed in FIG. 7A. (C) Proliferation assay at 12 weeks after challenge. Gag-Pol-Env (open bars) and Gag-Pol (hatched bars) produced by transient transfections were used for stimulation. Supernatants from mock-transfected cultures served as control antigen. Stimulation indices are the growth of cultures in the presence of viral antigens divided by the growth of cultures in the presence of mock antigen.
  • FIG. 10. Lymph node histomorphology at 12 weeks after challenge. (A) Typical lymph node from a vaccinated macaque showing evidence of follicular hyperplasia characterized by the presence of numerous secondary follicles with expanded germinal centers and discrete dark and light zones. (B) Typical lymph node from an infected control animal showing follicular depletion and paracortical lymphocellular atrophy. (C) A representative lymph node from an age-matched, uninfected macaque displaying nonreactive germinal centers. (D) The percentage of the total lymph node area occupied by germinal centers was measured to give a non-specific indicator of follicular hyperplasia. Data for uninfected controls are for four age-matched rhesus macaques. [0014]
  • FIG. 11. Temporal antibody responses. Micrograms of total Gag (A) or Env (B) antibody were determined with ELISAs. The titers of neutralizing antibody for SHIV-89.6 (C) and SHIV-89.6P (D) were determined with MT-2 cell killing and neutral red staining (D. C. Montefiori et al. 1988 [0015] J Clin Microbiol 26:231). Titers are the reciprocal of the serum dilution giving 50% neutralization of the indicated viruses grown in human PBMC. Symbols for animals are the same as in FIG. 8.
  • FIG. 12. Gag-CM9-Mamu-A*01 tetramer-specific T cells in Mamu-A*01 vaccinated and control macaques at various times before challenge and at two weeks after challenge. The number at the upper right corner of each plot represents the frequency of tetramer-specific CD8 T cells as a % of total CD8 T cells. The numbers above each column of FACS data designate individual animals. [0016]
  • FIG. 13. Map of plasmid transfer vector pLW-48. [0017]
  • FIG. 14. Sequence of plasmid transfer vector pLW-48. [0018]
  • FIG. 15. Sequences of plasmid transfer vector pLW-48, Psy II promoter (which controls ADA envelope expression), ADA envelope truncated, PmH5 promoter (which controls HXB2 gag pol expression), and HXB2 gag pol (with safety mutations, Δ integrase). [0019]
  • FIG. 16. Plasmid transfer vector pLW-48 and making MVA recombinant virus MVA/[0020] HIV 48.
  • FIG. 17. A clade B gag pol. [0021]
  • FIG. 18. Sequence of new Psyn II promoter.[0022]
    • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
  • Recombinant MVA Virus [0023]
  • Vaccinia virus, a member of the genus Orthopoxvirus in the family of Poxviridae, was used as live vaccine to immunize against the human smallpox disease. Successful worldwide vaccination with vaccinia virus culminated in the eradication of variola virus, the causative agent of the smallpox (The global eradication of smallpox. Final report of the global commission for the certification of smallpox eradication. History of Public Health, No. 4, Geneva: World Health Organization, 1980). Since that WHO declaration, vaccination has been universally discontinued except for people at high risk of poxvirus infections (e.g. laboratory workers). [0024]
  • More recently, vaccinia viruses have also been used to engineer viral vectors for recombinant gene expression and for the potential use as recombinant live vaccines (Mackett, M. et al. 1982 [0025] PNAS USA 79:7415-7419; Smith, G. L. et al. 1984 Biotech Genet Engin Rev 2:383-407). This entails DNA sequences (genes) which code for foreign antigens being introduced, with the aid of DNA recombination techniques, into the genome of the vaccinia viruses. If the gene is integrated at a site in the viral DNA which is non-essential for the life cycle of the virus, it is possible for the newly produced recombinant vaccinia virus to be infectious, that is to say able to infect foreign cells and thus to express the integrated DNA sequence (EP Patent Applications No. 83,286 and No. 110,385). The recombinant vaccinia viruses prepared in this way can be used, on the one hand, as live vaccines for the prophylaxis of infectious diseases, on the other hand, for the preparation of heterologous proteins in eukaryotic cells.
  • For vector applications health risks would be lessened by the use of a highly attenuated vaccinia virus strain. Several such strains of vaccinia virus were especially developed to avoid undesired side effects of smallpox vaccination. Thus, the modified vaccinia Ankara (MVA) has been generated by long-term serial passages of the Ankara strain of vaccinia virus (CVA) on chicken embryo fibroblasts (for review see Mayr, A. et al. 1975 [0026] Infection 3:6-14; Swiss Patent No. 568,392). The MVA virus is publicly available from American Type Culture Collection as ATCC No. VR-1508. MVA is distinguished by its great attenuation, that is to say by diminished virulence and ability to replicate in primate cells while maintaining good immunogenicity. The MVA virus has been analyzed to determine alterations in the genome relative to the parental CVA strain. Six major deletions of genomic DNA (deletion I, II, III, IV, V, and VI) totaling 31,000 base pairs have been identified (Meyer, H. et al. 1991 J Gen Virol 72:1031-1038). The resulting MVA virus became severely host cell restricted to avian cells.
  • Furthermore, MVA is characterized by its extreme attenuation. When tested in a variety of animal models, MVA was proven to be avirulent even in immunosuppressed animals. More importantly, the excellent properties of the MVA strain have been demonstrated in extensive clinical trials (Mayr A. et al. 1978 Zentralbl Bakteriol [B] 167:375-390; Stickl et al. 1974 Dtsch Med Wschr 99:2386-2392). During these studies in over 120,000 humans, including high-risk patients, no side effects were associated with the use of MVA vaccine. [0027]
  • MVA replication in human cells was found to be blocked late in infection preventing the assembly to mature infectious virions. Nevertheless, MVA was able to express viral and recombinant genes at high levels even in non-permissive cells and was proposed to serve as an efficient and exceptionally safe gene expression vector (Sutter, G. and Moss, B. 1992 [0028] PNAS USA 89:10847-10851). Additionally, novel vaccinia vector vaccines were established on the basis of MVA having foreign DNA sequences inserted at the site of deletion III within the MVA genome (Sutter, G. et al. 1994 Vaccine 12:1032-1040).
  • The recombinant MVA vaccinia viruses can be prepared as set out hereinafter. A DNA-construct which contains a DNA-sequence which codes for a foreign polypeptide flanked by MVA DNA sequences adjacent to a naturally occurring deletion, e.g. deletion III, or other non-essential sites, within the MVA genome, is introduced into cells infected with MVA, to allow homologous recombination. Once the DNA-construct has been introduced into the eukaryotic cell and the foreign DNA has recombined with the viral DNA, it is possible to isolate the desired recombinant vaccinia virus in a manner known per se, preferably with the aid of a marker. The DNA-construct to be inserted can be linear or circular. A plasmid or polymerase chain reaction product is preferred. The DNA-construct contains sequences flanking the left and the right side of a naturally occurring deletion, e.g. deletion III, within the MVA genome. The foreign DNA sequence is inserted between the sequences flanking the naturally occurring deletion. For the expression of a DNA sequence or gene, it is necessary for regulatory sequences, which are required for the transcription of the gene, to be present on the DNA. Such regulatory sequences (called promoters) are known to those skilled in the art, and include for example those of the [0029] vaccinia 11 kDa gene as are described in EP-A-198,328, and those of the 7.5 kDa gene (EP-A-110,385). The DNA-construct can be introduced into the MVA infected cells by transfection, for example by means of calcium phosphate precipitation (Graham et al. 1973 Virol 52:456-467; Wigler et al. 1979 Cell 16:777-785), by means of electroporation (Neumann et al. 1982 EMBO J 1:841-845), by microinjection (Graessmann et al. 1983 Meth Enzymol 101:482-492), by means of liposomes (Straubinger et al. 1983 Meth Enzymol 101:512-527), by means of spheroplasts (Schaffner 1980 PNAS USA 77:2163-2167) or by other methods known to those skilled in the art.
  • HIVs and Their Replication [0030]
  • The etiological agent of acquired immune deficiency syndrome (AIDS) is recognized to be a retrovirus exhibiting characteristics typical of the lentivirus genus, referred to as human immunodeficiency virus (HIV). The phylogenetic relationships of the human lentiviruses are shown in FIG. 1. HIV-2 is more closely related to SIV[0031] smm, a virus isolated from sooty mangabey monkeys in the wild, than to HIV-1. It is currently believed that HIV-2 represents a zoonotic transmission of SIVsmm to man. A series of lentiviral isolates from captive chimpanzees, designated SIVcpz, are close genetic relatives of HIV-1.
  • The earliest phylogenetic analyses of HIV-1 isolates focused on samples from Europe/North America and Africa; discrete clusters of viruses were identified from these two areas of the world. Distinct genetic subtypes or clades of HIV-1 were subsequently defined and classified into three groups: M (major); O (outlier); and N (non-M or O) (FIG. 2). The M group of HIV-1, which includes over 95% of the global virus isolates, consists of at least eight discrete clades (A, B, C, D, F, G, H, and J), based on the sequence of complete viral genomes. Members of HIV-1 group O have been recovered from individuals living in Cameroon, Gabon, and Equatorial Guinea; their genomes share less than 50% identity in nucleotide sequence with group M viruses. The more recently discovered group N HIV-1strains have been identified in infected Cameroonians, fail to react serologically in standard whole-virus enzyme-linked immunosorbent assay (ELISA), yet are readily detectable by conventional Western blot analysis. [0032]
  • Most current knowledge about HIV-1 genetic variation comes from studies of group M viruses of diverse geographic origin. Data collected during the past decade indicate that the HIV-1 population present within an infected individual can vary from 6% to 10% in nucleotide sequence. HIV-1 isolates within a clade may exhibit nucleotide distances of 15% in gag and up to 30% in gp120 coding sequences. Interclade genetic variation may range between 30% and 40% depending on the gene analyzed. [0033]
  • All of the HIV-1 group M subtypes can be found in Africa. Clade A viruses are genetically the most divergent and were the most common HIV-1 subtype in Africa early in the epidemic. With the rapid spread of HIV-1 to southern Africa during the mid to late 1990s, clade C viruses have become the dominant subtype and now account for 48% of HIV-1 infections worldwide. Clade B viruses, the most intensively studied HIV-1 subtype, remain the most prevalent isolates in Europe and North America. [0034]
  • High rates of genetic recombination are a hallmark of retroviruses. It was initially believed that simultaneous infections by genetically diverse virus strains were not likely to be established in individuals at risk for HIV-1. By 1995, however, it became apparent that a significant fraction of the HIV-1 group M global diversity included interclade viral recombinants. It is now appreciated that HIV-1 recombinants will be found in geographic areas such as Africa, South America, and Southeast Asia, where multiple HIV-1 subtypes coexist and may account for more than 10% of circulating HIV-1 strains. Molecularly, the genomes of these recombinant viruses resemble patchwork mosaics, with juxtaposed diverse HIV-1 subtype segments, reflecting the multiple crossover events contributing to their generation. Most HIV-1 recombinants have arisen in Africa and a majority contain segments originally derived from clade A viruses. In Thailand, for example, the composition of the predominant circulating strain consists of a clade A gag plus pol gene segment and a clade E env gene. Because the clade E env gene in Thai HIV-1 strains is closely related to the lade E env present in virus isolates from the Central African Republic, it is believed that the original recombination event occurred in Africa, with the subsequent introduction of a descendent virus into Thailand. Interestingly, no full-length HIV-1 subtype E isolate (i.e., with subtype E gag, pol, and env genes) has been reported to date. [0035]
  • The discovery that α and β chemokine receptors function as coreceptors for virus fusion and entry into susceptible CD4[0036] + cells has led to a revised classification scheme for HIV-1 (FIG. 3). Isolates can now be grouped on the basis of chemokine receptor utilization in fusion assays in which HIV-1 gp120 and CD4+ coreceptor proteins are expressed in separate cells. As indicated in FIG. 3, HIV-1 isolates using the CXCR4 receptor (now designated X4 viruses) are usually T cell line (TCL)-tropic syncytium inducing (SI) strains, whereas those exclusively utilizing the CCR5 receptor (R5 viruses) are predominantly macrophage (M)-tropic and non-syncytium inducing (NSI). The dual-tropic R5/X4 strains, which may comprise the majority of patient isolates and exhibit a continuum of tropic phenotypes, are frequently SI.
  • As is the case for all replication-competent retroviruses, the three primary HIV-1 translation products, all encoding structural proteins, are initially synthesized as polyprotein precursors, which are subsequently processed by viral or cellular proteases into mature particle-associated proteins (FIG. 4). The 55-kd Gag precursor Pr55[0037] Gag is cleaved into the matrix (MA), capsid (CA), nucleocapsid (NC), and p6 proteins. Autocatalysis of the 160-kd Gag-Pol polyprotein, Pr160Gag-Pol, gives rise to the protease (PR), the heterodimeric reverse transcriptase (RT), and the integrase (IN) proteins, whereas proteolytic digestion by a cellular enzyme(s) converts the glycosylated 160-kd Env precursor gp160 to the gp120 surface (SU) and gp41 transmembrane (TM) cleavage products. The remaining six HIV-1-encoded proteins (Vif, Vpr, Tat, Rev, Vpu, and Nef) are the primary translation products of spliced mRNAs.
  • Gag [0038]
  • The Gag proteins of HIV, like those of other retroviruses, are necessary and sufficient for the formation of noninfectious, virus-like particles. Retroviral Gag proteins are generally synthesized as polyprotein precursors; the HIV-1 Gag precursor has been named, based on its apparent molecular mass, Pr55[0039] Gag. As noted previously, the mRNA for Pr55Gag is the unspliced 9.2-kb transcript (FIG. 4) that requires Rev for its expression in the cytoplasm. When the pol ORF is present, the viral protease (PR) cleaves Pr55Gag during or shortly after budding from the cell to generate the mature Gag proteins p17 (MA), p24 (CA), p7 (NC), and p6 (see FIG. 4). In the virion, MA is localized immediately inside the lipid bilayer of the viral envelope, CA forms the outer portion of the cone-shaped core structure in the center of the particle, and NC is present in the core in a ribonucleoprotein complex with the viral RNA genome (FIG. 5).
  • The HIV Pr55[0040] Gag precursor oligomerizes following its translation and is targeted to the plasma membrane, where particles of sufficient size and density to be visible by EM are assembled. Formation of virus-like particles by Pr55Gag is a self-assembly process, with critical Gag-Gag interactions taking place between multiple domains along the Gag precursor. The assembly of virus-like particles does not require the participation of genomic RNA (although the presence of nucleic acid appears to be essential), pol-encoded enzymes, or Env glycoproteins, but the production of infectious virions requires the encapsidation of the viral RNA genome and the incorporation of the Env glycoproteins and the Gag-Pol polyprotein precursor Pr160Gag-Pol.
  • Pol [0041]
  • Downstream of gag lies the most highly conserved region of the HIV genome, the pol gene, which encodes three enzymes: PR, RT, and IN (see FIG. 4). RT and IN are required, respectively, for reverse transcription of the viral RNA genome to a double-stranded DNA copy, and for the integration of the viral DNA into the host cell chromosome. PR plays a critical role late in the life cycle by mediating the production of mature, infectious virions. The pol gene products are derived by enzymatic cleavage of a 160-kd Gag-Pol fusion protein, referred to as Pr160[0042] Gag-Pol. This fusion protein is produced by ribosomal frameshifting during translation of Pr55Gag (see FIG. 4). The frame-shifting mechanism for Gag-Pol expression, also utilized by many other retroviruses, ensures that the pol-derived proteins are expressed at a low level, approximately 5% to 10% that of Gag. Like Pr55Gag, the N-terminus of Pr160Gag-Pol is myristylated and targeted to the plasma membrane.
  • Protease [0043]
  • Early pulse-chase studies performed with avian retroviruses clearly indicated that retroviral Gag proteins are initially synthesized as polyprotein precursors that are cleaved to generate smaller products. Subsequent studies demonstrated that the processing function is provided by a viral rather than a cellular enzyme, and that proteolytic digestion of the Gag and Gag-Pol precursors is essential for virus infectivity. Sequence analysis of retroviral PRs indicated that they are related to cellular “aspartic” proteases such as pepsin and renin. Like these cellular enzymes, retroviral PRs use two apposed Asp residues at the active site to coordinate a water molecule that catalyzes the hydrolysis of a peptide bond in the target protein. Unlike the cellular aspartic proteases, which function as pseudodimers (using two folds within the same molecule to generate the active site), retroviral PRs function as true dimers. X-ray crystallographic data from HIV-1 PR indicate that the two monomers are held together in part by a four-stranded antiparallel β-sheet derived from both N- and C-terminal ends of each monomer. The substrate-binding site is located within a cleft formed between the two monomers. Like their cellular homologs, the HIV PR dimer contains flexible “flaps” that overhang the binding site and may stabilize the substrate within the cleft; the active-site Asp residues lie in the center of the dimer. Interestingly, although some limited amino acid homology is observed surrounding active-site residues, the primary sequences of retroviral PRs are highly divergent, yet their structures are remarkably similar. [0044]
  • Reverse Transcriptase [0045]
  • By definition, retroviruses possess the ability to convert their single-stranded RNA genomes into double-stranded DNA during the early stages of the infection process. The enzyme that catalyzes this reaction is RT, in conjunction with its associated RNaseH activity. Retroviral RTs have three enzymatic activities: (a) RNA-directed DNA polymerization (for minus-strand DNA synthesis), (b) RNaseH activity (for the degradation of the tRNA primer and genomic RNA present in DNA-RNA hybrid intermediates), and (c) DNA-directed DNA polymerization (for second- or plus-strand DNA synthesis). [0046]
  • The mature HIV-1 RT holoenzyme is a heterodimer of 66 and 51 kd subunits. The 51-kd subunit (p51) is derived from the 66-kd (p66) subunit by proteolytic removal of the C-terminal 15-kd RNaseH domain of p66 by PR (see FIG. 4). The crystal structure of HIV-1 RT reveals a highly asymmetric folding in which the orientations of the p66 and p51 subunits differ substantially. The p66 subunit can be visualized as a right hand, with the polymerase active site within the palm, and a deep template-binding cleft formed by the palm, fingers, and thumb subdomains. The polymerase domain is linked to RNaseH by the connection subdomain. The active site, located in the palm, contains three critical Asp residues (110, 185, and 186) in close proximity, and two coordinated Mg[0047] 2+ ions. Mutation of these Asp residues abolishes RT polymerizing activity. The orientation of the three active-site Asp residues is similar to that observed in other DNA polymerases (e.g., the Klenow fragment of E. coli DNA poll). The p51 subunit appears to be rigid and does not form a polymerizing cleft; Asp 110, 185, and 186 of this subunit are buried within the molecule. Approximately 18 base pairs of the primer-template duplex lie in the nucleic acid binding cleft, stretching from the polymerase active site to the RNaseH domain.
  • In the RT-primer-template-dNTP structure, the presence of a dideoxynucleotide at the 3′ end of the primer allows visualization of the catalytic complex trapped just prior to attack on the incoming dNTP. Comparison with previously obtained structures suggests a model whereby the fingers close in to trap the template and dNTP prior to nucleophilic attack of the 3′-OH of the primer on the incoming dNTP. After the addition of the incoming dNTP to the growing chain, it has been proposed that the fingers adopt a more open configuration, thereby releasing the pyrophosphate and enabling RT to bind the next dNTP. The structure of the HIV-1 RNaseH has also been determined by x-ray crystallography; this domain displays a global folding similar to that of [0048] E. coli RNaseH.
  • Integrase [0049]
  • A distinguishing feature of retrovirus replication is the insertion of a DNA copy of the viral genome into the host cell chromosome following reverse transcription. The integrated viral DNA (the provirus) serves as the template for the synthesis of viral RNAs and is maintained as part of the host cell genome for the lifetime of the infected cell. Retroviral mutants deficient in the ability to integrate generally fail to establish a productive infection. [0050]
  • The integration of viral DNA is catalyzed by integrase, a 32-kd protein generated by PR-mediated cleavage of the C-terminal portion of the HIV-1 Gag-Pol polyprotein (see FIG. 4). [0051]
  • Retroviral IN proteins are composed of three structurally and functionally distinct domains: an N-terminal, zinc-finger-containing domain, a core domain, and a relatively nonconserved C-terminal domain. Because of its low solubility, it has not yet been possible to crystallize the entire 288-amino-acid HIV-1 IN protein. However, the structure of all three domains has been solved independently by x-ray crystallography or NMR methods. The crystal structure of the core domain of the avian sarcoma virus IN has also been determined. The N-terminal domain ([0052] residues 1 to 55), whose structure was solved by NMR spectroscopy, is composed of four helices with a zinc coordinated by amino acids His-12, His-16, Cys-40, and Cys-43. The structure of the N-terminal domain is reminiscent of helical DNA binding proteins that contain a so-called helix-turn-helix motif; however, in the HIV-1 structure this motif contributes to dimer formation. Initially, poor solubility hampered efforts to solve the structure of the core domain. However, attempts at crystallography were successful when it was observed that a Phe-to-Lys change at IN residue 185 greatly increased solubility without disrupting in vitro catalytic activity. Each monomer of the HIV-1 IN core domain (IN residues 50 to 212) is composed of a five-stranded β-sheet flanked by helices; this structure bears striking resemblance to other polynucleotidyl transferases including RNaseH and the bacteriophage MuA transposase. Three highly conserved residues are found in analogous positions in other polynucleotidyl transferases; in HIV-1 IN these are Asp-64, Asp-116 and Glu-152, the so-called D,D-35-E motif. Mutations at these positions block HIV IN function both in vivo and in vitro. The close proximity of these three amino acids in the crystal structure of both avian sarcoma virus and HIV-1 core domains supports the hypothesis that these residues play a central role in catalysis of the polynucleotidyl transfer reaction that is at the heart of the integration process. The C-terminal domain, whose structure has been solved by NMR methods, adopts a five-stranded β-barrel folding topology reminiscent of a Src homology 3 (SH3) domain. Recently, the x-ray structures of SIV and Rous sarcoma virus IN protein fragments encompassing both the core and C-terminal domains have been solved.
  • Env [0053]
  • The HIV Env glycoproteins play a major role in the virus life cycle. They contain the determinants that interact with the CD4 receptor and coreceptor, and they catalyze the fusion reaction between the lipid bilayer of the viral envelope and the host cell plasma membrane. In addition, the HIV Env glycoproteins contain epitopes that elicit immune responses that are important from both diagnostic and vaccine development perspectives. [0054]
  • The HIV Env glycoprotein is synthesized from the singly spliced 4.3-kb Vpu/Env bicistronic mRNA (see FIG. 4); translation occurs on ribosomes associated with the rough endoplasmic reticulum (ER). The 160-kd polyprotein precursor (gp160) is an integral membrane protein that is anchored to cell membranes by a hydrophobic stop-transfer signal in the domain destined to be the mature TM Env glycoprotein, gp41 (FIG. 6). The gp160 is cotranslationally glycosylated, forms disulfide bonds, and undergoes oligomerization in the ER. The predominant oligomeric form appears to be a trimer, although dimers and tetramers are also observed. The gp160 is transported to the Golgi, where, like other retroviral envelope precursor proteins, it is proteolytically cleaved by cellular enzymes to the mature SU glycoprotein gp120 and TM glycoprotein gp41 (see FIG. 6). The cellular enzyme responsible for cleavage of retroviral Env precursors following a highly conserved Lys/Arg-X-Lys/Arg-Arg motif is furin or a furin-like protease, although other enzymes may also catalyze gp160 processing. Cleavage of gp160 is required for Env-induced fusion activity and virus infectivity. Subsequent to gp160 cleavage, gp120 and gp41 form a noncovalent association that is critical for transport of the Env complex from the Golgi to the cell surface. The gp120-gp41 interaction is fairly weak, and a substantial amount of gp120 is shed from the surface of Env-expressing cells. [0055]
  • The HIV Env glycoprotein complex, in particular the SU (gp120) domain, is very heavily glycosylated; approximately half the molecular mass of gp160 is composed of oligosaccharide side chains. During transport of Env from its site of synthesis in the ER to the plasma membrane, many of the side chains are modified by the addition of complex sugars. The numerous oligosaccharide side chains form what could be imagined as a sugar cloud obscuring much of gp120 from host immune recognition. As shown in FIG. 6, gp120 contains interspersed conserved (C[0056] 1 to C5) and variable (V1 to V5) domains. The Cys residues present in the gp120s of different isolates are highly conserved and form disulfide bonds that link the first four variable regions in large loops.
  • A primary function of viral Env glycoproteins is to promote a membrane fusion reaction between the lipid bilayers of the viral envelope and host cell membranes. This membrane fusion event enables the viral core to gain entry into the host cell cytoplasm. A number of regions in both gp120 and gp41 have been implicated, directly or indirectly, in Env-mediated membrane fusion. Studies of the HA[0057] 2 hemagglutinin protein of the orthomyxoviruses and the F protein of the paramyxoviruses indicated that a highly hydrophobic domain at the N-terminus of these proteins, referred to as the fusion peptide, plays a critical role in membrane fusion. Mutational analyses demonstrated that an analogous domain was located at the N-terminus of the HIV-1, HIV-2, and SIV TM glycoproteins (see FIG. 6). Nonhydrophobic substitutions within this region of gp41 greatly reduced or blocked syncytium formation and resulted in the production of noninfectious progeny virions.
  • C-terminal to the gp41 fusion peptide are two amphipathic helical domains (see FIG. 6) which play a central role in membrane fusion. Mutations in the N-terminal helix (referred to as the N-helix), which contains a Leu zipper-like heptad repeat motif, impair infectivity and membrane fusion activity, and peptides derived from these sequences exhibit potent antiviral activity in culture. The structure of the ectodomain of HIV-1 and SIV gp41, the two helical motifs in particular, has been the focus of structural analyses in recent years. Structures were determined by x-ray crystallography or NMR spectroscopy either for fusion proteins containing the helical domains, a mixture of peptides derived from the N- and C-helices, or in the case of the SIV structure, the intact gp41 ectodomain sequence from [0058] residue 27 to 149. These studies obtained fundamentally similar trimeric structures, in which the two helical domains pack in an antiparallel fashion to generate a six-helix bundle. The N-helices form a coiled-coil in the center of the bundle, with the C-helices packing into hydrophobic grooves on the outside.
  • In the steps leading to membrane fusion CD4 binding induces conformation changes in Env that facilitate coreceptor binding. Following the formation of a ternary gp120/CD4/coreceptor complex, gp41 adopts a hypothetical conformation that allows the fusion peptide to insert into the target lipid bilayer. The formation of the gp41 six-helix bundle (which involves antiparallel interactions between the gp41 N- and C-helices) brings the viral and cellular membranes together and membrane fusion takes place. [0059]
  • Use of Recombinant MVA Virus To Boost CD+8 Cell Immune Response [0060]
  • The present invention relates to generation of a CD8[0061] + T cell immune response against an antigen and also eliciting an antibody response. More particularly, the present invention relates to “prime and boost” immunization regimes in which the immune response induced by administration of a priming composition is boosted by administration of a boosting composition. The present invention is based on inventors' experimental demonstration that effective boosting can be achieved using modified vaccinia Ankara (MVA) vectors, following priming with any of a variety of different types of priming compositions including recombinant MVA itself.
  • A major protective component of the immune response against a number of pathogens is mediated by T lymphocytes of the CD8[0062] + type, also known as cytotoxic T lymphocytes (CTL). An important function of CD8+ cells is secretion of gamma interferon (IFNγ), and this provides a measure of CD8+ T cell immune response. A second component of the immune response is antibody directed to the proteins of the pathogen.
  • The present invention employs MVA which, as the experiments described below show, has been found to be an effective means for providing a boost to a CD8[0063] + T cell immune response primed to antigen using any of a variety of different priming compositions and also eliciting an antibody response.
  • Remarkably, the experimental work described below demonstrates that use of embodiments of the present invention allows for recombinant MVA virus expressing an HIV antigen to boost a CD8[0064] + T cell immune response primed by a DNA vaccine and also eliciting an antibody response. The MVA was found to induce a CD8+ T cell response after intradermal, intramuscular or mucosal immunization. Recombinant MVA has also been shown to prime an immune response that is boosted by one or more inoculations of recombinant MVA.
  • Non-human primates immunized with plasmid DNA and boosted with the MVA were effectively protected against intramucosal challenge with live virus. Advantageously, the inventors found that a vaccination regime used intradermal, intramuscular or mucosal immunization for both prime and boost can be employed, constituting a general immunization regime suitable for inducing CD8[0065] + T cells and also eliciting an antibody response, e.g. in humans.
  • The present invention in various aspects and embodiments employs an MVA vector encoding an HIV antigen for boosting a CD8[0066] + T cell immune response to the antigen primed by previous administration of nucleic acid encoding the antigen and also eliciting an antibody response.
  • A general aspect of the present invention provides for the use of an MVA vector for boosting a CD8[0067] + T cell immune response to an HIV antigen and also eliciting an antibody response.
  • One aspect of the present invention provides a method of boosting a CD8[0068] + T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method including provision in the individual of an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid, whereby a CD8+ T cell immune response to the antigen previously primed in the individual is boosted.
  • An immune response to an HIV antigen may be primed by immunization with plasmid DNA or by infection with an infectious agent. [0069]
  • A further aspect of the invention provides a method of inducing a CD8[0070] + T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method comprising administering to the individual a priming composition comprising nucleic acid encoding the antigen and then administering a boosting composition which comprises an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid.
  • A further aspect provides for use of an MVA vector, as disclosed, in the manufacture of a medicament for administration to a mammal to boost a CD8[0071] + T cell immune response to an HIV antigen, and also eliciting an antibody response. Such a medicament is generally for administration following prior administration of a priming composition comprising nucleic acid encoding the antigen.
  • The priming composition may comprise any viral vector, such as a vaccinia virus vector such as a replication-deficient strain such as modified vaccinia Ankara (MVA) or NYVAC (Tartaglia et al. 1992 [0072] Virology 118:217-232), an avipox vector such as fowlpox or canarypox, e.g. the strain known as ALVAC (Paoletti et al. 1994 Dev Biol Stand 82:65-69), or an adenovirus vector or a vesicular stomatitis virus vector or an alphavirus vector.
  • The priming composition may comprise DNA encoding the antigen, such DNA preferably being in the form of a circular plasmid that is not capable of replicating in mammalian cells. Any selectable marker should not be resistance to an antibiotic used clinically, so for example Kanamycin resistance is preferred to Ampicillin resistance. Antigen expression should be driven by a promoter which is active in mammalian cells, for instance the cytomegalovirus immediate early (CMV IE) promoter. [0073]
  • In particular embodiments of the various aspects of the present invention, administration of a priming composition is followed by boosting with a boosting composition, or first and second boosting compositions, the first and second boosting compositions being the same or different from one another. Still further boosting compositions may be employed without departing from the present invention. In one embodiment, a triple immunization regime employs DNA, then adenovirus as a first boosting composition, then MVA as a second boosting composition, optionally followed by a further (third) boosting composition or subsequent boosting administration of one or other or both of the same or different vectors. Another option is DNA then MVA then adenovirus, optionally followed by subsequent boosting administration of one or other or both of the same or different vectors. [0074]
  • The antigen to be encoded in respective priming and boosting compositions (however many boosting compositions are employed) need not be identical, but should share at least one CD8[0075] + T cell epitope. The antigen may correspond to a complete antigen, or a fragment thereof. Peptide epitopes or artificial strings of epitopes may be employed, more efficiently cutting out unnecessary protein sequence in the antigen and encoding sequence in the vector or vectors. One or more additional epitopes may be included, for instance epitopes which are recognized by T helper cells, especially epitopes recognized in individuals of different HLA types.
  • An HIV antigen of the invention to be encoded by a recombinant MVA virus includes polypeptides having immunogenic activity elicited by an amino acid sequence of an HIV Env, Gag, Pol, Vif, Vpr, Tat, Rev, Vpu, or Nef amino acid sequence as at least one CD8[0076] + T cell epitope. This amino acid sequence substantially corresponds to at least one 10-900 amino acid fragment and/or consensus sequence of a known HIV Env or Pol; or at least one 10-450 amino acid fragment and/or consensus sequence of a known HIV Gag; or at least one 10-100 amino acid fragment and/or consensus sequence of a known HIV Vif, Vpr, Tat, Rev, Vpu, or Nef.
  • Although a full length Env precursor sequence is presented for use in the present invention, Env is optionally deleted of subsequences. For example, regions of the gp120 surface and gp41 transmembrane cleavage products can be deleted. [0077]
  • Although a full length Gag precursor sequence is presented for use in the present invention, Gag is optionally deleted of subsequences. For example, regions of the matrix protein (p17), regions of the capsid protein (p24), regions of the nucleocapsid protein (p7), and regions of p6 (the C-terminal peptide of the Gag polyprotein) can be deleted. [0078]
  • Although a full length Pol precursor sequence is presented for use in the present invention, Pol is optionally deleted of subsequences. For example, regions of the protease protein (p10), regions of the reverse transcriptase protein (p66/p51), and regions of the integrase protein (p32) can be deleted. [0079]
  • Such an HIV Env, Gag, or Pol can have overall identity of at least 50% to a known Env, Gag, or Pol protein amino acid sequence, such as 50-99% identity, or any range or value therein, while eliciting an immunogenic response against at least one strain of an HIV. [0080]
  • Percent identify can be determined, for example, by comparing sequence information using the GAP computer program, version 6.0, available from the University of Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the alignment method of Needleman and Wunsch ([0081] J Mol Biol 1970 48:443), as revised by Smith and Waterman (Adv Appl Math 1981 2:482). Briefly, the GAP program defines identity as the number of aligned symbols (i.e., nucleotides or amino acids) which are identical, divided by the total number of symbols in the shorter of the two sequences. The preferred default parameters for the GAP program include: (1) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov and Burgess (Nucl Acids Res 1986 14:6745), as described by Schwartz and Dayhoff (eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington, D.C. 1979, pp. 353-358); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
  • In a preferred embodiment, an Env of the present invention is a variant form of at least one HIV envelope protein. Preferably, the Env is composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacks part or all of the cytoplasmic domain of gp41. [0082]
  • Known HIV sequences are readily available from commercial and institutional HIV sequence databases, such as GENBANK, or as published compilations, such as Myers et al. eds., [0083] Human Retroviruses and AIDS, A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences, Vol. I and II, Theoretical Biology and Biophysics, Los Alamos, N. Mex. (1993), or http://hiv-web.lanl.gov/.
  • Substitutions or insertions of an HIV Env, Gag, or Pol to obtain an additional HIV Env, Gag, or Pol, encoded by a nucleic acid for use in a recombinant MVA virus of the present invention, can include substitutions or insertions of at least one amino acid residue (e.g., 1-25 amino acids). Alternatively, at least one amino acid (e.g., 1-25 amino acids) can be deleted from an HIV Env, Gag, or Pol sequence. Preferably, such substitutions, insertions or deletions are identified based on safety features, expression levels, immunogenicity and compatibility with high replication rates of MVA. [0084]
  • Amino acid sequence variations in an HIV Env, Gag, or Pol of the present invention can be prepared e.g., by mutations in the DNA. Such HIV Env, Gag, or Pol include, for example, deletions, insertions or substitutions of nucleotides coding for different amino acid residues within the amino acid sequence. Obviously, mutations that will be made in nucleic acid encoding an HIV Env, Gag, or Pol must not place the sequence out of reading frame and preferably will not create complementary domains that could produce secondary mRNA structures. [0085]
  • HIV Env, Gag, or Pol-encoding nucleic acid of the present invention can also be prepared by amplification or site-directed mutagenesis of nucleotides in DNA or RNA encoding an HIV Env, Gag, or Pol and thereafter synthesizing or reverse transcribing the encoding DNA to produce DNA or RNA encoding an HIV Env, Gag, or Pol, based on the teaching and guidance presented herein. [0086]
  • Recombinant MVA viruses expressing HIV Env, Gag, or Pol of the present invention, include a finite set of HIV Env, Gag, or Pol-encoding sequences as substitution nucleotides that can be routinely obtained by one of ordinary skill in the art, without undue experimentation, based on the teachings and guidance presented herein. For a detailed description of protein chemistry and structure, see Schulz, G. E. et al., 1978 [0087] Principles of Protein Structure, Springer-Verlag, New York, N.Y., and Creighton, T. E., 1983 Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, Calif. For a presentation of nucleotide sequence substitutions, such as codon preferences, see Ausubel et al. eds. Current Protocols in Molecular Biology, Greene Publishing Assoc., New York, N.Y. 1994 at §§ A.1.1-A.1.24, and Sambrook, J. et al. 1989 Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. at Appendices C and D.
  • Thus, one of ordinary skill in the art, given the teachings and guidance presented herein, will know how to substitute other amino acid residues in other positions of an HIV env, gag, or pol DNA or RNA to obtain alternative HIV Env, Gag, or Pol, including substitutional, deletional or insertional variants. [0088]
  • Within the MVA vector, regulatory sequences for expression of the encoded antigen will include a natural, modified or synthetic poxvirus promoter. By “promoter” is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3′ direction on the sense strand of double-stranded DNA). “Operably linked” means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is “under transcriptional initiation regulation” of the promoter. Other regulatory sequences including terminator fragments, polyadenylation sequences, marker genes and other sequences may be included as appropriate, in accordance with the knowledge and practice of the ordinary person skilled in the art: see, for example, Moss, B. (2001). Poxviridae: the viruses and their replication. In Fields Virology, D. M. Knipe, and P. M. Howley, eds. (Philadelphia, Lippincott Williams & Wilkins), pp. 2849-2883. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in [0089] Current Protocols in Molecular Biology, 1998 Ausubel et al. eds., John Wiley & Sons.
  • Promoters for use in aspects and embodiments of the present invention must be compatible with poxvirus expression systems and include natural, modified and synthetic sequences. [0090]
  • Either or both of the priming and boosting compositions may include an adjuvant, such as granulocyte macrophage-colony stimulating factor (GM-CSF) or encoding nucleic acid therefor. [0091]
  • Administration of the boosting composition is generally about 1 to 6 months after administration of the priming composition, preferably about 1 to 3 months. [0092]
  • Preferably, administration of priming composition, boosting composition, or both priming and boosting compositions, is intradermal, intramuscular or mucosal immunization. [0093]
  • Administration of MVA vaccines may be achieved by using a needle to inject a suspension of the virus. An alternative is the use of a needleless injection device to administer a virus suspension (using, e.g., Biojector™ needleless injector) or a resuspended freeze-dried powder containing the vaccine, providing for manufacturing individually prepared doses that do not need cold storage. This would be a great advantage for a vaccine that is needed in rural areas of Africa. [0094]
  • MVA is a virus with an excellent safety record in human immunizations. The generation of recombinant viruses can be accomplished simply, and they can be manufactured reproducibly in large quantities. Intradermal, intramuscular or mucosal administration of recombinant MVA virus is therefore highly suitable for prophylactic or therapeutic vaccination of humans against AIDS which can be controlled by a CD8[0095] + T cell response.
  • The individual may have AIDS such that delivery of the antigen and generation of a CD8[0096] + T cell immune response to the antigen is of benefit or has a therapeutically beneficial effect.
  • Most likely, administration will have prophylactic aim to generate an immune response against HIV or AIDS before infection or development of symptoms. [0097]
  • Components to be administered in accordance with the present invention may be formulated in pharmaceutical compositions. These compositions may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g. intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes. [0098]
  • As noted, administration is preferably intradermal, intramuscular or mucosal. [0099]
  • Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. [0100]
  • For intravenous, cutaneous, subcutaneous, intramuscular or mucosal injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included as required. [0101]
  • A slow-release formulation may be employed. [0102]
  • Following production of MVA particles and optional formulation of such particles into compositions, the particles may be administered to an individual, particularly human or other primate. Administration may be to another mammal, e.g. rodent such as mouse, rat or hamster, guinea pig, rabbit, sheep, goat, pig, horse, cow, donkey, dog or cat. [0103]
  • Administration is preferably in a “prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, or in a veterinary context a veterinarian, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in [0104] Remington's Pharmaceutical Sciences, 16th edition, 1980, Osol, A. (ed.).
  • In one preferred regimen, DNA is administered at a dose of 250 μg to 2.5 mg/injection, followed by MVA at a dose of 10[0105] 6 to 109 infectious virus particles/injection.
  • A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated. [0106]
  • Delivery to a non-human mammal need not be for a therapeutic purpose, but may be for use in an experimental context, for instance in investigation of mechanisms of immune responses to an antigen of interest, e.g. protection against HIV or AIDS. [0107]
  • Further aspects and embodiments of the present invention will be apparent to those of ordinary skill in the art, in view of the above disclosure and following experimental exemplification, included by way of illustration and not limitation, and with reference to the attached figures. [0108]
    • EXAMPLE 1 Control of a Mucosal Challenge and Prevention of AIDS by a Multiprotein DNA/MVA Vaccine
  • Here we tested DNA priming and poxvirus boosting for the ability to protect against a highly pathogenic mucosal challenge. The 89.6 chimera of simian and human immunodeficiency viruses (SHIV-89.6) was used for the construction of immunogens and its highly pathogenic derivative, SHIV-89.6P, for challenge (G. B. Karlsson et al. 1997 [0109] J Virol 71:4218). SHIV-89.6 and SHIV-89.6P do not generate cross-neutralizing antibody (D. C . . . Montefiori et al. 1998 J Virol 72:3427) and allowed us to address the ability of vaccine-raised T cells and non-neutralizing antibodies to control an immunodeficiency virus challenge. Modified vaccinia Ankara (MVA) was used for the construction of the recombinant poxvirus. MVA has been highly effective at boosting DNA-primed CD8 T cells and enjoys the safety feature of not replicating efficiently in human or monkey cells (H. L. Robinson et al. 2000 AIDS Reviews 2:105).
  • To ensure a broad immune response both the DNA and recombinant MVA (rMVA) components of the vaccine expressed multiple immunodeficiency virus proteins. The DNA prime (DNA/89.6) expressed simian immunodeficiency virus (SIV) Gag, Pol, Vif, Vpx, and Vpr and human immunodeficiency virus-1 (HIV-1) Env, Tat, and Rev from a single transcript (R. J. Gorelick et al. 1999 [0110] Virology 253:259; M. M. Sauter et al. 1996 J Cell Biol 132:795).
  • Molecularly cloned SHIV-89.6 sequences were cloned into the vector pGA2 using ClaI and RsrII sites. This cloning deleted both long terminal repeats (LTRs) and nef. The SHIV-89.6 sequences also were internally mutated for a 12-base pair region encoding the first four amino acids of the second zinc finger in nucleocapsid. This mutation renders SHIV viruses noninfectious (R. J. Gorelick et al. 1999 [0111] Virology 253:259). A mutation in gp41 converted the tyrosine at position 710 to cysteine to achieve better expression of Env on the plasma membrane of DNA-expressing cells (M. M. Sauter et al. 1996 J Cell Biol 132:795). pGA2 uses the CMV immediate early promoter without intron A and the bovine growth hormone polyadenylation sequence to express vaccine inserts. Vaccine DNA was produced by Althea (San Diego, Calif.). In transient transfections of 293T cells, DNA/89.6 produced about 300 ng of Gag and 85 ng of Env per 1×106 cells.
  • The rMVA booster (MVA/89.6) expressed SIV Gag, Pol, and HIV-1 Env under the control of vaccinia virus early/late promoters. [0112]
  • The MVA double recombinant virus expressed both the HIV 89.6 Env and the SIV 239 Gag-Pol, which were inserted into deletion II and deletion III of MVA, respectively. The 89.6 Env protein was truncated for the COOH-terminal 115 amino acids of gp41. The modified H5 promoter controlled the expression of both foreign genes. [0113]
  • Vaccination was accomplished by priming with DNA at 0 and 8 weeks and boosting with rMVA at 24 weeks (FIG. 7A). [0114]
  • I.d. and i.m. DNA immunizations were delivered in phosphate-buffered saline (PBS) with a needleless jet injector (Bioject, Portland, Oreg.) to deliver five i.d. 100-μl injections to each outer thigh for the 2.5-mg dose of DNA or one i.d. 100-μl injection to the right outer thigh for the 250-μg dose of plasmid. I.m. deliveries of DNA were done with one 0.5-ml injection of DNA in PBS to each outer thigh for the 2.5-mg dose and one 100-μl injection to the right outer thigh for the 250-μg dose. 1×10[0115] 8 pfu of MVA/89.6 was administered both i.d. and i.m. with a needle. One 100-μl dose was delivered to each outer thigh for the i.d. dose and one 500-μl dose to each outer thigh for the i.m dose. Control animals received 2.5 mg of the pGA2 vector without vaccine insert with the Bioject device to deliver five 100-μl doses i.d. to each outer thigh. The control MVA booster immunization consisted of 2×108 pfu of MVA without an insert delivered i.d. and i.m. as described for MVA/89.6.
  • Four groups of six rhesus macaques each were primed with either 2.5 mg (high-dose) or 250 μg (low-dose) of DNA by intradermal (i.d.) or intramuscular (i.m.) routes using a needleless jet injection device (Bioject, Portland, Oreg.) (T. M. Allen et al. 2000 [0116] J Immunol 164:4968).
  • Young adult rhesus macaques from the Yerkes breeding colony were cared for under guidelines established by the Animal Welfare Act and the NIH “Guide for the Care and Use of Laboratory Animals” with protocols approved by the Emory University Institutional Animal Care and Use Committee. Macaques were typed for the Mamu-A*01 allele with polymerase chain reaction (PCR) analyses (M. A. Egan et al. 2000 [0117] J Virol 74:7485; I. Ourmanov et al. 2000 J Virol 74:2740). Two or more animals containing at least one Mamu-A*01 allele were assigned to each group. Animal numbers are as follows: 1, RBr-5*; 2, RIm-5*; 3, RQf-5*; 4, RZe-5; 5, ROm-5; 6, RDm-5; 7, RAj-5*; 8, RJi-5*; 9, RAl-5*; 10, RDe-5*; 11, RAi-5; 12, RPr-5; 13, RKw-4*; 14, RWz-5*; 15, RGo-5; 16, RLp-4; 17, RWd-6; 18, RAt-5; 19, RPb-5*; 20, RIi-5*; 21, RIq-5; 22, RSp-4; 23, RSn-5; 24, RGd-6; 25, RMb-5*; 26, RGy-5*; 27, RUs-4; and 28, RPm-5. Animals with the A*01 allele are indicated with asterisks.
  • Gene gun deliveries of DNA were not used because these had primed non-protective immune responses in a 1996-98 trial (H. L. Robinson et al. 1999 [0118] Nat Med 5:526). The MVA/89.6 booster immunization (2×108 plaque-forming units, pfu) was injected with a needle both i.d. and i.m. A control group included two mock immunized animals and two naive animals. The challenge was given at 7 months after the rMVA booster to test for the generation of long-term immunity. Because most HIV-1 infections are transmitted across mucosal surfaces, an intrarectal challenge was administered.
  • DNA priming followed by rMVA boosting generated high frequencies of virus-specific T cells that peaked at one week following the rMVA booster (FIG. 7). The frequencies of T cells recognizing the Gag-CM9 epitope were assessed by means of Mamu-A*01 tetramers, and the frequencies of T cells recognizing epitopes throughout Gag were assessed with pools of overlapping peptides and an enzyme-linked immunospot (ELISPOT) assay (C. A. Power et al. 1999 [0119] J Immunol Methods 227:99).
  • For tetramer analyses, about 1×10[0120] 6 peripheral blood mononuclear cells (PBMC) were surface-stained with antibodies to CD3 conjugated to fluorescein isothiocyanate (FITC) (FN-18; Biosource International, Camarillo, Calif.), CD8 conjugated to peridinin chlorophyl protein (PerCP) (SK1; Becton Dickinson, San Jose, Calif.), and Gag-CM9 (CTPYDINQM)-Mamu-A*01 tetramer (SEQ ID NO: 6) conjugated to allophycocyanin (APC), in a volume of 100 μl at 8° to 10° C. for 30 min. Cells were washed twice with cold PBS containing 2% fetal bovine serum (FBS), fixed with 1% paraformaldehyde in PBS, and analyzed within 24 hrs on a FACScaliber (Becton Dickinson, San Jose, Calif.). Cells were initially gated on lymphocyte populations with forward scatter and side scatter and then on CD3 cells. The CD3 cells were then analyzed for CD8 and tetramer-binding cells. About 150,000 lymphocytes were acquired for each sample. Data were analyzed using FloJo software (Tree Star, San Carlos, Calif.).
  • For interferon-γ (IFN-γ) ELISPOTs, MULTISCREEN 96 well filtration plates (Millipore Inc. Bedford, Mass.) were coated overnight with antibody to human IFN-γ (Clone B27, Pharmingen, San Diego, Calif.) at a concentration of 2 μg/ml in sodium bicarbonate buffer (pH 9.6) at 8° to 10° C. Plates were washed two times with RPMI medium and then blocked for 1 hour with complete medium (RPMI containing 10% FBS) at 37° C. Plates were washed five more times with plain RPMI medium, and cells were seeded in duplicate in 100 μl complete medium at numbers ranging from 2×10[0121] 4 to 5×105 cells per well. Peptide pools were added to each well to a final concentration of 2 μg/ml of each peptide in a volume of 100 μl in complete medium. Cells were cultured at 37° C. for about 36 hrs under 5% CO2. Plates were washed six times with wash buffer (PBS with 0.05% Tween-20) and then incubated with 1 μg of biotinylated antibody to human IFN-γ per milliliter (clone 7-86-1; Diapharma Group, West Chester, Ohio) diluted in wash buffer containing 2% FBS. Plates were incubated for 2 hrs at 37° C. and washed six times with wash buffer. Avidin-horseradish peroxidase (Vector Laboratories, Burlingame, Calif.) was added to each well and incubated for 30 to 60 min at 37° C. Plates were washed six times with wash buffer and spots were developed using stable DAB as substrate (Research Genetics, Huntsville, Ala.). Spots were counted with a stereo dissecting microscope. An ovalbumin peptide (SIINFEKL) (SEQ ID NO: 7) was included as a control in each analysis. Background spots for the ovalbumin peptide were generally <5 for 5×105 PBMCs. This background when normalized for 1×106 PBMC was <10. Only ELISPOT counts of twice the background (≧20) were considered significant. The frequencies of ELISPOTs are approximate because different dilutions of cells have different efficiencies of spot formation in the absence of feeder cells (C. A. Power et al. 1999 J Immunol Methods 227: 99). The same dilution of cells was used for all animals at a given time point, but different dilutions were used to detect memory and acute responses.
  • Gag-CM9 tetramer analyses were restricted to macaques that expressed the Mamu-A*01 histocompatibility type, whereas ELISPOT responses did not depend on a specific histocompatibility type. As expected, the DNA immunizations raised low levels of memory cells that expanded to high frequencies within 1 week of the rMVA booster (FIGS. 7 and 12). In Mamu-A*01 macaques, CD8 cells specific to the Gag-CM9 epitope expanded to frequencies as high as 19% of total CD8 T cells (FIG. 12). This peak of specific cells underwent a 10- to 100-fold contraction into the DNA/MVA memory pool (FIGS. 7A and 12). ELISPOTs for three pools of Gag peptides also underwent a major expansion (frequencies up to 4000 spots for 1×10[0122] 6 PBMC) before contracting from 5- to 20-fold into the DNA/MVA memory response (FIG. 7B). The frequencies of ELISPOTs were the same in macaques with and without the A*01 histocompatibility type (P>0.2).
  • Simple linear regression was used to estimate correlations between postbooster and postchallenge ELISPOT responses, between memory and postchallenge ELISPOT responses, and between logarithmically transformed viral loads and ELISPOT frequencies. Comparisons between vaccine and control groups and A*01 and non A*01 macaques were performed by means of two-sample t tests with logarithmically transformed viral load and ELISPOT responses. Two-way analyses of variance were used to examine the effects of dose and route of administration on peak DNA/MVA ELISPOTs, on memory DNA/MVA ELISPOTs, and on logarithmically transformed Gag antibody data. [0123]
  • At both peak and memory phases of the vaccine response, the rank order for the height of the ELISPOTs in the vaccine groups was 2.5 mg i.d.>2.5 mg i.m.>250 μg i.d.>250 μg i.m. (FIG. 7B). The IFN-γ ELISPOTs included both CD4 and CD8 cells. Gag-CM9-specific CD8 cells had good lytic activity after restimulation with peptide. [0124]
  • The highly pathogenic SHIV-89.6P challenge was administered intrarectally at 7 months after the rMVA booster, when vaccine-raised T cells were in memory (FIG. 7). [0125]
  • The challenge stock (5.7×10[0126] 9 copies of viral RNA per milliliter) was produced by one intravenous followed by one intrarectal passage in rhesus macaques of the original SHIV-89.6P stock (G. B. Karlsson et al. 1997 J Virol 71:4218). Lymphoid cells were harvested from the intrarectally infected animal at peak viremia, CD8-depleted, and mitogen-stimulated for stock production. Before intrarectal challenge, fasted animals were anesthetized (ketamine, 10 mg/kg) and placed on their stomach with the pelvic region slightly elevated. A feeding tube (8Fr (2.7 mm)×16 inches (41 cm); Sherwood Medical, St. Louis, Mo.) was inserted into the rectum for a distance of 15 to 20 cm. Following insertion of the feeding tube, a syringe containing 20 intrarectal infectious doses in 2 ml of RPMI-1640 plus 10% FBS was attached to the tube and the inoculum was slowly injected into the rectum. After delivery of the inoculum, the feeding tube was flushed with 3.0 ml of RPMI without FBS and then slowly withdrawn. Animals were left in place, with pelvic regions slightly elevated, for a period of ten minutes after the challenge.
  • The challenge infected all of the vaccinated and control animals (FIG. 8). However, by 2 weeks after challenge, titers of plasma viral RNA were at least 10-fold lower in the vaccine groups (geometric means of 1×10[0127] 7 to 5×107) than in the control animals (geometric mean of 4×108) (FIG. 8A) (S. Staprans et al. in: Viral Genome Methods K. Adolph, ed. CRC Press, Boca Raton, Fla., 1996 pp. 167-184; R. Hofmann-Lehmann et al. 2000 AIDS Res Hum Retroviruses 16:1247).
  • For the determination of SHIV copy number, viral RNA from 150 μl of ACD anticoagulated plasma was directly extracted with the QIAamp Viral RNA kit (Qiagen), eluted in 60 μl of AVE buffer, and frozen at −80° C. until SHIV RNA quantitation was performed. Five microliters of purified plasma RNA was reverse-transcribed in a final 20-μl volume containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 4 mM MgCl[0128] 2, 1 mM each deoxynucleotide triphosphate (dNTP), 2.5 μM random hexamers, 20 units MultiScribe RT, and 8 units ribonuclease inhibitor. Reactions were incubated at 25° C. for 10 min, followed by incubation at 42° C. for 20 min, and inactivation of reverse transcriptase at 99° C. for 5 min. The reaction mix was adjusted to a final volume of 50 μl containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 4 mM MgCl2, 0.4 mM each dNTP, 0.2 μM forward primer, 0.2 μM reverse primer, 0.1 μM probe, and 5 units AmpliTaq Gold DNA polymerase (all reagents from PerkinElmer Applied Biosystems, Foster City, Calif.). The primer sequences within a conserved portion of the SIV gag gene are the same as those described previously (S. Staprans et al. in: Viral Genome Methods K. Adolph, ed. CRC Press, Boca Raton, Fla., 1996 pp. 167-184). A PerkinElmer Applied Biosystems 7700 Sequence Detection System was used with the PCR profile: 95° C. for 10 min, followed by 40 cycles at 93° C. for 30 s, and 59.5° C. for 1 min. PCR product accumulation was monitored with the 7700 sequence detector and a probe to an internal conserved gag gene sequence: 6FAM-CTGTCTGCGTCATTTGGTGC-Tamra (SEQ ID NO: 8), where FAM and Tamra denote the reporter and quencher dyes. SHIV RNA copy number was determined by comparison with an external standard curve consisting of virion-derived SIVmac239 RNA quantified by the SIV bDNA method (Bayer Diagnostics, Emeryville, Calif.). All specimens were extracted and amplified in duplicate, with the mean result reported. With a 0.15-ml plasma input, the assay has a sensitivity of 103 RNA copies per milliliter of plasma and a linear dynamic range of 103 to 108 RNA copies (R2=0.995). The intraassay coefficient of variation was <20% for samples containing >104 SHIV RNA copies per milliliter, and <25% for samples containing 103 to 104 SHIV RNA copies per milliliter. To more accurately quantitate low SHIV RNA copy number in vaccinated animals at weeks 16 and 20, we made the following modifications to increase the sensitivity of the SHIV RNA assay: (i) Virions from ≦1 ml of plasma were concentrated by centrifugation at 23,000 g at 10° C. for 150 min before viral RNA extraction, and (ii) a one-step reverse transcriptase PCR method was used (R. Hofmann-Lehmann et al. 2000 AIDS Res Hum Retroviruses 16:1247). These changes provided a reliable quantification limit of 300 SHIV RNA copies per milliliter, and gave SHIV RNA values that were highly correlated to those obtained by the first method used (r=0.91, P<0.0001).
  • By 8 weeks after challenge, both high-dose DNA-primed groups and the low-dose i.d. DNA-primed group had reduced their geometric mean loads to about 1000 copies of viral RNA per milliliter. At this time, the low-dose i.m. DNA-primed group had a geometric mean of 6×10[0129] 3 copies of viral RNA and the nonvaccinated controls had a geometric mean of 2×106. By 20 weeks after challenge, even the low-dose i.m. group had reduced its geometric mean copies of viral RNA to 1000. Among the 24 vaccinated animals, only one animal, animal number 22 in the low-dose i.m. group, had intermittent viral loads above 1×104 copies per milliliter (FIG. 8D).
  • By 5 weeks after challenge, all of the nonvaccinated controls had undergone a profound depletion of CD4 cells (FIG. 8B). All of the vaccinated animals maintained their CD4 cells, with the exception of [0130] animal 22 in the low dose i.m. group (see above), which underwent a slow CD4 decline (FIG. 8E). By 23 weeks after challenge, three of the four control animals had succumbed to AIDS (FIG. 8C). These animals had variable degrees of enterocolitis with diarrhea, cryptosporidiosis, colicystitis, enteric campylobacter infection, splenomegaly, lymphadenopathy, and SIV-associated giant cell pneumonia. In contrast, all 24 vaccinated animals maintained their health.
  • Containment of the viral challenge was associated with a burst of antiviral T cells (FIGS. 7 and 9A). At one week after challenge, the frequency of tetramer[0131] + cells in the peripheral blood had decreased, potentially reflecting the recruitment of specific T cells to the site of infection (FIG. 9A). However, by two weeks after challenge, tetramer+ cells in the peripheral blood had expanded to frequencies as high as, or higher than, after the rMVA booster (FIG. 7 and 9A). The majority of the tetramer+ cells produced IFN-γ in response to a 6-hour peptide stimulation (FIG. 9B) (S. L. Waldrop et al. 1997 J Clin Invest 99:1739) and did not have the “stunned” IFN-γ negative phenotype sometimes observed in viral infections (F. Lechner et al. 2000 J Exp Med 191:1499).
  • For intracellular cytokine assays, about 1×10[0132] 6 PBMC were stimulated for 1 hour at 37° C. in 5 ml polypropylene tubes with 100 μg of Gag-CM9 peptide (CTPYDINQM) (SEQ ID NO: 6) per milliliter in a volume of 100 μl RPMI containing 0.1% bovine serum albumin (BSA) and 1 μg of antibody to human CD28 and 1 μg of antibody to human CD49d (Pharmingen, San Diego, Calif.) per milliliter. Then, 900 μl of RPMI containing 10% FBS and monensin (10 μg/ml) was added, and the cells were cultured for an additional 5 hrs at 37° C. at an angle of 5° under 5% CO2. Cells were surface stained with antibodies to CD8 conjugated to PerCP (clone SK1, Becton Dickinson) at 8° to 10° C. for 30 min, washed twice with cold PBS containing 2% FBS, and fixed and permeabilized with Cytofix/Cytoperm solution (Pharmingen). Cells were then incubated with antibodies to human CD3 (clone FN-18; Biosource International, Camarillo, Calif.) and IFN-γ (Clone B27; Pharmingen) conjugated to FITC and phycoerythrin, respectively, in Perm wash solution (Pharmingen) for 30 min at 4° C. Cells were washed twice with Perm wash, once with plain PBS, and resuspended in 1% paraformaldehyde in PBS. About 150,000 lymphocytes were acquired on the FACScaliber and analyzed with FloJo software.
  • The postchallenge burst of T cells contracted concomitant with the decline of the viral load. By 12 weeks after challenge, virus-specific T cells were present at about one-tenth of their peak height (FIGS. 7A and 9A). In contrast to the vigorous secondary response in the vaccinated animals, the naive animals mounted a modest primary response (FIGS. 7B and 9A). Tetramer[0133] + cells peaked at less than 1% of total CD8 cells (FIG. 9A), and IFN-γ-producing ELISPOTs were present at a mean frequency of about 300 as opposed to the much higher frequencies of 1000 to 6000 in the vaccine groups (FIG. 7B) (P<0.05).
  • The tetramer[0134] + cells in the control group, like those in the vaccine group, produced IFN-γ after peptide stimulation (FIG. 9B). By 12 weeks after challenge, three of the four controls had undetectable levels of IFN-γ-producing ELISPOTs. This rapid loss of antiviral T cells in the presence of high viral loads may reflect the lack of CD4 help.
  • T cell proliferative responses demonstrated that virus-specific CD4 cells had survived the challenge and were available to support the antiviral immune response (FIG. 9C). [0135]
  • About 0.2 million PBMC were stimulated in triplicate for 5 days with the indicated antigen in 200 μl of RPMI at 37° C. under 5% CO[0136] 2. Supernatants from 293T cells transfected with DNA expressing either SHIV-89.6 Gag and Pol or SHIV-89.6 Gag, Pol and Env were used directly as antigens (final concentration of ˜0.5 μg of p27 Gag per milliliter). Supernatants from mock DNA (vector alone)-transfected cells served as negative controls. On day six, cells were pulsed with 1 μCi of tritiated thymidine per well for 16 to 20 hours. Cells were harvested with an automated cell harvester (TOMTEC, Harvester 96, Model 1010, Hamden, Conn.) and counted with a Wallac 1450 MICROBETA Scintillation counter (Gaithersburg, Md.). Stimulation indices are the counts of tritiated thymidine incorporated in PBMC stimulated with 89.6 antigens divided by the counts of tritiated thymidine incorporated by the same PBMC stimulated with mock antigen.
  • At 12 weeks after challenge, mean stimulation indices for Gag-Pol-Env or Gag-Pol proteins ranged from 35 to 14 in the vaccine groups but were undetectable in the control group. Consistent with the proliferation assays, intracellular cytokine assays demonstrated the presence of virus-specific CD4 cells in vaccinated but not control animals. The overall rank order of the vaccine groups for the magnitude of the proliferative response was 2.5 mg i.d.>2.5 mg i.m.>250 μg i.d.>250 μg i.m. [0137]
  • At 12 weeks after challenge, lymph nodes from the vaccinated animals were morphologically intact and responding to the infection, whereas those from the infected controls had been functionally destroyed (FIG. 10). Nodes from vaccinated animals contained large numbers of reactive secondary follicles with expanded germinal centers and discrete dark and light zones (FIG. 10A). By contrast, lymph nodes from the non-vaccinated control animals showed follicular and paracortical depletion (FIG. 10B), while those from unvaccinated and unchallenged animals displayed normal numbers of minimally reactive germinal centers (FIG. 10C). Germinal centers occupied <0.05% of total lymph node area in the infected controls, 2% of the lymph node area in the uninfected controls, and up to 18% of the lymph node area in the vaccinated groups (FIG. [0138] 10D). More vigorous immune reactivity in the low-dose than the high-dose DNA-primed animals was suggested by more extensive germinal centers in the low dose group (FIG. 10D). At 12 weeks after challenge, in situ hybridization for viral RNA revealed rare virus-expressing cells in lymph nodes from 3 of the 24 vaccinated macaques, whereas virus-expressing cells were readily detected in lymph nodes from each of the infected control animals. In the controls, which had undergone a profound depletion in CD4 T cells, the cytomorphology of infected lymph node cells was consistent with a macrophage phenotype.
  • The prime/boost strategy raised low levels of antibody to Gag and undetectable levels of antibody to Env (FIG. 11). Postchallenge, antibodies to both Env and Gag underwent anamnestic responses with total Gag antibody reaching heights approaching 1 mg/ml and total Env antibody reaching heights of up to 100 μg/ml. [0139]
  • Enzyme-linked immunosorbent assays (ELISAs) for total antibody to Gag used bacterially produced SIV gag p27 to coat wells (2 μg per milliliter in bicarbonate buffer). ELISAs for antibody to Env antibody used 89.6 Env produced in transiently transfected 293T cells and captured with sheep antibody against Env (catalog number 6205; International Enzymes, Fairbrook Calif.). Standard curves for Gag and Env ELISAs were produced with serum from a SHIV-89.6-infected macaque with known amounts of immunoglobulin G (IgG) specific for Gag or Env. Bound antibody was detected with peroxidase-conjugated goat antibody to macaque IgG (catalog # YNGMOIGGFCP; Accurate Chemical, Westbury, N.Y.) and TMB substrate (Catalog # T3405; Sigma, St. Louis, Mo.). Sera were assayed at threefold dilutions in duplicate wells. Dilutions of test sera were performed in whey buffer (4% whey and 0.1[0140] % tween 20 in 1× PBS). Blocking buffer consisted of whey buffer plus 0.5% nonfat dry milk. Reactions were stopped with 2M H2SO4 and the optical density read at 450 nm. Standard curves were fitted and sample concentrations were interpolated as μg of antibody per ml of serum using SOFTmax 2.3 software (Molecular Devices, Sunnyvale, Calif.).
  • By 2 weeks after challenge, neutralizing antibodies for the 89.6 immunogen, but not the SHIV-89.6P challenge, were present in the high-dose DNA-primed groups (geometric mean titers of 352 in the i.d. and 303 in the i.m. groups) (FIG. 11C) (D. C. Montefiori et al. 1988 [0141] J Clin Microbiol 26:231). By 5 weeks after challenge, neutralizing antibody to 89.6P had been generated (geometric mean titers of 200 in the high-dose i.d. and 126 in the high-dose i.m. group) (FIG. 11D) and neutralizing antibody to 89.6 had started to decline. By 16 to 20 weeks after challenge, antibodies to Gag and Env had fallen in most animals.
  • Our results demonstrate that a multiprotein DNA/MVA vaccine can raise a memory immune response capable of controlling a highly virulent mucosal immunodeficiency virus challenge. Our levels of viral control were more favorable than have been achieved using only DNA (M. A. Egan et al. 2000 [0142] J Virol 74:7485) or rMVA vaccines (I. Ourmanov et al. 2000 J Virol 74:2740) and were comparable to those obtained for DNA immunizations adjuvanted with interleukin-2 (D. H. Barouch et al. 2000 Science 290:486). All of these previous studies have used more than three vaccine inoculations, none have used mucosal challenges, and most have challenged at peak effector responses and not allowed a prolonged post vaccination period to test for “long term” efficacy.
  • The dose of DNA had statistically significant effects on both cellular and humoral responses (P<0.05), whereas the route of DNA administration affected only humoral responses. Intradermal DNA delivery was about 10 times more effective than i.m. inoculations for generating antibody to Gag (P=0.02). Neither route nor dose of DNA appeared to have a significant effect on protection. At 20 weeks after challenge, the high-dose DNA-primed animals had slightly lower geometric mean levels of viral RNA (7×10[0143] 2 and 5×102) than the low-dose DNA-primed animals (9×102 and 1×103).
  • The DNA/MVA vaccine controlled the infection, rapidly reducing viral loads to near or below 1000 copies of viral RNA per milliliter of blood. Containment, rather than prevention of infection, affords the opportunity to establish a chronic infection (H. L. Robinson et al. 1999 [0144] Nat Med 5:526). By rapidly reducing viral loads, a multiprotein DNA/MVA vaccine will extend the prospect for long-term non-progression and limit HIV transmission. (J. W. Mellors et al. 1996 Science 272:1167; T. C. Quinn et al. 2000 N Engl J Med 342:921).
    • EXAMPLE 2 MVA Expressing Modified HIV Env, Gag, and Pol Genes
  • This disclosure describes the construction of a modified vaccinia Ankara (MVA) recombinant virus, MVA/HIV clade B recombinant virus expressing the HIV strain ADA env and the HXB2 gag pol (MVA/HIV ADA env+HXB2 gag pol). For amplification, the lab name of MVA/[0145] HIV 48 will be used, which denotes the plasmid from which the construct comes.
  • The HIV gag-pol genes were derived from the Clade B infectious HXB2 virus. The gag-pol gene was truncated so that most of the integrase coding sequences were removed and amino acids 185, 266, and 478 were mutated to inactivate reverse transcriptase, inhibit strand transfer activity, and inhibit the RNaseH activity, respectively. The Clade B CCR5 tropic envelope gene was derived from the primary ADA isolate; TTTTTNT sequences were mutated without changing coding capacity to prevent premature transcription termination and the cytoplasmic tail was truncated in order to improve surface expression, immunogenicity, and stability of the MVA vector. The HIV genes were inserted into a plasmid transfer vector so that gag-pol gene was regulated by the modified H5 early/late vaccinia virus promoter and the env gene was regulated by the newly designed early/late Psyn II promoter to provide similar high levels of expression. A self-deleting GUS reporter gene was included to allow detection and isolation of the recombinant virus. The HIV genes were flanked by MVA sequences to allow homologous recombination into the [0146] deletion 3 site so that the recombinant MVA would remain TK positive for stability and high expression in resting cells. The recombinant MVA was isolated and shown to express abundant amounts of gag-pol-env and to process gag. Production of HIV-like particles was demonstrated by centrifugation and by electron microscopy. The presence of env in the HIV-like particles was demonstrated by immunoelectron microscopy.
    Table of Sequences
    Description SEQ ID NO FIG. NO
    pLW-48 1 14
    pLW-48 1 15
    Psyn II promoter 2 15
    ADA envelope truncated 3 15
    PmH5 promoter 4 15
    HXB2 gag pol 5 15
  • Plasmid Transfer Vector [0147]
  • The plasmid transfer vector used to make the MVA recombinant virus, pLW-48, (FIG. 16) by homologous recombination was constructed as follows: [0148]
  • 1. From the commercially obtained plasmid, pGem-4Z (Promega), flanking areas on either side of deletion III, designated [0149] flank 1 and flank 2, containing 926 and 520 base pairs respectively, were amplified by PCR from the MVA stains of vaccinia virus. Within these flanks, a promoter, the mH5, which had been modified from the originally published sequence by changing two bases that had been shown by previously published work to increase the expression of the cloned gene, was added.
  • 2. A clade B gag pol (FIG. 17) was truncated so that the integrase was removed and was cloned into the plasmid so that it was controlled by the mH5 promoter. This gene contained the complete HXB2 sequence of the gag. The pol gene has reverse transcriptase safety mutations in amino acid 185 within the active site of RT, in amino acid 266 which inhibits strand transfer activity, and at amino acid 478 which inhibits the RNaseH activity. In addition, the integrase gene was deleted past EcoRI site. [0150]
  • 3. A direct repeat of 280 basepairs, corresponding to the last 280 base pairs of [0151] MVA flank 1, was added after flank 1.
  • 4. The p11 promoter and GUS reporter gene were added between the two direct repeats of [0152] flank 1 so that this screening marker could initially be used for obtaining the recombinant virus, yet deleted out in the final recombinant virus (Scheiflinger, F. et al. 1998 Arch Virol 143:467-474; Carroll, M. W. and B. Moss 1995 BioTechniques 19:352-355).
  • 5. A new promoter, Psyn II, was designed to allow for increased expression of the ADA env. The sequence of this new early/late promoter is given in FIG. 18. [0153]
  • 6. A truncated version of the ADA envelope with a silent 5TNT mutation was obtained by PCR and inserted in the plasmid under the control of the Psyn II promoter. The envelope was truncated in the cytoplasmic tail of the gp41 gene, deleting 115 amino acids of the cytoplasmic tail. This truncation was shown to increase the amount of envelope protein on the surface of infected cells and enhance immunogenicity of the envelope protein in mice, and stability of the recombinant virus in tissue culture. [0154]
  • Recombinant MVA Construction [0155]
  • 1. MVA virus, which may be obtained from ATCC Number VR-1508, was plaque purified three times by terminal dilutions in chicken embryo fibroblasts (CEF), which were made from 9 day old SPF Premium SPAFAS fertile chicken eggs, distributed by B and E Eggs, Stevens, Pa. [0156]
  • Secondary CEF cells were infected at an MOI of 0.05 of MVA and transfected with 2 μg of pLW-48, the plasmid described above. Following a two day incubation at 37° C., the virus was harvested, frozen and thawed 3×, and plated out on CEF plates. [0157]
  • 3. At 4 days, those foci of infection that stained blue after addition of X-gluc substrate, indicating that recombination had occurred between the plasmid and the infecting virus, were picked and inoculated on CEF plates. Again, those foci that stained blue were picked. [0158]
  • 4. These GUS containing foci were plated out in triplicate and analyzed for GUS staining (which we wanted to now delete) and ADA envelope expression. Individual foci were picked from the 3rd replicate plates of those samples that had about equal numbers of mixed populations of GUS staining and nonstaining foci as well as mostly envelope staining foci. [0159]
  • 5. These foci were again plated out in triplicate, and analyzed the same way. After 5 passages, a virus was derived which expressed the envelope protein but which had deleted the GUS gene because of the double repeat. By immunostaining, this virus also expressed the gag pol protein. [0160]
  • Characterization of MVA Recombinant Virus, MVA/[0161] HIV 48
  • 1. Aliquots of MVA/[0162] HIV 48 infected cell lysates were analyzed by radioimmunoprecipitation and immunostaining with monoclonal antibodies for expression of both the envelope and gag pol protein. In both of these tests, each of these proteins was detected.
  • 2. The recombinant virus was shown to produce gag particles in the supernatant of infected cells by pelleting the [0163] 35S-labeled particles on a 20% sucrose cushion.
  • 3. Gag particles were also visualized both outside and budding from cells as well as within vacuoles of cells in the electron microscope in thin sections. These gag particles had envelope protein on their surface. [0164]
  • Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer, and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion. [0165]
    • SUMMARY
  • In summary, we have made a recombinant MVA virus, MVA/[0166] HIV 48, which has high expression of the ADA truncated envelope and the HXB2 gag pol. The MVA recombinant virus is made using a transiently expressed GUS marker that is deleted in the final virus. High expression of the ADA envelope is possible because of a new hybrid early/late promoter, Psyn II. In addition, the envelope has been truncated because we have shown truncation of the envelope enhances the amount of protein on the surface of the infected cells, and hence enhances immunogenicity; stability of the recombinant is also enhanced. The MVA recombinant makes gag particles which has been shown by pelleting the particles through sucrose and analyzing by PAGE. Gag particles with envelope protein on the surface have also been visualized in the electron microscope.
    • EXAMPLE 3 Additional Modified or Synthetic Promoters Designed for Gene Expression in MVA or Other Poxviruses
  • Additional modified or synthetic promoters were designed for gene expression in MVA or other poxviruses. Promoters were modified to allow expression at early and late times after infection and to reduce possibility of homologous recombination between identical sequences when multiple promoters are used in same MVA vector. Promoters are placed upstream of protein coding sequence. [0167]
    m7.5 promoter:
    CGCTTTTTATAGTAAGTTTTTCACCCATAAATAATAAATACAATAATTAATTTC (SEQ ID NO:10)
    TCGTAAAAATTGAAAAACTATTCTAATTTATTGCACGGT
    Psyn II promoter:
    TAAAAAATGAAAAAATATTCTAATTTATAGGACGGTTTTGATTTTCTTTTTTTC (SEQ ID NO:2)
    TATGCTATAAATAATAAATA
    Psyn III promoter:
    TAAAAATTGAAAAAATATTCTAATTTATAGGACGGTTTTGATTTTCTTTTTTTC (SEQ ID NO:11)
    TATACTATAAATAATAAATA
    Psyn IV promoter:
    TAAAAATTGAAAAACTATTCTAATTTATAGGACGGTTTTGATTTTCTTTTTTTC (SEQ ID NO:12)
    TATACTATAAATAATAAATA
    Psyn V promoter:
    AAAAAATGATAAAGTAGGTTCAGTTTTATTGCTGGTTTAAAATCACGCTTTCG (SEQ ID NO:13)
    AGTAAAAACTACGAATATAAAT
    • EXAMPLE 4 Tables A-F
  • Table A: MVA/48 immunization—guinea pigs. [0168]
  • Groups of guinea pigs were immunized at [0169] days 0 and 30 with 1×108 infectious units of MVA/48 by either the intramuscular (IM) or intradermal (ID) route. As a control another group was immunized IM with the same dose of non-recombinant MVA. Sera taken before as well as after each immunization was analyzed for neutralizing activity against HIV-1-MN. Titers are the reciprocal serum dilution at which 50% of MT-2 cells were protected from virus-induced killing. Significant neutralizing activity was observed in all animals after the second immunization with MVA/48 (day 49).
  • Table B: Frequencies of HIV-1 gag-specific T cells following immunization of mice with MVA/48. [0170]
  • Groups of BalbC mice were immunized at [0171] days 0 and 21 with 1×107 infectious units of MVA/48 by one of three routes: intraperitoneal (IP), intradermal (ID), or intramuscular (IM). A control group was immunized with non-recombinant MVA. At 5 weeks after the last immunization, splenocytes were prepared and stimulated in vitro with an immunodominant peptide from HIV-1 p24 for 7 days. The cells were then mixed either with peptide-pulsed P815 cells or with soluble peptide. Gamma interferon-producing cells were enumerated in an ELISPOT assay. A value of >500 was assigned to wells containing too many spots to count. Strong T cell responses have been reported in mice immunized IP with other viruses. In this experiment, IP immunization of mice with MVA/48 elicited very strong HIV-1 gag-specific T cell responses.
  • Table C: DNA prime and MVA/48 boost—total ELISPOTS per animal. [0172]
  • Ten rhesus macaques were primed ([0173] weeks 0 and 8) with a DNA vaccine expressing HIV-1 antigens including Ada envelope and HXB2 gagpol. At week 24 the animals were boosted intramuscularly with 1×108 infectious units of MVA/48. Fresh peripheral blood mononuclear cells (PBMC) were analyzed for production of gamma interferon in an ELISPOT assay as follows: PBMC were incubated for 30-36 hours in the presence of pools of overlapping peptides corresponding to the individual HIV-1 antigens in the vaccines. The total number of gamma interferon-producing cells from each animal is shown in the table. T cell responses to DNA vaccination were limited (weeks 2-20). However, boosting with MVA/48 resulted in very strong HIV-1-specific T cell responses in all animals (week 25).
  • Table D: Antibody response following immunization of macaques with MVA/SHIV KB9. [0174]
  • Groups of rhesus macaques were immunized with 2×10[0175] 8 infectious units of MVA/SHIV-KB9 at weeks 0 and 4 by one of several routes: Tonsilar, intradermal (ID), or intramuscular (IM). Another group was immunized with non-recombinant MVA using the same routes. Serum samples from 2 weeks after the second immunization were analyzed for binding to KB9 envelope protein by ELISA and for neutralization of SHIV-89.6P and SHIV-89.6. In the ELISA assay, soluble KB9 envelope protein was captured in 96 well plates using an antibody to the C-terminus of gp120. Serial dilutions of sera were analyzed and used to determine the endpoint titers. Neutralization of SHIV-89.6P and SHIV-89.6 was determined in an MT-2 cell assay. Titers are the reciprocal serum dilution at which 50% of the cells were protected from virus-induced killing. In in vitro neutralization assays, SHIV-89.6P and SHIV-89.6 are heterologous, i.e. sera from animals infected with one of the viruses does not neutralize the other virus. Thus, two immunizations with MVA/SHIV-KB9 elicited good ELISA binding antibodies in all animals and neutralizing antibodies to the homologous virus (SHIV-89.6P) in some animals. In addition, heterologous neutralizing antibodies were observed in a subset of animals.
  • Table E: Frequencies of gag CM-9-specific CD3/CD8 T cells following immunization of macaques with MVA/SHIV-KB9. [0176]
  • Groups of MamuA*01 positive rhesus macaques were immunized with 2×10[0177] 8 infectious units of MVA/SHIV-KB9 at weeks 0 and 4 by one of several routes: tonsilar, intradermal (ID), or intramuscular IM). Another group was immunized with non-recombinant MVA. The frequencies of CD3+/CD8+ T cells that bound tetrameric complex containing the SIV gag-specific peptide CM9 were determined by flow cytometry at various times after each immunization. Time intervals were as follows: 1a, 1b, and 1d were one, two, and four weeks after the first immunization, respectively; 2a, 2b, 2c, and 2d were one, two, three, and twelve weeks after the second immunization, respectively. Values above background are shown in bold face. Strong SIV gag-specific responses were observed after a single immunization with MVA/SHIV-KB9 in all immunized animals. Boosting was observed in most animals following the second immunization. In addition, measurable tetramer binding was still found twelve weeks after the second immunization.
  • Table F: Frequencies of specific T cells following immunization of macaques with MVA/SHIV KB9. [0178]
  • Groups of macaques were immunized with MVA/SHIV-KB9 as described above. MVA/SHIV-KB9 expresses 5 genes from the chimeric virus, SHIV-89.6P: envelope, gag, polymerase, tat, and nef. Thus, the frequencies of T cells specific for each of the 5 antigens was analyzed using pools of peptides corresponding to each individual protein. Fresh PBMC were stimulated with pools of peptides for 30-36 hours in vitro. Gamma interferon-producing cells were enumerated in an ELISPOT assay. The total number of cells specific for each antigen is given as “total # spots”. In addition, the number of responding animals and average # of spots per group is shown. PBMC were analyzed at one week after the first immunization (1a) and one week after the second immunization (2a). Another group of 7 animals was immunized with non-recombinant MVA. In these animals, no spots above background levels were detected. Thus, a single immunization with MVA/SHIV-KB9 elicited strong SHIV-specific T cell responses in all animals. Gag and envelope responses were the strongest; most animals had responses to gag, all animals had responses to envelope. The Elispot responses were also observed after the second immunization with MVA/SHIV-KB9, albeit at lower levels. At both times, the rank order of responses was: tonsilar>ID>IM. We show good immune response to nef and some immune response to tat. [0179]
    TABLE A
    MVA/48 immunization - guinea pigs
    HIV-MN neutralizing antibody - reciprocal titer
    Animal Day
    4 day day 33
    # Group Route day 0 MVA #1 30 MVA#2 day 49
    885 MVA I.M. <20 I.M. 31 I.M. 24
    891 ″ ″ <20 ″ 85 ″ <20
    882 MVA/48 I.M. <20 I.M. <20 I.M. 5,524
    883 ″ ″ <20 ″ 68 ″ 691
    886 ″ ″ <20 ″ <20 ″ 4,249
    890 ″ ″ <20 ″ 180 ″ 89
    879 MVA/48 I.D. <20 I.D. <20 I.D. 817
    881 ″ ″ <20 ″ <20 ″ 234
    888 ″ ″ <20 ″ 24 ″ 112
    889 ″ ″ <20 ″ 22 ″ 376
  • [0180]
    TABLE B
    Frequencies of HIV-gag-specific T cells following
    immunization of mice with MVA/48
    Group P815 cells + gag peptide gag peptide no stimulation
    MVA control
    0 2 0 4 1 2
    MVA/48 (IP) >500 >500 >500 >500 8 8
    MVA/48 (ID) 12 5 49 33 4 2
    MVA/48 (IM) 22 18 66 49 12 8
  • [0181]
    TABLE C
    DNA prime and MVA/48 boost
    Total ELISPOTS per Animal
    WEEKS
    Animal # −2 2 6 102 142 202 252
    RLw 4 731* < 47 43 50 3905
    RVI 5 997* < < < 8 205
    Roa  <1 < 1 < < < 245
    RHc < < < < < < 535
    Ryl < < < < < < 4130
    RQk < 46 < < < < 630
    RDr < < < 14 < < 1965
    RZc < 5 < 58 < < 925
    RSf < 118 < < < 20 5570
    Ras < 69 < < < < 1435
    Total 9 1966 1 119 43 78 19545
    Geo Mean 4.5 105.3 1.0 33.7 43.0 20.0 1147.7
  • [0182]
    TABLE D
    Antibody response following immunization of
    macaques with MVA/SHIV KB9
    KB9 SHIV- SHIV-
    env SHIV- SHIV- 89.6 89.6P
    ELISA KB9 env elisa 89.6 89.6P # pos # pos
    Animal # Route titer average std dev. Nab titer Nab titer animals animals
    598 tonsil 25,600 31,086 20,383 <20 <20 3 2
    601 ″ 51,200 <20 <20
    606 ″ 25,600 <20 <20
    642 ″ 51,200 75 31
    646 ″ 51,200 61 48
    653 ″ 6,400 <20 <20
    654 ″ 6,400 22 <20
    602 i.d. 25,600 18,800 15,341 38 <20 2 4
    604 ″ 12,800 <20 262
    608 ″ 3,200 20 66
    637 ″ 12,800 <20 35
    638 ″ 51,200 <20 <20
    645 ″ 25,600 <20 <20
    647 ″ 12,800 32 162
    650 ″ 6,400 <20 <20
    599 i.m. 6,400 17,000 16,516 <20 <20 0 3
    600 ″ 6,400 <20 29
    609 ″ 6,400 <20 <20
    639 ″ 51,200 <20 85
    640 ″ 12,800 <20 <20
    641 ″ 25,600 <20 41
    649 ″ 1,600 <20 <20
    651 ″ 25,600 20 <20
    603 Control <100 <100 <20 <20 0 0
    605 ″ <100 <20 <20
    607 ″ <100 <20 <20
    643 ″ <100 <20 <20
    644 ″ <100 <20 <20
    648 ″ <100 <20 <20
    652 ″ <100 <20 <20
  • [0183]
    TABLE E
    Frequencies of gag CM9-specific CD3/CD8 T cells
    following immunization of macaques with MVA/SHIV KB9
    pre-
    Animal # Route Virus bleed 1a 1b 1d 2a 2b 2c 2d
    598 Tonsil MVA/KB9 0.018 0.41 0.79 0.25 2.64 1.13 0.51 0.21
    601 ″ ″ 0.071 0.34 0.38 0.27 0.83 0.7 0.36 0.039
    646 ″ ″ 0.022 0.68 0.76 0.43 1.12 0.91 0.53 0.15
    653 ″ ″ 0.041 0.69 0.85 0.53 0.68 0.49 0.47 0.3
    648 ″ MVA 0.033 0.039 0.022 0.058 0.033 0.013
    602 i.d. MVA/KB9 0.019 0.17 0.92 0.5 0.95 0.59 0.5 0.2
    604 ″ ″ 0.013 0.11 0.38 0.32 0.44 0.38 0.19 0.25
    650 ″ ″ 0.095 0.17 0.6 0.23 2.87 1.12 0.9 0.16
    647 ″ ″ 0.032 0.22 0.38 0.14 0.84 0.91 0.34 0.17
    652 ″ MVA 0.041 0.038 0.059 0.025 0.022 0.026 0.055
    599 i.m. MVA/KB9 0.081 0.31 0.082 0.12 0.054 0.11
    600 ″ ″ 0.034 0.15 0.41 0.17 0.29 0.27 0.16 0.049
    649 ″ ″ 0.00486 0.35 1.34 0.56 2.42 0.77 0.69 0.22
    651 ″ ″ 0.049 0.12 0.69 0.25 1.01 0.32 0.24 0.22
    603 ″ MVA 0.024 0.087 0.073 0.082 0.027 0.17
  • [0184]
    TABLE F
    Frequencies of specific T cells following immunization
    of macaques with MVA/SHIV KB9
    Gag specific Tat specific Nef specific Env specific Total
    # Total average # total average # total average # total Average #
    Study responding # # responding # # responding # # responding # # responding
    groups animals spots spots animals spots spots animals spots spots animals spots spots animals
    tonsil 1a
    4/6 1325 221 0/6 0 0 3/6 195 33 6/6 8760 1460 6/6
    tonsil 2a 5/6 1405 234 0/6 0 0 1/6 560 93 6/6 4485 748 6/6
    i.d. 1a 7/7 1335 191 0/7 0 0 2/7 215 31 7/7 7320 1046 7/7
    i.d. 2a 4/7 755 108 0/7 0 0 1/7 55 8 7/7 2700 386 7/7
    i.m. 1a 7/7 925 132 1/7 60 9 3/7 180 26 7/7 5490 784 7/7
    i.m. 2a 4/7 250 36 0/7 0 0 0/7 0 0 6/7 2205 315 6/7
  • While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All patents, patent applications and publications referred to above are hereby incorporated by reference. [0185]
  • 1 13 1 12225 DNA Artificial Sequence Plasmid pLW-48 1 gaattcgttg gtggtcgcca tggatggtgt tattgtatac tgtctaaacg cgttagtaaa 60 acatggcgag gaaataaatc atataaaaaa tgatttcatg attaaaccat gttgtgaaaa 120 agtcaagaac gttcacattg gcggacaatc taaaaacaat acagtgattg cagatttgcc 180 atatatggat aatgcggtat ccgatgtatg caattcactg tataaaaaga atgtatcaag 240 aatatccaga tttgctaatt tgataaagat agatgacgat gacaagactc ctactggtgt 300 atataattat tttaaaccta aagatgccat tcctgttatt atatccatag gaaaggatag 360 agatgtttgt gaactattaa tctcatctga taaagcgtgt gcgtgtatag agttaaattc 420 atataaagta gccattcttc ccatggatgt ttcctttttt accaaaggaa atgcatcatt 480 gattattctc ctgtttgatt tctctatcga tgcggcacct ctcttaagaa gtgtaaccga 540 taataatgtt attatatcta gacaccagcg tctacatgac gagcttccga gttccaattg 600 gttcaagttt tacataagta taaagtccga ctattgttct atattatata tggttgttga 660 tggatctgtg atgcatgcaa tagctgataa tagaacttac gcaaatatta gcaaaaatat 720 attagacaat actacaatta acgatgagtg tagatgctgt tattttgaac cacagattag 780 gattcttgat agagatgaga tgctcaatgg atcatcgtgt gatatgaaca gacattgtat 840 tatgatgaat ttacctgatg taggcgaatt tggatctagt atgttgggga aatatgaacc 900 tgacatgatt aagattgctc tttcggtggc tgggtaccag gcgcgccttt cattttgttt 960 ttttctatgc tataaatggt acgtcctgta gaaaccccaa cccgtgaaat caaaaaactc 1020 gacggcctgt gggcattcag tctggatcgc gaaaactgtg gaattgatca gcgttggtgg 1080 gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag gcagttttaa cgatcagttc 1140 gccgatgcag atattcgtaa ttatgcgggc aacgtctggt atcagcgcga agtctttata 1200 ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg atgcggtcac tcattacggc 1260 aaagtgtggg tcaataatca ggaagtgatg gagcatcagg gcggctatac gccatttgaa 1320 gccgatgtca cgccgtatgt tattgccggg aaaagtgtac gtatcaccgt ttgtgtgaac 1380 aacgaactga actggcagac tatcccgccg ggaatggtga ttaccgacga aaacggcaag 1440 aaaaagcagt cttacttcca tgatttcttt aactatgccg gaatccatcg cagcgtaatg 1500 ctctacacca cgccgaacac ctgggtggac gatatcaccg tggtgacgca tgtcgcgcaa 1560 gactgtaacc acgcgtctgt tgactggcag gtggtggcca atggtgatgt cagcgttgaa 1620 ctgcgtgatg cggatcaaca ggtggttgca actggacaag gcactagcgg gactttgcaa 1680 gtggtgaatc cgcacctctg gcaaccgggt gaaggttatc tctatgaact gtgcgtcaca 1740 gccaaaagcc agacagagtg tgatatctac ccgcttcgcg tcggcatccg gtcagtggca 1800 gtgaagggcg aacagttcct gattaaccac aaaccgttct actttactgg ctttggtcgt 1860 catgaagatg cggacttgcg tggcaaagga ttcgataacg tgctgatggt gcacgaccac 1920 gcattaatgg actggattgg ggccaactcc taccgtacct cgcattaccc ttacgctgaa 1980 gagatgctcg actgggcaga tgaacatggc atcgtggtga ttgatgaaac tgctgctgtc 2040 ggctttaacc tctctttagg cattggtttc gaagcgggca acaagccgaa agaactgtac 2100 agcgaagagg cagtcaacgg ggaaactcag caagcgcact tacaggcgat taaagagctg 2160 atagcgcgtg acaaaaacca cccaagcgtg gtgatgtgga gtattgccaa cgaaccggat 2220 acccgtccgc aaggtgcacg ggaatatttc gcgccactgg cggaagcaac gcgtaaactc 2280 gacccgacgc gtccgatcac ctgcgtcaat gtaatgttct gcgacgctca caccgatacc 2340 atcagcgatc tctttgatgt gctgtgcctg aaccgttatt acggatggta tgtccaaagc 2400 ggcgatttgg aaacggcaga gaaggtactg gaaaaagaac ttctggcctg gcaggagaaa 2460 ctgcatcagc cgattatcat caccgaatac ggcgtggata cgttagccgg gctgcactca 2520 atgtacaccg acatgtggag tgaagagtat cagtgtgcat ggctggatat gtatcaccgc 2580 gtctttgatc gcgtcagcgc cgtcgtcggt gaacaggtat ggaatttcgc cgattttgcg 2640 acctcgcaag gcatattgcg cgttggcggt aacaagaaag ggatcttcac tcgcgaccgc 2700 aaaccgaagt cggcggcttt tctgctgcaa aaacgctgga ctggcatgaa cttcggtgaa 2760 aaaccgcagc agggaggcaa acaatgagag ctcggttgtt gatggatctg tgatgcatgc 2820 aatagctgat aatagaactt acgcaaatat tagcaaaaat atattagaca atactacaat 2880 taacgatgag tgtagatgct gttattttga accacagatt aggattcttg atagagatga 2940 gatgctcaat ggatcatcgt gtgatatgaa cagacattgt attatgatga atttacctga 3000 tgtaggcgaa tttggatcta gtatgttggg gaaatatgaa cctgacatga ttaagattgc 3060 tctttcggtg gctggcggcc cgctcgagta aaaaatgaaa aaatattcta atttatagga 3120 cggttttgat tttctttttt tctatgctat aaataataaa tagcggccgc accatgaaag 3180 tgaaggggat caggaagaat tatcagcact tgtggaaatg gggcatcatg ctccttggga 3240 tgttgatgat ctgtagtgct gtagaaaatt tgtgggtcac agtttattat ggggtacctg 3300 tgtggaaaga agcaaccacc actctatttt gtgcatcaga tgctaaagca tatgatacag 3360 aggtacataa tgtttgggcc acacatgcct gtgtacccac agaccccaac ccacaagaag 3420 tagtattgga aaatgtgaca gaaaatttta acatgtggaa aaataacatg gtagaacaga 3480 tgcatgagga tataatcagt ttatgggatc aaagcctaaa gccatgtgta aaattaaccc 3540 cactctgtgt tactttaaat tgcactgatt tgaggaatgt tactaatatc aataatagta 3600 gtgagggaat gagaggagaa ataaaaaact gctctttcaa tatcaccaca agcataagag 3660 ataaggtgaa gaaagactat gcacttttct atagacttga tgtagtacca atagataatg 3720 ataatactag ctataggttg ataaattgta atacctcaac cattacacag gcctgtccaa 3780 aggtatcctt tgagccaatt cccatacatt attgtacccc ggctggtttt gcgattctaa 3840 agtgtaaaga caagaagttc aatggaacag ggccatgtaa aaatgtcagc acagtacaat 3900 gtacacatgg aattaggcca gtagtgtcaa ctcaactgct gttaaatggc agtctagcag 3960 aagaagaggt agtaattaga tctagtaatt tcacagacaa tgcaaaaaac ataatagtac 4020 agttgaaaga atctgtagaa attaattgta caagacccaa caacaataca aggaaaagta 4080 tacatatagg accaggaaga gcattttata caacaggaga aataatagga gatataagac 4140 aagcacattg caacattagt agaacaaaat ggaataacac tttaaatcaa atagctacaa 4200 aattaaaaga acaatttggg aataataaaa caatagtctt taatcaatcc tcaggagggg 4260 acccagaaat tgtaatgcac agttttaatt gtggagggga attcttctac tgtaattcaa 4320 cacaactgtt taatagtact tggaatttta atggtacttg gaatttaaca caatcgaatg 4380 gtactgaagg aaatgacact atcacactcc catgtagaat aaaacaaatt ataaatatgt 4440 ggcaggaagt aggaaaagca atgtatgccc ctcccatcag aggacaaatt agatgctcat 4500 caaatattac agggctaata ttaacaagag atggtggaac taacagtagt gggtccgaga 4560 tcttcagacc tgggggagga gatatgaggg acaattggag aagtgaatta tataaatata 4620 aagtagtaaa aattgaacca ttaggagtag cacccaccaa ggcaaaaaga agagtggtgc 4680 agagagaaaa aagagcagtg ggaacgatag gagctatgtt ccttgggttc ttgggagcag 4740 caggaagcac tatgggcgca gcgtcaataa cgctgacggt acaggccaga ctattattgt 4800 ctggtatagt gcaacagcag aacaatttgc tgagggctat tgaggcgcaa cagcatctgt 4860 tgcaactcac agtctggggc atcaagcagc tccaggcaag agtcctggct gtggaaagat 4920 acctaaggga tcaacagctc ctagggattt ggggttgctc tggaaaactc atctgcacca 4980 ctgctgtgcc ttggaatgct agttggagta ataaaactct ggatatgatt tgggataaca 5040 tgacctggat ggagtgggaa agagaaatcg aaaattacac aggcttaata tacaccttaa 5100 ttgaggaatc gcagaaccaa caagaaaaga atgaacaaga cttattagca ttagataagt 5160 gggcaagttt gtggaattgg tttgacatat caaattggct gtggtatgta aaaatcttca 5220 taatgatagt aggaggcttg ataggtttaa gaatagtttt tactgtactt tctatagtaa 5280 atagagttag gcagggatac tcaccattgt catttcagac ccacctccca gccccgaggg 5340 gacccgacag gcccgaagga atcgaagaag aaggtggaga cagagactaa tttttatgcg 5400 gccgctggta cccaacctaa aaattgaaaa taaatacaaa ggttcttgag ggttgtgtta 5460 aattgaaagc gagaaataat cataaataag cccggggatc ctctagagtc gacaccatgg 5520 gtgcgagagc gtcagtatta agcgggggag aattagatcg atgggaaaaa attcggttaa 5580 ggccaggggg aaagaaaaaa tataaattaa aacatatagt atgggcaagc agggagctag 5640 aacgattcgc agttaatcct ggcctgttag aaacatcaga aggctgtaga caaatactgg 5700 gacagctaca accatccctt cagacaggat cagaagaact tagatcatta tataatacag 5760 tagcaaccct ctattgtgtg catcaaagga tagagataaa agacaccaag gaagctttag 5820 acaagataga ggaagagcaa aacaaaagta agaaaaaagc acagcaagca gcagctgaca 5880 caggacacag caatcaggtc agccaaaatt accctatagt gcagaacatc caggggcaaa 5940 tggtacatca ggccatatca cctagaactt taaatgcatg ggtaaaagta gtagaagaga 6000 aggctttcag cccagaagtg atacccatgt tttcagcatt atcagaagga gccaccccac 6060 aagatttaaa caccatgcta aacacagtgg ggggacatca agcagccatg caaatgttaa 6120 aagagaccat caatgaggaa gctgcagaat gggatagagt gcatccagtg catgcagggc 6180 ctattgcacc aggccagatg agagaaccaa ggggaagtga catagcagga actactagta 6240 cccttcagga acaaatagga tggatgacaa ataatccacc tatcccagta ggagaaattt 6300 ataaaagatg gataatcctg ggattaaata aaatagtaag aatgtatagc cctaccagca 6360 ttctggacat aagacaagga ccaaaagaac cctttagaga ctatgtagac cggttctata 6420 aaactctaag agccgagcaa gcttcacagg aggtaaaaaa ttggatgaca gaaaccttgt 6480 tggtccaaaa tgcgaaccca gattgtaaga ctattttaaa agcattggga ccagcggcta 6540 cactagaaga aatgatgaca gcatgtcagg gagtaggagg acccggccat aaggcaagag 6600 ttttggctga agcaatgagc caagtaacaa attcagctac cataatgatg cagagaggca 6660 attttaggaa ccaaagaaag attgttaagt gtttcaattg tggcaaagaa gggcacacag 6720 ccagaaattg cagggcccct aggaaaaagg gctgttggaa atgtggaaag gaaggacacc 6780 aaatgaaaga ttgtactgag agacaggcta attttttagg gaagatctgg ccttcctaca 6840 agggaaggcc agggaatttt cttcagagca gaccagagcc aacagcccca ccagaagaga 6900 gcttcaggtc tggggtagag acaacaactc cccctcagaa gcaggagccg atagacaagg 6960 aactgtatcc tttaacttcc ctcagatcac tctttggcaa cgacccctcg tcacaataaa 7020 gatagggggg caactaaagg aagctctatt agatacagga gcagatgata cagtattaga 7080 agaaatgagt ttgccaggaa gatggaaacc aaaaatgata gggggaattg gaggttttat 7140 caaagtaaga cagtatgatc agatactcat agaaatctgt ggacataaag ctataggtac 7200 agtattagta ggacctacac ctgtcaacat aattggaaga aatctgttga ctcagattgg 7260 ttgcacttta aattttccca ttagccctat tgagactgta ccagtaaaat taaagccagg 7320 aatggatggc ccaaaagtta aacaatggcc attgacagaa gaaaaaataa aagcattagt 7380 agaaatttgt acagaaatgg aaaaggaagg gaaaatttca aaaattgggc ctgagaatcc 7440 atacaatact ccagtatttg ccataaagaa aaaagacagt actaaatgga ggaaattagt 7500 agatttcaga gaacttaata agagaactca agacttctgg gaagttcaat taggaatacc 7560 acatcccgca gggttaaaaa agaaaaaatc agtaacagta ctggatgtgg gtgatgcata 7620 tttttcagtt cccttagatg aagacttcag gaagtatact gcatttacca tacctagtat 7680 aaacaatgag acaccaggga ttagatatca gtacaatgtg cttccacagg gatggaaagg 7740 atcaccagca atattccaaa gtagcatgac aaaaatctta gagcctttta aaaaacaaaa 7800 tccagacata gttatctatc aatacatgaa cgatttgtat gtaggatctg acttagaaat 7860 agggcagcat agaacaaaaa tagaggagct gagacaacat ctgttgaggt ggggacttac 7920 cacaccagac aaaaaacatc agaaagaacc tccattcctt tggatgggtt atgaactcca 7980 tcctgataaa tggacagtac agcctatagt gctgccagaa aaagacagct ggactgtcaa 8040 tgacatacag aagttagtgg ggaaattgaa taccgcaagt cagatttacc cagggattaa 8100 agtaaggcaa ttatgtaaac tccttagagg aaccaaagca ctaacagaag taataccact 8160 aacagaagaa gcagagctag aactggcaga aaacagagag attctaaaag aaccagtaca 8220 tggagtgtat tatgacccat caaaagactt aatagcagaa atacagaagc aggggcaagg 8280 ccaatggaca tatcaaattt atcaagagcc atttaaaaat ctgaaaacag gaaaatatgc 8340 aagaatgagg ggtgcccaca ctaatgatgt aaaacaatta acagaggcag tgcaaaaaat 8400 aaccacagaa agcatagtaa tatggggaaa gactcctaaa tttaaactac ccatacaaaa 8460 ggaaacatgg gaaacatggt ggacagagta ttggcaagcc acctggattc ctgagtggga 8520 gtttgttaat acccctcctt tagtgaaatt atggtaccag ttagagaaag aacccatagt 8580 aggagcagaa accttctatg tagatggggc agctaacagg gagactaaat taggaaaagc 8640 aggatatgtt actaacaaag gaagacaaaa ggttgtcccc ctaactaaca caacaaatca 8700 gaaaactcag ttacaagcaa tttatctagc tttgcaggat tcaggattag aagtaaacat 8760 agtaacagac tcacaatatg cattaggaat cattcaagca caaccagata aaagtgaatc 8820 agagttagtc aatcaaataa tagagcagtt aataaaaaag gaaaaggtct atctggcatg 8880 ggtaccagca cacaaaggaa ttggaggaaa tgaacaagta gataaattag tcagtgctgg 8940 aatcaggaaa atactatttt tagatggaat agataaggcc caagatgaac attagttttt 9000 atgtcgacct gcagggaaag ttttataggt agttgataga acaaaataca taattttgta 9060 aaaataaatc actttttata ctaatatgac acgattacca atacttttgt tactaatatc 9120 attagtatac gctacacctt ttcctcagac atctaaaaaa ataggtgatg atgcaacttt 9180 atcatgtaat cgaaataata caaatgacta cgttgttatg agtgcttggt ataaggagcc 9240 caattccatt attcttttag ctgctaaaag cgacgtcttg tattttgata attataccaa 9300 ggataaaata tcttacgact ctccatacga tgatctagtt acaactatca caattaaatc 9360 attgactgct agagatgccg gtacttatgt atgtgcattc tttatgacat cgcctacaaa 9420 tgacactgat aaagtagatt atgaagaata ctccacagag ttgattgtaa atacagatag 9480 tgaatcgact atagacataa tactatctgg atctacacat tcaccagaaa ctagttaagc 9540 ttgtctccct atagtgagtc gtattagagc ttggcgtaat catggtcata gctgtttcct 9600 gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaagtgt 9660 aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc 9720 gctttcgagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg 9780 agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 9840 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 9900 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 9960 cgtaaaaagg ccgcgttgct ggcgtttttc gataggctcc gcccccctga cgagcatcac 10020 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 10080 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 10140 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 10200 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 10260 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 10320 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 10380 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 10440 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 10500 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 10560 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 10620 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 10680 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 10740 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 10800 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 10860 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 10920 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 10980 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 11040 cgcaacgttg ttggcattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 11100 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 11160 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 11220 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 11280 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 11340 agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 11400 gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 11460 agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 11520 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 11580 gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 11640 cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 11700 ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc 11760 atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtctcgc gcgtttcggt 11820 gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa 11880 gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg 11940 ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt 12000 gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgccattc gccattcagg 12060 ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt cgctattacg ccagctggcg 12120 aaagggggat gtgctgcaag gcgattaagt tgggtaacgc cagggttttc ccagtcacga 12180 cgttgtaaaa cgacggccag tgaattggat ttaggtgaca ctata 12225 2 74 DNA Artificial Sequence Psyn II promoter 2 taaaaaatga aaaaatattc taatttatag gacggttttg attttctttt tttctatgct 60 ataaataata aata 74 3 2214 DNA Artificial Sequence HIV env gene 3 atgaaagtga aggggatcag gaagaattat cagcacttgt ggaaatgggg catcatgctc 60 cttgggatgt tgatgatctg tagtgctgta gaaaatttgt gggtcacagt ttattatggg 120 gtacctgtgt ggaaagaagc aaccaccact ctattttgtg catcagatgc taaagcatat 180 gatacagagg tacataatgt ttgggccaca catgcctgtg tacccacaga ccccaaccca 240 caagaagtag tattggaaaa tgtgacagaa aattttaaca tgtggaaaaa taacatggta 300 gaacagatgc atgaggatat aatcagttta tgggatcaaa gcctaaagcc atgtgtaaaa 360 ttaaccccac tctgtgttac tttaaattgc actgatttga ggaatgttac taatatcaat 420 aatagtagtg agggaatgag aggagaaata aaaaactgct ctttcaatat caccacaagc 480 ataagagata aggtgaagaa agactatgca cttttctata gacttgatgt agtaccaata 540 gataatgata atactagcta taggttgata aattgtaata cctcaaccat tacacaggcc 600 tgtccaaagg tatcctttga gccaattccc atacattatt gtaccccggc tggttttgcg 660 attctaaagt gtaaagacaa gaagttcaat ggaacagggc catgtaaaaa tgtcagcaca 720 gtacaatgta cacatggaat taggccagta gtgtcaactc aactgctgtt aaatggcagt 780 ctagcagaag aagaggtagt aattagatct agtaatttca cagacaatgc aaaaaacata 840 atagtacagt tgaaagaatc tgtagaaatt aattgtacaa gacccaacaa caatacaagg 900 aaaagtatac atataggacc aggaagagca ttttatacaa caggagaaat aataggagat 960 ataagacaag cacattgcaa cattagtaga acaaaatgga ataacacttt aaatcaaata 1020 gctacaaaat taaaagaaca atttgggaat aataaaacaa tagtctttaa tcaatcctca 1080 ggaggggacc cagaaattgt aatgcacagt tttaattgtg gaggggaatt cttctactgt 1140 aattcaacac aactgtttaa tagtacttgg aattttaatg gtacttggaa tttaacacaa 1200 tcgaatggta ctgaaggaaa tgacactatc acactcccat gtagaataaa acaaattata 1260 aatatgtggc aggaagtagg aaaagcaatg tatgcccctc ccatcagagg acaaattaga 1320 tgctcatcaa atattacagg gctaatatta acaagagatg gtggaactaa cagtagtggg 1380 tccgagatct tcagacctgg gggaggagat atgagggaca attggagaag tgaattatat 1440 aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc aaaaagaaga 1500 gtggtgcaga gagaaaaaag agcagtggga acgataggag ctatgttcct tgggttcttg 1560 ggagcagcag gaagcactat gggcgcagcg tcaataacgc tgacggtaca ggccagacta 1620 ttattgtctg gtatagtgca acagcagaac aatttgctga gggctattga ggcgcaacag 1680 catctgttgc aactcacagt ctggggcatc aagcagctcc aggcaagagt cctggctgtg 1740 gaaagatacc taagggatca acagctccta gggatttggg gttgctctgg aaaactcatc 1800 tgcaccactg ctgtgccttg gaatgctagt tggagtaata aaactctgga tatgatttgg 1860 gataacatga cctggatgga gtgggaaaga gaaatcgaaa attacacagg cttaatatac 1920 accttaattg aggaatcgca gaaccaacaa gaaaagaatg aacaagactt attagcatta 1980 gataagtggg caagtttgtg gaattggttt gacatatcaa attggctgtg gtatgtaaaa 2040 atcttcataa tgatagtagg aggcttgata ggtttaagaa tagtttttac tgtactttct 2100 atagtaaata gagttaggca gggatactca ccattgtcat ttcagaccca cctcccagcc 2160 ccgaggggac ccgacaggcc cgaaggaatc gaagaagaag gtggagacag agac 2214 4 70 DNA Artificial Sequence PmH5 promoter 4 aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60 atcataaata 70 5 3479 DNA Artificial Sequence HIV genes 5 atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgatggga aaaaattcgg 60 ttaaggccag ggggaaagaa aaaatataaa ttaaaacata tagtatgggc aagcagggag 120 ctagaacgat tcgcagttaa tcctggcctg ttagaaacat cagaaggctg tagacaaata 180 ctgggacagc tacaaccatc ccttcagaca ggatcagaag aacttagatc attatataat 240 acagtagcaa ccctctattg tgtgcatcaa aggatagaga taaaagacac caaggaagct 300 ttagacaaga tagaggaaga gcaaaacaaa agtaagaaaa aagcacagca agcagcagct 360 gacacaggac acagcaatca ggtcagccaa aattacccta tagtgcagaa catccagggg 420 caaatggtac atcaggccat atcacctaga actttaaatg catgggtaaa agtagtagaa 480 gagaaggctt tcagcccaga agtgataccc atgttttcag cattatcaga aggagccacc 540 ccacaagatt taaacaccat gctaaacaca gtggggggac atcaagcagc catgcaaatg 600 ttaaaagaga ccatcaatga ggaagctgca gaatgggata gagtgcatcc agtgcatgca 660 gggcctattg caccaggcca gatgagagaa ccaaggggaa gtgacatagc aggaactact 720 agtacccttc aggaacaaat aggatggatg acaaataatc cacctatccc agtaggagaa 780 atttataaaa gatggataat cctgggatta aataaaatag taagaatgta tagccctacc 840 agcattctgg acataagaca aggaccaaaa gaacccttta gagactatgt agaccggttc 900 tataaaactc taagagccga gcaagcttca caggaggtaa aaaattggat gacagaaacc 960 ttgttggtcc aaaatgcgaa cccagattgt aagactattt taaaagcatt gggaccagcg 1020 gctacactag aagaaatgat gacagcatgt cagggagtag gaggacccgg ccataaggca 1080 agagttttgg ctgaagcaat gagccaagta acaaattcag ctaccataat gatgcagaga 1140 ggcaatttta ggaaccaaag aaagattgtt aagtgtttca attgtggcaa agaagggcac 1200 acagccagaa attgcagggc ccctaggaaa aagggctgtt ggaaatgtgg aaaggaagga 1260 caccaaatga aagattgtac tgagagacag gctaattttt tagggaagat ctggccttcc 1320 tacaagggaa ggccagggaa ttttcttcag agcagaccag agccaacagc cccaccagaa 1380 gagagcttca ggtctggggt agagacaaca actccccctc agaagcagga gccgatagac 1440 aaggaactgt atcctttaac ttccctcaga tcactctttg gcaacgaccc ctcgtcacaa 1500 taaagatagg ggggcaacta aaggaagctc tattagatac aggagcagat gatacagtat 1560 tagaagaaat gagtttgcca ggaagatgga aaccaaaaat gataggggga attggaggtt 1620 ttatcaaagt aagacagtat gatcagatac tcatagaaat ctgtggacat aaagctatag 1680 gtacagtatt agtaggacct acacctgtca acataattgg aagaaatctg ttgactcaga 1740 ttggttgcac tttaaatttt cccattagcc ctattgagac tgtaccagta aaattaaagc 1800 caggaatgga tggcccaaaa gttaaacaat ggccattgac agaagaaaaa ataaaagcat 1860 tagtagaaat ttgtacagaa atggaaaagg aagggaaaat ttcaaaaatt gggcctgaga 1920 atccatacaa tactccagta tttgccataa agaaaaaaga cagtactaaa tggaggaaat 1980 tagtagattt cagagaactt aataagagaa ctcaagactt ctgggaagtt caattaggaa 2040 taccacatcc cgcagggtta aaaaagaaaa aatcagtaac agtactggat gtgggtgatg 2100 catatttttc agttccctta gatgaagact tcaggaagta tactgcattt accataccta 2160 gtataaacaa tgagacacca gggattagat atcagtacaa tgtgcttcca cagggatgga 2220 aaggatcacc agcaatattc caaagtagca tgacaaaaat cttagagcct tttaaaaaac 2280 aaaatccaga catagttatc tatcaataca tgaacgattt gtatgtagga tctgacttag 2340 aaatagggca gcatagaaca aaaatagagg agctgagaca acatctgttg aggtggggac 2400 ttaccacacc agacaaaaaa catcagaaag aacctccatt cctttggatg ggttatgaac 2460 tccatcctga taaatggaca gtacagccta tagtgctgcc agaaaaagac agctggactg 2520 tcaatgacat acagaagtta gtggggaaat tgaataccgc aagtcagatt tacccaggga 2580 ttaaagtaag gcaattatgt aaactcctta gaggaaccaa agcactaaca gaagtaatac 2640 cactaacaga agaagcagag ctagaactgg cagaaaacag agagattcta aaagaaccag 2700 tacatggagt gtattatgac ccatcaaaag acttaatagc agaaatacag aagcaggggc 2760 aaggccaatg gacatatcaa atttatcaag agccatttaa aaatctgaaa acaggaaaat 2820 atgcaagaat gaggggtgcc cacactaatg atgtaaaaca attaacagag gcagtgcaaa 2880 aaataaccac agaaagcata gtaatatggg gaaagactcc taaatttaaa ctacccatac 2940 aaaaggaaac atgggaaaca tggtggacag agtattggca agccacctgg attcctgagt 3000 gggagtttgt taatacccct cctttagtga aattatggta ccagttagag aaagaaccca 3060 tagtaggagc agaaaccttc tatgtagatg gggcagctaa cagggagact aaattaggaa 3120 aagcaggata tgttactaac aaaggaagac aaaaggttgt ccccctaact aacacaacaa 3180 atcagaaaac tcagttacaa gcaatttatc tagctttgca ggattcagga ttagaagtaa 3240 acatagtaac agactcacaa tatgcattag gaatcattca agcacaacca gataaaagtg 3300 aatcagagtt agtcaatcaa ataatagagc agttaataaa aaaggaaaag gtctatctgg 3360 catgggtacc agcacacaaa ggaattggag gaaatgaaca agtagataaa ttagtcagtg 3420 ctggaatcag gaaaatacta tttttagatg gaatagataa ggcccaagat gaacattag 3479 6 9 PRT Simian Immunodeficiency virus 6 Cys Thr Pro Tyr Asp Ile Asn Gln Met 1 5 7 8 PRT Chicken 7 Ser Ile Ile Asn Phe Glu Lys Leu 1 5 8 20 DNA Artificial Sequence probe 8 ctgtctgcgt catttggtgc 20 9 4 PRT Human immunodeficiency Virus VARIANT (1)...(4) Xaa = Any Amino Acid 9 Tyr Xaa Xaa Leu 1 10 93 DNA Artificial Sequence m7.5 promoter 10 cgctttttat agtaagtttt tcacccataa ataataaata caataattaa tttctcgtaa 60 aaattgaaaa actattctaa tttattgcac ggt 93 11 74 DNA Artificial Sequence Psyn III promoter 11 taaaaattga aaaaatattc taatttatag gacggttttg attttctttt tttctatact 60 ataaataata aata 74 12 74 DNA Artificial Sequence Psyn IV promoter 12 taaaaattga aaaactattc taatttatag gacggttttg attttctttt tttctatact 60 ataaataata aata 74 13 75 DNA Artificial Sequence Psyn V promoter 13 aaaaaatgat aaagtaggtt cagttttatt gctggtttaa aatcacgctt tcgagtaaaa 60 actacgaata taaat 75

Claims (30)

What is claimed is:
1. A pharmaceutical composition comprising a recombinant MVA virus expressing an HIV env, gag, and pol gene or modified gene thereof for production of an HIV Env, Gag, and Pol antigen by expression from said recombinant MVA virus, wherein said HIV env gene is modified to encode an HIV Env protein composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacking part or all of the cytoplasmic domain of gp41, and a pharmaceutically acceptable carrier.
2. The pharmaceutical composition of claim 1, wherein said HIV pol gene or modified gene thereof is modified to inactivate reverse transcriptase and integrase.
3. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade A.
4. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade B.
5. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade C.
6. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade D.
7. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade E.
8. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade F.
9. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade G.
10. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade H.
11. The pharmaceutical composition of claim 1, wherein said HIV env, gag, or pol gene or modified gene thereof is taken from clade J.
12. The pharmaceutical composition of claim 1 wherein said HIV env, gag, or pol gene or modified gene thereof is inserted at the site of deletion III within the MVA genome.
13. The pharmaceutical composition of claim 1 wherein said HIV env, gag, or pol gene or modified gene thereof is under transcriptional initiation regulation of a H5-like early/late vaccinia virus promoter.
14. The pharmaceutical composition of claim 1 wherein recombinant MVA virus additionally expresses an additional HIV gene or modified gene thereof for production of an HIV antigen by expression from said recombinant MVA virus, wherein said additional HIV gene is a member selected from the group consisting of vif, vpr, tat, rev, vpu, and nef.
15. MVA/HIV48 comprising SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5.
16. pLW-48 having SEQ ID NO:1.
17. A plasmid transfer vector having the sequence of pLW-48 (SEQ ID NO:1) excluding the HIV env, gag, and pol genes.
18. pLW-48 (SEQ ID NO:1) wherein the HIV env, gag, and pol genes have a sequence taken from another clade.
19. A poxvirus comprising a promoter selected from the group consisting of m7.5 promoter having SEQ ID NO:10, Psyn II promoter having SEQ ID NO:2, Psyn III promoter having SEQ ID NO:11, Psyn IV promoter having SEQ ID NO:12, and Psyn V promoter having SEQ ID NO:13.
20. A method of boosting a CD8+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of any of claims 1-15, whereby a CD8+ T cell immune response to the antigen previously primed in the primate is boosted.
21. The method of claim 20, wherein the primate is a human.
22. The method of claim 20, wherein administration of the recombinant MVA virus is by needleless injection.
23. A method of inducing a CD8+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a composition of any of claims 1-15, whereby a CD8+ T cell immune response to the antigen in the primate is induced.
24. The method of claim 23, wherein the primate is a human.
25. The method of claim 23, wherein administration of the recombinant MVA virus is by needleless injection.
26. A method of inducing a CD8+ T cell immune response to an HIV Env, Gag, or Pol antigen in a primate, the method comprising provision in the primate of a priming composition comprising nucleic acid encoding said antigen and then provision in the primate of a boosting composition which comprises any of claims 1-15, whereby a CD8+ T cell immune response to the antigen is induced.
27. The method of claim 26, wherein the primate is a human.
28. The method of claim 26, wherein administration of the recombinant MVA virus is by needleless injection.
29. The method of claim 26, wherein the priming composition comprises plasmid DNA encoding said antigen.
30. A method of making a composition of any of claims 1-15 comprising preparing a plasmid transfer vector encoding an HIV env, gag, and pol gene or modified gene thereof, wherein said HIV env gene is modified to encode an HIV Env protein composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacking part or all of the cytoplasmic domain of gp41, and recombining said plasmid transfer vector with a MVA virus to produce a composition of any of claims 1-15.
US10/646,628 2001-03-08 2003-08-22 MVA expressing modified HIV envelope, gag, and pol genes Abandoned US20040146528A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US10/646,628 US20040146528A1 (en) 2001-03-08 2003-08-22 MVA expressing modified HIV envelope, gag, and pol genes
US12/018,150 US7867982B2 (en) 2001-03-08 2008-01-22 MVA expressing modified HIV envelope, gag, and pol genes
US12/987,791 US8916172B2 (en) 2001-03-08 2011-01-10 MVA expressing modified HIV envelope, gag, and pol genes
US14/566,066 US20150238593A1 (en) 2001-03-08 2014-12-10 Mva expressing modified hiv envelope, gag and pol genes

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US27443401P 2001-03-08 2001-03-08
PCT/US2002/006713 WO2002072754A2 (en) 2001-03-08 2002-03-01 Mva expressing modified hiv envelope, gag, and pol genes
US10/646,628 US20040146528A1 (en) 2001-03-08 2003-08-22 MVA expressing modified HIV envelope, gag, and pol genes

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/006713 Continuation WO2002072754A2 (en) 2000-03-02 2002-03-01 Mva expressing modified hiv envelope, gag, and pol genes

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/018,150 Continuation US7867982B2 (en) 2001-03-08 2008-01-22 MVA expressing modified HIV envelope, gag, and pol genes

Publications (1)

Publication Number Publication Date
US20040146528A1 true US20040146528A1 (en) 2004-07-29

Family

ID=23048178

Family Applications (4)

Application Number Title Priority Date Filing Date
US10/646,628 Abandoned US20040146528A1 (en) 2001-03-08 2003-08-22 MVA expressing modified HIV envelope, gag, and pol genes
US12/018,150 Expired - Fee Related US7867982B2 (en) 2001-03-08 2008-01-22 MVA expressing modified HIV envelope, gag, and pol genes
US12/987,791 Expired - Fee Related US8916172B2 (en) 2001-03-08 2011-01-10 MVA expressing modified HIV envelope, gag, and pol genes
US14/566,066 Abandoned US20150238593A1 (en) 2001-03-08 2014-12-10 Mva expressing modified hiv envelope, gag and pol genes

Family Applications After (3)

Application Number Title Priority Date Filing Date
US12/018,150 Expired - Fee Related US7867982B2 (en) 2001-03-08 2008-01-22 MVA expressing modified HIV envelope, gag, and pol genes
US12/987,791 Expired - Fee Related US8916172B2 (en) 2001-03-08 2011-01-10 MVA expressing modified HIV envelope, gag, and pol genes
US14/566,066 Abandoned US20150238593A1 (en) 2001-03-08 2014-12-10 Mva expressing modified hiv envelope, gag and pol genes

Country Status (13)

Country Link
US (4) US20040146528A1 (en)
EP (1) EP1372710B1 (en)
JP (2) JP4554887B2 (en)
CN (1) CN100446812C (en)
AT (1) ATE445411T1 (en)
AU (1) AU2002252199B2 (en)
CA (1) CA2454959C (en)
CY (1) CY1109659T1 (en)
DE (1) DE60234018D1 (en)
DK (1) DK1372710T3 (en)
ES (1) ES2334335T3 (en)
PT (1) PT1372710E (en)
WO (1) WO2002072754A2 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060134133A1 (en) * 2003-03-28 2006-06-22 Bernard Moss MVA expressing modified HIV envelope, Gag, and Pol genes
US20080274992A1 (en) * 2007-03-26 2008-11-06 Jean-Louis Excler Recombinant modified ankara viral hiv-1 vaccines
US20090060947A1 (en) * 2006-05-19 2009-03-05 Sanofi Pasteur, Inc. Immunological compositions
WO2009145853A1 (en) * 2008-04-16 2009-12-03 Virostatics Srl Novel assay for precursor t-cells having high proliferative capacity (phpc-assay)
CN101394868B (en) * 2006-03-07 2011-08-10 浙江海正药业股份有限公司 Strong immune induction by using combination of adenovirus type-5/type-35 vector and vaccinia virus mva vector
WO2012137071A2 (en) 2011-04-06 2012-10-11 Biovaxim Limited Pharmaceutical compositions for preventing and/or treating an hiv disease in humans
WO2017143016A1 (en) * 2016-02-16 2017-08-24 Geovax Inc. Multivalent hiv vaccine boost compositions and methods of use

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001092470A2 (en) 2000-03-02 2001-12-06 Emory University Dna expression vectors and methods of use
US8623379B2 (en) * 2000-03-02 2014-01-07 Emory University Compositions and methods for generating an immune response
PT1372710E (en) 2001-03-08 2009-12-21 Us Gov Health & Human Serv Mva expressing modified hiv envelope, gag, and pol genes
AU2003220111B2 (en) * 2002-03-08 2008-07-31 Emory University Compositions and methods for generating an immune response
CN1490056A (en) * 2002-10-18 2004-04-21 ��¡���ɵ°��̲��о����� Immunization methods and compositions against HIV-1
AU2004279362B2 (en) 2003-09-15 2011-03-17 Genvec, Inc. HIV vaccines based on ENV of multiple clades of HIV
DE602004009743T2 (en) * 2003-11-24 2008-08-28 Bavarian Nordic A/S Promoters for expression in modified vaccinia virus Ankara
CN1304580C (en) * 2004-07-09 2007-03-14 楼伟 Surface glucoprotein gp160 of recombination expression human acquired immunity defact virus 1
ATE527281T1 (en) 2004-07-16 2011-10-15 Us Gov Health & Human Serv VACCINES AGAINST AIDS COMPRISING CMV/R NUCLEIC ACID CONSTRUCTS
AU2012202786B8 (en) * 2004-08-27 2015-05-21 Emory University Recombinant MVA viruses expressing Clade A/G, Clade B, and Clade C modified HIV ENV, GAG and POL genes
ES2539010T3 (en) * 2004-08-27 2015-06-25 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Recombinant MVA viruses expressing HIV env, gag and pol modified HIV clade A / G, clade B, and clade C genes
ES2281252B1 (en) * 2005-07-27 2009-02-16 Consejo Superior De Investigaciones Cientificas RECOMBINANT VECTORS BASED ON THE MODIFIED ANKARA VIRUS (MVA) AS PREVENTIVE AND THERAPEUTIC VACCINES AGAINST AIDS.
FR2893254B1 (en) * 2005-11-14 2007-12-21 Biomerieux Sa COMPOSITION COMPRISING A BIORESORBABLE COLLOIDAL SYNTHETIC VECTOR AND A VIRAL VECTOR AND ITS PROPHYLACTIC, THERAPEUTIC AND DIAGNOSTIC USE.
CN101020052A (en) * 2006-02-16 2007-08-22 中国疾病预防控制中心性病艾滋病预防控制中心 AIDS vaccine based on replicative vaccinia virus vector
EP2042604A1 (en) * 2007-09-26 2009-04-01 Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) VV promoter driven overexpression of recombinant antigens
EP2337581B1 (en) * 2008-09-10 2017-08-23 Institut National De La Sante Et De La Recherche Medicale Synthetic gene coding for the gag protein of hiv-1 and use thereof for obtaining anti-hiv-1 vaccines
AP2012006258A0 (en) * 2009-10-13 2012-06-30 Geovax Inc Eliciting immune responses using recombinant MVA viruses expressing HIV ENV, GAG and POL antigens.
KR101472645B1 (en) 2010-05-19 2014-12-15 신닛테츠스미킨 카부시키카이샤 Method for press-forming l-shaped components
WO2014018850A2 (en) * 2012-07-27 2014-01-30 The Trustees Of The University Of Pennsylvania Cytoplasmic tail modifications to boost surface expression and immunogenicity of envelope glycoproteins
WO2016068919A1 (en) 2014-10-29 2016-05-06 Geovax, Inc. Combination therapy for treating viral reservoirs
US11701418B2 (en) 2015-01-12 2023-07-18 Geovax, Inc. Replication-deficient modified vaccinia Ankara (MVA) expressing Ebola virus glycoprotein (GP) and matrix protein (VP40)
CA3011014A1 (en) 2016-01-08 2017-07-13 Geovax, Inc. Compositions and methods for generating an immune response to a tumor associated antigen
WO2017136419A1 (en) 2016-02-03 2017-08-10 Geovax Inc. Compositions and methods for generating an immune response to a flavivirus
WO2018195447A1 (en) * 2017-04-20 2018-10-25 Geovax Labs, Inc. Recombinant mva-based hiv immunogens and uses thereof
WO2019018501A1 (en) * 2017-07-18 2019-01-24 Geovax Inc. Compositions and methods for generating an immune response to lasv
US11311612B2 (en) 2017-09-19 2022-04-26 Geovax, Inc. Compositions and methods for generating an immune response to treat or prevent malaria
IL295482A (en) 2020-02-14 2022-10-01 Geovax Inc Vaccines and uses thereof to induce an immune response to sars-cov2

Citations (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5169763A (en) * 1986-04-08 1992-12-08 Transgene S.A., Institut Pasteur Viral vector coding glycoprotein of HIV-1
US5185146A (en) * 1988-01-12 1993-02-09 Hoffmann-Laroche Inc. Recombinant mva vaccinia virus
US5256767A (en) * 1987-06-10 1993-10-26 The Immune Response Corporation Retroviral antigens
US5445953A (en) * 1991-08-26 1995-08-29 Immuno Aktiengesellschaft Direct molecular cloning of a modified poxvirus genome
US5494807A (en) * 1991-03-07 1996-02-27 Virogenetics Corporation NYVAC vaccinia virus recombinants comprising heterologous inserts
US5589466A (en) * 1989-03-21 1996-12-31 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization
US5614404A (en) * 1988-06-10 1997-03-25 Theriod Biologics, Incorporated Self-assembled, defective, non-self-propagating lentivirus particles
US5676950A (en) * 1994-10-28 1997-10-14 University Of Florida Enterically administered recombinant poxvirus vaccines
US5736368A (en) * 1988-06-10 1998-04-07 Therion Biologics Corporation Self assembled defective non-self propagating lentiviral particles
US5741492A (en) * 1996-01-23 1998-04-21 St. Jude Children's Research Hospital Preparation and use of viral vectors for mixed envelope protein vaccines against human immunodeficiency viruses
US5747338A (en) * 1996-08-15 1998-05-05 Chiron Corporation Method and construct for screening for inhibitors of transcriptional activation
US5846946A (en) * 1996-06-14 1998-12-08 Pasteur Merieux Serums Et Vaccins Compositions and methods for administering Borrelia DNA
US5849304A (en) * 1986-04-08 1998-12-15 The United States Of America As Represented By The Department Of Health And Human Services Recombinant vaccinia virus expressing human retrovirus gene
US5858775A (en) * 1994-06-06 1999-01-12 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5863542A (en) * 1991-03-07 1999-01-26 Virogenetics Corporation Recombinant attenuated ALVAC canaryopox virus containing heterologous HIV or SIV inserts
US5879925A (en) * 1994-08-15 1999-03-09 Connaught Laboratories Limited Genetically engineered human immunodeficiency virus-like particles with modified chimeric envelope glycoproteins containing influenza virus transmembrane spanning domains
US5911989A (en) * 1995-04-19 1999-06-15 Polynum Scientific Immunbiologische Forschung Gmbh HIV-vaccines
US5985641A (en) * 1989-10-13 1999-11-16 Connaught Laboratories Limited Non-infectious, replication-impaired, immunogenic human immunodeficiency virus type 1 retrovirus-like particles with multiple genetic deficiencies
US6077662A (en) * 1996-11-27 2000-06-20 Emory University Virus-like particles, methods and immunogenic compositions
US6080408A (en) * 1994-08-22 2000-06-27 Connaught Laboratories Limited Human immunodeficiency virus type 1 nucleic acids devoid of long terminal repeats capable of encoding for non-infectious, immunogenic, retrovirus-like particles
US6099847A (en) * 1997-05-15 2000-08-08 The United States Of America As Represented By The Department Of Health And Human Services Chimeric Gag pseudovirions
US6103244A (en) * 1991-08-26 2000-08-15 Immuno Ag. Methods for generating immune responses employing modified vaccinia of fowlpox viruses
US6121021A (en) * 1997-12-16 2000-09-19 Connaught Laboratories Limited Constitutive expression of non-infectious HIV-like particles
US6140114A (en) * 1996-04-05 2000-10-31 Universite Pierre Et Marie Curie (Paris Vi) Defective viral vaccine particles obtained in vivo or ex vivo
US6156952A (en) * 1998-04-09 2000-12-05 Constituent Institution Of The University Of Maryland System HIV transgenic animals and uses therefor
US6171596B1 (en) * 1993-12-10 2001-01-09 The United States Of America As Represented By The Department Of Health And Human Services Oligomeric HIV-1 envelope glycoproteins
US6201663B1 (en) * 1996-09-05 2001-03-13 Kabushiki Kaisha Ohara Magnetic head having a slider made of a glass-ceramic
US6204250B1 (en) * 1996-11-22 2001-03-20 The Mount Sinai Medical Center Of The City Of New York Immunization of infants
US6214804B1 (en) * 1989-03-21 2001-04-10 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US6291157B1 (en) * 1998-02-23 2001-09-18 Connaught Laboratories Limited Antigenically-marked non-infectious retrovirus-like particles
US6306625B1 (en) * 1988-12-30 2001-10-23 Smithkline Beecham Biologicals, Sa Method for obtaining expression of mixed polypeptide particles in yeast
US6448083B1 (en) * 1997-08-29 2002-09-10 Selective Genetics, Inc. Receptor-mediated gene delivery using bacteriophage vectors
US6554527B1 (en) * 1998-05-13 2003-04-29 Altronic Distributors Pty. Ltd. Mounting assembly

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1340729C (en) 1988-03-23 1999-09-07 Mohan Bir Singh Ryegrass pollen allergen
IL89567A0 (en) 1988-03-28 1989-09-10 Univ Leland Stanford Junior Mutated hiv envelope protein
WO1989012095A1 (en) * 1988-06-10 1989-12-14 Applied Biotechnology, Inc. A method of evaluating recombinant vaccines against immunodeficiency virus
WO1991007425A1 (en) * 1989-11-20 1991-05-30 Oncogen Limited Partnership Non-replicating recombinant-made retroviral particles used as antiviral agents and immunogens
IE71643B1 (en) * 1990-11-20 1997-02-26 Virogenetics Corp A recombinant poxviral vaccine for canine distemper
EP1380651A2 (en) * 1991-08-26 2004-01-14 Baxter Healthcare S.A. Recombinant fowlpox virus with intact FPV-tk-gene
GB9711957D0 (en) 1997-06-09 1997-08-06 Isis Innovation Methods and reagents for vaccination
DE19726167B4 (en) 1997-06-20 2008-01-24 Sanofi-Aventis Deutschland Gmbh Insulin, process for its preparation and pharmaceutical preparation containing it
GB2337755B (en) * 1998-05-29 2003-10-29 Secr Defence Virus vaccine
US6641816B1 (en) 1998-06-26 2003-11-04 Aventis Pasteur S.A. Use of poxviruses as enhancer of specific immunity
WO2000011140A1 (en) 1998-08-20 2000-03-02 The Wistar Institute Of Anatomy And Biology Methods of augmenting mucosal immunity through systemic priming and mucosal boosting
WO2001002607A1 (en) 1999-07-06 2001-01-11 Merck & Co., Inc. Adenovirus carrying gag gene hiv vaccine
US6256183B1 (en) * 1999-09-09 2001-07-03 Ferraz Shawmut Inc. Time delay fuse with mechanical overload device and indicator actuator
WO2001047955A2 (en) * 1999-12-23 2001-07-05 Medical Research Council Improvements in or relating to immune responses to hiv
AUPQ520800A0 (en) 2000-01-21 2000-02-17 Alfred Hospital Prime-boost vaccination strategy
WO2001092470A2 (en) * 2000-03-02 2001-12-06 Emory University Dna expression vectors and methods of use
EP1280551B1 (en) 2000-04-27 2007-01-10 Sanofi Pasteur Limited Vaccines against hiv infection
PT1372710E (en) 2001-03-08 2009-12-21 Us Gov Health & Human Serv Mva expressing modified hiv envelope, gag, and pol genes
US20030198621A1 (en) 2001-07-05 2003-10-23 Megede Jan Zur Polynucleotides encoding antigenic HIV type B and/or type C polypeptides, polypeptides and uses thereof

Patent Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5169763A (en) * 1986-04-08 1992-12-08 Transgene S.A., Institut Pasteur Viral vector coding glycoprotein of HIV-1
US5849304A (en) * 1986-04-08 1998-12-15 The United States Of America As Represented By The Department Of Health And Human Services Recombinant vaccinia virus expressing human retrovirus gene
US5256767A (en) * 1987-06-10 1993-10-26 The Immune Response Corporation Retroviral antigens
US5928930A (en) * 1987-06-10 1999-07-27 Immune Response Corporation Prevention and treatment of retroviral disease
US5853725A (en) * 1987-06-10 1998-12-29 The Immune Response Corporation Prevention and treatment of retroviral disease
US5185146A (en) * 1988-01-12 1993-02-09 Hoffmann-Laroche Inc. Recombinant mva vaccinia virus
US5747324A (en) * 1988-06-10 1998-05-05 Therion Biologics Corporation Self-assembled, defective, non-self-propagating lentivirus particles
US5614404A (en) * 1988-06-10 1997-03-25 Theriod Biologics, Incorporated Self-assembled, defective, non-self-propagating lentivirus particles
US5736368A (en) * 1988-06-10 1998-04-07 Therion Biologics Corporation Self assembled defective non-self propagating lentiviral particles
US6051410A (en) * 1988-06-10 2000-04-18 Therion Biologics, Corp. Self-assembled, defective, nonself-propagating viral particles
US6306625B1 (en) * 1988-12-30 2001-10-23 Smithkline Beecham Biologicals, Sa Method for obtaining expression of mixed polypeptide particles in yeast
US6214804B1 (en) * 1989-03-21 2001-04-10 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US5589466A (en) * 1989-03-21 1996-12-31 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US5985641A (en) * 1989-10-13 1999-11-16 Connaught Laboratories Limited Non-infectious, replication-impaired, immunogenic human immunodeficiency virus type 1 retrovirus-like particles with multiple genetic deficiencies
US5756103A (en) * 1991-03-07 1998-05-26 Virogenetics Corporation Alvac canarypox virus recombinants comprising heterlogous inserts
US5766599A (en) * 1991-03-07 1998-06-16 Virogenetics Corporation Trova fowl pox virus recombinants comprising heterologous inserts
US5494807A (en) * 1991-03-07 1996-02-27 Virogenetics Corporation NYVAC vaccinia virus recombinants comprising heterologous inserts
US5863542A (en) * 1991-03-07 1999-01-26 Virogenetics Corporation Recombinant attenuated ALVAC canaryopox virus containing heterologous HIV or SIV inserts
US6103244A (en) * 1991-08-26 2000-08-15 Immuno Ag. Methods for generating immune responses employing modified vaccinia of fowlpox viruses
US5445953A (en) * 1991-08-26 1995-08-29 Immuno Aktiengesellschaft Direct molecular cloning of a modified poxvirus genome
US6265183B1 (en) * 1991-08-26 2001-07-24 Baxter Aktiengesellschaft Direct molecular cloning of foreign genes into poxviruses and methods for the preparation of recombinant proteins
US5817637A (en) * 1993-01-26 1998-10-06 The Trustees Of The University Of Pennsylvania Genetic immunization
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization
US6171596B1 (en) * 1993-12-10 2001-01-09 The United States Of America As Represented By The Department Of Health And Human Services Oligomeric HIV-1 envelope glycoproteins
US5858775A (en) * 1994-06-06 1999-01-12 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5879925A (en) * 1994-08-15 1999-03-09 Connaught Laboratories Limited Genetically engineered human immunodeficiency virus-like particles with modified chimeric envelope glycoproteins containing influenza virus transmembrane spanning domains
US6080408A (en) * 1994-08-22 2000-06-27 Connaught Laboratories Limited Human immunodeficiency virus type 1 nucleic acids devoid of long terminal repeats capable of encoding for non-infectious, immunogenic, retrovirus-like particles
US5676950A (en) * 1994-10-28 1997-10-14 University Of Florida Enterically administered recombinant poxvirus vaccines
US5911989A (en) * 1995-04-19 1999-06-15 Polynum Scientific Immunbiologische Forschung Gmbh HIV-vaccines
US5741492A (en) * 1996-01-23 1998-04-21 St. Jude Children's Research Hospital Preparation and use of viral vectors for mixed envelope protein vaccines against human immunodeficiency viruses
US6086891A (en) * 1996-01-23 2000-07-11 St. Jude Children's Research Hospital Bi-functional plasmid that can act as both a DNA vaccine and a recombinant virus vector
US6140114A (en) * 1996-04-05 2000-10-31 Universite Pierre Et Marie Curie (Paris Vi) Defective viral vaccine particles obtained in vivo or ex vivo
US5846946A (en) * 1996-06-14 1998-12-08 Pasteur Merieux Serums Et Vaccins Compositions and methods for administering Borrelia DNA
US5747338A (en) * 1996-08-15 1998-05-05 Chiron Corporation Method and construct for screening for inhibitors of transcriptional activation
US6201663B1 (en) * 1996-09-05 2001-03-13 Kabushiki Kaisha Ohara Magnetic head having a slider made of a glass-ceramic
US6204250B1 (en) * 1996-11-22 2001-03-20 The Mount Sinai Medical Center Of The City Of New York Immunization of infants
US6077662A (en) * 1996-11-27 2000-06-20 Emory University Virus-like particles, methods and immunogenic compositions
US6099847A (en) * 1997-05-15 2000-08-08 The United States Of America As Represented By The Department Of Health And Human Services Chimeric Gag pseudovirions
US6448083B1 (en) * 1997-08-29 2002-09-10 Selective Genetics, Inc. Receptor-mediated gene delivery using bacteriophage vectors
US6121021A (en) * 1997-12-16 2000-09-19 Connaught Laboratories Limited Constitutive expression of non-infectious HIV-like particles
US6291157B1 (en) * 1998-02-23 2001-09-18 Connaught Laboratories Limited Antigenically-marked non-infectious retrovirus-like particles
US6156952A (en) * 1998-04-09 2000-12-05 Constituent Institution Of The University Of Maryland System HIV transgenic animals and uses therefor
US6554527B1 (en) * 1998-05-13 2003-04-29 Altronic Distributors Pty. Ltd. Mounting assembly

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110159036A1 (en) * 2003-03-28 2011-06-30 Bernard Moss MVA expressing modified HIV envelope, GAG, and POL genes
US7303754B2 (en) 2003-03-28 2007-12-04 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services MVA expressing modified HIV envelope, gag, and pol genes
US20060134133A1 (en) * 2003-03-28 2006-06-22 Bernard Moss MVA expressing modified HIV envelope, Gag, and Pol genes
CN101394868B (en) * 2006-03-07 2011-08-10 浙江海正药业股份有限公司 Strong immune induction by using combination of adenovirus type-5/type-35 vector and vaccinia virus mva vector
US20090060947A1 (en) * 2006-05-19 2009-03-05 Sanofi Pasteur, Inc. Immunological compositions
WO2008118936A3 (en) * 2007-03-26 2008-12-04 Int Aids Vaccine Initiative Method of elicting immune response with a modified mva viral hiv-1 vector
US20080274992A1 (en) * 2007-03-26 2008-11-06 Jean-Louis Excler Recombinant modified ankara viral hiv-1 vaccines
WO2009145853A1 (en) * 2008-04-16 2009-12-03 Virostatics Srl Novel assay for precursor t-cells having high proliferative capacity (phpc-assay)
WO2012137071A2 (en) 2011-04-06 2012-10-11 Biovaxim Limited Pharmaceutical compositions for preventing and/or treating an hiv disease in humans
EP3000476A1 (en) 2011-04-06 2016-03-30 Biovaxim Limited Pharmaceutical compositions for preventing and/or treating an hiv disease in humans
WO2017143016A1 (en) * 2016-02-16 2017-08-24 Geovax Inc. Multivalent hiv vaccine boost compositions and methods of use
US11098086B2 (en) 2016-02-16 2021-08-24 Geovax Inc. Multivalent HIV vaccine boost compositions and methods of use
US11897919B2 (en) 2016-02-16 2024-02-13 Geovax, Inc. Multivalent HIV vaccine boost compositions and methods of use

Also Published As

Publication number Publication date
EP1372710B1 (en) 2009-10-14
ATE445411T1 (en) 2009-10-15
CY1109659T1 (en) 2014-08-13
CN100446812C (en) 2008-12-31
EP1372710A4 (en) 2005-04-27
US7867982B2 (en) 2011-01-11
DE60234018D1 (en) 2009-11-26
WO2002072754A2 (en) 2002-09-19
WO2002072754A9 (en) 2003-01-03
US20110104199A1 (en) 2011-05-05
CA2454959C (en) 2018-07-10
EP1372710A2 (en) 2004-01-02
US8916172B2 (en) 2014-12-23
AU2002252199B2 (en) 2008-01-03
ES2334335T3 (en) 2010-03-09
PT1372710E (en) 2009-12-21
CA2454959A1 (en) 2002-09-19
WO2002072754A3 (en) 2003-05-22
CN1638795A (en) 2005-07-13
DK1372710T3 (en) 2010-01-18
US20090074726A1 (en) 2009-03-19
JP2004537974A (en) 2004-12-24
US20150238593A1 (en) 2015-08-27
JP4554887B2 (en) 2010-09-29
JP2010115208A (en) 2010-05-27

Similar Documents

Publication Publication Date Title
CA2454959C (en) Mva expressing modified hiv envelope, gag, and pol genes
EP1610816B1 (en) Mva virus expressing modified hiv envelope, gag, and pol genes
AU2002252199A1 (en) MVA expressing modified HIV envelope, GAG, and POL genes
CA2578403C (en) Recombinant mva viruses expressing clade a/g, clade b, and clade c modified hiv env, gag and pol genes
JP2011231112A (en) Composition and method for generating immune response
AU2012202786B8 (en) Recombinant MVA viruses expressing Clade A/G, Clade B, and Clade C modified HIV ENV, GAG and POL genes

Legal Events

Date Code Title Description
AS Assignment

Owner name: GOVERNMENT OF THE UNITED STATES OF AMERICA, AS REP

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MOSS, BERNARD;WYATT, LINDA;EARL, PATRICIA;REEL/FRAME:014974/0687

Effective date: 20040202

Owner name: EMORY UNIVERSITY, GEORGIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ROBINSON, HARRIET L.;REEL/FRAME:014975/0742

Effective date: 20040116

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:EMORY UNIVERSITY;REEL/FRAME:021262/0050

Effective date: 20040618

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH -DIRECTOR DEITR, MAR

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:EMORY UNIVERSITY;REEL/FRAME:037880/0754

Effective date: 20160303