AU2003220111B2 - Compositions and methods for generating an immune response - Google Patents
Compositions and methods for generating an immune response Download PDFInfo
- Publication number
- AU2003220111B2 AU2003220111B2 AU2003220111A AU2003220111A AU2003220111B2 AU 2003220111 B2 AU2003220111 B2 AU 2003220111B2 AU 2003220111 A AU2003220111 A AU 2003220111A AU 2003220111 A AU2003220111 A AU 2003220111A AU 2003220111 B2 AU2003220111 B2 AU 2003220111B2
- Authority
- AU
- Australia
- Prior art keywords
- hiv
- vectors
- clade
- pga2
- sequences
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24141—Use of virus, viral particle or viral elements as a vector
- C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Description
WO 03/076591 PCT/US03/07177 COMPOSITIONS AND METHODS FOR GENERATING AN IMMUNE RESPONSE RELATED APPLICATIONS This application is a continuation-in-part ofU.S.S.N. 10/093,953, which was filed on March 8, 2002, and which is a continuation-in-part ofU.S.S.N. 09/798,675, which was filed on March 2, 2001, and which claims the benefit of the filing dates of four provisional applications 60/251,083, filed December 1, 2000, U.S.S.N. 60/186,364, filed March 2, 2000, U.S.S.N. 60/324,845, filed September 25, 2001, and U.S.S.N. 60/325,004, filed September 26, 2001) and the benefit of the filing date of International Application No. PCT/US01/06795, which was filed on March 2, 2001, and which was published in English under International Publication No. WO 01/92470 on December 6, 2001. The contents of all earlier filed applications listed above are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION The present invention is directed generally to the fields of molecular genetics and immunology. More particularly, the present invention features expression vectors and methods of administering those vectors to animals.
GOVERNMENT SUPPORT The work described herein was supported, at least in part, by grants from the National Institutes of Health (P01 AI43045, P01 AI49364, and R21 AI44325). The United States Government may therefore have certain rights in this invention.
BACKGROUND OF THE INVENTION Vaccines have had profound and long lasting effects on world health. Smallpox has been eradicated, polio is near elimination, and diseases such as diphtheria, measles, mumps, pertussis, and tetanus are contained. Nonetheless, current vaccines address only a handful of the infections suffered by people and domesticated animals. Common infectious diseases for which there are no vaccines cost the United States alone about $120 billion dollars per year (Robinson et al., American Academy of Microbiology, May 31 June 2, 1996). In first world countries, emerging infections such as immunodeficiency viruses, as well as reemerging WO 03/076591 PCT/US03/07177 diseases like drug resistant forms of tuberculosis, pose new threats and challenges for vaccine development. The need for both new and improved vaccines is even more pronounced in third world countries where effective vaccines are often unavailable or cost-prohibitive.
The prevalence of HIV-1 infection has made vaccine development for this recently emergent agent a high priority for world health. Pre-clinical trials on DNA vaccines have demonstrated that DNA alone can protect against highly attenuated HIV-1 challenges in chimpanzees (Boyer et al., Nature Med. 3:526-532, 1997), but not against more virulent SIV challenges in macaques (Lu et al., Vaccine 15:920-923, 1997). A combination of DNA priming plus an envelope glycoprotein boost has raised neutralizing antibody-associated protection against a homologous challenge with a non-pathogenic chimera between SIV and HIV (SHIV-IIIB) (Letvin et al., Proc. Natl. Acad. Sci. USA 94:9378-9383, 1997). A comparative trial testing eight different protocols for the ability to protect against a series of challenges with SHIVs (chimeras between simian and human immunodeficiency viruses) revealed the best containment of challenge infections by an immunization protocol that included priming by intradermal inoculation of DNA and boosting with recombinant fowl pox virus vectors (Robinson et al., Nature Med. 5:526, 1999). This containment of challenge infections was independent of the presence of neutralizing antibody to the challenge virus. Despite these and many other efforts, a vaccine for containing HIV infection is still not commercially available.
SUMMARY OF THE INVENTION The continuing force of the AIDS epidemic illustrates the pressing need for effective vaccines against human immunodeficiency viruses (HIV), which frequently mutate and exist in several different clades (or subtypes) and recombinant forms. These subtypes and recombinant forms, which may arise either naturally or as the result of human intervention, can be distinguished by differences in the sequences of their nucleic acid. We have developed DNA vectors, viral vectors and recombinant viruses, recombinant modified vaccinia Ankara (MVA) viruses (described at length below) that can be used, alone or in combination, as a vaccine against one HIV clade, subtype, or recombinant form of HIV or against multiple HIV clades, subtypes, or recombinant forms (unless otherwise specified, the term "clade(s)" is meant to encompass subtypes or recombinant forms of HIV). Moreover, the vectors can encode a variety of antigens, which may be obtained from one clade or from WO 03/076591 PCT/US03/07177 two or more different clades, and the antigens selected and/or the manner in which the vectors are formulated mixed) can be manipulated to generate a protective immune response against a variety of clades the clades to which a patient is most likely to be exposed).
There is also a need for an effective vaccine against poxviruses, such as the variola virus that causes smallpox; the current smallpox vaccine carries a small risk of substantial adverse side effects. Although smallpox has been eradicated, the population is still threatened by smallpox as a biological weapon. The viral vectors described herein can be used to generate an immune response against poxviruses. Thus, methods in which such vectors are administered (regardless of the precise protocol followed) can also elicit an immune response that confers protective or therapeutic effects against conditions such as smallpox a pox viral vector can be administered before or after 1-4 or more days after) a subject has been exposed to an agent that causes a viral disease such as smallpox).
These methods can be effective regardless of whether the vectors contain vaccine inserts or what that insert encodes proteins obtained from an HIV or proteins that elicit an immune response against one or more HIV clades).
The present invention provides plasmid vectors as well as viral vectors that can be used to deliver nucleic acids to a cell; while the invention encompasses vectors that do not contain vaccine "inserts," when immunizing or treating a patient, the vectors will include nucleic acids that encode protein antigens that induce or enhance an immune response against a pathogen one or more HIV clades (or subtypes or recombinant forms)). The nucleic acids or polynucleotides described herein include those having linear arrays of naturally occurring and/or synthetic nucleotides (or nucleosides) derived from cDNA (or mRNA) or genomic DNA, or derivatives thereof (the pyrimidine or purine rings can be attached to a pentose sugar, such as a ribose or deoxyribose). The sequence of the nucleic acid may or may not be identical to a sequence occurring in nature the sequence can encode a mutant form of an HIV protein that may make the vaccine safer). Specific characteristics and specific sequences of the proteins that can be expressed by way of the vectors described herein are discussed below.
Plasmid or viral vectors can include nucleic acids representing one or more genes found in one or more HIV clades or any fragments or derivatives thereof that, when WO 03/076591 PCT/US03/07177 expressed, elicit an immune response against the virus (or viral clade) from which the nucleic acid was derived or obtained. The nucleic acids may be purified from HIV or they may have been previously cloned, subcloned, or synthesized and, in any event, can be the same as or different from a naturally occurring nucleic acid sequence. The plasmid vectors of the present invention may be referred to herein as, inter alia, expression vectors, expression constructs, plasmid vectors or, simply, as plasmids, regardless of whether or not they include a vaccine insert a nucleic acid sequence that encodes an antigen or immunogen).
Similar variations of the term "viral vector" may appear as well we may refer to the "viral vector" as a "poxvirus vector," a "vaccinia vector," a "modified vaccinia Ankara vector," or an "MVA vector"). The viral vector may or may not include a vaccine insert.
DNA molecules and viral vectors described herein can be used to generate recombinant viruses that can be used in combination with plasmid vectors to immunize patients prophylactically or therapeutically.
Accordingly, in one aspect, the invention features compositions (including pharmaceutically or physiologically acceptable compositions) that contain, but are not limited to, a vector, which may be a plasmid or viral vector, having a vaccine insert. The insert can include one or more of the sequences described herein (the features of the inserts and representative sequences are described at length below; any of these, or any combination of these, can be used as the insert). When the insert is'.expressed, the expressed protein(s) may generate an immune response against one or more HIV clades. One can increase the probability that the immune response will be effective against more than one clade by including.sequences from more than one clade in the insert of a single vector (multi-vector vaccines are also useful and are described further below). For example, to increase the probability of generating an immune response against clade B and clade C, one can administer, to a subject, vectors that each include an insert that encodes proteins of clade B and clade C. The subject may be a person who lives in, or travels between, parts of the world where HIV clades B and C are prevalent. Of course, expressing one or more proteins of a single clade is also beneficial and vectors that do so are within the scope of the invention (again, any inserts having the features or sequences of the exemplary inserts described herein can be used, and the inserts per se are features of the invention).
WO 03/076591 PCT/US03/07177 In another aspect, the invention features compositions (including pharmaceutically or physiologically acceptable compositions) that contain, but are not limited to, two vectors: a first vector that encodes one or more antigens a vector that includes a vaccine insert) that elicit induces or enhances) an immune response against an HIV of a first clade and a second vector that encodes one or more antigens that elicit induces or enhances) an immune response against an HIV of a second clade. However, the compositions can contain more than first and second vectors; they can contain three, four, five, six, or more different vectors (by "different" vectors, we mean vectors that contain different regulatory elements different promoters), or that encode different antigens or combinations of antigens, or that otherwise vary that vary in their "backbone" sequence)). In some embodiments, the compositions can contain as many vectors as are required to elicit an immune response against two, three, four, or a majority of, if not all, HIV clades. While one vector can encode one antigen Gag-Pol), one or more of the vectors the first vector, the second vector, or both; the first, second, third, or all three vectors; etc.) can include nucleic acids encoding at least three antigens Gag-Pol and Env), each of which can elicit an immune response directed primarily against the same HIV clade the first vector can express three antigens, each of which generates a response against, primarily, clade A and a second vector can express three antigens, each of which generates a response against, primarily, clade B).
In other embodiments, one ormore of the vectors can elicit an immune response against more than one HIV clade the first vector can express a first antigen Gag-Pol) that generates a response against clade A and a second antigen Env) that generates a response against clade Thus, one or more of the vectors can elicit an immune response against more than one HIV clade. Any of the types of vectors described herein, whether they are plasmid or viral vectors, or whether they individually encode antigens that elicit immune responses against primarily one, or more than one, HIV clade, can be used alone or in combination with one another, depending on the particular HIV clades to which one wishes to generate immunity.
The vaccine inserts per se the sequences encoding HIV proteins that serve as antigens or imnmunogens) are also within the scope of the invention. While these inserts are described at length below, we note here that the invention features a variety of isolated nucleic acids that represent modified HIV genomes fragments or recombinant forms of WO 03/076591 PCT/US03/07177 a genome or one or more HIV genes that are recombined or mutated in some way). For example, one or more nucleic acids can be deleted from one or more genes or replaced with other nucleic acids the sequences can be fragments of a gene or genes and can contain point mutations). More specifically, the invention features isolated nucleic acids that represent HIV genomes having safety mutations deletion of the LTRs and of sequences encoding integrase Vif, Vpr and Nef). The nucleic acids can encode Gag, PR, RT, Env, Tat, Rev, and Vpu proteins, one or more of which may contain safety mutations (particular mutations are described at length below). Moreover, the isolated nucleic acids can be of any HIV clade and nucleic acids from different clades can be used in combination (as described further below). In the work described herein, clade B inserts are designated JS JS2, JS7, and JS7.1), clade AG inserts are designated IC IC2, IC25, IC48, and IC90), and clade C inserts are designated IN IN2 and IN3). These inserts are within the scope of the present invention, as are vectors (whether plasmid or viral) containing them (particular vector/insert combinations are referred to below as, for example, pGA1/JS2, pGA2/JS2 etc.
Expression vectors that carry DNA are necessarily limited in that they can only be used to immunize patients with products proteins) encoded by DNA, and it is possible that bacterial and parasitic proteins may be atypically processed by eukaryotic cells. Another problem with existing DNA vaccines is that some vaccine insert sequences are unstable during the growth and amplification of DNA vaccine plasmids in bacteria. Instability can arise during.plasmid growth where the secondary structure of the vaccine insert or of the plasmid vector (the "backbone") can be altered by bacterial endonucleases. The expression vectors of the present invention can include a termination sequence that improves stability.
The termination sequence and other regulatory components promoters and polyadenylation sequences) are discussed at length below.
The compositions of the invention can be administered to humans, including children.
Accordingly, the invention features methods of immunizing a patient (or of eliciting an immune response in a patient, which may include multi-epitope CD8 T cell responses) by administering one or more types of vectors one or more plasmids, which may or may not have identical sequences, components, or inserts sequences that can encode antigens) and/or one or more viral vectors, which may or may not be identical or express identical antigens). As noted above, the vectors, whether plasmid or viral vectors, can WO 03/076591 PCT/US03/07177 include one or more nucleic acids obtained from or derived from a mutant sequence is a derivative sequence) one or more HIV clades. When these sequences are expressed, they produce an antigen or antigens that elicit an immune response to one or more HIV clades. In particular embodiments, patients receive a first vector and a second vector. The first vector can encode one or more antigens of a first HIV clade (these antigens can elicit induce or enhance) an immune response against that HIV clade) and the second vector can encode one or more antigens of a second HIV clade (here again, these antigens can elicit induce or enhance) an immune response against the second HIV clade). In alternative embodiments, the subject can receive a third, fourth, fifth, etc. vector encoding one or more antigens from a third, fourth, fifth, etc. HIV clade (or mutants thereof). Moreover, and as in other embodiments, the antigen(s) can be from any clade from one or more of clades A- L) or any HIV isolate.
Where the compositions contain vectors that differ either in their backbone, regulatory elements, or insert(s), the ratio of the vectors in the compositions, and the routes by which they are administered, can vary. The ratio of one type of vector to another can be equal or roughly equal roughly 1:1 or 1:1:1, etc.). Alternatively, the ratio can be in any desired proportion 1:2, 1:3, 1:4 1:10; 1:2:1, 1:3:1, 1:4:1 1:10:1; etc.). Thus, the invention features compositions containing a variety of vectors, the relative amounts of antigen-expressing vectors being roughly equal or in a desired proportion. While preformed mixtures may be made (and may be more convenient), one can, of course, achieve the same objective by administering two or more vector-containing compositions (on, for example, the same occasion within minutes of one another) or nearly the same occasion on consecutive days)).
Plasmid vectors can be administered alone a plasmid can be administered on one or several occasions with or without an alternative type of vaccine formulation with or without administration of protein or another type of vector, such as a viral vector)) and, optionally, with an adjuvant or in conjunction with prior to) an alternative booster immunization a live-vectored vaccine such as a recombinant modified vaccinia Ankara (MVA) virus comprising a DNA insert that can encode antigens identical to or differing from those encoded by the "prime" portion of the immunization. For example, the viral vector or MVA virus can contain at least some of the sequence contained with the plasmid WO 03/076591 PCT/US03/07177 administered as the "prime" portion of the inoculation protocol sequences encoding one or more, and possibly all, of the same antigens). The adjuvant can be a "genetic adjuvant" a protein delivered by way of a DNA sequence). Similarly, as described further below, one can immunize a patient (or elicit an immune response, which can include multi-epitope CD8 T cell responses) by administering a live-vectored vaccine an MVA vector or recombinant MVA virus) without administering a plasmid-based (or "DNA") vaccine. Thus, in alternative embodiments, the invention features compositions having only recombinant virus or viral vectors (with, optionally, one or more of any of the inserts described here, or inserts having their features) and methods of administering them. The viral-based regimens "MVA only" or "MVA-MVA" vaccine regimens) are the same as those described herein for "DNA-MVA" regimens, and the MVAs in any vaccine can be in any proportion desired. For example, in any case (whether the immunization protocol employs only plasmid-based immunogens, only viral-carried immunogens, or a combination of both), one can include an adjuvant and administer a variety of antigens, including those obtained from any HIV clade, by way of the plurality of vectors administered.
As implied by the term "immunization" (and variants thereof), the compositions of the invention can be administered to a subject who has not yet become infected with a pathogen (thus, the terms "subject" or "patient," as used herein encompasses apparently healthy or non-HIV-infected individuals), but the invention is not so limited; the compositions described herein can also be administered to treat a subject or patient who has already been exposed to, or who is known to be infected with, a pathogen an HIV of any clade, including those presently known as clades A-L or mutant or recombinant forms thereof).
An advantage of DNA and rMVA immunizations is that the immunogen may be presented by both MHC class I and class II molecules. Endogenously synthesized proteins readily enter processing pathways that load peptide epitopes onto MHC I as well as MHC II molecules. MHC I-presented epitopes raise CD8 cytotoxic T cell (Tc) responses, whereas MHC II-presented epitopes raise CD4 helper T cells By contrast, immunogens that are not synthesized in cells are largely restricted to the loading of MHC II epitopes and therefore raise CD4 Th but not CD8 Tc. In addition, DNA plasmids express only the immunizing antigens in transfected cells and can be used to focus the immune response on only those 15-07-'08 16:59 FRO11- T-903 P012/028 F-509 P 10fiRtASClTrmn-Id5)49 Ip.1, W.IJ5/07f3M8 00 o antigens desired for immunization. In contrast, live virus vectors, recombinant MVA Svirus, express many antigens those of the vector as well as the immunizing antigens) Z and prime immune responses against both the vector and the immunogen. Thus, we IND believed these live virus vectors could be highly effective at boosting a DNA-primed response by virtue of the large amounts of antigen that can be expressed by a live virus vector preferentially boosting the highly targeted DNA-primed immune response. The live virus vectors also stimulate the production of pro-inflammatory cytokines that augment O immune responses. Thus, administering one or more of the DNA vectors described herein Ci (as a "prime") and subsequently administering one or more of the recombinant MVA S10 viruses (as a "boost"), could be more effective than DNA-alone or live virus vectors-alone 0 3 at raising both cellular and humoral immunity. Insofar as these vaccines may be administered by DNA expression vectors and/or recombinant viruses, there is a need for plasmids that are stable in bacterial hosts and safe in animals. Plasmid-based vaccines that may have this added stability are disclosed herein, together with methods for administering them to animals, including humans.
The antigens encoded by DNA or rMVA are necessarily proteinaceous. The terms "protein," "polypeptide," and "peptide" are generally interchangeable, although the term "peptide" is commonly used to refer to a short sequence of amino acid residues or a fragment of a larger protein. In any event, serial arrays of amino acid residues, linked through peptide bonds, can be obtained by using recombinant techniques to express DNA as was done for the vaccine inserts described and exemplified herein), purified from a natural source, or synthesized.
Other advantages of DNA-based vaccines (and of viral vectors, such as pox virusbased vectors) are described below. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
Accordingly, another aspect of the invention features a method of eliciting a cellular and humoral immune response to an HIV antigen in a subject comprising: (a) administering to the subject a composition comprising a DNA vector encoding at least: HIV gag, HIV pol lacking the integrase domain, HIV tat, HIV rev, HIV vpu, and HIV env, -9- COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15 15-07-'08 16:59 FROM- T-903 P013/028 F-509 P" ,*4ASCllrmOI4W I pdocw-lItarM* 00 all of which are of a selected HIV chosen from the group consisting of HIV clades A, B, C, cl D, E, F, G, H, I, J, K, L, and HIV AG; and administering to the subject a composition Z comprising a modified vaccinia Ankara virus expressing at least one HIV antigen, wherein a cellular and humoral immune response to an HIV antigen is elicited in the subject.
In another aspect the invention features a method of eliciting a cellular and humoral immune response to an HIV antigen in a subject comprising: administering to the subject a composition comprising a DNA vector selected from: pGA2/JS7, pGAl/IN3, o pGA2/JS2, pGAI/IN2, pGAl/IC2 and pGAl/IC25; and administering to the subject a C composition comprising a modified vaccinia Ankara virus expressing at least one HIV antigen, wherein a cellular and humoral immune response to an HIV antigen is elicited in O the subject.
The invention also features a pharmaceutical composition comprising a DNA vector selected from pGA2/JS7, pGA1/IN3, pGA2/JS2, pGA1/IC2, pGAl/IN2 and BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic illustration of the plasmid construct pGAl. The identities and positions of elements present in the vector the promoter (here, a CMV promoter including -9a COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15 WO 03/076591 PCT/US03/07177 intron the multiple-cloning site, a terminator sequence (here, the lambda TO terminator), and a selection gene (here, the kanamycin resistance gene) are shown. Unique restriction endonuclease sites, which are useful for cloning vaccine inserts into the plasmid, are also shown.
Figs. 2a and 2b relate to pGA1. Fig. 2a is an illustration of the nucleotide sequence of pGA1 (SEQ ID NO:1), and Fig. 2b is a table listing the functional regions ofpGAl, their positions within the SEQ ID NO: 1, and the origins of the sequences.
Figs. 3a and 3b relate to pGAl.1. Fig. 3a is an illustration of the nucleotide sequence of pGA1.1 (SEQ ID NO:2), and Fig. 3b is a table listing the functional regions of pGA1.1, their positions within SEQ ID NO:2, and the origins of the sequences. pGA1.1 differs from pGA1 in that it includes an EcoR I restriction site in its multiple cloning site.
Figs. 4a and 4b relate to pGA1.2. Fig. 4a is an illustration of the nucleotide sequence ofpGA1.2 (SEQ ID NO:3) and Fig. 4b is a table listing the functional regions of pGA1.2, their positions within SEQ ID NO:3, and the origins of the sequences. pGAl.2 differs from pGA1.1 in that it includes a BamH I site in its multiple cloning site.
Fig. 5 is a schematic illustration of the plasmid construct pGA2. The identities and positions of elements present in the vector a promoter (here the CMV promoter without intron the multi-cloning site, a terminator sequence (here, the lambda TO terminator), and a selection gene (here, the kanamycin resistance gene) are shown. Unique restriction endonuclease sites, which are useful for cloning vaccine inserts into the plasmid, are also shown.
Figs. 6a and 6b relate to pGA2. Fig. 6a is an illustration of the nucleotide sequence of pGA2 (SEQ ID NO:4), and Fig 6b is a table listing the functional regions of pGA2, their positions within SEQ ID NO:4, and the origins of the sequences.
Figs. 7a and 7b relate to pGA2.1. Fig. 7a is an illustration of the nucleotide sequence ofpGA2.1 (SEQ ID NO:5) and Fig. 7b is a table listing the functional regions of pGA2.1, the positions within SEQ ID NO:5, and the origins of the sequences. pGA2.1 differs from pGA2 in having an EcoR I site in its multiple cloning site.
Figs. 8a and 8b relate to pGA2.2. Fig. 8a is an illustration of the nucleotide sequence ofpGA2.2 (SEQ ID NO:6), and Fig. 8b is a table listing the functional regions of pGA2.2, their positions with SEQ ID NO:6, and the origins of the sequences. pGA2.2 differs from pGA2.1 in having a BamH I site in its multiple cloning site.
WO 03/076591 PCT/US03/07177 Fig. 9 is a schematic representation of the proviral (integrated DNA) form of the HIV genome (HIV-1 wt) and a representative vaccine insert. This representative insert has safety mutations that include deletion of the LTRs, deletion of sequences encoding integrase (IN), Vif, Vpr and Nef. The insert encodes Gag, PR, RT, Env, Tat, Rev, and Vpu proteins. Clade B inserts are designated JS (clade IC (clade AG) and IN (clade C) with arabic numerals designating the specific vaccine constructs JS2, JS7 and JS7.1 are examples of specific clade B vaccine constructs; IC2, IC25, IC48 and IC90, examples of specific AG vaccine constructs; and IN2 and IN3 are examples of specific clade C vaccine constructs). When inserted into the pGAl vector, the insert-bearing plasmids are referred to as pGA1/JS2 etc; when inserted into the pGA2 vector, plasmids are referred to as pGA2/JS2 etc.
Figs. 10a-10c relate to pGA2/JS2. Fig. 10a is an illustration of the sequence of the pGA2/JS2 clade B vaccine vector (SEQ ID NO:7), and Fig O1b is a table listing the positions of seven functional regions of pGA2/JS2, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 10c is a table listing codons that were changed, the resulting amino acid change C392S indicates a substitution of serine for cysteine at amino acid residue 392), the region of the genome where the mutation resides, and the mutation's function.
Figs. 1 la-1 lc relate to pGA2/JS7. Fig. 1 la is an illustration of the sequence of the pGA2/JS7 clade B vaccine vector (SEQ ID NO:8), and Fig. 1 lb is a table listing the positions of seven functional regions of pGA2/JS7, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 1 Ic is a table listing codons that were changed, the resulting amino acid change C395S indicates a substitution of serine for cysteine at amino acid residue 395), the region of the genome where the mutation resides, and the mutation's function.
Figs. 12a-12c relate to pGA2/JS7.1. Fig. 12a is an illustration of the sequence of the pGA2/JS7.1 clade B vaccine vector (SEQ ID NO:9), and Fig 12b is a table listing the positions of functional regions ofpGA2/JS7.1, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 12c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
WO 03/076591 PCT/US03/07177 Figs. 13a-13c relate to pGA1/IC25. Fig. 13a is an illustration of the sequence of the pGA1/IC25 clade AG vaccine vector (SEQ ID NO:10), and Fig. 13b is a table listing the positions of functional regions within pGA1/IC25, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 13c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
Figs. 14a-14c relate to pGA1/IC2. Fig. 14a is an illustration of the sequence of the pGA1/IC2 clade AG vaccine vector (SEQ ID NO: and Fig. 14b is a table listing the positions of functional regions within pGA1/IC2, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 14c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
Figs. 15a-15c relate to pGAl/IC48. Fig. 15a is an illustration of the sequence of the pGA1/IC48 clade AG vaccine vector (SEQ ID NO: 12), and Fig. 15b is a table listing the positions of functional regions within pGAI/IC48, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 15c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
Figs. 16a-16c relate to pGA1/IC90. Fig. 16a is an illustration of the sequence of the pGA1/IC90 clade AG vaccine vector (SEQ ID NO:13), and Fig. 16b is a table listing the positions of functional regions within pGA1/IC90, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 16c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
Figs. 17a-17c relate to pGAl/IN3. Fig. 17a is an illustration of the sequence of the pGA1/IN3 clade C vaccine vector (SEQ ID NO:14), and Fig. 17b is a table listing the positions of functional regions within pGA1/IN3, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig. 17c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
WO 03/076591 PCT/US03/07177 Figs. 18a-18c relate to pGA1/IN2. Fig. 18a is an illustration of the sequence of the pGAl/IN2 clade C vaccine vector (SEQ ID NO:15), and Fig. 18b is a table listing the positions of functional regions within pGAI/IN2, the gene sequences within those regions (describing mutations, where present), and the origins of their sequences. Fig 18c is a table listing codons that were changed, the resulting amino acid change, the region of the genome where the mutation resides, and the mutation's function.
Fig. 19 is a schematic representation of an HIV-1 Env glycoprotein. The arrow indicates the site of gpl60 cleavage to gpl20 and gp41. In gpl20, cross-hatched areas represent variable domains (V 1 to V 2 and open boxes depict conserved sequences (C 1 to In the gp41 ectodomain, several domains are indicated: the N-terminal fusion peptide and the two ectodomain helices and C-helices). The membrane-spanning domain is represented by a black box. In the gp41 cytoplasmic domain, the Tyr-X-X-Leu (YXXL) endocytosis motif and two predicted helical domains (helix-1 and helix-2) are shown. Amino acid residues are numbered at intervals of 100.
Figs. 20A and 20B relate to the plasmid transfer vector pLW-48. Fig. 20A is a map of pLW-48 and Fig. 20B is a representation of its sequence.
Fig. 21 is a representation of the sequences of the plasmid transfer vector pLW-48, the Psy II promoter (which controls ADA envelope expression), the ADA envelope (truncated), the PmH5 promoter (which controls HXB2 gag and pol expression), and HXB2 gag-pol (with safety mutations, inactivating point mutations in RT and the deletion of integrase).
Fig. 22 is a representation of the plasmid transfer vector pLW-48 and a scheme for making an MVA recombinant virus (MVA/HIV 48).
Fig. 23 is a representation of a clade B gagpol.
Fig. 24 is a representation of a Psyn II promoter.
DETAILED DESCRIPTION This invention encompasses a wide variety of vectors and types of vectors plasmid and viral vectors), each of which can, but do not necessarily, include one or more nucleic acid sequences that encode one or more antigens that elicit that induce or enhance) an immune response against the pathogen from which the antigen was obtained or WO 03/076591 PCT/US03/07177 derived (the sequences encoding proteins that elicit an immune response may be referred to herein as "vaccine inserts" or, simply, "inserts"; when a mutation is introduced into a naturally occurring sequence, the resulting mutant is "derived" from the naturally occurring sequence). We point out that the vectors do not necessarily encode antigens to make it clear that vectors without "inserts" are within the scope of the invention and that the inserts per se are also compositions of the invention.
Accordingly, the invention features the nucleic acid sequences disclosed herein, analogs thereof, and compositions containing those nucleic acids (whether vector plus insert or insert only; physiologically acceptable solutions, which may include carriers such as liposomes, calcium, particles gold beads) or other reagents used to deliver DNA to cells). The analogs can be sequences that are not identical to those disclosed herein, but that include the same or similar mutations the same point mutation or a similar point mutation) at positions analogous to those included in the present sequences any of the JS, IC, or IN sequences disclosed herein). A given residue or domain can be identified in various HV clades even though it does not appear at precisely the same numerical position.
The analogs can also be sequences that include mutations that, while distinct from those described herein, similarly inactivate an HIV gene product. For example, a gene that is truncated to a greater or lesser extent than one of the genes described here, but that is similarly inactivated that loses a particular enzymatic activity) is within the scope of the present invention.
The pathogens and antigens, which are described in more detail below, include human immunodeficiency viruses of any clade from any known clade or from any isolate clade A, AG, B, C, D, E, F, G, H, I, J, K, or When the vectors include sequences from a pathogen, they can be administered to a patient to elicit an immune response. Thus, methods of administering antigen-encoding vectors, alone or in combination with one another, are also described herein. These methods can be carried out to either immunize patients (thereby reducing the patient's risk of becoming infected) or to treat patients who have already become infected; when expressed, the antigens may elicit both cell-mediated and humoral immune responses that may substantially prevent the infection immunization can protect against subsequent challenge by the pathogen) or limit the extent of its impact on the patient's health. While in many instances the patient will be a WO 03/076591 PCT/US03/07177 human patient, the invention is not so limited. Other animals, including non-human primates, domesticated animals and livestock can also be treated.
The compositions described herein, regardless of the pathogen or pathogenic subtype the HIV clade(s)) they are directed against, can include a nucleic acid vector a plasmid). As noted herein, vectors having one or more of the features or characteristics (particularly the oriented termination sequence and a strong promoter) of the plasmids designated pGA1, pGA2 (including, of course, those vectors per se), can be used as the basis for a vaccine or therapy. Such vectors can be engineered using standard recombinant techniques (several of which are illustrated in the examples, below) to include sequences that encode antigens that, when administered to, and subsequently expressed in, a patient will elicit induce or enhance) an immune response that provides the patient with some form of protection against the pathogen from which the antigens were obtained or derived protection against infection, protection against disease, or amelioration of one or more of the signs or symptoms of a disease). The encoded antigens can be of any HIV clade or subtype or any recombinant form thereof. With respect to inserts from immunodeficiency viruses, different isolates exhibit clustal diversity, with each isolate having overall similar diversity from the consensus sequence for the clade (see, Subbarao et al., AIDS 10(Suppl A):S13- 23, 1996). Thus, any isolate can be used as a reasonable representative of sequences for other isolates of the same clade. Accordingly, the compositions of the invention can be made with, and the methods described herein can be practiced with, natural variants of genes or nucleic acid molecules that result from recombination events, alternative splicing, or mutations (these variants may be referred to herein simply as "recombinant forms" of HIV).
Moreover, one or more of the inserts within any construct can be mutated to decrease their natural biological activity (and thereby increase their safety) in humans (these humanmade variants may also be referred to herein as "recombinant forms" of HIV (there are naturally occurring recombinant forms as well)). As noted above in the description of JS2, JS7 and JS7.1 and as described below (see, Examples 7-10), mutations can be introduced into sequences that participate in encapsidation. For example, one can mutate (by, for example, deletion of all or a part of) a cis-acting RNA encapsidation sequence in the non-coding regulatory sequence of an HIV HIV-1). Alternatively, or in addition, one WO 03/076591 PCT/US03/07177 can mutate sequences that encode any antigenic proteins any HIV antigen, including those listed above the viral RT or protease).
For example, the compositions of the invention include those having two vectors: (a) a first vector comprising a vaccine insert encoding one or more antigens that elicit an immune response against a human immunodeficiency virus (HIV) of a first subtype or recombinant form and a second vector comprising a vaccine insert encoding one or more antigens that elicit an immune response against an HTV of a second subtype or recombinant form. The compositions can be pharmaceutically acceptable and may include a carrier or adjuvant (discussed further below). Moreover, the insert of the first vector or the insert of the second vector can include the sequences of two or more of: a gag, pol, env, tat, rev, nef, vif vpr, or vpu gene or mutants thereof and, optionally, non-coding regulatory sequences (including the sequences of single promoters) of the HIV genome. At least one of the two or more sequences can be mutant or mutated so as to limit the encapsidation of viral RNA (preferably, the mutation(s) limit encapsidation appreciably).
One can introduce mutations and determine their effect (on, for example, expression or immunogenicity) using techniques known in the art; antigens that remain well expressed antigens that are expressed about as well as or better than their wild type counterparts), but are less biologically active than their wild type counterparts, are within the scope of the invention. Techniques are also available for assessing the immune response. One can, for example, detect anti-viral antibodies or virus-specific T cells.
The mutant constructs a vaccine insert) can include sequences encoding one or more of the substitution mutants described herein (see, e.g. the Examples) or an analogous mutation in another HIV clade. In addition to, or alternatively, HIV antigens can be rendered less active by deleting part of the gene sequences that encode them. Thus, the compositions of the invention can include constructs that encode antigens that, while capable of eliciting an immune response, are mutant (whether encoding a protein of a different length or content than a corresponding wild type sequence) and thereby less able to carry out their normal biological function when expressed in a patient. As noted above, expression, immunogenicity, and activity can be assessed using standard techniques for molecular biology and immunology.
WO 03/076591 PCT/US03/07177 Several plasmids have been constructed and used to express antigens the pGA2/JS2 construct has gone through immunogenicity studies in macaques). The plasmids made and used include pGAl and its derivatives pGA1.1 and pGAl.2; and pGA2, and its derivatives pGA2.1 and pGA2.2 (see Examples The vaccine constructs we made are typically referred to with the "backbone" vector and the "insert" being separated by a backslash. These constructs express HIV-1 antigens, and those constructs can be administered to patients as described herein. While antigens (wild type and those containing mutations that render them safer for administration) are discussed at length below, we note here that, based upon our present evidence, plasmids containing JS7-like inserts appear to exhibit better immunogenicity and are more efficient in priming an immune response (as evidenced by anti-Env antibodies) than are plasmids containing JS2-like inserts. pGA2/JS7 and pGA2/JS7.1 differ from pGA2/JS2 in several ways, one of which is the source of their respective antigens. In pGA2/JS7 and pGA2/JS7.1, the Gag and Pol genes were obtained from HIV-1 HXB2, whereas in pGA2/JS2 those genes were obtained from a closely related isolate of HIV-1, HIV-1 BH10. Accordingly, the invention features inserts (as well as vectors and compositions containing them) that include Gag and Pol genes obtained from HIV-1 HXB2. Moreover, these inserts can contain mutations that inhibit one or more of the biological activities carried out by Gag-Pol. The vaccine inserts designated JS7 and JS2 also differ in that JS7 has an inactivating point mutation in its protease gene. This mutation facilitates the formation of viral like particles (VLPs) by, we believe, precluding premature intracellular cleavage of the pr55 Gag protein. pGA2/JS7 and pGA2/JS7.1 both contain this protease mutation and both constructs produce VLPs in abundance. Accordingly, the invention features inserts that include mutant gag and/or pol sequences mutations one or more deletions or point mutations) that inhibit the protease gene). Additional point mutations in the vpu gene in pGA2/JS7.1 resulted in a loss of Vpu expression and an increase in Env expression (in pGA2/JS7.1, the start site of Vpu is mutated along with a downstream ATG to eliminate translation of Vpu). The increase in Env expression does not compromise Gag expression.
Identical or analogous changes can be made in any vaccine insert that includes gag, pol; any vaccine insert that encodes a viral protease; or any vaccine insert that includes a vpu gene (regardless of the clade or isolate from which it was obtained). Moreover, these WO 03/076591 PCT/US03/07177 changes can be made in vaccine inserts that are placed in any of the plasmid or live-vectored vaccines MVA) described herein in any plamid having one or more of the features or characteristics of the pGA vectors, the pGA vectors themselves, or the vaccinia vectors that may be used alone or in conjunction with to boost) a DNA-primed patient).
Any plasmid within the scope of the invention can be tested for expression by transfecting cells, such as 293T cells (a human embryonic kidney cell line) and assessing the level of antigen expression (by, for example, an antigen-capture ELISA or a Western blot).
Plasmids that express immunogens at a level comparable to, or higher than, the plasmids tested herein are strong therapeutic candidates and are within the scope of the invention (of course, any construct that elicits an effective immune response any desirable degree of protection from infection or other therapeutic benefit) is within the scope of the invention, regardless of the level of antigen expression it generates). One can similarly assess the ability of candidate vectors to produce VLPs; the more the vectors' products resemble VLPs, the more likely they are to elicit a strong antibody response (while this is a desirable feature, vectors that fail to form VLPs are nevertheless useful and are within the scope of the present invention). In addition to assessing expression and VLP formation in cell culture, one can assess candidate vectors in vivo. For example, one can assess immunogenicity in animal models (and, eventually, in human patients). Plasmids that have substantially the same sequence as the pGA vectors described herein and that express one or more of the antigens described herein are within the scope of the invention so long as they are immunogenic enough to induce or enhance a therapeutically beneficial response in a patient (a plasmid can have substantially the same sequence as a pGA vector even if one or more of the component parts of the plasmid, such as the marker gene or antibiotic-resistance gene, has been deleted).
In tests in animals for immunogenicity, one can perform an intracellular cytokine assay or an ELISPOT assay for IFN-y production in response to stimulation with an antigenic peptide to evaluate the frequency of responding T cells to that peptide. Proliferation assays can also be carried out. Antigens produced by transient transfection can be used for stimulation, and supernatants from mock-transfected cultures can serve as controls. If desired, the data can be presented as a stimulation index (the growth of cultures in the presence of pathogenic viral) antigens divided by the growth of cultures in the presence of mock antigen).
WO 03/076591 PCT/US03/07177 The nucleic acid vectors of the invention, including pGA1 and pGA2 and their derivatives can encode at least one antigen (which may also be referred to as an immunogen) obtained from, or derived from, any HIV clade or isolate any subtype or recombinant form of HIV). The antigen (or immunogen) may be: a structural component of an HIV virus; glycosylated, myristoylated, or phosphorylated; one that is expressed intracellularly, on the cell surface, or secreted (antigens that are not normally secreted may be linked to a signal sequence that directs secretion). More specifically, the antigen can be all, or an antigenic portion of, Gag, gpl20, Pol, Env a CCR5-using Env; see, for example, Fig. 19), Tat, Rev, Vpu, Nef, Vif, Vpr, or a VLP a polypeptide derived from a VLP that is capable of forming a VLP, including an Env-defective HIV VLP).
Particular inserts and insert-bearing compositions include the following. Where the composition includes either a vector with an insert or an insert alone, and that insert encodes a single antigen, the antigen can be a wild type or mutant gag sequence a gag sequence having a mutation in one or more of the sequences encoding a zinc finger a mutation at a nucleotide at any of positions 1279-1281, 1288-1290, 1342-1344, or 1351-1353 of SEQ ID NOs:7 or 8 or at an analogous position in an HIV gag sequence of another clade). As the mutation is intended to alter the encoded protein, it will not be a silent mutation one at the third-base wobble position of a codon (this is true in the context of gag or any other HIV sequence included in an insert of the invention). A mutation at one or more of the positions just listed would change one or more of the cysteine residues at positions 392, 395, 413, or 416 to another residue serine). Alternatively, the mutation can be at any of positions 1271-1273, 1280-1282, 1334-1336, or 1343-1345 of any of SEQ ID NOs:10-13) or at an analogous position in an HIV gag sequence of another clade. Such a mutation would change one or more of the cysteine residues at positions 390, 393, 411, or 414 to another residue serine). Alternatively, the mutation can be at any of positions 1260-1262, 1269-1271, 1323-1325, or 1332-1334 of SEQ ID NOs:14 or 15 or at an analogous position in an HIV gag sequence of another clade. Such a mutation would change one or more of the cysteine residues at positions 390, 393, 411, or 414 to another residue serine).
Where the composition includes either a vector with an insert or an insert alone, and that insert encodes multiple protein antigens, one of the antigens can be a wild type or mutant gag sequence, including those described above. Similarly, where a composition includes WO 03/076591 PCT/US03/07177 more than one type of vector or more than one type of insert, at least one of the vectors or inserts (whether encoding a single antigen or multiple antigens) can include a wild type or mutant gag sequence, including those described above or analogous sequences from other HIV clades. For example, where the composition includes first and second vectors, the vaccine insert in either or both vectors (whether the insert encodes single or multiple antigens) can encode Gag; where both vectors encode Gag, the Gag sequence in the first vector can be from one HIV clade clade B) and that in the second vector can be from another HIV clade clade C).
Where the composition includes either a vector with an insert or an insert alone, and that insert encodes a single antigen, the antigen can be wild type or mutant Pol. The sequence can be mutated by deleting or replacing one or more nucleic acids, and those deletions or substitutions can result in a Pol gene product that has less enzymatic activity than its wild type counterpart less integrase activity, less reverse transcriptase (RT) activity, or less protease activity). For example, one can inhibit RT by introducing a mutation at one or more of positions 2454-2456 or 2697-2699 of SEQ ID NO:7 or at an analogous position in a sequence of another subtype or recombinant form. While the invention is not limited to mutations that have any particular effect on enzyme activity, we believe the mutation at position 2454-2456 inhibits RT by inactivating the polymerase's active site and that the mutation at position 2697-2699 inhibits RT by ablating strand transfer activity. Accordingly, these mutations and others that have similar effects on the activity of the gene product are within the scope of the invention. More specifically, the mutation can change the amino acid encoded by the nucleotides at 2454-2456 of SEQ ID NO:7 (aspartic acid to any another amino acid asparagine Alternatively, or in addition, one can inhibit the polymerase's RNase H activity by, for example, introducing a mutation at nucleotides 3333-3335 of SEQ ID NO:7 a mutation that changes the glutamic acid residue to tryptophan Alternatively, the mutation can be at any of positions 2418- 2420, 2661-2663, or 3297-3299 of SEQ ID NOs:8 or 9 (other clade B inserts). Alternatively, the mutation can be at any of positions 2410-2412, 2653-2655, or 3289-3291 of any of SEQ ID NOs:10-13 (for example, the aspartic acid tryptophan and glutamic acid (E) residues at those positions can be changed to asparagine threonine and/or glutamine respectively). Alternatively, the mutation can be at any of positions 2387-2389, 2630- WO 03/076591 PCT/US03/07177 2632, or 3266-3268 of SEQ ID NOs:14 or 15. Nucleic acids encoding analogous residues in other clades can be identified by one of ordinary skill in the art, even if those residues are not found at precisely the same position as they were in the clades tested here.
Where the composition includes either a vector with an insert or an insert alone, and that insert encodes multiple protein antigens, one of the antigens can be a wild type or mutant pol sequence, including those described above (these multi-protein-encoding inserts can also encode the wild type or mutant gag sequences described above). Similarly, where a composition includes more than one type of vector or more than one type of insert, at least one of the vectors or inserts (whether encoding a single antigen or multiple antigens) can include a wild type or mutant pol sequence, including those described above (and, optionally, a wild type or mutant gag sequence, including those described above the inserts can encode Gag-Pol)). For example, where the composition includes first and second vectors, the vaccine insert in either or both vectors (whether the insert encodes single or multiple antigens) can encode Pol; where both vectors encode Pol, the Pol sequence in the first vector can be from one HIV clade clade B) and that in the second vector can be from another HIV clade clade AG).
Where an insert includes some or all of the pol sequence, another portion of the pol sequence that can be altered is the sequence encoding the protease activity (regardless of whether or not sequences affecting other enzymatic activities of Pol have been altered). For example, one can introduce a mutation at position 1641-1643 of SEQ ID NO:8 a mutation that changes the glutamic acid residue normally encoded by this codon to another amino acid residue, such as alanine As with the other mutants gag mutants) described herein, analogous mutations can be made in sequences obtained from other HIV clades. For example, one can introduce a mutation at position 1633-1635 of SEQ ID (changing arginine to another amino acid, such as asparagine at position 1703-1705 of SEQ ID NO: 12 (changing glycine to another residue, such as valine or at position 1828-1830 of SEQ ID NO:13 (changing leucine to another residue, such as methionine (SEQ ID NOs:10, 12, and 13 all represent clade AG sequences). In an insert from clade C, one can introduce a mutation at position 1610-1612 of SEQ ID NO:14 (changing aspartic acid to another amino acid residue, such as asparagine WO 03/076591 PCT/US03/07177 Where the composition includes either a vector with an insert or an insert alone, and that insert encodes a single antigen, the antigen can be a wild type or mutant Env, Tat, Rev, Nef, Vif, Vpr, or Vpu. Where the composition includes either a vector with an insert or an insert alone, and that insert encodes multiple protein antigens, one of the antigens can be a wild type or mutant Env. For example, multi-protein expressing inserts can encode wild type or mutant Gag-Pol and Env; they can also encode wild type or mutant Gag-Pol and Env and one or more of Tat, Rev, Nef, Vif, Vpr, or Vpu (each of which can be wild type or mutant).
As with other antigens, Env, Tat, Rev, Nef, Vif, Vpr, or Vpu can be mutant by virtue of a deletion, addition, or substitution of one or more amino acid residues any of these antigens can include a point mutation). With respect to Env, one or more mutations can be in any of the domains shown in Fig. 19. For example, one or more amino acids can be deleted from the gp 120 surface and/or gp41 transmembrane cleavage products. With respect to Gag, one or more amino acids can be deleted from one or more of: the matrix protein (p 17), the capsid protein (p24), the nucleocapsid protein (p7) and the C-terminal peptide For example, amino acids in one or more of these regions can be deleted (this may be especially desired where the vector is a viral vector, such as MVA). With respect to Pol, one or more amino acids can be deleted from the protease protein (p10), the reverse transcriptase protein (p66/p51), or the integrase protein (p32).
More specifically, the compositions of the invention can include a vector a plasmid or viral vector) that encodes: a Gag protein in which one or more of the zinc fingers has been inactivated to limit the packaging of viral RNA; a Pol protein in which the integrase activity has been inhibited by deletion of some or all of the pol sequence and (ii) the polymerase, strand transfer and/or RNase H activity of reverse transcriptase has been inhibited by one or more point mutations within the pol sequence; and Env, Tat, Rev, and Vpu, with or without mutations. In this embodiment, as in others, the encoded proteins can be obtained or derived from a subtype A, B or C HIV HIV-1) or recombinant forms thereof. Where the compositions include non-identical vectors, the sequence in each type of vector can be from a different HIV clade (or subtype or recombinant form thereof). For example, the invention features compositions that include plasmid vectors encoding the antigens just described (Gag-Pol, Env etc.), where some of the plasmids include antigens that are obtained from, or derived from, one clade and other plasmids include antigens that are WO 03/076591 PCT/US03/07177 obtained (or derived) from another clade. Mixtures representing two, three, four, five, six, or more clades (including all clades) are within the scope of the invention.
Where first and second vectors are included in a composition, either vector can be pGA1/JS2, pGA1/JS7, pGAl/JS7.1, pGA2/JS2, pGA2/JS7, pGA2/JS7.1 (pGA1.1 or pGA1.2 can be used in place ofpGAl and pGA2.1 or pGA2.2 can by used in place ofpGA2).
Similarly, either vector can be pGA1/IC25, pGA1/IC2, pGA1/IC48, pGA1/IC90, pGA2/IC25, pGA2/IC2, pGA2/IC48, or pGA2/IC90 (here again, pGA1.1 or pGA1.2 can be used in place of pGAl and pGA2.1 or pGA2.2 can be used in place of pGA2). In alternative embodiments, the encoded proteins can be those of, or those derived from, a subtype C HIV HIV-1) or a recombinant form thereof. For example, the vector can be pGA1/IN2, pGA1.1/IN2, pGA1.2/IN2, pGAl/IN3, pGAl.1/IN3, pGA1.2/IN3, pGA2/IN2, pGA2.1/IN2, pGA2.2/IN2, pGA2/IN3, pGA2.l/IN3, or pGA2.2/IN3.
The encoded proteins can also be those of, or those derived from, any of HIV clades (or subtypes) E, F, G, H, I, J, K or L or recombinant forms thereof. An HIV-1 classification system has been published by Los Alamos National Laboratory (HIV Sequence Compendium-2001, Kuiken et al, publ;ished by Theoretical Biology and Biophysics Group Los Alamos, NM, (2001); http://hiv-web.lanl.gov).
The compositions of the invention can also include a vector a plasmid vector) encoding: a Gag protein in which one or both zinc fingers have been inactivated; a Pol protein in which the integrase activity has been inhibited by deletion of some or all of the pol sequence, (ii) the polymerase, strand transfer and/or RNase H activity of reverse transcriptase has been inhibited by one or more point mutations within the pol sequence and (iii) the proteolytic activity of the protease has been inhibited by one or more point mutations; and Env, Tat, Rev, and Vpu, with or without mutations. As noted above, proteolytic activity can be inhibited by introducing a mutation at positions 1641-1643 of SEQ ID NO:8 or at an analogous position in the sequence of another HIV clade. For example, the plasmids can contain the inserts described herein as JS7, IC25, and IN3. As is true for plasmids encoding other antig'ens, plasmids encoding the antigens just described can be combined with mixed with) other plasmids that encode antigens obtained from, or derived from, a different HIV clade (or subtype or recombinant form thereof). The inserts per se (sans vector) are also within the scope of the invention.
WO 03/076591 PCT/US03/07177 Other vectors of the invention include plasmids encoding a Gag protein a Gag protein in which one or both of the zinc fingers have been inactivated); a Pol protein a Pol protein in which integrase, RT, and/or protease activities have been inhibited; a Vpu protein (which may be encoded by a sequence having a mutant start codon); and Env, Tat, and/or Rev proteins (in a wild type or mutant form). As is true for plasmids encoding other antigens, plasmids encoding the antigens just described can be combined with mixed with) other plasmids that encode antigens obtained from, or derived from, a different HIV clade (or subtype or recombinant form thereof). The inserts per se (sans vector) are also within the scope of the invention.
The plasmids described above, including those that express the JS2 or JS7 series of clade B HIV-I sequences, can be administered to any subject, but may be most beneficially administered to subjects who have been, or who are likely to be, exposed to an HIV of clade B (the same is true for vectors other than plasmid vectors). Similarly, plasmids or other vectors that express an IN series of clade C HIV-1 sequences can be administered to a subject who has been, or who may be, exposed to an HIV of clade C. As vectors expressing antigens of various clades can be combined to elicit an immune response against more than one clade (this can be achieved whether one vector expresses multiple antigens from different clades or multiple vectors express single antigens from different clades), one can tailor the vaccine formulation to best protect a given subject. For example, if a subject is likely to be exposed to regions of the world where clades other than clade B predominate, one can formulate and administer a vector or vectors that express an antigen (or antigens) that will optimize the elicitation of an immune response to the predominant clade or clades.
The antigens they express are not the only parts of the plasmid vectors that can vary.
Useful plasmids may or may not contain a terminator sequence that substantially inhibits transcription (the process by which RNA molecules are formed upon DNA templates by complementary base pairing). Useful terminator sequences include the lambda TO terminator and functional fragments or variants thereof. The terminator sequence is positioned within the vector in the same orientation and at the C terminus of any open reading frame that is expressed in prokaryotes the terminator sequence and the open reading frame are operably linked). By preventing read through from the selectable marker into the vaccine WO 03/076591 PCT/US03/07177 insert as the plasmid replicates in prokaryotic cells, the terminator stabilizes the insert as the bacteria grow and the plasmid replicates.
Selectable marker genes are known in the art and include, for example, genes encoding proteins that confer antibiotic resistance on a cell in which the marker is expressed resistance to kanamycin, ampicillin, or penicillin). The selectable marker is so-named because it allows one to select cells by virtue of their survival under conditions that, absent the marker, would destroy them. The selectable marker, the terminator sequence, or both (or parts of each or both) can be, but need not be, excised from the plasmid before it is administered to a patient. Similarly, plasmid vectors can be administered in a circular form, after being linearized by digestion with a restriction endonuclease, or after some of the vector "backbone" has been altered or deleted.
The nucleic acid vectors can also include an origin of replication a prokaryotic ori) and a transcription cassette that, in addition to containing one or more restriction endonuclease sites, into which an antigen-encoding insert can be cloned, optionally includes a promoter sequence and a polyadenylation signal. Promoters known as strong promoters can be used and may be preferred. One such promoter is the cytomegalovirus (CMV) intermediate early promoter, although other (including weaker) promoters may be used without departing from the scope of the present invention. Similarly, strong polyadenylation signals may be selected the signal derived from a bovine growth hormone (BGH) encoding gene, or a rabbit P globin polyadenylation signal (Bohm et al., J. Immunol..
Methods 193:29-40, 1996; Chapman et al., Nucl. Acids Res. 19:3979-3986, 1991; Hartikka et al., Hum. Gene Therapy 7:1205-1217, 1996; Manthorpe et al., Hum. Gene Therapy 4:419- 431, 1993; Montgomery et al., DNA Cell Biol. 12:777-783, 1993)).
The vectors can further include a leader sequence (a leader sequence that is a synthetic homolog of the tissue plasminogen activator gene leader sequence (tPA) is optional in the transcription cassette) and/or an intron sequence such as a cytomegalovirus (CMV) intron A or an SV40 intron. The presence of intron A increases the expression of many antigens from RNA viruses, bacteria, and parasites, presumably by providing the expressed RNA with sequences that support processing and function as a eukaryotic mRNA.
Expression can also be enhanced by other methods known in the art including, but not limited to, optimizing the codon usage of prokaryotic mRNAs for eukaryotic cells (Andre WO 03/076591 PCT/US03/07177 et al., J. Virol. 72:1497-1503, 1998; Uchijima et al., J. Immunol. 161:5594-5599, 1998).
Multi-cistronic vectors may be used to express more than one immunogen or an immunogen and an immunostimulatory protein (Iwasaki et al., J. Immunol. 158:4591-4601, 1997a; Wild et al., Vaccine 16:353-360, 1998). Thus (and as is true with other optional components of the vector constructs), vectors encoding one or more antigens from one or more HIV clades or isolates may, but do not necessarily, include a leader sequence and an intron the CMV intron A).
The vectors of the present invention differ in the sites that can be used for accepting antigen-encoding sequences and in whether the transcription cassette includes intron A sequences in the CMVIE promoter. Accordingly, one of ordinary skill in the art may modify the insertion site(s) or cloning site(s) within the plasmid without departing from the scope of the invention. Both intron A and the tPA leader sequence have been shown in certain instances to enhance antigen expression (Chapman et al., Nucleic Acids Research 19:3979- 3986, 1991).
As described further below, the vectors of the present invention can be administered with an adjuvant, including a genetic adjuvant. Accordingly, the nucleic acid vectors, regardless of the antigen they express, can optionally include such genetic adjuvants as GM- CSF, IL-15, IL-2, interferon response factors, secreted forms of flt-3, and mutated caspase genes. Genetic adjuvants can also be supplied in the form of fusion proteins, for example by fusing one or more C3d gene sequences 1-3 (or more) C3d gene sequences) to an expressed antigen.
In the event the vector administered is a pGA vector, it can comprise the sequence of, for example, pGA1 (SEQ ID NO:1) or derivatives thereof SEQ ID NOs:2 and 3) or pGA2 (SEQ ID NO:4) or derivatives thereof SEQ ID NOs:5 and The pGA vectors are described in more detail here (see also Examples pGAl is a 3897 bp plasmid that includes a promoter (bp 1-690), the CMV-intron A (bp 691-1638), a synthetic mimic of the tPA leader sequence (bp 1659 1721), the bovine growth hormone polyadenylation sequence (bp1761-1983), the lambda TO terminator (bp 1984-2018), the kanamycin resistance gene (bp 2037-2830) and the ColEI replicator (bp 2831-3890). The DNA sequence of the pGA1 construct (SEQ ID NO: 1) is shown in Fig. 2. In Fig. 1, the indicated restriction sites are useful for cloning antigen-encoding sequences. The Cla I or BspD I sites WO 03/076591 PCT/US03/07177 are used when the 5' end of a vaccine insert is cloned upstream of the tPA leader. The Nhe I site is used for cloning a sequence in frame with the tPA leader sequence. The sites listed between Sma I and Bin I are used for cloning the 3' terminus of an antigen-encoding sequence.
pGA2 is a 2947 bp plasmid lacking the 947 bp ofintron A sequences found in pGA1.
pGA2 is the same as pGA1, except for the deletion of intron A seqences. pGA2 is valuable for cloning sequences which do not require an upstream intron for efficient expression, or for cloning sequences in which an upstream intron might interfere with the pattern of splicing needed for good expression. Fig. 5 presents a schematic map of pGA2 with useful restriction sites for cloning vaccine inserts. Fig. 6a shows the DNA sequence of pGA2 (SEQ ID NO:2).
The use of restriction sites for cloning vaccine inserts into pGA2 is the same as that used for cloning fragments into pGA1. pGA2.1 and pGA2.2 are multiple cloning site derivatives of pGA2. Figs. 7a and 8a show the DNA sequence of pGA2.1 (SEQ ID NO:5) and pGA2.2 (SEQ ID NO:6) respectively.
pGA plasmids having "backbone" sequences that differ from those disclosed herein are also within the scope of the invention so long as the plasmids retain substantially all of the characteristics necessary to be therapeutically effective one can substitute nucleotides, add nucleotides, or delete nucleotides so long as the plasmid, when administered to a patient, induces or enhances an immune response against a given or desired pathogen).
For example, 1-10, 11-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, or more than 100 nucleotides can be deleted or replaced.
In one embodiment, the methods of the invention methods of eliciting an immune response in a patient) can be carried out by administering to the patient a therapeutically effective amount of a physiologically acceptable composition that includes a vector, which can contain a vaccine insert that encodes one or more antigens that elicit an immune response against an HIV. The vector can be a plasmid vector having one or more of the characteristics of the pGA constructs described above a selectable marker gene, a prokaryotic origin of replication, a termination sequence the lambda TO terminator) and operably linked to the selectable gene marker, and a eukaryotic transcription cassette comprising a promoter sequence, a nucleic acid insert encoding at least one antigen derived from an immunodeficiency virus, and a polyadenylation signal sequence). Of course, the WO 03/076591 PCT/US03/07177 vaccine inserts of the invention may be delivered by plasmid vectors that do not have the characteristics of the pGA constructs vectors other than pGA1 or pGA2).
Alternatively, the composition can include any viral or bacterial vector that includes an insert described herein. The invention, therefore, encompasses administration of a single type of vector plasmid or viral vectors that contain the same vaccine insert an insert encoding the same antigens)). As is made clear elsewhere, the patient may receive two types of vectors, and each of those vectors can elicit an immune response against an HIV of a different clade. For example, the invention features methods in which a patient receives a composition that includes a first vector comprising a vaccine insert encoding one or more antigens that elicit an immune response against a human immunodeficiency virus (HIV) of a first subtype or recombinant form and a second vector comprising a vaccine insert encoding one or more antigens that elicit an immune response against an HIV of a second subtype or recombinant form. The first and second vectors can be any of those described herein. Similarly, the inserts in the first and second vectors can be any of those described herein.
A therapeutically effective amount of a vector (whether considered the first, second, third, etc. vector) can be administered by an intramuscular or an intradermal route, together with a physiologically acceptable carrier, diluent, or excipient, and, optionally, an adjuvant.
A therapeutically effective amount of the same or a different vector can subsequently be administered by an intramuscular or an intradermal route, together with a physiologically acceptable carrier, diluent, or excipient, and, optionally, an adjuvant to boost an immune response. Such components can be readily selected by one of ordinary skill in the art, regardless of the precise nature of the antigens incorporated in the vaccine or the vector by which they are delivered.
The methods of eliciting an immune response can be carried out by administering only the plasmid vectors of the invention, by administering only the viral vectors or recombinant virus of the invention, or by administering both one can administer a plasmid vector (or a mixture or combination ofplasmid vectors)) to "prime" the immune response and a viral vector or recombinant virus (or a mixture or combination of viral vectors)) to "boost" the immune response. Where plasmid and viral vectors or recombinant virus are administered, their inserts may be "matched." To be "matched," one or more of the WO 03/076591 PCT/US03/07177 sequences of the inserts the sequences encoding Gag, or the sequences encoding Env, etc.) within the plasmid and viral vectors within the recombinant virus may be identical, but the term is not so limited. "Matched" sequences can also differ from one another. For example, inserts expressed by viral vectors are "matched" to those expressed by DNA vectors when the sequences used in the DNA vector are mutated or further mutated to allow (or optimize) replication of a viral vector that encodes those sequences and expression of the encoded antigens Gag, Gag-Pol, or Env) in cells infected with the viral vector.
At least some of the immunodeficiency virus vaccine inserts of the present invention were designed to generate non-infectious VLPs (a term that can encompass true VLPs as well as aggregates of viral proteins) from a single DNA. This was achieved using the subgenomic splicing elements normally used by immunodeficiency viruses to express multiple gene products from a single viral RNA. The subgenomic splicing patterns are influenced by splice sites and acceptors present in full length viral RNA, (ii) the Rev responsive element (RRE) and (iii) the Rev protein. The splice sites in retroviral RNAs use the canonical sequences for splice sites in eukaryotic RNAs. The RRE is an approximately 200 bp RNA structure that interacts with the Rev protein to allow transport of viral RNAs from the nucleus to the cytoplasm. In the absence of Rev, the approximately 10 kb RNA of immunodeficiency virus mostly undergoes splicing to the mRNAs for the regulatory genes Tat, Rev, and Nef. These genes are encoded by exons present between RT and Env and at the 3' end of the genome. In the presence of Rev, the singly spliced mRNA for Env and the unspliced mRNA for Gag and Pol are expressed in addition to the multiply spliced mRNAs for Tat, Rev, and Nef.
The expression of non-infectious VLPs from a single DNA affords a number of advantages to an immunodeficiency virus vaccine. The expression of a number of proteins from a single DNA affords the vaccinated host the opportunity to respond to the breadth of T- and B-cell epitopes encompassed in these proteins. The expression of proteins containing multiple epitopes allows epitope presentation by diverse histocompatibility types. By using whole proteins, one offers hosts of different histocompatibility types the opportunity to raise broad-based T cell responses. This may be essential for the effective containment of immunodeficiency virus infections, whose high mutation rate supports ready escape from immune responses (Evans et al., Nat. Med. 5:1270-1276, 1999; Poignard et al., Immunity WO 03/076591 PCT/US03/07177 10:431-438, 1999, Evans et al., 1995). In the context of the present vaccination scheme, just as in drug therapy, multi-epitope T cell responses that require multiple mutations for escape will provide better protection than single epitope T cell responses (which require only a single mutation for escape).
Immunogens can also be engineered to be more or less effective for raising antibody or Tc by targeting the expressed antigen to specific cellular compartments. For example, antibody responses are raised more effectively by antigens that are displayed on the plasma membrane of cells, or secreted therefrom, than by antigens that are localized to the interior of cells (Boyle et al., Int. Immunol. 9:1897-1906, 1997; Inchauspe et al., DNA Cell. Biol.
16:185-195, 1997). Tc responses may be enhanced by using N-terminal ubiquitination signals which target the DNA-encoded protein to the proteosome causing rapid cytoplasmic degradation and more efficient peptide loading into the MHC I pathway (Rodriguez et al., J. Virol. 71:8497-8503, 1997; Tobery et al., J. Exp. Med. 185:909-920, 1997; Wu et al., J. Immunol. 159:6037-6043, 1997). For a review on the mechanistic basis for DNA-raised immune responses, refer to Robinson and Pertmer, Advances in Virus Research, vol. 53, Academic Press (2000).
Another approach to manipulating immune responses is to fuse immunogens to immunotargeting or immunostimulatory molecules. To date, the most successful of these fusions have targeted secreted immunogens to antigen presenting cells (APCs) or lymph nodes (Boyle et al., Nature 392:408-411, 1998). Accordingly, the invention features the HIV antigens described herein fused to immunotargeting or immunostimulatory molecules such as CTLA-4, L-selectin, or a cytokine an interleukin such as IL-1, IL-2, IL-4, IL-7, or IL-21). Nucleic acids encoding such fusions and compositions containing them vectors and physiologically acceptable preparations) are also within the scope of the present invention.
DNA can be delivered in a variety of ways, any of which can be used to deliver the plasmids of the present invention to a subject. For example, DNA can be injected in, for example, saline using a hypodermic needle) or delivered biolistically (by, for example, a gene gun that accelerates DNA-coated beads). Saline injections deliver DNA into extracellular spaces, whereas gene gun deliveries bombard DNA directly into cells. The saline injections require much larger amounts of DNA (typically 100-1000 times more) than WO 03/076591 PCT/US03/07177 the gene gun (Fynan et al., Proc. Natl. Acad. Sci. USA 90:11478-11482, 1993). These two types of delivery also differ in that saline injections bias responses towards type 1 T-cell help, whereas gene gun deliveries bias responses towards type 2 T-cell help (Feltquate et al., J. Immunol. 158:2278-2284, 1997; Pertmer et al., J. Virol. 70:6119-6125, 1996). DNAs injected in saline rapidly spread throughout the body. DNAs delivered by the gun are more localized at the target site. Following either method of inoculation, extracellular plasmid DNA has a short half life of about 10 minutes (Kawabata et al., Pharm. Res. 12:825-830, 1995; Lew et al., Hum. Gene Ther. 6:553, 1995). Vaccination by saline injections can be intramuscular or intradermal gene gun deliveries can be administered to the skin or to surgically exposed tissue such as muscle.
While other routes of delivery are generally less favored, they can nevertheless be used to administer the compositions of the invention. For example, the DNA can be applied to the mucosa or by a parenteral route of inoculation. Intranasal administration of DNA in saline has met with both good (Asakura et al., Scand. J. Immunol. 46:326-330, 1997; Sasaki et al., Infect. Immun. 66:823-826, 1998b) and limited (Fynan et al., Proc. Natl. Acad. Sci.
USA 90:11478-82,1993) success. The gene gun has successfully raised IgG following the delivery of DNA to the vaginal mucosa (Livingston et al., Ann. New York Acad. Sci.
772:265-267, 1995). Some success at delivering DNA to mucosal surfaces has also been achieved using liposomes (McCluskie et al., Antisense Nucleic Acid Drug Dev. 8:401-414, 1998), microspheres (Chen et al., J. Virol. 72:5757-5761, 1998a; Jones et al., Vaccine 15:814-817, 1997) and recombinant Shigella vectors (Sizemore et al., Science 270:299-302, 1995; Sizemore et al., Vaccine 15:804-807, 1997). Agents such as these (liposomes, microspheres and recombinant Shigella vectors) can be used to deliver the nucleic acids of the present invention.
The dose of DNA needed to raise a response depends upon the method of delivery, the host, the vector, and the encoded antigen. The method of delivery may be the most influential parameter. From 10 pg to 5mg of DNA is generally used for saline injections of DNA, whereas from 0.2 pg to 20 pLg of DNA is used more typically for gene gun deliveries of DNA. In general, lower doses of DNA are used in mice (10-100 pg for saline injections and 0.2 pg to 2 pg for gene gun deliveries), and higher doses in primates (100 pg to 1 mg for saline injections and 2 pg to 20 pg for gene gun deliveries). The much lower amount of WO 03/076591 PCT/US03/07177 DNA required for gene gun deliveries reflect the gold beads directly delivering DNA into cells.
In addition to the DNA vectors described above, a number of different poxviruses can be used either alone without a nucleic acid or DNA prime) or as the boost component of a vaccine regimen. MVA has been particularly effective in mouse models (Schneider et aL, Nat. Med. 4:397-402, 1998). MVA is a highly attenuated strain of vaccinia virus that was developed toward the end of the campaign for the eradication of smallpox, and it has been safety tested in more than 100,000 people (Mahnel et al., Berl. Munch Tierarztl Wochenschr 107:253-256, 1994; Mayr et al. Zentralbl. Bakteriol. 167:375-390, 1978). During over 500 passages in chicken cells, MVA lost about 10% of its genome and the ability to replicate efficiently in primate cells. Despite its limited replication, MVA has proved to be a highly effective expression vector (Sutter et al., Proc. Natl. Acad. Sci. USA 89:10847-10851, 1992), raising protective immune responses in primates for parainfluenza virus (Durbin et al.
J. Infect. Dis. 179:1345-1351, 1999), measles (Stittelaar et al. J Virol. 74:4236-4243, 2000), and immunodeficiency viruses (Barouch et al., J. Virol. 75:5151-5158, 2001; Ourmanov et al., J. Virol. 74:2740-2751, 2000; Amara et al., J. Virol. 76:7625-7631, 2002). The relatively high immunogenicity of MVA has been attributed in part to the loss of several viral antiimmune defense genes (Blanchard et al., J. Gen. Virol. 79:1159-1167, 1998).
Vaccinia viruses have been used to engineer viral vectors for recombinant gene expression and as recombinant live vaccines (Mackett et al., Proc. Natl. Acad. Sci. USA 79:7415-7419; Smith et al., Biotech. Genet. Engin. Rev. 2:383-407, 1984). DNA sequences, which may encode any of the HIV antigens described herein, can be introduced into the genomes of vaccinia viruses. If the gene is integrated at a site in the viral DNA that is nonessential for the life cycle of the virus, it is possible for the newly produced recombinant vaccinia virus to be infectious able to infect foreign cells) and to express the integrated DNA sequences. Preferably, the viral vectors featured in the compositions and methods of the present invention are highly attenuated. Several attenuated strains of vaccinia virus were develpped to avoid undesired side effects of smallpox vaccination. The modified vaccinia Ankara (MVA) virus was generated by long-term serial passages of the Ankara strain of vaccinia virus on chicken embryo fibroblasts (CVA; see Mayr et al., Infection 3:6-14, 1975).
The MVA virus is publicly available from the American Type Culture Collection (ATCC; WO 03/076591 PCT/US03/07177 No. VR-1508; Manassas, VA). The desirable properties of the MVA strain have been demonstrated in clinical trials (Mayr et al., Zentralbl. Bakteriol. 167:375-390, 1978; Stickl et al., Dtsch. Med. Wschr. 99:2386-2392, 1974; see also, Sutter and Moss, Proc. Natl. Acad.
Sci. USA 89:10847-10851, 1992). During these studies in over 120,000 humans, including high-risk patients, no side effects were associated with the use of MVA vaccine.
The MVA vectors can be prepared as follows. A DNA construct that contains a DNA sequence, an insert sequence described herein, that encodes a foreign polypeptide any of the HIV antigens described herein) and that is flanked by MVA DNA sequences adjacent to a naturally occurring deletion with the MVA genome deletion I or other non-essential site(s); six major deletions of genomic DNA (designated deletions I, II, III, IV, V, and VI) totaling 31,000 base pairs have been identified (Meyer et al., J. Gen. Virol.
72:1031-1038, 1991)) is introduced into cells infected with MVA under conditions that permit homologous recombination to occur. Once the DNA construct has been introduced into the eukaryotic cell and the foreign DNA has recombined with the viral DNA, the recombinant vaccinia virus can be isolated by methods known in the art (isolation can be facilitated by use of a detectable marker). The DNA constructed to be inserted can be linear or circular a plasmid, linearized plasmid, gene, gene fragment, or modified HIV genome). The foreign DNA sequence is inserted between the sequences flanking the naturally occurring deletion. For better expression of a DNA sequence, the sequence can include regulatory sequences a promoter, such as the promoter of the vaccinia 11 kDa gene or the 7.5 kDa gene). The DNA construct can be introduced into MVA-infected cells by a variety of methods, including calcium phosphate-assisted transfection (Graham et al., Virol. 52:456-467, 1973 and Wigler et al., Cell 16:777-785, 1979), electroporation (Neumann et al., EMBO J 1:841-845, 1982) microinjection (Graessmann et al., Meth.
Enzymol. 101:482-492, 1983), by means of liposomes (Straubinger et al., Meth. Enzymol.
101:512-527, 1983), by means of spheroplasts (Schaffner, Proc. Natl. Acad. Sci. USA 77:2163-2167, 1980), or by other methods known in the art. The preparation of recombinant MVA virus is described in greater detail in Moss et al. PCT Publication WO 02/07275 A2 (International Application No. PCT/US02/06713) One can arrive at an appropriate dosage when delivering DNA by way of a viral vector, just as one can when a plasmid vector is used. For example, one can deliver 1 x 108 WO 03/076591 PCT/US03/07177 pfu of an MVA-based vaccine, and administration can be carried out intramuscularly, intradermally, intravenously, or mucosally.
Accordingly, the invention features a composition comprising: a first viral vector comprising a vaccine insert encoding one or more antigens that elicit an immune response against a human immunodeficiency virus (HIV) of a first subtype or recombinant form and a second viral vector comprising a vaccine insert encoding one or more antigens that elicit an immune response against an HIV of a second subtype or recombinant form. The viral vector can be a recombinant poxvirus or a modified vaccinia Ankara (MVA) virus, and the insert can be any of the HIV antigens described herein from any clade one can administer a prophylactically or therapeutically effective amount of an MVA that encodes a clade A, B, or C HIV HIV-1 antigen). Moreover, when administered in conjunction with a plasmid vector when administered subsequent to a "DNA prime"), the MVAborne sequence can be "matched" to the plasmid-bome sequence. For example, a vaccinia virus MVA) that expresses a recombinant clade B sequence can be matched to the JS series of plasmid inserts. Similarly, a vaccinia virus MVA) that expresses a recombinant clade A sequence can be matched to the IC series of plasmid inserts; a vaccinia virus MVA) that expresses a recombinant clade C sequence can be matched to the IN series ofplasmid inserts. While particular clades are exemplified below, the invention is not so limited. The compositions that contain a viral vector, can include viral vectors that express an HIV antigen from any known clade (including clades A, B, C, D, E, F, G, H, I, J, K or Methods of eliciting an immune response can, of course, be carried out with compositions expressing antigens from any of these clades as well.
Either the plasmid or viral vectors described here can be administered with an adjuvant any substance that is added to a vaccine to increase the vaccine's immunogenicity) and they can be administered by any conventional route of administration intramuscular, intradermal, intravenous or mucosally; see below). The adjuvant used in connection with the vectors described here (whether DNA or viral-based) can be one that slowly releases antigen the adjuvant can be a liposome), or it can be an adjuvant that is strongly immunogenic in its own right (these adjuvants are believed to function synergistically). Accordingly, the vaccine compositions described here can include known adjuvants or other substances that promote DNA uptake, recruit immune system cells to the WO 03/076591 PCT/US03/07177 site of the inoculation, or facilitate the immune activation of responding lymphoid cells.
These adjuvants or substances include oil and water emulsions, Corynebacterium parvum, Bacillus Calmette Guerin, aluminum hydroxide, glucan, dextran sulfate, iron oxide, sodium alginate, Bacto-Adjuvant, certain synthetic polymers such as poly amino acids and copolymers of amino acids, saponin, REGRESSIN (Vetrepharm, Athens, AVRIDINE N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine), paraffin oil, and muramyl dipeptide. Genetic adjuvants, which encode immunomodulatory molecules on the same or a co-inoculated vector, can also be used. For example, GM-CSF, IL-15, IL-2, interferon response factors, and mutated caspase genes can be included on a vector that encodes a pathogenic immunogen (such as an HIV antigen) or on a separate vector that is administered at or around the same time as the immunogen is administered. Expressed antigens can also be fused to an adjuvant sequence such as one, two, three or more copies of C3d.
The compositions described herein can be administered ina variety of ways including through any parenteral or topical route. For example, an individual can be inoculated by intravenous, intraperitoneal, intradermal, subcutaneous or intramuscular methods.
Inoculation can be, for example, with a hypodermic needle, needleless delivery devices such as those that propel a stream of liquid into the target site, or with the use of a gene gun that bombards DNA on gold beads into the target site. The vector comprising the pathogen vaccine insert can be administered to a mucosal surface by a variety of methods including intranasal administration, nose drops or inhalants, or intrarectal or intravaginal administration by solutions, gels, foams, or suppositories. Alternatively, the vector comprising the vaccine insert can be orally administered in the form of a tablet, capsule, chewable tablet, syrup, emulsion, or the like. In an alternate embodiment, vectors can be administered transdermally, by passive skin patches, iontophoretic means, and the like.
Any physiologically acceptable medium can be used to introduce a vector (whether nucleic acid-based or live-vectored) comprising a vaccine insert into a patient. For example, suitable pharmaceutically acceptable carriers known in the art include, but are not limited to, sterile water, saline, glucose, dextrose, or buffered solutions. The media may include auxiliary agents such as diluents, stabilizers sugars (glucose and dextrose were noted previously) and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, additives that enhance viscosity or syringability, colors, and the like. Preferably, the WO 03/076591 PCT/US03/07177 medium or carrier will not produce adverse effects, or will only produce adverse effects that are far outweighed by the benefit conveyed.
The present invention is further illustrated by the following examples, which are provided by way of illustration and should not be construed as limiting. The contents of all references, published patent applications and patents cited throughout the present application are hereby incorporated by reference in their entirety. A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention.
Example 1: pGA1 pGA1 (see Figs. 1 and 2) contains the ColEl origin of replication (a 672 bp sequence that contains the origin of replication (ori) and encodes an RNA primer and two negative regulators of replication initiation) the kanamycin resistance gene (an antibiotic resistance gene for plasmid selection in bacteria), the lambda TO terminator, and a eukaryotic expression cassette that includes an upstream intron (here, CMV Intron the CMV immediate early (CMVIE) promoter, and termination sequences from the bovine growth hormone polyadenylation sequence (BGHpA). A synthetic mimic of the leader sequence for tissue plasminogen activator (tPA) can also be included within the expression cassette. The expression cassette can include multiple restriction sites, and those sites can be included or excluded as desired to facilitate inclusion of expression cassettes that encode antigens from any HIV clade. The cloning sites in pGA1 include a Cla I site upstream of the tPA leader, a Nhe I site for cloning in frame with the tPA leader, and Xmn I, Sma I, Rsr II, and Avr II sites for cloning prior to the BGHpA. The originally constructed plasmid containing the ColE1 replicator was pBR322 (Bolivar et al., Gene 2:95-113, 1977; Sutcliffe et al., Cold Spring Harbor Quant. Biol. 43:77-90, 1978).
The lambda TO terminator (Scholtissek et al., Nucleic Acids Res. 15:3185, 1987) prevents read through from the kanamycin resistance gene into the eukaryotic expression cassette (in this case the vaccine transcription cassette) during prokaryotic growth of the plasmid. By preventing read through into the vaccine expression cassette, the terminator helps stabilize plasmid inserts during growth in bacteria.
WO 03/076591 PCT/US03/07177 The ColE1 replicator, the kanamycin resistance gene, and the transcriptional control elements for eukaryotic cells were combined in one plasmid using PCR fragments from the commercial vector pZErO-2.1 (Invitrogen, Carlsbad, CA) and a eukaryotic expression vector pJW4303 (Lu et al., Vaccine 15:920-923, 1997).
An 1859 bp fragment from pZErO-2.1 (nucleotides 1319 to 3178) included the ColEl origin of replication and the kanamycin resistance gene. A 2040 bp fragment from pJW4303 (nucleotides 376 to 2416) included the CMVIE promoter with intron A, a synthetic homolog of the tissue plasminogen activator leader (tPA), and the bovine growth hormone polyadenylation site (BGHpA). Fragments were amplified by polymerase chain reaction (PCR) with oligonucleotide primers containing Sal I sites. A ligation product with the transcription cassettes for kanamycin resistance from pZErO2 and the eukaryotic transcription cassette form pJW4303 in opposite transcriptional orientations, was identified for further development. Nucleotide numbering for this parent of the pGA vectors was started from the first bp of the 5' end of the CMV promoter.
The TO terminator was introduced into this parent for the pGA vectors by PCR amplification of a 391 bp fragment with a BamH I restriction endonuclease site at its 5' end and an Xba I restriction endonuclease site at its 3' end. The initial 355 bp of the fragment were sequences in the BGHpA sequence derived from the pJW4303 transcription cassette, the next 36 bases in a synthetic oligonuclotide introduced the TO sequence and the Xba I site.
The introduced TO terminator sequences comprised the sequence: ATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAA-3' (SEQ ID NO: 16).
The TO terminator containing the BamH I-Xba I fragment was substituted for the homologous fragment without the TO terminator in the plasmid created from pZErO-2 and pJW4303. The product was sequenced to verify the TO orientation (Fig. 1).
A region in the eukaryotic transcription cassette between nucleotides 1755-1845 contained the last 30 bp of the reading frame for SIV nef. This region was removed from pGA by mutating the sequence at nt 1858 and generating an Avr II restriction endonuclease site. A naturally occurring Avr II site is located at nt 1755. Digestion with Avr II enzyme and then religation with T4 DNA ligase allowed for removal of the SIV segment of DNA between nucleotides 1755-1845. To facilitate cloning of HIV-1 sequences into pGA vectors, WO 03/076591 PCT/US03/07177 a Cla I site was introduced at bp1648 and an Rsr II site at bp 1747 using standard techniques for site directed mutagenesis. Constructions were verified by sequence analyses.
Example 2: pGA1.1 pGA1.1 (SEQ ID NO: 2) is identical to pGA1 except that the multiple cloning site has been altered to include an EcoRI site. This was accomplished by site directed mutagenesis using the following primers: 5'-GCTGCTGCTGTGTGGAGAATTCTTCGTTTCGGC-3' (forward) and 5'-GCCGAAACGAAGAATTCTCCACACAGCAGCAGC-3' (reverse) (SEQ ID NOs:17 and 18 respectively). Accordingly, the pGAl.1 vector is an embodiment of the invention; as are other vectors having one or more of the features or characteristics of a pGA plasmid (see the detailed description), but different restriction endonuclease sites in the multi-cloning site the invention encompasses plasmids that are otherwise substantially similar to pGA1 but that have more, less, or different restriction endonuclease sites in their multi-cloning site).
Example 3: pGA1.2 pGA1.2 (SEQ ID NO: 3)is identical to pGA1.1 except that the multiple cloning site has been altered to include BamHI and XhoI sites 5' to' the EcoRI site. This was accomplished by site directed mutagenesis using the primer CTGCAGTCACCATGGATCCTTGCACT-CGAGGATGCAATGAAGAG- 3' (SEQ ID NO:19) and the reverse primer 3' (SEQ ID Example 4: pGA2 pGA2 is schematically illustrated in Fig. 5, and its nucleotide sequence is shown in Fig. 6 (SEQ ID NO: pGA2 is identical to pGAl except that the intron A sequence has been deleted from the CMV promoter of pGA2. pGA2 was created from pGA1 by introducing a Cla I site 8 bp downstream from the mRNA cap site in the CMV promoter; the Cla I site was introduced using oligonucleotide-directed mutagenesis using complimentary primers having WO 03/076591 PCT/US03/07177 the SEQuences: 5'-CCGTCAGATCGCATCGATACGCCATCCACG-3' (SEQ ID NO: 19 and 5'-CGTGGATGGCGTATCGATGCGATCTGACGG-3' (SEQ ID NO: 20). After insertion of the new Cla I site, pGA1 was digested with Cla I to remove the 946 bp Cla I fragment from pGA1, and then religated to yield pGA2.
Example 5: pGA2.1 PGA2.1 (SEQ ID NO:5) is identical to pGA2 except that the multiple cloning site has been altered to include an EcoRI sites. This was accomplished by site directed mutagenesis using using the following primers: forward 5'-GCTGCTGCTGTGTGGAGAATTCTTCGTTTCGGC-3' (SEQ ID NO:17) and reverse 5'-GCCGAAACGAAGAATTCTCCACACAGCAGCAGC-3' (SEQ ID NO:18).
Accordingly, the pGA2.1 vector is an embodiment of the invention; as are other vectors having one or more of the features or characteristics of a pGA plasmid (see the detailed description), but different restriction endonuclease sites in the multi-cloning site the invention encompasses plasmids that are otherwise substantially similar to pGA1 but that have more, less, or different restriction endonuclease sites in their multi-cloning site).
Example 6: pGA2.2 PGA2.2 (SEQ ID NO: 6) is identical to pGA1.1 except that the multiple cloning site has been altered to include a BamHI and a XhoI site 5' to the EcoRI site. This was accomplished by site directed mutagenesis using the forward primer GAACTCATTCTATGGATCCTTGC-TCGAGTGGATGCAATGAAGAG 3' and the reverse primer CACTCGAGCAAGGATCCATAGAATGAGTTC-3' (SEQ ID NOs:23 and 24 respectively) Example 7: Immunodeficiency Virus Vaccine Inserts HIV-1 vaccine inserts for the pGAI and pGA2 series of vectors were constructed to express multiple HIV-1 proteins from a single RNA transcript using the same subgenomic splicing mechanisms used by immunodeficiency viruses. To ensure that these multiproteinexpressing vectors did not form infectious virus, deletions and point mutations were introduced to cripple essential steps in the retrovirus life cycle. Fig. 9 presents schematics of WO 03/076591 PCT/US03/07177 the normal retroviral genome and a representative vaccine insert. Regions that have been deleted in the insert are stippled. X's indicate point mutations. The deletions included both of the long terminal repeat (LTR) sequences that encode cis-acting elements for reverse transcription, integration, and expression ofproviral DNA. 5' sequences adjacent to the LTR that promote encapsidation of viral RNA have been deleted. Coding sequences for the region ofpol encoding integrase as well as the auxiliary genes vifand vpr have been deleted.
And finally, nef, a gene encoding the Nef regulatory protein has been deleted. The seven point mutations that are common to all inserts described in the examples below are included in the schematic. These include four mutations in the zinc fingers in the nucleocapsid protein to limit zinc-finger-mediated packaging of viral RNA and three mutations in reverse transcriptase to prevent reverse transcription of viral RNA. Analogous changes can be made in any vaccine insert that includes gag andlorpol. Moreover, these changes (or analogous changes) can be made in vaccine inserts that are placed in any of the plasmid or live-vectored vaccines described herein in any plamid having one or more of the features or characteristics. of the pGA vectors, the pGA vectors themselves, or the vaccinia vectors that may be used alone or in conjunction with to boost) a DNA-primed patient).
The HIV-1 vaccine inserts described below can be expressed in any of the pGA vectors or further derivatives of these vectors. The examples for inserts that are given below are given with the example of the pGA vector that is planned for future use of that insert.
However, any of these inserts can be used in any of the pGA vectors as well as other eukaryotic expression vectors.
Example 8: pGA2/JS2, multiprotein clade B HIV-1 insert The sequence of pGA2/JS2 is shown in Fig. 7a (SEQ ID NO:7), its functional regions and the origins of these regions in Fig. 7b and the positions of its point mutations in Fig. 7c.
The JS2 insert described here was designed with clade B HIV-1 sequences so that it would elicit an immune response against HIV-1 sequences that are endemic in the United States, Europe, and Japan. As noted above, any clade B isolate can be used as a reasonable representative for other clade B isolates. Since HIV-1 isolates use different chemokine receptors as co-receptors, and the vast majority of viruses that are undergoing transmission use the CCR-5 co-receptor (Berger, AIDS 11(Suppl A):S3-16, 1997), the vaccine insert we WO 03/076591 PCT/US03/07177 designed had a CCR-5-using Env. Of course, Envs that function through any other coreceptor or that have been constructed from naturally occurring or synthetic sequences so as to increase immunogenicity can be made and used as well.
To achieve a multiprotein-expressing clade B vaccine insert with high expression, candidate vaccines were constructed from seven different HIV-1 sequences, as shown in Table 1.
Table 1: Comparison of candidate vaccine inserts Plasmid SEQuences Ability Expression Expression Comment designation tested to grow of Gag of Env plasmid BH10 Good Good Good X4 Env 6A-VLP 6A env in Poor Not tested not tested BAL-VLP BAL env in Good Poor Poor ADA-VLP ADA env in Good Good Good chosen for vaccine, renamed pGA1/JSl CDC-A-VLP CDC-A env in Good Good Poor CDC-B-VLP CDC-B-env in Good Good Good not as favorable _expression as ADA CDC-C-VLP CDC -C env Good Good Good not as favorable in BH10-VLP ___expression as ADA An initial construct, pBH10-VLP, was prepared from IIIB sequences that are stable in bacteria and have high expression in eukaryotic cells. The HIV-1-BH10 sequences were obtained from the NIH-sponsored AIDS Repository (catalog The parental pHIV-1was used as the template for PCR reactions to construct Primers were designed to yield a Gag-Rt PCR product PCR product) encompassing (from 5' to 105 bp of the 5' untranslated leader sequence and sequences from the start codon for Gag to the end of the RT coding sequence. The oligonucleotide primers introduced a Cla I site at the 5' end of the PCR product and EcoR I and Nhe I sites at the 3' end of the PCR product. Sense primer (5'-GAGCTCTATCGATGCAGGACTCGGCTTGC-3' (SEQ ID NO:25 and antisense primer (5'-GGCAGGTTTTAATCGCTAGCCTATGCTCTCC-3'(SEQ ID NO:26) were used to amplify the 5' PCR product.
WO 03/076591 PCT/US03/07177 The PCR product for the env region of HIV-1 PCR product) encompassed the vpu, tat, rev, and env sequences and the splice acceptor sites necessary for proper processing and expression of their respective mRNAs. An EcoR I site was introduced at the 5' end of this product and Nhe I and Rsr II sites were introduced into the 3' end. Sense primer (5'-GGGCAGGAGTGCTAGCC-3' (SEQ ID NO:27) and antisense primer 5'-CCACACTACTTTCGGACCGCTAGCCACCC-3' (SEQ ID NO: 28)) were used to amplify the 3' PCR product. The 5' PCR product was cloned into pGA1 at the Cla I and Nhe I sites of pGA1 and the identity of the construct confirmed by sequencing. The 3' PCR product was then inserted into the 5' clone at the EcoR I and Nhe I sites to yield pBH10. The construction of this plasmid resulted in proviral sequences that lacked LTRs, integrase, vif vpr and nefsequences (see Fig. 9).
Because pBH10-VLP encoded a CXCR-4 using Env, rather than a CCR-5 using Env, sequences encoding six different R5 Envs were substituted for env sequence in the intermediate (Table EcoR I to BamH I fragments encompassing tat, rev, vpu and env coding sequences from different viral genomes were substituted into pBH10. The resulting env and rev sequences were chimeras for the substituted seqences and HIV-1-BH10 sequences (see Fig. In the case of the HIV-1-ADA envelope, a BamH I site was introduced into the HIV-1-ADA sequence to facilitate substituting an EcoR I to BamH I fragment for the EcoR I to BamH I region of pBH10. The results of these constructions are summarized in Table 1. Of the six sequences tested, one, the 6A-VLP gave poor plasmid growth in transformed bacteria. The plasmid 6A-VLP was not developed further. Among the other constructs, the pBH10/ADA chimera produced the best expression of viral Gag and Env proteins (Table In transient transfections in 293T cells, the expression from the chimera was higher than that ofwt proviruses for HIV-1-ADA or HIV-1-IIIB.
Expression was also higher than for a previous multiprotein-expressing HIV-1 vaccine (dpol) (Richmond et al., J. Virol. 72:9092-9100, 1998) that had successfully primed cytotoxic T cell responses in rhesus macaques (Kent et al., J. Virol. 72:10180-10188, 1998). The chimera was now designated JS1. It should be recognized that plasmids having any given or desired HIV-1 inserts can be similarly assessed.
Next, inactivating point mutations were introduced into JS1 to further increase the safety of this construct for use in humans as a non-infectious vaccine agent (of course, WO 03/076591 WO 0/(17591PCT/US03/07177 mutations can be made preemptively, before any testing at all) (see Fig 10c). Four codon mutations were introduced into the Zinc fingers in nucleocapsid to limit the encapsidation of viral RNA and three codon mutations were introduced into the reverse transcriptase region of pol to inactivate the viral reverse transcriptase. The JS 1 insert with these mutations was designated JS2.
The mutations were made using a site directed mutagenesis kit (Stratagene) following the manufacturer's protocol. All mutations were confirmed by sequencing. Primer pairs used for the mutagenesis were: 5 '-GGTTAAGAGCTTCAATAGCGGCAAAGAAGGGC-3' (C3 92S, C395S; SEQ ID NO:29) and 5'-GCCCTTCTTTGCCGCTATTGAAGCTCTTAACC-3' (C392S, C395S; SEQ ID 5'-GGGCAGCTGGAAAAGCGGAAAGGAAGG-3' (C4 13S, C416S; SEQ ID NO:31 and 5'-CCTTCCTTTCCGCTTTTCCAGCTGCCC-3' (C413S, C416S; SEQ ID) NO:3 2); 5 '-CCAGACATAGTTATCTATCAATACATGAACGATTTGTATGiTAGG-3' (D 185N; SEQ H)DNO:33) and '-CCTACATACAAATCGTTCATGTATTGATAGATAACTATGTCTGG-3' (D1 85N; SEQ ID NO:34); 5 '-GGGGAAATTGAATACCGCAAGTCAGATTTACGC-3' (W266T; SEQ ID NO:35) and 5'-GGGTAAATCTGACTTGCGGTATTCAATTTCCCC-3' (W266T; SEQ ID NO:36); 5 '-CCCTAACTAACACAACAAATCAGAAAACTCAGTTACAAGC-3' (E478Q; SEQ ID NO:37) and '-GCTTGTAACTGAGTTTTCTGATTTGTTGTGTTAGTTAGGG-3' (E478Q; SEQ ID NO: 38).
Example 9. pGA2IJS7 vaccine plasmid The sequence of pGA2/JS7 is shown in Fig. I la (SEQ ID NO:8), its functional regions and the origins of these regions in Fig. 1 lb and the positions of its codon mutations in Fig. 1 ic. In the JS7 insert, Gag sequences of HIV-1-HXB-2 are substituted for the Gag sequences of BH 10. This was accomplished by PCR amplification of the HXB-2 sequence WO 03/076591 PCT/US03/07177 plasmid, NIH AIDS Research and Reference Program, catalog 3119) using the following primers: forward 5'-GAGCTCTATCGATGCAGGACTCGGCTTGC-3' (SEQ ID NO:39) and reverse 5'-CTCCAATTACTGTGAGAATTCTAATGTTCATCTTGGG-3' (SEQ ID NO:40). The forward primer introduced a Cla I site at the same position as that found in the JS2 insert and the reverse primer introduced a unique EcoR I site analogous to the same site in the JS2 insert. This PCR fragment was then inserted into pGA1.1 for mutagenesis. The safety mutations in the zinc finger regions and the RT mutations were then introduced as previously described for the JS2 insert. JS7 also differs from JS2 in having an inactivating codon mutation at the active site ofprotease. This mutation was introduced using the primers: 5'-GGCAACTAAAGGAAGCTCTATTAGCCACAGGAGC-3' (D25A Prtl; forward; SEQ ID NO:41) and 3' (D25A Prt2; reverse; SEQ ID NO:42). Once the mutations were confirmed by sequencing, the HXB-2 Gag-Pol insert was introduced into pGA2/JS2 via the Cla I and EcoR I sites. In contrast to the JS2 insert that expresses aggregates of HIV-1 proteins due to premature cleavage of the pr55Gag polyprotein by the viral protease, the JS7 insert forms immature virus like particles (VLPs) that bud from the plasma membrane of DNAexpressing cells.
Example 10 pGA2/JS7.1 vaccine plasmid The sequence of pGA2/JS7.1 is shown in Fig. 12a (SEQ ID NO:9), its functional regions and the origins of these regions in Fig. 12b and the positions of its codon mutations in Fig. 12c. pGA2/JS7.1 is a derivative ofpGA2/JS7 in which the start codon as well as an immediately upstream ATG have been mutated in vpu. These mutations were introduced to increase the level of the expression of Env. The mutations in the start codon for Vpu were accomplished using a site directed mutagenesis kit (Stratagene) and the oligonuccleotides: forward 5'-GCAGTAAGTAGTAAATCTAATCCAACCTTTAC-3' (SEQ ID NO:43) and reverse 5'-GTAAAGGTTGGATTAGATTTACTACTTACTGC-3' (SEQ ID NO:44).
WO 03/076591 PCT/US03/07177 Example 11. pGA1/IC25 vaccine plasmid The sequence ofpGAl/IC25 is shown in Fig. 13a (SEQ ID NO:10), its functional regions and the origins of these regions in Fig. 13b and the positions of its point mutations in Fig. 13c. The IC25 insert described here was designed with a circulating recombinant form of clades A and G (designated AG) so that it would elicit an immune response against HIV-1 sequences that predominate in West Africa. As noted above, any clade AG isolate from West Africa could be used as a reasonable representative for other clade AG isolates. Since HIV-1 isolates use different chemokine receptors as co-receptors, and the vast majority of viruses that are undergoing transmission use the CCR-5 co-receptor (Berger, AIDS 11 (Suppl A:S3-16, 1997), the AG vaccine insert we designed had a CCR-5-using Env. Of course, Envs that function through any other co-receptor or that have been constructed from naturally occurring or synthetic AG sequences so as to increase immunogenicity can be made and used as well.
To achieve a multiprotein-expressing clade AG vaccine insert with high expression, candidate vaccines were constructed from four different AG HIV-1 isolates, as shown in Table 2.
Table 2. Comparison of candidate AG vaccine inserts Plasmid SEQuences Ability Expression Expression Comment designation tested to grow of Gag of Env plasmid 418/928 418 gag in Poor Poor not tested 928-VLP 421/928 421 gag in Good Good Poor 928-VLP 896/928 896 gag in Good Good Poor 928-VLP 928/928 928 Good Good Good chosen for vaccine, renamed pGAl/ICl For each isolate, the forward primer 5'-AAGATCTATCGATGCAAGGACTCGGCTTGC-3' (SEQ ID NO:45) and the reverse primer TGCTCTTCTTGGG-3' (SEQ ID NO:46) were used to amplify the 5' Gag-RT PCR product.
The 3' PCR product for the Env region encompassed the vpu, tat, rev, and env sequences and WO 03/076591 PCT/US03/07177 the splice acceptor sites necessary for proper processing and expression of their respective mRNAs. An EcoR I site was introduced at the 5'end of this product and Nhe I and Rsr II sites were introduced into the 3' end. A forward primer 5'-AAGGGGTTAAAGCTATAATAAG-AATTCTGCA-3' (SEQ ID NO:47) and a reverse primer 5'-CCTTTGCTGCCCTATCTGA-TTCTTCTAGG-3' (SEQ ID NO:48) were used to amplify the 3' PCR product. Of these, those from patient 928 proved particularly favorable for further development (Table 2. The 928 sequences with deletions but not codon mutations were designated IC1.
The strategy used to construct IC25, a more disabled virus than IC1, was similar to that used to construct JS7 from JS1. Specifically four codon mutations were introduced into gag sequences to inactivate the zinc fingers that are involved in RNA packaging, three codon mutations were introduced into pol sequences to inactivate transcription, strand transfer and RNaseH activities of reverse transcriptase and the codon at the active site of the protease was mutated to limit proteolytic cleavage of viral Gag proteins and the maturation of viral particles. The protease mutations also limited premature cleavage of the Gag polyprotein and allowed budding of immature VLPs.
The inactivating codon mutations were made using a site directed mutagenesis kit (Stratagene) following the manufacturer's protocol. All mutations were confirmed by sequencing. Primer pairs used for the mutagenesis were: 5 '-GCCAGAGAATAATAAAGAGCTTCAACAGCGGCAAAGAAGG-3' (C390S, C393S; SEQ ID NO:49) and 5'-CCTTCTTTGCCGCTGTTGAAGCTCTTTATTATTCTCTGGC-3' (C390S, C393S; SEQ ID 5'-CCTAGAAAGAGAGGCAGCTGGAAAAGCGGAAAGGAAGG-3' (C411S, C414S; SEQ ID NO:51) and CCTTCCTTTCCGCTTTTCCAGCTGCCTCTCTTTCTAGG-3' (C414S 928 ZN4; SEQ ID NO:52); 5'-CCAATATATGAACGATTTATATGTAGGATCTGAC-3' (D185N; SEQ ID NO:53) and 5'-GTCAGATCCTACATATAAATCGTTCATATATTGG-3' (D185N; SEQ ID NO:54); WO 03/076591 PCT/USO3/07177 5'-GGGAAAACTAAATACCGCAAGTCAGATTTATGCAGG-3' (W266T; SEQ ID NO:55) and 5'-CCTGCATAAATCTGACTTGCGGTATTTAGTTTTCCC-3' (W266T; SEQ ID NO:56); and 5'-CCCTAATTGAGACAACAAATCAAAAGACTCAGTTACATGC-3'(E478Q; SEQ ID NO:57) and 5'-GCATGTAACTGAGTCTTTTGATTTGTTGTCTCAATTAGGG-3'(E478Q; SEQ ID NO:58).
5'-GCCAATAGAAGCCCTATTAAACACAGGAGC-3' (D25A; SEQ ID NO:59) and 5'-GCTCCTGTGTTTAATAGGGCTTCTATTGGC-3' (D25A; SEQ ID Example 12. PGA1/IC2 The sequence of pGAl/IC2 is shown in Fig. 14a (SEQ ID NO:11), its functional regions and the origins of these regions in Fig. 14b and the positions of its point mutations in Fig. 14c. pGA1/IC2 is identical to pGAl/IC25 except for not containing the inactivating point mutation in protease.
Example 13. PGA1/IC48 The sequence of pGA1/IC48 is shown in Fig. 15a (SEQ ID NO:12), its functional regions and the origins of these regions in Fig. 15b and the positions of its point mutations in Fig. 15c. pGA1/IC48 is identical to pGA1/IC25 exceptthat the codon mutation in protease is one that occurred in a drug resistant mutant mutant (Jacobsen et al., Virology 206:527-534, 1995). This mutation only partially inactivates the protease function. Mutagenesis was carried out using Stratagene kits and the following oligonucleotides: (G48V 928; SEQ ID NO:61) and 5'-CCTCCAATTCCCaCTATCATTTTTGG-3' (G48V 928; SEQ ID NO:62). This mutation only partially inactivates the protease function.
Example 14. PGA1/IC90 The sequence of pGA1/IC90 is shown in Fig. 16a (SEQ ID NO:13), its functional regions and the origins of these regions in Fig. 16b and the positions of its point mutations in Fig. 16c. pGAl/IC90 is identical to pGA1/IC25 except that the codon mutation in protease is one that occurred in a drug resistant mutant (Jacobsen et al., Virology 206:527-534, 1995).
WO 03/076591 PCT/US03/07177 This mutation only partially inactivates the protease function. Mutagenesis was carried out using Stratagene kits and the following oligonucleotides,: GGACGAAATATGaTGACTCAGATTGGT (M90L; SEQ ID NO:63) and 5'-ACCAATCTGAGTCAtCATATTTCGTCC-3' (M90L; SEQ ID NO:64).
Example 15. pGA1/IN3 The sequence of pGA1/IN3 is shown in Fig. 17a (SEQ ID NO:14), its functional regions and the origins of these regions in Fig. 17b and the positions of its point mutations in Fig. 17c. The IN3 insert described here was constructed from a clade C sequence recovered from a virus in India. As noted above, any clade C isolate could be used as a reasonable representative for other clade C isolates. Since HIV-1 isolates use different chemokine receptors as co-receptors, and the vast majority of viruses that are undergoing transmission use the CCR-5 co-receptor (Berger, AIDS 11(Suppl A):S3-16, 1997), the C vaccine insert we chose to construct had a CCR-5-using Env. Of course, Envs that function through any other co-receptor or that have been constructed from naturally occurring or synthetic C sequences so as to increase immunogenicity can be made and used as well.
To achieve a multiprotein-expressing clade C vaccine insert with high expression, candidate vaccines were constructed from four different clade C HIV-1 sequences that were obtained from the US NIAID AIDS repository, as shown in Table 3. Of these, those from the Indian clone proved particularly favorable for further development.
Table 3. Comparison of clade C candidate vaccine inserts Isolate and Ability to Expression of Expression of Comment Genbank grow plasmid Gag Env Accession South Africa Good Good Good AF286227 Israel Good Good Good AF286233 Tanzania Good Good Good AF286235 India Good Good Very good Chosen for vaccine, AF286231 renamed pGA1/IN1 WO 03/076591 PCT/US03/07177 and 3' sequences from the Indian clone were cloned into pGA1.2 using oligonucleotides and PCR to generate 5' and 3' fragments. The 5' fragment encoding Gag and RT was generated using the forward primer CGCAGGATCCGGCTTGCTGAAG (SEQ ID NO:65), which incorporated a BamH I site at the 5' end of the fragment, and the reverse primer 5'-TCTACTCGAGCTTATTATAGCACTCTCCTG-3' (SEQ ID NO:66), which incorporated an Xho I site as well as two stop codons at the 3' end of the fragment. The 3' fragment encoding Tat, Rev, Vpu, and Env was generated using the forward primer 5'-CCTCTCGAGATACTTGGACAGGAG-3' (SEQ ID NO:67) and the reverse primer 5'-CACTTGCTAGCCATTTTACTGCAAAGC-3' (SEQ ID NO:68). These were designed such that Xho I and Nhe I restriction sites were incorporated at the 5' and 3' ends, respectively of the 3' fragment. These fragments were introduced into pGA1.2 using directed cloning to create pGA1.2/IN1.
The strategy used to construct IN3, a more disabled virus than IN1, was similar to that used to construct JS7 from JS1. Specifically four codon mutations were introduced into gag sequences to inactivate the zinc fingers that are involved in RNA packaging, three codon mutations were introduced into pol sequences to inactivate transcription, strand transfer and RNaseH activities of reverse transcriptase and the codon at the active site of the protease was mutated to limit proteolytic cleavage of viral Gag proteins and the maturation of viral particles. The protease mutations also limited premature cleavage of the Gag polyprotein and allowed budding of immature VLPs.
The inactivating codon mutations were made using a site directed mutagenesis kit (Stratagene) following the manufacturer's protocol. All mutations were confirmed by sequencing. Primer pairs used for the mutagenesis were: CTAAAAGAACTGTTAAATCCTTCAACTCTGGCAAGGAAGGGCAC-3' (C390S, C393S; SEQ ID NO: 70) and 5'-GTGCCCTTCCTTGCCAGAGTTGAAGGATTTAACAGTTCTTTTAG-3'(C390S, C393S; SEQ ID NO: 71); 5' CTAGGAAAAAAGGCTCTTGGAAATCTGGAAAGGAAGGACAC (C411S, C414S; SEQ ID NO:72) and WO 03/076591 PCT/US03/07177 5'-GTGTCCTTCCTTTCCAGATTTCCAAGAGCCTTTTTTCCTAG-3' (C411S and C414S; SEQ ID NO:73): 5'-GTCATCTATCAATATATGAATGACTTGTATGTAG-3' (D185N, SEQ ID NO:74) and 5'-CTACATACAAGTCATTCATATATTGATAGATGAC-3' (D185N, SEQ ID 5'-GTGGGAAAATTAAACACGGCAAGCCAGATTTAC-3' (W266T, SEQ ID NO:76) and 5'-GTAAATCTGGCTTGCCGTGTTTAATTTTCCCAC-3' (W266T, SEQ ID NO:77); 5'-CAAATCAGAAGACTCAATTACAAGCAATTTATC-3' (E478Q, SEQ ID NO:78) and 5'-GATAAATTGCTTGTAATTGAGTCTTCTGATTTG-3' (E478Q, SEQ ID NO:79) and 5'-GGAGGCTCTCTTAGcCACAGGAGCAGATG-3' (D25N, SEQ ID NO: 80) and 5'-CATCTGCTCCTGTGgCTAAGAGAGCCTCC-3' (D25N, SEQ ID NO 81).
Example 16. pGA1/IN2 The sequence of pGA1/IN2 is shown in Fig. 18a (SEQ ID NO: its functional regions and the origins of these regions in Fig. 18b and the positions of its point mutations in Fig. 18c. pGAIIN2 differs from pGAI/IN3 in not having the D25N Inactivating point mutation in protease.
Example 17: Sequences provided for matched rMVAs Sequences for the JS, IC, and IN inserts were used to prepare matched recombinant modified vaccinia Ankara (rMVA) vectors. These matched vectors can be used as booster inoculations for the various DNAs. They can also be used for both priming and boosting an anti-HIV immune response. The sequences provided to generate the viral vector included the three inactivating point mutations in reverse transcriptase. A representative study, in which a recombinant MVA vector was constructed and characterized, follows.
MVA virus (which may be obtained from the American Type Culture Collection) was plaque purified three times by terminal dilutions in chicken embryo fibroblasts (CEF), which were made from 9-day old SPF Premium SPAFAS fertile chicken eggs, distributed by B and E eggs (Stevens, PA). Secondary CEF cells were infected at an MOI of 0.05 of MVA and transfected with 2 pLW-48 (as described above; see Figs. 20A and 20B). Following a two- 15-07-'08 16:59 FROM- T-903 P014/28 F-509 P'.OflRIAClaInoirIAN loc.pTornoOa 00 o day incubation at 37 0 C, the virus was harvested, frozen and thawed three times. It was then C, plated on CEF plates. At "four days," those foci of infection that stained blue after addition Sof X-gluc substrate, indicating that recombination had occurred between the plasmid and INO the infecting virus, were picked and inoculated on CEF plates. Again, those foci that stained blue were picked. These GUS-containing foci were plated out in triplicate and analyzed for GUS staining (which we wanted to now delete) and ADA envelope expression. Individual foci were picked from the third replicate plates of those samples that o had about equal numbers of mixed populations of GUS staining and non-staining foci as C¢l well as mostly envelope staining foci. These foci were again plated out in triplicate and analyzed the same way. After five passages, a virus was derived that expressed the o envelope protein but which had deleted the GUS gene because of the double repeat. By immunostaining, this virus also expressed the Gag-Pol protein.
Aliquots of MVA/HIV48 infected cell lysates were analyzed by radioimmunoprecipitation and immunostaining with monoclonal antibodies for expression of both the Env and Gag-Pol protein. In both of these tests, each of these proteins was detected. The recombinant virus was shown to produce gag particles in the supernatant of infected cells by pelleting the 3SS-labeled particles on a 20% sucrose cushion. By electron microscopy, gag particles were visualized both outside and budding from cells as well as within vacuoles of cells. The gag particles had envelope protein on their surface.
Thus, we made a recombinant MVA virus that expressed the ADA truncated envelope and the HXB2 Gag-Pol protein. The MVA recombinant virus is made using a transiently expressed GUS marker that is deleted in the final virus. High expression of the ADA envelope is possible because of a new hybrid early/late promoter (Psyn II; see, e.g., Figs. 21, 22, and 24). In addition, the envelope has been truncated, as this may enhance the amount of protein on the surface of the infected cells and hence enhance immunogenicity.
Stability of the recombinant may also be enhanced.
The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
-51- COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15 15-07-'08 16:59 FROM- T-903 P015/028 F-509 POPOfltR A.SClaln tI 2 149 Ispldol.OISM7200 00 0 0 c1 Throughout this specification and the claims which follow, unless the context Srequires otherwise, the word "comprise", and variations such as "comprises" and S"comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
0
C-,
0 -51a- COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15
Claims (5)
15-07-'08 16:59 FROM- T-903 P016/028 F-509 00 O o THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS: S1. A method of eliciting a cellular and humoral immune response to an HIV O antigen in a subject comprising: administering to the subject a composition comprising a DNA vector encoding at least: HIV gag, HIV pol lacking the integrase domain, HIV tat, HIV rev, HIV vpu, and HIV env, all of which are of a selected HIV chosen from the group consisting of SHIV clades A, B, C, D, E, F, G, H, I, J, K, L, and HIV AG; and C, administering to the subject a composition comprising a modified vaccinia Ankara virus expressing at least one HIV antigen, 0 wherein a cellular and humoral immune response to an HIV antigen is elicited in the subject. 2. The method of claim 1 wherein the selected HIV is chosen from the group consisting of HIV clade B, HIV clade C, and HIV AG. 3. The method of claim 1 wherein the selected HIV clade is HIV clade B. 4. The method of claim 1 wherein the DNA vector comprises: a bacterial resistance gene, a lambda TO terminator and the CMV immediate early promoter. The method of claim 1 wherein the modified vaccinia Ankara virus expresses HIV gag. 6. The method of claim 1 wherein the modified Ankara virus expresses at least HIV gag and HIV pol, wherein the integrase domain of the HIV pol is deleted. 7. The method of claim 6 wherein the modified Ankara virus also expresses a truncated HIV env. -52- COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15 15-07-'08 16:59 FROM- T-903 P017/028 F-509 P\ CPfmAAsCluimslSl20 149 I pad-chl-ImW 00 8. The method of claim 1 wherein the DNA vector comprises pGAl or pGA2. S9. The method of any one of claims 1-8 wherein the HIV gag has a mutation in O a zinc finger domain that reduces RNA packaging activity. The method of claim 1 wherein the HIV pol has a mutation that reduces protease activity. S11. The method of claim I wherein the HIV pol has a mutation that reduces 10 polymerase activity. 12. The method of claim 1 wherein the HIV pol has a mutation that reduces strand transfer activity. 13. The method of claim 1 wherein the HIV pol has a mutation that reduces RNase H activity. 14. The method of claim 1 wherein the DNA vector is selected from: pGA2/JS7, pGA1/IN3, pGA2/JS2, pGA1/IN2, pGA1/IC2 and pGA1/IC25. A method of eliciting a cellular and humoral immune response to an HIV antigen in a subject comprising: administering to the subject a composition comprising a DNA vector selected from: pGA2/JS7, pGAl/IN3, pGA2/JS2, pGA1/IN2, pGAl/IC2 and and administering to the subject a composition comprising a modified vaccinia Ankara virus expressing at least one HIV antigen, wherein a cellular and humoral immune response to an HIV antigen is elicited in the subject.
16. A pharmaceutical composition comprising pGA2/JS7. -53- COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15 15-07-'08 16:59 FROM- T-903 P018/028 F-509 MOPfR\RAStCluM 25014pW I 00 0 S A phaaceuical composition comprising pG N3 C 17. A pharmaceutical composition comprising pGA2/IN3.
18. A pharmaceutical composition comprising pGA2/JS2. 19, A pharmaceutical composition comprising pGA /IC2. A pharmaceutical composition comprising pGA1/IN2.
21. A pharmaceutical composition comprising pGA1/IC25, 0
22. A method according to any one of claims 1-15 or a composition according to any one of claims 16-21 substantially as hereinbefore described with reference to the Figures and/or Examples. -54- COMS ID No: ARCS-198393 Received by IP Australia: Time 17:02 Date 2008-07-15
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2003220111A AU2003220111B2 (en) | 2002-03-08 | 2003-03-10 | Compositions and methods for generating an immune response |
AU2008243079A AU2008243079A1 (en) | 2002-03-08 | 2008-10-31 | Compositions and methods for generating an immune response |
Applications Claiming Priority (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/093,953 US20040105871A1 (en) | 2000-03-02 | 2002-03-08 | Compositions and methods for generating an immune response |
US10/093,953 | 2002-03-08 | ||
US10/336,566 | 2003-01-03 | ||
US10/336,566 US8623379B2 (en) | 2000-03-02 | 2003-01-03 | Compositions and methods for generating an immune response |
PCT/US2003/007177 WO2003076591A2 (en) | 2002-03-08 | 2003-03-10 | Compositions and methods for generating an immune response |
AU2003220111A AU2003220111B2 (en) | 2002-03-08 | 2003-03-10 | Compositions and methods for generating an immune response |
AU2008243079A AU2008243079A1 (en) | 2002-03-08 | 2008-10-31 | Compositions and methods for generating an immune response |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2008243079A Division AU2008243079A1 (en) | 2002-03-08 | 2008-10-31 | Compositions and methods for generating an immune response |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2003220111A1 AU2003220111A1 (en) | 2003-09-22 |
AU2003220111B2 true AU2003220111B2 (en) | 2008-07-31 |
Family
ID=40292469
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2003220111A Expired AU2003220111B2 (en) | 2002-03-08 | 2003-03-10 | Compositions and methods for generating an immune response |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2003220111B2 (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001092470A2 (en) * | 2000-03-02 | 2001-12-06 | Emory University | Dna expression vectors and methods of use |
AU2002320314A1 (en) * | 2001-07-05 | 2003-01-21 | Chiron, Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
AU2002252199B2 (en) * | 2001-03-08 | 2008-01-03 | Emory University | MVA expressing modified HIV envelope, GAG, and POL genes |
-
2003
- 2003-03-10 AU AU2003220111A patent/AU2003220111B2/en not_active Expired
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001092470A2 (en) * | 2000-03-02 | 2001-12-06 | Emory University | Dna expression vectors and methods of use |
AU2002252199B2 (en) * | 2001-03-08 | 2008-01-03 | Emory University | MVA expressing modified HIV envelope, GAG, and POL genes |
AU2002320314A1 (en) * | 2001-07-05 | 2003-01-21 | Chiron, Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
Non-Patent Citations (1)
Title |
---|
Huang et al, J Virol, 2001, 75: 4947-4951 * |
Also Published As
Publication number | Publication date |
---|---|
AU2003220111A1 (en) | 2003-09-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9254319B2 (en) | Compositions and methods for generating an immune response | |
JP4554887B2 (en) | MVA expressing modified HIV envelope, gag, and pol genes | |
JP5178196B2 (en) | Recombinant MVA virus expressing the clade A / G, clade B, and clade C modified HIVenv, gag, and pol genes | |
US20130078276A1 (en) | Vectors expressing hiv antigens and gm-csf and related methods of generating an immune response | |
EP1610816B1 (en) | Mva virus expressing modified hiv envelope, gag, and pol genes | |
AU2002252199A1 (en) | MVA expressing modified HIV envelope, GAG, and POL genes | |
ZA200504021B (en) | Methods and compositions for immunization against HIV | |
US20070048861A1 (en) | Compositions and methods for generating an immune response | |
Coupar et al. | Fowlpox virus vaccines for HIV and SHIV clinical and pre-clinical trials | |
US20090142373A1 (en) | Immunizing Against HIV Infection | |
AU2003220111B2 (en) | Compositions and methods for generating an immune response | |
US20150231227A1 (en) | Compositions and methods for generating an immune response | |
AU2003213839A1 (en) | Method of inducing an enhanced immune response against hiv | |
AU2012202786B8 (en) | Recombinant MVA viruses expressing Clade A/G, Clade B, and Clade C modified HIV ENV, GAG and POL genes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
DA3 | Amendments made section 104 |
Free format text: THE NATURE OF THE AMENDMENT IS: ADD CO-INVENTORS AMARA, RAMA; ROSS, TEDD M.; BRIGHT, RICK ARTHUR; WYATT, LINDA; EARL, PATRICIA; ELLENBERGER, DENNIS; FOLKS, T.; BUTERA, S. |
|
DA3 | Amendments made section 104 |
Free format text: THE NATURE OF THE AMENDMENT IS: ADD THE NAME OF THE CO-APPLICANT THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, CENTERS FOR DISEASE CONTROL AND PREVENTION |
|
FGA | Letters patent sealed or granted (standard patent) | ||
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |