US20040072234A1

US20040072234A1 - High affinity nucleic acid ligands to lectins

Info

Publication number: US20040072234A1
Application number: US10/705,300
Authority: US
Inventors: David Parma; Brian Hicke; Philippe Bridonneau; Lary Gold
Original assignee: Gilead Sciences Inc
Current assignee: Gilead Sciences Inc
Priority date: 1990-06-11
Filing date: 2003-11-10
Publication date: 2004-04-15
Also published as: US6280932B1; US7399752B2; US20030059769A1; US6544959B1; US20040043923A1

Abstract

This invention discloses high-affinity oligonucleotide ligands to lectins, specifically nucleic acid ligands having the ability to bind to the lectins, wheat germ agglutinin, L-selectin, E-selectin and P-selectin. Also disclosed are the methods for obtaining such ligands. This invention discloses high-affinity oligonucleotide ligands to lectins, specifically nucleic acid ligands having the ability to bind to the lectins, wheat germ agglutinin, L-selectin, E-selectin and P-selectin. Also disclosed are the methods for obtaining such ligands.

Description

FIELD OF THE INVENTION

Described herein are methods for identifying and preparing high-affinity nucleic acid ligands to lectins. Lectins are carbohydrate binding proteins. The method utilized herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by EXponential enrichment. Specifically disclosed herein are high-affinity nucleic acid ligands to wheat germ agglutinin (WGA), L-selectin, E-selectin, and P-selectin.

BACKGROUND OF THE INVENTION

The biological role of lectins (non-enzymatic carbohydrate-binding proteins of non-immune origin; I. J. Goldstein et al., 1980, Nature 285:66) is inextricably linked to that of carbohydrates. One function of carbohydrates is the modification of physical characteristics of glyco-conjugates (i.e., solubility, stability, activity, susceptibility to enzyme or antibody recognition), however, a more interesting and relevant aspect of carbohydrate biology has emerged in recent years; the carbohydrate portions of glyco-conjugates are information rich molecules (N. Sharon and H. Lis, 1989, Science 246:227-234; K. Drickamer and M. Taylor, 1993, Annu. Rev. Cell Biol. 9:237-264; A. Varki, 1993, Glycobiol. 3:97-130). Within limits, the binding of carbohydrates by lectins is specific (i.e., there are lectins that bind only galactose or N-acetylgalactose; other lectins bind mannose; still others bind sialic acid and so on; K. Drickamer and M. Taylor, supra). Specificity of binding enables lectins to decode information contained in the carbohydrate portion of glyco-conjugates and thereby mediate many important biological functions.

Numerous mammalian, plant, microbial and viral lectins have been described (I. Ofek and N. Sharon, 1990, Current Topics in Microbiol.and Immunol. 151:91-113; K. Drickamer and M. Taylor, supra; I. J. Goldstein and R. D. Poretz, 1986, in The Lectins, p.p. 33-247; A. Varki, supra). These proteins mediate a diverse array of biological processes which include: trafficking of lysosomal enzymes, clearance of serum proteins, endocytosis, phagocytosis, opsonization, microbial and viral infections, toxin binding, fertilization, immune and inflammatory responses, cell adhesion and migration in development and in pathological conditions such as metastasis. Roles in symbiosis and host defense have been proposed for plant lectins but remain controversial. While the functional role of some lectins is well understood, that of many others is understood poorly or not at all.

The diversity and importance of processes mediated by lectins is illustrated by two well documented mammalian lectins, the asialoglycoprotein receptor and the serum mannose binding protein, and by the viral lectin, influenza virus hemagglutinin. The hepatic asialoglycoprotein receptor specifically binds galactose and N-acetylgalactose and thereby mediates the clearance of serum glycoproteins that present terminal N-acetylgalactose or galactose residues, exposed by the prior removal of a terminal sialic acid. The human mannose-binding protein (MBP) is a serum protein that binds terminal mannose, fucose and N-acetylglucosamine residues. These terminal residues are common on microbes but not mammalian glyco-conjugates. The binding specificity of MBP constitutes a non-immune mechanism for distinguishing self from non-self and mediates host defense through opsonization and complement fixation. Influenza virus hemagglutinin mediates the initial step of infection, attachment to nasal epithelial cells, by binding sialic acid residues of cell-surface receptors.

The diversity of lectin mediated functions provides a vast array of potential therapeutic targets for lectin antagonists. Both lectins that bind endogenous carbohydrates and those that bind exogenous carbohydrates are target candidates. For example, antagonists to the mammalian selecting, a family of endogenous carbohydrate binding lectins, may have therapeutic applications in a variety of leukocyte-mediated disease states. Inhibition of selectin binding to its receptor blocks cellular adhesion and consequently may be useful in treating inflammation, coagulation, transplant rejection, tumor metastasis, rheumatoid arthritis, reperfusion injury, stroke, myocardial infarction, burns, psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic and traumatic shock, acute lung injury, and ARDS.

The selecting, E-, P- and L-, are three homologous C-type lectins that recognize the tetrasaccharide, sialyl-Lewis ^X(C. Foxall et al, 1992, J. Cell Biol. 117,895-902). Selectins mediate the initial adhesion of neutrophils and monocytes to activated vascular endothelium at sites of inflammation (R. S. Cotran et al., 1986, J. Exp. Med. 164, 661-; M. A. Jutila et al., 1989, J. Immunol. 143,3318-; J. G. Geng et al., 1990, Nature, 757; U. H. Von Adrian et al., 1994, Am. J. Physiol. Heart Circ. Physiol. 263, H1034-H1044). In addition, L-selectin is responsible for the homing of lymphocytes to peripheral and mesenteric lymph nodes (W. M. Gallatin et al., 1983, Nature 304,30; T. K. Kishimoto et al., 1990, Proc. Natl. Acad. Sci. 87,2244-) and P-selectin mediates the adherence of platelets to neutrophils and monocytes (S- C. Hsu-Lin et al., 1984, J. BioL Chem. 259,9121).

Selectin antagonists (antibodies and carbohydrates) have been shown to block the extravasation of neutrophils at sites of inflammation (P. Piscueta and F. W. Luscinskas, 1994, Am. J. Pathol. 145, 461-469), to be efficacious in animal models of ischemia/reperfusion (A. S. Weyrich et al., 1993, J. Clin. Invest. 91,2620-2629; R. K. Winn et al., 1993, J. Clin. Invest. 92, 2042-2047), acute lung injury (M. S. Mulligan et al., 1993, J. Immunol. 151, 6410-6417; A. Seekamp et al., 1994, Am. J. Pathol. 144, 592-598), insulitis/diabetes (X. D. Yang et al., 1993, Proc. Natl. Acad. Sci. 90,10494-10498), meningitis (C. Granet et al., 1994, J. Clin. Invest. 93, 929-936), hemorrhagic shock (R. K. Winn et al., 1994, Am J. Physiol. Heart Circ. Physiol. 267, H2391-H2397) and transplantation. In addition, selectin expression has been documented in models of arthritis (F. Jamar et al., 1995, Radiology 194, 843-850), experimental allergic encephalomyelitis (J. M. Dopp et al., 1994, J. Neuroimmunol. 54, 129-144), cutaneous inflammation (A. Siber et al., 1994, Lab. Invest. 70, 163-170) glomerulonephritis (P. G. Tipping et al., 1994, Kidney Int. 46, 79-88), on leukaemic cells and colon carcinomas (R. M. Lafrenie et al., 1994, Eur. J. Cancer [A] 30A, 2151-2158) and L-selectin receptors have been observed in myelinated regions of the central nervous system (K. Huang et al., 1991, J. Clin. Invest. 88, 1778-1783). These animal model data strongly support the expectation of a therapeutic role for selectin antagonists in a wide variety of disease states in which host tissue damage is neutrophil-mediated.

Other examples of lectins that recognize endogenous carbohydrates are CD22β, CD23, CD44 and sperm lectins (A. Varki, 1993, Glycobiol.3, 97-130; P. M. Wassarman, 1988, Ann. Rev. Biochem. 57, 415-442). CD22β is involved in early stages of B lymphocyte activation; antagonists may modulate the immune response. CD23 is the low affinity IgE receptor; antagonists may modulate the IgE response in allergies and asthma. CD44 binds hyaluronic acid and thereby mediates cell/cell and cell/matrix adhesion; antagonists may modulate the inflammatory response. Sperm lectins are thought to be involved in sperm/egg adhesion and in the acrosomal response; antagonists may be effective contraceptives, either by blocking adhesion or by inducing a premature, spermicidal acrosomal response.

Antagonists to lectins that recognize exogenous carbohydrates may have wide application for the prevention of infectious diseases. Many viruses (influenza A, B and C; Sendhi, Newcastle disease, coronavirus, rotavirus, encephalomyelitis virus, enchephalomyocarditis virus, reovirus, paramyxovirus) use lectins on the surface of the viral particle for attachment to cells, a prerequisite for infection; antagonists to these lectins are expected to prevent infection (A. Varki, 1993, Glycobiol.3, 97-130). Similarly colonization/infection strategies of many bacteria utilize cell surface lectins to adhere to mammalian cell surface glyco-conjugates. Antagonists to bacterial cell surface lectins are expected to have therapeutic potential for a wide spectrum of bacterial infections, including: gastric ( Helicobacter pylori), urinary tract (E. coli), pulmonary (Klebsiella pneumoniae, Stretococcus pneumoniae, Mycoplasma pneumoniae) and oral (Actinomyces naeslundi and Actinomyces viscosus) colonization/infection (S. N. Abraham, 1994, Bacterial Adhesins, in The Handbook of Immunopharmacology: Adhesion Molecules, C. D. Wegner, ed; B. J. Mann et al., 1991, Proc. Natl. Acad. Sci. 88, 3248-3252). A specific bacterial mediated disease state is Pseudomonas aeruginosa infection, the leading cause of morbidity and mortality in cystic fibrosis patients. The expectation that high affinity antagonists will have efficacy in treating P. aeruginosa infection is based on three observations. First, a bacterial cell surface, GalNAcβ1-4Gal binding lectin mediates infection by adherence to asialogangliosides (αGM1 and αGM2) of pulmonary epithelium (L. Imundo et al., 1995, Proc. Natl. Acad. Sci 92, 3019-3023). Second, in vitro, the binding of P. aeruginosa is competed by the gangliosides' tetrasaccharide moiety, Galβ1-3GalNAcβ1-4Galβ1-4Glc. Third, in vivo, instillation of antibodies to Pseudomonas surface antigens can prevent lung and pleural damage (J. F. Pittet et al., 1993, J. Clin. Invest. 92, 1221-1228).

Non-bacterial microbes that utilize lectins to initiate infection include Entamoeba histalytica (a Gal specific lectin that mediates adhesion to intestinal mucosa; W. A. Petri, Jr., 1991, AMS News 57:299-306) and Plasmodium faciparum (a lectin specific for the terminal Neu5Ac(a2-3)Gal of glycophorin A of erthrocytes; P. A. Orlandi et al., 1992, J. Cell Biol. 116:901-909). Antagonists to these lectins are potential therapeutics for dysentery and malaria.

Toxins are another class of proteins that recognize exogenous carbohydrates (K -A Karlsson, 1989, Ann. Rev. Biochem. 58:309-350). Toxins are complex, two domain molecules, composed of a functional and a cell recognition/adhesion domain. The adhesion domain is often a lectin (i.e., bacterial toxins: pertussis toxin, cholera toxin, heat labile toxin, verotoxin and tetanus toxin; plant toxins: ricin and abrin). Lectin antagonists are expected to prevent these toxins from binding their target cells and consequently to be useful as antitoxins.

There are still other conditions for which the role of lectins is currently speculative. For example, genetic mutations result in reduced levels of the serum mannose-binding protein (MBP). Infants who have insufficient levels of this lectin suffer from severe infections, but adults do not. The high frequency of mutations in both oriental and Caucasian populations suggests a condition may exist in which low levels of serum mannose-binding protein are advantageous. Rheumatoid arthritis (RA) may be such a condition. The severity of RA is correlated with an increase in IgG antibodies lacking terminal galactose residues on Fc region carbohydrates (A. Young et al., 1991, Arth. Rheum. 34, 1425-1429; I. M. Roitt et al., 1988, J. Autoimm. 1, 499-506). Unlike their normal counterpart, these gal-deficient carbohydrates are substrates for MBP. MBP/IgG immunocomplexes may contribute to host tissue damage through complement activation. Similarly, the eosinophil basic protein is cytotoxic. If the cytotoxicity is mediated by the lectin activity of this protein, then a lectin antagonist may have therapeutic applications in treating eosinophil mediated lung damage.

Lectin antagonists may also be useful as imaging agents or diagnostics. For example; E-selectin antagonists may be used to image inflamed endothelium. Similarly antagonists to specific serum lectins, i.e. mannose-binding protein, may also be useful in quantitating protein levels.

Lectins are often complex, multi-domain, multimeric proteins. However, the carbohydrate-binding activity of mammalian lectins is normally the property of a carbohydrate recognition domain or CRD. The CRDs of mammalian lectins fall into three phylogenetically conserved classes: C-type, S-type and P-type (K. Drickamer and M. E. Taylor, 1993, Annu. Rev. Cell Biol. 9, 237-264). C-type lectins require Ca ⁺⁺ for ligand binding, are extracellular membrane and soluble proteins and, as a class, bind a variety of carbohydrates. S-type lectins are most active under reducing conditions, occur both intra- and extracellularly, bind β-galactosides and do not require Ca⁺⁺. P-type lectins bind mannose 6-phosphate as their primary ligand.

Although lectin specificity is usually expressed in terms of monosaccharides and/or oligosacchrides (i.e., MBP binds mannose, fucose and N-acetylglucosamine), the affinity for monosaccharides is weak. The dissociation constants for monomeric saccharides are typically in the millimolar range (Y. C. Lee, 1992, FASEB J. 6:3193-3200; G. D. Glick et al., 1991, J Biol.Chem. 266:23660-23669; Y. Nagata and M. M. Burger, 1974, J. Biol. Chem. 249:116-3122).

Co-crystals of MBP complexed with mannose oligomers offer insight into the molecular limitations on affinity and specificity of C-type lectins (W. I. Weis et al., 1992, Nature 360:127-134; K. Drickamer, 1993, Biochem. Soc. Trans. 21:456-459). The 3- and 4-hydroxyl groups of mannose form coordination bonds with bound Ca ⁺⁺ ion #2 and hydrogen bonds with glutamic acid (185 and 193) and asparagine (187 and 206). The limited contacts between the CRD and bound sugar are consistent with its spectrum of monosaccharide binding; N-acetylglucosamine has equatorial 3- and 4-hydroxyls while fucose has similarly configured hydroxyls at the 2 and 3 positions.

The affinity of the mannose-binding protein and other lectins for their natural ligands is greater than that for monosaccharides. Increased specificity and affinity can be accomplished by establishing additional contacts between a protein and its ligand (K. Drickamer, 1993, supra) either by 1) additional contacts with the terminal sugar (i.e., chicken hepatic lectin binds N-acetylglucose amine with greater affinity than mannose or fucose suggesting interaction with the 2-substituent); 2) clustering of CRDs for binding complex oligosaccharides (i.e., the mammalian asialylglycoprotein receptor); 3) interactions with additional saccharide residues (i.e., the lectin domain of selectins appears to interact with two residues of the tetrasaccharide sialyl-Lewis ^X: with the charged terminal residue, sialic acid, and with the fucose residue; wheat germ agglutinin appears to interact with all three residues of trimers of N-acetylglucosamine); or by 4) contacts with a non-carbohydrate portion of a glyco-protein.

The low affinity of lectins for mono- and oligo-saccharides presents major difficulties in developing high affinity antagonists that may be useful therapeutics. Approaches that have been used to develop antagonists are similar to those that occur in nature: 1) addition or modification of substituents to increase the number of interactions; and 2) multimerization of simple ligands.

The first approach has had limited success. For example, homologues of sialic acid have been analyzed for affinity to influenza virus hemagglutinin (S. J. Watowich et al. 1994, Structure 2:719-731). The dissociation constants of the best analogues are 30 to 300 μM which is only 10 to 100-fold better than the standard monosaccharide.

Modifications of carbohydrate ligands to the selectins have also had limited success. In static ELISA competition assays, sialyl-Lewis ^aand sialyl-Lewis^Xhave IC₅₀s of 220 μM and 750 μM, respectively, for the inhibition of the binding of an E-selectin/IgG chimera to immobilized sialyl-Lewis^X(R. M. Nelson et al., 1993, J. Clin. Invest. 91, 1157-1166). The IC₅₀of a sialyl-Lewis^aderivative (addition of an aliphatic aglycone to the GlcNAc and replacement of the N-acetyl with an NH₂group) improved 10-fold to 21 μM. Similarly, removal of the N-acetyl from sialyl-lewis^Ximproves inhibition in an assay dependent manner (C. Foxall et al., 1992, J. Cell Biol. 117, 895-902; S. A. DeFrees et al., 1993, J. Am. Chem. Soc. 115, 7549-7550).

The second approach, multimerization of simple ligands, can lead to dramatic improvements in affinity for lectins that bind complex carbohydrates (Y. C. Lee, supra). On the other hand, the approach does not show great enhancement for lectins that bind simple oligosaccharides; dimerizing sialyl-Lewis ^X, a minimal carbohydrate ligand for E-selectin, improves inhibition approximately 5-fold (S. A. DeFrees et al., supra).

An alternative approach is to design compounds that are chemically unrelated to the natural ligand. In the static ELISA competition assays inositol polyanions inhibit L- and P-selectin binding with IC ₅₀s that range from 1.4 μM to 2.8 mM (O. Cecconi et al., 1994, J. Biol. Chem. 269, 15060-15066). Synthetic oligopeptides, based on selectin amino acid sequences, inhibit neutrophil binding to immobilized P-selectin with IC₅₀s ranging from 50 μM to 1 mM (J -G Geng et al., 1992, J of Biol. Chem. 267, 19846-19853).

Lectins are nearly ideal targets for isolation of antagonists by SELEX technology described below. The reason is that oligonucleotide ligands that are bound to the carbohydrate binding site can be specifically eluted with the relevant sugar(s). Oligonucleotide ligands with affinities that are several orders of magnitude greater than that of the competing sugar can be obtained by the appropriate manipulation of the nucleic acid ligand to competitor ratio. Since the carbohydrate binding site is the active site of a lectin, essentially all ligands isolated by this procedure will be antagonists. In addition, these SELEX ligands will exhibit much greater specificity than monomeric and oligomeric saccharides.

A method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules has been developed. This method, Systematic Evolution of Ligands by EXponential enrichment, termed SELEX, is described in U.S. patent application Ser. No. 07/536,428, entitled 37 Systematic Evolution of Ligands by Exponential Enrichment,” now abandoned, U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,475,096, U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Nucleic Acid Ligands,” now U.S. Pat. No. 5,270,163 (see also PCT/US91/04078), each of which is herein specifically incorporated by reference. Each of these applications, collectively referred to herein as the SELEX Patent Applications, describes a fundamentally novel method for making a nucleic acid ligand to any desired target molecule.

The SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.

The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled “Method for Selecting Nucleic Acids on the Basis of Structure,” describes the use of SELEX in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled “Photoselection of Nucleic Acid Ligands” describes a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993, entitled “High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine,” describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Solution SELEX,” describes a SELEX-based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled “Methods of Producing Nucleic Acid Ligands” describes methods for obtaining improved nucleic acid ligands after SELEX has been performed. U.S. patent application Ser. No. 08/400,440, filed Mar. 8, 1995, entitled “Systematic Evolution of Ligands by EXponential Enrichment: Chemi-SELEX,” describes methods for covalently linking a ligand to its target.

The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified nucleic acid ligands containing modified nucleotides are described in U.S. patent application Ser. No. 08/117,991, filed Sep. 8, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides,” that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines. U.S. patent application Ser. No. 08/134,028, supra, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH ₂), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe). U.S. patent application Ser. No. 08/264,029, filed Jun. 22, 1994, entitled “Novel Method of Preparation of 2′ Modified Pyrimidine Intramolecular Nucleophilic Displacement,” describes novel methods for making 2′-modified nucleosides.

The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides as described in U.S. patent application Ser. No. 08/284,063, filed Aug. 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX”. The SELEX method also includes combining the selected nucleic acid ligands with non-oligonucleotide functional units and U.S. patent application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX” and U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes”. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules. Each of the above described patent applications which describe modifications of the basic SELEX procedure are specifically incorporated by reference herein in their entirety.

The present invention applies the SELEX methodology to obtain nucleic acid ligands to lectin targets. Lectin targets, or lectins, include all the non-enzymatic carbohydrate-binding proteins of non-immune origin, which include, but are not limited to, those described above.

Specifically, high affinity nucleic acid ligands to wheat germ agglutinin, and various selectin proteins have been isolated. For the purposes of the invention the terms wheat germ agglutinin, wheat germ lectin and WGA are used interchangeably. Wheat germ agglutinin (WGA) is widely used for isolation, purification and structural studies of glyco-conjugates. As outlined above, the selectins are important anti-inflammatory targets. Antagonists to the selectins modulate extravasion of leukocytes at sites of inflammation and thereby reduce neutrophil caused host tissue damage. Using the SELEX technology, high affinity antagonists of L-selectin, E-selectin and P-selectin mediated adhesion are isolated.

BRIEF SUMMARY OF THE INVENTION

The present invention includes methods of identifying and producing nucleic acid ligands to lectins and the nucleic acid ligands so identified and produced. More particularly, nucleic acid ligands are provided that are capable of binding specifically to Wheat Germ Agglutinin (WGA), L-Selectin, E-selectin and P-selectin.

Further included in this invention is a method of identifying nucleic acid ligands and nucleic acid ligand sequences to lectins comprising the steps of (a) preparing a candidate mixture of nucleic acids, (b) partitioning between members of said candidate mixture on the basis of affinity to said lectin, and (c) amplifying the selected molecules to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity for binding to said lectin.

More specifically, the present invention includes the nucleic acid ligands to lectins identified according to the above-described method, including those ligands to Wheat Germ Agglutinin listed in Table 2, those ligands to L-selectin listed in Tables 8, 12 and 16, and those ligands to P-selectin listed in Tables 19 and 25. Additionally, nucleic acid ligands to E-selectin and serum mannose binding protein are provided. Also included are nucleic acid ligands to lectins that are substantially homologous to any of the given ligands and that have substantially the same ability to bind lectins and antagonize the ability of the lectin to bind carbohydrates. Further included in this invention are nucleic acid ligands to lectins that have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind lectins and antagonize the ability of the lectin to bind carbohydrates.

The present invention also includes modified nucleotide sequences based on the nucleic acid ligands identified herein and mixtures of the same.

The present invention also includes the use of the nucleic acid ligands in therapeutic, prophylactic and diagnostic applications.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows consensus hairpin secondary structures for [0036] WGA 2′-NH₂RNA ligands: (a) family 1, (b) family 2 and (c) family 3. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. Nucleotides derived from fixed sequence are in lower case.
FIG. 2 shows binding curves for the L-selectin SELEX second and [0037] ninth round 2′-NH₂RNA pools to peripheral blood lymphocytes (PBMCs).
FIG. 3 shows binding curves for [0038] random 40N7 2′-NH₂RNA (SEQ ID NO: 64) and the cloned L-selectin ligand, F14.12 (SEQ ID NO: 78), to peripheral blood lymphocytes (PBMC).
FIG. 4 shows the results of a competition experiment in which the binding of 5 nM [0039] ³²P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10⁷/ml) is competed with increasing concentrations of unlabeled F14.12 (SEQ ID NO: 78). RNA Bound equals 100×(net counts bound in the presence of competitor/net counts bound in the absence of competitor).
FIG. 5 shows the results of a competition experiment in which the binding of 5 nM [0040] ³²P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10⁷/ml) is competed with increasing concentrations of the blocking monoclonal anti-L-selectin antibody. DREG-56, or an isotype matched, negative control antibody. RNA Bound equals 100×(net counts bound in the presence of competitor/net counts bound in the absence of competitor).
FIG. 6 shows the results of a competitive ELISA assay in which the binding of soluble LS-Rg to immobilized sialyl-Lewis[0041] ^X/BSA conjugates is competed with increasing concentrations of unlabeled F14.12 (SEQ ID NO: 78). Binding of LS-Rg was monitored with an HRP conjugated anti-human IgG antibody. LS-Rg Bound equals 100×(OD₄₅₀in the presence of competitor)/(OD₄₅₀in the absence of competitor). The observed OD₄₅₀was corrected for nonspecific binding by subtracting the OD₄₅₀in the absence of LS-Rg from the experimental values. In the absence of competitor the OD₄₅₀was 0.324 and in the absence of LS-Rg 0.052. Binding of LS-Rg requires divalent cations; in the absence of competitor, replacement of Ca⁺⁺/Mg⁺⁺ with 4 mM EDTA reduced the OD₄₅₀to 0.045.
FIG. 7 shows hairpin secondary structures for representative L-[0042] selectin 2′NH₂RNA ligands: (a) F13.32 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 84), family III; and (c) F14.12 (SEQ. ID NO: 78), family II. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. Nucleotides derived from fixed sequence are in lower case.
FIG. 8 shows a schematic representation of each dimeric and mutimeric oligonucleotide complex: (a) dimeric branched oligonucleotide; (b) multivalent streptavidin/bio-oligonucleotide complex (A: streptavidin; B: biotin); (c) dimeric dumbell oligonucleotide; (d) dimeric fork oligonucleotide. [0043]
FIG. 9 shows binding curves for the L-selectin SELEX fifteenth round ssDNA pool to PBMCs (10[0044] ⁷/ml).
FIG. 10 shows the results of a competition experiment in which the binding of 2 nM [0045] ³²P-labeled round 15 ssDNA to PBMCs (10⁷/ml) is competed with increasing concentrations of the blocking monoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody. RNA Bound equals 100×(net counts bound in the presence of competitor/net counts bound in the absence of competitor).
FIG. 11 shows L-selectin specific binding of LD201T1 (SEQ ID NO: 185) to human lymphocytes and granulocytes in whole blood a, FITC-LD201T1 binding to lymphocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA. b, FITC-LD201T1 binding to granulocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA. All samples were stained with 0.15 mM FITC-LD201T1; thick line: FITC-LD201T1 only; thick dashed line: FITC-LD201T1 with 0.3 mM DREG-56; medium thick line: FITC-LD201T1 with 7 mM unlabeled NX280; thin line: FITC-LD201T1 stained cells, reassayed after addition of 4 mM EDTA; thin dashed line: autofluorescence. [0046]
FIG. 12 shows the consensus hairpin secondary structures for [0047] family 1 ssDNA ligands to L-selectin. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N—N′. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.
FIG. 13 shows that in vitro pre-treatment of human PBMC with NX288 (SEQ ID NO: 193) inhibits lymphocyte trafficking to SCID mouse PLN. Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with [0048] ⁵¹Cr (Amersham). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma). Female SCID mice (6-12 weeks of age) were injected intravenously with 2×10⁶cells. The cells were either untreated or mixed with either 13 pmol of antibody (DREG-56 or MEL-14), or 4, 1, or 0.4 nmol of modified oligonucleotide. One hour later the animals were anaesthetised, a blood sample taken and the mice were euthanised. PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by a Packard gamma counter. Values shown represent the mean±s.e. of triplicate samples, and are representative of 3 experiments.
FIG. 14 shows that pre-injection of NX288 (SEQ ID NO: 193) inhibits human lymphocyte trafficking to SCID mouse PLN and MLN. Human PBMC were purified, labeled, and washed as described above. Cells were prepared as described in FIG. 13. Female SCID mice (6-12 weeks of age) were injected intravenously with 2×10[0049] ⁶cells. One to 5 min prior to injecting the cells, the animals were injected with either 15 pmol DREG-56 or 4 nmol modified oligonucleotide. Animals were scarificed 1 hour after injection of cells. Counts incorporated into organs were quantified as described in FIG. 13. Values shown represent the mean±s.e. of triplicate samples, and are representative of 2 experiments.
FIG. 15 shows the consensus hairpin secondary structures for 2′-F RNA ligands to L-selectin. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N′. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line. [0050]
FIG. 16 shows the consensus hairpin secondary structures for 2′-F RNA ligands to P-selectin. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N′. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.[0051]

DETAILED DESCRIPTION OF THE INVENTION

This application describes high-affinity nucleic acid ligands to lectins identified through the method known as SELEX. SELEX is described in U.S. patent application Ser. No. 07/536,428, entitled “Systematic Evolution of Ligands by EXponential Enrichment”, now abandoned; U.S. patent application Ser. No. 07/714,131, filed Jun. 10, 1991, entitled “Nucleic Acid Ligands”, now U.S. Pat. No. 5,475,096; U.S. patent application Ser. No. 07/931,473, filed Aug. 17, 1992, entitled “Nucleic Acid Ligands”, now U.S. Pat. No. 5,270,163, (see also PCT/US91104078). These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications. [0052]
In its most basic form, the SELEX process may be defined by the following series of steps: [0053]
1) A candidate mixture of nucleic acids of differing sequence is prepared. The candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent). [0054]
2) The candidate mixture is contacted with the selected target under conditions favorable for binding between the target and members of the candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids of the candidate mixture can be considered as forming nucleic acid-target pairs between the target and those nucleic acids having the strongest affinity for the target. [0055]
3) The nucleic acids with the highest affinity for the target are partitioned from those nucleic acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of nucleic acid) corresponding to the highest affinity nucleic acids exist in the candidate mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the nucleic acids in the candidate mixture (approximately 0.05-50%) are retained during partitioning. [0056]
4) Those nucleic acids selected during partitioning as having the relatively higher affinity to the target are then amplified to create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target. [0057]
5) By repeating the partitioning and amplifying steps above, the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase. Taken to its extreme, the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule. [0058]
The SELEX Patent Applications describe and elaborate on this process in great detail. Included are targets that can be used in the process; methods for partitioning nucleic acids within a candidate mixture; and methods for amplifying partitioned nucleic acids to generate enriched candidate mixture. The SELEX Patent Applications also describe ligands obtained to a number of target species, including both protein targets where the protein is and is not a nucleic acid binding protein. [0059]
This invention also includes the ligands as described above, wherein certain chemical modifications are made in order to increase the in vivo stability of the ligand or to enhance or mediate the delivery of the ligand. Examples of such modifications include chemical substitutions at the sugar and/or phosphate and/or base positions of a given nucleic acid sequence. See, e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 9, 1993, entitled “High Affinity Nucleic Acid Ligands Containing Modified Nucleotides” which is specifically incorporated herein by reference. Additionally, in co-pending and commonly assigned U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992 ('624), now U.S. Pat. No. 5,496,938, methods are described for obtaining improved nucleic acid ligands after SELEX has been performed. The '624 application, entitled “Methods of Producing Nucleic Acid Ligands,” is specifically incorporated herein by reference. Further included in the '624 patent are methods for determining the three-dimensional structures of nucleic acid ligands. Such methods include mathematical modeling and structure modifications of the SELEX-derived ligands, such as chemical modification and nucleotide substitution. Other modifications are known to one of ordinary skill in the art. Such modifications may be made post-SELEX (modification of previously identified unmodified ligands) or by incorporation into the SELEX process. Additionally, the nucleic acid ligands of the invention can be complexed with various other compounds, including but not limited to, lipophilic compounds or non-immunogenic, high molecular weight compounds. Lipophilic compounds include, but are not limited to, cholesterol, dialkyl glycerol, and diacyl glycerol. Non-immunogenic, high molecular weight compounds include, but are not limited to, polyethylene glycol, dextran, albumin and magnetite. The nucleic acid ligands described herein can be complexed with a lipophilic compound (e.g., cholesterol) or attached to or encapsulated in a complex comprised of lipophilic components (e.g., a liposome). The complexed nucleic acid ligands can enhance the cellular uptake of the nucleic acid ligands by a cell for delivery of the nucleic acid ligands to an intracellular target. The complexed nucleic acid ligands can also have enhanced pharmacokinetics and stability. U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes,” which is herein incorporated by reference describes a method for preparing a therapeutic or diagnostic complex comprised of a nucleic acid ligand and a lipophilic compound or a non-immunogenic, high molecular weight compound. [0060]
The methods described herein and the nucleic acid ligands identified by such methods are useful for both therapeutic and diagnostic purposes. Therapeutic uses include the treatment or prevention of diseases or medical conditions in human patients. Many of the therapeutic uses are described in the background of the invention, particularly, nucleic acid ligands to selectins are useful as anti-inflammatory agents. Antagonists to the selectins modulate extravasion of leukocytes at sites of inflammation and thereby reduce neutrophil caused host tissue damage. Diagnostic utilization may include both in vivo or in vitro diagnostic applications. The SELEX method generally, and the specific adaptations of the SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications. SELEX identifies nucleic acid ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, of course, the desired properties one skilled in the art would seek in a diagnostic ligand. [0061]
The nucleic acid ligands of the present invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any nucleic acid ligand by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures. The nucleic acid ligands to lectin, particularly selectins, described herein may specifically be used for identification of the lectin proteins. [0062]
SELEX provides high affinity ligands of a target molecule. This represents a singular achievement that is unprecedented in the field of nucleic acids research. The present invention applies the SELEX procedure to lectin targets. Specifically, the present invention describes the identification of nucleic acid ligands to Wheat Germ Agglutinin, and the selecting, specifically, L-selectin, P-selectin and E-selectin. In the Example section below, the experimental parameters used to isolate and identify the nucleic acid ligands to lectins are described. [0063]
In order to produce nucleic acids desirable for use as a pharmaceutical, it is preferred that the nucleic acid ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the nucleic acid ligand have the highest possible affinity to the target. [0064]
In the present invention, a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity for Wheat Germ Agglutinin from a degenerate library containing 50 random positions (50N). This invention includes the specific nucleic acid ligands to Wheat Germ Agglutinin shown in Table 2 (SEQ ID NOS: 4-55), identified by the methods described in Examples 1 and 2. Specifically, RNA ligands containing 2′-NH[0065] ₂modified pyrimidines are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of Wheat Germ Agglutinin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Table 2. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of Wheat Germ Agglutinin shown in Table 2 shows that sequences with little or no primary homology may have substantially the same ability to bind Wheat Germ Agglutinin. For these reasons, this invention also includes nucleic acid ligands that have substantially the same ability to bind Wheat Germ Agglutinin as the nucleic acid ligands shown in Table 2. Substantially the same ability to bind Wheat Germ Agglutinin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind Wheat Germ Agglutinin.
In the present invention, SELEX experiments were performed in search of nucleic acid ligands with specific high affinity for L-selectin from degenerate libraries containing 30 or 40 random positions (30N or 40N). This invention includes the, specific nucleic acid ligands to L-selectin shown in Tables 8, 12 and 16 (SEQ ID NOS: 67-117, 129-180, 185-196 and 293-388), identified by the methods described in Examples 7, 8, 13, 14, 22 and 23. Specifically, RNA ligands containing 2′-NH[0066] ₂or 2′-F pyrimidines and ssDNA ligands are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of L-selectin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 8, 12 and 16. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of L-selectin shown in Tables 8, 12 and 16 shows that sequences with little or no primary homology may have substantially the same ability to bind L-selectin. For these reasons, this invention also includes nucleic acid ligands that have substantially the same ability to bind L-selectin as the nucleic acid ligands shown in Tables 8, 12 and 16. Substantially the same ability to bind L-selectin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind L-selectin.
In the present invention, SELEX experiments were performed in search of nucleic acid ligands with specific high affinity for P-selectin from degenerate libraries containing 50 random positions (SON). This invention includes the specific nucleic acid ligands to P-selectin shown in Tables 19 and 25 (SEQ ID NOS: 199-247 and 251-290), identified by the methods described in Examples 27, 28, 35 and 36. Specifically, RNA ligands containing 2′-NH[0067] ₂and 2′-F pyrimidines are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of P-selectin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 19 and 25. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of P-selectin shown in Tables 19 and 25 shows that sequences with little or no primary homology may have substantially the same ability to bind P-selectin. For these reasons, this invention also includes nucleic acid ligands that have substantially the same ability to bind P-selectin as the nucleic acid ligands shown in Tables 19 and 25. Substantially the same ability to bind P-selectin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence—substantially homologous to those specifically described herein—has substantially the same ability to bind P-selectin.
In the present invention, a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity for E-selectin from a degenerate library containing 40 random positions (40N). This invention includes specific nucleic acid ligands to E-selectin identified by the methods described in Example 40. The scope of the ligands covered by this invention extends to all nucleic acid ligands of E-selectin, modified and unmodified, identified according to the SELEX procedure. [0068]
Additionally, the present invention includes multivalent Complexes comprising the nucleic acid ligands of the invention. The mulivalent Complexes increase the binding energy to facilitate better binding affinities through slower off-rates of the nucleic acid ligands. The multivalent Complexes may be useful at lower doses than their monomeric counterparts. In addition, high molecular weight polyethylene glycol was included in some of the Complexes to decrease the in vivo clearance rate of the Complexes. Specifically, nucleic acid ligands to L-selectin were placed in multivalent Complexes. [0069]
As described above, because of their ability to selectively bind lectins, the nucleic acid ligands to lectins described herein are useful as pharmaceuticals. This invention, therefore, also includes a method for treating lectin-mediated diseases by administration of a nucleic acid ligand capable of binding to a lectin. [0070]
Therapeutic compositions of the nucleic acid ligands may be administered parenterally by injection, although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories, are also envisioned. One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used. In one preferred embodiment, it is envisioned that the carrier and the ligand constitute a physiologically-compatible, slow release formulation. The primary solvent in such a carrier may be either aqueous or nonaqueous in nature. In addition, the carrier may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation. Similarly, the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the ligand. Such excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form. [0071]
Once the therapeutic composition has been formulated, it may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration. The manner of administering formulations containing nucleic acid ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal or vaginal or rectal suppository. [0072]
Well established animal models exist for many of the disease states which are candidates for selectin antagonist therapy. Models available for testing the efficacy of oligonucleotide selectin antagonists include: [0073]
1) mouse models for peritoneal inflammation (P. Pizcueta and F. W. Luscinskas, 1994, Am. J. Pathol. 145, 461-469), diabetes (A. C. Hanninen et al., 1992, J. Clin. Invest. 92, 2509-2515), lymphocyte trafficking (L. M. Bradley et al., 1994, J. Exp. Med., 2401-2406), glomerulonephritis (P. G. Tipping et al., 1994, Kidney Int. 46, 79-88), experimental allergic encephalomyelitis (J. M. Dopp et al., 1994, J. Neuroimmunol. 54: 129-144), acute inflammation in human/SCID mouse chimera (H. -C. Yan et al., 1994, J. Immunol. 152, 3053-3063), endotoxin-mediated inflammation (W. E. Sanders et al., 1992, [0074] Blood 80, 795-800);
2) rat models for acute lung injury (M. S. Milligan et al., 1994, J. Immunol. 152, 832-840), hind limb ischemia/reperfusion injury (A. Seekamp et al., 1994, Am. J. Pathol 144, 592-598), remote lung injury (A. Seekamp et al., 1994, supra; D. L. Carden et al., 1993, J. Appl. Physiol 75, 2529-2543), neutrophil rolling on mesenteric venules (K. Ley et al., 1993, Blood 82, 1632-1638), myocardial infarction ischemia reperfusion injury (D. Altavilla et al., 1994, Eur. J. Pharmacol. Environ. Toxicol. Pharmacol. 270, 45-51); [0075]
3) rabbit models for hemorrhagic shock (R. K. Winn et al., 1994, Am. J. Physiol. Heart Circ. Physiol. 267, H2391-H2397), ear ischemia reperfusion injury (D. Mihelcic et al., 1994, Bollod 84, 2333-2328) neutrophil rolling on mesenteric venules (A. M. Olofsson et al., Blood 84, 2749-2758), experimental meningitis (C. Granert et al., 1994, J. Clin. Invest. 93, 929-936); lung, peritoneal and subcutaneous bacterial infection (S. R. Sharer et al., 1993, J. Immunol. 151, 4982-4988), myocardial ischemia/repefusion (G. Montrucchio et al., 1989, Am. J. Physiol. 256, H1236-H1246), central nervous system ischemic injury (W. M. Clark et al., 1991, Stroke 22, 877-883); [0076]
4) cat models for myocardial infraction ischemia reperfusion injury (M. Buerke et al., 1994, J. Pharmacol. Exp. Ther. 271, 134-142); [0077]
5) dog models for myocardial infarction ischemia reperfusion injury (D. J. Lefer et al., 1994, Circulation 90, 2390-2401); [0078]
6) pig models for arthritis (F. Jamar et al., 1995, Radiology 194, 843-850); [0079]
7) rhesus monkey models for cutaneous inflammation (A. Silber et al., Lab. Invest. 70, 163-175); [0080]
8) cynomolgus monkey models for renal transplants (S. -L. Wee, 1991, Transplant. Prod. 23, 279-280); and [0081]
9) baboon models for dacron grafts (T. Palabrica et al, 1992, Nature 359, 848-851), septic, traumatic and hypovolemic shock (H. Redl et al., 1991, Am. J. Pathol. 139, 461466). [0082]
The nucleic acid ligands to lectins described herein are useful as pharmaceuticals and as diagnostic reagents. [0083]

EXAMPLES

The following examples are illustrative of certain embodiments of the invention and are not to be construed as limiting the present invention in any way. Examples 1-6 describe identification and characterization of 2′-NH[0084] ₂RNA ligands to Wheat Germ Agglutinin. Examples 7-12 described identification and characterization of 2′-NH₂RNA ligands to L-selectin. Examples 13-21 describe identification and characterization of ssDNA ligands to L-selectin. Examples 22-25 describe identification and characterization of 2′-F RNA ligands to L-selectin. Example 26 describes identification of ssDNA ligands to P-selectin. Examples 27-39 describes identification and characterization of 2′-NH₂and 2′-F RNA ligands to P-selectin. Example 40 describes identification of nucleic acid ligands to E-selectin.

Example 1

Nucleic Acid Ligands to Wheat Germ Agglutinin

The experimental procedures outlined in this Example were used to identify and characterize nucleic acid ligands to wheat germ agglutinin (WGA) as described in Examples 2-6. [0085]

Experimental Procedures

A) Materials

Wheat Germ Lectin ([0086] Triticum vulgare) Sepharose 6MB beads were purchased from Pharmacia Biotech. Wheat Germ Lectin, Wheat Germ Agglutinin, and WGA are used interchangeably herein. Free Wheat Germ Lectin (Triticum vulgare) and all other lectins were obtained from E Y Laboratories; methyl-α-D-mannopyranoside was from Calbiochem and N-acetyl-D-glucosamine, GlcNAc, and the trisaccharide N N′N′-triacetylchitotriose, (GlcNAc)₃, were purchased from Sigma Chemical Co. The 2′-NH₂modified CTP and UTP were prepared according to Pieken et. al. (1991, Science 253:314-317). DNA oligonucleotides were synthesized by Operon. All other reagents and chemicals were purchased from commercial sources. Unless otherwise indicated, experiments utilized Hanks' Balanced Salt Solutions (HBSS; 1.3 mM CaCl₂, 5.0 mM KCl, 0.3 mM KH₂PO₄, 0.5 mM MgCl₂.6H₂O, 0.4 mM MgSO₄.7H₂O, 138 mM NaCl, 4.0 mM NaHCO₃, 0.3 mM Na₂HPO4, 5.6 mM D-Glucose; GibcoBRL).

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. In the wheat germ agglutinin SELEX experiment, the DNA template for the initial RNA pool contained 50 random nucleotides, flanked by [0087] N9 5′ and 3′ fixed regions (50N9) 5′ gggaaaagcgaaucauacacaaga-50N-gcuccgccagagaccaaccgagaa 3′ (SEQ ID NO: 1). All C and U have 2′-NH₂substituted for 2′-OH for ribose. The primers for the PCR were the following: 5′ Primer 5′ taatacgactcactatagggaaaagcgaatcatacacaaga 3′ (SEQ ID NO: 2) and 3′ Primer 5′ ttctcggttggtctctggcggagc 3′ (SEQ ID NO: 3). The fixed regions of the starting random pool include DNA primer annealing sites for PCR and cDNA synthesis as well as the consensus T7 promoter region to allow in vitro transcription. These single-stranded DNA molecules were converted into double-stranded transcribable templates by PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 0.1% TritonX-100, 7.5 mM MgCl₂, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase. Transcription reactions contained 5 mM DNA template, 5 units/μl T7 RNA polymerase, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl₂, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 2 mM each of 2′-OH ATP, 2′-OH GTP, 2′-NH₂CTP, 2′-NH₂UTP, and 0.31 mM α-³² P 2′-OH ATP.
The strategy for partitioning WGA/RNA complexes from unbound RNA was 1) to incubate the RNA pool with WGA immobilized on sepharose beads; 2) to remove unbound RNA by extensive washing; and 3) to specifically elute RNA molecules bound at the carbohydrate binding site by incubating the washed beads in buffer containing high concentrations of (GlcNAc)[0088] ₃. The SELEX protocol is outlined in Table 1.
The WGA density on Wheat Germ Lectin Sepharose 6MB beads is approximately 5 mg/ml of gel or 116 μM (manufacturer's specifications). After extensive washing in HBSS, the immobilized WGA was incubated with RNA at room temperature for 1 to 2 hours in a 2 ml siliconized column with constant rolling (Table 1). Unbound RNA was removed by extensive washing with HBSS. Bound RNA was eluted as two fractions; first, nonspecifically eluted RNA was removed by incubating and washing with 10 mM methyl-α-D-mannopyranoside in HBSS (Table 1; rounds 1-4) or with HBSS (Table 1; rounds 5-11); second, specifically eluted RNA was removed by incubating and washing with 0.5 to 10 mM (GlcNAc)[0089] ₃in HBSS (Table 1). The percentage of input RNA that was specifically eluted is recorded in Table 1.
The specifically eluted fraction was processed for use in the following round. Fractions eluted from immobilized WGA were heated at 90° C. for 5 minutes in 1% SDS, 2% β-mercaptoethanol and extracted with phenol/chloroform. RNA was reverse transcribed into cDNA by AMV reverse transcriptase at 48° C. for 60 min in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc)[0090] ₂, 10 mM DTT, 100 pmol DNA primer, 0.4 mM each of dNTPs, and 0.4 unit/μl AMV RT. PCR amplification of this cDNA resulted in approximately 500 pmol double-stranded DNA, transcripts of which were used to initiate the next round of SELEX.

D) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for WGA and for other proteins. Filter discs (nitrocellulose/cellulose acetate mixed matrix, 0.45 μm pore size, Millipore; or pure nitrocellulose, 0.45 μm pore size, Bio-Rad) were placed on a vacuum manifold and washed with 4 ml of HBSS buffer under vacuum. Reaction mixtures, containing [0091] ³²P labeled RNA pools and unlabeled WGA, were incubated in HBSS for 10 min at room temperature, filtered, and then immediately washed with 4 ml HBSS. The filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor.
WGA is a homodimer, molecular weight 43.2 kD, with 4 GlcNAc binding sites per dimer. For affinity calculations, we assume one RNA ligand binding site per monomer (two per dimer). The monomer concentration is defined as 2 times the dimer concentration. The equilibrium dissociation constant, K[0092] _d, for an RNA pool or specific ligand that binds monophasically is given by the equation
K_d=[P_f][R_f]/[RP]
where, [Rf]=free RNA concentration [0093]
[Pf]=free WGA monomer concentration [0094]
[RP]=concentration of RNA/WGA monomer complexes [0095]
K[0096] _d=dissociation constant
A rearrangement of this equation, in which the fraction of RNA bound at equilibrium is expressed as a function of the total concentration of the reactants, was used to calculate Kds of monophasic binding curves: [0097]
q=(P _T +R _T +K _d−((P _T +R _T +K _d)²−4 P _T R _T)^1/2)
q=fraction of RNA bound [0098]
[P[0099] _T=total WGA monomer concentration
[R[0100] _T=total RNA concentration
K[0101] _ds were determined by least square fitting of the data points using the graphics program Kaleidagraph (Synergy Software, Reading, Pa.).

E) Cloning and Sequencing

The sixth and eleventh round PCR products were re-amplified with primers which contain a BamH1 or a EcoR1 restriction endonuclease recognition site. Using these restriction sites the DNA sequences were inserted directionally into the pUC18 vector. These recombinant plasmids were transformed into [0102] E. coli strain JM109 (Stratagene, La Jolla, Calif.). Plasmid DNA was prepared according to the alkaline hydrolysis method (Zhou et al., 1990 Biotechniques 8:172-173) and about 72 clones were sequenced using the Sequenase protocol (United States Biochemical Corporation, Cleveland, Ohio). The sequences are provided in Table 2.

F) Competitive Binding Studies

Competitive binding experiments were performed to determine if RNA ligands and (GlcNAc)[0103] ₃bind the same site on WGA. A set of reaction mixtures containing α³²P labeled RNA ligand and unlabeled WGA, each at a fixed concentration (Table 5), was incubated in HBSS for 15 min at room temperature with (GlcNAc)₃. Individual reaction mixtures were then incubated with a (GlcNAc)₃dilution from a 2-fold dilution series for 15 minutes. The final (GlcNAc)₃concentrations ranged from 7.8 μM to 8.0 mM (Table 5). The reaction mixtures were filtered, processed and counted as described in “Nitrocellulose Filter Binding Assay,” paragraph D above.
Competition titration experiments were analyzed by the following equation to determine the concentration of free protein [P] as a function of the total concentration of competitor added, [C[0104] _T]:
0=[P](1+K _L [L _T]/(1+K _L [P])+K _C [C _T]/(1+K _C [P]))−P_T
where L[0105] _Tis the concentration of initial ligand, K_Lis the binding constant of species L to the protein (assuming 1:1 stiochiometry) and Kc is the binding constant of species C to the protein (assuming 1:1 stiochiometry). Since it is difficult to obtain a direct solution for equation 1, iteration to determine values of [P] to a precision of 1×10⁻¹⁵was used. Using these values of [P], the concentration of protein-ligand complex [PL] as a function of [C_T] was determined by the following equation:
[P _L ]=K _L [L _T ][P](1+K _L [P])
Since the experimental data is expressed in terms of % [PL], the calculated concentration of [PL] was normalized by the initial concentration of [PLo] before addition of the competitor. ([PLo] was calculated using the quadratic solution for the standard binding equation for the conditions used. The maximum (M) and minimum (B) % [PL] was allowed to float during the analysis as shown in the following equation. [0106]
% [P _L ]=[PL]/[PLo]*(M−B)+B
A non-linear least-squares fitting procedure was used as described by P. R. Bevington (1969) Data Reduction and Error Analysis for the Physical Sciences, McGraw-Hill publishers. The program used was originally written by Stanley J. Gill in MatLab and modified for competition analysis by Stanley C. Gill. The data were fit to equations 1-3 to obtain best fit parameters for K[0107] _C, M and B as a function of [C_T] while leaving K_Land P_Tfixed.

G) Inhibition of WGA Agglutinating Activity

Agglutination is a readily observed consequence of the interaction of a lectin with cells and requires that individual lectin molecules crosslink two or more cells. Lectin mediated agglutination can be inhibited by sugars with appropriate specificity. Visual assay of the hemagglutinating activity of WGA and the inhibitory activity of RNA ligands, GlcNAc and (GlcNAc)[0108] ₃was made in Falcon round bottom 96 well microtiter plates, using sheep erythrocytes. Each well contained 54 μl of erythrocytes (2.5×10⁸cells/ml) and 54 μl of test solution.
To titrate WGA agglutinating activity, each test solution contained a WGA dilution from a 4-fold dilution series. The final WGA concentrations ranged from 0.1 μM to 0.5 μM. For inhibition assays, the test solutions contained 80 nM WGA (monomer) and a dilution from a 4-fold dilution series of the designated inhibitor. Reaction mixtures were incubated at room temperature for 2 hours, after which time no changes were observed in the precipitation patterns of erythrocytes. These experiments were carried out in Gelatin Veronal Buffer (0.15 nM CaCl[0109] ₂, 141 mM NaCl, 0.5 mM MgCl₂, 0.1% gelatin, 1.8 mM sodium barbital, and 3.1 mM barbituric acid, pH 7.3-7.4; Sigma #G-6514).
In the absence of agglutination, erythrocytes settle as a compact pellet. Agglutinated cells form a more diffuse pellet. Consequently, in visual tests, the diameter of the pellet is diagnostic for agglutination. The inhibition experiments included positive and negative controls for agglutination and appropriate controls to show that the inhibitors alone did not alter the normal precipitation pattern. [0110]

Example 2

RNA Ligands to WGA

A. SELEX

The starting RNA library for SELEX, randomized 50N9 (SEQ ID NO: 1), contained approximately 2×10[0111] ¹⁵molecules (2 nmol RNA). The SELEX protocol is outlined in Table 1. Binding of randomized RNA to WGA is undetectable at 36 μM WGA monomer. The dissociation constant of this interaction is estimated to be >4 mM.
The percentage of input RNA eluted by (GlcNAc)[0112] ₃increased from 0.05% in the first round, to 28.5% in round 5 (Table 1). The bulk K_dof round 5 RNA was 600 nM (Table 1). Since an additional increase in specifically eluted RNA was not observed in round 6a (Table 1), round 6 was repeated (Table 1, round 6b) with two modifications to increase the stringency of selection: the volume of gel, and hence the mass of WGA, was reduced ten fold; and RNA was specifically eluted with increasing concentrations of (GlcNAc)3, in stepwise fashion, with only the last eluted RNA processed for the following round. The percentage of specifically eluted RNA increased from 5.7% in round 6b to 21.4% in round 8, with continued improvement in the bulk Kd (260 nM, round 8 RNA, Table 1).
For [0113] rounds 9 through 11 the WGA mass was again reduced ten fold to further increase stringency. The K_dof round 11 RNA was 68 nM. Sequencing of the bulk starting RNA pool and sixth and eleventh round RNA revealed some nonrandomness in the variable region at the sixth round and increased nonrandomess at round eleven.
To monitor the progess of SELEX, ligands were cloned and sequenced from round 6b and [0114] round 11. From each of the two rounds, 36 randomly picked clones were sequenced. Sequences were aligned manually and are shown in Table 2.

B. RNA Sequences

From the sixth and eleventh rounds, respectively, 27 of 29 and 21 of 35 sequenced ligands were unique. The number before the “.” in the ligand name indicates whether it was cloned from the [0115] round 6 or round 11 pool. Only a portion of the entire clone is shown in Table 2 (SEQ ID NOS: 4-55). The entire evolved random region is shown in upper case letters. Any portion of the fixed region is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. In Table 2, ligands sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into nine sequence families (1-9) and a group of unrelated sequences (Orphans).
The distribution of families from round six to eleven provides a clear illustration of the appearance and disappearance of ligand families in response to increased selective pressure (Table 2). [0116] Family 3, predominant (11/29 ligands) in round 6, has nearly disappeared (2/35) by round 11. Similarly, minor families 6 through 9 virtually disappear. In contrast, only one (family 1) of round eleven's predominant families (1, 2, 4 and 5) was detected in round six. The appearance and disappearance of families roughly correlates with their binding affinities.
Alignment (Table 2) defines consensus sequences for families 14 and 6-9 (SEQ ID NOS: 56-63). The consensus sequences of families 1-3 are long (20, 16 and 16, respectively) and very highly conserved. The consensus sequences of [0117] families 1 and 2 contain two sequences in common: the trinucleotide TCG and the pentanucleotide ACGAA. A related tetranucleotide, AACG, occurs in family 3. The variation in position of the consensus sequences within the variable regions indicates that the ligands do not require a specific sequence from either the 5′ or 3′ fixed region.
The consensus sequences of [0118] family 1 and 2 are flanked by complementary sequences 5 or more nucleotides in length. These complementary sequences are not conserved and the majority include minor discontinuities. Family 3 also exhibits flanking complementary sequences, but these are more variable in length and structure and utilize two nucleotide pairs of conserved sequence.
Confidence in the [0119] family 4 consensus sequence (Table 2) is limited by the small number of ligands, the variability of spacing and the high G content. The pentanucleotide, RCTGG, also occurs in families 5 and 8. Ligands of family 5 show other sequence similarities to those of family 4, especially to ligand 11.28.

C. Affinities

The dissociation constants for representative members of families 1-9 and orphan ligands were determined by nitrocellulose filter binding experiments and are listed in Table 3. These calculations assume one RNA ligand binding site per WGA monomer. At the highest WGA concentration tested (36 μM WGA monomer), binding of random RNA is not observed, indicating a K[0120] _dat least 100-fold higher than the protein concentration or >4 mM.
The data in Table 3 define several characteristics of ligand binding. First, RNA ligands to WGA bind monophasically. Second, the range of measured dissociation constants is 1.4 nM to 840 nM. Third, the binding for a number of ligands, most of which were sixth round isolates, was less than 5% at the highest WGA concentration tested. The dissociation constants of these ligands are estimated to be greater than 20 μM. Fourth, on average eleventh round isolates have higher affinity than those from the sixth round. Fifth, the SELEX probably was not taken to completion; the best ligand (11.20)(SEQ ID NO: 40) is not the dominant species. Since the SELEX was arbitrarily stopped at the 11th round, it is not clear that 11.20 would be the ultimate winner. Sixth, even though the SELEX was not taken to completion, as expected, RNA ligands were isolated that bind WGA with much greater affinity than do mono- or oligosaccharides (ie., the affinity of 11.20 is 5×10[0121] ⁵greater than that of GlcNAc, Kd=760 μM, and 850 better than that of (GlcNAc)₃, Kd=12 μM; Y. Nagata and M. Burger, 1974, supra). This observation validates the proposition that competitive elution allows the isolation of oligonucleotide ligands with affinities that are several orders of magnitude greater than that of the competing sugar.
In addition these data show that even under conditions of high target density, 116 pmol WGA dimer/μl of beads, it is possible to overcome avidity problems and recover ligands with nanomolar affinities. From the sixth to the eleventh round (Table 2), in response to increased selective pressure as indicated by the improvement in bulk K[0122] _d(Table 1), sequence families with lower than average affinity (Table 3) are eliminated from the pool.

Example 3

Specificity of RNA Ligands to WGA

The affinity of WGA ligands 6.8, 11.20 and 11.24 (SEQ ID NOS: 13, 40, and 19) for GlcNAc binding lectins from [0123] Ulex europaeus, Datura stramonium and Canavalia ensiformis were determined by nitrocellulose partitioning. The results of this determination are shown in Table 4. The ligands are highly specific for WGA. For example, the affinity of ligand 11.20 for WGA is 1,500, 8,000 and >15,000 fold greater than it is for the U. europaeus, D. stramonium and C. ensiformis lectins, respectively. The 8,000 fold difference in affinity for ligand 11.20 exhibited by T. vulgare and D. stramonium compares to a 3 to 10 fold difference in their affinity for oligomers of GlcNAc and validates the proposition that competitive elution allows selection of oligonucleotide ligands with much greater specificity than monomeric and oligomeric saccharides (J. F. Crowley et al., 1984, Arch. Biochem. and Biophys. 231:524-533; Y. Nagata and M. Burger, 1974, supra; J -P. Privat et al., FEBS Letters 46:229-232).

Example 4

Competitive Binding Studies

If an RNA ligand and a carbohydrate bind a common site, then binding of the RNA ligand is expected to be competitively inhibited by the carbohydrate. Furthermore, if the oligonucleotide ligands bind exclusively to carbohydrate binding sites, inhibition is expected to be complete at high carbohydrate concentrations. In the experiments reported in Table 5, dilutions of unlabeled (GlcNAc)[0124] ₃, from a 2-fold dilution series, were added to three sets of binding reactions that contained WGA and an α³²P labeled RNA ligand (6.8, 11.20 or 11.24 (SEQ ID NOS: 13, 40 and 19); [RNA] final=[WGA]final=15 nM). After a 15 minute incubation at room temperature, the reactions were filtered and processed as in standard binding experiments.
Qualitatively, it is clear that RNA ligands bind only to sites at which (GlcNAc)[0125] ₃binds, since inhibition is complete at high (GlcNAc)₃concentrations (Table 5). These data do not rule out the possibility that (GlcNAc)₃binds one or more sites that are not bound by these RNA ligands.
Quantitatively, these data fit a simple model of competitive inhibition (Table 5) and give estimates of 8.4, 10.9 and 19.4 μM for the Kd of (GlcNAc)[0126] ₃. These estimates are in good agreement with literature values (12 μM@4 C, Nagata and Burger, 1974, supra; 11 μM@10.8 C, Van Landschoot et al., 1977, Eur. J. Biochem. 79:275-283; 50 μM, M. Monsigny et al., 1979, Eur J. Biochem. 98:39-45). These data confirm the proposition that competitive elution with a specific carbohydrate targets the lectin's carbohydrate binding site.

Example 5

Inhibition of WGA Agglutinating Activity

At 0.5 μM, RNA ligands 6.8 and 11.20 (SEQ ID NO: 13 and 40) completely inhibit WGA mediated agglutination of sheep erythrocytes (Table 6). Ligand 11.24 (SEQ ID NO: 19) is not as effective, showing only partial inhibition at 2 μM, the highest concentration tested (Table 6). (GlcNAc)3 and GlcNAc completely inhibit agglutination at higher concentrations, 8 μM and 800 μM, respectively, (Table 6; Monsigny et al., supra). The inhibition of agglutination varifies the proposition that ligands isolated by this procedure will be antagonists of lectin function. Inhibition also suggests that more than one RNA ligand is bound per WGA dimer, since agglutination is a function of multiple carbohydrate binding sites. [0127]
An alternative interpretation for the inhibition of agglutination is that charge repulsion prevents negatively charged WGA/RNA complexes from binding carbohydrates (a necessary condition for agglutination) on negatively charged cell surfaces. This explanation seems unlikely for two reasons. First, negatively charged oligonucleotide ligands selected against an immobilized purified protein are known to bind to the protein when it is presented in the context of a cell surface (see Example 10, L-selectin cell binding). Second, negatively charged (pI=4) succinylated WGA is as effective as native WGA (pI=8.5) in agglutinating erythrocytes (M. Monsigny et al., supra). [0128]

Example 6

Secondary Structure of High Affinity WGA Ligands

In favorable instances, comparative analysis of aligned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved. [0129]
Comparative analyses of both [0130] family 1 and 2 sequences each yield a hairpin structure with a large highly conserved loop (FIGS. 1a and 1 b). Interactions between loop nucleotides are likely but they are not defined by these data. The stems of individual ligands vary in sequence, length and structure (i.e., a variety of bulges and internal loops are allowed; Table 2). Qualitatively it is clear that the stems are validated by Watson/Crick covariation and that by the rules of comparative analysis the stems are not directly involved in binding WGA. Family 3 can form a similar hairpin in which 2 pairs of conserved nucleotides are utilized in the stem (FIG. 1c).
If it is not possible to fold the ligands of a sequence family into homologous structures, their assignment to a single family is questionable. Both ligand 11.7, the dominant member of [0131] family 4, and ligand 11.28 can be folded into two plane G-quartets. However, this assignment is speculative: 1) 11.28 contains five GG dinucleotides and one GGGG tetranucleotide allowing other G-quartets; and 2) ligands 11.2 and 11.33 cannot form G-quartets. On the other hand, all ligands can form a hairpin with the conserved sequence GAGRFTNCRT in the loop. However, the conserved sequence RCTGGC (Table 2) does not have a consistent role in these hairpins.
Multiple G-quartet structures are possible for [0132] Family 5. One of these resembles the ligand 11.7 G-quartet. No convincing hairpin structures are possible for ligand 11.20.

Example 7

2′-NH₉RNA Ligands to Human L-Selectin

The experimental procedures outlined in this Example were used to identify and characterize the 2′-NH[0133] ₂RNA ligands to human L-selectin in Examples 8-12.

Experimental Procedures

A) Materials

LS-Rg is a chimeric protein in which the extracellular domain of human L-selectin is joined to the Fc domain of a human G2 immunoglobulin (Norgard et al., 1993, PNAS 90:1068-1072). ES-Rg, PS-Rg and CD22β-Rg are analogous constructs of E-selectin, P-selectin and CD22β joined to a human G1 immunoglobulin Fc domain (R. M. Nelson et al., 1993, supra; I. Stamenkovic et al., 1991, [0134] Cell 66, 1133-1144). Purified chimera were provided by A. Varki. Soluble P-selectin was purchased from R&D Systems. Protein A Sepharose 4 Fast Flow beads were purchased from Pharmacia Biotech. Anti-L-selectin monoclonal antibodies: SK11 was obtained from Becton-Dickinson, San Jose, Calif.; DREG-56, an L-selectin specific monoclonal antibody, was purchased from Endogen, Cambridge, Mass. The 2′-NH₂modified CTP and UTP were prepared according to Pieken et. al. (1991, Science 253:314-317). DNA oligonucleotides were synthesized by Operon. All other reagents and chemicals were purchased from commercial sources. Unless otherwise indicated, experiments utilized HSMC buffer (1 mM CaCl₂, 1 mM MgCl₂, 150 mM NaCl, 20.0 mM HEPES, pH 7.4).

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. The nucleotide sequence of the synthetic DNA template for the LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by [0135] N7 5′ and 3′ fixed regions (40N7). 40N7 transcript has the sequence 5′ gggaggacgaugcgg-40N-cagacgacucgcccga 3′ (SEQ ID NO: 64). All C and U have 2′-NH₂substituted for 2′-OH on the ribose. The primers for the PCR were the following:
[0136] N7 5′ Primer 5′ taatacgactcactatagggaggacgatgcgg 3′ (SEQ ID NO: 65)
[0137] N7 3′ Primer 5′ tcgggcgagtcgtcctg 3′ (SEQ ID NO: 66)
The fixed regions include primer annealing sites for PCR and cDNA synthesis as well as a consensus T7 promoter to allow in vitro transcription. The initial RNA pool was made by first Klenow extending 1 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 3.5 nmols primer 5N7, 1.4 nmols 40N7, 1× Klenow Buffer, 0.4 mM each of dATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml. [0138]
For subsequent rounds, eluted RNA was the template for AMV reverse transcriptase mediated synthesis of single-stranded cDNA. These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl[0139] ₂, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase. Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mM MgCl₂, 5 mM DTT, 2 mM spermidine, 2 mM each of 2′-OH ATP, 2′-OH GTP, 2′-NH₂CTP, 2′-NH₂UTP, and 250 nM α-³² P 2′-OH ATP.
The strategy for partitioning LS-Rg/RNA complexes from unbound RNA is outlined in Tables 7a and 7b. First, the RNA pool was incubated with LS-Rg immobilized on protein A sepharose beads in HSMC buffer. Second, the unbound RNA was removed by extensive washing. Third, the RNA molecules bound at the carbohydrate binding site were specifically eluted by incubating the washed beads in HMSC buffer containing 5 mM EDTA in place of divalent cations. The 5 mM elution was followed by a non-specific 50 mM EDTA elution. LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions (Pharmacia Biotech). [0140]
The 5 mM EDTA elution is a variation of a specific site elution strategy. Although it is not a priori as specific as elution by carbohydrate competition, it is a general strategy for C-type (calcium dependent binding) lectins and is a practical alternative when the cost and/or concentration of the required carbohydrate competitor is unreasonable (as is the case with sialyl-Lewis[0141] ^X). This scheme is expected to be fairly specific for ligands that form bonds with the lectin's bound Ca⁺⁺ because the low EDTA concentration does not appreciably increase the buffer's ionic strength and the conformation of C-type lectins is only subtly altered in the absence of bound calcium (unpublished observations cited by K. Drickamer, 1993, Biochem. Soc. Trans. 21:456-459).
In the initial SELEX rounds, which were performed at 4° C., the density of immobilized LS-Rg was 16.7 pmols/μl of [0142] Protein A Sepharose 4 Fast Flow beads. In later rounds, the density of LS-Rg was reduced (Tables 7a and 7b), as needed, to increase the stringency of selection. At the seventh round, the SELEX was branched and continued in parallel at 4° C. (Table 7a) and at room temperature (Table 7b). Wash and elution buffers were equilibrated to the relevant incubation temperature. Beginning with the fifth round, SELEX was often done at more than one LS-Rg density. In each branch, the eluted material from only one LS-Rg density was carried forward.
Before each round, RNA was batch adsorbed to 100 μl of protein A sepharose beads for 1 hour in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized LS-Rg was batch incubated with pre-adsorbed RNA for 1 to 2 hours in a 2 ml siliconized column with constant rocking. Unbound RNA was removed by extensive batch washing (200 to 500 μl HSMC/wash). Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second the remaining elutable RNA was removed by incubating and/or washing with 50 mM EDTA in HSMC without divalents. The percentage of input RNA that was eluted is recorded in Tables 7a and 7b. In every round, an equal volume of protein A sepharose beads without LS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round of SELEX. [0143]
The eluted fractions were processed for use in the following round (Tables 7a and 7b). After extracting with phenol/chloroform and precipitating with isopropanol/ethanol (1:1, v/v), the RNA was reverse transcribed into cDNA by AMV reverse transcriptase either 1) at 48° C. for 15 minutes and then 65° C. for 15 minutes or 2) at 37° C. and 48° C. for 15 minutes each, in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc)[0144] ₂, 10 mM DTT, 100 pmol DNA primer, 0.4 mM each of dNTPs, and 0.4 unit/μl AMV RT. Transcripts of the PCR product were used to initiate the next round of SELEX.

C) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for LS-Rg and for other proteins. Filter discs (nitrocellulose/cellulose acetate mixed matrix, 0.45 μm pore size, Millipore) were placed on a vacuum manifold and washed with 2 ml of HSMC buffer under vacuum. Reaction mixtures, containing [0145] ³²P labeled RNA pools and unlabeled LS-Rg, were incubated in HSMC for 10-20 min at 4° C., room temperature or 37° C., filtered, and then immediately washed with 4 ml HSMC at the same temperature. The filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor.
LS-Rg is a dimeric protein that is the expression product of a recombinant gene constructed by fusing the DNA sequence that encodes the extracellular domains of human L-selectin to the DNA that encodes a human IgG[0146] ₂Fc region. For affinity calculations, we assume one RNA ligand binding site per LS-Rg monomer (two per dimer). The monomer concentration is defined as 2 times the LS-Rg dimer concentration. The equilibrium dissociation constant, K_d, for an RNA pool or specific ligand that binds monophasically is given by the equation
Kd=[Pf][Rf]/[RP]
where, [Rf]=free RNA concentration [0147]
[Pf]=free LS-Rg monomer concentration [0148]
[RP]=concentration of RNA/LS-Rg complexes [0149]
Kd=dissociation constant [0150]
A rearrangement of this equation, in which the fraction of RNA bound at equilibrium is expressed as a function of the total concentration of the reactants, was used to calculate Kds of monophasic binding curves: [0151]
q=(P _T +R _T +K _d−((P _T +R _T +K _d)²−4 P _T R _T)^1/2)
q=fraction of RNA bound [0152]
[P[0153] _T]=2×(total LS-Rg concentration)
[R[0154] _T]=total RNA concentration
Many ligands and evolved RNA pools yield biphasic binding curves. Biphasic binding can be described as the binding of two affinity species that are not in equilibrium. Biphasic binding data were evaluated with the equation [0155]
q=2P _t +R _t +Kd ₁ +Kd ₂−[(P _t +X ₁ R ₁ +K _d1)²−4P _t X ₁ R _t]^1/2−[(P _t +X ₂ R _t +K _d2)²−4P _t X ₂ R _t]^1/2,
where X[0156] ₁and X₂are the mole fractions of affinity species R₁and R₂and K_d1and K_d2are the corresponding dissociation constants. K_ds were determined by least square fitting K_ds were determined by least square fitting of the data points using the graphics program Kaleidagraph (Synergy Software, Reading, Pa.).

D) Cloning and Sequencing

Sixth, thirteenth (RT) and fourteenth (4° C.) round PCR products were re-amplified with primers which contain either a BamHI or a HinDIII restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinant plasmids were transformed into [0157] E. coli strain DH5a (Life Technologies, Gaithersburg, Md.). Plasmid DNA was prepared according to the alkaline hydrolysis method (PERFECTprep, 5′-3′, Boulder, Colo.). Approximately 150 clones were sequenced using the Sequenase protocol (Amersham, Arlington Heights, Ill.). The resulting ligand sequences are shown in Table 8.

E) Cell Binding Studies

The ability of evolved ligand pools and cloned ligands to bind to L-selectin presented in the context of a cell surface was tested in experiments with isolated human peripheral blood mononuclear cells (PBMCs). Whole blood, collected from normal volunteers, was anticoagulated with 5 mM EDTA. Six milliliters of blood were layered on a 6 ml Histopaque gradient in 15 ml polypropylene tube and centrifuged (700 g) at room temperature for 30 minutes. The mononuclear cell layer was collected, diluted in 10 ml of Ca[0158] ⁺⁺/Mg⁺⁺-free DPBS (DPBS(−); Gibco 14190-029) and centrifuged (225 g) for 10 minutes at room temperature. Cell pellets from two gradients were combined, resuspended in 10 ml of DPBS(−) and recentrifuged as described above. These pellets were resuspended in 100 μl of SMHCK buffer supplemented with 1% BSA. Cells were counted in a hemocytometer, diluted to 2×10⁷cells/ml in SMHCK/1% BSA and immediately added to binding assays. Cell viability was monitored by trypan blue exclusion.
For cell binding assays, a constant number of cells were titrated with increasing concentrations of radiolabeled ligand. The test ligands were serially diluted in DPBS(−)/1% BSA to 2-times the desired final concentration approximately 10 minutes before use. Equal volumes (25 μl) of each ligand dilution and the cell suspension (2×10[0159] ⁷cells/ml) were added to 0.65 ml eppendorf tubes, gently vortexed and incubated on ice for 30 minutes. At 15 minutes the tubes were revortexed. The ligand/PBMC suspension was layered over 50 μl of ice cold phthalate oil (1:1=dinonyl:dibutyl phthalate) and microfuged (14,000 g) for 5 minutes at 4° C. Tubes were frozen in dry ice/ethanol, visible pellets amputated into scintillation vials and counted in Beckman LS6500 scintilation counter as described in Example 7, paragraph C.
The specificity of binding to PBMCs was tested by competition with the L-selectin specific blocking monoclonal antibody, DREG-56, while saturability of binding was tested by competition with unlabeled RNA. Experimental procedure and conditions were like those for PBMC binding experiments, except that the radiolabeled RNA ligand ([0160] final concentration 5 nM) was added to serial dilutions of the competitor before mixing with PBMCs.

F) Inhibition of Selectin Binding to sialyl-Lewis^X

The ability of evolved RNA pools or cloned ligands to inhibit the binding of LS-Rg to sialyl-Lewis[0161] ^Xwas tested in competive ELISA assays (C. Foxall et al., 1992, supra). For these assays, the wells of Coming (25801) 96 well microtiter plates were coated with 100 ng of a sialyl-Lewis^X/BSA conjugate, air dried overnight, washed with 300 μl of PBS(−) and then blocked with 1% BSA in SHMCK for 60 min at room temperature. RNA ligands were incubated with LS-Rg in SHMCK/1% BSA at room temperature for 15 min. After removal of the blocking solution, 50 μl of LS-Rg (10 nM) or a LS-Rg (10 nM)/RNA ligand mix was added to the coated, blocked wells and incubated at room temperature for 60 minutes. The binding solution was removed, wells were washed with 300 μl of PBS(−) and then probed with HRP conjugated anti-human IgG, at room temperature to quantitate LS-Rg binding. After a 30 minute incubation at room temperature in the dark with OPD peroxidase substrate (Sigma P9187), the extent of LS-Rg binding and percent inhibition was determined from the OD₄₅₀.

Example 8

2′-NH₉RNA Ligands to Human L-selectin

A. SELEX

The starting RNA pool for SELEX, randomized 40N7 (SEQ ID NO: 63), contained approximately 10[0162] ¹⁵molecules (1 nmol RNA). The SELEX protocol is outlined in Tables 7a and 7b and Example 7. The dissociation constant of randomized RNA to LS-Rg is estimated to be approximately 10 μM. No difference was observed in the RNA elution profiles with 5 mM EDTA from SELEX and background beads for rounds 1 and 2, while the 50 mM elution produced a 2-3 fold excess over background (Table 7a). The 50 mM eluted RNA from rounds 1 and 2 were amplified for the input material for rounds 2 and 3, respectively. Beginning in round 3, the 5 mM elution from SELEX beads was significantly higher than background and was processed for the next round's input RNA. The percentage of input RNA eluted by 5 mM EDTA increased from 0.5% in the first round to 8.4% in round 5 (Table 7a). An additional increase in specifically eluted RNA from the 10 μM LS-Rg beads was not observed in round 6 (Table 7a). To increase the stringency of selection, the density of immobilized LS-Rg was reduced ten fold in round 5 with further reductions in protein density at later rounds. The affinity of the selected pools rapidly increased and the pools gradually evolved biphasic binding characteristics.
Binding experiments with 6th round RNA revealed that the affinity of the evolving pool for L-selectin was temperature sensitive. Beginning with [0163] round 7, the SELEX was branched; one branch was continued at 4° C. (Table 7a) while the other was conducted at room temperature (Table 7b). Bulk sequencing of 6th, 13th (rm temp) and 14th (4° C.) RNA pools revealed noticeable non-randomness at round six and dramatic non-randomess at the later rounds. The 6th round RNA bound monophasically at 4° C. with a dissociation constant of approximately 40 nM, while the 13th and 14th round RNAs bound biphasically with high affinity Kds of approximately 700 pM. The molar fraction of the two pools that bound with high affinity were 24% and 65%, respectively. The binding of all tested pools required divalent cations. In the absence of divalent cations, the Kds of the 13th and 14th round pools increased to 45 nM and 480 nM, respectively (HSMC, minus Ca⁺⁺/Mg⁺⁺, plus 2 mM EDTA).
To monitor the progress of SELEX, ligands were cloned and sequenced from [0164] rounds 6, 13 (rm temp) and 14 (4° C.). Sequences were aligned manually and with the aid of a computer program that determines consensus sequences from frequently occurring local alignments.

B. Sequences

In Table 8, ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). The letter/number combination before the “.” in the ligand name indicates whether it was cloned from the [0165] round 6, 13 or 14 pools. Only the evolved random region is shown in Table 8. Any portion of the fixed region is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the sixth, thirteenth and fourteenth rounds, respectively, 26 of 48, 8 of 24 and 9 of 70 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once, are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into thirteen sequence families (I-XIII) and a group of unrelated sequences (Orphans)(SEQ ID NOs: 67-117).
Two families, I and III, are defined by ligands from multiple lineages. Both families occur frequently in [0166] round 6, but only one family m ligand was identified in the final rounds. Six families (IV, V, VI, VII, VIII, and possibly II) are each defined by just two lineages which limits confidence in their consensus sequences. Five families (IX through XIII) are defined by a single lineage which precludes determination of consensus sequences.
Ligands from family II dominate the final rounds: 60/70 ligands in [0167] round 14 and 9/24 in round 13. Family II is represented by three mutational variations of a single sequence. One explanation for the recovery of a single lineage is that the ligand's information content is extremely high and was therefore represented by a unique species in the starting pool. Family II ligands were not detected in the sixth round which is consistent with a low frequency in the initial population. An alternative explanation is sampling error. Note that a sequence of questionable relationship was detected in the sixth round.
The best defined consensus sequences are those of family I, AUGUGUA (SEQ ID NO: 118), and of family III, AACAUGAAGUA (SEQ ID NO: 120), as shown in Table 8. Family III has two additional, variably spaced sequences, AGUC and ARUUAG, that may be conserved. The tetranucleotide AUGW is found in the consensus sequence of families I, III, and VII and in families II, VIII and IX. If this sequence is significant, it suggests that the conserved sequences of ligands of family VIII are circularly permuted. The sequence AGAA is found in the consensus sequence of families IV and VI and in families X and XIII. [0168]

C. Affinities

The dissociation constants for representative ligands from [0169] rounds 13 and 14, including all orphans, were determined by nitrocellulose filter binding experiments are described in Example 7 and the results are listed in Table 9. These calculations assume two RNA ligand binding sites per chimera. The affinity of random RNA cannot be reliably determined but is estimated to be approximately 10 μM.
In general, ligands bind monophasically with dissociation constants ranging from 50 pM to 15 nM at 4° C. Some of the highest affinity ligands bind biphasically. Although ligands of families I, VII, X and orphan F14.70 bind about equally well at 4° C. and room temperature, in general the affinities decrease with increasing temperature. The observed affinities substantiate the proposition that it is possible to isolate oligonucleotide ligands with affinities that are several orders of magnitude greater than that of carbohydrate ligands. [0170]

Example 9

Specificity of 2′-NH₉RNA Ligands to L-Selectin

The affinity of L-selectin ligands to ES-Rg, PS-Rg and CD22β-Rg were determined by nitrocellulose partitioning as described in Example 7. As indicated in Table 10, the ligands are highly specific for L-selectin. In general, a ligand's affinity for ES-Rg is 10[0171] ³-fold lower and that for PS-Rg is about 10⁴-fold less than for LS-Rg. Binding above background is not observed for CD22β-Rg at the highest protein concentration tested (660 nM), indicating that ligands do not bind the Fc domain of the chimeric constructs nor do they have affinity for the sialic acid binding site of an unrelated lectin. The specificity of oligonucleotide ligand binding contrasts sharply with the binding of cognate carbohydrates by the selectins and confirms the proposition that SELEX ligands will have greater specificity than carbohydrate ligands.

Example 10

Binding of L-Selectin 2′-NH₇RNA Ligands to Human PBMCs

Since the L-selectin ligands were isolated against purified, immobilized protein, it is essential to demonstrate that they bind L-selectin presented in the context of a cell surface. Comparison of 2nd and 9th round RNAs (FIG. 2) shows that the evolved (9th round) ligand pool binds isolated PBMCs with high affinity and, as expected for specific binding, in a saturable fashion. The binding of [0172] round 2 RNA appears to be non-saturable as is characteristic of non-specific binding. The cloned ligand, F14.12 (SEQ ID NO: 78), also binds in a saturable fashion with a dissociation constant of 1.3 mM, while random 40N7 (SEQ ID NO: 64) resembles round 2 RNA (FIG. 3). The saturability of binding is confirmed by the data in FIG. 4; >90% of 5 nNM ³²P-labeled F14.12 RNA binding is competed by excess cold RNA. Specificity is demonstrated by the results in FIG. 5; binding of 5 nM ³²P-labeled F14.12 RNA is completely competed by the anti-L-selectin blocking monoclonal antibody, DREG-56, but is unaffected by an isotype-matched irrelevant antibody. These data validate the feasibility of using immobilized, purified protein to isolate ligands against a cell surface protein and the binding specificity of F14.12 to L-selectin in the context of a cell surface.

Example 11

Inhibition of Binding to Sialyl-Lewis^X

Oligonucleotide ligands, eluted by 2-5 mM EDTA, are expected to derive part of their binding energy from contacts with the lectin domain's bound Ca[0173] ⁺⁺ and consequently, are expected to compete with sialyl-Lewis^Xfor binding. The ability of ligand F14.12 (SEQ ID NO: 78) to inhibit LS-Rg binding to immobilized sialyl-Lewis^Xwas determined by competition ELISA assays. As expected, 4 mM EDTA reduced LS-Rg binding 7.4-fold, while 20 mM round 2 RNA did not inhibit LS-Rg binding. Carbohydrate binding is known to be Ca⁺⁺ dependent; the affinity of round 2 RNA is too low to bind 10 nM LS-Rg (Table 7).
In this assay F14.12 RNA inhibits LS-Rg binding in a concentration dependent manner with an IC[0174] ₅₀of about 10 nM (FIG. 6). Complete inhibition is observed at 50 nM F14.12. The observed inhibition is reasonable under the experimental conditions; the Kd of F14.12 at room temperature is about 1 nM (Table 9) and 10 nM LS-Rg is 20 nM binding sites. These data verify that RNA ligands compete with sialyl-Lewis^Xfor LS-Rg binding and support the contention that low concentrations of EDTA specifically elute ligands that bind the lectin domain's carbohydrate binding site.

Example 12

Secondary Structure of High Affinity 2′-NH₂Ligands to L-Selectin

In favorable instances, comparative analysis of aligned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved. [0175]
Comparative analysis of the family I alignment suggests a hairpin structure in which the consensus sequence, AUGUGUGA, is contained within a variable size loop (FIG. 7[0176] a). The stem sequences are not conserved and may be either 5′ or 3′-fixed or variable sequence. The one ligand that does not form a stem, F14.25 (SEQ ID NO: 73), has a significantly lower affinity than the other characterized ligands (Table 9).
The proposed structure for family III is also a hairpin with the conserved sequence, AACAUGAAGUA, contained within a variable length loop (FIG. 7[0177] b). The 5′-half of the stem is 5′-fixed sequence which may account in part for the less highly conserved sequence, AGUC.
Although there is no alignment data for family II, the sequence folds into a pseudoknot (FIG. 7[0178] c). Three attractive features of this model are 1) the helices stack on one another, 2) the structure utilizes only variable sequence and 3) the structure is compatible with the major variant sequences.

Example 13

ssDNA Ligands to Human L-Selectin

The experimental procedures outlined in this Example were used to identify and characterize ssDNA ligands to human L-selectin as described in Examples 14-21. [0179]

Experimental Procedures

A) Materials

Unless otherwise indicated, all materials used in the ssDNA SELEX against the L-selectin/IgG2 chimera, LS-Rg, were identical to those of Example 7, paragraph A. The buffer for SELEX experiments was 1 mM CaCl[0180] ₂, 1 mM MgCl₂, 100 mM NaCl, 10.0 mM HEPES, pH 7.4. The buffer for all binding affinity experiments differed from the above in containing 125 mM NaCl, 5 mM KCl, and 20 nM HEPES, pH 7.4.

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. The strategy used for this ssDNA SELEX is essentially identical to that described in Example 7, paragraph B except as noted below. The nucleotide sequence of the synthetic DNA template for the LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by [0181] BH 5′ and 3′ fixed regions. The random DNA template was termed 40BH (SEQ ID NO: 126) and had the following sequence: 5′-ctacctacgatctgactagc<40N>sgcttactctcatgtagttcc-3′. The primers for the PCR were the following: 5′ Primer: 5′-ctacctacgatctgactagc-3′ (SEQ ID NO: 127) and 3′ Primer: 5′-ajajaggaactacatgagagtaagc-3′; j=biotin (SEQ ID NO: 128). The fixed regions include primer annealing sites for PCR amplification. The initial DNA pool contained 500 pmols of each of two types of single-stranded DNA: 1) synthetic ssDNA and 2) PCR amplified, ssDNA from 1 nmol of synthetic ssDNA template.
For subsequent rounds, eluted DNA was the template for PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl[0182] ₂, 1 mM of each DATP, dCTP, dGTP, and dTTP and 25 U/ml of the Stoffel fragment of Taq DNA polymerase. After PCR amplification, double stranded DNAs were end-labeled using γ³²P-ATP. Complementary strands were separated by electrophoresis through an 8% polyacrylarnidenM urea gel. Strand separation results from the molecular weight difference of the strands due to biotintylation of the 3′ PCR primer. In the final rounds, DNA strands were separated prior to end labelling in order to achieve high specific activity. Eluted fractions were processed by ethanol precipitation.
The strategy for partitioning LS-Rg/ssDNA complexes from unbound ssDNA was as described in Example 7, paragraph B, except that 2 mM EDTA was utilized for specific elution. The SELEX strategy is outlined in Table 11. [0183]

C) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications and in Example 7, paragraph C, a nitrocellulose filter partitioning method was used to determine the affinity of ssDNA ligands for LS-Rg and for other proteins. For these experiments a Gibco BRL 96 well manifold was substituted for the 12 well Millipore manifold used in Example 7 and radioactivity was determined with a Fujix BAS100 phosphorimager. Binding data were analyzed as described in Example 7, paragraph C. [0184]

D) Cloning and Sequencing

Thirteenth, fifteenth and seventeenth round PCR products were re-amplified with primers which contain either a BamHI or a HinDIII restriction endonuclease recognition site. Approximately 140 ligands were cloned and sequenced using the procedures described in Example 7, paragraph D. The resulting sequences are shown in Table 12. [0185]

E) Cell Binding Studies

The ability of evolved ligand pools to bind to L-selectin presented in the context of a cell surface was tested in experiments with isolated human peripheral blood mononuclear cells (PBMCs) as described in Example 7, paragraph E [0186]

Flow Cytometry

Binding of oligonucleotides to leukocytes was tested in flow cytometry applications. Briefly, peripheral blood mononuclear cells (PBMC) were purified on histoplaque by standard techniques. Cells (500 cells/mL) were incubated with fluorescein labeled oligonucleotide in 0.25 ML SMHCK buffer (140 mM NaCl, 1 mM MgCl[0187] ₂, 1 mM CaCl₂, 5 mM, KCl, 20 mM HEPES pH 7.4, 8.9 mM NaOH, 0.1% (w/v) BSA, 0.1% (w/v) sodium azide) at room temperature for 15 minutes. Fluorescent staining of cells was quantified on a FACSCaliber fluorescent activated cell sorter (Becton Dickinson, San Jose, Calif.).
To examine the ability of oligonucleotides to bind leukocytes in whole blood, 25 μl aliquots of heparinised whole blood were stained for 30 min at 22° C. with 2 μg Cy5PE labeled anti-CD45 (generous gift of Ken Davis, Becton-Dickinson) and 0.15 μM FITC-LD201T1 (synthesized with a 5′-Fluorescein phosphoramidite by Operon Technologies, Alameda, Calif.; SEQ ID NO: 185). To determine specificity, other samples were stained with FITC-LD201T1 in the presence of 0.3 μM DREG-56 or 7 μM unlabeled LD201T1; or cells were reassayed after addition of 4 mM EDTA. The final concentration of whole blood was at least 70% (v/v). Stained, concentrated whole blood was diluted {fraction (1/15)} in 140 mM NaCl, 5 mM KCl, 1 mM MgCl[0188] ₂, 1 mM CaCl₂, 20 mM HEPES pH 7.4, 0.1% bovine serum albumin and 0.1% NaN₃immediately prior to flow cytometry on a Becton-Dickinson FACS Calibur. Lymphocytes and granulocytes were gated using side scatter and CD45CyPE staining.

F) Synthesis and Characterization of Multimeric Oligonucleotide Ligands

Synthesis of Branched Dimeric Oligonucleotide Complexes

Dimeric oligonucleotides were synthesized by standard solid state processes, with initiation from a 3′-3′ Symmetric Linking CPG (Operon, Alameda, Calif.). Branched complexes contain two copies of a truncated L-selectin DNA ligand, each of which is linked by the 3′ end to the above CPG via a five unit ethylene glycol spacer (FIG. 8A). Each ligand is labeled with a fluorescein phosphoramidite at the 5′ end (Glen Research, Sterling, Va.). Branched dimers were made for 3 truncates of LD201T1 (SEQ ID NO: 142). The truncated ligands used were LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 187) and LD201T1 (SEQ ID NO: 185). Branched dimers were purified by gel electrophoresis. [0189]

Synthesis of Multivalent Biotintylated-DNA Ligand/Streptavidin Complexes

Multivalent oligonucleotide complexes were produced by reacting biotintylated DNA ligands with either fluorescein or phycoerythrin labeled streptavidin (SA-FITC, SA-PE, respectively) (FIG. 8B). Streptavidin (SA) is a tetrameric protein, each subunit of which has a biotin binding site. 5′ and 3′ biotintylated DNAs were synthesized by Operon Technologies, Inc (Alameda, Calif.) using BioTEG and BioTEG CPG (Glen Research, Sterling, Va.), respectively. The expected stoichiometry is 2 to 4 DNA molecules per complex. SA/bio-DNA complexes were made for 3 truncates of LD201(SEQ ID NO: 142). The truncated ligands were LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 188) and LD201T1 (SEQ ID NO: 185). The bio-DNA/SA multivalent complexes were generated by incubating biotin modified oligonucleotide (1 mM) and fluoroscein labeled streptavidin (0.17 mM) in 150 mM NaCl, 20 mM HEPES pH 7.4 at room temperature for at least 2 hours. Oligonucleotide-streptavidin complexes were used directly from the reaction mixture without additional purification of the Complex from free streptavidin or oligonucleotide. [0190]

Synthesis of a Dumbell Dimer Multivalent Complex

A “dumbell” DNA dimer complex was formulated from a homobifunctional N-hydroxysuccinimidyl (or NHS) active ester of polyethelene glycol, PEG 3400 MW, and a 29mer DNA oligonucleotide, NX303 (SEQ ID NO: 196), having a 5′ terminal Amino Modifier C6 dT (Glen Research) and a 3′-3′ terminal phosphodiester linkage (FIG. 8C). NX303 is a truncate of LD201 (SEQ ID NO: 142). The conjugation reaction was in DMSO with 1% TEA with excess equivalents of the DNA ligand to PEG. The PEG conjugates were purified from the free oligonucleotide by reverse phase chromatography. The dimer was then purified from the monomer by anion exchange HPLC. The oligonucleotide was labeled at the 5′ terminus with fluorescein as previously described. [0191]

Synthesis of a Fork Dimer Multivalent Complex

To synthesize the fork dimer multivalent complex (FIG. 8D), a glycerol was attached by its 2-position to one terminus of a linear PEG molecule ([0192] MW 20 kD) to give the bis alcohol. This was further modified to the bis succinate ester, which was activated to the bis N-hydroxysuccinimidyl active ester. The active ester was conjugated to the primary amine at the 5′ terminus of the truncated DNA nucleic acid ligand NX303 (SEQ ID NO: 196). The conjugation reaction was in DMSO with 1% TEA with excess equivalents of the DNA ligand to PEG. The PEG conjugates were purified away from the free oligonucleotide by reverse phase chromatography. The dimer was then purified away from the monomer by anion exchange HPLC. The oligonucleotide was labeled at the 5′ terminus with fluorescein as previously described.

Characterization of Multimeric Oligonucleotide Ligands

The binding of dimeric and multimeric oligonucleotide complexes to human peripheral blood mononuclear cells was analyzed by flow cytometry as described in Example 13, paragraph D. [0193]

G) Photo-Crosslinking

A photo-crosslinking version of DNA ligand LD201T4 (SEQ ID NO: 187) was synthesized by replacing nucleotide T15 (FIG. 12) with 5-bromo-deoxyuracil. 4 nmol of [0194] ³²P-labeled DNA was incubated with 4 nmol L-selectin-Rg in 4 ml 1×SHMCK+0.01% human serni albumin (w/v), then irradiated at ambient temperature with 12,500 pulses from an excimer laser at a distance of 50 cm and at 175 mJ/pulse. Protein and DNA were precipitated with 400 μl 3 M sodium acetate and 8.4 ml ethanol followed by incubation at −70 degrees C. Precipitated material was centrifuged, vacuum dried and resuspended in 100 μl 0.1 M Tris pH 8.0, 10 mM CaCl₂. Fourty-five fig chymotrypsin were added and after 20 min at 37 degrees C, the material was loaded onto an 8% polyacrylamide/7 M ureal 1×TBE gel and electrophoresed until the xylene cyanole had migrated 15 cm. The gel was soaked for 5 min in 1×TBE and then blotted for 30 min at 200 mAmp in 1×TBE onto Immobilon-P (Millipore). The membrane was washed for 2 min in water, air dried, and an autoradiograph taken. A labeled band running slower than the free DNA band, representing a chymotryptic peptide crosslinked to LD201T4, was observed and the autoradiograph was used as a template to excise this band from the membrane. The peptide was sequenced by Edman degradation, and the resulting sequence was LEKTLP_SRSYY. The blank residue corresponds to the crosslinked amino acid, F82 of the lectin domain.

H) Lymphocyte Trafficking Experiments

Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with [0195] ⁵¹Cr (Amersham). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma). Female SCID mice (6-12 weeks of age) were injected intravenously with 2×10⁶cells. The cells were either untreated or mixed with either 13 pmol of antibody (DREG-56 or MEL-14), or 4, 1, or 0.4 nmol of modified oligonucleotide (synthesis described below). One hour later the animals were anesthetized, a blood sample taken and the mice were euthanised. PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by a Packard gamma counter. In a second protocol, 2×10⁶human PBMC, purified, labeled, and washed as described above, were injected intravenously into female SCID mice without antibody or oligonucleotide pretreatment. One to 5 min prior to injecting the cells, the animals were injected with either 15 pmol DREG-56 or 4 nmol modified oligonucleotide. Counts incorporated into organs were quantified as described above.
Synthesis of modified nucleotides NX288 (SEQ ID NO: 193) and NX303 (SEQ ID NO: 196) was initiated by coupling to a dT-5′-CE polystyrene support (Glen Research), resulting in a 3′-3′ terminal phosphodiester linkage, and having a 5′ terminal an Amino Modifier C6 dT (Glen Research). Once NX288 and NX303 were synthesized, a 20,000 MW PEG2-NHS ester (Shearwater Polymers, Huntsville, Ala.) was then coupled to the oligonucleotide through the 5′ amine moiety. The molar ratio, PEG:oligo, in the reactions was from 3:1 to 10:1. The reactions were performed in 80:20 (v:v) 100 mM borate buffer pH 8: DMF at 37° C. for one hour. [0196]

I) Inhibition of L-selectin Binding to Sialyl Lewis^X

SLe[0197] ^X-BSA (Oxford GlycoSystems, Oxford, UK) in 1×PBS, without CaCl₂and MgCl₂,′ (GIBCO/BRL) was immobilized at 100 ng/well onto a microtiter plate by overnight incubation at 22° C. The wells were blocked for 1 h with the assay buffer consisting of 20 mM HEPES, 111 mM NaCl, 1 mM CaCl₂, 1 mM MgCl₂, 5 mM KCl, 8.9 mM NaOH, final pH 8, and 1% globulin-free BSA (Sigma). The reaction mixtures, incubated for 90 min with orbital shaking, contained 5 nM L-Selectin-Rg, a 1:100 dilution of anti-human IgG-peroxidase conjugate (Sigma), and 0-50 nM of competitor in assay buffer. After incubation, the plate was washed with BSA-free assay buffer to remove unbound chimera-antibody complex and incubated for 25 min with O-phenylenediamine dihydrochloride peroxidase substrate (Sigma) by shaking in the dark at 22° C. Absorbance was read at 450 nm on a Bio-Kinetics Reader, Model EL312e (Bio-Tek Instruments, Laguna Hills, Calif.). Values shown represent the mean±s.e from duplicate, or triplicate, samples from one representative experiment.

Example 14

ssDNA Ligands to L-Selectin

A. SELEX

The starting ssDNA pool for SELEX, randomized 40BH (SEQ ID NO: 126), contained approximately 10[0198] ¹⁵molecules (1 nmol ssDNA). The dissociation constant of randomized ssDNA to LS-Rg is estimated to be approximately 10 μM. The SELEX protocol is outlined in Table 11;
The initial round of SELEX was performed at 4° C. with an LS-Rg density of 16.7 pmol/μl of protein A sepharose beads. Subsequent rounds were at room temperature except as noted in Table 11. The 2 mM EDTA elution was omitted from rounds 1-3. The signal to noise ratio of the 50 mM EDTA elution in these three rounds was 50, 12 and 25, respectively (Table 11). These DNAs were amplified for the input materials of rounds 2-4. Beginning with [0199] round 4, a 2 mM EDTA elution was added to the protocol. In this and all subsequent rounds, the 2 mM EDTA eluted DNA was amplified for the next round's input material.
To increase the stringency of selection, the density of immobilized LS-Rg was reduced ten fold in [0200] round 4 with further reductions in protein as needed to increase the stringency of selectin (Table 11). Under these conditions a rapid increase in the affinity of the selected pools was observed (Tables 11); at 4° C., the dissociation constant of round 7 ssDNA was 60 nM.
Binding experiments with 7th round DNA revealed that the affinity of the evolving pool for L-selectin was weakly temperature sensitive (Kds: 60 nM, 94 nM and 230 nM at 4° C., room temperature and 37° C., respectively). To enhance the selection of ligands that bind at physiological temperature, rounds 8, 13, 16 and 17 were performed at 37° C. Although temperature sensitive, the affinity of [0201] round 15 ssDNA was optimal at room temperature (160 pM), with 3-fold higher Kds at 4° C. and 37° C.
Bulk sequencing of DNA pools indicates some non-randomness at [0202] round 5 and dramatic non-randomness at round 13. Ligands were cloned and sequenced from rounds 13, 15, and 17. Sequences were aligned manually and with the aid of a NeXstar computer program that determines consensus sequences from frequently occurring local alignments.

B. Sequences

In Table 12, ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Only the evolved random region is shown in Table 12. Any portion of the fixed region is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into six families and a group of unrelated sequences or orphans (Table 12)(SEQ ID NOs: 129-180). [0203]
[0204] Family 1 is defined by ligands from 33 lineages and has a well defined consensus sequence, TACAAGGYGYTAVACGTA (SEQ ID NO: 181). The conservation of the CAAGG and ACG and their 6 nucleotide spacing is nearly absolute (Table 12). The consensus sequence is flanked by variable but complementary sequences that are 3 to 5 nucleotides in length. The statistical dominance of family 1 suggests that the properties of the bulk population are a reflection of those of family 1 ligands. Note that ssDNA family I and 2′-NH₂family I share a common sequence, CAAGGCG and CAAGGYG, respectively.
[0205] Family 2 is represented by a single sequence and is related to family 1. The ligand contains the absolutely conserved CAAGG and highly conserved ACG of family 1 although the spacing between the two elements is strikingly different (23 compared to 6 nucleotides).
Families 4-6 are each defined by a small number of ligands which limits confidence in their consensus sequence, while [0206] family 7 is defined by a single sequence which precludes determination of a consensus. Family 5 appears to contain two conserved sequences, AGGGT and RCACGAYACA, the positions of which are circularly permuted.

C. Affinities

The dissociation constants of representative ligands from Table 12 are shown in Table 13. These calculations assume two ssDNA ligand binding sites per chimera. The affinity of random ssDNA cannot be reliably determined but is estimated to be approximately 10 μM. [0207]
At room temperature, the dissociation constants range from 43 pM to 1.8 nM which is at least a 5×10[0208] ³to 2×10⁵fold improvement over randomized ssDNA (Table 13). At 37° C., the Kds range from 130 pM to 23 nM. The extent of temperature sensitivity varies from insensitive (ligands LD122 and LD127 (SEQ ID NO: 159 and 162)) to 80-fold (ligand LD112 (SEQ ID NO: 135)). In general, among family 1 ligands the affinity of those from round 15 is greater than that of those from round 13. For the best ligands (LD208, LD227, LD230 and LD233 (SEQ ID NOS: 133, 134, 132, and 146)), the difference in affinity at room temperature and 37° C. is about 4-fold.
The observed affinities of the evolved ssDNA ligand pools reaffirm our proposition that it is possible to isolate oligonucleotide ligands with affinities that are several orders of magnitude greater than that of carbohydrate ligands. [0209]

Example 15

Specificity of ssDNA Ligands to L-Selectin

The affinity of representative cloned ligands for LS-Rg, ES-Rg, PS-Rg, CD22β-Rg and WGA was determined by nitrocellulose partitioning and the results shown in Table 14. The ligands are highly specific for L-selectin. The affinity for ES-Rg is about 10[0210] ³-fold lower and that for PS-Rg is about 5×10³-fold less than for LS-Rg. Binding above background is not observed for CD22β-Rg or for WGA at 0.7 and 1.4 μM protein, respectively, indicating that ligands neither bind the Fc domain of the chimeric constructs nor have affinity for unrelated sialic acid binding sites.
The specificity of oligonucleotide ligand binding contrasts sharply with the binding of cognate carbohydrates by the selectins and reconfirms the proposition that SELEX ligands will have greater specificity than carbohydrate ligands. [0211]

Example 16

Cell Binding Studies

Round 15 ssDNA pool was tested for its ability to bind to L-selectin presented in the context of a peripheral blood mononuclear cell surface as described in Example 13, paragraph E. The evolved pool was tested both for affinity and for specificity by competition with an anti-L-selectin monoclonal antibody. FIG. 9 shows that the [0212] round 15 ssDNA pool binds isolated PBMCs with a dissociation constant of approximately 1.6 nM and, as is expected for specific binding, in a saturable fashion. FIG. 10 directly demonstrates specificity of binding; in this experiment, binding of 2 nM ³²P-labeled round 15 ssDNA is completely competed by the anti-L-selectin blocking monoclonal antibody, DREG-56, but is unaffected by an isotype-matched irrelevant antibody. In analogous experiments, LD201T1 (SEQ ID NO: 185) was shown to bind human PBMC with high affinity. Binding was saturable, divalent cation dependent, and blocked by DREG-56.
These data validate the feasibility of using immobilized, purified protein to isolate ligands against a cell surface protein and demonstrate the specific binding of the [0213] round 15 ssDNA pool and of ligand LD201T1 to L-selectin in the context of a cell surface.
The binding of LD201T1 to leukocytes in whole blood was examined by flow cytometry. Fluorescein isothiocyanate (FITC)-conjugated LD201T1 specifically bind human lymphocytes and neutrophils (FIGS. [0214] 11A/B); binding is inhibited by competition with DREG-56, unlabeled LD201, and by the addition of 4 mM EDTA (FIGS. 11A/B). These cell binding studies demonstrate that LD201T1 bind saturably and specifically to human L-selectin on lymphocytes and neutrophils.

Example 17

Secondary Structure of High Affinity ssDNA Ligands to L-Selectin

In favorable instances, comparative analysis of aligned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved. [0215]
Comparative analysis of 24 sequences from [0216] family 1 strongly supports a hairpin secondary structure for these ligands (FIG. 12). In the figure, consensus nucleotides are specified, with invariant nucleotides in bold type. To the right of the stem is a matrix showing the number of occurrences of particular base pairs for the positions in the stem that are on the same line. The deduced structure consists of a GYTA tetraloop, a 3 nucleotide-pair upper stem and a 6 to 7 nucleotide-pair lower stem. The upper and lower stems are separated by an asymmetrical, AA internal loop or “bulge.” Two of the three base pairs in the upper stem and 6 of 7 in the lower stem are validated by covariation. The two invariant pairs, positions 7/20 and 10/19 are both standard Watson/Crick basepairs. This structure provides a plausible basis for the direct involvement of invariant nucleotides (especially, A8, A9 and T15) in binding the target protein.
The site of oligonucleotide binding on L-selectin can be deduced from a set of competition experiments. DREG56 is an anti-L-selectin, adhesion blocking monoclonal antibody that is known to bind to the lectin domain. Binding of three unrelated ligands, LD201T1 (SEQ ID NO: 185), LD174T1 (SEQ ID NO: 194) and LD196T1 (SEQ ID NO: 195), to LS-Rg was blocked by DREG-56, but not by an isotype-matched control. In cross-competition experiments, LD201T1, LD174T1, or LD196T1 prevented radio-labeled LD201T1 from binding to LS-Rg, consistent with the premise that the ligands bind the same or overlapping sites. The blocking and competition experiments, taken together with divalent cation-dependence of binding, suggest that all three ligands bind to the lectin domain. This conclusion has been verified for LD201 by photo-crosslinking experiments. [0217]
If T15 of LD201T4 (SEQ ID NO: 187; FIG. 12) is replaced with 5-bromo-uracil, the resulting DNA photo-crosslinks at high yield (17%) to LS-Rg following irradiation with an excimer laser as described in Example 13, paragraph G. The high yield of crosslinking indicates a point contact between the protein and T15. Sequencing of the chymotryptic peptide corresponding to this point contact revealed a peptide deriving from the lectin domain; F82 is the crosslinking amino acid. Thus, F82 contacts T15 in a stacking arrangement that permits high yield photo-crosslinking. By analogy to the structure of the highly related E-selectin (Graves et al, Nature 367, 532-538, 1994), F82 is adjacent to the proposed carbohydrate binding site. Thus, this photo-crosslink provides direct evidence that ligand LD201 makes contact with the lectin domain of LS-Rg and provides an explanation for the function of the oligonucleotides in either sterically hindering access to the carbohydrate binding site or in altering the conformation of the lectin domain upon DNA binding. [0218]

Example 18

L-Selectin ssDNA Ligand Truncate Data

Initial experiments to define the minimal high affinity sequence of [0219] family 1 ligands show that more than the 26 nucleotide hairpin (FIG. 12; Table 13) is required. Ligands corresponding to the hairpin, LD201T4 (SEQ ID NO: 187) and LD227T1 (SEQ ID NO: 192) derived from LD201 (SEQ ID NO: 173) and LD227 (SEQ ID NO: 134), respectively, bind with 20-fold and 100-fold lower affinity than their full length progenitors. The affinity of LD201T3 (SEQ ID NO: 186), a 41 nucleotide truncate of ligand LD201, is reduced about 15-fold compared to the full length ligand, while the affinity of the 49-mer LD201T1 (SEQ ID NO: 185) is not significantly altered (Tables 12 and 13).
Additional experiments show that truncates LD201T10 (SEQ ID NO: 188) and LD227X1 (SEQ ID NO: 191) bind with affinities similar to their full length counterparts. Both of these ligands have stems that are extended at the base of the consensus stem. Alterations in the sequence of the added stem have little, if any, effect on binding, suggesting that it is not directly involved in binding [0220]
The added stem is separated from the consensus stem by a single stranded bulge. The two ligands' single stranded bulges differ in length and have unrelated sequences. Furthermore, LD201's bulge is at the 5′-end of the original stem base while that of LD227 is at the 3′-end. Thus, the two ligands do not present an obvious consensus structure. Removal of the loop (LD201) or scrambling or truncating the sequence (LD227) diminishes affinity, suggesting that the bulged sequences may be directly involved in binding. Note that although LD201T3 is longer than LD201T10, it is unable to form the single stranded loop and extended stem because of the position of the truncated ends. [0221]

Example 19

Inhibition of Binding to Sialyl Lewis^X

Sialyl Lewis[0222] ^xis the minimal carbohydrate ligand bound by selecting. The ability of ssDNA ligands to inhibit the binding of L-selectin to Sialyl Lewis^Xwas determined in competition ELISA assays as described in Example 13, paragraph I. LD201T1 (SEQ ID NO: 185), LD174T1 (SEQ ID NO: 194) and LD196T1 (SEQ ID NO: 195) inhibited LS-Rg binding to immobilized SLe^Xin a dose dependent manner with IC₅₀s of approximately 3 nM. This is a 10⁵-10⁶-fold improvement over the published IC₅₀values for SLe^Xin similar plate-binding assays. A scrambled sequence based on LD201T1 showed no activity in this assay. These data verify that DNA ligands compete with sialyl-Lewis^Xfor LS-Rg binding and support the contention that low concentrations of EDTA specifically elute ligands that bind the lectin domain's carbohydrate binding site.

Example 20

Inhibition of Lymphocyte Trafficking by L-Selectin ssDNA Ligands

Lymphocyte trafficking to peripheral lymph nodes is exquisitely dependent on L-selectin. Since the ssDNA ligands binds to human but not rodent L-selectin, a xenogeneic lymphocyte trafficking system was established to evaluate in vivo efficacy. Human PBMC, labeled with [0223] ⁵¹Cr, were injected intravenously into SCID mice. Cell trafficking was determined 1 hour later. In this system, human cells traffic to peripheral and mesenteric lymph nodes (PLN and MLN). This accumulation is inhibited by DREG-56 (FIG. 13) but not MEL-14, a monoclonal antibody that blocks murine L-selectin-dependent trafficking. In initial experiments cells were incubated with either DREG-56 or 3′ capped and PEG-modified oligonucleotide before injection. NX288 (SEQ ID NO: 193) inhibited trafficking of cells to PLN (FIG. 13) and MLN in a dose-dependent fashion but had no effect on the accumulation of cells in other organs. At the highest dose tested (4 nmol), inhibition by the DNA ligand was comparable to that of DREG-56 (13 pmol), while a scrambled sequence had no significant effect (FIG. 13). The activity of LD174T1 (SEQ ID NO: 194) was similar to that of NX288.
To determine if the modified oligonucleotide was effective when it was not pre-incubated with cells, DREG-56 (13 pmol/mouse) or the modified oligonucleotide (4 nmol/mouse) was injected intravenously into animals and 1-5 min later the radio-labeled human cells were given intravenously. Again, both NX288 (SEQ ID NO: 193) and DREG-56 inhibited trafficking to PLN and MLN while the scrambled sequence had no effect (FIG. 14). Therefore, the modified oligonucleotide did not require pre-incubation with the cells to effectively block trafficking. These experiments demonstrate, in vivo, the efficacy of oligonucleotide ligands in inhibiting a L-selectin dependent process. [0224]

Example 21

L-Selectin Nucleic Acid Ligand Multimers

Multivalent Complexes were made in which two nucleic acid ligands to L-selectin were conjugated together. Multivalent Complexes of nucleic acid ligands are described in copending U.S. patent application Ser. No. 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes” which is herein incorporated by reference in its entirety. These multivalent Complexes were intended to increase the binding energy to facilitate better binding affinities through slower off-rates of the nucleic acid ligands. These multivalent Complexes may be useful at lower doses than their monomeric counterparts. In addition, high molecular weight (20 kD) polyethylene gylcol (PEG) was included in some of the Complexes to decrease the in vivo clearance rate of the complexes. Specifically, the nucleic acid ligands incorporated into the Complexes were LD201T1 (SEQ ID NO: 185), LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 188) and NX303 (SEQ ID NO: 196). Multivalent selectin nucleic acid ligand Complexes were produced as described in Example 13, paragraph F. [0225]
A variety of monomeric nucleic acid ligands and multivalent Complexes have been examined in flow cytometry. The multivalent Complexes exhibited similar specificity to the monomeric forms, but enhanced affinity as well as improved (i.e., slower) off-rate for human lymphocytes. Titration curves, obtained from incubating fluorescently labeled monomeric FITC-LD201T1 with peripheral blood mononuclear cells (PBMC) purified human lymphocytes, indicated that binding to cells is saturable. Half-saturation fluorescence occurred at 3 nM oligonucleotide. In contrast, the branched dimeric FITC-LD201T1 and bio-LD201T1/SA multivalent Complexes exhibited half-saturation at approximately 0.15 nM, corresponding to an apparent 20-fold increase in affinity. In similar experiments, half saturation of the dumbell and fork dimers of LD201T4 was observed at 0.1 and 0.6 nM, respectively, compared to 20 nM for monomeric LD201T4. [0226]
Kinetic competition experiments were performed on monomeric nucleic acid ligands and multivalent Complexes. Kinetic competition experiments were performed with PBMC purified lymphocytes. Cells were stained as described above but used 10 nM oligonucleotide. The off-rate for monomeric, dimeric and multivalent Complexes was determined by addition of 500 nM unlabeled oligonucleotide to cells stained with fluorescently labeled ligand and measurement of the change in the mean fluorescence intensity as a function of time. The dissociation rate of a monomeric LD201T1 from L-selectin expressing human lymphocytes was approximately 0.005 sec-1, corresponding to a half-life of roughly 2.4 minutes. The LD201T1 branched dimer and biotin conjugate multivalent Complexes exhibited apparent off-rates several times slower than that observed for the monomeric ligand and as slow or slower than that observed for the anti-L-selectin blocking antibody DREG56, determined under the same conditions. A multivalent Complex containing a non-binding nucleic acid sequence did not stain cells under identical conditions and did not compete in the off-rate experiments. The off-rate of the LD201T4 dumbell and fork dimers is faster than the LD201T1 branched dimer and is better than all monomers tested. These results confirm the proposition that dimeric and multimeric ligands bind with higher affinities than do monomeric ligands and that the increased affinity results from slower off-rates. [0227]

Example 22

2′-F RNA Ligands to Human L-Selectin

The experimental procedures outlined in this Example were used to identify and characterize 2′-F RNA ligands to human L-selectin as described in Examples 23-25. [0228]

Experimental Procedures

A) Materials

Unless otherwise indicated, all materials used in the 2′-F RNA SELEX against the L-selectin/IgG2 chimera, LS-Rg, were identical to those of Examples 7, paragraph A and 13, paragraph A. SHMCK-140 buffer, used for all SELEX and binding experiments, was 1 mM CaCl[0229] ₂, 1 mM MgCl₂, 140 mM NaCl, 5 mM KCl, and 20 mM HEPES, pH 7.4. A soluble form of L-selectin, corresponding to the extracellular domains, was purchased from R&D Systems and used for some nitrocellulose filter binding experiments.

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. Procedures are essentially identical to those in Examples 7 and 13 except as noted. The variable regions of synthetic DNA templates were randomized at either 30 or 40 positions and were flanked by [0230] N7 5′ and 3′ fixed regions producing transcripts 30N7 (SEQ ID NO: 292) and 40N7 (SEQ ID NO: 389). The primers for the PCR were the following:
[0231] N7 5′ Primer 5′ taatacgactcactatagggaggacgatgcgg 3′ (SEQ ID NO: 65)
[0232] N7 3′ Primer 5′ tcgggcgagtcgtcctg 3 ′ (SEQ ID NO: 66)
The initial RNA pool was made by first Klenow extending 3 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 6 nmols primer 5N7, 3 nmols 30N7 or 40n7, 1× Klenow Buffer, 1.8 mM each of DATP, dCTP, dGTP and dTTP in a reaction volume of 0.5 ml. [0233]
For subsequent rounds, eluted RNA was the template for AMV reverse transcriptase mediated synthesis of single-stranded cDNA. These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl[0234] ₂, 0.2 mM of each dATP, DCTP, dGTP, and dTTP, and 100 U/ml of Taq DNA polymerase. Transcription reactions contained one third of the purified PCR reaction, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mM MgCl₂, 5 mM DTT, 2 mM spermidine, 1 mM each of 2′-OH ATP, 2′-OH GTP, 3 mM each of 2′-F CTP, 2′-F UTP, and 250 nM α-³² P 2′-OH ATP. Note that in all transcription reactions 2′-F CTP and 2′-F UTP replaced CTP and UTP.
The strategy for partitioning LS-Rg/RNA complexes from unbound RNA is outlined in Table 15 and is essentially identical to that of Example 7, paragraph B. In the initial SELEX rounds, which were performed at 37° C., the density of immobilized LS-Rg was 10 pmols/μl of [0235] Protein A Sepharose 4 Fast Flow beads. LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions (Pharmacia Biotech). In later rounds, the density of LS-Rg was reduced (Table 15), as needed, to increase the stringency of selection. At the seventh round, both SELEXes were branched. One branch was continued as previously described (Example 7, paragraph B). In the second branch of both SELEXes, the RNA pool was pre-annealed to oligonucleotides that are complementary to the 5′ and 3′ fixed sequences. These rounds are termed “counter-selected” rounds. Before each round, RNA was batch adsorbed to 100 μl of protein A sepharose beads for 15 minutes in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized LS-Rg was batch incubated with pre-adsorbed RNA for 1 to 2 hours in a 2 ml column with constant rocking. Unbound RNA was removed by extensive batch washing (500 μl SHMCK 140/wash). In addition, the counter selected rounds were extensively washed with buffer containing 200 nM of both complementary oligos. Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 100 μL 5 mM EDTA in SHMCK 140 without divalent cations; second, the remaining elutable RNA was removed by incubating and/or washing with 500 μL 50 mM EDTA in SHMCK 140 without divalents. The percentage of input RNA that was eluted is recorded in Table 22. In every round, an equal volume of protein A sepharose beads without LS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round of SELEX.
The 5 mM EDTA eluates were processed for use in the following round (Table 15). After precipitating with isopropanol/ethanol (1:1, v/v), the RNA was reverse transcribed into cDNA by AMV reverse transcriptase either at 48° C. for 15 minutes and then 65° C. for 15 minutes in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc)[0236] ₂, 10 mM DTT, 200 pmol DNA primer, 0.5 mM each of dNTPs, and 0.4 unit/μL AMV RT. Transcripts of the PCR product were used to initiate the next round of SELEX.

C) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for LS-Rg and for other proteins. Filter discs (nitrocellulose/cellulose acetate mixed matrix, 0.45 μm pore size, Millipore) were placed on a vacuum manifold and washed with 3 ml of [0237] SHMCK 140 buffer under vacuum. Reaction mixtures, containing ³²P labeled RNA pools and unlabeled LS-Rg, were incubated in SHMCK 140 for 10-20 min at 37° C., and then immediately washed with 3 ml SHMCK 140. The filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor. Alternatively, binding studies employed 96 well micro-titer manifolds essentially as described in Example 13, paragraph E.

D) Cloning and Sequencing

12th round PCR products were re-amplified with primers which contain either a BamHI or a HinDIII restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinant plasmids were transformed into [0238] E. coli strain DH5a (Life Technologies, Gaithersburg, Md.). Plasmid DNA was prepared according to the alkaline lysis method (Quiagen, QIAwell, Chattsworth Calif.). Approximately 300 clones were sequenced using the ABI Prism protocol (Perkin Elmer, Foster City, Calif.). Sequences are shown in Table 16.

E) Cell Binding Studies

Binding of evolved ligands to L-selectin presented in the context of a cell surface was tested by flow cytometry experiments with human lymphocytes. Briefly, peripheral blood mononuclear cells (PBMC) were purified on histoplaque by standard techniques. To evaluate leukocyte binding by unlabeled 2′-F ligands, cells (500 cells/mL) were incubated with fluorescein labeled FITC-LD201T1 (SEQ ID NO: 185) in the presence of increasing concentrations of individual, unlabeled 2′-F ligands in 0.25 mL SMHCK buffer (140 mM NaCl, 1 mM MgCl[0239] ₂, 1 mM CaCl₂, 5 mM, KCl, 20 mM HEPES pH 7.4, 8.9 mM NaOH, 0.1% (w/v) BSA, 0.1% (w/v) sodium azide) at room temperature for 15 minutes. Fluorescent staining of cells was quantified on a FACSCaliber fluorescent activated cell sorter (Becton Dickinson, San Jose, Calif.). The affinity of the 2′-F competitor was calculated from the flurorescence inhibition curves.

Example 23

2′-F RNA Ligands to L-Selectin

A. SELEX

The starting RNA pools for SELEX, randomized 30N7 (SEQ ID NO: 292) or 40N7 (SEQ ID NO: 389) contained approximately 10[0240] ¹⁴molecules (0.7 nmol RNA). The SELEX protocol is outlined in Table 15 and Example 22. All rounds were selected at 37° C. The dissociation constant of randomized RNA to LS-Rg is estimated to be approximately 10 μM. After six rounds the pool affinities had improved to approximately 300 nM. An aliquot of the RNA recovered from the seventh round was used as the starting material for the first counter-selected rounds. Five rounds of counter-selection and five additional standard rounds were performed in parallel. Thus, a total of twelve rounds were performed in both branches of both SELEXes: 30N7, counter-selected 30N7, 40N7 and counter-selected 40N7. The affinities of each of the 12th round pools ranged from 60 to 400 pM. Ligands were cloned from these pools.

B. Sequences of 2′-F RNA Ligands to L-Selectin

In Table 16, ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Fixed region sequence is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. [0241]
The 30N7 and 40N7 SELEX final pools shared a common major sequence family, even though identical sequences from the two SELEXes are rare (Table 16). Most ligands (72 of the 92 unique sequences) from the 30N7 and 40N7 SELEXes contain one of two related sequence motifs, RYGYGUUUUCRAGY or RYGYGUUWWUCRAGY. These motifs define [0242] family 1. Within the family there are three subfamilies. Subfamily la ligands (53/66) contain an additional sequence motif, CUYARRY, one nucleotide 5′ to the family 1 consensus motifs. Subfamily 1b (9/66 unique sequences) lacks the CUYARRY motif. Subfamily 1c (5/66) is also missing the CUYARRY motif, has an A inserted between the Y and G of consensus YGUU and lacks the consensus GA base pair. The significance of the sequence subfamilies is reflected in the postulated secondary structure of the ligands (Example 25).
A second family, composed of 5 sequences, has a relatively well defined consensus: UACUAN[0243] _0-1UGURCG . . . UYCACUAAGN_1-2CCC (Table 16). Family 3 has a short, unreliable consensus motif (Table 16). In addition, there are approximately 12 orphans or apparently unrelated sequences. Three of the orphan sequences were recovered at least twice (Table 16).

C. Affinities

The dissociation constants of representative ligands from Table 16 are shown in Table 17. These calculations assume two ligand binding sites per chimera. The affinity of random 2′-F RNA cannot be reliably determined but is estimated to be approximately 10 μM. [0244]
The dissociation constants range from 34 pM to 315 nM at 37° C. Binding affinity is not expected to be temperature sensitive since selection was at 37° C. and 2′-F RNA forms thermal stable structures, but binding has not been tested at lower temperatures. For the most part, the extreme differences in affinity may be related to predicted secondary structure (Example 25). [0245]
The observed affinities of the evolved 2′-F RNA ligands reaffirm our proposition that it is possible to isolate oligonucleotide ligands with affinities that are several orders of magnitude greater than that of carbohydrate ligands. [0246]

Example 24

Cell Binding Studies

The ability of [0247] full length 2′-F ligands to bind to L-selectin presented in the context of a cell surface was tested by competition-flow cytometry experiments with human peripheral blood lymphocytes. Lymphocytes were stained with 10 nM FITC-conjugated DNA ligand FITC-LD201T1 (SEQ ID NO: 185) in the presence of increasing concentrations of unlabeled 2′-F ligands as described in Example 22, paragraph E. Ligands LF1513 (SEQ ID NO: 321), LF1514 (SEQ ID NO: 297), LF1613 (SEQ ID NO: 331) and LF1618 (SEQ ID NO: 351) inhibited the binding of FITC-LD201T1 in a concentration dependent manner, with complete inhibition observed at competitor concentrations of 10 to 300 nM. These results demonstrate that the 2′-F ligands are capable of binding cell surface L-selectin and suggest that the 2′-F ligands and LD201T1 bind the same or overlapping sites. The affinities of the fluoro ligands, calculated from the competition curves, range from 0.2 to 25 nM. The affinity of two of the ligands for L-selectin on human lymphocytes, LF1613 (Kd=0.2 nM) and LF1514 (Kd=0.8 nM), is significantly better than that of the DNA ligand LD201T1 (Kd=3 nM). The reasonable agreement between the affinities for purified protein and lymphocyte L-selectin suggests that binding to lymphocytes is specific for L-selectin. These data validate the feasibility of using immobilized, purified protein to isolate ligands against a cell surface protein.

Example 25

Secondary Structure of High Affinity 2′-F RNA Ligands to L-Selectin

In favorable instances, comparative analysis of aligned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved. [0248]
The deduced secondary structure of family la ligands from comparative analysis of 21 unique sequences is a hairpin motif (FIG. 15) consisting of a 4 to 7 nucleotide terminal loop, a 6 base upper stem and a lower stem of 4 or more base pairs. The consensus terminal loops are either a UUUU tetraloop or a UUWWU pentaloop. Hexa- and heptaloops are relatively rare. The upper and lower stems are delineated by a 7 nucleotide bulge in the 5′-half of the stem. Four of the six base pairs in the upper stem and all base pairs in the lower stem are supported by Watson-Crick covariation. Of the two invariant base pairs in the upper stem, one is the loop closing GC, while the other is a non-standard GA. The lower stem is most often 4 or 5 base pairs long but can be extended. While the sequence of the upper stem is strongly conserved, that of the lower stem is not, with the possible exception of the YR′ base pair adjacent to the internal bulge. This base pair appears to covary with the 3′ position of the 7 nucleotide bulge in a manner which minimizes the likelihood of extending the upper stem. Both the sequence (CUYARRY) and length (7 nt) of the bulge are highly conserved. [0249]
In terms of comparative analysis, the 7 nucleotide bulge, the upper stem and the 5′ and 3′ positions of the terminal loop are most apt to be directly involved in L-selectin binding. Specifically, the 5′ U and 3′ U of the terminal loop, the invariant GC and GA base pairs of the upper stem and the conserved C, U and A of the bulge are the mostly likely candidates. The lower stem, because of its variability in length and sequence, is less likely to be directly involved. The importance of the bulge for binding is supported by the poor affinity of ligand LF1512 (SEQ ID NO: 357; Kd=315 nM); the simplest structure for this ligand is a UUUU tetraloop and a ten base pair, nearly perfect, consensus stem which is missing only the 7 nucleotide bulge. [0250]
The deduced secondary structure of family 1b is similar to that of family 1a, except that the upper stem is usually 7 base pairs in length and that the single stranded bulge which does not have a highly conserved consensus is only 4 nucleotide long. This structure may be an acceptable variation of the 1a secondary structure with the upper stem's increased length allowing a shorter bulge; the affinity of ligand LF1511 (SEQ ID NO: 332) is 300 pM. [0251]
Although family 1c has a consensus sequence, GUUUUCNR that is related to 1a and 1b, a convincing consensus secondary structure is not evident, perhaps due to insufficient data. The most highly structured member of the family, LF1618 (SEQ ID NO: 351), permits a UUUU tetraloop and “upper” stem of 7 base pairs but has neither a lower stem nor the [0252] consensus 7 nucleotide bulge sequence of 1a. The upper stem differs from those of 1a and 1b in that it has an unpaired A adjacent to the loop closing G and does not have the invariant GA base pair of 1a and 1b. The affinity of LF1618 is a modest 10 nM which suggests that family 1c forms a less successful structure.
Predictions of minimal high affinity sequences for [0253] family 1 ligands can be made and serve as a partial test of the postulated secondary structure. Truncates which include only the upper stem and terminal loop, LF1514T1 (SEQ ID NO: 385) or these two elements plus the 7 nucleotide bulge sequence, LF1514T2 (SEQ ID NO: 386), are not expected to bind with high affinity. On the other hand, there is a reasonable, but not rigorous, expectation that ligands truncated at the base of the lower consensus stem, LF1514T4 (SEQ ID NO: 387) and LF1807T4 (SEQ ID NO: 388), will bind with high affinity. In side by side comparisons, the affinities of LF1514T1 and LF1514T2 for LS-Rg were reduced at least 100-fold in comparison to full length LD1514 (SEQ ID NO: 297), while the affinity of LF1514T4 was reduced less than two fold and that of LF1807T4 approximately three-fold. The correspondence between the predicted and observed truncate affinities supports the postulated secondary structure.
Since the ssDNA ligand LD201T1 (SEQ ID NO: 185) and the adhesion blocking anti-human L-selectin antibody DREG56 are known to bind to the lectin domain of L-selectin, competition between radio-labeled LF1807 (SEQ ID NO: 309) and either unlabeled DREG56 or unlabeled LD201T1 can serve to determine if the 2′-F ligands also bind the lectin domain of purified LS-Rg. In these experiments, both DREG56 and LD201T1 gave concentration dependent inhibition of LF1807 binding. Complete inhibition was attained with 300 nM Mab and 1 μM LD201T1. The competitors' affinities of LS-Rg, calculated from the competition curves, were in good agreement with their known affinities. These results are consistent with the premise that LF1807, NX280 and DREG56 have the same or overlapping binding sites and consequently it is expected that 2′-F ligands will be antagonists of L-selectin mediated adhesion. These results also reaffirm the proposition that the SELEX protocol, with 5 mM elution of bound oligonucleotides, preferentially elutes ligands bound at or near the lectin domain's bound calcium. [0254]

Example 26

ssDNA Ligands to Human P-Selectin

PS-Rg is a chimeric protein in which the lectin, EGF, and the first two CRD domains of human P-selectin are joined to the Fc domain of a human G1 immunoglobulin (R. M. Nelson et al., 1993, supra). Purified chimera is provided by A. Varki. Soluble P-selectin is purchased from R&D Systems. Unless otherwise indicated, all materials used in the ssDNA SELEX against the P-selectin/IgG[0255] ₁chimera, PS-Rg, are identical to those of Examples 7 and 13.
The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163. The specific strategies and procedures for evolving high affinity ssDNA antagonists to P-selectin are described in Examples 7 and 13. [0256]

Example 27

2′-F RNA Ligands to Human P-Selectin

The Experimental procedures outlined in this Example were used to identify 2′-F RNA ligands to human P-selectin as described in Examples 28-34. [0257]

Experimental Procedures

A) Materials

PS-Rg is a chimeric protein in which the extracellular domain of human P-selectin is joined to the Fc domain of a human G2 immunoglobulin (Norgard et al., 1993, PNAS 90:1068-1072). ES-Rg and CD22β-Rg are analogous constructs of E-selectin and CD220 joined to a human G1 immunoglobulin Fc domain (R. M. Nelson et al., 1993, supra; I. Stamenkovic et al., 1991, [0258] Cell 66, 1133-1144) while LS-Rg has L-selectin joined to an IgG2 Fc domain. Purified chimera were provided by A. Varki. Soluble P-selectin was purchased from R&D Systems. Protein A Sepharose 4 Fast Flow beads were purchased from Pharmacia Biotech. Anti-P-selectin monoclonal antibodies: G1 was obtained from Centocor. The 2′-F modified CTP and UTP were prepared according to Pieken et. al. (1991, Science 253:314-317). DNA oligonucleotides were synthesized by Operon. All other reagents and chemicals were purchased from commercial sources. Unless otherwise indicated, experiments utilized HSMC buffer (1 mM CaCl₂, 1 mM MgCl₂, 150 mM NaCl, 20.0 mM HEPES, pH 7.4).

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. The nucleotide sequence of the synthetic DNA template for the PS-Rg SELEX was randomized at 50 positions. This variable region was flanked by [0259] N8 5′ and 3′ fixed regions. The transcript 50N8 has the sequence 5′ gggagacaagaauaaacgcucaa-50N-uucgacaggaggcucacaacaggc 3′ (SEQ ID NO: 390). All C and U have 2′-F substituted for 2′-OH on the ribose. The primers for the PCR were the following:
[0260] N8 5′ Primer 5′ taatacgactcactatagggagacaagaataaacgctcaa 3′ (SEQ ID NO: 197)
[0261] N8 3′ Primer 5′ gcctgttgtgagcctcctgtcgaa 3′ (SEQ ID NO: 198) The fixed regions include primer annealing sites for PCR and cDNA synthesis as well as a consensus T7 promoter to allow in vitro transcription. The initial RNA pool was made by first Klenow extending 1 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 3.5 nmols primer 5N8, 1.4 nmols 40N8, 1× Klenow Buffer, 0.4 mM each of DATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml.
For subsequent rounds, eluted RNA was the template for AMV reverse transcriptase mediated synthesis of single stranded cDNA. These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification. PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl[0262] ₂, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase. Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 40 mM Tris-HCl (pH 8.0), 12 mM MgCl₂, 5 mM DTT, 1 mM spermidine, 4% PEG 8000, 1 mM each of 2′-OH ATP and 2′-OH GTP, 3.3 mM each of 2′-F CTP and 2′-F UTP, and 250 nM α-³² P 2′-OH ATP.
The strategy for partitioning PS-Rg/RNA complexes from unbound RNA is essentially identical to the strategy detailed in Example 7 for ligands to L-selectin (Table 18). [0263]
In the initial SELEX rounds, which were performed at 37° C., the density of immobilized PS-Rg was 20 pmols/μl of [0264] Protein A Sepharose 4 Fast Flow beads. In later rounds, the density of PS-Rg was reduced (Table 18), as needed, to increase the stringency of selection. Beginning with the second round, SELEX was often done at more than one PS-Rg density. At each round, the eluted material from only one PS-Rg density was carried forward.
Before each round, RNA was batch adsorbed to 100 μl of protein A sepharose beads for 1 hour in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized PS-Rg was batch incubated with pre-adsorbed RNA for 0.5 to 1 hours in a 2 ml siliconized column with frequent mixing. Unbound RNA was removed by extensive batch washing (500 μl HSMC/wash). Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second, the remaining elutable RNA was removed by incubating and/or washing with 50 mM EDTA in HSMC without divalents. The percentage of input RNA that was eluted is recorded in Table 18. In every round, an equal volume of protein A sepharose beads without PS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round of SELEX. [0265]
The eluted fractions were processed for use in the following round (Table 18). After precipitating with 300 mM [0266] Sodium Acetate pH 7 in ethanol (2.5 volumes), the RNA was resuspended in 80 μl of H₂O and 40 μl were reverse transcribed into cDNA by AMV reverse transcriptase at 48° C. for 30 minutes, in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc)₂, 10 mM DTT, 200 pmol DNA primer, 0.4 mM each of dNTPs, and 0.4 unit/μl AMV RT. Transcripts of the PCR product were used to initiate the next round of SELEX.

C) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for PS-Rg and for other proteins. Filter discs (nitrocellulose/cellulose acetate mixed matrix, 0.45 μm pore size, Millipore) were placed on a vacuum manifold and washed with 2 ml of HSMC buffer under vacuum. Reaction mixtures, containing [0267] ³²P labeled RNA pools and unlabeled PS-Rg, were incubated in HSMC for 10-20 min at 4° C., room temperature or 37° C., filtered, and then immediately washed with 4 ml HSMC at the same temperature. The filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor.
PS-Rg is a dimeric protein that is the expression product of a recombinant gene constructed by fusing the DNA sequence that encodes the extracellular domains of human P-selectin to the DNA that encodes a human IgG[0268] ₁Fc region. For affinity calculations, one ligand binding site per PS-Rg monomer (two per dimer) were assumed. The monomer concentration is defined as 2 times the PS-Rg dimer concentration. The equilibrium dissociation constant, K_d, for an RNA pool or specific ligand is calculated as described in Example 7, paragraph C.

D) Cloning and Sequencing

Twelfth round PCR products were re-amplified with primers which contain either a BamHI or a HinDIII restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinant plasmids were transformed into [0269] E. coli strain JM109 (Life Technologies, Gaithersburg, Md.). Plasmid DNA was prepared according to the alkaline hydrolysis method (PERFECTprep, 5′-3′, Boulder, Colo.). Approximately 50 clones were sequenced using the Sequenase protocol (Amersham, Arlington Heights, Ill.). The resulting ligand sequences are shown in Table 19.

E) Boundary Experiments

The minimal high affinity sequence of individual ligands was determined by boundary experiments (Tuerk et. al. 1990, J. Mol. Biol. 213: 749). Individual RNA ligands, [0270] ³²P-labeled at the 5′-end for the 3′ boundary and ³²P-labeled at the 3′-end for the 5′ boundary, are hydrolyzed in 50 mM Na2CO3 pH 9 for 8 minutes at 95° C. The resulting partial hydrolysate contains a population of end-labeled molecules whose hydrolyzed ends correspond to each of the purine positions in the full length molecule. The hydrolysate is incubated with PS-Rg (at concentrations 5-fold above, below and at the measured Kd for the ligand). The RNA concentration is significantly lower than the Kd. The reaction is incubated at room temperature for 30 minutes, filtered, and then immediately washed with 5 ml HSMC at the same temperature. The bound RNA is extracted from the filter and then electrophoresed on an 8% denaturing gel adjacent to hydrolyzed RNA which has not been incubated with PS-Rg. Analysis is as described in Tuerk et. al. 1990, J. Mol. Biol. 213: 749.

F) 2′-O-Methyl Substitution Experiments

In order to decrease the susceptibility of the 2′-F pyrimidine RNA ligands to nuclease digestion, post-SELEX modification experiments were performed to identify 2′-OH purines that are replaceable with 2′-OMe purines without loss of affinity as described in Green et. al. (1995, J. Mol. Biol. 247: 60-68). Briefly, seven oligonucleotides were synthesized, each with three mixed positions. A mixed position is defined as a 2′-OH purine nucleotide within the RNA which has been synthesized with 2:1 ratio of 2′-OH:2′-OMe. Since the coupling efficiency of 2′-OH phosphoramidites is lower than that of 2′-OMes, the resulting RNA has 25-50% 2′-OH at each mixed position. [0271] ³²P end-labeled RNA ligands are then incubated with concentrations of PS-Rg 2-fold above and 2.5-fold below the Kd of the unmodified ligand at room temperature for 30 minutes, filtered, and then immediately washed with 5 ml HSMC at the same temperature. The bound RNA (Selected RNA) is extracted from the filter and then hydrolyzed with 50 mM Na₂CO₃pH 9 for 8 minutes at 95° C. in parallel with RNA which has not been exposed to binding and filtration (Unselected RNA). The Selected RNA is then electrophoresed on a 20% denaturing gel adjacent to Unselected RNA.
To determine the affect on binding affinity of 2′-OMe substitution at a particular position, the ratio of intensities of the Unselected:Selected bands that correspond to the position in question are calculated. The Unselected:Selected ratio when the position is mixed is compared to the mean ratio for that position from experiments in which the position is not mixed. If the Unselected:Selected ratio of the mixed position is significantly greater than that when the position is not mixed, 2′-OMe may increase affinity. Conversely, if the ratio is significantly less, 2′-OMe may decrease affinity. If the ratios are not significantly different, 2′-OMe substitution has no affect. [0272]

G) Cell Binding Studies

The ability of evolved ligand pools and cloned ligands to bind to P-selectin presented in the context of a cell surface was tested in experiments with human platelet suspensions. Whole blood from normal volunteers was collected in Vacutainer 6457 tubes. Within 5 minutes of collection, 485 g of blood was stimulated with 15 μl Bio/Data THROMBINEX for 5 minutes at room temperature. A 100 μl aliquot of stimulated blood was transferred to 1 ml of BB− (140 MM NaCl, 20 mM HEPES pH 7.35, 5 mM KCl, 0.01% NaN[0273] ₃) at 4° C. and spun at 735×g for 5 minutes. This step was repeated and the resulting pellet was re-suspended in 1 ml of BB+ (140 mM NaCl, 20 mM HEPES pH 7.35, 5 mM KCl. 0.01% NaN₃, 1 mM CaCl₂, 1 mM MgCl₂) at 4° C.
To detect antigen expression, 15 μl BB+ containing FITC conjugated anti-CD61 or PE conjugated anti-CD62 antibody (Becton Dickinson) was incubated for 20-30 minutes at 4° C. with 10 μl of platelet suspension. This was diluted to 200 μl with 4° C. BB+ and analyzed on a Becton Dickinson FACSCaliber using 488 nm excitation and FL1 (530 nm emission) or FL2 (580 rum emission) with the machine live gated on platelets. Between 1000 and 5000 events in this gate were recorded. [0274]
To detect oligonucleotide ligand binding, 15 μl BB+ containing ligand conjugated to either FITC or biotin was incubated 20-30 minutes at 4° C. with 10 μl platelet suspension. The FITC-ligand incubations were diluted to 200 μl with BB+ and analyzed on a FACSCaliber flow cytometer. The biotinylated-ligand reactions were incubated with streptavidin-phycoerythrin (SA-PE) (Becton Dickinson) for 20 minutes at 4° C., before dilution and analysis. Wash steps with 500 μl BB+ and 700×g spins have been used without compromising the quality of the results. [0275]
The specificity of binding to P-selectin (CD62P) expressed on platelets was tested by competition with the P-selectin specific blocking monoclonal antibody, G1. Saturability of binding was tested by self-competition with unlabeled RNA. [0276]

H) Inhibition of Selectin Binding to Sialyl-Lewis^X

The ability of evolved RNA pools or cloned ligands to inhibit the binding of PS-Rg to sialyl-Lewis[0277] ^Xwas tested in competitive ELISA assays (C. Foxall et al., 1992, supra). For these assays, the wells of Corning (25801) 96 well microtiter plates were coated with 100 ng of a sialyl-Lewis^X/BSA conjugate, air dried overnight, washed with 300 μl of PBS(−) and then blocked with 1% BSA in HSMC for 60 min at room temperature. RNA ligands were incubated with PS-Rg in HSMC/1% BSA at room temperature for 15 min. After removal of the blocking solution, 50 μl of PS-Rg (10 nM) or a PS-Rg (10 nM)/RNA ligand mix was added to the coated, blocked wells and incubated at room temperature for 60 minutes. The binding solution was removed, wells were washed with 300 μl of PBS(−) and then probed with HRP conjugated anti-human IgG, at room temperature to quantitate PS-Rg binding. After a 30 minute incubation at room temperature in the dark with OPD peroxidase substrate (Sigma P9187), the extent of PS-Rg binding and percent inhibition was determined from the OD₄₅₀.

Example 28

2′-F RNA Ligands to Human P-selectin

A. SELEX

The starting RNA pool for SELEX, randomized 50N8 (SEQ ID NO: 390), contained approximately 10[0278] ¹⁵molecules (1 nmol RNA). The SELEX protocol is outlined in Table 18. The dissociation constant of randomized RNA to PS-Rg is estimated to be approximately 2.5 μM. An eight-fold difference was observed in the RNA elution profiles with 5 mM EDTA from SELEX and background beads for rounds 1 and 2, while the 50 mM elution produced a 30-40 fold excess over background Table 18. For rounds 1 through 3, the 5 mM and 50 mM eluted RNAs were pooled and processed for the next round. Beginning with round 4, only the 5 mM eluate was processed for the following round. To increase the stringency of selection, the density of immobilized PS-Rg was reduced five fold in round 2 and again in round three without greatly reducing the fraction eluted from the column. The density of immobilized PS-Rg was further reduced 1.6-fold in round 4 and remained at this density until round 8, with further reductions in protein density at later rounds. The affinity of the selected pools rapidly increased and the pools gradually evolved biphasic binding characteristics.
Binding experiments with 12th round RNA revealed that the affinity of the evolving pool for P-selectin was not temperature sensitive. Bulk sequencing of 2nd, 6th, 11th and 12th RNA pools revealed noticeable non-randomness by round twelve. The 6th round RNA bound monophasically at 37° C. with a dissociation constant of approximately 85 nM, while the 11th and 12th round RNAs bound biphasically with high affinity Kds of approximately 100 and 20 pM, respectively. The binding of all tested pools required divalent cations. In the absence of divalent cations, the Kds of the 12th round pools increased to >10 nM. (HSMC, minus Ca[0279] ⁺⁺/Mg⁺⁺, plus 2 mM EDTA). The 12th round pool showed high specificity for PS-Rg with measured Kd's of 1.2 μM and 4.9 μM for ES-Rg and LS-Rg, respectively.

B. RNA Sequences

In Table 19, ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Fixed region sequence is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the twelfth round, 21 of 44 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once, are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into five sequence families (1-5) and a group of two unrelated sequences (Orphans)(SEQ ID NOs: 199-219). [0280]
[0281] Family 1 is defined by 23 ligands from 13 independent lineages. The consensus sequence is composed of two variably spaced sequences, CUCAACGAMC and CGCGAG (Table 19). In 11 of 13 ligands the CUCAA of the consensus is from 5′ fixed sequence which consequently minimizes variability and in turn reduces confidence in interpreting the importance of CUCAA or the paired GAG (see Example 27).
Families 2-5 are each represented by multiple isolates of a single sequence which precludes determination of consensus sequences. [0282]

D. Affinities

The dissociation constants for representative ligands, including all orphans, were determined by nitrocellulose filter binding experiments and are listed in Table 20. These calculations assume two binding sites per chimera. The affinity of random RNA is estimated to be approximately 2.5 μM. [0283]
In general, ligands bind monophasically with dissociation constants ranging from 15 pM to 450 pM at 37° C. Some of the highest affinity ligands bind biphasically. Full length ligands of families 14 show no temperature dependence. The observed affinities substantiate the proposition that it is possible to isolate oligonucleotide ligands with affinities that are several orders of magnitude greater than that of carbohydrate ligands. [0284]

Example 29

Specificity of 2′-F RNA Ligands

The affinity of P-selectin ligands to ES-Rg, LS-Rg and CD22β-Rg were determined by nitrocellulose partitioning. As indicated in Table 20, the ligands are highly specific for P-selectin. In general, a ligand's affinity for ES-Rg and LS-Rg is at least 10[0285] ⁴-fold lower than for PS-Rg. Binding above background is not observed for CD22β-Rg at the highest protein concentration tested (660 nM), indicating that ligands do not bind the Fc domain of the chimeric constructs nor do they have affinity for the sialic acid binding site of this unrelated lectin. The specificity of oligonucleotide ligand binding contrasts sharply with the binding of cognate carbohydrates by the selectins and confirms the proposition that SELEX ligands will have greater specificity than carbohydrate ligands.

Example 30

Inhibition of Binding to sialyl-Lewis^X

Oligonucleotide ligands, eluted by 2-5 mM EDTA, are expected to derive part of their binding energy from contacts with the lectin domain's bound Ca[0286] ⁺⁺ and consequently, are expected to compete with sialyl-Lewis^Xfor binding. In competition assays, the selected oligonucleotide ligands competitively inhibit PS-Rg binding to immobilized sialyl-Lewis^Xwith IC50s ranging from 1 to 4 nM (Table 20). Specifically, ligand PF377 (SEQ ID NO: 206) has an IC50 of approximately 2 nM. Complete inhibition is attained at 10 nM ligand. This result is typical of high affinity ligands and is reasonable under the experimental conditions. The IC50s of ligands whose Kds are much lower than the PS-Rg concentration (10 nM) are limited by the protein concentration and are expected to be approximately one half the PS-Rg concentration. The specificity of competition is demonstrated by the inability of round 2 RNA (Kd˜1 μM) to inhibit PS-Rg binding to immobilized sialyl-Lewis^X. These data verify that 2′-F RNA ligands are functional antagonists of PS-Rg.

Example 31

Secondary Structure of High Affinity Ligands

In favorable instances, comparative analysis of aligned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequences are likely to be directly involved. [0287]
Comparative analysis of the [0288] family 1 alignment suggests a hairpin motif, the stem of which contains three asymmetrical internal loops (FIG. 16). In the figure, consensus positions are specified, with invariant nucleotides in bold type. To the right of the stem is a matrix showing the number of occurrences of particular base pairs for the positions in the stem that are on the same line. The matrix shows that 6 of the stem's 9 base pairs are supported by Watson-Crick covariation. Portions of the two consensus motifs, CUC and GAG, form the terminus of the stem. Conclusions regarding a direct role of the terminus in binding are tempered by the use of fixed sequence (11 of 13 ligands) which limits variability. The variability of the loop's sequence and length suggests that it is not directly involved in binding. This conclusion is reenforced by ligand PF422 (SEQ ID NO: 202) which is a circular permutation of the consensus motif. Although the loop that connects the stem's two halves is at the opposite end relative to other ligands, PF422 binds with high (Kd=172 pM; Table 21) affinity.

Example 32

Boundary Experiments

Boundary experiments were performed on a number of P-selectin ligands as described in Example 27 and the results are shown in Table 21. The results for [0289] family 1 ligands are consistent with their proposed secondary structure. The composite boundary species vary in size from 38-90 nucleotides, but are 40-45 nucleotides in family 1. Affinities of these truncated ligands are shown in Table 22. In general, the truncates lose no more than 10-fold in affinity in comparison to the full length, effectively inhibit the binding of PS-Rg to sialyl-Lewis^xand maintain binding specificity for PS-Rg (Table 22). These data validate the boundary method for identifying the minimal high affinity binding element of the RNA ligands.

Example 33

Binding of 2′-F RNA Ligands to Human Platelets

Since the P-selectin ligands were isolated against purified protein, their ability to bind P-selectin presented in the context of a cell surface was determined in flow cytometry experiments with activated human platelets. Platelets were gated by side scatter and CD61 expression. CD61 is a constitutively expressed antigen on the surface of both resting and activated platelets. The expression of P-selectin was monitored with anti-CD62P monoclonal antibody (Becton Dickinson). The mean fluorescence intensity of activated platelets, stained with biotintylated-PF377s1 (SEQ ID NO: 223)/SA-PE (Example 27, paragraph G), is 5 times greater than that of similarly stained resting platelets. In titration experiments, half maximal fluorescence occurs at approximately 50 pM PF377s1 (EC50) which is consistent with its equilibrium dissociation constant, 60 pM, for PS-Rg. Binding to platelets is specific by the criterion that it is saturable. Saturability has been demonstrated not only by titration but also by competition with unlabeled PF377s1. [0290]
Binding to platelets is P-selectin specific by the criteria that 1) oligonucleotides that do not bind PS-Rg do not bind platelets; 2) that binding of PF377s1 to platelets is divalent cation dependent; and most importantly 3) that binding is inhibited by the anti-P-selectin adhesion blocking monoclonal antibody G1, but not by an isotype control antibody. These data validate the feasibility of using immobilized, purified protein to isolate highly specific ligands against a cell surface P-selectin. [0291]

Example 34

2′-O-Methyl Substitution Experiments

2′-OMe purine substitutions were performed on ligand PF377s1 (SEQ ID NO: 223) as described in Example 27 paragraph F and the results are shown in Table 23. The data indicate that 2′-OMe purines at positions 7-9, 15, 27, 28 and 31 enhance binding while substitutions at [0292] positions 13, 14, 16, 18, 21 22, 24, and 30 have little or no affect on affinity. Thus it appears that up to 15 positions may be substituted with only slight losses in affinity. In partial confirmation of this expectation, the affinity of 377s1 simultaneously substituted with 2′-OMe purines at 11 positions (PF377M6, SEQ ID NO: 235) is 250 pM (Table 22).

Example 35

2′-NH₂RNA Ligands to Human P-Selectin

The experimental procedures described in this Example are used in Examples 36-38 to isolate and characterize 2′-NH[0293] ₂RNA ligands to human P-selectin.

Experimental Procedures

A) Materials

Unless otherwise indicated, all materials used in the 2′-NH[0294] ₂RNA SELEX against the P-selectin/IgG₁chimera, PS-Rg, were identical to those of Example 27. The 2′-NH₂modified CTP and UTP were prepared according to Pieken et. al. (1991, Science 253:314-317). The buffer for SELEX experiments was 1 mM CaCl₂, 1 mM MgCl₂, 150 mM NaCl, 10.0 mM HEPES, pH 7.4.

B) SELEX

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. The nucleotide sequence of the synthetic DNA template for the PS-Rg SELEX was randomized at 50 positions. This variable region was flanked by [0295] N8 5′ and 3′ fixed regions. The transcript 50N8 has the sequence 5′ gggagacaagaauaaac gcucaa-50N-uucgacaggaggcucacaacaggc 3′ (SEQ ID NO: 248). All C and U have 2′-NH₂substituted for 2′-OH on the ribose. The primers for the PCR were the following:
[0296] N8 5′ Primer 5′ taatacgactcactatagggagacaagaataaacgctcaa 3′ (SEQ ID NO: 249)
[0297] N8 3′ Primer 5′ gcctgttgtgagcctcctgtcgaa 3′ (SEQ ID NO: 250). The procedures used to isolate 2′-NH₂oligonucleotide ligands to P-selectin are identical to those described 2′-F ligands in Example 27, except that transcription reactions utilized 1 mM each, 2′-NH₂-CTP and 2′-NH₂-UTP, in place of 3.3 mM each 2′-F-CTP and 2′-F-UTP.

C) Nitrocellulose Filter Binding Assay

As described in SELEX Patent Applications and in Example 27, paragraph C, a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for PS-Rg and for other proteins. Either a Gibco BRL 96 well manifold, as described in Example 23 or a 12 well Millipore manifold (Example 7C) was used for these experiments. Binding data were analyzed as described in Example 7, paragraph C. [0298]

D) Cloning and Sequencing

Twelfth round PCR products were re-amplified with primers which contain either a BamHI or a HinDIII restriction endonuclease recognition site. Approximately 75 ligands were cloned and sequenced using the procedures described in Example 7, paragraph D. The resulting sequences are shown in Table 25. [0299]

E) Cell Binding Studies

The ability of evolved ligand pools to bind to P-selectin presented in the context of a cell surface was tested in flow cytometry experiments with human platelet suspensions as described in Example 7, paragraph E. [0300]

Example 36

2′-NH₂RNA Ligands to Human P-Selectin

A. SELEX

The starting 2′-NH[0301] ₂RNA pool for SELEX, randomized 50N8 (SEQ ID NO: 248), contained approximately 1015 molecules (1 nmol 2′-NH₂RNA). The dissociation constant of randomized RNA to PS-Rg is estimated to be approximately 6.4 μM. The SELEX protocol is outlined in Table 24.
The initial round of SELEX was performed at 37° C. with an PS-Rg density of 20 pmol/μl of protein A sepharose beads. Subsequent rounds were all at 37° C. In the first round there was no signal above background for the 5 mM EDTA elution, whereas the 50 mM EDTA elution had a [0302] signal 7 fold above background, consequently, the two elutions were combined and processed for the next round. This scheme was continued through round 6. Starting with round seven only the 5 mM eluate was processed for the next round. To increase the stringency of selection, the density of immobilized PS-Rg was reduced ten fold in round 6 with further reductions in protein density at later rounds. Under these conditions a rapid increase in the affinity of the selected pools was observed.
Binding experiments with 12th round RNA revealed that the affinity of the evolving pool for P-selectin was temperature sensitive despite performing the selection at 37° C., (Kds: 13 pM, 91 pM and 390 pM at 4° C., room temperature and 37° C., respectively). Bulk sequencing of RNA pools indicated dramatic non-randomness at [0303] round 10 with not many visible changes in round 12. Ligands were cloned and sequenced from round 12.

B. 2′-NH₂RNA Sequences

In Table 25, the 2′-NH[0304] ₂RNA ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030)(SEQ ID NOS: 251-290). The evolved random region is shown in upper case letters in Table 25. Any portion of the fixed region is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the twelfth round, 40/61 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. Ligands from family 1 dominate the final pool containing 16/61 sequences, which are derived from multiple lineages. Families 2 and 3 are represented by slight mutational variations of a single sequence. Sequences labeled as “others” do not have any obvious similarities. Family 1 is characterized by the consensus sequence GGGAAGAAGAC (SEQ ID NO: 291).

C. Affinities

The dissociation constants of representative ligands are shown in Table 26. These calculations assume two RNA ligand binding sites per chimera. The affinity of random 2′-NH[0305] ₂RNA is estimated to be approximately 10 μM.
At 37° C., the dissociation constants range from 60 pM to 50 nM which is at least a l×[0306] 10 ³to l>10 ⁵fold improvement over randomized 2′-NH₂RNA (Table 26). There is a marked temperature sensitivity for Clone PA350 (SEQ ID NO: 252) with an increase in affinity of 6 fold at 4° C. (Table 26). The observed affinities of the evolved 2′-NH₂ligand pools reaffirm our proposition that it is possible to isolate oligonucleotide ligands with affinities that are several orders of magnitude greater than that of carbohydrate ligands.

Example 37

Specificity of 2′-NH₂RNA Ligands to P-Selectin

The affinity of clone PA350 (SEQ ID NO: 252) for LS-Rg and ES-Rg was determined by nitrocellulose partitioning and the results shown in Table 26. The ligands are highly specific for P-selectin. The affinity for ES-Rg is about 600-fold lower and that for LS-Rg is about 5×10[0307] ⁵-fold less than for PS-Rg. Binding above background is not observed for CD22β-Rg indicating that ligands neither bind the Fc domain of the chimeric constructs nor have affinity for unrelated sialic acid binding sites.
The specificity of oligonucleotide ligand binding contrasts sharply with the binding of cognate carbohydrates by the selectins and reconfirms the proposition that SELEX ligands will have greater specificity than carbohydrate ligands. [0308]

Example 38

Cell Binding Studies

FITC-labeled ligand PA350 (FITC-350) (SEQ ID NO: 252) was tested for its ability to bind to P-selectin presented in the context of a platelet cell surface by flow cytometry experiments as described in Example 23, paragraph G. [0309]
The specificity of FITC-PA350 for binding to P-selectin was tested by competition experiments in which FITC-PA350 and unlabeled blocking monoclonal antibody G1 were simultaneously added to stimulated platelets. G1 effectively competes with FITC-PA350 for binding to platelets, while an isotype matched control has little or no effect which demonstrates that FITC-PA350 specifically binds to P-selectin. The specificity of binding is further verified by the observation that oligonucleotide binding is saturable; binding of 10 nM FITC-PA350 is inhibited by 200 nM unlabeled PA350. In addition, the binding of FITC-PA350 is dependent on divalent cations; at 10 nM FITC-PA350 activated platelets are not stained in excess of autofluorescence in the presence of 5 mM EDTA. [0310]
These data validate the feasibility of using immobilized, purified protein to isolate ligands against a cell surface protein and the binding specificity of 2′-NH[0311] ₂ligands to P-selectin in the context of a cell surface.

Example 39

Inhibition of P-selectin Binding to Sialyl Lewis^x

In competition assays, ligands PA341 (SEQ ID NO: 251) and PA350 (SEQ ID NO: 252) competitively inhibit PS-Rg binding to immobilized sialyl-Lewis[0312] ^xwith IC50s ranging from 2 to 5 nM (Table 26). This result is typical of high affinity ligands and is reasonable under the experimental conditions. The IC50s of ligands whose Kds are much lower than the PS-Rg concentration (10 nM) are limited by the protein concentration and are expected to be approximately one half the PS-Rg concentration. The specificity of competition is demonstrated by the inability of round 2 RNA (Kd˜1 μM) to inhibit PS-Rg binding to immobilized sialyl-Lewis^x. These data verify that 2-NH₂RNA ligands are functional antagonists of P-selectin.

Example 40

2′-NH₂RNA Ligands to Human E-Selectin

ES-Rg is a chimeric protein in which the extracellular domain of human E-selectin is joined to the Fc domain of a human G1 immunoglobulin (R. M. Nelson et al., 1993, supra). Purified chimera were provided by A. Varki. Unless otherwise indicated, all materials used in this SELEX are similar to those of Examples 7 and 13. [0313]

The SELEX procedure is described in detail in U.S. Pat. No. 5,270,163 and elsewhere. The rationale and experimental procedures are the same as those described in Examples 7 and 13.

TABLE 1


Wheat Germ Agglutinin Selex

			Gel	Total
	Total Protein	Total RNA	Volume	Volume	% RNA	% RNA	Kd
Round	(pmole)	(pmole)	(μl)	(μl)	Eluted	Amplified	(nM)

1	5,800	2,020	50	276	0.05	0.05	6,000,000
2	5,800	1,070	50	276	0.12	0.12
3	5,800	1,770	50	280	0.21	0.21
4	5,800	900	50	263	3	3
5	5,800	500	50	271	28.5	28.5	600
6a	5,800	1,000	50	282	28.8
6b	580	1,000	5	237	5.7	0.18	400
7	580	940	5	245	12.8	0.87	320
8	580	192	5	265	21.4	0.64	260
9	58	170	0.5	215	3.8	0.06	130
10	58	184	0.5	210	5.2	0.12	94
11	58	180	0.5	210	2.3	0.07	68




#Rounds 7-8: 200 μl of 0.2 mM (GlcNAc)3, incubated as in round 6; wash twice with sane buffer; washed sequentially with 3x 200 μl each, of 0.5, 1.0, 1.5, 2.0 and 10 mM (G1cNAc)3. Rounds 9-11: incubated 15 @ room temperature in 200 μl of 1 mM (GlcNAc);
#washed 2x with 200 μl of same buffer; incubation and washes repeated with 1.5, 2.0 and 10 mM (GlcNAc).

TABLE 2


Wheat Germ Agglutinin 2′ NH₂RNA Ligands

	SEQ
	ID
Ligand	NO.	SEQUENCE

FAMILY 1

11.8	4	AUGGUUGGCCUGGGCGCAGGCUUCGAAGACUCGGCGGGAA CGGGAAUGgcuccgcc
11.4(3)	5	CAGGCACUG AAAACUCGGCGGGAA CG AAAG UAGUGCCGACUCAGACGCGU
11.10	6	AGUCUGGCCAAAGACUCGGCGGGAA CGUAAAACGGCCAGAAUU
11.35	7	GUAGGAGGUUCCAUCACC AGGACUCGGCGGGAA CG GAA, GGUGAUGS
11.5	8	ACAAGGAUCGAUGGCGAGCCGGGGAGG GCUCGGCGGGAA CG AAA UCUgcuccgcc
11.26	9	UUGGGCAGGCAGAGCGAGACCGGGGGCUCGGCGGGAA CG GAACAGGAAUcgcuccgcc
11.19	10	AAGGGAUGGGAUUGGGACGAGCGGCC AAGACUCGGCGGGAA CG AAG GGUcgcuccgcc
11.15	11	aaucauacac aagaCUCCGCGGGAA CG AAA GUGUCAUGGUAGCAAGUCCAAUGGUGGACUCUc
11.34	12	aaucauacac aagaCUCGGCGGGAA CGUGAA GUGGGUAGGUAGCUGAAGACGGUCUGGGCGCCA
6.8	13	AAGGGAUGGGAUUGGGACGAGCGGCC AAGACUCGGCGGGAA CG AAG GGUCCgcuccgcc
6.9	14	aaucauacaca agaCUCGGCGGGAA CG AAG UGUGUGAGUAACGAUCACUUGGUACUAAAGCCC
6.23	15	aaucauacac aagaCUCGGCGGGAAUCG AAA GUGUACUGAAUUAGAACGGUGGGCCUGCUCAUCGU
6.26	16	aaucauacaca agaCUCGGCGGGAAUCGUAA UGUGGAUGAUAGCACGAUGGCAGYAGUAGUCGGACCGC
6.14	17	aaucauacacaagaCAGCGGCGG AGUC A GUGAAAGCGUGGGGGGYGCGGGAGGUCUACCCUGAC
CON-	56	AAGACUCGGCGGGAA CG AAA
SENSUS:

FAMILY 2

11.12	18	CGGCUGUGUGUGGU AGCGUCAUAGUAGGAGUCGUCACGAACCAA GGCgcuccgcc
11.24(2)	19	CGGCUGU GUGGUGUUGGAGCGUCAUAGUAGGAGUCGUCACGAACCAA GGCgcuccgcc
11.27(2)	20	CGAUGCGAGGCAAGAA AUGGAGUCGUUACGAACCC UCUUGCAGUGCGCGc
11.32	21	CGUGCGGAGCAAAUAGGGGAUC AUCGAGUCGU ACGAACCGUUAUCGCcgcuccgcc
11.6	22	CUGGGGAGCAGGAUAUGAGAUGUGCGGGGCA AUGGAGUCGUGACGAACC gcuccgcc
CON-	57	GGAGUCGUGACGAACC
SENSUS:

FAMILY 3

11.13	23	GUCCGCCCCCAGGGAUGCAACGGGGUGGCUCUAAAAGGCUUGGCUAA
11.23	24	GAGAAUGAGCAUGGCCGGGGCAGGAAGUGGGUGGCAACGGAGGCCA
6.3	25	GAUACAGCGCGGGUCUAAAGACCUUGCCCCUAGG AUGCAACGGGGUGCGUCCGCC
6.7	26	UGAAGGGUGGUAAGAGAGAGUCUGAGCUCGUCCUAGGGAUGCAACGGCACGUCCGCC
6.20	27	CAAACCUGCAGUCGCGCGGUGAAACCUAGGGUUGCAACGGUACAUCGCUGUCGUCCGCC
6.34	28	GUGGACUGGAAUCUUCGAGGACAGGAACGUUCCUAGGGAUGCAACOGACCGUCCGCC
6.35	29	GUGUACCAAUGGAGGCAAUGCUGCGGGAAUGGAGGCCUAGGGAUGCAAC
6.5	30	GUCCCUAGGGAUGCAACGGGCAGCAUUCGCAUAGGAGUAAUCGGAGGUC
6.16	31	GCCUAGGGAUGCAACGGCGAAUGGAUAGCGAUGUCGUGGACAGCCAGGU
6.19	32	AUCGAACCUAGGGAUOCAACGGUGAAGGUUGUGAGGAUUCGCCAUUAGGC
6.21	33	GCUAGGGAUGCCGCAGAAUGGUCGCGGAUGUAAUAGGUGAAGAUUGUUGC
6.25	34	GGACCUAGGGAUGCAACGGUCCGACCUUGAUGCGCGGGUGUCCAAGCUAC
6.33	35	AAGGGAGGAGCUAGAGAGGGAAAGGUUACUACGCGCCAGAAUAGGAUGU
CON-	58	CCUAGGGAUGCAACGG
SENSUS:

FAMILY 4

11.2	36	CCAACGUA CAUCGCGAGCUGGUG GAGAGUUCAUGA GGGUGUUACGGGGU
11.33	37	CCCAACGUGUCAUCGCGAGCUGGCG GAGAGUUCAUG GGGU UACGGGU
11.28	38	GUUGCUGCGAGCUGGGGGCGGCGA GAAGGUAGGCGGUCCGAGUGUU CGAAU
11.7(4)	39	aCUGGCAAGRAGUGCGUGAGGGUACGUUAG GGGUGUU UGGGCCGAUCGCAU
CON-	59	RCUGG GAGRGU GGGUGUU
SENSUS:

FAMILY 5

11.20(5)	40	UUGGUCGUACUGGACAGAGCCGUGGUAGAGGGAUUGGGACAAAGUGUCA

FAMILY 6

6.15	41	UGUGAGAAAGUGGCCAACUUUAGGACGUCGGUGGACUGYGCGGGUAGGCUC
6.28	42	CAGGCAGAUGUGUCUGAGUUCGUCGGAGUA GACGUCGGUGGAC GCGGAAC
CON-	60	UGUGNNNNAGUNNNNNNNNNUA GACGUCGGUGGACNNNGCGG
SENSUS:

FAMILY 7

6.24	43	UGUGAUUAGGCAGUUGCAGCCGCC GU GCGGAGACGU GA CUCGAG GAUUC
6.27	44	UGCCGGUGGAAAGGCGGGUAGGU GA CCCGAG GAUUCCUACCAAGCCAU
11.3	45	GAGGUGRA UGGGAGAGUGGAGCCCGGGUGACUCGAGGAUUCCCGU
CON-	61	GGGNNNGU GA CYCGRG GAYUC
SENSUS:

FAMILY 8

6.2	46	GUCAUGCUGUGGCUGAACAUACUGGUGAAAGUUCAGUAGGGUGGAUACAgcuccgcc
6.6(2)	47	CCGGGGAUGGUGAGUCGGGCAGUGUGACCGAACUGGUGCCCGCUGAGAgcucc
CON-	62	UGANCNNACUGGUGNNNGNGNAG
SENSUS:

FAMILY 9

6.11	48	ACACUAACCAGGUCUCU GAACGCGGGAC GGAGGUG UGGGCGAGGUGGAA
6.13	49	CCGUCUCCCGAGAACCAGGCAGAGGACGUGCUGAAGGAGCUG CAUCUAGAA
6.17	50	CCGUCUCC GAGAACCAGGCAGAGGAGGUGCUGAAGGRGCUGGCAUCUACAA
CON-	63	GUCUCY GAACNNGGNA GGANGUGNUG GAGNUG
SENSUS:

ORPHANS

6.1	51	CCCGCACAUAAUGUAGGGAACAAUGUUAUGGCGGAAUUGAUAACCGGU
6.4	52	CGAUGUUAGCGCCUCCGGGAGAGGUUAGGGUCGUGCGGNAAGAGUGAGGU
6.18	53	GGUACGGGCGAGACGAGAUGGACUUAUAGGUCGAUGAACGGGUAGCAGCUC
11.30	54	CGGUUGCUGAACAGAACGUGAGUCUUGGUGAGUCGCACAGAUUGUCCU
11.29	55	ACUGAGUAAGGUCUGGCGUGGCAUUAGGUUAGUGGGAGGCUUGGAGUAGc

TABLE 3


Dissociation Constants of RNA Ligands to WGA

Ligand	SEQ ID NO:	Kd

Family

1

11.8	4	9.2 nM
11.4	5	32 nM
11.35	7	90 nM
11.5	8	44 nM
11.26	9	38 nM
11.19	10	22 nM
11.15	11	54 nM
11.34	12	92 nM
6.8	13	11 nM
6.9	14	396 nM
6.23	15	824 nM
6.14	17	<5%

Family

2

11.12	18	15.2 nM
11.24	19	19.4 nM
11.27	20	30 nM
11.32	21	274 nM
11.6	22	702 nM

Family

3

11.13	23	<5%
11.23	24	<5%
6.3	25	120 nM
6.2	27	<5%
6.34	28	<5%
6.35	29	<5%
6.5	30	678 nM
6.16	31	<5%
6.19	32	74 nM

Family

4

11.2	36	62 nM
11.33	37	<5%
11.28	38	9.2 nM
11.7	39	16 nM

Family

5

11.2

40

1.4 nM

Family

7

6.27	44	56 nM
11.3	45	410 nM

Family

8

6.6

47

<5%

Family

9

6.11

48

<5%

Orphans

11.3	54	56 nM
11.29	55	32 nM

TABLE 4


Specificity of RNA Ligands to WGA

Kds for N-acetyl-glucosamine Binding Lectins

	Ligand 6.8	Ligand 11.20	Ligand 11.24
LECTIN	(SEQ ID NO: 13)	(SEQ ID NO: 40)	(SEQ ID NO: 19)

Triticum	11.4 nM	1.4 nM	19.2 nM
vulgare (WGA)
Canavalia	<5%*	<5%*	<5%*
ensiformis
(Con A)**
Datura	<5%*	11.2 μM	<5%*
stramonium
Ulex europaeus	4.4 μM	2.2 μM	<5%*
(UEA-II)

[0318]

TABLE 5

INHIBITION OF RNA LIGAND BINDING TO WHEAT

GERM AGGULTININ

Ligand SEQ ID NO: Competitor IC₅₀(μM) Max Inhib K_c(μM)

6.8 13 (GlcNAc)₃ 95 >95% 10.9

11.20 40 (GlcNAc)₃ 120 >95% 8.4

11.24 19 (GlcNAc)₃ 120 >95% 19.4
[0319]

TABLE 6

INHIBITION OF WGA MEDIATED AGGLUTINATION

OF SHEEP ERYTHROCYTES

Inhibitory Concentration (μM)

Inhibitor SEQ ID NO: Complete Partial

6.8 13 0.5 0.12

11.20 40 0.5 0.12

11.24 19 * 2

(GlcNAc)₃ 8 2

GlcNAc 780 200

TABLE 7a


L-Selectin 2′NH₂-RNA SELEX at 4° C.

						% 5 mM	% 50 mM
	Total	Total				EDTA	EDTA
SELEX	RNA	Protein	RNA:LS-	Bead	Total	Eluted	Eluted
Round #	pmoles	pmoles	Rg Ratio	Volume	Volume	RNA	RNA	Kd(nM)

Rnd 0								10,000
Rnd 1	1060	167.0	6.3	10 μL	˜100 μL	0.498	0.301
Rnd 2	962	167.0	5.8	10 μL	˜100 μL	0.306	0.114
Rnd 3	509	167.0	3.0	10 μL	˜100 μL	1.480	0.713
Rnd 4	407	167.0	2.4	10 μL	˜100 μL	5.010	1.596	434
Rnd 5	429	167.0	2.6	10 μL	˜100 μL	8.357	7.047
	439	16.7	26.3	10 μL	˜100 μL	0.984	0.492	133
Rnd 6	452	167.0	2.7	10 μL	˜100 μL	7.409	6.579
	46	16.7	2.8	10 μL	˜100 μL	3.468	1.312	37
Rnd 7	43	16.7	2.6	10 μL	˜100 μL	8.679	2.430
	44	16.7	2.6	10 μL	˜100 μL	7.539	2.358
	22	4.2	5.2	10 μL	˜100 μL	2.748	1.298
Rnd 8	43	16.7	2.6	10 μL	˜100 μL	8.139	1.393	33
	23	4.2	5.5	10 μL	˜100 μL	2.754	0.516
Rnd 9	23	4.2	5.5	10 μL	˜100 μL	4.352	0.761
Rnd 10	21	4.2	5.0	10 μL	˜100 μL	6.820	1.123	13
	23	8.4	2.7	50 μL	˜150 μL	14.756	1.934
Rnd 11	30	10.5	2.9	250 μL	˜500 μL	0.707	0.033
Rnd 12	12	10.5	1.1	250 μL	˜500 μL	3.283	0.137
Rnd 13	7	1	7	250 μL	˜500 μL	4.188	0.136	0.3
Rnd 14	9	1	9	250 μL	˜500 μL	4.817	0.438	0.7

TABLE 7b


L-Selectin 2′NH₂-RNA SELEX at Room Temperature

%

5 mM	%	50 mM
	Total	Total				EDTA	EDTA
SELEX	RNA	Protein	RNA:LS-	Bead	Total	Eluted	Eluted
Round #	pmoles	pmoles	Rg Ratio	Volume	Volume	RNA	RNA	Kd (nM)

Rnd 7	43	10.0	4.3	10 μL	˜100 μL	1.205	0.463
Rnd 8	35	10	3.5	10 μL	˜100 μL	6.642	0.401
	35	10	3.5	10 μL	˜100 μL	5.540	0.391
Rnd 9	24	2.5	9.6	10 μL	˜100 μL	1.473	0.383	13
Rnd 10	30	6.3	4.9	250 μL	˜500 μL	0.707	0.033
Rnd 11	12	6.3	1.9	250 μL	˜500 μL	3.283	0.134
Rnd 12	6	0.6	9.4	250 μL	˜500 μL	0.877	0.109	0.3
Rnd 13	1	0.6	1.4	250 μL	˜500 μL	5.496	0.739	0.7

TABLE 8


L-Selectin 2′ NH₂RNA LIGANDS

Ligand	SEQ ID NO.	Sequences

Family I

F13.32(5)	67	CGCGUAUGUGUGAAAGCGUGUGCACGGAGGCGU-CUACAAU
6.60(2)	68	GGCAUUGUGUGAAUAGCUGAUCCCACAGGUAACAACAGCA
6.50(3)	69	UAAUGUGUGAAUCAAGCAGUCUGAAUAGAUUAGACAAAAU
6.79	70	AUGUGUGAGUAGCUGAGCCCCCGAGUAUGAWACCUGACUA
F14.9	71	AAACCUUGAUGUGUGAUAGAGCAUCCCCCAGGCGACGUAC
F14.21	72	UUGAGAUGUGUGAGUACAAGCUCAAAAUCCCGUUGGAGG
F14.25	73	UAGAGGUAGUAUGUGUGGGAGAUGAAAAUACUGUGGAAAG
F13.48(2)	74	AAAGUUAUGAGUCCGUAUAUCAAGGUCGACAUGUGUGAAU
6.71	75	CACGAAAAACCCGAAUUGGGUCGCCCAUAAGGAUGUGUGA
6.28	76	GUAAAGAGAUCCUAAUGGCUCGCUAGAUGUGAUGUGAAAC
CONSENSUS:	118	AUGUGUGA

Family II

F14.20(26)	77	UAACAA CAAUCAAGGCGGGUUCACCGCCCCAGUAUGAGUG
F14.12(22)	78	UAACAA CAAUCAAGGCGGGUUYACCGCCCCAGUAUGAGUA
F14.11(12)	79	UAACAA CAAUCAAGGCGGGUUYACCGCUCCAGUAUGAGUA
F13.45(9)	80	UAACAA CAAUCAAGGCGGGUUCACCGCCCCAGUAUGAGUG
6.80	81	ACCAAGCAAUCUA GGUCGAACGCUACA CAUGAAUGACGUc
CONSENSUS:	119	CAA CAAUC AUGAGUR

Family III

6.17	82	GAACAUGAAGUAAUCAAAGUCGUACC AAUAUACAGGAAGC
6.49	83	GAACAUGAAGUAAGAC CGUCAC AAUUCGAAUGAUUGAAUA
6.16	84	GAACAUGAAGUAAAA AGUCGACG AAUUAGCUGUAACCAAAA
6.37	85	GAACAUGAAGUAAA AGUCUG AGUUAGUAAAUUACAGUGAU
6.78	86	GAACUUGAAGUUGA ANUCGCUAA GGUUAUGGAUUCAAGAUU
6.26	87	AACAUGAAGUAAUA AGUC GACGUAAUUAGCUGUAACUAAA
6.40	88	AACAUGAAGUAAA AGUCUG AGUUAGAAAUUACAAGUGAU-
F13.57	89	UAACAUAAAGUAGCG CGUCUGUGAGAGGAAGUGCCUGGAU
CONSENSUS:	120	AACAUGAAGUA AGUC ARUUAG

Family IV

6.58	90	AUAGAACCGCAAGGAUAACCUCGACCGUGGUCAACUGAGA
6.69	91	UAAGAACCGCUAGCGCACGAUCAAACAAAGAGAAACAAA-
CONSENSUS:	121	AGAACCGCWAG

Family V

6.56	92	UUCUCUCCAAGAACYGAGCGAAUAAACSACCGGASUCACA
F13.55	93	UGUCUCUCCUGACUUUUAUUCUUAGUUCGAGCUGUCCUGG
CONSENSUS:	122	UCUCUCC

Family VI

F14.27	94	CCGUACAUGGUAARCCU CGAAGGAUUCCCGGGAUGAUCCC
F14.53	95	UCCCAGAGUCCCGUGAUGCGAAGAAUCCAUUAGUACCAGA
CONSENSUS:	123	CGAAGAAUYC

Family VII

F13.42	96	GAUGUAAAUGACAAAUGAACCUCGAAAGAUUGCACACUC
F13.51	97	AUGUAAAUCUAGGCAGAAACGUAGGGCAUCCACCGCAACGA
CONSENSUS:	124	AUGUAAAU

Family VIII

6.33(11)	98	AUAACCCAAGCAGCNUCGAGAAAGAGCUCCAUAGAUGAU-
6.41	99	CAAAGCACGCGUAUGGCAUGAAACUGGCANCCCAAGUAAG
CONSENSUS:	125	AACCCAAG

Family IX

F13.46(4)	100	CAAAAGGUUGACGUAGCGAAGCUCUCAAAAUGGUCAUGAC

Family X
F14.2	101	AAGUGAAGCUAAAGCGGAGGG CCAUUCAGUUUCNCACCA

F14.13(2)	102	AAGUGAAGCUAAAGSGGAGGG CCACUCAGAAACGCACCA

Family XI

6.72(2)	103	CACCGCUAAOCAGUGGCAUAGCCCAGUAACCUGUAAGAGA
6.42	104	CAC-GCUAAGCAGUGGCAUAGC---GWAACCUGUAAGAGA

Family XII

6.30(5)	105	AGAUUACCAUAACCGCGUAGUCGAAGACAUAUAGUAGCGA

Family XIII

6.52(2)	106	ACUCGGGUAGAACGCGACUUGCCACCACUCCCAUAAAGAC

Orphans

6.14	107	UCAGAACUCUGCCGCUGUAGACAAAGAGGAGCUUAGCGAA
6.36	108	AAUGAGCAUCGAGAGAGCGCGAACUCAUCGAGCGUACUAA
6.41	119	CAAAGCACGCGUAUGGCAUGAAACUGGCANCCCAAGUAAG
6.44	110	GAUGCAGCAACCUGAAAACGGCGUCCACAGGUAAUAACAG
6.70	111	AAACUCGCUACAAACACCCAAUCCUAGAACGUUAUGGAGA
6.76	112	CUAGCAUAGCCACCGGAACAGACAGAUACGAGCACGAUCA
6.89	113	GAUUCGGAGUACUGAAAAACAACCCUCAAAAGUGCAUAGG
6.81	114	GUCCAGGACGGACCGCAGCUGUGAUACAAUCGACUUACAC
6.70	115	AAACUCGCUACAAACACCCAAUCCUAGAACGUUAUGGAGA
F13.59	116	CGGCCCUUAUCGGAGGUCUGCGCCACUAAUUACAUCCAC
F14.70	117	UCCAGAGCGUGAAGAUCAACGUCCCGGNGUCGAAGA

[0323]

TABLE 9

Dissociation Constants of 2′ NH₂RNA Ligands

to L-Selectin*

Ligand SEQ ID NO: 4° C. Rm Temp

Family I

F13.32 67 15.7 nM 14.9 nM

F13.48 74 15.9 nM 9.2 nM

F14.9 71 8.2 nM 15.4 nM

F14.21 72 2.3 nM 15.9 nM

F14.25 73 1300 nM

Family II

F14.12 78 5.8 pM 1.7 nM

(0.68) (0.62)

16.2 nM 94 nM

F14.20 77 58 pM 1.0 nM

(0.68) (0.28)

60 nM 48 nM

Family III

F13.57 89 3.0 nM 75 nM

Family V

F13.55 93 62 pM 1.5 nM

Family VI

F14.53 95 97 pM 142 nM

(0.65)

14.5 nM

F14.27 94 145 nM

Family VII

F13.42 96 2.0 nM 5.5 nM

F13.51 97 8.8 nM 18 nM

Family X

F14.2 101 1.8 nM 7.2 nM

F14.13 102 1.3 nM

(0.74)

270 nM

Orphans

F13.59 116 <5% <5%

F14.70 117 2.0 nM 7.8 nM

(0.75) (0.58)

254 nM 265 nM
[0324]

TABLE 10

Specificity of 2′ NH₂RNA Ligands to L-Selectin*

Ligand SEQ ID NO: LS-Rg ES-Rg PS-Rg CD22-Rg

Family I

F13.32 67 15.7 nM <5% 17 μM <5%

F13.48 74 15.9 nM <5% 720 nM <5%

F14.9 71 8.2 nM <5% <5%

F14.21 72 2.3 nM 2.6 μM <5%

F14.25 73 1300 nM

Family II

F14.12 78 60 pM 47 nM 910 nM <5%

F14.20 77 58 pM 70 nM <5%

(0.68)

60 nM

Family III

F13.57 89 3.0 nM 2.7 μM <5%

Family V

F13.55 93 62 pM 49 nM 5.8 μM <5%

Family VI

F14.53 95 97 pM 355 nM 5.2 μM <5%

(0.65)

14.5 nM

Family VII

F13.42 96 2.0 nM 4.4 μM <5%

F13.51 97 8.8 nM 2.0 μM

Family X

F14.2 101 1.8 nM 1.9 μM 450 nM <5%

Orphans

F13.59 116 <5% <5% <5%

F14.70 117 2.0 nM 5.9 μM <5%

(0.75)

254 nM

TABLE 11


L-SELECTIN ssDNA SELEX

		Total	Total
		DNA	Prot.	DNA:	Bead		% Eluted	% Eluted	Kd, nM	signal:bkgd
Round	Temp.	pmol	pmol	Protein	Vol.	Total Vol.	2 mM EDTA	50 mM EDTA	4 degrees	2 mM

Rnd

0									10,000
Rnd 1	4	930	167	5.6	10 μL	˜100 μL	n/a	5.5		50
Rnd 2	25	400	167	2.4	10 μL	˜100 μL	n/a	2.19		12
Rnd 3	25	460	167	2.8	10 μL	˜100 μL	n/a	2.55		25
Rnd 4	25	100	16.7	6	10 μL	˜100 μL	0.35	0.29		1.3
Rnd 5	25	100	16.7	6	10 μL	˜100 μL	0.23	0.08	967	3
Rnd 6	25	1000	16.7	60	10 μL	˜100 μL	1.42	0.38		4
Rnd 7	25	100	16.7	6	10 μL	˜100 μL	6.9	0.93	60	18
Rnd 8	37	100	16.7	6	10 μL	˜100 μL	1.9	0.31		9
Rnd 9	25	10	1.67	6	10 μL	˜100 μL	0.5	0.16	2.1	1.6
Rnd 10	25	10	1.67	6	10 μL	˜100 μL	2.2	0.57		5
Rnd 11	25	2.5	0.42	6	10 μL	˜100 μL	0.37	0.07	1.3 @ 25° C.	8
Rnd 12	25	2.5	0.42	6	10 μL	˜100 μL	0.86	0.13		11
Rnd 13	37	2.5	0.42	6	10 μL	˜100 μL	0.7	0.35	0.44 @ 25° C.	5
Rnd 14	25	5	0.84	6	50 μL	˜100 μL	2.8	0.76		4
Rnd 15	25	1.25	0.21	6	50 μL	˜100 μL	1.7	0.5	0.16 @ 25° C.	7

TABLE 12


L-Selectin ssDNA Ligands

Ligand	SEQ ID NO	SEQUENCE

Family 1

LD204(3)	129	GGAACACGTGAGGTTTAC AAGGCACTCGAC GTAAACACTT
LD145	130	CCCCGAAGAACATTTTAC AAGGTGCTAAAC GTAAAATCAG
LD183(2)	131	GGCATCCCTGAGTCATTAC AAGGTTCTTAAC GTAATGTAC
LD230(2)	132	TGCACACCTGAGGGTTAC AAGGCGCTAGAC GTAACCTCTC
LD208(7)	133	CACGTTTC AAGGGGTTACAC GAAACGATTCACTCCTTGGC
LD227(5)	134	CGGACATGAGCGTTAC AAGGTGCTAAAC GTAACGTACTT
LD112	135	CGCATCCACATAGTTC AAGGGGCPACAC GAAATATGCA
LD137	136	TACCCCTTGgGCCTCATAGAC AAGGTCTTAAAC GTTAGC
LD179(2)	137	CACATGCCTGACGCGGTAC AAGGCCTGG AC GTAACGTTG
LD182	138	TAGTGCTCCACGTATTC AAGGTGCTAAAC GAAGACGGCCT
LD190	139	AGCGATGC AAGGGGCTACAC GCAACGATTTAGATGCTCT
LD193(2)	140	CCAGGAGCACAGTAC AAGGTGTTAAAC GTAATGTCTGGT
LD199	141	ACCACACCTGGGCGGTAC AAGGAGTTATCC GTAACGTGT
LD201(2)	142	CAAGGTAACCAGTAC AAGGTGCTAAAC GTAATGGCTTCG
LD203	143	ACCCCCGACCCGAGTAC AAGGCATTCGAC GTAATCTGGT
LD207	144	CAGTAC AAGGTGTTAAAC GTAATGCCGATCGAGTTGTAT
LD216	145	ACAACGAGTAC AAGGAGATAGAC GTAATCGGCGCAGGTATC
LD233(5)	146	CACGACAGAGAAC AAGGCGTTAGAC GTTATCCGACCACG
LD191	147	AGGGAGAAC AAGGTGCTAAAC GTTTATCTACACTTCACCT
LD128(3)	148	AGGACC AAGGTGTTAAAC GGCTCCCCTGGCTATGCCTCTT
LD111(2)	149	gcTACAC AAGGTGCTAAAC GTAGAGCCAGATCCGATCTGAGC
LD139	150	GGAC AAGGCACTCGAC GTAGTTTATAACTCCCTCCGGgCC
LD237	151	gcTACAC AAGGGGCCAAAC GGAAGCCAGACGCGGATCTGACA
LD173	152	CGGCTATAC NNGGTGCTAAAC GCAGAGACTCGATCAACA
LD209	153	GAGTAGCC AAGGCGTTAGAC GGAGGGGGAATGGAAGCTTG
LD221	154	GAGTAGCC AAGGCGTTAGAC GGAGGGGGAATGG
LD108	155	GAGTAGCC AAGGCGTTAGAC GGAGGGGGAATGTGAGCACA
LD141	156	TAGCTCCACACAC AASSCGCRGCAC ATAGGGGATATCTGG
LD539	175	CGGCAGGGCACTAAC AAGGTGTTAAAC GTTACGGATGCC
LD547	176	TGCACACCGGCCCACCCGGAC AAGGCGCTAGAC GAAATGACTCTGTTCTG
LD516	177	GACGAAGAGGCC AAGGTGATAACC GGAGTTTCCGTCCGC
LD543	178	AAGGACTTAGCTATCC AAGGCACTCGAC GAAGAGCCCGA
LD545	179	ATGCCCAGTTC AAGGTTCTGACC GAAATGACTCTGTTCTG

Truncates

LD201T1	185	tagCCAAGGTAACCAGTAC AAGGTGCTAAAC GTAATGGCTTCGgcttac
LD201T3	186	GTAACCAGTAC AAGGTGCTAAAC GTAATGGCTTCGgcttac
LD201T4	187	CCAGTAC AAGGTCCTAAAC GTAATGG
LD201T10	188	CGCGGTAACCAGTAC AAGGTGCTAAAC GTAATGGCGCG
LD201T12	189	GCGGTAACCAGTAC AAGGTGCTAAAC GTAATGGCGC
LD227t5	190	ACATGAGCGTTAC AAGGTGCTAAAC GTAACGTACTTgcttactctcatgt
LD227x1	191	cgcGCGTTAC AAGGTGCTAAAC GTAACGTACTTgcttactcgcg
LD227t1	192	GCGTTAC AAGGTGCTAAAC GTAACGT
NX288	193	dt_atagCCAAGGTAACCAGTAC AAGGTGCTAAAC GTAATGGCTTTCGgcttact[3′3′]t
NX303	196	dt_a CCAGTAc AAGGTGCTAAAC GTAATGGt[3′3′]t
Consensus:	181	TAC AAGCYGYTAVAC GTA

Family 2

LD181(3)	157	CAT CAAGGACTTTGCCCGAAACCCTAGGTTCACG TGTGGG

Family 4

LD174(2)	158	CATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTG
LD122	159	GCAACGTGGCCCCGTT TAGCTCATTTGACCGTTCCATCCG
LD239	160	CCACAGACAATCGCAGTCCCCGTG TAGCTCTGGGTGTCT
LD533	180	GCAGCGTGGCCCTGTT TAGCTCATTTGACCGTTCCATCCG

Truncates
LD174t1	194	tagCCATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTGgctta
Consensus:	182	GGCCCCGT

Family 5

LD109	161	CCACCGTGATGCACGATACATGAGGGTGTGTCAGCGCAT
LD127	162	CGAGGTAGTCGTTATAGGGTGCGCACCACACACAGCGGTRG
Consensus:	183	RCACGAYACA

Family 6

LD196	163	TGGCCGTACGGGCCGTGCACCCACTTACCTGGGAAGTGA
LD229	164	CTCTGCTTACCTCATGTAGTTCCAAGCTTGGCGTAATCATG

Truncate
LD196t1	195	agcTGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGAgctta
Consensus:	184	CTTACCT

Family 7

LD206(2)	165	AGCCTTGT ACGGGGTTACAC ACAACGATTTAGATCCTCT

Orphans

LD214	166	TGATGCGACTTTAGTCGAACGTTACTGGGGCTCAGAGGACA
LD102	167	CGAGGATCTGATACTTATTGAACATAMCCGCACNCAGGCTT
LD530	168	CGATCGTGTGTCATGCTACCTACGATCTGACTA
LD504	169	GCACACAAGTCAAGCATGCGACCTTCAACCATCGACCCGA
LD509	170	ATGCCAGTGCAGGCTTCCATCCATCAGTCTGACANNNNNN
LD523	171	CACTTCGGCTCTACTCCACCTCGGTCCTCCACTCCACAG-
LD527	172	CGCTAACTGACCCTCGATCCCCCCAAGCCATCCTCATCGC
LD541	173	ATCTGACTAGCTCGGCGAGAGTACCCGCTCATGGCTTCGGCGAATGCCCT
LD548	174	TCCTGAGACCTTACAATAGGCTGCGGTACTGCAACGTGGA

TABLE 13


Dissociation Constants of ssDNA Ligands to L-Selectin

		Room
Ligand	SEQ ID NO:	Temperature	37° C.

Family

1

LD111	149	330 pM	11.8 nM
LD128	148	310 pM	1.8 nM
LD108	155	160 pM	8.5 nM
LD112	135	300 pM	23.2 nM
LD137	136	520 pM	0.65 nM
LD139	150	210 pM	6.8 nM
LD145	130	920 pM	8.8 nM
LD179	137	180 pM	590 pM
LD182	138	130 pM	2.0 nM
LD183	131	170 pM	1.0 nM
LD193
140	88 pM	970 pM
LD201	142	110 pM	1.2 nM
LD204	129	100 pM	3.7 nM
LD208	155	110 pM	380 pM
LD227	134	43 pM	160 pM
LD230	132	57 pM	260 pM
LD233	146	110 nM	380 pM

Family

2

LD181

157

84 pM

1.8 nM

Family

4

LD122	159	1.8 nM	2.1 nM
LD174	158	43 pM	370 pM
LD239	160	170 pM	1.6 nM

Family

5

	LD109	161	190 pM	9.6 nM
	LD127	162	1.0 nM	890 pM

Family

6

LD196

163

130 pM

3.4 nM

Family

7

LD206

165

330 pM

6.0 nM

Orphans

	LD102	167	not determined	7.9 nM
	LD214	166	660 pM	8.4 nM
	Round
15		160 pM	660 pM
	Pool
	LD201T1*			4.8 nM
	LD201T3*			43 nM

TABLE 14


Specificities of ssDNA Ligands to L-Selectin*

Ligand	SEQ ID NO:	LS-Rg	ES-Rg	PS-Rg

Family

1

LD111	149	1.1 nM	1.2 μM	840 nM
LD201	142	110 nM	37 nM	1.0 μM
LD204	129	450 pM	1.5 μM	2.9 μM
LD227	134	64 pM	33 nM	560 nM
LD230	132	44 pM	19 nM	600 nM
LD233	146	120 pM	39 nM	420 nM

Family

2

LD181

157

200 pM

37 nM

1.6 μM

Family

4

LD122	159	340 pM	400 nM	420 nM
LD174	158	46 pM	28 nM	380 nM

Family

5

LD127

162

250 pM

1.3 μM

780 nM

Family

6

LD196

163

220 pM

50 nM

3.4 μM

Family

7

LD206	165	120 pM	100 nM	600 nM

TABLE 15


Summary of Selection Conditions and Results from
2′F RNA Human L-selectin SELEXes

	Total	Total	Temp,	% Bound	%	5 mM	EDTA
SELEX	RNA	Protein	Time,	LS-Rg	EDTA	Signal/
Round	pmoles	pmoles	Vol.	Sites	Eluted	Bkgnd	Kd(nM)

30n7 2′Fluro SELEX

1	630	100	37° C. 15′ 10 μl	0.7	0.1	20
2	656	100	37° C. 15′ 10 μl	2.8	0.4	24
3	608	100	37° C. 15′ 10 μl	11.6	1.9	68	10000
4	193	20	37° C. 15′ 10 μl	7.4	0.8	24
5	193	20	37° C. 15′ 10 μl	19.7	2.1	17	850
6	86	10	37° C. 15′ 10 μl	15.7	1.9	8	360
7	17	2	37° C. 15′ 10 μl	12.1	1.4	3
8	17	2	37° C. 15′ 10 μl	55.1	6.6	2
9	19	2	37° C. 15′ 10 μl	40.1	4.2	4
10	18	2	37° C. 15′ 10 μl	28.4	3.3	3	3
11	103	12.5	37° C. 15′ 50 μl	647.7	8.3	65
11	27	2.5	37° C. 15′ 50 μl	63.1	5.9	3	0.5
12	89	5	37° C. 15′ 50 μl	53.2	3.0	7
12	79	5	37° C. 15′ 50 μl	54.8	3.5	65	0.4

40n7 2′Fluro SELEX

1	677	100	37° C. 15′ 10 μl	1.8	0.3	31
2	659	100	37° C. 15′ 10 μl	5.8	0.9	19
3	499	100	37° C. 15′ 10 μl	9.6	1.9	25	10000
4	187	20	37° C. 15′ 10 μl	4.3	0.5	7
5	179	20	37° C. 15′ 10 μl	19.7	2.2	8	1024
6	89	10	37° C. 15′ 10 μl	17.7	2.0	12	240
7	19	2	37° C. 15′ 10 μl	17.3	1.8	2
8	17	2	37° C. 15′ 10 μl	78.9	10.4	5
9	19	2	37° C. 15′ 10 μl	36.5	4.1	3
10	18	2	37° C. 15′ 10 μl	14.1	2.3	2	0.9
11	99	12.5	37° C. 15′ 50 μl	60.3	7.7	16
11	22	2.5	37° C. 15′ 50 μl	90.1	10.4	18	0.3
12	89	5	37° C. 15′ 50 μl	53.2	3.0	7
12	92	5	37° C. 15′ 50 μl	92.2	5.0	80	0.1

30n7 Primer Competition Counter-SELEX

1	168	20	37° C.15′ 100 μl	2.1	0.25	6
2	189	20	37° C.15′ 100 μl	15.4	1.62	119
3	185	20	37° C.15′ 100 μl	9.2	0.99	66	2
4	95	5	37° C.15′ 100 μl	44.0	2.33	6	0.3
5	100	5	37° C.15′ 100 μl	29.0	1.43	43
5	104	5	37° C.15′ 100 μl	36.0	1.70	24	0.4

40n7 Primer Competition Counter-SELEX

1	155	20	37° C.15′ 100 μl	1.9	0.25	5
2	184	20	37° C.15′ 100 μl	26.8	2.92	172
3	117	20	37° C.15′ 100 μl	12.9	2.21	78	2
4	93	5	37° C.15′ 100 μl	46.0	2.43	3	0.2
5	93	5	37° C.15′ 100 μl	37.0	2.00	52
5	94	5	37° C.15′ 100 μl	42.0	2.25	15	0.06

TABLE 16


L-Selectin 2′ F Ligands Sequences

		SEQ
		ID
Ligand	Sequence	NO.

Family 1a

LF1518	gggaggacgau gcggG CAAAUUG CAUGCG UU-UU-- CGAGUG CUUGC UcagacGacucgcccga	293
LF1817	gggaggacgaugc ggUG CUUAAAC AACGCG UGAAU-- CGAGUU CAUC CACUCCUCCU cagacgacucgcccg	294

a

LF1813	gggaggacgaugcggUUAAU UCAGU CUCAAAC GGUGCG UUUAU-- CGAGCC ACUGA UcwgacgacucgcccgaA	295
LF1822	gggaggacgaugcggCU UAGAG CUCAAAC GGUGUG ACUUU-- CAAGCC CUCUA UGCCcagacgacucgcccga	296
LF1514	gggaggacgaugc ggUAC CUCAAAU UGCGUG UU-UU-- CAAGCA GUAUc agacgacucgcccga	297
LF1529	gggaggacgaugcg gACC CUCAAAU AACGUG UCUUU-- CAAGUU GGUc agacgacucgcccga	298
LF1527(2)	gggaggacgaugcg gACC CUCAAAU AGCGUG CAUUU-- CAAGCU GGUc agacgacucgcccga	299
LF1536(2)	gggaAgacgaugc ggCG CUCAAAU AAUGCG UUAAU-- CGAAUU CGCC cagacgacucgcccga	300
LF1614	gggaggacgaugcggCA AACAAG CUCAAAU GACGUG UUUUU-- CAAGUC CUUGUU GUcagacgacucgcccga	301
LF1625	gggaggacgaugcggUA GUAAGU CUCAAAU GUUGCG UUUUU-- CGAAAC ACUUAC AUcaGacgacucgcccga	302
LF1728	gggaggacgaugc ggAGA CUCAAAU GGUGUG UU-UU-- CAAGCC UCUCC cagUcgacucgcccga	303
LF1729	gggaggacgaugc ggUG CUCAAAU GAUGCG UUUCU-- CGAAUC CACC cAgacgacucgcccga GG	304
LF1815	gggaggacgaugc ggCCAUCGGU CUUGGGC AACGCG UU-UU-- CGAGUU ACCUAUGGUc agacgacucgcccga	305
LF1834	gggaggacgaugcggCCAUC GGU CUUGGGC AACGCG UU-UU-- CGAGUU aCC UACAUcagacgacucgcccga	306
LF1508	gggaggacgaugcg gGACC CUUAGGC AACGUG UU-UU-- CAAGUU GGUc agacgacucgcccga	307
LF1828	gggaggacgaugcgg ACGUAGCU CUUAGGC AAUGCG UAUUU-- CGAAUU AGCUGUGU cagacgacucgcccga	308
LF1807	gggaggacgaugc ggAGU CUUAGGC AGCGCG UU-UU-- CGAGCU ACUCC AUCGCCAGUcagacgacucgcccga	309
LF1825	gggaAgacgaugcgg AAUGCU CUUAGGC AGCGCG UUAAU-- CGAGCU AGCACAUCCUcagacgacucgcccga	310
LF1855	gggaggacgaugG ggAGU CUUAGGC AGCGCG UU-UU-- CGAGCU ACUCC AUCGCCAGUcagacgacucgcccga	311
LF1811	gggaggacgaugcgg UAAUCU CUUAGGC AUCGCG UUAAU-- CGAGAU AGAUCACCGU cagacgacucgcccga	312
LF1626	gggaggacgaugcgg CAAUGUCh CUUAGGC CACGCG UUAAU-- CGAGCG UGACUGU cagacgacucgcccgag	313
LF1808(3)	gggaggacgaugc ggCAUGGU CUUAGGC GACGCG UUUAUAU CGAGUC ACCAUGCU cagacgacucgcccga	314
LF1719(2)*	gggaggacgaugcgg GAUG CUUAGGC GCCGUG UU-UU-- CAAGGC CAUc agacgacucgcccga	315
LF1619	gggaggacgaugcggU AAUUGU CUUAGGC GCCGUG UU-AU-- CAAGGC ACAAUU UCCCUcagacgacucgcccga	316
LF1620	gggaagacgaugcggCUACUA GUGU CUUAGGC GGAGUG UUUAU-- CAAUCC ACAC aUcagacgacucgcccga	317
LF1756	gggaggacgaugcggA CUGA CUUAGGC UGCGCG CACUU-- CGAGCA UcaG acgacucgcccga	318
LF1629(2)	gggaggacgaugcgg UGGUGUGU CUUUGGC ACCGCG UAUUUU- CGAGGU ACACAUca gacgacucgcccga	319
LF1821	gggaggacgaugcggUG GUGUGU CUUUGGC ACCGCG UA-UU-- CUCGAG GUACAC AUcagacgacucgcccga	320
LF1513	gggaggacgaugcg gGCU CUUCAGC AACGUG UU-AU-- CAAGUU AGCCc agacgacucgcccga	321
LF1615	gggaggacgaugc ggCGUAA CUUCAGC GGUGUG UUAAU-- CAAGCC UUACGCC AUCUcagacgacucgcccga	322
LF1521(2)	gaggacgaugc ggGCU CUUAAGC AACGUG UU-AU-- CAAGUU AGCCc agacgacucgcccga	323
LF1651	gggaggacga ugcggU CUCAAGC aAUGCG UUUAU-- CGAAUU ACCGUA CGCCUCCGUcagacgacucgccc	324

ga

LF1830	gggaggacgaugcggAA AUCU CUUAAGC AGCGUG UAAAU-- CAAGCU AGAU CUUCGUcagacgacucgcccga	325
LF1523(2)*	gggaggacgaugc ggUU CUUAAGC AGCGCG UCAAU-- CGAGCU AACC cagacgacucgcccga	326
LF1708**	gggaggacgaugc ggAU CUUAAGC AGCGCG UCAAU-- CGAGCU AACC cagacgacucgcccgag	327
LF1851	ACAGCUGAUGACCAUGAUUACGCCAAG CUUAAGC AGCGCG UU-UU-- CGAGCU CAUGUUGGUcagacgacucgcccga	328
LF1610(3)**	gggaggac gaugcggAGGGU CUUAAGC AGUGUG AUAAU-- CAAACU ACUCUCCGUGUc agacgacucgcccga	329
LF1712	gggaggacgaugc ggGAU CUUAAGC AGUGCG UUAUU-- CGAACU AUCCc agacgacucgcccga	330
LF1613(3)	gggaggacgaugcggUGC UAUU CUUAAGC GGCGUG UUUUU-- CAAGCC AAUA UCAUcagacgacucgcccga	331
LF1735	gggaggac gaugcggU CUUAAGC GGCGCG AUUUU-- CGAGCC ACCGCAUCCUC CGUGcaGacgacucgccc	332

ga

LF1731	gggaggacgaugcg gCCU CUUAAGC GUCGUG UUUUU-- CAAGCU GGUc agacgacucgcccga	333
LF1853	ggga ggacgaugcggAUACCACCU CUUAAGC GACGUG CAUUU-- CAAGUC AGAUGGucagacgacUcgcccga	334
LF1816	gggaggacgAugcggUGCUA UU CUUAAGC GGCGUG UAAAU-- CAAGCU AG AUCAUCGUcagacgacucgcccga	335
LF1622(3)*	gggaggacgaugcggA ACGACU CUUAAGC UGUGCG UU-UU-- CGAACA AGUCGU AACUcagacgacucgcccga	336
LF1725	gggaggacgaugc ggCU CUCAUUU wGCGCG UAAAU-- CGAGCU AGCC cagacgacucgcccga	337
LF1632	gggaggacgaugcggAG UCwCU CUCcacC AkCGUG UkUUAAU CAAGCU AnUG CCUcagacGacucgcccga	338
LF1856	gggaggacGaugcggUCUAC GGUCU CUCUGGC GGUGCG UAAAU-- CkAACC AGAUCG cagacgacucgcccga	339
LF1631	gggaggacgaugc ggUdAUUU CyUAAUC hGAGCG UUUAU-- CUAUCU mAAUkAUC CUcagacgacucgcccga	340
LF1730	gggaggacgaugc ggaU CgCAAUmU GUwGCG UU-CU-- CkAAAC AGCC Ucagacgacucgcccga	341
LF1852	gggaggacgaugc ggAACUU CUUAGGC AGCGUG CUAGU-- CAAGCU AAGUUCC ACCUcagacgacucgcccga	371
LF1653	gggaggacgaugcggC ACAAU CUUCGGC AGCGUG CAAGAU- CAAGCU AUUGU UGUcagacgacucgcccga	372
LF1554	gggaggacgaugc ggCGGU CUUAAGC AGUGUG UCAAU-- CAAACU AUCGUc agacgacucgcccga	366
LF1722	gggaggacgaugc ggUU CUUAAGC AGCGCG UCAAU- CGAGCU AACC cagacgacucgcccga	367

Truncates

LF1514T1	UGCGUG UU-UU-- CAAGCA	385
LF1514T2	CUCAAAU UGCGUG UU-UU-- CAAGCA	386
LF1514T4	ggUAC CUCAAAU UGCGUG UU-UU-- CAAGCA GUAUc	387
LF1807T5	ggAGU CUUAGGC AGCGCG UU-UU-- CGAGCU ACUCC	388

Family 1b

LF1511(4)	gggaggacgaugcgg UGGUU CUAG GCACGUG UU-UU-- CAAGUGU AAUca gacgacucgcccga	342
LF1753	gggaggac gaugc ggAA ACAUGUG UU-UU-- CGAAUGU gCUC UCCUCCCCAAACAACyCCCCCAA	343
LF1524	gggaggacg augc ggAA GGCCGUG UUAAU-- CAAGGCU GCAAU AAAUCAUCCUCCC cagacgac	344

ucgcccga

LF1810

g ggaggacgaugc ggAG GAUGGUG UUCAU-- CAAGAUU GCUCGUUCUUU ACUGCGUUcagacgac

345

ucgcccga

LF1621(2)*	gggaggacgaugcggUCAA AGUGAAG AAUG GACaGCG UU-UU-- CGAGUU GCUUCACU cagacGacucgcccga	346
LF1826(2)*	gggaggacgaugcgg GGAG AAUG GCCAGCG UUUAU-- CGAGGU GCUCCGUUAACCGG cAgacgacucgccc	347

ga

LF1713	gggaggacgaugcgg GAGG AAUG GACwGCG UAUAU-- CGAGUUG CCUc agacgacucgcccga	348
LF1520	gggaggacgaugcg gAUCG AUU UCAUGCG UUUUU-- CGAGUGA CGAUc agacgacucgcccga	349
LF1552	gggaggacgaugcggA GACc CUA AGmGsG UksUUUU CAAsCU GGUc wgacgacuzgcccga	350

Family 1c

LF1618(2)	gggaggacgaugcgg UUAGCCUACACUCUAGGUUCAG UU-UU-- CGAAUCUUCCACCG cWgacgacucgcccga	351
LF1528(3)	gggaggacgaugcgg UUAGGUCAAUGAUCUUAG UU-UU-- CGAUUCGU cagacgacucgcccga	352
LF1718	gggaggacga ugcggA CGUGUG UAUCrAr UU-UU-- CCGCUG UUUGUG cagacgacucgcccga	353
LF1623	gggaggacGaugcgg ACAGGGUUCUUAG GCGGAG UG-UU-- CAUCAA UCCAACCAUGU cagacgacucgcccga	354
LF1557	gggaggacgaugcgg CGAUUUCCAC AGUUUG UCUUAUU CCGCAU AU cagacgacucgcccga	355

Family 1 (Unclassified)

LF1707	gggaggacgaugcgg AUAyUCAgCUyGUGUk UU-UU-- CdAUCUUCCC cagacgacucgcccga	356
LF1512	gggaggacgaugc ggCACACGUG UU-UU-- CAAGUGUGCU CCUGGGAU cagacgacucgcccga	357
LF1535(2)	gggaggacgaugc ggCAAUGUG UUUCU--- CAAAUUGCU UUCUCCCUU cagacgacucgcccga	358
LF1711	gggaAgacg augcggUG UUGAU-- CAAUG AAUGUCCUCCUCCUACCC cagacgacucgc	364

ccga

LF1517

gggaggacgau gcgguG UUUGU-- CAAUGU CAUGAUUAGUUUUCCCA cagacgacucgc

365

	ccga

Family 2

LF1627(2)	gggaggacgaugc ggAUACUACCGUGCG AACaCUAAG UCCCGUCUGUCCACUCCU cagacgacucgcccga	359
LF1724(2)*	gggaggacgaugc ggAUaCUA-UGUGCG UUCACUAAG UCCCGUC-GUCCCCU cagacgacucgcccga	360
LF1652(2)	gggaggacgaugc ggGUACUA UGUACG AUCaCUAAG CCCCAUCACCCUUCUCACU cagacnacucgcccga	361
LF1519	gggaggacgaugc ggUUACUA UGUACA UUUACUAAG ACCCAACGU cagacgacucgcccga	362
LF1608	gggaggacgaugc ggUUwCUA UGUwCGCCUUACUAAGUACCCGUCGACUGUCCCAU cagacgacucgcccga	363

Family 3

LF1710	gggaggacgaugcgg AAUGrCCCGUUACCAwCAAUGCGCCUCdUUGmCCCCAAACAACyCCCCCAA	368
LF1829	gacgaugcgg AAUyUCGUGyUAcGCGUyyYCUAUCCAAUCUACCCCmUCUCCAAU cagacgacyc-----	369
LF1509	gggaggacgaugcgg CGCUUACAAUAAUUCUCCCUGAGUACAGCucag acgacucgcccga	370

Orphans

LF1507	gggaggacgaugcgg UCAUUAACCAAGAUAUGCGAAUCACCUCCU cagacgacucgcccga	373
LF1516(2)	gggaggacgaugcgg UCAUUCUCUAAAAAAGUAUUCCGUACCUCCa cagacgacucgcccga	374
LF1530(2)*	gggaggacgaugcgg GUGAUCUUUUAUGCUCCUCUUGUUUCCUGU cagacgacucgcccga	375
LF1835(4*)	gggaggacnaugcgg UCUAGGCaUCGCUAUUCUUUACUGAUAUAAUUACUCCCCU cagacgacucgcccga	376
monster	gggaggacgaugcgg AGUwwGCNCGGUCCAGUCACAUCCwAUCCC cagacGacucgcccga	377
LF1522	gggaggacgAugcgg CUCUCAUAUkGwGUrUUyUUCmUUCsrGGCUCAAACAAyyCCCCCAA	378
LF1727	gggaggacgaugcgg CUUGUUAGUUAAACUCGAGUCUCCACCCCU cagacgacucgcccga	379
LF1510	gggaggacgaugcgg UCUCUwCUvACvUGUrUUCACAUUUUCGCyUCAAACAACyCCCCCAA	380
LF1715	gggaggacgaugcgg UUrACAAUGrssCUCrCCUUCCCwGGUCCU cagacgacucgcccga	381
LF1809	AggaggacGaugcgg UUAUCUGAArCwUGCGUAAmCUArUGUsAAAsUGCAACrA cRaacaacYcScccaa	382
LF1533	Aggaagacgaugcgg UUCGAUUUAUUUGUGUCAUUGUUCUUCCAU cagacgacucgcccga	383
LF1720	--------------- -----------GUGAUGACAUGGAUUACGC cagacgacucgcccga	384

TABLE 17


2′ Fluoro L-selectin SELEXes:
Full Length Transcribed Ligands:
Protein and Lymphocyte Binding Affinity

		L-selectin#	Lymphocytes##
LIGAND	SEQ ID NO	Kd (nM)	Kd (nM)

LF1508	307	0.5
LF1511	342	0.48
LF1512	357	315
LF1513	321	0.16	4
LF1514	297	0.13	0.8
LF1516	374	1.3*
LF1518	293	0.42
LF1520	339	0.5*
LF1521	323	0.25*
LF1523	326	0.25
LF1524	344	2.1*
LF1527	299	0.32
LF1528	352	—*
LF1529	298	0.6
LF1535	358	—*
LF1536	300	0.22*
LF1610	329	0.53
LF1613	331	0.034	0.2
LF1614	301	0.17
LF1615	322	0.32
LF1618	351	9.6	25
LF1707	356	0.16*
LF1708	327	70
LF1712	330	0.065*
LF1713	338	0.22*
LF1718	353	6.4*
LF1807	309	0.034
LF1808	314	0.6
LF1810	345	8.1*
LF1811	312	0.19
LF1815	305	0.18*
LF1816	335	—*
LF1817	294	2.3*
40N7		—
NX280		1.6	3

TABLE 18


P-SELECTIN 2′F RNA SELEX

					% RNA	Signal to	% RNA	Signal to
					eluted	Noise-	eluted	Noise-
SELEX	RNA Load	PS-Rg	Bead	Total	5 mM	5 mM	50 mM	50 mM	% Retained
Round #	(pmol)	(pmol)	Volume	Volume	EDTA	EDTA	EDTA	EDTA	on column	Kd(nM)

Rnd 1	320	200	10 μl	125 μl	1.4	8	8.3	40	0.7	2500
Rnd 2	510	100	10 μl	125 μl	1.8	9	3.5	30	0.6
	200	40	10 μl	125 μl	1.7	5	2.6	12	0.3
Rnd 3	200	40	10 μl	125 μl	2.3	15	3.0	13	0.1
	40	8	10 μl	125 μl	1.3	4	0.8	8	0.3	1200
Rnd 4	25	5	10 μl	125 μl	1.2	3	0.6	3	0.7
Rnd 5	25	5	10 μl	125 μl	0.9	3	0.15	1.5	0.3	280-900
Rnd 6	25	5	10 μl	125 μl	0.8	2	0.0	1	0.4	85
Rnd 7	50	5	10 μl	125 μl	4.0	8	1.0	4.3	0.5	13
Rnd 8	50	5	10 μl	125 μl	4.6	16	0.4	6.7	0.3	5
	10	1	10 μl	125 μl	4.5	6	0.2	2.3	1.4	5
Rnd 9	10	1	10 μl	125 μl	5.3	28	0.05	1.5	1.2
	10	1	100 μl	250 μl	2.8	6	0.3	2	0.8
Rnd 10	5	0.5	10 μl	500 μl	5.6	20	0.2	5	1.2
Rnd 11	5	1	250 μl	500 μl	10	11	0.4	2	2.5	0.1-2
	1	0.2	10 μl	500 μl	14.2	15	0.6	3	13
Rnd 12	1	0.1	250 μl	500 μl	4.5	4	0.8	2	4.7	0.02-20
Rnd 13	0.1	0.01	250 μl	500 μl	2.6	2	ND	ND	3.6

TABLE 19


P-Selectin 2′-F RNA Ligands

		SEQ
		ID
Ligand	Sequence	NO.

Family 1

PF373(6)

gggagacaagaauaaacgcucaaCGAAUCAGUAAACAUAACACCAUGAAACAUAAAUAGCACGCGAGACGUCuucgacaggaggcucacaa

199

caggc

PF424

gggagacaagaauaaacgcucaaCGAGUUCACAUGGGAGCAAUCUCCGAAUAAACAACACGCKAKCGCAAAuucgacaggaggcucacaac

200

aggc

PF412

gggagacaagaauaaacgcucaaCGACCACAAUACAAACUCGUAUGGAACACGCGAGCGACAGUGACGCAUUuucgacaggaggcucacaa

201

caggc

PF422

gggagacaagaauaaacgcucaaCGUCAAGCCAGAAUCCGGAACACGCGAGAAAACAAAUCAACGACCAAUCGAuucgacaggaggcucac

202

aacaggc

PF426

gggagacaagaauaaacgcucaaCGACCACAAUAACCGGAAAUCCCCGCGGUUACGGAACACGCGAACAUGAAuucgacaggaggcucaca

203

acaggc

PF398

gggagacaagaauaaacgcucaaCGAACCACGGGGAAAUCCACCAGUAACACGCGAGGCAAACAGACCCUCuucgacaggaggcucacaac

204

aggc

PF380(2)

gggagacaagaauaaacgcucaacCGAGCAAAAGUACUCA CGGGACCAGGAGAUCAGCAACACGCGAGACGAAAuucgacaggaggcuca

205

caacaggc

PF377(2)

gggagacaagaauaaacgcucaaCGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACCuucgacaggaggcucacaa

206

caggc

PF387(2)

gggagacaagaauaaacgcucaaCGCACCAGGAACAACGAGAACCAUCAGUAAACGCGAGCGAUUGCAUGuucgacaggaggcucacaaca

207

ggc

PF383

gggagacaagaauaaacgcucaaCGCACCAGGAACAACAAGAACCAUCAGUAAGCGCGAGCGAUUGCAUAuucgacaggaggcucacaaca

208

ggc

PF395

gggagacaagaauaaacgcucaaCGAGCAAGGAACGAAUACAAACCAGGAAACUCAGCAACACGCGAGCAGUAAGAAuucgacaggaggcu

209

cacaacaggc

PF416(2)

gggagacaagaauaaacgcucaaCAGUUCACUCAACCGGCACCAGACUACGAUCAGCAUUGGCGAGUGAACACuucgacaggaggcucaca

210

acaggc

PF388(2)

gggagacaagaauaaacgcucaaCUGGCAACGGGAUAACAACAAAUGU CACCAGCACUAGCGAGACGGAAGGuucgacaggaggcucaca

211

	acaggc

Family

1 Truncates

PF373s1	CUCAACGAAUCAGUAAACAUAACACCAUGAAACAUAAAUAGCACGCGAG	220
PF424s1	CUCAACGAGUUCACAUGGGAGCAAUCUCCGAAUAAACAACACGCGAG	221
PF3981	CUCAACGAACCACGGGGAAAUCCACCAGUAACACGCGAG	222
PF377s1	CUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAG	223
PF377s2	CGCUCAACGAGCCAGGAACAUCGACGACAGCAAACGCGAGCG	224
PF377L1	CUCAACGAGCCAGGACUACGAUCAGCCAAACGCGAG	225
PF387s1	CUCAACGCACCAGGAACAACGAGAACCAUCAGUAAACGCGAG	226
PF383s1	CUCAACGCACCAGGAACAACAAGAACCAUCAGUAAGCGCGAG	227
PF416s2	CACUCAACCGGCACCAGACUACGAUCAGCAUUGGCGAGUG	228
PF422s1	GAAUCCGGAACACGCGAGAAAACAAAUCAACGACCAAUCGAUUCG	229

2′-O-Methyl Substituted Truncates

PF377M1	CUCAACGAGCCAGGACGUCAGCAAACGCGAG	230
PF3772	CUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAG	231
PF377M3	CUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAG	232
PF377M4	CUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAG	233
PF377M5	CUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAG	234
PF377M6	CUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAG	235

Family 2

PF378(8)

gggagacaagaauaaacgcucaaCGAUGAGCGUGACCGAAGCUAUAAUCAGGUCGAUUCACCAAGCAAUCUUAuucgacaggaggcucaca

212

	acaggc

Family

3

PF381(5)

gggagacaagaauaaacgcucaaAGGAUCACACAAACAUCGGUCAAUAAAUAAGUAUUGAUAGCGGGGAUAuucgacaggaggcucacaac

213

	aggc

Family

4

PF411(2)

gggagacaagaauaaacgcucaaCAACCCAACCAUCUAGAGCUUCGAACCAUGGUAUACAAGGGAACACAAAAuucgacaggaggcucaca

214

	acaggc

Family

5

PF396(2)

gggagacaagaauaaacgcucaaGCGGUCAGAAACAAUAGCUGGAUACAUACCGCGCAUCCGCUGGGCGAUAuucgacaggaggcucacaa

215

	caggc

Orphans

PF386

gggagacaagaauaaacgcucaaACAAGAGAGUCAAACCAAGUGAGAUCAGAGCGUUUAGCGCGGAAAGCACAuucgacaggaggcucaca

216

acaggc

PF382

gggagacaagaauaaacgcucaaACUCGACUAGUAAUCACCCUAGCAUAAAUCUCCUCGAGCACAGACGAUAuucgacaggaggcucacaa

217

caggc

PF404

gggagacaagaauaaacgcucaaUCAGCAGUAAGCGAUCCUAUAAAGAUCAACUAGCCAAAGAUGACUUAuucgacaggaggcucacaaca

218

ggc

PF417

gggagacaagaauaaacgcucaaAAAGACGUAUUCGAUUCGAAACGAGAAAGACUUCAAGUGAGCCCGCAGuucgacaggaggcucacaac

219

	aggc

TABLE 20


Dissociation Constants and Specificity of 2′F RNA
Ligands to P-Selectin

						SEQ
	Kd	S LeX	Kd	Kd		ID
Ligand	(PS-Rg)	(IC50)	(ES-Rg)	(LS-Rg)	Tm(° C.)	NO.

PF373	49.5 pM		>3 μM	>3 μM		199
PF377	18.5 pM	3 nM	2.3 μM	>3 μM	53° C.	206
PF378	51.5 pM					212
PF380	74.5 pM	4 nM				205
PF381	16.5 pM	1 nM				213
PF386	45.5 pM					216
PF387	16 pM					207
PF388	90 pM					211
PF395	26 pM					209
PF396	24 pM					215
PF398	46 pM					204
PF404	47.5 pM					218
PF411	13 pM	2 nM				214
PF412	450 pM					201
PF416	63 pM					210
PF417	69 pM					219
PF422	172 pM	3 nM				202
PF424	36.5 pM					200

TABLE 21


Boundary Results for 2′ F RNA Ligands to P-Selectin

		SEQ
		ID
Kd(pM)	Clone#	NO.

FAMILY 1

56	PF373s1	cucaaCGAAUCAG UA AACAUAACACCAUGAAACA UAAAUAGCACGCGAG	220
178	PF424s1	cucaaCGAGUUCACAUG GGAGCAAUCUCCGAA UAAACAACACGCGAG	221
63	PF398s1	cucaaCGAACCAC GG GGAAAUCCA CCAGUAACACGCGAG	222

ND

PF380s1

cucaaCGAGCAAAAGUACUCACGGGACCAGGAGA UCAGCAACACGCGAG ACGAAA-

236

		uucg
50	PF377s1	cucaaCGAGCCAG GA ACAUCGACG UCAGCAAA CGCGAGCG	223
50	PF377s2	cg cucaaCGAGCCAG GA ACAUCGACG UCAGCAAA CGCGAG CG	234
	PF412	cg cucaaCGACCACAA UA CAAACUCG UAUGGAACACGCGAG CG	237
63	PF387s1	cg cucaaCGCACCAG GA ACAACGAGAACCA UCAGUAAA CGCGAG CG	226
10000	PF383s1	acg cucaaCGCACCAG GA ACAACAAGAACCA UCAGUAAG CGCGAG CG	227
	PF388	cg cucaaCuGGCAAC GG GAUAACAACAAAUGUCA CCAGCACU AGCGAG ACG	238
150	PF416s1	UCA CUCAACCGGCACCA GA CUACGA UCAGCAUU GGCGAG UG	239
	PF395	gggagacaagaauaaacg cucaaCGAGCAAG GA ACGAAUACAAACCAGGAAACUCAGCAACACGCGAG CA	240
	PF426	cucaaCGACCACAA UA ACCGGAAAUCCCCGCGGU UACCGGAACACGCGAA CA	241
1000	PF422s1	AUCAACGACCAAUC GA uucg3′ 5′GAAUCCGGAACACGCGAG -	229
		AAAACAA

FAMILY

2

	PF378	agaauaaacgcucaaCGAUGAGCGUGACCGAAGCUAUAAUCAGGUCGAUUCACCAAGCAAUCUUAuucg	242

FAMILY 3

	PF381	acgcucaaAGGAUCACACAAACAUCGGUCAAUAAAUAAGUAUUGAUAGCG	243

FAMILY 4

	PF396	gcucaaGCGGUCAGAAACAAUAGCUGGAUACAUACCGCGCAUCCGCUGGGCG	244

FAMILY 5

	PF411	ACCAUCUAGAGCUUCGAACCAUGGUAUACAAGGGAACACAAAAuucgcggaggcucca	245

ORPHANS

PF386	gggagacaaga-	246
	uaaacgcucaaACAAGAGAGUCAAACCAAGUGAGAUCAGAGCGUUUAGCGCGGAAAGCACA-
	uucgacaggaggcucacaacaggc
PF417	gggagacaagaauaaacgcucaaAAAGACGUAUUCGAUUCGAAACGAGAAAGAC UUCAAGUGAGCCCGCAG-	247
	uucgacaggaggcuca

TABLE 22


Dissociation Constants and Specificity of Truncated
2′F RNA Ligands to P-Selectin

	Kd	S LeX	Kd	Kd	Tm	#
Ligand	(PS-Rg)	(IC50)	(ES-Rg)	(LS-Rg)	(° C.)	Bases	SEQ ID NO.

PF373s1	56 pM	3 nM	>3 μM	>3 μM			220
PF377s1	60 pM	2 nM	>3 μM	>3 μM	59° C.	38	223
PF377s2	45 pM	4 nM				42	224
PF383s1	10000 pM	25 nM				46	227
PF387s1	63 pM	2 nM	>3 μM	>3 μM		46	226
PF398s1	178 pM	2 nM	>3 μM	>3 μM		39	222
PF416s2	150 pM	3 nM				42	228
PF422s1	1000 pM	8 nM	>3 μM	>3 μM		44	229
PF377s1B	65 pM	3 nM	>3 μM	>3 μM		38	223
PF377s1B:SA	30 pM					38	223
PF377s1F	60 pM	3 nM				38	223
PF377s1-	125 pM	2 nM				41	223
5′NH2
PF377L1	220 pM	4 nM	>3 μM	>3 μM		35	225
PF377t3′	30 pM	2 nM				59	223
PF377M1	120 pM		>3 μM			38	230
PF377M2	1700 pM					38	231
PF377M3	900 pM	10 nM	>3 μM			38	232
PF377M4	1700 pM					38	233
PF377M5	60 pM	2 nM	>3 μM			38	234
PF377M6	250 pM					38	235

TABLE 23


2′OMe Substitution of 2′F RNA
Ligands to P-Selectin

Purine	Unmixed	Std.	Mixed	Mixed	Predicted	Actual
Position	Ratio	Dev.	40 pM	200 pM	Pref.	Pref.

4	1.07	0.12	0.3	0.4	2′-OH	untested
5	1.00	1.00	0.4	0.7	2′-OH	untested
7	1.00	0.13	1.2	1.5	2′-O—Me	2′-O—Me
8	1.03	0.20	2.3	1.3	2′-O—Me	2′-O—Me
12	0.83	0.12	0.4	0.5	2′-OH	untested
13	0.90	0.17	0.8	0.8	neutral	2′-O—Me
14	0.73	0.15	0.8	0.9	neutral	2′-O—Me
15	0.63	0.15	0.8	1.3	2′-0—Me	2′O—Me
16	0.67	0.10	0.5	0.7	neutral	untested
18	0.60	0.10	0.7	0.7	neutral	2′-O—Me
21	0.87	0.30	0.5	0.7	neutral	2′-O—Me
22	0.72	0.16	0.7	0.8	neutral	2′-O—Me
24	0.70	0.16	0.6	0.8	neutral	2′-O—Me
27	0.83	0.12	1.3	1.5	2′-O—Me	2′-O-Me
28	0.69	0.09	0.6	1.0	2′-O—Me	?
30	0.90	0.00	0.8	1.0	neutral	?
31	0.92	0.16	1.2	1.5	2′-O—Me	2′O—Me
32	1.10	0.06	0.5	0.8	2′-OH	untested
34	0.93	0.06	0.7	0.9	2′-OH	untested

TABLE 24


					% RNA	Signal to	% RNA	Signal to
					eluted	Noise-	eluted	Noise-	%
SELEX	RNA Load	PS-Rg	Bead	Total	5 mM	5 mM	50 mM	50 mM	Retained
Round #	(pmol)	(pmol)	Volume	Volume	EDTA	EDTA	EDTA	EDTA	on column	Kd (nM)

Rnd 1	330	200	10 μl	125 μl	0.0	1	1.3	6.5	0.2	6350
Rnd 2	300	100	10 μl	100 μl	0.8	8	0.3	2.7	0.6
Rnd 3	550	100	10 μl	125 μl	0.6	21	0.2	8	0.1	1900
Rnd 4	500	100	10 μl	125 μl	1.0	33	0.8	10	0.4
Rnd 5	365	100	10 μl	125 μl	1.5	30	1.6	32	0.4	470
Rnd 6	500	50	10 μl	125 μl	1.9	22	0.9	17	0.3
	50	5	10 μl	125 μl	1.1	5	0.4	2.3	1.2	103
Rnd 7	50	5	10 μl	125 μl	1.8	7	0.05	1.8	0.6	31
Rnd 8	50	5	10 μl	125 μl	3.6	7	0.0	<1	0.6
Rnd 9	10	1	10 μl	125 μl	3.3	5	0.1	2	1.2
Rnd 10	1	0.2	10 μl	500 μl	2.5	3	0.0	<1	0.3	0.2-6
Rnd 11	1	0.1	10 μl	500 μl	2.0	2	0.0	<1	5.0
	1	0.1	250 μl	500 μl	1.5	2	0.0	<1	12.0
Rnd 12	1	0.1	10 μl	500 μl	4.1	5	0.2	2	3.2
	1	0.1	250 μl	500 μl	3.1	2	0.2	1	14.0

[0339]

TABLE 25

P-Selectin 2′ NH2 RNA Ligands

SEQ

ID

Ligand Sequence NO.

family 1

PA341(7) gggagacaagaauaaacgcucaaGCCCCAAACGCAAGCGAGCAUCCGCAACAGGGAAGAAGACAGACGAAUGAuucgacaggaggcucaca 251

acaggc

PA350 gggagacaagaauaaacgcucaaGCCCCAAACGCAAGUGAGCAUCCGCAACAGGGAAGAAGACAGACGAUUGAuucgacaggaggcucaca 252

acaggc

PA466 gggagacaagaaauaaacncucaaGCCCCAAACGCAAGUGAGCAUCCGCAACAGGGAAGAAGACAGAUGAAUGAuucgacaggaggcucac 253

aacaggc

PA473 gggagacaagaauaaacncucaaGCCCCAA GCAAGUGAGCAUCCGCAACAGGGAAGAAGACAGACGAGUGAuucgacaggaggcucac 254

aacaggc

PA477(3) gggagacaagaauaaacncucaaGCCCCAAaCGCAAGUG AGCAUCCGCAACAGGGAAGAAGACAGACGAAUGAuucgacaggaggcucac 255

aacaggc

PA328(3) gggagacaagaauaaacgcucaaGCAAAAGGCGUAAAUACACC UCCGCAACUGGGAAGAAGACGCAGGGACGGuucgacaggNggcucac 256

aacaggc

family

2

PA337(6) gggagacaagaauaaacgcucaaACAGCUACAAGUGGGACAACAGGGUACAGCGGAGAGAAACAUCCAAACAAGuucgacaggaggcucac 257

aacaggc

family

3

PA448(7) gggagacaagaauaaacgcucaaAUCAACUAAACAACGCAGUCACGAGAACGACCGGKCUGACUCCGAAAG uucgacaggaggcucac 258

aacaggc

others

PA325 gggagacaagaauaaacgcucaaACGAGAGCACCAAGGCAACAGAUGCAGAAGAAGUGUGCGCGCGCGAAA uucgacaggaggcucac 259

aacaggc

PA327 gggagacaagaauaaacgcucaaUAAGACAACGAACAGACAGAAGCGAAAAAGGGGCGCCGCAGCAACAACAAAuucgacaggaggcucac 260

aacaggc

PA446 gggagacaagaauaaacgcucaaCGUGUACCACAACAGUUCCACG GAAGCUGGAAUAGGACGCAGAGGAA uucgacaggaggcucac 261

aacaggc

PA313 gggagacaagaauaaacgcucaaACAAAAUUWUGGUGGGCCCCGcAACMGGGRGGRAGRCCGUUGAAGGC uucgacaggaggcucac 262

aacaggc

PA336 gggagacaagaauaaacgcucaaGAUCAUAACGAGAGGAGAGGGAGAACUACACGCGCGCGAGGAAAGAG uucgacaggaggcucac 263

aacaggc

PA301 gggagacaagaauaaacgcucaaACACAAAUCGGGCAGGGACUGGGUUGGGCACGGCAGGGCGCC uucgacaggaggcucac 264

aacaggc

PA305 gggagacaagaauaaacgcucaaGUGGGCUCGGGCCGGAUGUCUACGGGUGUGAAGAAACCCCUAGGGCAGGG uucgacaggaggcucac 265

aacaggc

PA309 gggagacaagaauaaacgcucaaGAUCAGCGGAACUAAGAAAUGGAAGGCUAAGCACCGGGAUCGGGAGAA uucgacaggaggcucac 266

aacaggc

PA315 gggagacaagaauaaacgcucaaUAACAAAGCAGCAAAGUACCAGAGGAGAGUUGGCAGGGUUUAGGCAGC uucgacaggaggcucac 267

aacaggc

PA318 gggagaca-gaauaaacgcucaaAGACCAAGGGACAGCAGCGGGGAAAAACAGAUCACAGCUGUAAGAGGGC uucgacaggaggcucac 268

aacaggc

PA319 gggagacaagaauaaacgcucaaAGUCGGGGAUAGAAACACACUAAGAAGUGCAUCAGGUAGGAGAUAA uucgacaggaggcucac 269

aacaggc

PA320 gggagacaagaauaaacgcucaaGAGUAUCACACAAACCGGCACGGACUAAGCAGAAGGAGGUACGGAAGA uucgacaggaggcucac 270

aacaggc

PA321 gggagacaagaauaaacNcucaaCGAAAUAGAAGGAACAGAAGAAUGGBGAWGNGGGAAAUgGCAACGAA uucgacaggaggcucac 271

aacaggc

PA324 gggagacaagaauaaacgcucaaACGAGACCCUGGAUACGAGGCUGAGGGAAAGGGAGMMMRRAMCUARRCKC uucgacaggaggcucac 272

aacaggc

PA329 gggagacaagaauaaacgcucaaGAAGGAUACUUAGGACUACGUGGGAUGGGAUGAAAUGGGAGAACGGGAG uucgacaggaggcucac 273

aacaggc

PA330 gggagacaagaauaaacgcucaaAACGCACAAAGUAAGGGACGGGAUGGAUCGCCCUAGGCUGGAAGGGAAC uucgacaggaggcucac 274

aacaggc

PA332 gggagacaagaauaaacgcucaaGGUGAACGGCAGCAAGGCCCAAAACGUAAGGCCGGAAACNGGAGAGGGA uucgacaggnggcucac 275

aacaggc

PA335 gggagacaagaauaaacgcucaaUGAUAUACACGUAAGCACUGAACCAGGCUGAGAUCCAUCAGUGCCCAGG uucgacaggaggcucac 276

aacaggc

PA336 gggagacaagaauaaacgcucaaGAUCAUAACGAGAGGAGAGGGAGAACUACACGCGCGCGAGGAAAGAG uucgacaggaggcucac 277

aacaggc

PA338 gggagacaagaauaaacgcucaaUCAAGUAAGGAGGAAGGGUCGUGACAGAAAAACGAGCAAAAAACGCGAG uucgacaggaggcucac 278

aacaggc

PA339 gggagacaagaauaaacgcucaaAAGGUGCCGGGUUGGAGGGGUAGCAAGAAAUGGCUAGGGCGCASGA uucgacaggnggcucac 279

aacaggc

PA342 gggagacaagaauaaacgcucaaCCAACGCGCACCCCGCAGCAAACGAAAUUGGGGAGACAGGUGCAAGACAG uucgacaggaggcucac 280

aacaggc

PA349 gggagacaagaauaaackcucaaCAAACAAUAUCGGCGCAGGAAAACGUAGAAACGAAAMGGAGCUGCGYGGA uucgacaggaggcucac 281

aacaggc

PA351 gggagacaagaauaaacgcucaaUGAUAGCACAGUGUAUAAGAAAACGCAACACCGCGCGCGGAAGAG uucgacaggaggcucac 282

aacaggc

PA352 gggagacaagaauaaacgcucaaGAUCAUCGCAGUAUCGGAAUCGACCCUCAGUGGGUGACAUGCGGACAAG uucgacaggaggcucac 283

aacaggc

PA353 gggagacaagaauaaacgcucaaGUACCGGGAAGGGAUGAACUGGGAUAUGGGAACGGAGGUCAGAGGCACGA uucgacaggaggcucac 284

aacaggc

PA354 gggagacaagaauaaacgcucaaGCAAUGGAACGCUAGGAGGGAACAUAAGCAGGGCGAGCGGAGUCGAUAGC uucgacaggaggcucac 285

aacaggc

PA447 gggagacaagaauaaacgcucaaAACAGAACUGAUCGGCGCAGGUUGAUAAAGGGGCAGCGGGAAGAUCACAA uucgacaggaggcucac 286

aacaggc

PA463 gggagacaagaauaaacgcucaaGGGAAACGGAAAGGGACAAGGCGAACAGACGAGAAGUAGACGGAGUAGGA uucgacaggaggcucac 287

aacaggc

PA465 gggagacaagaauaaacgcucaaNNNGAGGAAGGGCACGCAAGGAAACAAAACACAAAGCAGAAGUAGUAAGA uucgacaggaggcucac 288

aacaggc

PA467 gggagacaagaauaaacgcucaaGUACRCAGUGAGCAGAAGCAGAGAGACUUGGGAUGGGAUGAAAUGGKC uucgacaggaggcucac 289

aacaggc

PA479 gggagacaagaauaaacNcucaaCCGACGUGGACDCGCAUCGGCAUCCAGACCAGGCUGNBCNGCACCASACG uucgacaggaggcucac 290

aacaggc

TABLE 26


Dissociation Constants and Specificity of
2′NH2 RNA Ligands to P-Selectin

	Kd	Kd	SLeX	Kd	Kd	SEQ ID
Ligand	(PS-Rg)	(4oC)	(IC50)	(ES-Rg)	(LS-Rg)	NO.

PA 301	2.5	nM					264
PA 305	0.21	pM					265
PA 309	0.656	pM					266
PA 315	5	nM					267
PA 318	2	nM					268
PA 319	11	nM					269
PA 320	4.5	nM					270
PA 321	8	nM					271
PA 325	>10	nM					259
PA 327	13.5	nM					260
PA 328	3	nM					256
PA 329	4	nM					273
PA 330	0.237	nM					274
PA 335	10.5	nM					276
PA 336	15	nM					277
PA 337	4.5	nM					257
PA 338	57	nM					278
PA 339	13.5	nM					279
PA 341	0.44	nM		3 nM			251
PA 342	4	nM					280
PA 350	0.06	nM	0.01 nM	2 nM	375 nM	>3 μM	252
PA 351	2	nM					282
PA 352	6	nM					283
PA 353	9	nM					284
PA 354	5	nM					285
PA 447	50	nM					286
PA 448	5	nM					258
PA 463	8	nM					287
PA 465	>50	nM					288
PA 466	0.43	nM					253
PA 467	24	nM					289
PA 473	0.36	nM					254
PA 477	0.57	nM					255

[0341]
1 390 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 1 GGGAAAAGCG AAUCAUACAC AAGANNNNNN NNNNNNNNNN NNNNNNNNNN 50 NNNNNNNNNN NNNNNNNNNN NNNNGCUCCG CCAGAGACCA ACCGAGAA 98 41 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 2 UAAUACGACU CACUAUAGGG AAAAGCGAAU CAUACACAAG A 41 24 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 3 UUCUCGGUUG GUCUCUGGCG GAGC 24 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 4 GGGAAAAGCG AAUCAUACAC AAGAAUGGUU GGCCUGGGCG CAGGCUUCGA 50 AGACUCGGCG GGAACGGGAA UGGCUCCGCC AGAGACCAAC CGAGAA 96 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 5 GGGAAAAGCG AAUCAUACAC AAGACAGGCA CUGAAAACUC GGCGGGAACG 50 AAAGUAGUGC CGACUCAGAC GCGUGCUCCG CCAGAGACCA ACCGAGAA 98 91 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 6 GGGAAAAGCG AAUCAUACAC AAGAAGUCUG GCCAAAGACU CGGCGGGAAC 50 GUAAAACGGC CAGAAUUGCU CCGCCAGAGA CCAACCGAGA A 91 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 7 GGGAAAAGCG AAUCAUACAC AAGAGUAGGA GGUUCCAUCA CCAGGACUCG 50 GCGGGAACGG AAGGUGAUGS GCUCCGCCAG AGACCAACCG AGAA 94 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 8 GGGAAAAGCG AAUCAUACAC AAGAACAAGG AUCGAUGGCG AGCCGGGGAG 50 GGCUCGGCGG GAACGAAAUC UGCUCCGCCA GAGACCAACC GAGAA 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 9 GGGAAAAGCG AAUCAUACAC AAGAUUGGGC AGGCAGAGCG AGACCGGGGG 50 CUCGGCGGGA ACGGAACAGG AAUGCUCCGC CAGAGACCAA CCGAGAA 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 10 GGGAAAAGCG AAUCAUACAC AAGAAAGGGA UGGGAUUGGG ACGAGCGGCC 50 AAGACUCGGC GGGAACGAAG GGUGCUCCGC CAGAGACCAA CCGAGAA 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 11 GGGAAAAGCG AAUCAUACAC AAGACUCGGC GGGAACGAAA GUGUCAUGGU 50 AGCAAGUCCA AUGGUGGACU CUGCUCCGCC AGAGACCAAC CGAGAA 96 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 12 GGGAAAAGCG AAUCAUACAC AAGACUCGGC GGGAACGUGA AGUGGGUAGG 50 UAGCUGAAGA CGGUCUGGGC GCCAGCUCCG CCAGAGACCA ACCGAGAA 98 99 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 13 GGGAAAAGCG AAUCAUACAC AAGAAAGGGA UGGGAUUGGG ACGAGCGGCC 50 AAGACUCGGC GGGAACGAAG GGUCCGCUCC GCCAGAGACC AACCGAGAA 99 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 14 GGGAAAAGCG AAUCAUACAC AAGACUCGGC GGGAACGAAG UGUGUGAGUA 50 ACGAUCACUU GGUACUAAAA GCCCGCUCCG CCAGAGACCA ACCGAGAA 98 100 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 15 GGGAAAAGCG AAUCAUACAC AAGACUCGGC GGGAAUCGAA AGUGUACUGA 50 AUUAGAACGG UGGGCCUGCU CAUCGUGCUC CGCCAGAGAC CAACCGAGAA 100 103 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 16 GGGAAAAGCG AAUCAUACAC AAGACUCGGC GGGAAUCGUA AUGUGGAUGA 50 UAGCACGAUG GCAGYAGUAG UCGGACCGCG CUCCGCCAGA GACCAACCGA 100 GAA 103 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 17 GGGAAAAGCG AAUCAUACAC AAGACAGCGG CGGAGUCAGU GAAAGCGUGG 50 GGGGYGCGGG AGGUCUACCC UGACGCUCCG CCAGAGACCA ACCGAGAA 98 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 18 GGGAAAAGCG AAUCAUACAC AAGACGGCUG UGUGUGGUAG CGUCAUAGUA 50 GGAGUCGUCA CGAACCAAGG CGCUCCGCCA GAGACCAACC GAGAA 95 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 19 GGGAAAAGCG AAUCAUACAC AAGACGGCUG UGUGGUGUUG GAGCGUCAUA 50 GUAGGAGUCG UCACGAACCA AGGCGCUCCG CCAGAGACCA ACCGAGAA 98 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 20 GGGAAAAGCG AAUCAUACAC AAGACGAUGC GAGGCAAGAA AUGGAGUCGU 50 UACGAACCCU CUUGCAGUGC GCGGCUCCGC CAGAGACCAA CCGAGAA 97 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 21 GGGAAAAGCG AAUCAUACAC AAGACGUGCG GAGCAAAUAG GGGAUCAUGG 50 AGUCGUACGA ACCGUUAUCG CGCUCCGCCA GAGACCAACC GAGAA 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 22 GGGAAAAGCG AAUCAUACAC AAGACUGGGG AGCAGGAUAU GAGAUGUGCG 50 GGGCAAUGGA GUCGUGACGA ACCGCUCCGC CAGAGACCAA CCGAGAA 97 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 23 GGGAAAAGCG AAUCAUACAC AAGAGUCCGC CCCCAGGGAU GCAACGGGGU 50 GGCUCUAAAA GGCUUGGCUA AGCUCCGCCA GAGACCAACC GAGAA 95 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 24 GGGAAAAGCG AAUCAUACAC AAGAGAGAAU GAGCAUGGCC GGGGCAGGAA 50 GUGGGUGGCA ACGGAGGCCA GCUCCGCCAG AGACCAACCG AGAA 94 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 25 GGGAAAAGCG AAUCAUACAC AAGAGAUACA GCGCGGGUCU AAAGACCUUG 50 CCCCUAGGAU GCAACGGGGU GGCUCCGCCA GAGACCAACC GAGAA 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 26 GGGAAAAGCG AAUCAUACAC AAGAUGAAGG GUGGUAAGAG AGAGUCUGAG 50 CUCGUCCUAG GGAUGCAACG GCAGCUCCGC CAGAGACCAA CCGAGAA 97 99 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 27 GGGAAAAGCG AAUCAUACAC AAGACAAACC UGCAGUCGCG CGGUGAAACC 50 UAGGGUUGCA ACGGUACAUC GCUGUGCUCC GCCAGAGACC AACCGAGAA 99 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 28 GGGAAAAGCG AAUCAUACAC AAGAGUGGAC UGGAAUCUUC GAGGACAGGA 50 ACGUUCCUAG GGAUGCAACG GACGCUCCGC CAGAGACCAA CCGAGAA 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 29 GGGAAAAGCG AAUCAUACAC AAGAGUGUAC CAAUGGAGGC AAUGCUGCGG 50 GAAUGGAGGC CUAGGGAUGC AACGCUCCGC CAGAGACCAA CCGAGAA 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 30 GGGAAAAGCG AAUCAUACAC AAGAGUCCCU AGGGAUGCAA CGGGCAGCAU 50 UCGCAUAGGA GUAAUCGGAG GUCGCUCCGC CAGAGACCAA CCGAGAA 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 31 GGGAAAAGCG AAUCAUACAC AAGAGCCUAG GGAUGCAACG GCGAAUGGAU 50 AGCGAUGUCG UGGACAGCCA GGUGCUCCGC CAGAGACCAA CCGAGAA 97 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 32 GGGAAAAGCG AAUCAUACAC AAGAAUCGAA CCUAGGGAUG CAACGGUGAA 50 GGUUGUGAGG AUUCGCCAUU AGGCGCUCCG CCAGAGACCA ACCGAGAA 98 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 33 GGGAAAAGCG AAUCAUACAC AAGAGCUAGG GAUGCCGCAG AAUGGUCGCG 50 GAUGUAAUAG GUGAAGAUUG UUGCGCUCCG CCAGAGACCA ACCGAGAA 98 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 34 GGGAAAAGCG AAUCAUACAC AAGAGGACCU AGGGAUGCAA CGGUCCGACC 50 UUGAUGCGCG GGUGUCCAAG CUACGCUCCG CCAGAGACCA ACCGAGAA 98 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 35 GGGAAAAGCG AAUCAUACAC AAGAAAGGGA GGAGCUAGAG AGGGAAAGGU 50 UACUACGCGC CAGAAUAGGA UGUGCUCCGC CAGAGACCAA CCGAGAA 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 36 GGGAAAAGCG AAUCAUACAC AAGACCAACG UACAUCGCGA GCUGGUGGAG 50 AGUUCAUGAG GGUGUUACGG GGUGCUCCGC CAGAGACCAA CCGAGAA 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 37 GGGAAAAGCG AAUCAUACAC AAGACCCAAC GUGUCAUCGC GAGCUGGCGG 50 AGAGUUCAUG AGGGUUACGG GUGCUCCGCC AGAGACCAAC CGAGAA 96 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 38 GGGAAAAGCG AAUCAUACAC AAGAGUUGGU GCGAGCUGGG GCGGCGAGAA 50 GGUAGGCGGU CCGAGUGUUC GAAUGCUCCG CCAGAGACCA ACCGAGAA 98 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 39 GGGAAAAGCG AAUCAUACAC AAGACUGGCA AGRAGUGCGU GAGGGUACGU 50 UAGGGGUGUU UGGGCCGAUC GCAUGCUCCG CCAGAGACCA ACCGAGAA 98 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 40 GGGAAAAGCG AAUCAUACAC AAGAUUGGUC GUACUGGACA GAGCCGUGGU 50 AGAGGGAUUG GGACAAAGUG UCAGCUCCGC CAGAGACCAA CCGAGAA 97 99 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 41 GGGAAAAGCG AAUCAUACAC AAGAUGUGAG AAAGUGGCCA ACUUUAGGAC 50 GUCGGUGGAC UGYGCGGGUA GGCUCGCUCC GCCAGAGACC AACCGAGAA 99 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 42 GGGAAAAGCG AAUCAUACAC AAGACAGGCA GAUGUGUCUG AGUUCGUCGG 50 AGUAGACGUC GGUGGACGCG GAACGCUCCG CCAGAGACCA ACCGAGAA 98 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 43 GGGAAAAGCG AAUCAUACAC AAGAUGUGAU UAGGCAGUUG CAGCCGCCGU 50 GCGGAGACGU GACUCGAGGA UUCGCUCCGC CAGAGACCAA CCGAGAA 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 44 GGGAAAAGCG AAUCAUACAC AAGAUGCCGG UGGAAAGGCG GGUAGGUGAC 50 CCGAGGAUUC CUACCAAGCC AUGCUCCGCC AGAGACCAAC CGAGAA 96 93 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 45 GGGAAAAGCG AAUCAUACAC AAGAGAGGUG RAUGGGAGAG UGGAGCCCGG 50 GUGACUCGAG GAUUCCCGUG CUCCGCCAGA GACCAACCGA GAA 93 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 46 GGGAAAAGCG AAUCAUACAC AAGAGUCAUG CUGUGGCUGA ACAUACUGGU 50 GAAAGUUCAG UAGGGUGGAU ACAGCUCCGC CAGAGACCAA CCGAGAA 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 47 GGGAAAAGCG AAUCAUACAC AAGACCGGGG AUGGUGAGUC GGGCAGUGUG 50 ACCGAACUGG UGCCCGCUGA GAGCUCCGCC AGAGACCAAC CGAGAA 96 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 48 GGGAAAAGCG AAUCAUACAC AAGAACACUA ACCAGGUCUC UGAACGCGGG 50 ACGGAGGUGU GGGCGAGGUG GAAGCUCCGC CAGAGACCAA CCGAGAA 97 99 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 49 GGGAAAAGCG AAUCAUACAC AAGACCGUCU CCCGAGAACC AGGCAGAGGA 50 CGUGCUGAAG GAGCUGCAUC UAGAAGCUCC GCCAGAGACC AACCGAGAA 99 99 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 50 GGGAAAAGCG AAUCAUACAC AAGACCGUCU CCGAGAACCA GGCAGAGGAG 50 GUGCUGAAGG RGCUGGCAUC UACAAGCUCC GCCAGAGACC AACCGAGAA 99 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 51 GGGAAAAGCG AAUCAUACAC AAGACCCGCA CAUAAUGUAG GGAACAAUGU 50 UAUGGCGGAA UUGAUAACCG GUGCUCCGCC AGAGACCAAC CGAGAA 96 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 52 GGGAAAAGCG AAUCAUACAC AAGACGAUGU UAGCGCCUCC GGGAGAGGUU 50 AGGGUCGUGC GGNAAGAGUG AGGUGCUCCG CCAGAGACCA ACCGAGAA 98 99 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 53 GGGAAAAGCG AAUCAUACAC AAGAGGUACG GGCGAGACGA GAUGGACUUA 50 UAGGUCGAUG AACGGGUAGC AGCUCGCUCC GCCAGAGACC AACCGAGAA 99 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 54 GGGAAAAGCG AAUCAUACAC AAGACGGUUG CUGAACAGAA CGUGAGUCUU 50 GGUGAGUCGC ACAGAUUGUC CUGCUCCGCC AGAGACCAAC CGAGAA 96 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 55 GGGAAAAGCG AAUCAUACAC AAGAACUGAG UAAGGUCUGG CGUGGCAUUA 50 GGUUAGUGGG AGGCUUGGAG UAGGCUCCGC CAGAGACCAA CCGAGAA 97 20 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 56 AAGACUCGGC GGGAACGAAA 20 16 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 57 GGAGUCGUGA CGAACC 16 16 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 58 CCUAGGGAUG CAACGG 16 18 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 59 RCUGGGAGRG UGGGUGUU 18 42 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 60 UGUGNNNNAG UNNNNNNNNN UAGACGUCGG UGGACNNNGC GG 42 21 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 61 GGGNNNGUGA CYCGRGGAYU C 21 23 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 62 UGANCNNACU GGUGNNNGNG NAG 23 32 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 63 GUCUCYGAAC NNGGNAGGAN GUGNUGGAGN UG 32 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 64 GGGAGGACGA UGCGGNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 50 NNNNNCAGAC GACUCGCCCG A 71 32 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 65 TAATACGACT CACTATAGGG AGGACGATGC GG 32 17 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 66 TCGGGCGAGT CGTCCTG 17 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 67 GGGAGGACGA UGCGGCGCGU AUGUGUGAAA GCGUGUGCAC GGAGGCGUCU 50 ACAAUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 68 GGGAGGACGA UGCGGGGCAU UGUGUGAAUA GCUGAUCCCA CAGGUAACAA 50 CAGCACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 69 GGGAGGACGA UGCGGUAAUG UGUGAAUCAA GCAGUCUGAA UAGAUUAGAC 50 AAAAUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 70 GGGAGGACGA UGCGGAUGUG UGAGUAGCUG AGCGCCCGAG UAUGAWACCU 50 GACUACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 71 GGGAGGACGA UGCGGAAACC UUGAUGUGUG AUAGAGCAUC CCCCAGGCGA 50 CGUACCAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 72 GGGAGGACGA UGCGGUUGAG AUGUGUGAGU ACAAGCUCAA AAUCCCGUUG 50 GAGGCAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 73 GGGAGGACGA UGCGGUAGAG GUAGUAUGUG UGGGAGAUGA AAAUACUGUG 50 GAAAGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 74 GGGAGGACGA UGCGGAAAGU UAUGAGUCCG UAUAUCAAGG UCGACAUGUG 50 UGAAUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 75 GGGAGGACGA UGCGGCACGA AAAACCCGAA UUGGGUCGCC CAUAAGGAUG 50 UGUGACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 76 GGGAGGACGA UGCGGGUAAA GAGAUCCUAA UGGCUCGCUA GAUGUGAUGU 50 GAAACCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 77 GGGAGGACGA UGCGGUAACA ACAAUCAAGG CGGGUUCACC GCCCCAGUAU 50 GAGUGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 78 GGGAGGACGA UGCGGUAACA ACAAUCAAGG CGGGUUYACC GCCCCAGUAU 50 GAGUACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 79 GGGAGGACGA UGCGGUAACA ACAAUCAAGG CGGGUUYACC GCUCCAGUAU 50 GAGUACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 80 GGGAGGACGA UGCGGUAACA ACAAUCAAGG CGGGUUCACC GCCCCAGUAU 50 GAGUGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 81 GGGAGGACGA UGCGGACCAA GCAAUCUAUG GUCGAACGCU ACACAUGAAU 50 GACGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 82 GGGAGGACGA UGCGGGAACA UGAAGUAAUC AAAGUCGUAC CAAUAUACAG 50 GAAGCCAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 83 GGGAGGACGA UGCGGGACAU GAAGUAAGAC CGUCACAAUU CGAAUGAUUG 50 AAUACAGACG ACUCGCCCGA 70 72 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 84 GGGAGGACGA UGCGGGAACA UGAAGUAAAA AGUCGACGAA UUAGCUGUAA 50 CCAAAACAGA CGACUCGCCC GA 72 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 85 GGGAGGACGA UGCGGGAACA UGAAGUAAAA GUCUGAGUUA GUAAAUUACA 50 GUGAUCAGAC GACUCGCCCG A 71 72 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 86 GGGAGGACGA UGCGGGAACU UGAAGUUGAA NUCGCUAAGG UUAUGGAUUC 50 AAGAUUCAGA CGACUCGCCC GA 72 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 87 GGGAGGACGA UGCGGAACAU GAAGUAAUAA GUCGACGUAA UUAGCUGUAA 50 CUAAACAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 88 GGGAGGACGA UGCGGAACAU GAAGUAAAAG UCUGAGUUAG AAAUUACAAG 50 UGAUCAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 89 GGGAGGACGA UGCGGUAACA UAAAGUAGCG CGUCUGUGAG AGGAAGUGCC 50 UGGAUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 90 GGGAGGACGA UGCGGAUAGA ACCGCAAGGA UAACCUCGAC CGUGGUCAAC 50 UGAGACAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 91 GGGAGGACGA UGCGGUAAGA ACCGCUAGCG CACGAUCAAA CAAAGAGAAA 50 CAAACAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 92 GGGAGGACGA UGCGGUUCUC UCCAAGAACY GAGCGAAUAA ACSACCGGAS 50 UCACACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 93 GGGAGGACGA UGCGGUGUCU CUCCUGACUU UUAUUCUUAG UUCGAGCUGU 50 CCUGGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 94 GGGAGGACGA UGCGGCCGUA CAUGGUAARC CUCGAAGGAU UCCCGGGAUG 50 AUCCCCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 95 GGGAGGACGA UGCGGUCCCA GAGUCCCGUG AUGCGAAGAA UCCAUUAGUA 50 CCAGACAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 96 GGGAGGACGA UGCGGGAUGU AAAUGACAAA UGAACCUCGA AAGAUUGCAC 50 ACUCCAGACG ACUCGCCCGA 70 72 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 97 GGGAGGACGA UGCGGAUGUA AAUCUAGGCA GAAACGUAGG GCAUCCACCG 50 CAACGACAGA CGACUCGCCC GA 72 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 98 GGGAGGACGA UGCGGAUAAC CCAAGCAGCN UCGAGAAAGA GCUCCAUAGA 50 UGAUCAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 99 GGGAGGACGA UGCGGCAAAG CACGCGUAUG GCAUGAAACU GGCANCCCAA 50 GUAAGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 100 GGGAGGACGA UGCGGCAAAA GGUUGACGUA GCGAAGCUCU CAAAAUGGUC 50 AUGACCAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 101 GGGAGGACGA UGCGGAAGUG AAGCUAAAGC GGAGGGCCAU UCAGUUUCNC 50 ACCACAGACG ACUCGCCCGA 70 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 102 GGGAGGACGA UGCGGAAGUG AAGCUAAAGS GGAGGGCCAC UCAGAAACGC 50 ACCACAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 103 GGGAGGACGA UGCGGCACCG CUAAGCAGUG GCAUAGCCCA GUAACCUGUA 50 AGAGACAGAC GACUCGCCCG A 71 67 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 104 GGGAGGACGA UGCGGCACGC UAAGCAGUGG CAUAGCGWAA CCUGUAAGAG 50 ACAGACGACU CGCCCGA 67 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 105 GGGAGGACGA UGCGGAGAUU ACCAUAACCG CGUAGUCGAA GACAUAUAGU 50 AGCGACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 106 GGGAGGACGA UGCGGACUCG GGUAGAACGC GACUUGCCAC CACUCCCAUA 50 AAGACCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 107 GGGAGGACGA UGCGGUCAGA ACUCUGCCGC UGUAGACAAA GAGGAGCUUA 50 GCGAACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 108 GGGAGGACGA UGCGGAAUGA GCAUCGAGAG AGCGCGAACU CAUCGAGCGU 50 ACUAACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 109 GGGAGGACGA UGCGGCAAAG CACGCGUAUG GCAUGAAACU GGCANCCCAA 50 GUAAGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 110 GGGAGGACGA UGCGGGAUGC AGCAACCUGA AAACGGCGUC CACAGGUAAU 50 AACAGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 111 GGGAGGACGA UGCGGAAACU CGCUACAAAC ACCCAAUCCU AGAACGUUAU 50 GGAGACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 112 GGGAGGACGA UGCGGCUAGC AUAGCCACCG GAACAGACAG AUACGAGCAC 50 GAUCACAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 113 GGGAGGACGA UGCGGGAUUC GGAGUACUGA AAAACAACCC UCAAAAGUGC 50 AUAGGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 114 GGGAGGACGA UGCGGGUCCA GGACGGACCG CAGCUGUGAU ACAAUCGACU 50 UACACCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 115 GGGAGGACGA UGCGGAAACU CGCUACAAAC ACCCAAUCCU AGAACGUUAU 50 GGAGACAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 116 GGGAGGACGA UGCGGCGGCC CUUAUCGGAG GUCUGCGCCA CUAAUUACAU 50 CCACCAGACG ACUCGCCCGA 70 67 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 117 GGGAGGACGA UGCGGUCCAG AGCGUGAAGA UCAACGUCCC GGNGUCGAAG 50 ACAGACGACU CGCCCGA 67 8 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 118 AUGUGUGA 8 15 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 119 CAACAAUCAU GAGUR 15 21 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 120 AACAUGAAGU AAGUCARUUA G 21 11 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 121 AGAACCGCWA G 11 7 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 122 UCUCUCC 7 10 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 123 CGAAGAAUYC 10 8 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 124 AUGUAAAU 8 8 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 125 AACCCAAG 8 80 base pairs nucleic acid single linear DNA 126 CTACCTACGA TCTGACTAGC NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 50 NNNNNNNNNN GCTTACTCTC ATGTAGTTCC 80 20 base pairs nucleic acid single linear DNA 127 CTACCTACGA TCTGACTAGC 20 25 base pairs nucleic acid single linear DNA N AT POSITION 2 AND 4 IS BIOTIN 128 ANANAGGAAC TACATGAGAG TAAGC 25 80 base pairs nucleic acid single linear DNA 129 CTACCTACGA TCTGACTAGC GGAACACGTG AGGTTTACAA GGCACTCGAC 50 GTAAACACTT GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 130 CTACCTACGA TCTGACTAGC CCCCGAAGAA CATTTTACAA GGTGCTAAAC 50 GTAAAATCAG GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 131 CTACCTACGA TCTGACTAGC GGCATCCCTG AGTCATTACA AGGTTCTTAA 50 CGTAATGTAC GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 132 CTACCTACGA TCTGACTAGC TGCACACCTG AGGGTTACAA GGCGCTAGAC 50 GTAACCTCTC GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 133 CTACCTACGA TCTGACTAGC CACGTTTCAA GGGGTTACAC GAAACGATTC 50 ACTCCTTGGC GCTTACTCTC ATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 134 CTACCTACGA TCTGACTAGC CGGACATGAG CGTTACAAGG TGCTAAACGT 50 AACGTACTTG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 135 CTACCTACGA TCTGACTAGC CGCATCCACA TAGTTCAAGG GGCTACACGA 50 AATATTGCAG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 136 CTACCTACGA TCTGACTAGC TACCCCTTGG GCCTCATAGA CAAGGTCTTA 50 AACGTTAGCG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 137 CTACCTACGA TCTGACTAGC CACATGCCTG ACGCGGTACA AGGCCTGGAC 50 GTAACGTTGG CTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 138 CTACCTACGA TCTGACTAGC TAGTGCTCCA CGTATTCAAG GTGCTAAACG 50 AAGACGGCCT GCTTACTCTC ATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 139 CTACCTACGA TCTGACTAGC AGCGATGCAA GGGGCTACAC GCAACGATTT 50 AGATGCTCTG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 140 CTACCTACGA TCTGACTAGC CCAGGAGCAC AGTACAAGGT GTTAAACGTA 50 ATGTCTGGTG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 141 CTACCTACGA TCTGACTAGC ACCACACCTG GGCGGTACAA GGAGTTATCC 50 GTAACGTGTG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 142 CTACCTACGA TCTGACTAGC CAAGGTAACC AGTACAAGGT GCTAAACGTA 50 ATGGCTTCGG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 143 CTACCTACGA TCTGACTAGC ACCCCCGACC CGAGTACAAG GCATTCGACG 50 TAATCTGGTG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 144 CTACCTACGA TCTGACTAGC CAGTACAAGG TGTTAAACGT AATGCCGATC 50 GAGTTGTATG CTTACTCTCA TGTAGTTCC 79 81 base pairs nucleic acid single linear DNA 145 CTACCTACGA TCTGACTAGC ACAACGAGTA CAAGGAGATA GACGTAATCG 50 GCGCAGGTAT CGCTTACTCT CATGTAGTTC C 81 79 base pairs nucleic acid single linear DNA 146 CTACCTACGA TCTGACTAGC CACGACAGAG AACAAGGCGT TAGACGTTAT 50 CCGACCACGG CTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 147 CTACCTACGA TCTGACTAGC AGGGAGAACA AGGTGCTAAA CGTTTATCTA 50 CACTTCACCT GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 148 CTACCTACGA TCTGACTAGC AGGACCAAGG TGTTAAACGG CTCCCCTGGC 50 TATGCCTCTT GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 149 CTACCTACGA TCTGACTAGC TACACAAGGT GCTAAACGTA GAGCCAGATC 50 GGATCTGAGC GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 150 CTACCTACGA TCTGACTAGC GGACAAGGCA CTCGACGTAG TTTATAACTC 50 CCTCCGGGCC GCTTACTCTC ATGTAGTTCC 80 81 base pairs nucleic acid single linear DNA 151 CTACCTACGA TCTGACTAGC TACACAAGGG GCCAAACGGA GAGCCAGACG 50 CGGATCTGAC AGCTTACTCT CATGTAGTTC C 81 79 base pairs nucleic acid single linear DNA 152 CTACCTACGA TCTGACTAGC CGGCTATACN NGGTGCTAAA CGCAGAGACT 50 CGATCAACAG CTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 153 CTACCTACGA TCTGACTAGC GAGTAGCCAA GGCGTTAGAC GGAGGGGGAA 50 TGGAAGCTTG GCTTACTCTC ATGTAGTTCC 80 73 base pairs nucleic acid single linear DNA 154 CTACCTACGA TCTGACTAGC GAGTAGCCAA GGCGTTAGAC GGAGGGGGAA 50 TGGGCTTACT CTCATGTAGT TCC 73 80 base pairs nucleic acid single linear DNA 155 CTACCTACGA TCTGACTAGC GAGTAGCCAA GGCGTTAGAC GGAGGGGGAA 50 TGTGAGCACA GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 156 CTACCTACGA TCTGACTAGC TAGCTCCACA CACAASSCGC RGCACATAGG 50 GGATATCTGG GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 157 CTACCTACGA TCTGACTAGC CATCAAGGAC TTTGCCCGAA ACCCTAGGTT 50 CACGTGTGGG GCTTACTCTC ATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 158 CTACCTACGA TCTGACTAGC CATTCACCAT GGCCCCTTCC TACGTATGTT 50 CTGCGGGTGG CTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 159 CTACCTACGA TCTGACTAGC GCAACGTGGC CCCGTTTAGC TCATTTGACC 50 GTTCCATCCG GCTTACTCTC ATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 160 CTACCTACGA TCTGACTAGC CCACAGACAA TCGCAGTCCC CGTGTAGCTC 50 TGGGTGTCTG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 161 CTACCTACGA TCTGACTAGC CCACCGTGAT GCACGATACA TGAGGGTGTG 50 TCAGCGCATG CTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 162 CTACCTACGA TCTGACTAGC CGAGGTAGTC GTTATAGGGT RCRCACGACA 50 CAAARCRGTR GCTTACTCTC ATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 163 CTACCTACGA TCTGACTAGC TGGCGGTACG GGCCGTGCAC CCACTTACCT 50 GGGAAGTGAG CTTACTCTCA TGTAGTTCC 79 81 base pairs nucleic acid single linear DNA 164 CTACCTACGA TCTGACTAGC CTCTGCTTAC CTCATGTAGT TCCAAGCTTG 50 GCGTAATCAT GGCTTACTCT CATGTAGTTC C 81 79 base pairs nucleic acid single linear DNA 165 CTACCTACGA TCTGACTAGC AGCGTTGTAC GGGGTTACAC ACAACGATTT 50 AGATGCTCTG CTTACTCTCA TGTAGTTCC 79 81 base pairs nucleic acid single linear DNA 166 CTACCTACGA TCTGACTAGC TGATGCGACT TTAGTCGAAC GTTACTGGGG 50 CTCAGAGGAC AGCTTACTCT CATGTAGTTC C 81 81 base pairs nucleic acid single linear DNA 167 CTACCTACGA TCTGACTAGC CGAGGATCTG ATACTTATTG AACATAMCCG 50 CACNCAGGCT TGCTTACTCT CATGTAGTTC C 81 73 base pairs nucleic acid single linear DNA 168 CTACCTACGA TCTGACTAGC CGATCGTGTG TCATGCTACC TACGATCTGA 50 CTAGCTTACT CTCATGTAGT TCC 73 80 base pairs nucleic acid single linear DNA 169 CTACCTACGA TCTGACTAGC GCACACAAGT CAAGCATGCG ACCTTCAACC 50 ATCGACCCGA GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 170 CTACCTACGA TCTGACTAGC ATGCCAGTGC AGGCTTCCAT CCATCAGTCT 50 GACANNNNNN GCTTACTCT CATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 171 CTACCTACGA TCTGACTAGC CACTTCGGCT CTACTCCACC TCGGTCCTCC 50 ACTCCACAG GCTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 172 CTACCTACGA TCTGACTAGC CGCTAACTGA CCCTCGATCC CCCCAAGCCA 50 TCCTCATCGC GCTTACTCTC ATGTAGTTCC 80 90 base pairs nucleic acid single linear DNA 173 CTACCTACGA TCTGACTAGC ATCTGACTAG CTCGGCGAGA GTACCCGCTC 50 ATGGCTTCGG CGAATGCCCT GCTTACTCTC ATGTAGTTCC 90 80 base pairs nucleic acid single linear DNA 174 CTACCTACGA TCTGACTAGC TCCTGAGACG TTACAATAGG CTGCGGTACT 50 GCAACGTGGA GCTTACTCTC ATGTAGTTCC 80 79 base pairs nucleic acid single linear DNA 175 CTACCTACGA TCTGACTAGC CGGCAGGGCA CTAACAAGGT GTTAAACGTT 50 ACGGATGCCG CTTACTCTCA TGTAGTTCC 79 90 base pairs nucleic acid single linear DNA 176 CTACCTACGA TCTGACTAGC TGCACACCGG CCCACCCGGA CAAGGCGCTA 50 GACGAAATGA CTCTGTTCTG GCTTACTCTC ATGTAGTTCC 90 79 base pairs nucleic acid single linear DNA 177 CTACCTACGA TCTGACTAGC GACGAAGAGG CCAAGGTGAT AACCGGAGTT 50 TCCGTCCGCG CTTACTCTCA TGTAGTTCC 79 79 base pairs nucleic acid single linear DNA 178 CTACCTACGA TCTGACTAGC AAGGACTTAG CTATCCAAGG CACTCGACGA 50 AGAGCCCGAG CTTACTCTCA TGTAGTTCC 79 80 base pairs nucleic acid single linear DNA 179 CTACCTACGA TCTGACTAGC ATGCCCAGTT CAAGGTTCTG ACCGAAATGA 50 CTCTGTTCTG GCTTACTCTC ATGTAGTTCC 80 80 base pairs nucleic acid single linear DNA 180 CTACCTACGA TCTGACTAGC GCAGCGTGGC CCTGTTTAGC TCATTTGACC 50 GTTCCATCCG GCTTACTCTC ATGTAGTTCC 80 18 base pairs nucleic acid single linear DNA 181 TACAAGGYGY TAVACGTA 18 8 base pairs nucleic acid single linear DNA 182 GGCCCCGT 8 10 base pairs nucleic acid single linear DNA 183 RCACGAYACA 10 7 base pairs nucleic acid single linear DNA 184 CTTACCT 7 49 base pairs nucleic acid single linear DNA 185 TAGCCAAGGT AACCAGTACA AGGTGCTAAA CGTAATGGCT TCGGCTTAC 49 41 base pairs nucleic acid single linear DNA 186 GTAACCAGTA CAAGGTGCTA AACGTAATGG CTTCGGCTTA C 41 26 base pairs nucleic acid single linear DNA 187 CCAGTACAAG GTGCTAAACG TAATGG 26 38 base pairs nucleic acid single linear DNA 188 CGCGGTAACC AGTACAAGGT GCTAAACGTA ATGGCGCG 38 36 base pairs nucleic acid single linear DNA 189 GCGGTAACCA GTACAAGGTG CTAAACGTAA TGGCGC 36 50 base pairs nucleic acid single linear DNA 190 ACATGAGCGT TACAAGGTGC TAAACGTAAC GTACTTGCTT ACTCTCATGT 50 44 base pairs nucleic acid single linear DNA 191 CGCGCGTTAC AAGGTGCTAA ACGTAACGTA CTTGCTTACT CGCG 44 26 base pairs nucleic acid single linear DNA 192 GCGTTACAAG GTGCTAAACG TAACGT 26 52 base pairs nucleic acid single linear <Unknown> N at position 1 is an amino modifier C6 dT Nucleotide 51 is an inverted- orientation (3′3′ linkage) phosphoramidite 193 NTAGCCAAGG TAACCAGTAC AAGGTGCTAA ACGTAATGGC TTCGGCTTAC 50 TT 52 48 base pairs nucleic acid single linear DNA 194 TAGCCATTCA CCATGGCCCC TTCCTACGTA TGTTCTGCGG GTGGCTTA 48 47 base pairs nucleic acid single linear DNA 195 AGCTGGCGGT ACGGGCCGTG CACCCACTTA CCTGGGAAGT GAGCTTA 47 29 base pairs nucleic acid single linear DNA N at position 1 is an amimo modifier C6 dT Nucleotide number 28 is an inverted-orientation (3′3′ linkage) phosphoramidite 196 NCCAGTACAA GGTGCTAAAC GTAATGGTT 29 40 base pairs nucleic acid single linear DNA 197 TAATACGACT CACTATAGGG AGACAAGAAT AAACGCTCAA 40 24 base pairs nucleic acid single linear DNA 198 GCCTGTTGTG AGCCTCCTGT CGAA 24 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 199 GGGAGACAAG AAUAAACGCU CAACGAAUCA GUAAACAUAA CACCAUGAAA 50 CAUAAAUAGC ACGCGAGACG UCUUCGACAG GAGGCUCACA ACAGGC 96 95 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 200 GGGAGACAAG AAUAAACGCU CAACGAGUUC ACAUGGGAGC AAUCUCCGAA 50 UAAACAACAC GCKAKCGCAA AUUCGACAGG AGGCUCACAA CAGGC 95 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 201 GGGAGACAAG AAUAAACGCU CAACGACCAC AAUACAAACU CGUAUGGAAC 50 ACGCGAGCGA CAGUGACGCA UUUUCGACAG GAGGCUCACA ACAGGC 96 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 202 GGGAGACAAG AAUAAACGCU CAACGUCAAG CCAGAAUCCG GAACACGCGA 50 GAAAACAAAU CAACGACCAA UCGAUUCGAC AGGAGGCUCA CAAAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 203 GGGAGACAAG AAUAAACNCU CAACGACCAC AAUAACCGGA AAUCCCCGCG 50 GUUACGGAAC ACGCGAACAU GAAUUCGACA GGAGGCUCAC AACAGGC 97 95 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 204 GGGAGACAAG AAUAAACGCU CAACGAACCA CGGGGAAAUC CACCAGUAAC 50 ACGCGAGGCA AACAGACCCU CUUCGACAGG AGGCUCACAA CAGGC 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 205 GGGAGACAAG AAUAAACGCU CAACGAGCAA AAGUACUCAC GGGACCAGGA 50 GAUCAGCAAC ACGCGAGACG AAAUUCGACA GGAGGCUCAC AACAGGC 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 206 GGGAGACAAG AAUAAACGCU CAACGAGCCA GGAACAUCGA CGUCAGCAAA 50 CGCGAGCGCA ACCAGUAACA CCUUCGACAG GAGGCUCACA ACAGGC 96 94 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 207 GGGAGACAAG AAUAAACGCU CAACGCACCA GGAACAACGA GAACCAUCAG 50 UAAACGCGAG CGAUUGCAUG UUCGACAGGA GGCUCACAAC AGGC 94 94 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 208 GGGAGACAAG AAUAAACGCU CAACGCACCA GGAACAACAA GAACCAUCAG 50 UAAGCGCGAG CGAUUGCAUA UUCGACAGGA GGCUCACAAC AGGC 94 101 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 209 GGGAGACAAG AAUAAACGCU CAACGAGCAA GGAACGAAUA CAAACCAGGA 50 AACUCAGCAA CACGCGAGCA GUAAGAAUUC GACAGGAGGC UCACAACAGG 100 C 101 97 base pairs nucleic acid single linear <Unknown> All C′s are 2′-F cytosine All U′s are 2′-F uracil 210 GGGAGACAAG AAUAAACGCU CAACAGUUCA CUCAACCGGC ACCAGACUAC 50 GAUCAGCAUU GGCGAGUGAA CACUUCGACA GGAGGCUCAC AACAGGC 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 211 GGGAGACAAG AAUAAACGCU CAACUGGCAA CGGGAUAACA ACAAAUGUCA 50 CCAGCACUAG CGAGACGGAA GGUUCGACAG GAGGCUCACA ACAGGC 96 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 212 GGGAGACAAG AAUAAACGCU CAACGAUGAG CGUGACCGAA GCUAUAAUCA 50 GGUCGAUUCA CCAAGCAAUC UUAUUCGACA GGAGGCUCAC AACAGGC 97 95 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 213 GGGAGACAAG AAUAAACGCU CAAAGGAUCA CACAAACAUC GGUCAAUAAA 50 UAAGUAUUGA UAGCGGGGAU AUUCGACAGG AGGCUCACAA CAGGC 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 214 GGGAGACAAG AAUAAACGCU CAACAACCCA ACCAUCUAGA GCUUCGAACC 50 AUGGUAUACA AGGGAACACA AAAUUCGCGG AGGCUCCAAC AGGCGGC 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 215 GGGAGACAAG AAUAAACGCU CAAGCGGUCA GAAACAAUAG CUGGAUACAU 50 ACCGCGCAUC CGCUGGGCGA UAUUCGACAG GAGGCUCACA ACAGGC 96 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 216 GGGAGACAAG AAUAAACGCU CAAACAAGAG AGUCAAACCA AGUGAGAUCA 50 GAGCGUUUAG CGCGGAAAGC ACAUUCGACA GGAGGCUCAC AACAGGC 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 217 GGGAGACAAG AAUAAACGCU CAAACUCGAC UAGUAAUCAC CCUAGCAUAA 50 AUCUCCUCGA GCACAGACGA UAUUCGACAG GAGGCUCACA ACAGGC 96 94 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 218 GGGAGACAAG AAUAAACGCU CAAUCAGCAG UAAGCGAUCC UAUAAAGAUC 50 AACUAGCCAA AGAUGACUUA UUCGACAGGA GGCUCACAAC AGGC 94 95 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 219 GGGAGACAAG AAUAAACGCU CAAAAAGACG UAUUCGAUUC GAAACGAGAA 50 AGACUUCAAG UGAGCCCGCA GUUCGACAGG AGGCUCACAA CAGGC 95 49 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 220 CUCAACGAAU CAGUAAACAU AACACCAUGA AACAUAAAUA GCACGCGAG 49 47 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 221 CUCAACGAGU UCACAUGGGA GCAAUCUCCG AAUAAACAAC ACGCGAG 47 39 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 222 CUCAACGAAC CACGGGGAAA UCCACCAGUA ACACGCGAG 39 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 223 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 42 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 224 CGCUCAACGA GCCAGGAACA UCGACGUCAG CAAACGCGAG CG 42 35 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 225 CUCAACGAGC CAGGACUACG AUCAGCAAAC GCGAG 35 42 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 226 CUCAACGCAC CAGGAACAAC GAGAACCAUC AGUAAACGCG AG 42 42 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 227 CUCAACGCAC CAGGAACAAC AAGAACCAUC AGUAAGCGCG AG 42 40 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 228 CACUCAACCG GCACCAGACU ACGAUCAGCA UUGGCGAGUG 40 45 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 229 GAAUCCGGAA CACGCGAGAA AACAAAUCAA CGACCAAUCG AUUCG 45 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′- F uracil 7, 9, 14, 21 G are 2′-O- methyl guanine 8, 15, 18, 22, 27, 31 A are 2′-O-methly adenine 230 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′- F uracil 7, 9, 13, 14, 21, 24, 28 G are 2′-O-methyl- guanine 8, 15, 18, 22, 27, 30, 31 A are 2′-O-methyl-adenine 231 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′- F uracil 7, 9, 14, 21, 36 G are 2′-O-methyl- guanine 8, 15, 18, 22, 27, 31, 37 A are 2′-O-methyl-adenine 232 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′- F uracil 7, 9, 13, 14, 21, 24, 28, 36 G are 2′-O-methyl- guanine 8, 15, 18, 22, 27, 30, 31, 37 A are 2′-O-methyl-adenine 233 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′- F uracil 7, 9, 14 G are 2′-O-methyl- guanine 8, 15, 18, 27, 31 A are 2′-O-methyl-adenine 234 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 38 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′- F uracil 7, 9, 13, 14, 24 G are 2′-O-methyl- guanine 8, 15, 18, 22, 27, 31 A are 2′-O-methyl-adenine 235 CUCAACGAGC CAGGAACAUC GACGUCAGCA AACGCGAG 38 59 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 236 CUCAACGAGC AAAAGUACUC ACGGGACCAG GAGAUCAGCA ACACGCGAGA 50 CGAAAUUCG 59 43 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 237 CGCUCAACGA CCACAAUACA AACUCGUAUG GAACACGCGA GCG 43 51 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 238 CGCUCAACUG GCAACGGGAU AACAACAAAU GUCACCAGCA CUAGCGAGAC 50 G 51 41 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 239 UCACUCAACC GGCACCAGAC UACGAUCAGC AUUGGCGAGU G 41 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 240 GGGAGACAAG AAUAAACGCU CAACGAGCAA GGAACGAAUA CAAACCAGGA 50 AACUCAGCAA CACGCGAGCA 70 51 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 241 CUCAACGACC ACAAUAACCG GAAAUCCCCG CGGUUACGGA ACACGCGAAC 50 A 51 69 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 242 AGAAUAAACG CUCAACGAUG AGCGUGACCG AAGCUAUAAU CAGGUCGAUU 50 CACCAAGCAA UCUUAUUCG 69 50 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 243 ACGCUCAAAG GAUCACACAA ACAUCGGUCA AUAAAUAAGU AUUGAUAGCG 50 52 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 244 GCUCAAGCGG UCAGAAACAA UAGCUGGAUA CAUACCGCGC AUCCGCUGGG 50 CG 52 58 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 245 ACCAUCUAGA GCUUCGAACC AUGGUAUACA AGGGAACACA AAAUUCGCGG 50 AGGCUCCA 58 96 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 246 GGGAGACAAG AUAAACGCUC AAACAAGAGA GUCAAACCAA GUGAGAUCAG 50 AGCGUUUAGC GCGGAAAGCA CAUUCGACAG GAGGCUCACA ACAGGC 96 87 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 247 GGGAGACAAG AAUAAACGCU CAAAAAGACG UAUUCGAUUC GAAACGAGAA 50 AGACUUCAAG UGAGCCCGCA GUUCGACAGG AGGCUCA 87 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 248 GGGAGACAAG AAUAAACGCU CAANNNNNNN NNNNNNNNNN NNNNNNNNNN 50 NNNNNNNNNN NNNNNNNNNN NNNUUCGACA GGAGGCUCAC AACAGGC 97 40 base pairs nucleic acid single linear DNA 249 TAATACGACT CACTATAGGG AGACAAGAAT AAACGCTCAA 40 24 base pairs nucleic acid single linear DNA 250 GCCTGTTGTG AGCCTCCTGT CGAA 24 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 251 GGGAGACAAG AAUAAACGCU CAAGCCCCAA ACGCAAGCGA GCAUCCGCAA 50 CAGGGAAGAA GACAGACGAA UGAUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 252 GGGAGACAAG AAUAAACGCU CAAGCCCCAA ACGCAAGUGA GCAUCCGCAA 50 CAGGGAAGAA GACAGACGAU UGAUUCGACA GGAGGCUCAC AACAGGC 97 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 253 GGGAGACAAG AAAUAAACNC UCAAGCCCCA AACGCAAGUG AGCAUCCGCA 50 ACAGGGAAGA AGACAGAUGA AUGAUUCGAC AGGAGGCUCA CAACAGGC 98 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 254 GGGAGACAAG AAUAAACNCU CAAGCCCCAA GCAAGUGAGC AUCCGCAACA 50 GGGAAGAAGA CAGACGAGUG AUUCGACAGG AGGCUCACAA CAGGC 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 255 GGGAGACAAG AAUAAACNCU CAAGCCCCAA ACGCAAGUGA GCAUCCGCAA 50 CAGGGAAGAA GACAGACGAA UGAUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 256 GGGAGACAAG AAUAAACGCU CAAGCAAAAG GCGUAAAUAC ACCUCCGCAA 50 CUGGGAAGAA GACGCAGGGA CGGUUCGACA GGNGGCUCAC AACAGGC 97 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 257 GGGAGACAAG AAUAAACGCU CAAACAGCUA CAAGUGGGAC AACAGGGUAC 50 AGCGGAGAGA AACAUCCAAA CAAGUUCGAC AGGAGGCUCA CAACAGGC 98 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 258 GGGAGACAAG AAUAAACGCU CAAAUCAACU AAACAACGCA GUCACGAGAA 50 CGACCGGKCU GACUCCGAAA GUUCGACAGG AGGCUCACAA CAGGC 95 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 259 GGGAGACAAG AAUAAACGCU CAAACGAGAG CACCAAGGCA ACAGAUGCAG 50 AAGAAGUGUG CGCGCGCGAA AUUCGACAGG AGGCUCACAA CAGGC 95 98 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 260 GGGAGACAAG AAUAAACGCU CAAUAAGACA ACGAACAGAC AGAAGCGAAA 50 AAGGGGCGCC GCAGCAACAA CAAAUUCGAC AGGAGGCUCA CAACAGGC 98 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 261 GGGAGACAAG AAUAAACGCU CAACGUGUAC CACAACAGUU CCACGGAAGC 50 UGGAAUAGGA CGCAGAGGAA UUCGACAGGA GGCUCACAAC AGGC 94 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 262 GGGAGACAAG AAUAAACGCU CAAACAAAAU UWUGGUGGGC CCCGCAACMG 50 GGRGGRAGRC CGUUGAAGGC UUCGACAGGA GGCUCACAAC AGGC 94 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 263 GGGAGACAAG AAUAAACGCU CAAGAUCAUA ACGAGAGGAG AGGGAGAACU 50 ACACGCGCGC GAGGAAAGAG UUCGACAGGA GGCUCACAAC AGGC 94 89 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 264 GGGAGACAAG AAUAAACGCU CAAACACAAA UCGGGCAGGG ACUGGGUUGG 50 GCACGGCAGG GCGCCUUCGA CAGGAGGCUC ACAACAGGC 89 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 265 GGGAGACAAG AAUAAACGCU CAAGUGGGCU CGGGCCGGAU GUCUACGGGU 50 GUGAAGAAAC CCCUAGGGCA GGGUUCGACA GGAGGCUCAC AACAGGC 97 95 base pairs nucleic acid single linear <Unknown> All U′s are 2′-NH2 uracil 266 GGGAGACAAG AAUAAACGCU CAAGAUCAGC GGAACUAAGA AAUGGAAGGC 50 UAAGCACCGG GAUCGGGAGA AUUCGACAGG AGGCUCACAA CAGGC 95 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 267 GGGAGACAAG AAUAAACGCU CAAUAACAAA GCAGCAAAGU ACCAGAGGAG 50 AGUUGGCAGG GUUUAGGCAG CUUCGACAGG AGGCUCACAA CAGGC 95 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 268 GGGAGACAGA AUAAACGCUC AAAGACCAAG GGACAGCAGC GGGGAAAAAC 50 AGAUCACAGC UGUAAGAGGG CUUCGACAGG AGGCUCACAA CAGGC 95 93 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 269 GGGAGACAAG AAUAAACGCU CAAAGUCGGG GAUAGAAACA CACUAAGAAG 50 UGCAUCAGGU AGGAGAUAAU UCGACAGGNG GCUCACAACA GGC 93 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 270 GGGAGACAAG AAUAAACGCU CAAGAGUAUC ACACAAACCG GCACGGACUA 50 AGCAGAAGGA GGUACGGAAG AUUCGACAGG AGGCUCACAA CAGGC 95 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 271 GGGAGACAAG AAUAAACNCU CAACGAAAUA GAAGGAACAG AAGAAUGGBG 50 AWGNGGGAAA UGGCAACGAA UUCGACAGGN GGCUCACAAC AGGC 94 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 272 GGGAGACAAG AAUAAACGCU CAAACGAGAC CCUGGAUACG AGGCUGAGGG 50 AAAGGGAGMM MRRAMCUARR CKCUUCGACA GGAGGCUCAC AACAGGC 97 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 273 GGGAGACAAG AAUAAACGCU CAAGAAGGAU ACUUAGGACU ACGUGGGAUG 50 GGAUGAAAUG GGAGAACGGG AGUUCGACAG GAGGCUCACA ACAGGC 96 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 274 GGGAGACAAG AAUAAACGCU CAAAACGCAC AAAGUAAGGG ACGGGAUGGA 50 UCGCCCUAGG CUGGAAGGGA ACUUCGACAG GAGGCUCACA ACAGGC 96 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 275 GGGAGACAAG AAUAAACGCU CAAGGUGAAC GGCAGCAAGG CCCAAAACGU 50 AAGGCCGGAA ACNGGAGAGG GAUUCGACAG GNGGCUCACA ACAGGC 96 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 276 GGGAGACAAG AAUAAACGCU CAAUGAUAUA CACGUAAGCA CUGAACCAGG 50 CUGAGAUCCA UCAGUGCCCA GGUUCGACAG GAGGCUCACA ACAGGC 96 94 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 277 GGGAGACAAG AAUAAACGCU CAAGAUCAUA ACGAGAGGAG AGGGAGAACU 50 ACACGCGCGC GAGGAAAGAG UUCGACAGGA GGCUCACAAC AGGC 94 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 278 GGGAGACAAG AAUAAACGCU CAAUCAAGUA AGGAGGAAGG GUCGUGACAG 50 AAAAACGAGC AAAAAACGCG AGUUCGACAG GAGGCUCACA ACAGGC 96 93 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil (xi) 279 GGGAGACAAG AAUAAACGCU CAAAAGGUGC CGGGUUGGAG GGGUAGCAAG 50 AAAUGGCUAG GGCGCASGAU UCGACAGGNG GCUCACAACA GGC 93 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 280 GGGAGACAAG AAUAAACGCU CAACCAACGC GCACCCCGCA GCAAACGAAA 50 UUGGGGAGAC AGGUGCAAGA CAGUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 281 GGGAGACAAG AAUAAACKCU CAACAAACAA UAUCGGCGCA GGAAAACGUA 50 GAAACGAAAM GGAGCUGCGY GGAUUCGACA GGAGGCUCAC AACAGGC 97 93 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 282 GGGAGACAAG AAUAAACGCU CAAUGAUAGC ACAGUGUAUA AGAAAACGCA 50 ACACCGCGCG CGGAAAGAGU UCGACAGGAG GCUCACAACA GGC 93 96 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 283 GGGAGACAAG AAUAAACGCU CAAGAUCAUC GCAGUAUCGG AAUCGACCCU 50 CAGUGGGUGA CAUGCGGACA AGUUCGACAG GAGGCUCACA ACAGGC 96 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 284 GGGAGACAAG AAUAAACGCU CAAGUACCGG GAAGGGAUGA ACUGGGAUAU 50 GGGAACGGAG GUCAGAGGCA CGAUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 285 GGGAGACAAG AAUAAACGCU CAAGCAAUGG AACGCUAGGA GGGAACAUAA 50 GCAGGGCGAG CGGAGUCGAU AGCUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 286 GGGAGACAAG AAUAAACGCU CAAAACAGAA CUGAUCGGCG CAGGUUGAUA 50 AAGGGGCAGC GCGAAGAUCA CAAUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 287 GGGAGACAAG AAUAAACGCU CAAGGGAAAC GGAAAGGGAC AAGGCGAACA 50 GACGAGAAGU AGACGGAGUA GGAUUCGACA GGAGGCUCAC AACAGGC 97 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 288 GGGAGACAAG AAUAAACGCU CAANNNGAGG AAGGGCACGC AAGGAAACAA 50 AACACAAAGC AGAAGUAGUA AGAUUCGACA GGAGGCUCAC AACAGGC 97 95 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 289 GGGAGACAAG AAUAAACGCU CAAGUACRCA GUGAGCAGAA GCAGAGAGAC 50 UUGGGAUGGG AUGAAAUGGK CUUCGACAGG AGGCUCACAA CAGGC 95 97 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 290 GGGAGACAAG AAUAAACNCU CAACCGACGU GGACDCGCAU CGGCAUCCAG 50 ACCAGGCUGN BCNGCACCAS ACGUUCGACA GGAGGCUCAC AACAGGC 97 11 base pairs nucleic acid single linear RNA All C′s are 2′-NH2 cytosine All U′s are 2′-NH2 uracil 291 GGGAAGAAGA C 11 66 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 292 GGGAGGACGA UGCGGNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 50 CAGACGACUC GCCCGA 66 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 293 GGGAGGACGA UGCGGGCAAA UUGCAUGCGU UUUCGAGUGC UUGCUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 294 GGGAGGACGA UGCGGUGCUU AAACAACGCG UGAAUCGAGU UCAUCCACUC 50 CUCCUCAGAC GACUCGCCCG A 71 72 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 295 GGGAGGACGA UGCGGUUAAU UCAGUCUCAA ACGGUGCGUU UAUCGAGCCA 50 CUGAUCWGAC GACUCGCCCG AA 72 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 296 GGGAGGACGA UGCGGCUUAG AGCUCAAACG GUGUGACUUU CAAGCCCUCU 50 AUGCCCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 297 GGGAGGACGA UGCGGUACCU CAAAUUGCGU GUUUUCAAGC AGUAUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 298 GGGAGGACGA UGCGGACCCU CAAAUAACGU GUCUUUCAAG UUGGUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 299 GGGAGGACGA UGCGGACCCU CAAAUAGCGU GCAUUUCAAG CUGGUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 300 GGGAAGACGA UGCGGCGCUC AAAUAAUGCG UUAAUCGAAU UCGCCCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 301 GGGAGGACGA UGCGGCAAAC AAGCUCAAAU GACGUGUUUU UCAAGUCCUU 50 GUUGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 302 GGGAGGACGA UGCGGUAGUA AGUCUCAAAU GUUGCGUUUU UCGAAACACU 50 UACAUCAGAC GACUCGCCCG A 71 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 303 GGGAGGACGA UGCGGAGACU CAAAUGGUGU GUUUUCAAGC CUCUCCCAGU 50 CGACUCGCCC GA 62 63 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 304 GGGAGGACGA UGCGGUGCUC AAAUGAUGCG UUUCUCGAAU CCACCCAGAC 50 GACUCGCCCG AGG 63 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 305 GGGAGGACGA UGCGGCCAUC GGUCUUGGGC AACGCGUUUU CGAGUUACCU 50 AUGGUCAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 306 GGGAGGACGA UGCGGCCAUC GGUCUUGGGC AACGCGUUUU CGAGUUACCU 50 ACAUCAGACG ACUCGCCCGA 70 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 307 GGGAGGACGA UGCGGGACCC UUAGGCAACG UGUUUUCAAG UUGGUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 308 GGGAGGACGA UGCGGACGUA GCUCUUAGGC AAUGCGUAUU UCGAAUUAGC 50 UGUGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 309 GGGAGGACGA UGCGGAGUCU UAGGCAGCGC GUUUUCGAGC UACUCCAUCG 50 CCAGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 310 GGGAAGACGA UGCGGAAUGC UCUUAGGCAG CGCGUUAAUC GAGCUAGCAC 50 AUCCUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 311 GGGAGGACGA UGGGGAGUCU UAGGCAGCGC GUUUUCGAGC UACUCCAUCG 50 CCAGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 312 GGGAGGACGA UGCGGUAAUC UCUUAGGCAU CGCGUUAAUC GAGAUAGAUC 50 ACCGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 313 GGGAGGACGA UGCGGCAAUG UCHCUUAGGC CACGCGUUAA UCGAGCGUGA 50 CUGUCAGACG ACUCGCCCGA G 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 314 GGGAGGACGA UGCGGCAUGG UCUUAGGCGA CGCGUUUAUA UCGAGUCACC 50 AUGCUCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 315 GGGAGGACGA UGCGGGAUGC UUAGGCGCCG UGUUUUCAAG GCCAUCAGAC 50 GACUCGCCCG A 61 72 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 316 GGGAGGACGA UGCGGUAAUU GUCUUAGGCG CCGUGUUAUC AAGGCACAAU 50 UUCCCUCAGA CGACUCGCCC GA 72 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 317 GGGAAGACGA UGCGGCUACU AGUGUCUUAG GCGGAGUGUU UAUCAAUCCA 50 CACAUCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 318 GGGAGGACGA UGCGGACUGA CUUAGGCUGC GCGCACUUCG AGCAUCAGAC 50 GACUCGCCCG A 61 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 319 GGGAGGACGA UGCGGUGGUG UGUCUUUGGC ACCGCGUAUU UUCGAGGUAC 50 ACAUCAGACG ACUCGCCCGA 70 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 320 GGGAGGACGA UGCGGUGGUG UGUCUUUGGC ACCGCGUAUU CUCGAGGUAC 50 ACAUCAGACG ACUCGCCCGA 70 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 321 GGGAGGACGA UGCGGGCUCU UCAGCAACGU GUUAUCAAGU UAGCCCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 322 GGGAGGACGA UGCGGCGUAA CUUCAGCGGU GUGUUAAUCA AGCCUUACGC 50 CAUCUCAGAC GACUCGCCCG A 71 59 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 323 GAGGACGAUG CGGGCUCUUA AGCAACGUGU UAUCAAGUUA GCCCAGACGA 50 CUCGCCCGA 59 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 324 GGGAGGACGA UGCGGUCUCA AGCAAUGCGU UUAUCGAAUU ACCGUACGCC 50 UCCGUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 325 GGGAGGACGA UGCGGAAAUC UCUUAAGCAG CGUGUAAAUC AAGCUAGAUC 50 UUCGUCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 326 GGGAGGACGA UGCGGUUCUU AAGCAGCGCG UCAAUCGAGC UAACCCAGAC 50 GACUCGCCCG A 61 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 327 GGGAGGACGA UGCGGAUCUU AAGCAGCGCG UCAAUCGAGC UAACCCAGAC 50 GACUCGCCCG AG 62 75 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 328 ACAGCUGAUG ACCAUGAUUA CGCCAAGCUU AAGCAGCGCG UUUUCGAGCU 50 CAUGUUGGUC AGACGACUCG CCCGA 75 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 329 GGGAGGACGA UGCGGAGGGU CUUAAGCAGU GUGAUAAUCA AACUACUCUC 50 CGUGUCAGAC GACUCGCCCG A 71 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 330 GGGAGGACGA UGCGGGAUCU UAAGCAGUGC GUUAUUCGAA CUAUCCCAGA 50 CGACUCGCCC GA 62 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 331 GGGAGGACGA UGCGGUGCUA UUCUUAAGCG GCGUGUUUUU CAAGCCAAUA 50 UCAUCAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 332 GGGAGGACGA UGCGGUCUUA AGCGGCGCGA UUUUCGAGCC ACCGCAUCCU 50 CCGUGCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 333 GGGAGGACGA UGCGGCCUCU UAAGCGUCGU GUUUUUCAAG CUGGUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 334 GGGAGGACGA UGCGGAUACC ACCUCUUAAG CGACGUGCAU UUCAAGUCAG 50 AUGGUCAGAC GACUCGCCCG A 71 72 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 335 GGGAGGACGA UGCGGUGCUA UUCUUAAGCG GCGUGUAAAU CAAGCUAGAU 50 CAUCGUCAGA CGACUCGCCC GA 72 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 336 GGGAGGACGA UGCGGAACGA CUCUUAAGCU GUGCGUUUUC GAACAAGUCG 50 UAACUCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 337 GGGAGGACGA UGCGGCUCUC AUUUWGCGCG UAAAUCGAGC UAGCCCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 338 GGGAGGACGA UGCGGAGUCW CUCUCCACCA KCGUGUKUUA AUCAAGCUAN 50 UGCCUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 339 GGGAGGACGA UGCGGUCUAC GGUCUCUCUG GCGGUGCGUA AAUCKAACCA 50 GAUCGCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 340 GGGAGGACGA UGCGGUDAUU UCYUAAUCHG AGCGUUUAUC UAUCUMAAUK 50 AUCCUCAGAC GACUCGCCCG A 71 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 341 GGGAGGACGA UGCGGAUCGC AAUMUGUWGC GUUCUCKAAA CAGCCUCAGA 50 CGACUCGCCC GA 62 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 342 GGGAGGACGA UGCGGUGGUU CUAGGCACGU GUUUUCAAGU GUAAUCAGAC 50 GACUCGCCCG A 61 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 343 GGGAGGACGA UGCGGAAACA UGUGUUUUCG AAUGUGCUCU CCUCCCCAAA 50 CAACYCCCCC AA 62 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 344 GGGAGGACGA UGCGGAAGGC CGUGUUAAUC AAGGCUGCAA UAAAUCAUCC 50 UCCCCAGACG ACUCGCCCGA 70 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 345 GGGAGGACGA UGCGGAGGAU CGUGUUCAUC AAGAUUGCUC GUUCUUUACU 50 GCGUUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 346 GGGAGGACGA UGCGGUCAAA GUGAAGAAUG GACAGCGUUU UCGAGUUGCU 50 UCACUCAGAC GACUCGCCCG A 71 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 347 GGGAGGACGA UGCGGGGAGA AUGGCCAGCG UUUAUCGAGG UGCUCCGUUA 50 ACCGGCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 348 GGGAGGACGA UGCGGGAGGA AUGGACWGCG UAUAUCGAGU UGCCUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 349 GGGAGGACGA UGCGGAUCGA UUUCAUGCGU UUUUCGAGUG ACGAUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 350 GGGAGGACGA UGCGGAGACC CUAAGMGSGU KSUUUUCAAS CUGGUCWGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 351 GGGAGGACGA UGCGGUUAGC CUACACUCUA GGUUCAGUUU UCGAAUCUUC 50 CACCGCWGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 352 GGGAGGACGA UGCGGUUAGG UCAAUGAUCU UAGUUUUCGA UUCGUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 353 GGGAGGACGA UGCGGACGUG UGUAUCRARU UUUCCGCUGU UUGUGCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 354 GGGAGGACGA UGCGGACAGG GUUCUUAGGC GGAGUGUUCA UCAAUCCAAC 50 CAUGUCAGAC GACUCGCCCG A 71 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 355 GGGAGGACGA UGCGGCGAUU UCCACAGUUU GUCUUAUUCC GCAUAUCAGA 50 CGACUCGCCC GA 62 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 356 GGGAGGACGA UGCGGAUAYU CAGCUYGUGU KUUUUCDAUC UUCCCCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 357 GGGAGGACGA UGCGGCACAC GUGUUUUCAA GUGUGCUCCU GGGAUCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 358 GGGAGGACGA UGCGGCAAUG UGUUUCUCAA AUUGCUUUCU CCCUUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 359 GGGAGGACGA UGCGGAUACU ACCGUGCGAA CACUAAGUCC CGUCUGUCCA 50 CUCCUCAGAC GACUCGCCCG A 71 66 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 360 GGGAGGACGA UGCGGAUACU AUGUGCGUUC ACUAAGUCCC GUCGUCCCCU 50 CAGACGACUC GCCCGA 66 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 361 GGGAGGACGA UGCGGGUACU AUGUACGAUC ACUAAGCCCC AUCACCCUUC 50 UCACUCAGAC NACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 362 GGGAGGACGA UGCGGUUACU AUGUACAUUU ACUAAGACCC AACGUCAGAC 50 GACUCGCCCG A 61 72 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 363 GGGAGGACGA UGCGGUUWCU AUGUWCGCCU UACUAAGUAC CCGUCGACUG 50 UCCCAUCAGA CGACUCGCCC GA 72 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 364 GGGAAGACGA UGCGGUGUUG AUCAAUGAAU GUCCUCCUCC UACCCCAGAC 50 GACUCGCCCG A 61 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 365 GGGAGGACGA UGCGGUGUUU GUCAAUGUCA UGAUUAGUUU UCCCACAGAC 50 GACUCGCCCG A 61 64 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 366 GGGAGGACGA UGCGGCGGUC UUAAGCAGUG UGUCAAUCAA ACUAUCGUCA 50 GACGACUCGC CCGA 64 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 367 GGGAGGACGA UGCGGUUCUU AAGCAGCGCG UCAAUCGAGC UAACCCAGAC 50 GACUCGCCCG A 61 66 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 368 GGGAGGACGA UGCGGAAUGR CCCGUUACCA WCAAUGCGCC UCDUUGMCCC 50 CAAACAACYC CCCCAA 66 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 369 GGGAGGACGA UGCGGAAUYU CGUGYUACGC GUYYYCUAUC CAAUCUACCC 50 CMUCUCCAAU CAGACGACYC 70 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 370 GGGAGGACGA UGCGGCGCUU ACAAUAAUUC UCCCUGAGUA CAGCUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 371 GGGAGGACGA UGCGGAACUU CUUAGGCAGC GUGCUAGUCA AGCUAAGUUC 50 CACCUCAGAC GACUCGCCCG A 71 70 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 372 GGGAGGACGA UGCGGCACAA UCUUCGGCAG CGUGCAAGAU CAAGCUAUUG 50 UUGUCAGACG ACUCGCCCGA 70 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 373 GGGAGGACGA UGCGGUCAUU AACCAAGAUA UGCGAAUCAC CUCCUCAGAC 50 GACUCGCCCG A 61 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 374 GGGAGGACGA UGCGGUCAUU CUCUAAAAAA GUAUUCCGUA CCUCCACAGA 50 CGACUCGCCC GA 62 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 375 GGGAGGACGA UGCGGGUGAU CUUUUAUGCU CCUCUUGUUU CCUGUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 376 GGGAGGACNA UGCGGUCUAG GCAUCGCUAU UCUUUACUGA UAUAAUUACU 50 CCCCUCAGAC GACUCGCCCG A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 377 GGGAGGACGA UGCGGAGUWW GCNCGGUCCA GUCACAUCCW AUCCCCAGAC 50 GACUCGCCCG A 61 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 378 GGGAGGACGA UGCGGCUCUC AUAUKGWGUR UUYUUCMUUC SRGGCUCAAA 50 CAAYYCCCCC AA 62 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 379 GGGAGGACGA UGCGGCUUGU UAGUUAAACU CGAGUCUCCA CCCCUCAGAC 50 GACUCGCCCG A 61 62 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 380 GGGAGGACGA UGCGGUCUCU WCUVACVUGU RUUCACAUUU UCGCYUCAAA 50 CAACYCCCCC AA 62 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 381 GGGAGGACGA UGCGGUURAC AAUGRSSCUC RCCUUCCCWG GUCCUCAGAC 50 GACUCGCCCG A 61 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 382 AGGAGGACGA UGCGGUUAUC UGAARCWUGC GUAAMCUARU GUSAAASUGC 50 AACRACRAAC AACYCSCCCA A 71 61 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 383 AGGAAGACGA UGCGGUUCGA UUUAUUUGUG UCAUUGUUCU UCCAUCAGAC 50 GACUCGCCCG A 61 35 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 384 GUGAUGACAU GGAUUACGCC AGACGACUCG CCCGA 35 16 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 385 UGCGUGUUUU CAAGCA 16 23 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 386 CUCAAAUUGC GUGUUUUCAA GCA 23 33 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 387 GGUACCUCAA AUUGCGUGUU UUCAAGCAGU AUC 33 33 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 388 GGAGUCUUAG GCAGCGCGUU UUCGAGCUAC UCC 33 71 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 389 GGGAGGACGA UGCGGNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN 50 NNNNNCAGAC GACUCGCCCG A 71 97 base pairs nucleic acid single linear RNA All C′s are 2′-F cytosine All U′s are 2′-F uracil 390 GGGAGACAAG AAUAAACGCU CAANNNNNNN NNNNNNNNNN NNNNNNNNNN 50 NNNNNNNNNN NNNNNNNNNN NNNUUCGACA GGAGGCUCAC AACAGGC 97

Claims

We claim:

1. A method for identifying nucleic acid ligands and nucleic acid ligand sequences to a lectin comprising:

a) contacting a candidate mixture of nucleic acids with a lectin, wherein nucleic acids having an increased affinity to said lectin relative to the candidate mixture may be partitioned from the remainder of the candidate mixture;

b) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; and

c) amplifying the increased affinity nucleic acids to yield a mixture of nucleic acids enriched for nucleic acid sequences with relatively higher affinity and specificity for binding to said lectin, whereby nucleic acid ligands to said lectin may be identified.

2. The method of claim 1 further comprising:

d) repeating steps a), b) and c).

3. The method of claim 1 wherein said candidate mixture is comprised of single-stranded nucleic acids.

4. The method of claim 3 wherein said single-stranded nucleic acids are ribonucleic acids.

5. The method of claim 4 wherein said nucleic acids comprise modified ribonucleic acids.

6. The method of claim 5 wherein said nucleic acids comprise modified ribonucleic acids selected from the group consisting of 2′-amino (2′- NH₂) modified ribonucleic acids and 2′-fluoro (2′-F) modified ribonucleic acids.

7. The method of claim 3 wherein said single-stranded nucleic acids are deoxyribonucleic acids.

8. The method of claim 2 further comprising

e) forming a multivalent Complex comprising two nucleic acid ligands identified in step c).

9. The method of claim 5 further comprising

e) substituting 2′-O-methyl ribonucleic acids for 2′-OH ribonucleic acids in the nucleic acid ligands identified in step c).

10. The method of claim 1 wherein said lectin is selected from the group consisting of a mammalian lectin, a plant lectin, a microbial lectin and a viral lectin.

11. The method of claim 1 wherein said lectin is wheat germ agglutinin.

12. The method of claim 1 wherein said lectin is a selectin.

13. The method of claim 12 wherein said selectin is selected from the group consisting of L-selectin, E-selectin, and P-selectin.

14. The method of claim 1 wherein said lectin is serum mannose binding protein.

15. A purified and isolated non-naturally occurring nucleic acid ligand to a lectin.

16. The nucleic acid ligand of claim 15 which is a non-naturally occurring nucleic acid ligand having a specific binding affinity for said lectin, such lectin being a three dimensional chemical structure other than a polynucleotide that binds to said nucleic acid ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein said nucleic acid ligand is not a nucleic acid having the known physiological function of being bound by said lectin.

17. The nucleic acid ligand of claim 15 wherein said lectin is selected from the group consisting of a mammalian lectin, a plant lectin, a microbial lectin and a viral lectin.

18. The nucleic acid ligand of claim 15 wherein said lectin is selected from the group consisting of wheat germ agglutinin, L-selectin, E-selectin and P-selectin.

19. The nucleic acid ligand of claim 15 wherein said lectin is wheat germ agglutinin.

20. The nucleic acid ligand to wheat germ agglutinin of claim 19 wherein said nucleic acid ligand is a ribonucleic acid (RNA) ligand.

21. The nucleic acid ligand of claim 20 which comprises a modified ribonucleic acid.

22. The nucleic acid ligand of claim 21 wherein said modified ribonucleic acid is a 2′-amino (NH₂) modified ribonucleic acid.

23. The nucleic acid ligand to wheat germ agglutinin of claim 22 wherein said ligand is an RNA ligand selected from the group consisting of the nucleotide sequences set forth in Table 2.

24. The nucleic acid ligand of claim 23 wherein said ligand is selected from the group consisting of SEQ ID NOS: 455.

25. The nucleic acid ligand of claim 20 wherein said ligand comprises sequences selected from the group consisting of SEQ ID NOS: 5-63.

26. The nucleic acid ligand to wheat germ agglutinin of claim 19 wherein said ligand is substantially homologous to and has substantially the same ability to bind said wheat germ agglutinin as a ligand selected from the group consisting of the sequences set forth in Table 2.

27. The nucleic acid ligand to wheat germ agglutinin of claim 19 wherein said ligand has substantially the same structure and the same ability to bind said wheat germ agglutinin as a ligand selected from the group consisting of the sequences set forth in Table 2.

28. The nucleic acid ligand of claim 15 wherein said lectin is a selectin.

29. The nucleic acid ligand of claim 28 wherein said selectin is selected from the group consisting of L-selectin, E-selectin and P-selectin.

30. The nucleic acid ligand of claim 29 wherein said selectin is L-selectin.

31. The nucleic acid ligand to L-selectin of claim 30 wherein said nucleic acid ligand is ribonucleic acid (RNA) ligand.

32. The nucleic acid ligand of claim 31 which comprises a modified ribonucleic acid.

33. The nucleic acid ligand of claim 32 wherein said modified ribonucleic acid is selected from the group consisting of a 2′-amino (2′-NH₂) modified ribonucleic acid and a 2′-fluoro (2′-F) modified ribonucleic acid.

34. The nucleic acid ligand to L-selectin of claim 33 wherein said ligand is an RNA ligand selected from the group consisting of the nucleotide sequences set forth in Tables 8 and 16.

35. The nucleic acid ligand of claim 34 wherein said ligand is selected from the group consisting of SEQ ID NOS: 67-117 and 293-388.

36. The nucleic acid ligand of claim 31 wherein said ligand comprises sequences selected from the group consisting of SEQ ID NOS: 118-125.

37. The nucleic acid ligand to L-selectin of claim 30 wherein said ligand is substantially homologous to and has substantially the same ability to bind said L-selectin as a ligand selected from the group consisting of the sequences set forth in Tables 8, 12 and 16.

38. The nucleic acid ligand to L-selectin of claim 30 wherein said ligand has substantially the same structure and the same ability to bind said L-selectin as a ligand selected from the group consisting of the sequences set forth in Tables 8, 12 and 16.

39. The nucleic acid ligand to L-selectin of claim 30 wherein said nucleic acid ligand is deoxyribonucleic acid (DNA).

40. The nucleic acid ligand to L-selectin of claim 39 wherein said ligand is an DNA ligand selected from the group consisting of the nucleotide sequences set forth in Table 12.

41. The nucleic acid ligand of claim 40 wherein said ligand is selected from the group consisting of SEQ ID NOS: 129-180 and 185-196.

42. The nucleic acid ligand of claim 39 wherein said ligand comprises sequences selected from the group consisting of SEQ ID NOS: 181-184.

43. The nucleic acid ligand of claim 29 wherein said selectin is P-selectin.

44. The nucleic acid ligand to P-selectin of claim 43 wherein said nucleic acid ligand is ribonucleic acid (RNA) ligand.

45. The nucleic acid ligand of claim 44 which comprises a modified ribonucleic acid.

46. The nucleic acid ligand of claim 45 wherein said modified ribonucleic acid is selected from the group consisting of a 2′-amino (2′-NH₂) modified ribonucleic acid, a 2′-fluoro (2′-F) modified ribonucleic acid, and a 2′-O-Methyl (2′-O-Me) modified ribonucleic acid.

47. The nucleic acid ligand to P-selectin of claim 46 wherein said ligand is an RNA ligand selected from the group consisting of the nucleotide sequences set forth in Tables 19, 21 and 25.

48. The nucleic acid ligand of claim 47 wherein said ligand is selected from the group consisting of SEQ ID NOS: 199-219 and 236-290.

49. The nucleic acid ligand of claim 44 wherein said ligand comprises sequences selected from the group consisting of SEQ ID NO: 291.

50. The nucleic acid ligand to P-selectin of claim 43 wherein said ligand is substantially homologous to and has substantially the same ability to bind said P-selection as a ligand selected from the group consisting of the sequences set forth in Tables 19, 21 and 25.

51. The nucleic acid ligand to P-selectin of claim 43 wherein said ligand has substantially the same structure and the same ability to bind said P-selectin as a ligand selected from the group consisting of the sequences set forth in Tables 19, 21 and 25.

52. The nucleic acid ligand to P-selectin of claim 46 wherein said nucleic acid ligand is deoxyribonucleic acid (DNA).

53. The nucleic acid ligand of claim 15 wherein said ligand is a ribonucleic acid ligand.

54. The nucleic acid ligand of claim 53 which comprises a modified ribonucleic acid.

55. The nucleic acid ligand of claim 54 wherein said modified ribonucleic acid is selected from the group consisting of 2′-amino (2′-NH₂) modified ribonucleic acids, 2′-fluoro (2′-F) modified ribonucleic acids and 2′-O-Methyl (2′-O-Me) modified ribonucleic acids.

56. The nucleic acid ligand of claim 15 wherein said ligand is a deoxyribonucleic acid.

57. The nucleic acid ligand of claim 15 wherein said ligand has been further chemically modified at the sugar and/or phosphate and/or base.

58. A multivalent Complex comprising a plurality of ligands of claim 15.

59. A nucleic acid ligand to a lectin identified according to the method comprising:

c) amplifying the increased affinity nucleic acids to yield a mixture of nucleic acids enriched for nucleic acid sequences with relatively higher affinity and specificity for binding to said lectin, whereby nucleic acid ligands of said lectin may be identified.

60. A method for treating a lectin-mediated disease comprising administering a pharmaceutically effective amount of a nucleic acid ligand to a lectin.

61. The method of claim 60 wherein said nucleic acid ligand to a lectin is identified according to the method of claim 1.

62. The method of claim 60 wherein said lectin is a selectin.

63. The method of claim 62 wherein said selectin is L-selectin.

64. The method of claim 62 wherein said selectin is P-selectin.