US20030213010A1

US20030213010A1 - Transgenic high tryptophan plants

Info

Publication number: US20030213010A1
Application number: US10/430,011
Authority: US
Inventors: Lisa Weaver; Tim Oulmassov; Gabriela Vaduva; Jihong Liang; Marguerite Varagona; Tyamagondlu Venkatesh
Original assignee: Monsanto Co; Monsanto Technology LLC
Current assignee: Monsanto Co; Monsanto Technology LLC
Priority date: 2002-05-03
Filing date: 2003-05-05
Publication date: 2003-11-13
Also published as: WO2003092363A2; CA2482879A1; WO2003092363A3; CA2482879C; EP1571896A4; AU2003253601A1; US8158851B2; AU2003253601A8; BR0309860A; CN1852975A; EP1571896A2; CN1852975B; US20110195175A1

Abstract

The present invention provides a method for altering the tryptophan content of a plant by introducing and expressing an isolated DNA segment encoding an anthranilate synthase in the cells of the plant. Transgenic plants transformed with an isolated DNA segment encoding an anthranilate synthase, as well as human or animal food, seeds and progeny derived from these plants, are also provided.

Description

This application claims the benefit of the filing date of the provisional Application U.S. Serial No. 60/377,727, filed May 3, 2002.[0001]

The seeds of a number of important crops, including soybean and maize do not contain sufficient quantities of several amino acids to be nutritionally complete. These amino acids include, but are not limited to: tryptophan, isoleucine, valine, arginine, lysine, methionine, and threonine. Therefore, the biosynthetic pathways for these amino acids, and/or biosynthetic pathways for metabolites that feed into those pathways, are potential targets for manipulation in order to increase the amino acid content of these plants.

Anthranilate synthase (AS, EC 4.1.3.27) catalyzes the first reaction branching from the aromatic amino acid pathway to the biosynthesis of tryptophan in plants, fungi, and bacteria.

The most common form of anthranilate synthase (for example, the maize anthranilate synthase) is a heterotetrameric enzyme consisting of two subunits, the α or TrpE subunit and the β or TrpG subunit. Two α-subunits and two β-subunits assemble to form the heterotetrameric anthranilate synthases. “Monomeric” forms of AS have also been discovered that comprise a single polypeptide chain having the activities of both TrpE and TrpG subunits (for example Rhizobium meliloti). While monomeric anthranilate synthases comprise just one type of polypeptide, the enzymatically active form of a monomeric anthranilate synthase is typically a homodimer consisting of two such monomeric polypeptides. Both heterotetrameric and monomeric anthranilate synthases catalyze the formation of anthranilate in a reaction utilizing glutamine and chorismate. The domain found on the α-subunit (referred to herein as the “α-domain”) binds chorismate and eliminates the enolpyruvate side chain, and the domain found on the β-subunit (referred to herein as the “β-domain”) transfers an amino group from glutamine to the position on the chorismate phenyl ring that resides between the carboxylate and the enolpyruvate moieties.

The next reaction in the synthesis of tryptophan is the transfer of the phosphoribosyl moiety of phosphoribosyl pyrophosphate to anthranilate. The indole ring is formed in two steps involving an isomerization converting the ribose group to a ribulose followed by a cyclization reaction to yield indole glycerol phosphate. The final reaction in the pathway is catalyzed by a single enzyme that may contain either one or two subunits. The reaction accomplishes the cleavage of indole glyceraldehyde-3-phosphate and condensation of the indole group with serine (Umbarger, Ann. Rev. Biochem., 47:555 (1978)).

Metabolite flow in the tryptophan pathway in higher plants and microorganisms is apparently regulated through feedback inhibition of anthranilate synthase by tryptophan. Tryptophan may block the conformational rearrangement that is required to activate the β-domain and to create a channel for passage of ammonia toward the active site of the α-domain. Such feedback inhibition by tryptophan is believed to depress the production of tryptophan by anthranilate synthase. See Li J. & Last, R. L., The Arabidopsis thaliana trp5 mutant has a feedback-resistant anthranilate synthase and elevated soluble tryptophan (Plant Physiol., 110:51-59(1996)).

Several amino acid residues have been identified as being involved in the feedback regulation of the anthranilate synthase complex from Salmonella typhimurium. Such information provides evidence of an amino-terminal regulatory site (J. Biol. Chem., 266:8328-8335 (1991)). Niyogi et al. have further characterized the anthranilate synthase from certain plants employing a molecular approach. See, Niyogi and Fink, Plant Cell, 4:721 (1992) and Niyogi et al., Plant Cell, 5:1011 (1993). They found that the α-subunits of the Arabidopsis anthranilate synthase are encoded by two closely related, nonallelic genes that are differentially regulated. One of these α-subunit genes, ASA1, is induced by wounding and bacterial pathogen infiltration, implicating its involvement in a defense response, whereas the other α-subunit gene, ASA2, is expressed at constitutive basal levels. Both predicted proteins share regions of homology with bacterial and fungal anthranilate synthase proteins, and contain conserved amino acid residues at positions that have been shown to be involved in tryptophan feedback inhibition in bacteria (Caligiuri et al., J. Biol. Chem., 266:8328 (1991)).

Amino acid analogs of tryptophan and analogs of the intermediates in the tryptophan biosynthetic pathway (e.g., 5-methyltryptophan, 4-methyltryptophan, 5-fluorotryptophan, 5-hydroxytryptophan, 7-azatryptophan, 3β-indoleacrylic acid, 3-methylanthranilic acid), have been shown to inhibit the growth of both prokaryotic and eukaryotic organisms. Plant cell cultures can be selected for resistance to these amino acid analogs. For example, cultured tobacco, carrot, potato, corn and Datura innoxia cell lines have been selected that are resistant to growth inhibition by 5-methyltryptophan (5-MT), an amino acid analog of tryptophan, due to expression of an altered anthranilate synthase.

Ranch et al., Plant Physiol., 71:136 (1983) selected for 5-MT resistance in cell cultures of Datura innoxia, a dicot weed, and reported that the resistant cell cultures contained increased tryptophan levels (8 to 30 times higher than the wild type level) and an anthranilate synthase with less sensitivity to tryptophan feedback inhibition. Regenerated plants were also resistant to 5-MT, contained an altered anthranilate synthase, and had greater concentrations of free tryptophan (4 to 44 times) in the leaves than did the leaves of the control plants. In contrast to the studies with N. tabacum, where the altered enzyme was not expressed in plants regenerated from resistant cell lines, these results indicated that the amino acid overproduction phenotype could be selected at the cellular level and expressed in whole plants regenerated from the selected cells in Datura innoxia.

Hibberd et al. (U.S. Pat. No. 4,581,847) described 5-MT resistant maize cell lines that contained an anthranilate synthase that was less sensitive to feedback inhibition than wild-type anthranilate synthase. One 5-MT resistant cell line accumulated free tryptophan at levels almost twenty-fold greater than that of non-transformed cell lines.

P. C. Anderson et al. (U.S. Pat. No. 6,118,047) disclose the use of a tryptophan-insensitive α-domain of anthranilate synthase from C28 maize in a transgene to prepare transgenic maize plants ( Zea mays) exhibiting elevated levels of free tryptophan in the seed(s).

Although it is possible to select for 5-MT resistance in certain cell cultures and plants, this characteristic does not necessarily correlate with the overproduction of free tryptophan in whole plants. Additionally, plants regenerated from 5-MT resistant lines frequently do not express an altered form of the enzyme. Nor is it predictable that this characteristic will be stable over a period of time and will be passed along as a heritable trait.

Anthranilate synthase has also been partially purified from crude extracts of cell cultures of higher plants (Hankins et al., Plant Physiol., 57:101 (1976); Widholm, Biochim. Biophys. Acta, 320:217 (1973)). However, it was found to be very unstable. Thus, there is a need to provide plants with a source of anthranilate synthase that can increase the tryptophan content of plants.

SUMMARY OF THE INVENTION

The present invention provides nucleic acids encoding an anthranilate synthase (AS) that can be used to generate transgenic plants. When such anthranilate synthase nucleic acids are expressed in a transgenic plant, elevated levels of tryptophan can be achieved within the cells of the plant. In one embodiment, the present invention is directed to DNA molecules that encode a monomeric anthranilate synthase, where such a monomeric anthranilate synthase is a natural or genetically engineered chimeric fusion of the α- and β-domains of an anthranilate synthase. The anthranilate synthase gene from a few species (e.g., some bacteria and other microbes) naturally gives rise to a monomeric anthranilate synthase that constitutes a single polypeptide chain. However, most species have a heterotetrameric anthranilate synthase composed of two a and two β domains found on separate subunits. The present invention also contemplates formation of chimeric anthranilate synthase fusion proteins comprising any anthranilate synthase α-domain linked to any β-domain.

In general, the sequence identity of naturally occurring monomeric anthranilate synthases with most plant anthranilate synthases is quite low. However, according to the invention, such monomeric anthranilate synthases can provide high levels of tryptophan when expressed in a plant, despite a low sequence identity with the plant's endogenous anthranilate synthase enzyme. Accordingly, the present invention provides monomeric anthranilate synthases that can have divergent sequences and that are capable of efficiently providing high levels of tryptophan in a plant host. For example, transgenic soybean plants containing the monomeric Agrobacterium tumefaciens anthranilate synthase can produce from up to about 10,000 to about 12,000 ppm tryptophan in seeds, with average trp levels ranging up to about 7,000 to about 8,000 ppm. In contrast, non-transgenic soybean plants normally have up to only about 100 to about 200 ppm tryptophan in seeds.

Accordingly, the present invention provides an isolated DNA sequence encoding a monomeric anthranilate synthase, wherein the monomeric anthranilate synthase has an anthranilate α-domain and an anthranilate β-domain and wherein the monomeric anthranilate synthase is expressed in a plant. Such expression can elevate the level of L-tryptophan in the plant.

The monomeric anthranilate synthase can be naturally monomeric. Examples of organisms from which naturally monomeric anthranilate synthase nucleic acids may be isolated, include but are not limited to organisms such as Agrobacterium tumefaciens, Rhizobium meliloti (e.g., Genbank Accession No. GI 95177), Mesorhizobium loti (e.g., Genbank Accession No. GI 13472468), Brucella melitensis (e.g., Genbank Accession No. GI 17982357), Nostoc sp. PCC7120 (e.g., Genbank Accession Nos. GI 17227910 or GI 17230725), Azospirillum brasilense (e.g., Genbank Accession No. GI 1174156) and Anabaena M22983 (e.g., Genbank Accession No. GI 152445). In some embodiments, the isolated DNA encodes an Agrobacterium tumefaciens anthranilate synthase having, for example, an amino acid sequence having SEQ ID NO: 4 or a nucleotide sequence having any one of SEQ ID NOs: 1 or 75.

Alternatively, the monomeric anthranilate synthase can be a fusion of any available anthranilate synthase α and β domain. Such α and β domains can be derived from Zea mays, Ruta graveolens, Sulfolobus solfataricus, Salmonella typhimurium, Serratia marcescens, Escherichia coli, Agrobacterium tumefaciens, Arabidopsis thaliana, Rhizobium meliloti (e.g., Genbank Accession No. GI 95177), Mesorhizobium loti (e.g., Genbank Accession No. GI 13472468), Brucella melitensis (e.g., Genbank Accession No. GI 17982357), Nostoc sp. PCC7120 (e.g., Genbank Accession No. GI 17227910 or GI 17230725), Azospirillum brasilense (e.g., Genbank Accession No. GI 1174156) and Anabaena M22983 (e.g., Genbank Accession No. GI 152445), soybean, rice, cotton, wheat, tobacco or any gene encoding a subunit or domain of anthranilate synthase. For example, nucleic acids encoding such an α or β domain can be obtained by using the sequence information in any of SEQ ID NOs: 1-70, 75-113, and 116-137.

In another embodiment, the invention provides an isolated DNA encoding an α domain of anthranilate synthase from Zea mays that comprises SEQ ID NOs: 5 or 66. Such an isolated DNA can have nucleotide sequence SEQ ID NOs: 2, 67, or 68. The isolated DNA can be operably linked to a promoter and, when expressed in a plant can provide elevated levels of L-tryptophan in the plant.

In yet another embodiment, the invention provides an isolated DNA molecule encoding an anthranilate synthase wherein the DNA molecule encodes a protein substantially homologous to an anthranilate synthase protein exemplified by SEQ ID NOs: 66, 108-111, 133, and 137. The isolated DNA encoding an anthranilate synthase comprises a DNA molecule substantially homologous to a DNA molecule exemplified by SEQ ID NOs: 67, 68, 104-107, and 134-136.

In still another embodiment, the present invention provides a DNA construct comprising an expression cassette, wherein the expression cassette in operable linkage comprises (i) a heterologous promoter; (ii) a DNA molecule encoding a monomeric anthranilate synthase protein, wherein the monomeric anthranilate synthase comprises a single polypeptide comprising an anthranilate synthase α-domain and an anthranilate synthase β-domain, and (iii) a transcriptional terminator. The monomeric anthranilate synthase protein may comprise a protein substantially homologous to proteins exemplified by SEQ ID NOs: 4, 7, 43, 57, 77-82, and 130-132. The DNA molecule may comprise a DNA molecule substantially homologous to a DNA molecule exemplified by SEQ ID NOs: 1, 75, 76, 83, and 121-129.

In a further embodiment, the present invention provides a DNA construct comprising a first expression cassette, wherein the first expression cassette in operable linkage comprises (i) a heterologous promoter; (ii) a DNA molecule encoding an anthranilate synthase α-domain protein and (iii) a transcriptional terminator.

The above DNA construct may futher comprise a second expression cassette in operable linkage comprising (i) a heterologous promoter; (ii) a DNA molecule encoding an anthranilate synthase β-domain protein and (iii) a transcriptional terminator. The DNA construct may comprise an α-domain or β-domain protein substantially homologous to a protein exemplified by SEQ ID NOs: 5, 6, 8, 44, 45, 66, 99, 100, 101, 102, 103, 108, 109, 110, 111, 117, 118, 133, or 137. The DNA molecule encoding an anthranilate synthase α-domain or β-domain protein may comprise a DNA molecule substantially homologous to a DNA molecule exemplified by SEQ ID NOs: 2, 3, 67, 94, 95, 96, 97, 98, 104, 105, 106, 112, 116, 119, 120, 134, 135, or 136. A specific example comprises a DNA construct where the α-domain anthranilate synthase protein is SEQ ID NO: 66 and the β-domain protein is SEQ ID NO: 118.

The isolated DNA can also encode a mutant anthranilate synthase, or a mutant anthranilate synthase domain. Such a mutant anthranilate synthase, or domain thereof, can have one or more mutations. As is known to one of skill in the art, mutations can be silent, can give rise to variant gene products having enzymatic activity similar to wild type or can give rise to derivative gene products that have altered enzymatic acitivity. The present invention contemplates all such mutations.

The mutated isolated DNA can be generated from a wild type anthranilate synthase nucleic acid either in vitro or in vivo and can encode, for example, one or more amino acid substitutions, deletions or insertions. Mutant isolated DNAs that generate a mutant anthranilate synthase having increased activity, greater stability, or less sensitivity to feedback inhibition by tryptophan or tryptophan analogs are desirable. In one embodiment, the anthranilate synthase, or a domain thereof, is resistant to inhibition by endogenous L-tryptophan or by tryptophan analogs. For example, the anthranilate synthase can have one or more mutations in the tryptophan-binding pocket or elsewhere that reduces the sensitivity of the anthranilate synthase, or the domain thereof, to tryptophan inhibition. Among the amino acid residues contemplated for mutation are residues, for example, at about positions 48, 51, 52, 293, and 298. For example, the mutation can be:

a) at about position 48 replace Val with Phe;

b) at about position 48 replace Val with Tyr;

c) at about position 51 replace Ser with Phe;

d) at about position 51 replace Ser with Cys;

e) at about position 52 replace Asn with Phe;

f) at about position 293 replace Pro with Ala;

g) at about position 293 replace Pro with Gly; or

h) at about position 298 replace Phe with Trp;

wherein the position of the mutation is determined by alignment of the amino acid sequence of the selected anthranilate synthase with an Agrobacterium tumefaciens anthranilate synthase amino acid sequence. Examples of anthranilate synthases having such mutations include those with SEQ ID NOs: 58-65, 69, 70, and 84-94.

The isolated DNA can encode other elements and functions. Any element or function contemplated by one of skill in the art can be included. For example, the isolated DNA can also include a promoter that can function in a plant cell that is operably linked to the DNA encoding the anthranilate synthase. The isolated DNA can further encode a plastid transit peptide. The isolated DNA can also encode a selectable marker or a reporter gene. Such a selectable marker gene can impart herbicide resistance to cells of said plant, high protein content, high oil content, high lysine content, high isoleucine content, high tocopherol content and the like. The DNA sequence can also comprise a sequence encoding one or more of the insecticidal proteins derived from Bacillus thuringiensis.

The present invention further provides vectors comprising an isolated DNA of the invention. Such vectors can be used to express anthranilate synthase polypeptides in prokaryotic and eukaryotic cells, to transform plant cells and to generate transgenic plants.

The present invention also provides a transgenic plant comprising an isolated DNA of the invention. Expression of these isolated DNAs in the transgenic plant can result in an elevated level of L-tryptophan, preferably free L-tryptophan, in the transgenic plant, e.g., in the seeds or other parts of the plant. The level is increased above the level of L-tryptophan in the cells of a plant that differ from the cells of the transgenic soybean plant by the absence of the DNA, e.g., the corresponding untransformed cells or an untransformed plant with the same genetic background. The DNA is preferably heritable in that it is preferably transmitted through a complete normal sexual cycle of the fertile plant to its progeny and to further generations.

Transgenic plants that can have such an isolated DNA include dicotyledonous plants (dicots), for example, soybean or canola. Alternatively, the transgenic plants can be monocotyledonous plants (monocots), for example, maize, rice, wheat, barley, or sorghum.

The present invention also provides a seed of any of the transgenic plants containing any of the isolated DNAs, anthranilate synthase polypeptides, transgenes or vectors of the invention.

The present invention further provides an animal feed or human food that contains at least a portion of a plant having an isolated DNA or DNA construct of the invention. Portions of plants that can be included in the animal feed or human food include, for example, seeds, leaves, stems, roots, tubers, or fruits. Desirable portions of plants have increased levels of tryptophan provided by expression of an anthranilate synthase encoded by an isolated DNA of the invention.

The present invention further provides a method for altering, preferably increasing, the tryptophan content of a plant (dicot or a monocot) by introducing an isolated DNA of the invention into regenerable cells of the plant. The DNA sequence is preferably operably linked to at least one promoter operable in the plant cells. The transformed cells are identified or selected, and then regenerated to yield a plant comprising cells that can express a functional anthranilate synthase polypeptide. In some embodiments, the DNA encoding the anthranilate synthase, or domain thereof, is a mutant DNA. The introduced DNA is preferably heritable and the plant is preferably a fertile plant. For example, the introduced DNA preferably can be passed by a complete sexual cycle to progeny plants, and can impart the high tryptophan phenotype to subsequent generations of progeny.

The anthranilate synthase-encoding DNAs, are preferably incorporated into vectors or “transgenes” that can also include DNA sequences encoding transit peptides, such as plastid transit peptides, and selectable marker or reporter genes, operably linked to one or more promoters that are functional in cells of the target plant. The promoter can be, for example, an inducible promoter, a tissue specific promoter, a strong promoter or a weak promoter. Other transcription or translation regulatory elements, e.g., enhancers or terminators, can also be functionally linked to the anthranilate synthase-encoding DNA segment.

Cells in suspension culture or as embryos, intact tissues or organs can be transformed by a wide variety of transformation techniques, for example, by microprojectile bombardment, electroporation and Agrobacterium tumefaciens-mediated transformation, and other procedures available to the art.

Thus, the cells of the transformed plant comprise a native anthranilate synthase gene and a transgene or other DNA segment encoding an exogenous anthranilate synthase. The expression of the exogenous anthranilate synthase in the cells of the plant can lead to increased levels of tryptophan and its secondary metabolites. In some embodiments, such expression confers tolerance to an amount of endogenous L-tryptophan analogue, for example, so that at least about 10% more anthranilate synthase activity is present than in a plant cell having a wild type or tryptophan-sensitive anthranilate synthase.

The present invention also provides a method for altering the tryptophan content in a plant comprising: (a) introducing into regenerable cells of a plant a transgene comprising an isolated DNA encoding an anthranilate synthase domain and a plastid transit peptide, operably linked to a promoter functional in the plant cell to yield transformed cells; and (b) regenerating a transformed plant from said transformed plant cells wherein the cells of the plant express the anthranilate synthase domain encoded by the isolated DNA in an amount effective to increase the tryptophan content in said plant relative to the tryptophan content in an untransformed plant of the same gentic background. The domain can be an anthranilate synthase α-domain. The anthranilate synthase domain can have one or more mutations, for example, mutations that reduce the sensitivity of the domain to tryptophan inhibition. Such mutations can be, for example, in the tryptophan-binding pocket. Such a domain can be, for example, an anthranilate synthase domain from Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Brucella melitensis, Escherichia coli, Euglena gracilis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Ruta graveolens, Rhodopseudomonas palustris, Salmonella typhimurium, Serratia marcescens, Sulfolobus solfataricus, soybean, rice, cotton or Zea mays. Ruta graveolens has its own chloroplast transport sequence that may be used with the anthranilate synthase transgene. Accordingly, one of skill in the art may not need to add a plastid transport sequence when using a Ruta graveolens DNA.

The present invention also provides novel isolated and purified DNA molecules comprising a DNA encoding a monomeric anthranilate synthase, or a domain thereof. Such an anthranilate synthase DNA can provide high levels of tryptophan when expressed within a plant. In some embodiments, the anthranilate synthase is substantially resistant to inhibition by free L-tryptophan or an analog thereof. Examples of novel DNA sequences contemplated by the invention include but are not limited to DNA molecules isolated from Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Bradyrhizobium japonicum, Brucella melitensis, Escherichia coli, Euglena gracilis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Ruta graveolens, Rhodopseudomonas palustris, Rhodospirillum rubrum, Salmonella typhimurium, Serratia marcescens, Sorghum bicolor, Sulfolobus solfataricus, Thermobifida fusca, or Zea mays (maize), or other such anthranilate synthases.

These DNA sequences include synthetic or naturally-occurring monomeric forms of anthranilate synthase that have the α-domain of anthranilate synthase linked to at least one other anthranilate synthase domain on a single polypeptide chain. The monomeric anthranilate synthase can, for example, be a fusion of an anthranilate synthase α or β domain. Such an anthranilate synthase α or β domain can be derived from Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Bradyrhizobium japonicum, Brucella melitensis, Escherichia coli, Euglena gracilis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Ruta graveolens, Rhodopseudomonas palustris, Rhodospirillum rubrum, Salmonella typhimurium, Serratia marcescens, Sorghum bicolor, Sulfolobus solfataricus, Thermobifida fusca, sorghum, soybean, rice, cotton, wheat, tobacco, or Zea mays (maize) or any gene encoding a subunit or domain of anthranilate synthase. Such anthranilate synthases and domains thereof are also exemplified herein by the anthranilate synthase nucleic acids isolated from Agrobacterium tumefaciens, (SEQ ID NOs: 1, 75, or 84-94), Zea mays, (SEQ ID NOs: 2, 67, 68, 96, 116, or 136), Ruta graveolens (SEQ ID NO: 3), Anabaena M22983, Arabidopsis thaliana (SEQ ID NO: 45), Azospirillum brasilense (SEQ ID NO: 122), Brucella melitensis (SEQ ID NO: 123), Mesorhizobium loti (SEQ ID NO: 121), Nostoc sp. PCC7120 (SEQ ID NOs: 124 or 125), Rhizobium meliloti, Rhodopseudomonas palustris (SEQ ID NO: 126), Sulfolobus solfataricus, rice (SEQ ID NOs: 94, 95, 119, or 120), wheat (SEQ ID NO: 97), tobacco (SEQ ID NO: 98), Gossypium hirsutum (SEQ ID NOs: 104 or 105), Glycine max (SEQ ID NOs: 106, 107, 112, or 113), Bradyrhizobium janonicum (SEQ ID NO: 127), Rhodospirillum rubrum (SEQ ID NO: 128), Thermobifida fusca (SEQ ID NO: 129) or Sorghum bicolor (SEQ ID NOs: 134 or 135). These nucleotide sequences encode anthranilate synthases or α-domains or β domains thereof from Agrobacterium tumefaciens (SEQ ID NOs: 4, 58-65, 69, or 70); Zea mays (SEQ ID NOs: 5, 66, 101, 118, or 137) and Ruta graveolens (SEQ ID NO: 6), Anabaena M22983, Azospirillum brasilense (SEQ ID NO: 78), Brucella melitensis (SEQ ID NO: 79), Mesorhizobium loti (SEQ ID NO: 77), Nostoc sp. PCC7120 (SEQ ID NOs: 80 or 81), Rhizobium meliloti (SEQ ID NOs: 7 or 43), Rhodopseudomonas palustris (SEQ ID NOs: 57 or 82), Sulfolobus solfataricus (SEQ ID NOs: 8 or 44), rice (SEQ ID NOs: 99, 100, or 117), wheat (SEQ ID NO: 102), tobacco (SEQ ID NO: 103), Gossypium hirsutum (SEQ ID NOs: 108 or 109), Glycine max (SEQ ID NOs: 110 or 111), Bradyrhizobium japonicum (SEQ ID NO: 130), Rhodospirillum rubrum (SEQ ID NO: 131), Thermobifida fusca (SEQ ID NO: 132) or Sorghum bicolor (SEQ ID NO: 133).

The present invention also provides an isolated DNA molecule comprising a DNA sequence encoding an Agrobacterium tumefaciens anthranilate synthase or a domain thereof having enzymatic activity. Such a DNA molecule can encode an anthranilate synthase having SEQ ID NOs: 4, 58-65, 69, or 70, a domain or variant thereof having anthranilate synthase activity. The DNA molecule can also have a sequence comprising SEQ ID NOs: 1, 75, or 84-93, or a domain or variant thereof. Coding regions of any DNA molecule provided herein can also be optimized for expression in a selected organism, for example, a selected plant or microbe. An example of a DNA molecule having optimized codon usage for a selected plant is an Agrobacterium tumefaciens anthranilate synthase DNA molecule having SEQ ID NO: 75.

The present invention also provides an isolated and purified DNA molecule comprising a DNA sequence encoding a Zea mays anthranilate synthase domain. Such a DNA molecule can encode an anthranilate synthase domain having SEQ ID NOs: 5 or 66, or a variant or derivative thereof having anthranilate synthase activity. The DNA molecule can also have a sequence comprising SEQ ID NOs: 2, 67, or 68, or a domain or variant thereof.

The present invention further provides an isolated DNA molecule of at least 8 nucleotides that hybridizes to the complement of a DNA molecule comprising any one of SEQ ID NOs: 1, 75, or 84-94 under stringent conditions. Such a DNA molecule can be a probe or a primer, for example, a nucleic acid having any one of SEQ ID NOs: 9-42, 47-56, or 138-143. Alternatively, the DNA it can include up to an entire coding region for a selected anthranilate synthase, or a domain thereof. Such a DNA can also include a DNA sequence encoding a promoter operable in plant cells and/or a DNA sequence encoding a plastid transit peptide. The present invention further contemplates vectors for transformation and expression of these types of DNA molecules in plants and/or microbes.

Functional anthranilate synthase DNA sequences and functional anthranilate synthase polypeptides that exhibit 50%, preferably 60%, more preferably 70%, even more preferably 80%, most preferably 90%, e.g., 95% to 99%, sequence identity to the DNA sequences and amino acid sequences explicitly described herein are also within the scope of the present invention. For example, 85% identity means that 85% of the amino acids are identical when the 2 sequences are aligned for maximum matching. Gaps (in either of the 2 sequences being matched) are allowed in maximizing matching; gap lengths of 5 or less are preferred with 2 or less being more preferred.

Alternatively and preferably, two polypeptide sequences are homologous, as this term is used herein, if they have an alignment score of more than 5 (in standard deviation units) using the program ALIGN with the mutation data matrix and a gap penalty of 6 or greater. See Dayhoff, M. O., in “Atlas of Protein Sequence and Structure”, 1972, volume 5, National Biomedical Research Foundation, pp. 101-110, and Supplement 2 to this volume, pp. 1-10. The 2 sequences or parts thereof are more preferably homologous if their amino acids are greater than or equal to 50% identical when optimally aligned using the ALIGN program. The present invention further provides expression vectors for generating a transgenic plant with high seed levels of tryptophan comprising an isolated DNA sequence encoding a monomeric anthranilate synthase comprising an anthranilate synthase α-domain linked to an anthranilate synthase β-domain and a plastid transit peptide, operably linked to a promoter functional in a plant cell. Such a monomeric anthranilate synthase can, for example, be an Agrobacterium tumefaciens, Rhizobium meliloti, Mesorhizobium loti, Brucella melitensis, Nostoc sp. PCC7120, Azospirillum brasilense, Anabaena M22983, Bradyrhizobium japonicum, Rhodospirillum rubrum, or Thermobifida fusca anthranilate synthase. The monomeric anthranilate synthase can also be a fusion of anthranilate synthase α- and β-domains derived from Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Brucella melitensis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Rhodopseudomonas palustris, Ruta graveolens, Sulfolobus solfataricus, Salmonella typhimurium, Serratia marcescens, Bradyrhizobium japonicum, Rhodospirillum rubrum, Thermobifida fusca, Sorghum bicolor, soybean, rice, cotton, wheat, tobacco, Zea mays, or any gene encoding a subunit or domain of anthranilate synthase.

The transmission of the isolated and purified anthranilate synthase DNA providing increased levels of tryptophan can be evaluated at a molecular level, e.g., Southern or Northern blot analysis, PCR-based methodologies, the biochemical or immunological detection of anthranilate synthase, or by phenotypic analyses, i.e., whether cells of the transformed progeny can grow in the presence of an amount of an amino acid analog of tryptophan that inhibits the growth of untransformed plant cells.

The present invention also provides a method of producing anthranilate synthase in a prokaryotic or eukaryotic host cell, such as a yeast, insect cell, or bacterium, which can be cultured, preferably on a commercial scale. The method includes the steps of introducing a transgene comprising a DNA segment encoding an anthranilate synthase, or a domain thereof, such as a monomeric anthranilate synthase, comprising at least the α and β anthranilate synthase domains, or functional variant thereof, into a host cell and expressing anthranilate synthase in the host cell so as to yield functional anthranilate synthase or domain thereof. A transgene generally includes transcription and translation regulatory elements, e.g., a promoter, functional in host cell, either of eukaryotic or prokaryotic origin. Preferably, the transgene is introduced into a prokaryotic cell, such as Escherichia coli, or a eukaryotic cell, such as a yeast or insect cell, that is known to be useful for production of recombinant proteins. Culturing the transformed cells can lead to enhanced production of tryptophan and its derivatives, which can be recovered from the cells or from the culture media. Accumulation of tryptophan may also lead to the increased production of secondary metabolites in microbes and plants, for example, indole containing metabolites such as simple indoles, indole conjugates, indole alkaloids, indole phytoalexins and indole glucosinalates in plants.

Anthranilate synthases insensitive to tryptophan have the potential to increase a variety of chorismate-derived metabolites, including those derived from phenylalanine due to the stimulation of phenylalanine synthesis by tryptophan via chorismate mutase. See Siehl, D. The biosynthesis of tryptophan, tyrosine, and phenylalanine from chorismate in Plant Amino Acids: Biochemistry and Biotechnology, ed. BK Singh, pp. 171-204. Other chorismate-derived metabolites that may increase when feedback insensitive anthranilate synthase s are present include phenylpropanoids, flavonoids, and isoflavonoids, as well as those derived from anthranilate, such as indole, indole alkaloids, and indole glucosinolates. Many of these compounds are important plant hormones, plant defense compounds, chemopreventive agents of various health conditions, and/or pharmacologically active compounds. The range of these compounds whose synthesis might be increased by expression of anthranilate synthase depends on the organism in which the anthranilate synthase is expressed. The present invention contemplates synthesis of tryptophan and other useful compounds in a variety of prokaryotic and eukaryotic cells or organisms, including plant cells, microbes, fungi, yeast, bacteria, insect cells, and mammalian cells.

Hence, the present invention provides a method for producing tryptophan comprising: culturing a prokaryotic or eukaryotic host cell comprising an isolated DNA under conditions sufficient to express a monomeric anthranilate synthase encoded by the isolated DNA, wherein the monomeric anthranilate synthase comprises an anthranilate synthase α domain and an anthranilate synthase β domain, and wherein the conditions sufficient to express a monomeric anthranilate synthase comprise nutrients and precursors sufficient for the host cell to synthesize tryptophan utilizing the monomeric anthranilate synthase.

Examples of useful compounds that may be generated upon expression in a variety of host cells and/or organisms include indole acetic acid and other auxins, isoflavonoid compounds important to cardiovascular health found in soy, volatile indole compounds which act as signals to natural enemies of herbivorous insects in maize, anticarcinogens such as indole glucosinolates (indole-3-carbinol) found in the Cruciferae plant family, as well as indole alkaloids such as ergot compounds produced by certain species of fungi. (Barnes et al., Adv Exp Med Biol., 401:87 (1996); Frey et al., Proc Natl Acad. Sci., 97:14801 (2000); Muller et al., Biol. Chem., 381:679 (2000); Mantegani et al., Farmaco, 54:288 (1999); Zeligs, J Med Food, 1:67 (1998); Mash et al., Ann NY Acad Sci., 844:274 (1998); Melanson et al., Proc Natl Acad. Sci., 94:13345 (1997); Broadbent et al., Curr Med Chem., 5:469 (1998)).

The present invention also provides an isolated and purified DNA molecule of at least seven nucleotide bases that hybridizes under moderate, and preferably, high stringency conditions to the complement of an anthranilate synthase encoding DNA molecule. Such isolated and purified DNA molecules comprise novel DNA segments encoding anthranilate synthase or a domain or mutant thereof. The mutant DNA can encode an anthranilate synthase that is substantially resistant to inhibition by free L-tryptophan or an amino acid analog of tryptophan. Such anthranilate synthase DNA molecules can hybridize, for example, to an Agrobacterium tumefaciens, Rhodopseudomonas palustris or Ruta graveolens anthranilate synthase, or an α-domain thereof, including functional mutants thereof. When these DNA molecules encode a functional anthranilate synthase or an anthranilate synthase domain, they are termed “variants” of the primary DNA molecules encoding anthranilate synthase, anthranilate synthase domains or mutants thereof. Shorter DNA molecules or oligonucleotides can be employed as primers for amplification of target DNA sequences by PCR, or as intermediates in the synthesis of full-length genes.

Also provided is a hybridization probe comprising a novel isolated and purified DNA segment of at least seven nucleotide bases, which is detectably labeled or which can bind to a detectable label, which DNA segment hybridizes under moderate or, preferably, high stringency conditions to the non-coding strand of a DNA molecule comprising a DNA segment encoding an anthranilate synthase such as a monomeric anthranilate synthase, or a domain thereof, such as the α-domain, including functional mutants thereof, that are substantially resistant to inhibition by an amino acid analog of tryptophan. Moderate and stringent hybridization conditions are well known to the art, see, for example sections 0.47-9.51 of Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 ^ndEdition (1989); see, also, Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3^rdEdition (Jan. 15, 2001). For example, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (SSC); 0.1% sodium lauryl sulfate (SDS) at 50° C., or (2) employ a denaturing agent such as formamide during hybridization, e.g., 50% formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42° C. Another example is use of 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% sodium dodecylsulfate (SDS), and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC and 0.1% SDS.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a restriction map of plasmid pMON61600. [0060]
FIG. 2 depicts the translated sequence of the [0061] Agrobacterium tumefaciens anthranilate synthase DNA sequence (upper sequence) (SEQ ID NO: 4) and the translated sequence of the anthranilate synthase DNA sequence from Rhizobium meliloti (lower sequence) (SEQ ID NO: 7).
FIG. 3 is a restriction map of plasmid pMON34692. [0062]
FIG. 4 is a restriction map of plasmid pMON34697. [0063]
FIG. 5 is a restriction map of plasmid pMON34705. [0064]
FIGS. [0065] 6A-B depicts an anthranilate synthase amino acid sequence alignment comparing the Agrobacterium tumefaciens α-domain sequence (SEQ ID NO: 4) and the Sulfolobus solfataricus α-domain sequence (SEQ ID NO: 8).
FIGS. [0066] 7A-B depicts the sequences of the 34 primers (SEQ ID NOs: 9-42) used to mutate SEQ ID NO: 1. The mutated codons are underlined and the changed bases are in lower case.
FIG. 8 depicts a restriction map of plasmid pMON13773. [0067]
FIG. 9 depicts a restriction map of plasmid pMON58044. [0068]
FIG. 10 depicts a restriction map of plasmid pMON53084. [0069]
FIG. 11 depicts a restriction map of plasmid pMON58045. [0070]
FIG. 12 depicts a restriction map of plasmid pMON58046. [0071]
FIG. 13 depicts a restriction map of plasmid pMON38207. [0072]
FIG. 14 depicts a restriction map of plasmid pMON58030. [0073]
FIG. 15 depicts a restriction map of plasmid pMON58006. [0074]
FIG. 16 depicts a restriction map of plasmid pMON58041. [0075]
FIG. 17 depicts a restriction map of plasmid pMON58028. [0076]
FIG. 18 depicts a restriction map of plasmid pMON58042. [0077]
FIG. 19 depicts a restriction map of plasmid pMON58029. [0078]
FIG. 20 depicts a restriction map of plasmid pMON58043. [0079]
FIGS. [0080] 21A-D depicts a multiple sequence alignment of monomeric “TrpEG” anthranilate synthases having SEQ ID NOs: 4 and 43 (derived from Agrobacterium tumefaciens and Rhizobium meliloti, respectively) with the TrpE (α) and TrpG (β) domains of heterotetrameric anthranilate synthases from Sulfolobus solfataricus (SEQ ID NO: 44) and Arabidopsis thaliana (SEQ ID NO: 45). Linker regions are underlined.
FIG. 22 is a restriction map of plasmid pMON52214. [0081]
FIG. 23 is a restriction map of plasmid pMON53901. [0082]
FIG. 24 is a restriction map of plasmid pMON39324. [0083]
FIG. 25 is a restriction map of plasmid pMON39322. [0084]
FIG. 26 is a restriction map of plasmid pMON39325. [0085]
FIG. 27 is a graph depicting free tryptophan levels in soybean seeds transformed with pMON39325. There were five observations from each event. NT represents non-transgenic soybean seed. [0086]
FIG. 28 is a restriction map of plasmid pMON25997. [0087]
FIG. 29 is a restriction map of plasmid pMON62000. [0088]
FIG. 30 depicts the sequence of the truncated trpE gene of [0089] Escherichia coli EMG2 (K-12 wt F+) (SEQ ID NO: 46). The first 30 bp and the last 150 bp of this trpE nucleic acid are connected by an EcoRI restriction site. The beginning of the trpG gene follows the trpE stop codon.
FIG. 31 schematically depicts construction of the in-frame deletion in the [0090] E. coli trpE gene.
FIGS. [0091] 32A-C depicts the DNA (SEQ ID NO: 1) and amino acid (SEQ ID NO: 4) sequences of the α-domain of the anthranilate synthase gene isolated from Agrobacterium tumefaciens.
FIGS. [0092] 33A-C depicts the DNA (SEQ ID NO: 2) sequence of the α-domain of the anthranilate synthase gene isolated from Zea mays. FIG. 33D depicts the amino acid (SEQ ID NO: 5) sequence of the α-domain of the anthranilate synthase gene isolated from Zea mays.
FIG. 34 is a restriction map of plasmid pMON58120. [0093]
FIGS. [0094] 35A-E provides a sequence comparison of anthranilate synthase amino acid sequences from Agrobacterium tumefaciens (AgrTu_—15889565) (SEQ ID NO: 4), Rhizobium meliloti (RhiMe_—136328) (SEQ ID NO: 7), Mesorhizobium loti (MesLo_—13472468) (SEQ ID NO: 77), Azospirillum brasilense (AzoBr_—1717765) (SEQ ID NO: 78), Brucella melitensis (BruMe_—17986732) (SEQ ID NO: 79), Nostoc sp. (Nostoc_—17227910) (SEQ ID NO: 80), Nostoc sp. (Nostoc_—17230725) (SEQ ID NO: 81), and Rhodopseudomonas palustris (RhoPa_TrpEG) (SEQ ID NO: 82).
FIGS. [0095] 36A-B provides an optimized nucleotide sequence for Agrobacterium tumefaciens anthranilate synthase (SEQ ID NO: 75).
FIGS. [0096] 37A-C provides an alignment of the wild type (top strand) and optimized (bottom strand) Agrobacterium tumefaciens anthranilate synthase nucleotide sequences (SEQ ID NOs: 1 and 75). These two sequences are 94% identical, as demonstrated by the middle strand.
FIG. 38 is a restriction map of plasmid pMON66877. [0097]
FIG. 39 is a restriction map of plasmid pMON66878. [0098]
FIG. 40 is a restriction map of plasmid pMON66879. [0099]
FIG. 41 is a restriction map of plasmid pMON66595. [0100]
FIG. 42 is a restriction map of plasmid pMON66599. [0101]
FIG. 43 is a restriction map of plasmid pMON66598. [0102]
FIG. 44 is a restriction map of plasmid pMON66596. [0103]
FIG. 45 is a restriction map of plasmid pMON79951. [0104]
FIG. 46 is a restriction map of plasmid pMON79955. [0105]
FIG. 47 is a restriction map of plasmid pMON79956. [0106]
FIG. 48 is a restriction map of plasmid pMON36524. [0107]
FIG. 49 is a restriction map of plasmid pMON30167. [0108]

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides isolated DNAs, vectors, host cells and transgenic plants comprising an isolated nucleic acid encoding an anthranilate synthase capable of providing high levels of tryptophan upon expression within the plant. In one embodiment, the isolated nucleic acid encodes a monomeric anthranilate synthase (AS). In other embodiments, the isolated nucleic acid encodes an anthranilate synthase, or a domain thereof, that is substantially resistant to inhibition by free L-tryptophan or an amino acid analog of tryptophan. Expression of the anthranilate synthase, or domain thereof, elevates the level of tryptophan, e.g., free tryptophan in the seed, over the level present in the plant absent such expression. [0109]
Methods are also provided for producing transgenic plants having nucleic acids associated with increased anthranilate synthase activity, and producing cultured cells, plant tissues, plants, plant parts and seeds that produce high levels of tryptophan. Such transgenic plants can preferably sexually transmit the ability to produce high levels of tryptophan to their progeny. Also described are methods for producing isolated DNAs encoding mutant anthranilate synthases, and cell culture selection techniques to select for novel genotypes that overproduce tryptophan and/or are resistant to tryptophan analogs. For example, to produce soybean lines capable of producing high levels of tryptophan, transgenic soybean cells that contain at least on of the isolated DNAs of the present invention, are prepared and characterized, then regenerated into plants. Some of the isolated DNAs are resistant to growth inhibition by the tryptophan analog. The methods provided in the present invention may also be used to produce increased levels of free tryptophan in dicot plants, such as other legumes, as well as in monocots, such as the cereal grains. [0110]

Definitions

As used herein, “altered” levels of tryptophan in a transformed plant, plant tissue, plant part or plant cell are levels which are greater or lesser than the levels found in the corresponding untransformed plant, plant tissue, plant part or plant cell. [0111]
As used herein, a “α-domain” is a portion of an enzyme or enzymatic complex that binds chorismate and eliminates the enolpyruvate side chain. Such an α-domain can be encoded by a TrpE gene. In some instances, the α-domain is a single polypeptide that functions only to bind chorismate and to eliminate the enolpyruvate side chain from chorismate. In other instances, the α-domain is part of a larger polypeptide that can carry out other enzymatic functions in addition to binding chorismate and eliminating the enolpyruvate side chain from chorismate. [0112]
The term “β-domain” refers to a portion of an enzyme or enzymatic complex that transfers an amino group from glutamine to the position on the chorismate ring that resides between the carboxylate and the enolpyruvate moieties. Such a β-domain can be encoded by a TrpG gene. In some instances, the β-domain is a single polypeptide that functions only to transfer an amino group from glutamine to the position on the chorismate ring that resides between the carboxylate and the enolpyruvate moieties. In other instances, the β-domain is part of a larger polypeptide that can carry out other enzymatic functions in addition to transferring an amino group from glutamine to the position on the chorismate ring that resides between the carboxylate and the enolpyruvate moieties. [0113]
As used herein, “an amino acid analog of tryptophan” is an amino acid that is structurally related to tryptophan and that can bind to the tryptophan-binding site in a wild type anthranilate synthase. These analogs include, but are not limited to, 6-methylanthranilate, 5-methyltryptophan, 4-methyltryptophan, 5-fluorotryptophan, 5-hydroxytryptophan, 7-azatryptophan, 3β-indoleacrylic acid, 3-methylanthranilic acid, and the like. [0114]
The phrase “consists essentially of” as used with respect to the present DNA molecules, sequences or segments is defined to mean that a major portion of the DNA molecule, sequence or segment encodes an anthranilate synthase. Unless otherwise indicated, the DNA molecule, sequence or segment generally does not encode proteins other than an anthranilate synthase. [0115]
The term “complementary to” is used herein to mean that the sequence of a nucleic acid strand could hybridize to all, or a portion, of a reference polynucleotide sequence. For illustration, the nucleotide sequence “TATAC” has 100% identity to a [0116] reference sequence 5′-TATAC-3′ but is 100% complementary to a reference sequence 5′-GTATA-3′.
As used herein, an “exogenous” anthranilate synthase is an anthranilate synthase that is encoded by an isolated DNA that has been introduced into a host cell, and that is preferably not identical to any DNA sequence present in the cell in its native, untransformed state. An “endogenous” or “native” anthranilate synthase is an anthranilate synthase that is naturally present in a host cell or organism. [0117]
As used herein, “increased” or “elevated” levels of free L-tryptophan in a plant cell, plant tissue, plant part or plant are levels that are about 2 to 200 times, preferably about 5 to 150 times, and more preferably about 10-100 times, the levels found in an untransformed plant cell, plant tissue, plant part or plant, i.e., one where the genome has not been altered by the presence of an exogenous anthranilate synthase nucleic acid or domain thereof. For example, the levels of free L-tryptophan in a transformed plant seed are compared with those in an untransformed plant seed (“the starting material”). [0118]
DNA molecules encoding an anthranilate synthase, and DNA molecules encoding a transit peptide or marker/reporter gene are “isolated” in that they were taken from their natural source and are no longer within the cell where they normally exist. Such isolated DNA molecules may have been at least partially prepared or manipulated in vitro, e.g., isolated from a cell in which they are normally found, purified, and amplified. Such isolated DNA molecules can also be “recombinant” in that they have been combined with exogenous DNA molecules or segments. For example, a recombinant DNA can be an isolated DNA that is operably linked to an exogenous promoter, or to a promoter that is endogenous to the host cell. [0119]
As used herein with respect to anthranilate synthase, the term “monomeric” means that two or more anthranilate synthase domains are incorporated in a functional manner into a single polypeptide chain. The monomeric anthranilate synthase may be assembled in vivo into a dimeric form. Monomeric anthranilate synthase nucleic acids and polypeptides can be isolated from various organisms such as [0120] Agrobacterium tumefaciens, Anabaena M22983, Azospirillum brasilense, Brucella melitensis, Euglena gracilis, Mesorhizobium loti, Nostoc sp. PCC7120 or Rhizobium meliloti. Alternatively, monomeric anthranilate synthase nucleic acids and polypeptides can be constructed from a combination of domains selected from any convenient monomeric or multimeric anthranilate synthase gene. Such organisms include, for example, Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Brucella melitensis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Rhodopseudomonas palustris, Ruta graveolens, Sulfolobus solfataricus, Salmonella typhimurium, Serratia marcescens, soybean, rice, cotton, Zea mays, or any gene encoding a subunit or domain of anthranilate synthase. Nucleic acids encoding the selected domains can be linked recombinantly. For example, a nucleic acid encoding the C-terminus of an α-domain can be linked to a nucleic acid encoding the N-terminus of the β-domain, or vice versa, by forming a phosphodiester bond. As an alternative, such single domain polypeptides can be linked chemically. For example, the α-domain can be linked via its C-terminus to the N-terminus of the β-domain, or vice versa, by forming a peptide bond.
As used herein, a “native” gene means a gene that has not been changed in vitro, i.e., a “wild-type” gene that has not been mutated in vitro. [0121]
The term “plastid” refers to the class of plant cell organelles that includes amyloplasts, chloroplasts, chromoplasts, elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids. These organelles are self-replicating, and contain what is commonly referred to as a “chloroplast genome,” a circular DNA molecule that ranges in size from about 120 to about 217 kb, depending upon the plant species, and which usually contains an inverted repeat region. [0122]
As used herein, “polypeptide” means a continuous chain of amino acids that are all linked together by peptide bonds, except for the N-terminal and C-terminal amino acids that have amino and carboxylate groups, respectively, and that are not linked in peptide bonds. Polypeptides can have any length and can be post-translationally modified, for example, by glycosylation or phosphorylation. [0123]
As used herein, a plant cell, plant tissue or plant that is “resistant or tolerant to inhibition by an amino acid analog of tryptophan” is a plant cell, plant tissue, or plant that retains at least about 10% more anthranilate synthase activity in the presence of an analog of L-tryptophan, than a corresponding wild type anthranilate synthase. In general, a plant cell, plant tissue, or plant that is “resistant or tolerant to inhibition by an amino acid analog of tryptophan” can grow in an amount of an amino acid analog of tryptophan that normally inhibits growth of the untransformed plant cell, plant tissue, or plant, as determined by methodologies known to the art. For example, a homozygous backcross converted inbred plant transformed with a DNA molecule that encodes an anthranilate synthase that is substantially resistant or tolerant to inhibition by an amino acid analog of tryptophan grows in an amount of an amino acid analog of tryptophan that inhibits the growth of the corresponding, i.e., substantially isogenic, recurrent inbred plant. [0124]
As used herein, an anthranilate synthase that is “resistant or tolerant to inhibition by tryptophan or an amino acid analog of tryptophan” is an anthranilate synthase that retains greater than about 10% more activity than a corresponding “wild-type” or native susceptible anthranilate synthase, when the tolerant/resistant and wild type anthranilate synthases are exposed to equivalent amounts of tryptophan or an amino acid analog of tryptophan. Preferably the resistant or tolerant anthranilate synthase retains greater than about 20% more activity than a corresponding “wild-type” or native susceptible anthranilate synthase. [0125]
As used herein with respect to anthranilate synthase, the phrase “a domain thereof,” includes a structural or functional segment of a full-length anthranilate synthase. A structural domain includes an identifiable structure within the anthranilate synthase. An example of a structural domain includes an alpha helix, a beta sheet, an active site, a substrate or inhibitor binding site and the like. A functional domain includes a segment of an anthranilate synthase that performs an identifiable function such as a tryptophan binding pocket, an active site or a substrate or inhibitor binding site. Functional domains of anthranilate synthase include those portions of anthranilate synthase that can catalyze one step in the biosynthetic pathway of tryptophan. For example, an α-domain is a domain that can be encoded by trpE and that can transfer NH[0126] ₃to chorismate and form anthranilate. A β-domain can be encoded by trpG and can remove an amino group from glutamine to form ammonia. Hence, a functional domain includes enzymatically active fragments and domains of an anthranilate synthase. Mutant domains of anthranilate synthase are also contemplated. Wild type anthranilate synthase nucleic acids utilized to make mutant domains include, for example, any nucleic acid encoding a domain of Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Brucella melitensis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Rhodopseudomonas palustris, Ruta graveolens, Sulfolobus solfrataricus, Salmonella typhimurium, Serratia marcescens, soybean, rice, cotton, wheat, tobacco, Zea mays, or any gene encoding a subunit or domain of anthranilate synthase that can comprise at least one amino acid substitution in the coding region thereof. Domains that are mutated or joined to form a monomeric anthranilate synthase having increased tryptophan biosynthetic activity, greater stability, reduced sensitivity to tryptophan or an analog thereof, and the like, are of particular interest.
The term “5′ UTR” refers to the untranslated region of DNA upstream, or 5′, of the coding region of a gene. [0127]
The term “3′ UTR” refers to the untranslated region of DNA downstream, or 3′, of the coding region of a gene. [0128]
The term “substantially homologous” refers to two sequences which are at least about 90% identical in sequence, as measured by the BestFit program described herein ([0129] Version 10; Genetics Computer Group, Inc., University of Wisconsin Biotechnology Center, Madison, Wis.), using default parameters.
The percent of sequence identity is preferably determined using the “Best Fit” or “Gap” program of the Sequence Analysis Software Package ([0130] Version 10; Genetics Computer Group, Inc., University of Wisconsin Biotechnology Center, Madison, Wis.). “Gap” utilizes the algorithm of Needleman and Wunsch (1970) to find the alignment of two sequences that maximizes the number of matches and minimizes the number of gaps.
“BestFit” performs an optimal alignment of the best segment of similarity between two sequences and inserts gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman (Smith and Waterman, 1981; Smith et al., 1983). The percent identity is most preferably determined using the “Best Fit” program using default parameters. As used herein, the term “operatively linked” means that a promoter is connected to a coding region in such a way that the transcription of that coding region is controlled and regulated by that promoter. Means for operatively linking a promoter to a coding region are well known in the art. [0131]

General Concepts

The present invention relates to novel nucleic acids and methods for obtaining plants that produce elevated levels of free L-tryptophan. The overproduction results from the introduction and expression of a nucleic acid encoding anthranilate synthase, or a domain thereof. Such anthranilate synthase nucleic acids include wild type or mutant α-domains, or monomeric forms of anthranilate synthase. A monomeric form of anthranilate synthase comprises at least two anthranilate synthase domains in a single polypeptide chain, e.g., an α-domain linked to a β-domain. [0132]
Native plant anthranilate synthases are generally quite sensitive to feedback inhibition by L-tryptophan and analogs thereof. Such inhibition constitutes a key mechanism for regulating the tryptophan synthetic pathway. Therefore, an anthranilate synthase or a domain thereof that is highly active, more efficient or that is inhibited to a lesser extent by tryptophan or an analog thereof will likely produce elevated levels of tryptophan. According to the invention, the [0133] Agrobacterium tumefaciens anthranilate synthase is particularly useful for producing high levels of tryptophan.
To generate high levels of tryptophan in a plant or a selected host cell, the selected anthranilate synthase nucleic acid is isolated and may be manipulated in vitro to include regulatory signals required for gene expression in plant cells or other cell types. Because the tryptophan biosynthetic pathway in plants is reported to be present within plastids, the exogenous anthranilate synthase nucleic acids are either introduced into plastids or are modified by adding a nucleic acid segment encoding an amino-terminal plastid transit peptide. Such a plastid transit peptide can direct the anthranilate synthase gene product into plastids. In some instances the anthranilate synthase may already contain a plastid transport sequence, in which case there is no need to add one. [0134]
In order to alter the biosynthesis of tryptophan, the nucleic acid encoding an anthranilate synthase activity must be introduced into plant cells or other host cells and these transformed cells identified, either directly or indirectly. An entire anthranilate synthase or a useful portion or domain thereof can be used. The anthranilate synthase is stably incorporated into the plant cell genome. The transcriptional signals controlling expression of the anthranilate synthase must be recognized by and be functional within the plant cells or other host cells. That is, the anthranilate synthase must be transcribed into messenger RNA (mRNA), and the mRNA must be stable in the plant cell nucleus and be transported intact to the cytoplasm for translation. The anthranilate synthase mRNA must have appropriate translational signals to be recognized and properly translated by plant cell ribosomes. The polypeptide gene product must substantially escape proteolytic attack in the cytoplasm, be transported into the correct cellular compartment (e.g. a plastid) and be able to assume a three-dimensional conformation that will confer enzymatic activity. The anthranilate synthase must further be able to function in the biosynthesis of tryptophan and its derivatives; that is, it must be localized near the native plant enzymes catalyzing the flanking steps in biosynthesis (presumably in a plastid) in order to obtain the required substrates and to pass on the appropriate product. [0135]
Even if all these conditions are met, successful overproduction of tryptophan is not a predictable event. The expression of some transgenes may be negatively affected by nearby chromosomal elements. If the high level of tryptophan is achieved by mutation to reduce feedback inhibition, there may be other control mechanisms compensating for the reduced regulation at the anthranilate synthase step. There may be mechanisms that increase the rate of breakdown of the accumulated amino acids. Tryptophan and related amino acids must be also overproduced at levels that are not toxic to the plant. Finally, the introduced trait must be stable and heritable in order to permit commercial development and use. [0136]
Isolation and Identification of DNA Coding for an Anthranilate Synthase [0137]
Nucleic acids encoding an anthranilate synthase can be identified and isolated by standard methods, for eample, as described by Sambrook et al., in “Molecular Cloning: A Laboratory Manual”, 2[0138] ^ndEdition (1989); Sambrook and Russell, in “Molecular Cloning: A Laboratory Manual”, 3rd Edition (Jan. 15, 2001). For example, a DNA sequence encoding an anthranilate synthase or a domain thereof can be identified by screening of a DNA or cDNA library generated from nucleic acid derived from a particular cell type, cell line, primary cells, or tissue. Examples of libraries useful for identifying and isolating an anthranilate synthase include, but are not limited to, a cDNA library derived from Agrobacterium tumefaciens strain A348, maize inbred line B73 (Stratagene, La Jolla, Calif., Cat. #937005, Clontech, Palo Alto, Calif., Cat. # FL1032a, #FL1032b, and FL1032n), genomic library from maize inbred line Mo17 (Stratagene, Cat. #946102), genomic library from maize inbred line B73 (Clontech, Cat. # FL1032d), genomic DNA from Anabaena M22983 (e.g., Genbank Accession No. GI 152445), Arabidopsis thaliana, Azospirillum brasilense (e.g., Genbank Accession No. GI 1174156), Brucella melitensis (GI 17982357), Escherichia coli, Euglena gracilis, Mesorhizobium loti (e.g., Genbank Accession No. GI 13472468), Nostoc sp. PCC7120 (e.g., Genbank Accession No. GI 17227910 or GI 17230725), Rhizobium meliloti (e.g., Genbank Accession No. GI 95177), Ruta graveolens, Rhodopseudomonas palustris, Salmonella typhimurium, Serratia marcescens, Sulfolobus solfataricus, soybean, rice, cotton, wheat, tobacco, Zea mays (maize), or other species. Moreover, anthranilate synthase nucleic acids can be isolated by nucleic acid amplification procedures using genomic DNA, mRNA or cDNA isolated from any of these species.
Screening for DNA fragments that encode all or a portion of the sequence encoding an anthranilate synthase can be accomplished by screening plaques from a genomic or cDNA library for hybridization to a probe of an anthranilate synthase gene from other organisms or by screening plaques from a cDNA expression library for binding to antibodies that specifically recognize anthranilate synthase. DNA fragments that hybridize to anthranilate synthase probes from other organisms and/or plaques carrying DNA fragments that are immunoreactive with antibodies to anthranilate synthase can be subcloned into a vector and sequenced and/or used as probes to identify other cDNA or genomic sequences encoding all or a portion of the desired anthranilate synthase gene. Preferred cDNA probes for screening a maize or plant library can be obtained from plasmid clones pDPG600 or pDPG602. [0139]
A cDNA library can be prepared, for example, by random oligo priming or oligo dT priming. Plaques containing DNA fragments can be screened with probes or antibodies specific for anthranilate synthase. DNA fragments encoding a portion of an anthranilate synthase gene can be subcloned and sequenced and used as probes to identify a genomic anthranilate synthase gene. DNA fragments encoding a portion of a bacterial or plant anthranilate synthase can be verified by determining sequence homology with other known anthranilate synthase genes or by hybridization to anthranilate synthase-specific messenger RNA. Once cDNA fragments encoding portions of the 5′, middle and 3′ ends of an anthranilate synthase are obtained, they can be used as probes to identify and clone a complete genomic copy of the anthranilate synthase gene from a genomic library. [0140]
Portions of the genomic copy or copies of an anthranilate synthase gene can be sequenced and the 5′ end of the gene identified by standard methods including either by DNA sequence homology to other anthranilate synthase genes or by RNAase protection analysis, for example, as described by Sambrook et al., in “Molecular Cloning: A Laboratory Manual”, 2[0141] ^ndEdition (1989); Sambrook and Russell, in “Molecular Cloning: A Laboratory Manual”, 3^rdEdition (Jan. 15, 2001). The 3′ and 5′ ends of the target gene can also be located by computer searches of genomic sequence databases using known AS coding regions. Once portions of the 5′ end of the gene are identified, complete copies of the anthranilate synthase gene can be obtained by standard methods, including cloning or polymerase chain reaction (PCR) synthesis using oligonucleotide primers complementary to the DNA sequence at the 5′ end of the gene. The presence of an isolated full-length copy of the anthranilate synthase gene can be verified by hybridization, partial sequence analysis, or by expression of a maize anthranilate synthase enzyme.
Exemplary isolated DNAs of the invention include DNAs having the following nucleotide SEQ ID NO: [0142]
SEQ ID NO: 1 [0143] Agrobacterium tumefaciens (wild type)
SEQ ID NO: 2 [0144] Zea mays (wild type, alpha2)
SEQ ID NO: 3 [0145] Ruta graveolens
SEQ ID NO: 46 truncated TrpE gene of [0146] E. coli EMG2 (K-12 wt F+)
SEQ ID NO: 67 [0147] Zea mays (C28 mutant)
SEQ ID NO: 68 [0148] Zea mays (C28+ terminator)
SEQ ID NO: 71 Chloroplast Targeting Peptide (g) [0149]
SEQ ID NO: 73 Chloroplast Targeting Peptide (a) [0150]
SEQ ID NO: 75 [0151] Agrobacterium tumefaciens (optimized)
SEQ ID NO: 76 [0152] Rhodopseudomonas palustris
SEQ ID NO: 83 [0153] Rhodopseudomonas palustris (RhoPa_TrpEG)
SEQ ID NO: 84 [0154] Agrobacterium tumefaciens V48F mutant
SEQ ID NO: 85 [0155] Agrobacterium tumefaciens V48Y mutant
SEQ ID NO: 86 [0156] Agrobacterium tumefaciens S51F mutant
SEQ ID NO: 87 [0157] Agrobacterium tumefaciens S51 C mutant
SEQ ID NO: 88 [0158] Agrobacterium tumefaciens N52F mutant
SEQ ID NO: 89 [0159] Agrobacterium tumefaciens P293A mutant
SEQ ID NO: 90 [0160] Agrobacterium tumefaciens P293G mutant
SEQ ID NO: 91 [0161] Agrobacterium tumefaciens F298W mutant
SEQ ID NO: 92 [0162] Agrobacterium tumefaciens S50K mutant
SEQ ID NO: 93 [0163] Agrobacterium tumefaciens F298A mutant
SEQ ID NO: 94 rice [0164]
SEQ ID NO: 95 rice isozyme [0165]
SEQ ID NO: 96 maize (U.S. Pat. No. 6,118,047 to Anderson) [0166]
SEQ ID NO: 97 wheat [0167]
SEQ ID NO: 98 tobacco [0168]
SEQ ID NO: 104 [0169] Gossypium hirsutum (alpha)
SEQ ID NO: 105 [0170] Gossypium hirsutum (beta)
SEQ ID NO: 106 [0171] Glycine max (alpha)
SEQ ID NO: 107 [0172] Glycine max (beta)
SEQ ID NO: 112 [0173] Glycine max (alpha) with 5′ and 3′UTRs
SEQ ID NO: 113 [0174] Glycine max (beta) with 5′ and 3′UTRs
SEQ ID NO: 116 [0175] Zea mays (beta)
SEQ ID NO: 119 [0176] Oryza sativa (beta1)
SEQ ID NO: 120 [0177] Oryza sativa (beta2)
SEQ ID NO: 121 [0178] Mesorhizobium loti
SEQ ID NO: 122 [0179] Azospirillum brasilense
SEQ ID NO: 123 [0180] Brucella melitensis
SEQ ID NO: 124 Nostoc sp. [0181]
SEQ ID NO: 125 Nostoc sp. [0182]
SEQ ID NO: 126 [0183] Rhodopseudomonas palustris
SEQ ID NO: 127 [0184] Bradyrhizobium japonicum
SEQ ID NO: 128 [0185] Rhodospirillum rubrum
SEQ ID NO: 129 [0186] Thermobifida fusca
SEQ ID NO: 134 [0187] Sorghum bicolor (beta1)
SEQ ID NO: 135 [0188] Sorghum bicolor (beta2)
SEQ ID NO: 136 [0189] Zea mays (alpha1)
Certain primers are also useful for the practise of the present invention, for example, primers having SEQ ID NOs: 9-42, 47-56, or 138-143. [0190]
The present invention also contemplates any isolated nucleic acid encoding an anthranilate synthase having, for example, any one of the following amino acid sequences. [0191]
SEQ ID NO: 4 [0192] Agrobacterium tumefaciens (wild type)
SEQ ID NO: 5 [0193] Zea mays (wild type)
SEQ ID NO: 6 [0194] Ruta graveolens
SEQ ID NO: 7 [0195] Rhizobium meliloti
SEQ ID NO: 8 [0196] Sulfolobus solfataricus
SEQ ID NO: 43 [0197] Rhizobium meliloti
SEQ ID NO: 44 [0198] Sulfolobus solfataricus
SEQ ID NO: 45 [0199] Arabidopsis thaliana
SEQ ID NO: 57 [0200] Rhodopseudomonas palustris
SEQ ID NO: 58 [0201] Agrobacterium tumefaciens V48F mutant
SEQ ID NO: 59 [0202] Agrobacterium tumefaciens V48Y mutant
SEQ ID NO: 60 [0203] Agrobacterium tumefaciens S51F mutant
SEQ ID NO: 61 [0204] Agrobacterium tumefaciens S51C mutant
SEQ ID NO: 62 [0205] Agrobacterium tumefaciens N52F mutant
SEQ ID NO: 63 [0206] Agrobacterium tumefaciens P293A mutant
SEQ ID NO: 64 [0207] Agrobacterium tumefaciens P293G mutant
SEQ ID NO: 65 [0208] Agrobacterium tumefaciens F298W mutant
SEQ ID NO: 66 [0209] Zea mays C28 mutant
SEQ ID NO: 69 [0210] Agrobacterium tumefaciens S50K mutant
SEQ ID NO: 70 [0211] Agrobacterium tumefaciens F298A mutant
SEQ ID NO: 74 Chloroplast Targeting Peptide (a) [0212]
SEQ ID NO: 72 Chloroplast Targeting Peptide (g) [0213]
SEQ ID NO: 77 [0214] Mesorhizobium loti (MesLo_—13472468)
SEQ ID NO: 78 [0215] Azospirillum brasilense (AzoBr_—1717765)
SEQ ID NO: 79 [0216] Brucella melitensis (BruMe_—17986732)
SEQ ID NO: 80 Nostoc sp. (Nostoc 17227910) [0217]
SEQ ID NO: 81 Nostoc sp. (Nostoc[0218] _—17230725)
SEQ ID NO: 82 [0219] Rhodopseudomonas palustris RhoPa_TrpEG
SEQ ID NO: 99 rice [0220]
SEQ ID NO: 100 rice isozyme [0221]
SEQ ID NO: 101 maize (U.S. Pat. No. 6,118,047 to Anderson) [0222]
SEQ ID NO: 102 wheat [0223]
SEQ ID NO: 103 tobacco [0224]
SEQ ID NO: 108 [0225] Gossypium hirsutum (alpha)
SEQ ID NO: 109 [0226] Gossypium hirsutum (beta)
SEQ ID NO: 110 [0227] Glycine max (alpha)
SEQ ID NO: 111 [0228] Glycine max (beta)
SEQ ID NO: 114 [0229] Zea mays (ASalpha2) chloroplast targeting peptide
SEQ ID NO: 115 [0230] Zea mays (ASalpha1) chloroplast targeting peptide
SEQ ID NO: 117 [0231] Oryza sativa (beta)
SEQ ID NO: 118 [0232] Zea mays (beta)
SEQ ID NO: 130 [0233] Bradyrhizobium japonicum
SEQ ID NO: 131 [0234] Rhodospirillum rubrum
SEQ ID NO: 132 [0235] Thermobifida fusca
SEQ ID NO: 133 [0236] Sorghum bicolor (beta)
SEQ ID NO: 137 [0237] Zea mays (ASalpha1)
Any of these nucleic acids and polypeptides can be utilized in the practice of the invention, as well as any mutant, variant or derivative thereof. [0238]
Monomeric Anthranilate Synthases [0239]
According to the present invention, monomeric anthranilate synthases from plant and non-plant species are functional in plants and can provide high levels of tryptophan. Surprisingly, monomeric anthranilate synthases from non-plant species function very well in plants even though the sequences of these monomeric anthranilate synthases have low homology with most plant anthranilate synthases. For example, monomeric anthranilate synthases from species as diverse as bacteria, protists, and microbes can be used successfully. In particular, monomeric anthranilate synthases from bacterial species such as [0240] Agrobacterium tumefaciens, Rhizobium meliloti, Mesorhizobium loti, Brucella melitensis, Nostoc sp. PCC7120, Azospirillum brasilense, Anabaena M22983, Bradyrhizobium janonicum, Rhodospirillum rubrum, and Thermobidfida fusca are functional in plants and can provide high levels of tryptophan, despite the rather low sequence identity of these monomeric anthranilate synthases with most plant anthranilate synthases.
Transgenic plants containing, for example, the wild type monomeric [0241] Agrobacterium tumefaciens anthranilate synthase can produce up to about 10,000 to about 12,000 ppm tryptophan in seeds, with average trp levels ranging up to about 7,000 to about 8,000 ppm. Non-transgenic soybean plants normally have up to only about 100 to about 200 ppm tryptophan in seeds. By comparison transgenic plants containing an added mutant Zea mays α domain produce somewhat lower levels of tryptophan (e.g., averages up to about 3000 to about 4000 ppm).
Monomeric enzymes may have certain advantages over multimeric enzymes. For example, while the present invention is not to be limited to a specific mechanism, a monomeric enzyme may provide greater stability, coordinated expression, and the like. When domains or subunits of a heterotetrameric anthranilate synthase are synthesized in vivo, those domains/subunits must properly assemble into a heterotetrameric form before the enzyme becomes active. Addition of a single domain of anthranilate synthase by transgenic means to a plant may not provide overproduction of the entire heterotetrameric enzyme because there may not be sufficient endogenous amounts of the non-transgenic domains to substantially increase levels of the functional tetramer. Hence, nucleic acids, vectors and enzymes encoding a monomeric anthranilate synthase can advantageously be used to overproduce all of the enzymatic functions of anthranilate synthase. [0242]
According to the present invention, anthranilate synthase domains from species that naturally produce heterotetrameric anthranilate synthases can be fused or linked to provide monomeric anthranilate synthases that can generate high tryptophan levels when expressed within a plant cell, plant tissue or seed. For example, a monomeric anthranilate synthase can be made by fusing or linking the α- and β-domains of anthranilate synthase so that the sequence of the α-β fusion generally aligns with an anthranilate synthase that is naturally monomeric. Examples of sequence alignments of monomeric and heterotetrameric anthranilate synthases are shown in FIGS. 21 and 35. Using such sequence alignments, the spacing and orientation of anthranilate synthase domains can be adjusted or modified to generate a monomeric anthranilate construct from heterotetrameric domains that optimally aligns with naturally monomeric anthranilate synthases. Such a fusion protein can be used to increase tryptophan levels in the tissues of a plant. [0243]
Heterotetrameric anthranilate synthases, such as the [0244] Sulfolobus solfataricus anthranilate synthase (e.g., Genbank Accession No. GI1004323), share between about 30% to about 87% sequence homology with heterotetrameric anthranilate synthases from other plant and microbial species. Monomeric anthranilate synthases, such as the A. tumefaciencs anthranilate synthase, have between about 83% and about 52% identity to the other monomeric enzymes such as Rhizobium meliloti (Genbank Accession No. GI 15966140) and Azospirillum brasilense (Genbank Accession No. 1717765), respectively. Bae et al., Rhizobium meliloti anthranilate synthase gene: cloning, sequence, and expression in Escherichia coli. J. Bacteriol., 171: 3471-3478 (1989); De Troch et al., Isolation and characterization of the Azospirillum brasilense trpE(G) gene, encoding anthranilate synthase. Curr. Microbiol., 34:27-32 (1997).
However, the overall sequence identity shared between naturally monomeric and naturally heterotetrameric anthranilate synthases can be less than 30%. Hence, visual alignment rather than computer-generated alignment, may be needed to optimally align monomeric and heterotetrameric anthranilate synthases. Landmark structures and sequences within the anthranilate synthases can facilitate sequences alignments. For example, the motif “LLES” is part of a β-sheet of the β-sandwich that forms the tryptophan-binding pocket of anthranilate synthases. Such landmark sequences can be used to more confidently align divergent anthranilate synthase sequences, and are especially useful for determination of key residues involved in tryptophan binding. [0245]
To accomplish the fusion or linkage of anthranilate synthase domains, the C-terminus of the selected TrpE or α-domain is linked to the N-terminus of the TrpG domain or β-domain. In some cases, a linker peptide may be utilized between the domains to provide the appropriate spacing and/or flexibility. Appropriate linker sequences can be identified by sequence alignment of monomeric and heterotetrameric anthranilate synthases. [0246]
The selected β-domains can be cloned, for example, by hybridization, PCR amplification or as described in Anderson et al., U.S. Pat. No. 6,118,047. A plastid transit peptide sequence can also be linked to the anthranilate synthase coding region using standard methods. For example, an Arabidopsis small subunit (SSU) chloroplast targeting peptide (CTP, SEQ ID NOs: 71-74) may be used for this purpose. See also, Stark et al., [0247] Science, 258:287 (1992). The fused gene can then be inserted into a suitable vector for plant transformation as described herein.
Anthranilate Synthase Mutants [0248]
Mutant anthranilate synthases contemplated by the present invention can have any type of mutation including, for example, amino acid substitutions, deletions, insertions, and/or rearrangements. Such mutants can be derivatives or variants of anthranilate synthase nucleic acids and polypeptides specifically identified herein. Alternatively, mutant anthranilate synthases can be obtained from any available species, including those not explicitly identified herein. The mutants, derivatives and variants can have identity with at least about 30% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. In a preferred embodiment, polypeptide derivatives and variants have identity with at least about 50% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. In a more preferred embodiment, polypeptide derivatives and variants have identity with at least about 60% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. In a more preferred embodiment, polypeptide derivatives and variants have identity with at least about 70% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. In an even more preferred embodiment, polypeptide derivatives and variants have identity with at least about 80% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. In an even more preferred embodiment, polypeptide derivatives and variants have identity with at least about 90% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. In an even more preferred embodiment, polypeptide derivatives and variants have identity with at least about 95% of the amino acid positions of any one of SEQ ID NOs: 4-8, 43-45, 57-66, 69-70, 77-82, 99-111, 117-118, 130-133, and 137, and have anthranilate synthase activity. [0249]
In one embodiment, anthranilate synthase mutants, variants and derivatives can be identified by hybridization of any one of SEQ ID NOs: 1-3,9-42, 46, 47-56, 67-68, 75-76, 83-98, 104-107, 112, 113, 116, 119-129, 134-136, and 138-143, or a fragment or primer thereof under moderate or, preferably, high stringency conditions to a selected source of nucleic acids. Moderate and stringent hybridization conditions are well known to the art, see, for example sections 0.47-9.51 of Sambrook et al., Molecular Cloning: A Laboratory Manual, 2[0250] ^ndEdition (1989); see, also, Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3^rdEdition (Jan. 15, 2001). For example, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (SSC); 0.1% sodium lauryl sulfate (SDS) at 50° C., or (2) employ a denaturing agent such as formamide during hybridization, e.g., 50% formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42° C. Another example is use of 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% sodium dodecylsulfate (SDS), and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC and 0.1% SDS.
The present invention further provides hybridization probes and primers comprising a novel isolated and purified DNA segment of at least seven nucleotide bases, which can be detectably labeled or bind to a detectable label. Such a hybridization probe or primer can hybridize under moderate or high stringency conditions to either strand of a DNA molecule that encodes an anthranilate synthase. Examples of such hybridization probes and primers include any one of SEQ ID NOs: 9-42, 47-56, and 138-143. [0251]
The anthranilate synthase can be any anthranilate synthase, or a mutant or domain thereof, such as the α-domain. The anthranilate synthase can be a monomeric anthranilate synthase. Functional mutants are preferred, particularly those that can generate high levels of tryptophan in a plant, for example, those mutants that are substantially resistant to inhibition by an amino acid analog of tryptophan. [0252]
Nucleic acids encoding mutant anthranilate synthases can also be generated from any convenient species, for example, from nucleic acids encoding any domain of [0253] Agrobacterium tumefaciens, Anabaena M22983 (e.g. Genbank Accession No. GI 152445), Arabidopsis thaliana, Azospirillum brasilense (e.g., Genbank Accession No. GI 1174156), Brucella melitensis (e.g., Genbank Accession No. GI 17982357), Escherichia coli, Euglena gracilis, Mesorhizobium loti (e.g., Genbank Accession No. GI 13472468), Nostoc sp. PCC7120 (e.g., Genbank Accession No. GI 17227910 or GI 17230725), Rhizobium meliloti (e.g., Genbank Accession No. GI 95177), Ruta graveolens, Rhodopseudomonas palustris, Salmonella typhimurium, Serratia marcescens, Sulfolobus solfataricus, Bradyrhizobium japonicum, Rhodospirillum rubrum, Thermobifida fusca, Sorghum bicolor, soybean, rice, cotton, wheat, tobacco, Zea mays (maize), or any gene encoding a subunit or domain of anthranilate synthase.
Mutants having increased anthranilate synthase activity, reduced sensitivity to feedback inhibition by tryptophan or analogs thereof, and/or the ability to generate increased amounts of tryptophan in a plant are desirable. Such mutants do have a functional change in the level or type of activity they exhibit and are sometimes referred to as “derivatives” of the anthranilate synthase nucleic acids and polypeptides provided herein. [0254]
However, the present invention also contemplates anthranilate synthase variants as well as anthranilate synthase nucleic acids with “silent” mutations. As used herein, a silent mutation is a mutation that changes the nucleotide sequence of the anthranilate synthase but that does not change the amino acid sequence of the encoded anthranilate synthase. A variant anthranilate synthase is encoded by a mutant nucleic acid and the variant has one or more amino acid changes that do not substantially change its activity when compared to the corresponding wild type anthranilate synthase. The invention is directed to all such derivatives, variants and anthranilate synthases nucleic acids with silent mutations. [0255]
DNA encoding a mutated anthranilate synthase that is resistant and/or tolerant to L-tryptophan or amino acid analogs of tryptophan can be obtained by several methods. The methods include, but are not limited to: [0256]
1. spontaneous variation and direct mutant selection in cultures; [0257]
2. direct or indirect mutagenesis procedures on tissue cultures of any cell types or tissue, seeds or plants; [0258]
3. mutation of the cloned anthranilate synthase gene by methods such as by chemical mutagenesis; site specific or site directed mutagenesis Sambrook et al., cited supra), transposon mediated mutagenesis (Berg et al., [0259] Biotechnology, 1:417 (1983)), and deletion mutagenesis (Mitra et al., Molec. Gen. Genetic., 215:294 (1989));
4. rational design of mutations in key residues; and [0260]
5. DNA shuffling to incorporate mutations of interest into various anthranilate synthase nucleic acids. [0261]
For example, protein structural information from available anthranilate synthase proteins can be used to rationally design anthranilate synthase mutants that have a high probability of having increased activity or reduced sensitivity to tryptophan or tryptophan analogs. Such protein structural information is available, for example, on the [0262] Solfulobus solfataricus anthranilate synthase (Knochel et al., Proc. Natl. Acad. Sci. (U.S.A.), 96:9479-9484 (1999)). Rational design of mutations can be accomplished by alignment of the selected anthranilate synthase amino acid sequence with the anthranilate synthase amino acid sequence from an anthranilate synthase of known structure, for example, Sulfolobus solfataricus. See FIGS. 6, 21, and 35. The predicted tryptophan binding and catalysis regions of the anthranilate synthase protein can be assigned by combining the knowledge of the structural information with the sequence homology. For example, residues in the tryptophan binding pocket can be identified as potential candidates for mutation to alter the resistance of the enzyme to feedback inhibition by tryptophan. Using such structural information, several Agrobacterium tumefaciens anthranilate synthase mutants were rationally designed in the site or domain involved in tryptophan binding.
Using such sequence and structural analysis, regions analogous to the monomeric [0263] Agrobacterium tumefaciens anthranilate synthase at approximately positions 25-60 or 200-225 or 290-300 or 370-375 were identified in the monomeric Agrobacterium tumefaciens anthranilate synthase as being potentially useful residues for mutation to produce active anthranilate synthases that may have less sensitivity to tryptophan feedback inhibition. More specifically, amino acids analogous to P29, E30, S31, 132, S42, V43, V48, S50, S51, N52, N204, P205, M209, F210, G221, N292, P293, F298, and A373 in the monomeric Agrobacterium tumefaciens anthranilate synthase are being potentially useful residues for mutation to produce active anthranilate synthases that may have less sensitivity to tryptophan feedback inhibition. The present invention contemplates any amino acid substitution or insertion at any of these positions. Alternatively, the amino acid at any of these positions can be deleted.
Site directed mutagenesis can be used to generate amino acid substitutions, deletions and insertions at a variety of sites. Examples of specific mutations made within the [0264] Agrobacterium tumefaciens anthranilate synthase coding region include the following:
at about [0265] position 48 replace Val with Phe (see e.g., SEQ ID NO: 58);
at about [0266] position 48 replace Val with Tyr (see e.g., SEQ ID NO: 59);
at about [0267] position 51 replace Ser with Phe (see e.g., SEQ ID NO: 60);
at about [0268] position 51 replace Ser with Cys (see e.g., SEQ ID NO: 61);
at about position 52 replace Asn with Phe (see e.g., SEQ ID NO: 62); [0269]
at about [0270] position 293 replace Pro with Ala (see e.g., SEQ ID NO: 63);
at about [0271] position 293 replace Pro with Gly (see e.g., SEQ ID NO: 64); or
at about [0272] position 298 replace Phe with Trp (see e.g., SEQ ID NO: 65).
Similar mutations can be made in analogous positions of any anthranilate synthase by alignment of the amino acid sequence of the anthranilate synthase to be mutated with an [0273] Agrobacterium tumefaciens anthranilate synthase amino acid sequence. One example of an Agrobacterium tumefaciens anthranilate synthase amino acid sequence that can be used for alignment is SEQ ID NO: 4.
Useful mutants can also be identified by classical mutagenesis and genetic selection. A functional change can be detected in the activity of the enzyme encoded by the gene by exposing the enzyme to free L-tryptophan or amino acid analogs of tryptophan, or by detecting a change in the DNA molecule using restriction enzyme mapping or DNA sequence analysis. [0274]
For example, a gene encoding an anthranilate synthase substantially tolerant to 5-methyltryptophan (5-MT) can be isolated from a 5-methyltryptophan tolerant cell line. See U.S. Pat. No. 4,581,847, the disclosure of which is incorporated by reference herein. Briefly, partially differentiated plant cell cultures are grown and subcultured with continuous exposures to low levels of 5-methyltryptophan. 5-methyltryptophan concentrations are then gradually increased over several subculture intervals. Cells or tissues growing in the presence of normally toxic 5-methyltryptophan levels are repeatedly subcultured in the presence of 5-methyltryptophan and characterized. Stability of the 5-methyltryptophan tolerance trait of the cultured cells may be evaluated by growing the selected cell lines in the absence of 5-methyltryptophan for various periods of time and then analyzing growth after exposing the tissue to 5-methyltryptophan. Cell lines that are tolerant by virtue of having an altered anthranilate synthase enzyme can be selected by identifying cell lines having enzyme activity in the presence of normally toxic, i.e., growth inhibitor, levels of 5-methyltryptophan. [0275]
The anthranilate synthase gene cloned from a 5-MT- or 6-methylanthramilate (6-MA)-resistant cell line can be assessed for tolerance to 5-MT, 6-MA, or other amino acid analogs of tryptophan by standard methods, as described in U.S. Pat. No. 4,581,847, the disclosure of which is incorporated by reference herein. [0276]
Cell lines with an anthranilate synthase of reduced sensitivity to 5-methyltryptophan inhibition can be used to isolate a 5-methyltryptophan-resistant anthranilate synthase. A DNA library from a cell line tolerant to 5-methyltryptophan can be generated and DNA fragments encoding all or a portion of an anthranilate synthase gene can be identified by hybridization to a cDNA probe encoding a portion of an anthranilate synthase gene. A complete copy of the altered gene can be obtained either by cloning and ligation or by PCR synthesis using appropriate primers. The isolation of the altered gene coding for anthranilate synthase can be confirmed in transformed plant cells by determining whether the anthranilate synthase being expressed retains enzyme activity when exposed to normally toxic levels of 5-methyltryptophan. See, Anderson et al., U.S. Pat. No. 6,118,047. [0277]
Coding regions of any DNA molecule provided herein can also be optimized for expression in a selected organism, for example, a selected plant or other host cell type. An example of a DNA molecule having optimized codon usage for a selected plant is an [0278] Agrobacterium tumefaciens anthranilate synthase DNA molecule having SEQ ID NO: 75. This optimized Agrobacterium tumefaciens anthranilate synthase DNA (SEQ ID NO: 75) has 94% identity with SEQ ID NO: 1.
Transgenes and Vectors [0279]
Once a nucleic acid encoding anthranilate synthase or a domain thereof is obtained and amplified, it is operably combined with a promoter and, optionally, with other elements to form a transgene. [0280]
Most genes have regions of DNA sequence that are known as promoters and which regulate gene expression. Promoter regions are typically found in the flanking DNA sequence upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2,000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression. Some isolated promoter sequences can provide for gene expression of heterologous genes, that is, a gene different from the native or homologous gene. Promoter sequences are also known to be strong or weak or inducible. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that provides for turning on and off of gene expression in response to an exogenously added agent or to an environmental or developmental stimulus. Promoters can also provide for tissue specific or developmental regulation. An isolated promoter sequence that is a strong promoter for heterologous genes is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells and provides for a high level of gene expression when desired. [0281]
The promoter in a transgene of the present invention can provide for expression of anthranilate synthase from a DNA sequence encoding anthranilate synthase. Preferably, the coding sequence is expressed so as to result in an increase in tryptophan levels within plant tissues, for example, within the seeds of the plant. In another embodiment, the coding sequence is expressed so as to result in increased tolerance of the plant cells to feedback inhibition or to growth inhibition by an amino acid analog of tryptophan or so as to result in an increase in the total tryptophan content of the cells. The promoter can also be inducible so that gene expression can be turned on or off by an exogenously added agent. For example, a bacterial promoter such as the P[0282] _tacpromoter can be induced to varying levels of gene expression depending on the level of isothiopropylgalactoside added to the transformed bacterial cells. It may also be preferable to combine the gene with a promoter that provides tissue specific expression or developmentally regulated gene expression in plants. Many promoters useful in the practice of the invention are available to those of skill in the art.
Preferred promoters will generally include, but are not limited to, promoters that function in bacteria, bacteriophage, plastids or plant cells. Useful promoters include the CaMV 35S promoter (Odell et al., [0283] Nature, 313:810 (1985)), the CaMV 19S (Lawton et al., Plant Mol. Biol., 9:31F (1987)), nos (Ebert et al., Proc. Nat. Acad. Sci. (U.S.A.), 84:5745 (1987)), Adh (Walker et al., Proc. Nat. Acad. Sci. (U.S.A.), 84:6624 (1987)), sucrose synthase (Yang et al., Proc. Nat. Acad. Sci. (U.S.A.), 87:4144 (1990)), α-tubulin, napin, actin (Wang et al., Mol. Cell. Biol., 12:3399 (1992)), cab (Sullivan et al., Mol. Gen. Genet., 215:431 (1989)), PEPCase promoter (Hudspeth et al., Plant Mol. Biol., 12:579 (1989)), the 7S-alpha′-conglycinin promoter (Beachy et al., EMBO J, 4:3047 (1985)) or those associated with the R gene complex (Chandler et al., The Plant Cell, 1:1175 (1989)). Other useful promoters include the bacteriophage SP6, T3, and T7 promoters.
Plastid promoters can be also be used. Most plastid genes contain a promoter for the multi-subunit plastid-encoded RNA polymerase (PEP) as well as the single-subunit nuclear-encoded RNA polymerase. A consensus sequence for the nuclear-encoded polymerase (NEP) promoters and listing of specific promoter sequences for several native plastid genes can be found in Hajdukiewicz et al., [0284] EMBO J., 16:4041-4048, (1997), which is hereby in its entirety incorporated by reference.
Examples of plastid promoters that can be used include the [0285] Zea mays plastid RRN (ZMRRN) promoter. The ZMRRN promoter can drive expression of a gene when the Arabidopsis thaliana plastid RNA polymerase is present. Similar promoters that can be used in the present invention are the Glycine max plastid RRN (SOYRRN) and the Nicotiana tabacum plastid RRN (NTRRN) promoters. All three promoters can be recognized by the Arabidopsis plastid RNA polymerase. The general features of RRN promoters are described by Hajdukiewicz et al. and U.S. Pat. No. 6,218,145.
Moreover, transcription enhancers or duplications of enhancers can be used to increase expression from a particular promoter. Examples of such enhancers include, but are not limited to, elements from the CaMV 35S promoter and octopine synthase genes (Last et al., U.S. Pat. No. 5,290,924). For example, it is contemplated that vectors for use in accordance with the present invention may be constructed to include the ocs enhancer element. This element was first identified as a 16 bp palindromic enhancer from the octopine synthase (ocs) gene of Agrobacterium (Ellis et al., [0286] EMBO J., 6:3203 (1987)), and is present in at least 10 other promoters (Bouchez et al., EMBO J., 8:4197 (1989)). It is proposed that the use of an enhancer element, such as the ocs element and particularly multiple copies of the element, will act to increase the level of transcription from adjacent promoters when applied in the context of monocot transformation. Tissue-specific promoters, including but not limited to, root-cell promoters (Conkling et al., Plant Physiol., 93:1203 (1990)), and tissue-specific enhancers (Fromm et al., The Plant Cell, 1:977 (1989)) are also contemplated to be particularly useful, as are inducible promoters such as ABA- and turgor-inducible promoters, and the like.
As the DNA sequence between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can influence gene expression, one may also wish to employ a particular leader sequence. Any leader sequence available to one of skill in the art may be employed. Preferred leader sequences direct optimum levels of expression of the attached gene, for example, by increasing or maintaining mRNA stability and/or by preventing inappropriate initiation of translation (Joshi, [0287] Nucl. Acid Res., 15:6643 (1987)). The choice of such sequences is at the discretion of those of skill in the art. Sequences that are derived from genes that are highly expressed in dicots, and in soybean in particular, are contemplated.
In some cases, extremely high expression of anthranilate synthase or a domain thereof, is not necessary. For example, using the methods of the invention such high levels of anthranilate synthase may be generated that the availability of substrate, rather than enzyme, may limit the levels of tryptophan generated. In such cases, more moderate or regulated levels of expression can be selected by one of skill in the art. Such a skilled artisan can readily modulate or regulate the levels of expression, for example, by use of a weaker promoter or by use of a developmentally regulated or tissue specific promoter. [0288]
Nucleic acids encoding the anthranilate synthase of interest can also include a plastid transit peptide (e.g. SEQ ID NOs: 72, 74, 114, or 115) to facilitate transport of the anthranilate synthase polypeptide into plastids, for example, into chloroplasts. A nucleic acid encoding the selected plastid transit peptide (e.g. SEQ ID NOs: 71 or 73) is generally linked in-frame with the coding sequence of the anthranilate synthase. However, the plastid transit peptide can be placed at either the N-terminal or C-terminal end of the anthranilate synthase. [0289]
Constructs also include the nucleic acid of interest (e.g. DNA encoding an anthranilate synthase) along with a nucleic acid sequence that acts as a transcription termination signal and that allows for the polyadenylation of the resultant mRNA. Such transcription termination signals are placed 3′ or downstream of the coding region of interest. Preferred transcription termination signals contemplated include the transcription termination signal from the nopaline synthase gene of [0290] Agrobacterium tumefaciens (Bevan et al., Nucl. Acid Res., 11:369 (1983)), the terminator from the octopine synthase gene of Agrobacterium tumefaciens, and the 3′ end of genes encoding protease inhibitor I or II from potato or tomato, although other transcription termination signals known to those of skill in the art are also contemplated. Regulatory elements such as Adh intron 1 (Callis et al., Genes Develop., 1:1183 (1987)), sucrose synthase intron (Vasil et al., Plant Physiol., 91:5175 (1989)) or TMV omega element (Gallie et al., The Plant Cell, 1:301 (1989)) may further be included where desired. These 3′ nontranslated regulatory sequences can be obtained as described in An, Methods in Enzymology, 153:292 (1987) or are already present in plasmids available from commercial sources such as Clontech, (Palo Alto, Calif.). The 3′ nontranslated regulatory sequences can be operably linked to the 3 terminus of an anthranilate synthase gene by standard methods. Other such regulatory elements useful in the practice of the invention are known to those of skill in the art.
A DNA construct may comprise a first expression cassette, comprised of, in operable linkage, a heterologous promoter, a DNA molecule encoding an anthrantilate synthase α-domain protein and a transcriptional terminator. This DNA construct may further comprise a second expression cassette in operable linkage, comprising a heterologous promoter, a DNA molecule encoding an anthranilate synthase β-domain protein and a transcriptional terminator. [0291]
Selectable marker genes or reporter genes are also useful in the present invention. Such genes can impart a distinct phenotype to cells expressing the marker gene and thus allow such transformed cells to be distinguished from cells that do not have the marker. Selectable marker genes confer a trait that one can ‘select’ for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like). Reporter genes, or screenable genes, confer a trait that one can identify through observation or testing, i.e., by ‘screening’ (e.g., the R-locus trait). Of course, many examples of suitable marker genes are known to the art and can be employed in the practice of the present invention. [0292]
Possible selectable markers for use in connection with the present invention include, but are not limited to, a neo gene (Potrykus et al., [0293] Mol Gen. Genet., 199:183 (1985)) which codes for neomycin resistance and can be selected for using kanamycin, G418, and the like; a bar gene which codes for bialaphos resistance; a gene which encodes an altered EPSP synthase protein (Hinchee et al., Biotech., 6:915 (1988)) thus conferring glyphosate resistance; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., Science, 242:419 (1988)); a mutant acetolactate synthase gene (ALS) that confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (EP 154 204 (1985)); a methotrexate-resistant DHFR gene (Thillet et al., J. Biol. Chem., 263:12500 (1988)); a dalapon dehalogenase gene that confers resistance to the herbicide dalapon; or a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan. Where a mutant EPSP synthase gene is employed, additional benefit may be realized through the incorporation of a suitable plastid transit peptide (CTP).
An illustrative embodiment of a selectable marker gene capable of being used in systems to select transformants is the genes that encode the enzyme phosphinothricin acetyltransferase, such as the bar gene from [0294] Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes (U.S. Pat. No. 5,550,318, which is incorporated by reference herein). The enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami et al., Mol. Gen. Genet., 205:42 (1986); Twell et al., Plant Physiol., 91:1270 (1989)) causing rapid accumulation of ammonia and cell death.
Screenable markers that may be employed include, but are not limited to, a β-glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known; an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., in Chromosome Structure and Function, pp. 263-282 (1988)); a β-lactamase gene (Sutcliffe, [0295] Proc. Nat. Acad. Sci. (U.S.A.), 75:3737 (1978)), which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a xyle gene (Zukowsky et al., Proc. Nat. Acad. Sci. (U.S.A.), 80:1101 (1983)) that encodes a catechol dioxygenase that can convert chromogenic catechols; an α-amylase gene (Ikuta et al., Biotech., 8:241 (1990)); a tyrosinase gene (Katz et al., J. Gen. Microbiol., 129:2703 (1983)) that encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to form the easily detectable compound melanin; a β-galactosidase gene, which encodes an enzyme for which there are chromogenic substrates; a luciferase (lux) gene (Ow et al., Science, 234:856 (1986)), which allows for bioluminescence detection; or even an aequorin gene (Prasher et al., Biochem. Biophys. Res. Comm., 126:1259 (1985)), which may be employed in calcium-sensitive bioluminescence detection, or a green fluorescent protein gene (Niedz et al., Plant Cell Reports, 14:403 (1995)). The presence of the lux gene in transformed cells may be detected using, for example, X-ray film, scintillation counting, fluorescent spectrophotometry, low-light video cameras, photon-counting cameras, or multiwell luminometry. It is also envisioned that this system may be developed for populational screening for bioluminescence, such as on tissue culture plates, or even for whole plant screening.
Additionally, transgenes may be constructed and employed to provide targeting of the gene product to an intracellular compartment within plant cells or in directing a protein to the extracellular environment. This will generally be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of a particular gene. The resultant transit, or signal, peptide will transport the protein to a particular intracellular, or extracellular destination, respectively, and may then be post-translationally removed. Transit or signal peptides act by facilitating the transport of proteins through intracellular membranes, e.g., vacuole, vesicle, plastid and mitochondrial membranes, whereas signal peptides direct proteins through the extracellular membrane. By facilitating transport of the protein into compartments inside or outside the cell, these sequences may increase the accumulation of gene product. [0296]
A particular example of such a use concerns the direction of an anthranilate synthase to a particular organelle, such as the plastid, rather than to the cytoplasm. This is exemplified by the use of the Arabidopsis SSU1A transit peptide that confers plastid-specific targeting of proteins. Alternatively, the transgene can comprise a plastid transit peptide-encoding DNA sequence or a DNA sequence encoding the the rbcS (RuBISCO) transit peptide operably linked between a promoter and the DNA sequence encoding an anthranilate synthase (for a review of plastid targeting peptides, see Heijne et al., [0297] Eur. J. Biochem., 180:535 (1989); Keegstra et al., Ann. Rev. Plant Physiol. Plant Mol. Biol., 40:471 (1989)). If the transgene is to be introduced into a plant cell, the transgene can also contain plant transcriptional termination and polyadenylation signals and translational signals linked to the 3′ terminus of a plant anthranilate synthase gene.
An exogenous plastid transit peptide can be used which is not encoded within a native plant anthranilate synthase gene. A plastid transit peptide is typically 40 to 70 amino acids in length and functions post-translationally to direct a protein to the plastid. The transit peptide is cleaved either during or just after import into the plastid to yield the mature protein. The complete copy of a gene encoding a plant anthranilate synthase may contain a plastid transit peptide sequence. In that case, it may not be necessary to combine an exogenously obtained plastid transit peptide sequence into the transgene. [0298]
Exogenous plastid transit peptide encoding sequences can be obtained from a variety of plant nuclear genes, so long as the products of the genes are expressed as preproteins comprising an amino terminal transit peptide and transported into plastid. Examples of plant gene products known to include such transit peptide sequences include, but are not limited to, the small subunit of ribulose biphosphate carboxylase, chlorophyll a/b binding protein, plastid ribosomal proteins encoded by nuclear genes, certain heatshock proteins, amino acid biosynthetic enzymes such as acetolactate acid synthase, 3-enolpyruvylphosphoshikimate synthase, dihydrodipicolinate synthase, anthranilate synthase and the like. In some instances a plastid transport protein already may be encoded in the anthranilate synthase gene of interest, in which case there may be no need to add such plastid transit sequences. Alternatively, the DNA fragment coding for the transit peptide may be chemically synthesized either wholly or in part from the known sequences of transit peptides such as those listed above. [0299]
Regardless of the source of the DNA fragment coding for the transit peptide, it should include a translation initiation codon, for example, an ATG codon, and be expressed as an amino acid sequence that is recognized by and will function properly in plastids of the host plant. Attention should also be given to the amino acid sequence at the junction between the transit peptide and the anthranilate synthase enzyme where it is cleaved to yield the mature enzyme. Certain conserved amino acid sequences have been identified and may serve as a guideline. Precise fusion of the transit peptide coding sequence with the anthranilate synthase coding sequence may require manipulation of one or both DNA sequences to introduce, for example, a convenient restriction site. This may be accomplished by methods including site-directed mutagenesis, insertion of chemically synthesized oligonucleotide linkers, and the like. [0300]
Precise fusion of the nucleic acids encoding the plastid transport protein may not be necessary so long as the coding sequence of the plastid transport protein is in-frame with that of the anthranilate synthase. For example, additional peptidyl or amino acids can often be included without adversely affecting the expression or localization of the protein of interest. [0301]
Once obtained, the plastid transit peptide sequence can be appropriately linked to the promoter and an anthranilate synthase coding region in a transgene using standard methods. A plasmid containing a promoter functional in plant cells and having multiple cloning sites downstream can be constructed or obtained from commercial sources. The plastid transit peptide sequence can be inserted downstream from the promoter using restriction enzymes. An anthranilate synthase coding region can then be translationally fused or inserted immediately downstream from and in frame with the 3′ terminus of the plastid transit peptide sequence. Hence, the plastid transit peptide is preferably linked to the amino terminus of the anthranilate synthase. Once formed, the transgene can be subcloned into other plasmids or vectors. [0302]
In addition to nuclear plant transformation, the present invention also extends to direct transformation of the plastid genome of plants. Hence, targeting of the gene product to an intracellular compartment within plant cells may also be achieved by direct delivery of a gene to the intracellular compartment. Direct transformation of plastid genome may provide additional benefits over nuclear transformation. For example, direct plastid transformation of anthranilate synthase eliminates the requirement for a plastid targeting peptide and post-translational transport and processing of the pre-protein derived from the corresponding nuclear transformants. Plastid transformation of plants has been described by P. Maliga, [0303] Current Opinion in Plant Biology, 5:164-172 (2002), P. B. Heifetz, Biochimie, 82:655-666 (2000), R. Bock., J. Mol. Biol., 312:425-438 (2001), and H. Daniell et al., Trends in Plant Science, 7:84-91 (2002), and references within.
After constructing a transgene containing an anthranilate synthase gene, the cassette can then be introduced into a plant cell. Depending on the type of plant cell, the level of gene expression, and the activity of the enzyme encoded by the gene, introduction of DNA encoding an anthranilate synthase into the plant cell can lead to the overproduction of tryptophan, confer tolerance to an amino acid analog of tryptophan, such as 5-methyltryptophan or 6-methylanthranilate, and/or otherwise alter the tryptophan content of the plant cell. [0304]
Transformation of Host Cells [0305]
A transgene comprising an anthranilate synthase gene can be subcloned into a known expression vector, and AS expression can be detected and/or quantitated. This method of screening is useful to identify transgenes providing for an expression of an anthranilate synthase gene, and expression of an anthranilate synthase in the plastid of a transformed plant cell. [0306]
Plasmid vectors include additional DNA sequences that provide for easy selection, amplification, and transformation of the transgene in prokaryotic and eukaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, or pBS-derived vectors. The additional DNA sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert DNA sequences or genes encoded in the transgene, and sequences that enhance transformation of prokaryotic and eukaryotic cells. [0307]
Another vector that is useful for expression in both plant and prokaryotic cells is the binary Ti plasmid (as disclosed in Schilperoort et al., U.S. Pat. No. 4,940,838) as exemplified by vector pGA582. This binary Ti plasmid vector has been previously characterized by An, cited supra. This binary Ti vector can be replicated in prokaryotic bacteria such as [0308] E. coli and Agrobacterium. The Agrobacterium plasmid vectors can also be used to transfer the transgene to plant cells. The binary Ti vectors preferably include the nopaline T DNA right and left borders to provide for efficient plant cell transformation, a selectable marker gene, unique multiple cloning sites in the T border regions, the colE1 replication of origin and a wide host range replicon. The binary Ti vectors carrying a transgene of the invention can be used to transform both prokaryotic and eukaryotic cells, but is preferably used to transform plant cells. See, for example, Glassman et al., U.S. Pat. No. 5,258,300.
The expression vector can then be introduced into prokaryotic or eukaryotic cells by available methods. Methods of transformation especially effective for monocots and dicots, include, but are not limited to, microprojectile bombardment of immature embryos (U.S. Pat. No. 5,990,390) or Type II embryogenic callus cells as described by W. J. Gordon-Kamm et al. ([0309] Plant Cell, 2:603 (1990)), M. E. Fromm et al. (Bio/Technology, 8:833 (1990)) and D. A. Walters et al. (Plant Molecular Biology, 18:189 (1992)), or by electroporation of type I embryogenic calluses described by D'Halluin et al. (The Plant Cell, 4:1495 (1992)), or by Krzyzek (U.S. Pat. No. 5,384,253). Transformation of plant cells by vortexing with DNA-coated tungsten whiskers (Coffee et al., U.S. Pat. No. 5,302,523) and transformation by exposure of cells to DNA-containing liposomes can also be used.
After transformation of the selected anthranilate synthase construct into a host cell, the host cell may be used for production of useful products generated by the transgenic anthranilate synthase in combination with the host cell's enzymatic machinery. Culturing the transformed cells can lead to enhanced production of tryptophan and other useful compounds, which can be recovered from the cells or from the culture media. Examples of useful compounds that may be generated upon expression in a variety of host cells and/or organisms include tryptophan, indole acetic acid and other auxins, isoflavonoid compounds important to cardiovascular health found in soy, volatile indole compounds which act as signals to natural enemies of herbivorous insects in maize, anticarcinogens such as indole glucosinolates (indole-3-carbinol) found in the Cruciferac plant family, as well as indole alkaloids such as ergot compounds produced by certain species of fungi. (Barnes et al., [0310] Adv Exp Med Biol, 401:87 (1996); Frey et al., Proc Natl Acad. Sci., 97:14801 (2000); Muller et al., Biol. Chem., 381:679 (2000); Mantegani et al., Farmaco, 54:288 (1999); Zeligs, J Med Food, 1:67 (1998); Mash et al., Ann NY Acad Sci., 844:274 (1998); Melanson et al., Proc Natl Acad. Sci., 94:13345 (1997); Broadbent et al., Curr Med Chem., 5:469 (1998)).
Accumulation of tryptophan may also lead to the increased production of secondary metabolites in microbes and plants, for example, indole containing metabolites such as simple indoles, indole conjugates, indole alkaloids, indole phytoalexins and indole glucosinalates in plants. [0311]
Anthranilate synthases insensitive to tryptophan have the potential to increase a variety of chorismate-derived metabolites, including those derived from phenylalanine due to the stimulation of phenylalanine synthesis by tryptophan via chorismate mutase. See Siehl, D. The biosynthesis of tryptophan, tyrosine, and phenylalanine from chorismate in “Plant Amino Acids: Biochemistry and Biotechnology”, ed. BK Singh, pp 171-204. Other chorismate-derived metabolites that may increase when feedback insensitive anthranilate synthases are present include phenylpropanoids, flavonoids, and isoflavonoids, as well as those derived from anthranilate, such as indole, indole alkaloids, and indole glucosinolates. Many of these compounds are important plant hormones, plant defense compounds, chemopreventive agents of various health conditions, and/or pharmacologically active compounds. [0312]
The range of these compounds whose synthesis might be increased by expression of anthranilate synthase depends on the organism in which the anthranilate synthase is expressed. One of skill in the art can readily assess which organisms and host cells to use and/or test in order to generate the desired compounds. The present invention contemplates synthesis of tryptophan and other useful compounds in a variety of organisms, including plants, microbes, fungi, yeast, bacteria, insect cells, and mammalian cells. [0313]
Strategy for Selection of Tryptophan Overproducer Cell Lines [0314]
Efficient selection of a desired tryptophan analog resistant, tryptophan overproducer variant using tissue culture techniques requires careful determination of selection conditions. These conditions are optimized to allow growth and accumulation of tryptophan analog resistant, tryptophan overproducer cells in the culture while inhibiting the growth of the bulk of the cell population. The situation is complicated by the fact that the vitality of individual cells in a population can be highly dependent on the vitality of neighboring cells. [0315]
Conditions under which cell cultures are exposed to tryptophan analog are determined by the characteristics of the interaction of the compound with the tissue. Such factors as the degree of toxicity and the rate of inhibition should be considered. The accumulation of the compounds by cells in culture, and the persistence and stability of the compounds, both in the media and in the cells, also need to be considered along with the extent of uptake and transmission to the desired cellular compartment. Additionally, it is important to determine whether the effects of the compounds can be readily reversed by the addition of tryptophan. [0316]
The effects of the analog on culture viability and morphology is carefully evaluated. It is especially important to choose analog exposure conditions that have no impact on plant regeneration capability of cultures. Choice of analog exposure conditions is also influenced by whether the analog kills cells or simply inhibits cell divisions. [0317]
The choice of a selection protocol is dependent upon the considerations described above. The protocols briefly described below can be utilized in the selection procedure. For example, to select for cells that are resistant to growth inhibition by a tryptophan analog, finely divided cells in liquid suspension culture can be exposed to high tryptophan analog levels for brief periods of time. Surviving cells are then allowed to recover and accumulate and are then reexposed for subsequently longer periods of time. Alternatively, organized partially differentiated cell cultures are grown and subcultured with continuous exposure to initially low levels of a tryptophan analog. Concentrations are then gradually increased over several subculture intervals. While these protocols can be utilized in a selection procedure, the present invention is not limited to these procedures. [0318]
Genes for Plant Modification [0319]
As described hereinabove, genes that function as selectable marker genes and reporter genes can be operably combined with the DNA sequence encoding the anthranilate synthase, or domain thereof, in transgenes, vectors and plants of the present invention. Additionally, other agronomical traits can be added to the transgenes, vectors and plants of the present invention. Such traits include, but are not limited to, insect resistance or tolerance; disease resistance or tolerance (viral, bacterial, fungal, nematode); stress resistance or tolerance, as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress, oxidative stress, increased yields, food content and makeup, physical appearance, male sterility, drydown, standability, prolificacy, starch properties, oil quantity and quality, and the like. One may incorporate one or more genes conferring such traits into the plants of the present invention. [0320]
Insect Resistance or Tolerance [0321] Bacillus thuringiensis (or “Bt”) bacteria include nearly 20 known subspecies of bacteria which produce endotoxin polypeptides that are toxic when ingested by a wide variety of insect species. The biology and molecular biology of the endotoxin proteins (Bt proteins) and corresponding genes (Bt genes) has been reviewed by H. R. Whitely et al., Ann. Rev. Microbiol., 40:549 (1986) and by H. Hofte et al., Microbiol. Rev., 53:242 (1989). Genes coding for a variety of Bt proteins have been cloned and sequenced. A segment of the Bt polypeptide is essential for toxicity to a variety of Lepidoptera pests and is contained within approximately the first 50% of the Bt polypeptide molecule. Consequently, a truncated Bt polypeptide coded by a truncated Bt gene will in many cases retain its toxicity towards a number of Lepidoptera insect pests. For example, the HD73 and HD1 Bt polypeptides have been shown to be toxic to the larvae of the important Lepidoptera insect pests of plants in the U.S.A. such as the European corn borer, cutworms and earworms. The genes coding for the HD1 and HD73 Bt polypeptides have been cloned and sequenced by M. Geiser et al., Gene, 48:109 (1986) and M. J. Adang et al., Gene, 36:289 (1985), respectively, and can be cloned from HD1 and HD73 strains obtained from culture collections (e.g. Bacillus Genetic Stock Center, Columbus, Ohio or USDA Bt stock collection Peoria, IL) using standard protocols. Examples of Bt genes and polypeptides are described, for example, in U.S. Pat. Nos. 6,329,574; 6,303,364; 6,320,100; and 6,331,655.
DNA coding for new, previously uncharacterized Bt toxins, may be cloned from the host Bacillus organism using protocols that have previously been used to clone Bt genes, and new synthetic forms of Bt toxins may also be produced. [0322]
A Bt gene useful in the present invention may include a 5′ DNA sequence including a sequence of DNA which will allow for the initiation of transcription and translation of a downstream located Bt sequence in a plant. The Bt gene may also comprise a 3′ DNA sequence that includes a sequence derived from the 3′ non-coding region of a gene that can be expressed in the plant of interest. The Bt gene would also include a DNA sequence coding for a toxic Bt polypeptide produced by [0323] Bacillus thuringiensis or toxic portions thereof or having substantial amino sequence homology thereto. The Bt coding sequence may include: (i) DNA sequences which code for insecticidal proteins that have substantial homology to Bt endotoxins that are active against insect pests of the plant of interest, e.g., the HD73 or HD1 Bt sequences; (ii) sequences coding for insecticidally-active segments of the Bt endotoxin polypeptide, e.g., insecticidally active HD73 or HD1 polypeptides truncated from the carboxy and/or amino termini; and/or (iii) a truncated Bt sequence fused in frame with a sequence(s) that codes for a polypeptide that provides some additional advantage such as: (a) genes that are selectable, e.g., genes that confer resistance to antibiotics or herbicides, (b) reporter genes whose products are easy to detect or assay, e.g., luciferase or beta-glucuronidase; (c) DNA sequences that code for polypeptide sequences that have some additional use in stabilizing the Bt protein against degradation or enhance the efficacy of the Bt protein against insects, e.g., protease inhibitors; and (d) sequences that help direct the Bt protein to a specific compartment inside or outside the plant cell, e.g., a signal sequence.
To obtain optimum synthesis of the Bt protein in the plant, it may also be appropriate to adjust the DNA sequence of the Bt gene to more resemble the genes that are efficiently expressed in the plant of interest. Since the codon usage of Bt genes may be dissimilar to that used by genes that are expressed in the plant of interest, the expression of the Bt gene in plant cells may be improved by the replacement of these codons with those that are more efficiently expressed in plants, e.g., are used more frequently in the plants of interest (See E. Murray et al., [0324] Nucl Acids Res., 17:477 (1989)). Such replacement of codons may require the substitution of bases without changing the amino acid sequence of the resulting Bt polypeptide. The Bt polypeptide may be identical in sequence to the bacterial gene or segments thereof. The complete Bt coding sequence, or sections thereof, containing a higher proportion of preferred codons than the original bacterial gene could be synthesized using standard chemical synthesis protocols, and introduced or assembled into the Bt gene using standard protocols, such as site-directed mutagenesis or DNA polymerization and ligation and the like.
Protease inhibitors may also provide insect resistance. For example, use of a protease inhibitor II gene, pinII, from tomato or potato may be useful. Also advantageous is the use of a pinII gene in combination with a Bt toxin gene. Other genes which encode inhibitors of the insects' digestive system, or those that encode enzymes or co-factors that facilitate the production of inhibitors, may also be useful. This group includes oryzacystatin and amylase inhibitors such as those from wheat and barley. [0325]
Genes encoding lectins may confer additional or alternative insecticide properties. (Murdock et al., [0326] Phytochemistry, 29 85 (1990); Czapla and Lang, J. Econ. Entomol., 83:2480 (1990) Lectin genes contemplated to be useful include, for example, barley and wheat germ agglutinin (WGA) and rice lectins. (Gatehouse et al., J Sci Food Agric., 35:373 (1984))
Genes controlling the production of large or small polypeptides active against insects when introduced into the insect pests such as lytic peptides, peptide hormones and toxins and venoms, may also be useful. For example, the expression of juvenile hormone esterase, directed towards specific insect pests, may also result in insecticidal activity, or perhaps cause cessation of metamorphosis. (Hammock et al., [0327] Nature, 344:458 (1990))
Transgenic plants expressing genes encoding enzymes that affect the integrity of the insect cuticle may also be useful. Such genes include those encoding, for example, chitinase, proteases, lipases and also genes for the production of nikkomycin. Genes that code for activities that affect insect molting, such those affecting the production of ecdysteroid UDP-glucosyl transferase, may also be useful. [0328]
Genes that code for enzymes that facilitate the production of compounds that reduce the nutritional quality of the plant to insect pests, may also be useful. It may be possible, for instance, to confer insecticidal activity to a plant by altering its sterol composition. Further embodiments of the present invention concern transgenic plants with enhanced lipoxygenase activity. [0329]
The present invention also provides methods and compositions useful in altering plant secondary metabolites. One example concerns altering plants to produce DIMBOA which, it is contemplated, will confer resistance to European corn borer, rootworm and several other insect pests. See, e.g., U.S. Pat. No. 6,331,880. DIMBOA is derived from indole-related compounds. The present invention provides methods for increasing the content of indole-related compounds like tryptophan within plant cells and tissues. Hence, according to the invention the methods provided herein may also increase the levels of DIMBOA, and thereby increase the reistance of plants to insects. [0330]
The introduction of genes that can regulate the production of maysin, and genes involved in the production of dhurrin in sorghum, is also contemplated to be of use in facilitating resistance to earworm and rootworm, respectively. [0331]
Further genes encoding proteins characterized as having potential insecticidal activity may also be used. Such genes include, for example, the cowpea trypsin inhibitor (CpTI; Hilder et al., [0332] Nature, 330:160 (1987)) which may be used as a rootworm deterrent; genes encoding avermectin (Avermectin and Abamectin., Campbell, W. C., Ed., 1989; Ikeda et al., J Bacteriol, 169:5615 1987) which may prove useful as a corn rootworm deterrent; ribosome inactivating protein genes; and genes that regulate plant structures. Transgenic plants including anti-insect antibody genes and genes that code for enzymes that can convert a non-toxic insecticide (pro-insecticide) applied to the outside of the plant into an insecticide inside the plant are also contemplated.
Environmental or Stress Resistance or Tolerance [0333]
Improvement of a plant's ability to tolerate various environmental stresses can be effected through expression of genes. For example, increased resistance to freezing temperatures may be conferred through the introduction of an “antifreeze” protein such as that of the Winter Flounder (Cutler et al., [0334] J Plant Physiol., 135:351 (1989)) or synthetic gene derivatives thereof. Improved chilling tolerance may also be conferred through increased expression of glycerol-3-phosphate acetyltransferase in plastids (Wolter et al., The EMBO J., 11:4685 (1992)). Resistance to oxidative stress can be conferred by expression of superoxide dismutase (Gupta et al., Proc. Natl. Acad. Sci (U.S.A.), 90:1629 (1993)), and can be improved by glutathione reductase (Bowler et al., Ann Rev. Plant Physiol., 43:83 (1992)).
It is contemplated that the expression of genes that favorably affect plant water content, total water potential, osmotic potential, and turgor will enhance the ability of the plant to tolerate drought and will therefore be useful. It is proposed, for example, that the expression of genes encoding for the biosynthesis of osmotically-active solutes may impart protection against drought. Within this class are genes encoding for mannitol dehydrogenase (Lee and Saier, [0335] J. Bacteriol., 258, 10761 (1982)) and trehalose-6-phosphate synthase (Kaasen et al., J. Bacteriology, 174:889 (1992)).
Similarly, other metabolites may protect either enzyme function or membrane integrity (Loomis et al., J. Expt. Zoology, 252:9 (1989)), and therefore expression of genes encoding for the biosynthesis of these compounds might confer drought resistance in a manner similar to or complimentary to mannitol. Other examples of naturally occurring metabolites that are osmotically active and/or provide some direct protective effect during drought and/or desiccation include fructose, erythritol, sorbitol, dulcitol, glucosylglycerol, sucrose, stachyose, raffinose, proline, glycine, betaine, ononitol and pinitol. See, e.g., U.S. Pat. No. 6,281,411. [0336]
Three classes of Late Embryogenic Proteins have been assigned based on structural similarities (see Dure et al., [0337] Plant Molecular Biology, 12:475 (1989)). Expression of structural genes from all three LEA groups may confer drought tolerance. Other types of proteins induced during water stress, which may be useful, include thiol proteases, aldolases and transmembrane transporters, which may confer various protective and/or repair-type functions during drought stress. See, e.g., PCT/CA99/00219 (Na+/H+ exchanger polypeptide genes). Genes that effect lipid biosynthesis might also be useful in conferring drought resistance.
The expression of genes involved with specific morphological traits that allow for increased water extractions from drying soil may also be useful. The expression of genes that enhance reproductive fitness during times of stress may also be useful. It is also proposed that expression of genes that minimize kernel abortion during times of stress would increase the amount of grain to be harvested and hence be of value. [0338]
Enabling plants to utilize water more efficiently, through the introduction and expression of genes, may improve the overall performance even when soil water availability is not limiting. By introducing genes that improve the ability of plants to maximize water usage across a full range of stresses relating to water availability, yield stability or consistency of yield performance may be realized. [0339]
Disease Resistance or Tolerance [0340]
Resistance to viruses may be produced through expression of genes. For example, expression of antisense genes targeted at essential viral functions or expression of genes encoding viral coat proteins may impart resistance to the virus. [0341]
Resistance to diseases caused by bacteria and fungi may be conferred through introduction of genes. For example, genes encoding so-called “peptide antibiotics,” pathogenesis related (PR) proteins, toxin resistance, and proteins affecting host-pathogen interactions such as morphological characteristics may be useful. [0342]
Mycotoxin Reduction/Elimination [0343]
Production of mycotoxins, including aflatoxin and fumonisin, by fungi associated with plants is a significant factor in rendering grain not useful. Inhibition of the growth of these fungi may reduce the synthesis of these toxic substances and therefore reduce grain losses due to mycotoxin contamination. It may be possible to introduce genes into plants such that would inhibit synthesis of the mycotoxin without interfering with fungal growth. Further, expression of a novel gene which encodes an enzyme capable of rendering the mycotoxin nontoxic would be useful in order to achieve reduced mycotoxin contamination of grain. [0344]
Plant Composition or Quality [0345]
The composition of the plant may be altered, for example, to improve the balance of amino acids in a variety of ways including elevating expression of native proteins, decreasing expression of those with poor composition, changing the composition of native proteins, or introducing genes encoding entirely new proteins possessing superior composition. See, e.g., U.S. Pat. No. 6,160,208 (alteration of seed storage protein expression). The introduction of genes that alter the oil content of the plant may be of value. See, e.g., U.S. Pat. Nos. 6,069,289 and 6,268,550 (ACCase gene). Genes may be introduced that enhance the nutritive value of the starch component of the plant, for example by increasing the degree of branching, resulting in improved utilization of the starch in cows by delaying its metabolism. [0346]
Plant Agronomic Characteristics [0347]
Two of the factors determining where plants can be grown are the average daily temperature during the growing season and the length of time between frosts. Expression of genes that are involved in regulation of plant development may be useful, e.g., the liguleless and rough sheath genes that have been identified in corn. [0348]
Genes may be introduced into corn that would improve standability and other plant growth characteristics. Expression of genes which confer stronger stalks, improved root systems, or prevent or reduce ear droppage would be of value to the farmer [0349]
Nutrient Utilization [0350]
The ability to utilize available nutrients may be a limiting factor in growth of plants. It may be possible to alter nutrient uptake, tolerate pH extremes, mobilization through the plant, storage pools, and availability for metabolic activities by the introduction of genes. These modifications would allow a plant to more efficiently utilize available nutrients. For example, an increase in the activity of an enzyme that is normally present in the plant and involved in nutrient utilization may increase the availability of a nutrient. An example of such an enzyme would be phytase. [0351]
Male Sterility [0352]
Male sterility is useful in the production of hybrid seed, and male sterility may be produced through expression of genes. It may be possible through the introduction of TURF-13 via transformation to separate male sterility from disease sensitivity. See Levings, [0353] Science, 250:942-947, (1990). As it may be necessary to restore male fertility for breeding purposes and for grain production, genes encoding restoration of male fertility may also be introduced.
Selection and Characterization of Resistant Cell Lines [0354]
Selections are carried out until cells or tissue are recovered which are observed to be growing well in the presence of normally inhibitory levels of a tryptophan analog thereof. These cell “lines” are subcultured several additional times in the presence of a tryptophan analog to remove non-resistant cells and then characterized. The amount of resistance that has been obtained is determined by comparing the growth of these cell lines with the growth of unselected cells or tissue in the presence of various tryptophan analogs at various concentrations. Stability of the resistance trait of the cultured cells may be evaluated by simply growing the selected cell lines in the absence of the tryptophan analog for various periods of time and then analyzing growth after re-exposing the tissue to the analog. The resistant cell lines may also be evaluated using in vitro chemical studies to verify that the site of action of the analog is altered to a form that is less sensitive to inhibition by tryptophan analogs. [0355]
Transient expression of an anthranilate synthase gene can be detected and quantitated in the transformed cells. Gene expression can be quantitated by RT-PCR analysis, a quantitative Western blot using antibodies specific for the cloned anthranilate synthase or by detecting enzyme activity in the presence of tryptophan or an amino acid analog of tryptophan. The tissue and subcellular location of the cloned anthranilate synthase can be determined by immunochemical staining methods using antibodies specific for the cloned anthranilate synthase or subcellular fractionation and subsequent biochemical and/or immunological analyses. Sensitivity of the cloned anthranilate synthase to agents can also be assessed. Transgenes providing for expression of an anthranilate synthase or anthranilate synthase tolerant to inhibition by an amino acid analog of tryptophan or free L-tryptophan can then be used to transform monocot and/or dicot plant tissue cells and to regenerate transformed plants and seeds. Transformed cells can be selected by detecting the presence of a selectable marker gene or a reporter gene, for example, by detecting a selectable herbicide resistance marker. Transient expression of an anthranilate synthase gene can be detected in the transgenic embryogenic calli using antibodies specific for the cloned anthranilate synthase, or by RT-PCR analyses. [0356]
Plant Regeneration and Production of Seed [0357]
Transformed embryogenic calli, meristematic tissue, embryos, leaf discs and the like can then be used to generate transgenic plants that exhibit stable inheritance of the transformed anthranilate synthase gene. Plant cell lines exhibiting satisfactory levels of tolerance to an amino acid analog of tryptophan are put through a plant regeneration protocol to obtain mature plants and seeds expressing the tolerance traits by methods well known in the art (for example, see, U.S. Pat. Nos. 5,990,390 and 5,489,520; and Laursen et al., [0358] Plant Mol. Biol., 24:51 (1994)). The plant regeneration protocol allows the development of somatic embryos and the subsequent growth of roots and shoots. To determine that the tolerance trait is expressed in differentiated organs of the plant, and not solely in undifferentiated cell culture, regenerated plants can be assayed for the levels of tryptophan present in various portions of the plant relative to regenerated, non-transformed plants. Transgenic plants and seeds can be generated from transformed cells and tissues showing a change in tryptophan content or in resistance to a tryptophan analog using standard methods. It is especially preferred that the tryptophan content of the leaves or seeds is increased. A change in specific activity of the enzyme in the presence of inhibitory amounts of tryptophan or an analog thereof can be detected by measuring enzyme activity in the transformed cells as described by Widholm, Biochimica et Biophysica Acta, 279:48 (1972). A change in total tryptophan content can also be examined by standard methods as described by Jones et al., Analyst, 106:968 (1981).
Mature plants are then obtained from cell lines that are known to express the trait. If possible, the regenerated plants are self pollinated. In addition, pollen obtained from the regenerated plants is crossed to seed grown plants of agronomically important inbred lines. In some cases, pollen from plants of these inbred lines is used to pollinate regenerated plants. The trait is genetically characterized by evaluating the segregation of the trait in first and later generation progeny. The heritability and expression in plants of traits selected in tissue culture are of particular importance if the traits are to be commercially useful. [0359]
The commercial value of tryptophan overproducer soybeans, cereals and other plants is greatest if many different hybrid combinations are available for sale. The farmer typically grows more than one kind of hybrid based on such differences as maturity, standability or other agronomic traits. Additionally, hybrids adapted to one part of the country are not adapted to another part because of differences in such traits as maturity, disease, and insect resistance. Because of this, it is necessary to breed tryptophan overproduction into a large number of parental inbred lines so that many hybrid combinations can be produced. [0360]
A conversion process (backcrossing) is carried out by crossing the original overproducer line to normal elite lines and crossing the progeny back to the normal parent. The progeny from this cross will segregate such that some plants carry the gene responsible for overproduction whereas some do not. Plants carrying such genes will be crossed again to the normal parent resulting in progeny which segregate for overproduction and normal production once more. This is repeated until the original normal parent has been converted to an overproducing line, yet possesses all other important attributes as originally found in the normal parent. A separate backcrossing program is implemented for every elite line that is to be converted to tryptophan overproducer line. [0361]
Subsequent to the backcrossing, the new overproducer lines and the appropriate combinations of lines which make good commercial hybrids are evaluated for overproduction as well as a battery of important agronomic traits. Overproducer lines and hybrids are produced which are true to type of the original normal lines and hybrids. This requires evaluation under a range of environmental conditions where the lines or hybrids will generally be grown commercially. For production of high tryptophan soybeans, it may be necessary that both parents of the hybrid seed be homozygous for the high tryptophan character. Parental lines of hybrids that perform satisfactorily are increased and used for hybrid production using standard hybrid seed production practices. [0362]
The transgenic plants produced herein are expected to be useful for a variety of commercial and research purposes. Transgenic plants can be created for use in traditional agriculture to possess traits beneficial to the consumer of the grain harvested from the plant (e.g., improved nutritive content in human food or animal feed). In such uses, the plants are generally grown for the use of their grain in human or animal foods. However, other parts of the plants, including stalks, husks, vegetative parts, and the like, may also have utility, including use as part of animal silage, fermentation feed, biocatalysis, or for ornamental purposes. [0363]
Transgenic plants may also find use in the commercial manufacture of proteins or other molecules, where the molecule of interest is extracted or purified from plant parts, seeds, and the like. Cells or tissue from the plants may also be cultured, grown in vitro, or fermented to manufacture such molecules. [0364]
The transgenic plants may also be used in commercial breeding programs, or may be crossed or bred to plants of related crop species. Improvements encoded by the recombinant DNA may be transferred, e.g., from soybean cells to cells of other species, e.g., by protoplast fusion. [0365]
In one embodiment, a transgene comprised of a maize anthranilate α-domain isolated from a maize cell line tolerant to 5-MT and linked to the 35S CaMV promoter is introduced into a 5-MT sensitive monocot or dicot tissue using microprojectile bombardment. Transformed embryos or meristems are selected and used to generate transgenic plants. Transformed calli and transgenic plants can be evaluated for tolerance to 5-MT or 6-MA and for stable inheritance of the tolerance trait. [0366]
The following examples further illustrate the invention and are not intended to be limiting thereof. [0367]

EXAMPLE 1

Isolation and E. coli Expression of Anthranilate Synthase from Agrobacterium tumefaciens

This example describes the isolation of anthranilate synthase from [0368] Agrobacterium tumefaciens and its expression in E. coli.
Cloning of [0369] Agrobacterium tumefaciens AS
The nucleotide and amino acid sequences of the anthranilate synthase coding region from [0370] Rhizobium meliloti (GenBank accession number: P15395) was used to search an Agrobacterium tumefaciens C58 genomic sequence database (Goodner et al. Science, 294:2323-2328 (2001)). The search consisted of tblastn using blosum62 matrix, (Altschul et al., Nucleic Acid Res., 25:3389-3402 (1997)).
The identified AS homolog in the [0371] Agrobacterium tumefaciens C58 genomic sequence database was cloned by PCR using genomic DNA from Agrobacterium tumefaciens strain C58 (ATCC No. 33970) as the template. The primary PCR reaction was carried out using the following primers:

5′-TTATGCCGCCTGTCATCG-3′; and (SEQ ID NO: 47)

5′-ATAGGCTTAATGGTAACCG-3′. (SEQ ID NO: 48)
Gene amplification parameters were as follows: (a) denature at 95° C. for 30 seconds, (b) anneal at 50° C. for 30 seconds and (c) extend at 72° C. for 2 minutes, using Expand high fidelity PCR (Roche Biochemicals), according to manufacturer directions. [0372]
An additional round of PCR amplification, yielding a product of approximately 2.3 Kb in length, was carried out using the amplified template from above and the following nested primers: [0373]

5′-CTGAACAACAGAAGTACG-3′; and (SEQ ID NO: 49)

5′-TAACCGTGTCATCGAGCG-3′. (SEQ ID NO: 50)
The purified PCR product was ligated into pGEM-T easy (Promega Biotech) resulting in the plasmid pMON61600 (FIG. 1). pMON61600 was sequenced using standard sequencing methodology. Confirmation of the correct sequence was obtained by comparison of the sequence the [0374] Rhizobium meliloti anthranilate synthase sequence (FIG. 2). The translated amino acid sequence from the isolated clone (SEQ ID NO: 4) shared 88% identity with the Rhizobium meliloti enzyme (SEQ ID NO: 7) (FIG. 2).
The abbreviation “AgroAS” or [0375] A. tumefaciens AS is sometimes used herein to refer to Agrobacterium tumefaciens anthranilate synthase.
[0376] E. coli Expression of Agrobacterium tumefaciens AS
The following vectors were constructed to facilitate subcloning of the [0377] Agrobacterium tumefaciens AS gene into a suitable expression vector.
A 2215 base pair PCR fragment was generated using pMON61600 as the template and the following primers: [0378]

(SEQ ID NO: 51)

5′-AAAAAGATCTCCATGGTAACGATCATTCAGG-3′; and

(SEQ ID NO: 52)

5′-AAAAGAATTCTTATCACGCGGCCTTGGTCTTCGCC-3′.
The plasmid pMON61600 was digested with restriction enzymes NcoI and RsrII. In addition, a 409 bp fragment (derived by digesting the 2215 base pair PCR product with NcoI and RsrII) was then ligated into the digested pMON61600 plasmid, thereby replacing the NcoI/RsrII fragment, and resulting in a NcoI site in frame with the translation initiation codon (ATG) of [0379] Agrobacterium tumefaciens AS to yield plasmid pMON34692 (FIG. 3).
The base T7 [0380] E. coli expression plasmid, pMON34697 (FIG. 4), was generated by restriction digestion of pET30a (Novogen, Inc) with SphI and BamHI. The resulting 4,969 bp fragment was purified and subcloned with a 338 bp SphI and BamHI fragment from pET11d (Novogen, Inc).
The plasmid pMON34705 (FIG. 5) was generated by restriction digestion of pMON34697 with NcoI and SacI. The resulting 5,263 bp fragment was then purified and ligated with a 2,256 bp NcoI and SacI fragment from pMON34692 containing [0381] Agrobacterium tumefaciens AS.
The plasmid pMON34705 was transformed into [0382] E. coli BL21(DE3) (F-ompT HsdS_b(r_B ⁻m_B ⁻)gal dcm (DE3)) according to manufacturer's instructions (Novogen, Inc). DE3 is a host lysogen of λDE3 containing chromosomal copy of T7 RNA polymerase under control of an isopropyl-1-thio-D-galactopyranoside (IPTG) inducible lacUV5.
Transformed cells were selected on kanamyacin plates that had been incubated at 37° C. overnight (10 hours). Single colonies were transferred to 2 ml of LB (Luria Broth; per liter, 10 g tryptone, 5 g yeast extract, 10 g NaCl, and 1 g glucose (optional)) or 2X-YT broth (per liter, 16 g tryptone, 10 g yeast extract, 5 g NaCl) and then placed in a 37° C. incubator and shaken at 225 rpm for 3 hours. The cells were removed and 4 μL of 100 mM IPTG was added to the culture and returned to the 37° C. incubator for an additional 2 to 3 hours. A 1 mL aliquot of the cells was removed and sonicated in sonication buffer, (50 mM potassium phosphate (pH 7.3), 10% glycerol, 10 mM 2-mercaptoethanol and 10 mM MgCl[0383] ₂). The resulting lysed cell extract was the source material for the standard AS assay described below. The results established that the expression system based on plasmid pMON34705 was able to produce soluble and enzymatically active Agrobacterium tumefaciens AS protein that accounts for approximately 50% of total soluble extracted protein.

EXAMPLE 2

High Trp Seed Levels are Achieved by Transformation of Plants with Wild Type Agrobacterium Anthranilate Synthase

Expression Vector pMON58120 [0384]
The vector pMON58120 (FIG. 34) encodes a fusion between a 264 base pair Arabidopsis small subunit (SSU) chloroplast targeting peptide (CTP, SEQ ID NO: 71) and a 2187 base pair wild type Agrobacterium anthranilate synthase (AgroAS) open reading frame (SEQ ID NO: 1). See, Stark et al., (1992) [0385] Science, 258:287. Expression of this open reading frame is driven by the soy 7S alpha prime (7Sα′) promoter.
Upon translation on cytoplasmic ribosomes, the fusion (immature protein) is imported into chloroplast where the chloroplast targeting sequence is removed. There are two cleavage sites in the CTP1. The first site is 30 base pairs upstream of the CDS start (C/M), and the other is at the initial methionine (C/M). The second cleavage site does not seem to be processed efficiently. The cleavage is predicted to yield a mature protein of about 70 Kd that has AS activity as shown by enzyme activity data and trp efficacy data. [0386]
The AS gene was transformed with the synthetic CP4 gene that confers glyphosate resistance, however the CP4 gene is processed separately from the AS gene. Expression of the CP4 gene was driven by the FMV promoter, which is a 35S promoter from Figwort Mosaic Virus. Glyphosate resistance allows for selection of the transformed plants. [0387]
Western Analysis of AS Protein [0388]
Thirty-five transformation events of pMON58120 were analyzed for AgroAS protein presence. AgroAS protein was detected with a polyclonal antibody raised in rabbits against purified His-tagged AgroAS. The His-tagged, full-length Agro-AS polypeptide was used as an antigen to generate a population of polyclonal antibodies in rabbits by CoCalico Biological, Inc. The recombinant His-tagged Agro-AS DNA was placed into a pMON34701 (pet-30a-agroAS) expression vector. The His-AgroAS fusion protein was expressed in [0389] E. coli BL21(DE3) and purified by Ni-NTA resin system (Qiagen protocol). For western analysis, primary rabbit anti-AgroAS antibodies were used at 1:5,000 dilution. Secondary, goat anti-rabbit alkaline phosphatase-conjugated antibodies were used at 1:5,000 dilution. In transgenic lines carrying 7Salpha′-Agro AS genes, western blot analysis consistently revealed the presence of a single band that specifically cross-reacted with anti-AgroAS antibodies. This band was not detected in the nontransgenic control line.
Free Amino Acid Analysis of Soy and Arabidopsis Seed [0390]
Amino Acid Extraction: About 50 mg of crushed soy seed (5 mg of Arabidopsis) material was placed in each centrifuge vial. One milliliter of 5% trichloroacetic acid was added to each sample (100 μl for Arabidopsis). The samples were vortexedu, and allowed to sit, with agitation, at room temperature for 15 min. They were then microcentrifuged for 15 min at 14000 rpm. Some of the supernatant was then removed, placed in a HPLC vial and sealed. Samples were kept at 4° C. in the analysis queue. [0391]
Amino Acid Analysis: The reagents utilized for amino acid analysis included the OPA reagent (o-phthalaldehyde and 3-mercaptopropionic acid in borate buffer (Hewlett-Packard, PN5061-3335)) where the borate buffer (0.4 N in water, pH 10.2). The analysis was performed using the [0392] Agilent 1100 series HPLC system as described in the Agilent Technical Publication, “Amino Acid Analysis Using Zorbax Eclipse-AAA Columns and the Agilent 1100 HPLC”, Mar. 17, 2000. First, 0.5 μl of the sample was derivatized with 2.5 μl of OPA reagent in 10 μl of borate buffer. Second, the derivative is injected onto a Eclipse XDB-C18 5 μm, 4.6×150 mm column using a flow rate of 1.2 ml/min. Amino acid concentrations were measured using fluorescence: excitation at 340 nm, emission at 450 nm. Elution was with a gradient of HPLC Buffers A and B according to Table A, where HPLC Buffer A was 40 mM Na₂HPO₄, pH=7.8 and HPLC Buffer B was 9:9:2:Methanol:Acetonitrile:Water.

TABLE A

Amino Acid Elution

Time

0 20 21 26 27

% Buffer B 5 65 100 100 100
Amino acid standards were prepared from the dry chemicals, using all amino acids of interest. Proline analysis required an additional derivatization step with 9-fluorenylmethyl-chloroformate (FMOC). Amino acid standards were also sometimes purchased in concentrations ranging from 0 to 100 μg/ml. Samples were reported in μg/g of seed powder. [0393]
Expression of Wild Type Agrobacterium Anthranilate Synthase in Arabidopsis [0394]
The vector pMON58120 was transformed into Arabidopsis plants by vacuum infiltration of the secondary influorescences, and plants were allowed to set transgenic seed. The seed was collected and screened for the presence of a selectable marker (glyphosate resistance). Glyphosate resistant plants were grown to maturity and seed from each plant, which was designated a transformation event, and analyzed for tryptophan content (Table B). Selected transformation events were also analyzed for the presence of the expressed Agrobacterium anthranilate synthase protein in the mature seed by Western blot analysis as shown in Table B. [0395]

TABLE B

Analysis of Transformants

Transformation Event Trp (ppm) Protein present

7317 2547 +

7315 2960 +

7319 3628 +

7313 3979 +
Expression of Wild Type Agrobacterium Anthranilate Synthase in Soy ([0396] Glycine Max)

Thirty-three out of thirty-five soy transformation events analyzed had an increase in seed trp levels, for example, from above 500 ppm and up to 12,000 ppm. In nontransgenic soy seeds, the trp level is less than 200 ppm. All seeds that contained high amounts of trp demonstrated anthranilate synthase protein expression by western blotting. Table C presents data for nineteen soy events that contain high trp levels and also are positive for anthranilate synthase anthranilate synthase protein by western blot analysis.

TABLE C


Correlation between the Presence of the Agro AS Protein and
Tryptophan Levels in Nineteen Soy Transgenic
Events bearing pMON58120

	Trp max	Trp average
Pedigree	(ppm)	(ppm)	Protein present?

A3244 (ctr)	306	96	NO
GM_A20380: @.	6444	2246.4	YES
GM_A20532: @.	6055	2556.6	YES
GM_A22043: @.	10422	2557.2	YES
GM_A20598: @.	8861	2859.9	YES
GM_A20744: @.	7121	3373.3	YES
GM_A20381: @.	6392	3572.9	YES
GM_A20536: @.	9951	3581.5	YES
GM_A20510: @.	8916	3592.7	YES
GM_A20459: @.	8043	3900.4	YES
GM_A20337: @.	7674	4088.6	YES
GM_A20533: @.	9666	4183.2	YES
GM_A20577: @.	6276	4434.1	YES
GM_A20339: @.	9028	4687.8	YES
GM_A20386: @.	8487	5285.3	YES
GM_A20457: @.	11007	5888.9	YES
GM_A20379: @.	7672	6416.1	YES
GM_A20537: @.	9163	6695.8	YES
GM_A20534: @.	12676	7618.2	YES
GM_A20576: @.	10814	7870.1	YES

The Agro AS Enzyme Assay [0398]
The specific activity of anthranilate synthase was measured in eleven transformation events carrying the pMON58120 construct. Individual soybean immature seeds were analyzed using an HPLC-based end-point assay based on the method described by C. Paulsen ([0399] J. Chromatogr., 547:155-160 (1991)). Briefly, desalted extracts were generated from individual seeds in grinding buffer (100 mM Tris pH 7.5, 10% glycerol, 1 mM EDTA, 1 mM DTT) and incubated for 30 min with reaction buffer (100 mM tris pH 7.5, 1 mM chorismate, 20 mM glutamine, and 10 mM MgCl₂). Agro AS activity was measured in the presence or absence of 25 mM trp. The reaction was stopped with phosphoric acid and the amount of anthranilate formed was quantified by HPLC using a fluorescence detector set at 340 nm/excitation and 410 nm/emission.
The specific activity of AS in immature segregating transgenic seeds ranged from 1.5-fold up to 70-fold increase compared to a nontransgenic control, reaching as high as 6,000 pmoles/mg/min. As shown in the last column of Table D, the anthranilate synthase activity in transgenic plants is resistant to tryptophan inhibition (see Table D). [0400]

TABLE D

Agro AS Enzyme Activity in Transgenic Event 20576

Seed Specific Activity Specific Activity (pmoles/mg/min)

Event No. (pmoles/mg/min) (+25 micromolar Trp)

Control 3244-1 95.4 42.4

Control 3244-2 85.5 40.6

20576 20576-1 6060.2 4407.1

20576 20576-2 3783.8 1709.4

20576 20576-3 2768.3 2431.7

20576 20576-4 4244.08 2125.2

EXAMPLE 3

Soybean Transformation with a Vector Containing a Maize Anthranilate Synthase α-Subunit Gene

The coding sequence for a maize anthranilate synthase α-subunit was isolated from pMON52214 (FIG. 22) by digesting with XbaI in combination with a partial NcoI digest (see Anderson et al., U.S. Pat. No. 6,118,047). The resulting 1952 bp DNA fragment representing the anthranilate synthase a coding region was gel purified, and the ends were made blunt. The plasmid pMON53901 (FIG. 23) was digested with BglII and EcoRI, to generate a 6.8 Kb fragment. After isolation, the ends of the 6.8 Kb fragment were made blunt and dephosphorylated. The 1952 Kb fragment containing the ASα gene was then ligated into the blunt-ended 6.8 Kb pMON53901 fragment to generate pMON39324, a [0401] maize 7S promoter-maize ASα-NOS 3′ UTR expression vector (FIG. 24).
This pMON39324, a [0402] maize 7S promoter-maize ASα-NOS 3′ UTR cassette, was subsequently digested with BamHI resulting in a 2.84 Kb DNA fragment, containing the 7S promoter and maize ASα coding sequence. The plasmid pMON39322 (FIG. 25) was digested with BamHI resulting in a 5.88 kb DNA fragment. These two fragments were then ligated together to create pMON39325 (FIG. 26), a transformation vector containing 7S promoter-maize ASα-NOS 3′ UTR cassette subcloned into pMON39322.

Using similar procedures, the coding sequence for a maize anthranilate synthase α-subunit was cloned downstream from the USP promoter to generate a pMON58130 expression vector, downstream from the Arc5 promoter to generate a pMON69662 expression vector, downstream from the Lea9 promoter to generate a pMON69650 expression vector, and downstream from the Per1 promoter to generate a pMON69651 expression vector. A list with these expression vectors is presented in Table E.

TABLE E


C28-Maize Anthranilate Synthase Constructs

Seed Generation	Expression Cassette	Vector Name

R4	7Sa'-maize ASα	PMON39325
R2	Napin-maize ASα	PMON58023
R1	USP-maize ASα	PMON58130
R1	Arc5-maize ASα	PMON69662
R1	Lea9-maize ASα	PMON69650
R1	Per1-maize ASα	PMON69651

These vectors were used for plant transformation and propagation experiments. Soybean plants were transformed with the maize AS-containing vectors using the microprojectile bombardment technology as described herein. Several transgenic soybean lines were established for each type of vector and propagated through the number of generations indicated in Table E. [0404]
For example, three homozygous lines were established that carried the 7Sα′-maize AS transgene from pMON39325. These three lines were grown in a randomized block design in two different locations. Mature seed was produced and analyzed for free amino acid content. Controls were included to establish baseline trp levels, i.e. the three corresponding negative isolines and the nontransgenic controls. [0405]

Table F provides R4 seed tryptophan in ppm for pMON39325 transformant and control lines, showing that the average non-transgenic soybeans contain about 100-200 μg tryptophan/g seed powder whereas the pMON39325 transformants contain substantially more Trp. See also, FIG. 27.

TABLE F


Trp Levels in seeds of Soybean Plants Transformed
with the C28 Zea mays mutant (pMON39325)

	Average trp		Average trp of
Positive	of Positive		corresponding
isoline	Isoline	Standard	Negative isoline	Standard
number	(ppm)	deviation	(ppm)	deviation

39325-1	3467	377	226	55
35325-2	2623	307	164	20
35325-3	3715	152	184	64
35325-4	2833	165	202	146
35325-5	3315	161	173	34
35325-6	2394	318	144	22
nontransgenic			191	24
control-7
nontransgenic			118	23
control-8

Five other constructs, expressing the C28 maize anthranilate synthase under the control of five different promoters (Table E) were transformed into soy and transgenic plants were obtained. Each construct generated events high in trp. An example illustrating events generated by Per1-C28 maize anthranilate synthase is shown in Tables G and H. [0407]

TABLE G

C28 maize AS Protein Expression Correlates

with Increased Trp Levels in Three Transgenic Events

bearing Per1-C28 maize AS (pMON69651)

Pedigree Trp average (ppm) Protein present?

Control 96 No

22689 2375 Yes

22787 1707 Yes

22631 1116 Yes
Table H illustrates the enzymatic activity of C28 maize AS in R1 seeds from soybean plants transformed with the pMON69651 expression vector. [0408]

TABLE H

Specific Activity of C28 maize AS in R1 Seeds

of pMON69651 Transformants

Specific activity

Seed Specific activity (pmoles/mg/min)

Event number (pmoles/mg/min) (+25 micromolar tryptophan)

Control 51.6 2.6

22689 22689-1 130.9 64.7

22689-2 115.3

22689-3 148.5 61.1

22689-4 149.5

22698-5 133.8 60.3
These results indicate that there is a substantial increase in tryptophan when soybean plant tissues are transformed with the C28 maize AS gene. [0409]
The high trp levels shown in Table G correlate with the presence of the AS protein and with increased specific activity (2.5 fold higher than in nontransgenic controls) for the transgenic enzyme (Table H). As shown in Table H—and as predicted by the biochemical properties of the C28 maize AS enzyme—the specific activity of transgenic events is tryptophan-resistant. [0410]

EXAMPLE 4

Rational Design of Agrobacterium tumefacians Anthranilate Synthase Tryptophan Feedback Insensitive Mutants

This example describes vectors containing mutant [0411] Agrobacterium tumefaciens anthranilate synthase enzymes that have various degrees of sensitivity or insensitivity to feedback inhibition by tryptophan or tryptophan analogs.
Generation of [0412] Agrobacterium tumefaciens Mutant Anthranilate Synthase Genes
Using protein structural information from [0413] Solfulobus solfataricus anthranilate synthase as a guide (Knochel et al., Proc. Natl. Acad. Sci. (U.S.A.), 96:9479-9484 (1999)) several Agrobacterium tumefaciens anthranilate synthase mutants were rationally designed utilizing protein informatics to confidently assign several residues involved in tryptophan binding. This was accomplished by alignment of the Agrobacterium tumefaciens anthranilate synthase gene with the anthranilate synthase amino acid sequence from Sulfolobus solfataricus (FIG. 6). The putative tryptophan binding and catalysis regions of the Agrobacterium tumefaciens were assigned by combining the knowledge of the structural information with the sequence homology. Residues in the binding pocket were identified as potential candidates for altering to provide resistance to feedback inhibition by tryptophan.
Based on the structural analysis of the [0414] Sulfolobus solfataricus anthranilate synthase enzyme, it suggested that amino acids E30, S31, 132, S42, V43, N204, P205, M209, F210, G221, and A373 were involved in tryptophan binding. Based on the pairwise alignment, N204, P205, and F210 of Sulfolobus solfataricus were also conserved in the monomeric Agrobacterium tumefaciens anthranilate synthase as residues N292, P293, and F298 respectively.
However, due to multiple insertions and deletions, the N-terminal regions of the [0415] Sulfolobus solfataricus and Agrobacterium tumefaciens enzymes were highly divergent. For this reason, it was necessary to manually assign residues at the N-terminal region of the Agrobacterium tumefaciens anthranilate synthase involved in tryptophan regulation (FIG. 6). Structural analysis indicated that the motif “LLES” formed a β sheet in the tryptophan-binding pocket. This structure appeared to be highly conserved among the heterotetrameric enzymes. The known monomeric enzymes were then manually aligned to the Sulfolobus solfataricus sequence using the “LLES” motif as a landmark (FIG. 21). Based on this protein informatics analysis, amino acid residues V48, S50, S51, and N52 in Agrobacterium tumefaciens AS were also likely to be involved in tryptophan binding.
With the putative tryptophan binding residues assigned in the [0416] Agrobacterium tumefaciens monomeric enzyme, several distinct strategies were rationalized for reducing the sensitivity of the enzyme to tryptophan inhibition. These substitutions included for example, enlarging the tryptophan-binding pocket (F298A), narrowing the binding pocket (V48F, V48Y, S51F, S51C, N52F, F298W), increasing the polarity of the binding pocket (S50K), or distorting the shape of the binding pocket by changing the protein main chain conformation (P293A, P29G).
[0417] A. tumefaciens AS Site-Directed Mutagenesis
Site directed mutagenesis was used to generate ten single amino acid substitutions six sites. The mutations were introduced into the [0418] Agrobacterium tumefaciens AS in pMON34705 using the QuikChange™ Site-Directed Mutagenesis Kit (Stratagene). The primers used for site directed mutagenesis were SEQ ID NOs: 9-42 (FIG. 7; F=forward, R=reverse). Each primer sequence is specific for alteration of the nucleic acid at a specific location in the sequence and thus changing the encoded codon to code for a new amino acid. For example, S51C designates a change from serine to cysteine at amino acid position 51 in the Agrobacterium tumefaciens AS peptide sequence.
Following mutagenesis the sequence of the entire gene was reconfirmed and the variants expressed and purified from [0419] E. coli as described below for the wild type enzyme. The resultant plasmids comprising mutant Agrobacterium tumefaciens AS are suitably cloned into a plasmid for overproduction of protein using the T7 expression system as described in Example 1.
[0420] Agrobacterium tumefaciens AS Protein Expression and Purification
[0421] Agrobacterium tumefaciens AS wild type and mutant enzymes were expressed in E. coli as described in Example 1. The purification of all the Agrobacterium tumefaciens AS enzymes, including wild type and mutants therof, was performed at 4° C. The cells (approximate wet weight of 1 g) were suspended in 20 ml of purification buffer (50 mM potassium phosphate, pH 7.3, 10 mM MgCl₂, 10 mM 2-mercaptoethanol, 10% glycerol) and lysed by ultrasonication (Branson sonifier Cell Disruptor, W185). Supernatant was collected after centrifugation of the homogenate at 20,000×g for 15 min. The supernatant was subjected to ammonium sulfate fractionation (30 to 65% saturation). The precipitate was collected after centrifugation at 20,000×g for 15 min and dissolved in 3 ml of the purification buffer and then loaded as a whole on an Econo-Pac 10DG desalting column, pre-equilibrated with the same buffer. Fractions containing the enzyme were detected by the developed assay and pooled. The pooled enzyme (4.3 mls) was loaded on a 10 ml DEAE Sephacel (Pharmacia Biotech) column (1.5×7.5 cm) equilibrated with the same buffer. The column was washed with 30 ml of the purification buffer and the enzyme was eluted with 30 ml of 50 mM NaCl in the same buffer. Fractions containing high AS activity were pooled and precipitated by 65% ammonium sulfate saturation and isolated and desalted as above. Fractions containing the enzyme were pooled and stored at −80° C.
Anthranilate Synthase Enzyme Assay and Kinetic Analysis [0422]
The standard assay for [0423] Agrobacterium tumefaciens AS was performed at 25° C. in an assay buffer containing 100 mM potassium phosphate, pH 7.0, 10 mM MgCl₂, 1 mM dithiothreitol, 200 μM chorismate and 10 mM L-glutamine. The reaction was started by adding 30 μl of enzyme to the reaction mixture and mixing. The formation of anthranilate was directly monitored by the absorbance increase at 320 m for 3 minutes. Initial rate of reaction was calculated as unit absorbance increase per second based on the slope of the absorbance change over the reaction time. K_mfor chorismate (K_m ^Cho) was determined in the total volume of 1 ml assay buffer containing 100 mM potassium phosphate, pH 7.0, 10 mM MgCl₂, 1 mM dithiothreitol with 10 mM L-glutamine and varying the concentration of chorismate between 2.5-100 μM chorismate. The K_mfor glutamine (K_m ^Gln) was determined in the total volume of 1 ml assay buffer containing 100 mM potassium phosphate, pH 7.0, 10 mM MgCl₂, 1 mM dithiothreitol with 200 μM chorismate and varying the concentration of L-glutamine between 0.1-2 mM L-glutamine. IC₅₀for tryptophan (IC₅₀ ^Trp) was determined with in the total volume of 1 ml assay buffer containing 100 mM potassium phosphate, pH 7.0, 10 mM MgCl₂, 1 mM dithiothreitol, 10 mM L-glutamine, 200 μM chorismate and varying the concentration of L-tryptophan between 0.1-10 mM L-tryptophan. Kinetic parameters and IC₅₀of AS were calculated after fitting the data to a non-linear regression program (GraFit).

Several mutants demonstrated reduced sensitivity to tryptophan inhibition while still maintaining enzymatic activity comparable to the wild type enzyme (Table I). These results demonstrate that the extent of sensitivity to tryptophan inhibition can be decreased, for example, by mutating amino acids in the tryptophan-binding pocket of anthranilate synthase and by optimizing of the mutations demonstrating feedback insensitivity.

TABLE I


Anthranilate Synthase Activity and Effect of Tryptophan
on Agrobacterium tumefaciens AS Mutants

		K_m ^Cho	K_m ^Gln		k_cat/K_m ^Cho	IC₅₀ ^Trp
Mutation	Codon	(μM)	(mM)	k_cat(s⁻¹)	(μM⁻¹s⁻¹)	(μM)

WT		8.0	0.11	0.43	5.37 × 10⁻²	5
V48F	TTT	4.5	0.08	0.24	5.33 × 10⁻²	150
V48Y	TAT	4.2	0.10	0.18	4.28 × 10⁻²	650
S50K	AAG		13	0.01	0.13	1.00 × 10⁻²	0.1
S51F	TTC	10	0.06	0.08	0.80 × 10⁻²	>32,000
S51C	TGC	2.8	0.08	0.15	5.36 × 10⁻²	1,500
N52F	TTC	5.5	0.04	0.21	3.82 × 10⁻²	41
P293A	GCG		24	0.16	0.35	1.46 × 10⁻²	14
P293G	GGG		33	0.07	0.48	1.45 × 10⁻²	17
F298A	GCC	9.2	0.10	0.46	5.00 × 10⁻²	5.5
F298W	TGG	18	0.14	0.44	2.44 × 10⁻²	450

EXAMPLE 5

Random Mutagenesis of Agrobacterium tumefaciens AS to Generate Tryptophan Feedback Insensitive Mutants

In addition to the rational design approaches described in Example 4, other strategies to generate feedback insensitive mutants of anthranilate synthase include, but are not limited to, random mutageneseis. Random mutagenesis of the [0425] Agrobacterium tumefaciens AS, can be accomplished, for example, by chemical mutagenesis (isolated DNA or whole organism), error prone PCR, and DNA shuffling. This example describes the use of chemical mutagenesis followed by genetic selection. The genetic selection approach is also useful for selection of desirable mutants derived from other mutagenesis techniques.
Generation of [0426] E. coli Expression Plasmid Containing A. tumefaciens AS
The open reading frame from the [0427] Agrobacterium tumefaciens AS clone pMON61600 (SEQ ID NO: 1, described in Example 1) was amplified by PCR using primers that contain an Nco 1 site on the 5′ end of the forward primer and an XbaI site on the 3′ end of the reverse primer:

(SEQ ID NO: 55)

5′-CATCCCATGGATGGTAACGATCATTCAGGAT-3′; and

(SEQ ID NO: 56)

5′-GATGTCTAGAGACACTATAGAATACTCAAGC-3′.
The resulting PCR product was ligated into pMON25997 (FIG. 28), which had the bktB open reading frame (Slater et al., [0428] J. Bact., 180:1979-1987 (1998)) removed by digestion with BspH1 and Xba1 resulting in plasmid pMON62000 (FIG. 29). pMON62000 is the base plasmid used for mutagenesis and complementation of the tryptophan auxotroph (EMG2ΔtrpE).
Generation of an [0429] E. coli Tryptophan Auxotroph EMG2ΔtrpE
[0430] E. coli strain Ec-8 (EMG2ΔtrpE) was constructed using the suicide vector pKO3 to delete 1,383 base pairs from the chromosomal trpE gene of E. coli strain EMG2(K-12 wt F+) (E. coli Genetic Stock Center). Two amplicons from E. coli genomic DNA were PCR amplified. The first amplicon was approximately 1.5 kb and contained the first 30 bp of the trpE ORF at the 3′ end. This amplicon contains a BamHI site at the 5′ end and an EcoR1 site at the 3′ end. The second amplicon was approximately 1 kb and contained the last 150 bp of the trpE ORF at the 5′ end. This amplicon contains an EcoR1 site at the 5′ end and a Sal1 site at the 3′ end. The two amplicons were digested with the appropriate enzymes and ligated together at the EcoR1 site to create an in-frame deletion of trpE. FIG. 30 shows the resulting sequence of the truncated gene (SEQ ID NO: 46). The trpE deletion amplicon was ligated into pKO3 at the BamH1 and Sal1 sites. Gene disruption was performed as described in A. J. Link et al. J. Bacteriol., 179:6228 (1997).
Complementation of [0431] E. coli Tryptophan Auxotroph EMG2ΔtrpE with pMON62000
[0432] E. coli strain Ec-8 (EMG2ΔtrpE) was transformed with pMON62000 and plated on M9 minimal medium to determine if the deletion was complemented by the addition of pMON62000. A plasmid control (minus the Agrobacterium tumefaciens AS insert) and a strain control Ec-8 were also plated onto M9 minimal medium and onto M9 minimal medium with 40 μg/ml tryptophan. Growth of strain Ec-8 transformed with pMON62000 was observed on M9 without tryptophan, no growth of either of the controls was observed, indicating complementation of the trpE deletion in strain Ec-8 by pMON62000.
Hydroxylamine Mutagenesis of pMON62000 and Genetic Selection of Mutants [0433]
To generate mutants of anthranilate synthase, pMON62000 was mutated with the chemical mutagen hydroxylamine. The following ingredients were combined in an eppendorf tube: 20 μg pMON62000 plasmid DNA and 40 μl 2.5 M hydroxylamine, pH 6.0. The volume was brought to a volume of 200%1 with 0.1M NaH[0434] ₂PO₄, pH 6.0+5 mM EDTA, pH 6.0. The tube was incubated at 70° C. After 1.5 hours, 100 μl of reaction mixture was dialyzed on a nitrocellulose filter that was floating on approximately 500 ml H₂O. After 15 minutes, the DNA was concentrated using Qiagen PCR Purification Kit. After 3 hours, the remaining 100 μl of the reaction mixture was removed and purified in the same manner.
[0435] E. coli strain Ec-8 was then transformed by electroporation with 100 ng of pMON62000 that had been mutagenized for either 1.5 or 3 hours with hydroxylamine. Two transformation procedures were performed for each time point. Transformed cells were allowed to recover for 4 or 6 hours in SOC medium (20 g/L Bacto-Tryptone, 5 g/L Bacto Yeast Extract, 10 ml/L 1M NaCl, 2.5 ml/L 1M KCl, 18 g glucose).
Two 245 mm square bioassay plates were prepared containing M9 minimal medium, plus 2% agar, and 50 μg/ml 5-methyl-DL-tryptophan (5-MT). An aliquot of 900 μl of the 1.5 hour mutagenized transformation mixture was plated onto one 50 μg/ml 5-MT plate. The remaining 100 μl was plated onto the M9 control plate. The same procedure was performed for the transformation mixture containing the 3.0 hour mutagenized plasmid. [0436]
The plates were then incubated at 37° C. for approx. 2.5 days. Resistant colonies were isolated from the 5-MT plates and were streaked onto LB-kanamycin (50 μg/ml) plates to confirm the presence of the plasmid. All of the selected colonies grew on these plates. Individual colonies from each of the resistant clones were prepped in duplicate to isolate the plasmid. Restriction digests and PCR were performed and confirmed that all the clones contained the desired [0437] Agrobacterium tumefaciens AS insert.
The rescued plasmids were then transformed back into strain Ec-8. One colony from each tranformation was purified by streaking onto new LB-Kanamycin plates. To confirm resistance to 5-MT, individual purified colonies were streaked onto plates containing M9 plus 50 μg/ml 5-MT and 2% agar, and then grown at 37° C. for 3 days. Resistance was confirmed for most of the clones. To determine if resistant mutants would remain resistant at an even higher concentration of 5-MT, they were plated onto M9 plus 300 μg/ml 5-MT and 2% Agar. Most clones demonstrated resistance at this high concentration also. [0438]
The plasmids from all of the resistant clones were isolated and sequenced on both strands. Some of the mutations from this experiment are diagrammed in Table J. [0439]

TABLE J

A. tumefaciens trpEG Sequence Variations

in 5-MT Resistant Clones.

Database Original K_m ^cho IC₅₀ ^trp

Clone # Clone # Determined Sequence Variations (μM) (μM)

Wt 8.0 5.0

Ec-12 1 G4A Val2Ile

Ec-18 8 C35T Thr12Ile 15 2.5

Ec-19 9 C2068T Pro690Ser 5.0 3.4

Ec-20 11 G1066A Glu356Lys &

C1779T Ile593Ile
As indicated by the data in Table J, several mutants had little effect on the K[0440] _m ^choand IC₅₀trp of the mutant enzyme, indicating that these mutations are likely not the source of resistance to tryptophan feedback inhibition. For example, the mutation of C to T at nucleotide 35, which changes a threonine residue to isoleucine at amino acid position 12 (Thr12Ile), gives rise to a minor change in K_m ^choand IC₅₀ ^tpvalues. Similarly, a change of C to T at nucleotide position 2068, which changes a proline to a serine also gives rise to a minor change in K_m ^choand IC₅₀ ^trpvalues. These mutations may therefore, may be “silent” mutations that give rise to variant gene products having enzymatic properties like those of wild type.

EXAMPLE 6

High Tryptophan Transgenic Soybean Plants

This example sets forth preparation of transgenic soybean plants having elevated tryptophan levels resulting from transformation with tryptophan feedback insensitive mutants of anthranilate synthase from [0441] Agrobacterium tumefaciens.
Vector Construction [0442]
Plasmid pMON34711, which harbors the anthranilate synthase clone from [0443] Agrobacterium tumefaciens containing the F298W mutation described in Example 4, was digested with restriction enzyme NotI. The ends of the resulting fragment were blunted and then digested with NcoI. The plasmid pMON13773 (FIG. 8) was then digested with restriction enzyme EcoRI, the ends blunted and then digested with NcoI. The resulting fragments were ligated resulting in plasmid pMON58044, which contained the AS gene under the control of the 7S promoter and NOS 3′ UTR (FIG. 9).
Plasmid pMON58044 was then cut with restriction enzymes BglII and NcoI and ligated with a fragment that was generated by digesting pMON53084 (FIG. 10) with BglII and NcoI. The resulting fragment was named pMON58045 (FIG. 11) and contained the sequence for the Arabidopsis SSU1A transit peptide. [0444]
Finally, plasmid pMON58046 (FIG. 12) was constructed by ligating the fragments generated by digesting pMON58045 (FIG. 11) and pMON38207 (FIG. 13) with restriction enzyme NotI. This resulted in the pMON58046 vector (FIG. 12) that was used for soybean transformation. [0445]
Soybean Transformation By Microprojectile Bombardment [0446]
For the particle bombardment transformation method, commercially available soybean seeds (i.e., Asgrow A3244, A4922) were germinated overnight for approximately 18-24 hours and the meristem explants were excised. The primary leaves were removed to expose the meristems and the explants were placed in targeting media with the meristems positioned perpendicular to the direction of the particle delivery. [0447]
The pMON58046 transformation vector described above was precipitated onto microscopic gold particles with CaCl[0448] ₂and spermidine and subsequently resuspended in ethanol. The suspension was coated onto a Mylar sheet that was then placed onto the electric discharge device. The particles were accelerated into the plant tissue by electric discharge at approximately 60% capacitance.
Following bombardment, the explants were placed in selection media (WPM+0.075 mM glyphosate) (WPM=Woody Plant Medium (McCown & Lloyd, [0449] Proc. International Plant Propagation Soc., 30:421, (1981) minus BAP)) for 5-7 weeks to allow for selection and growth of transgenic shoots. Phenotype positive shoots were harvested approximately 5-7 weeks post-bombardment and placed into selective rooting media (BPM+0.025 mM glyphosate) (see, below for BRM recipe) for 2-3 weeks. Shoots producing roots were transferred to the greenhouse and potted in soil. Shoots that remained healthy on selection, but did not produce roots were transferred to non-selective rooting media (BRM without glyphosate) for an additional 2 weeks. The roots from any shoots that produced roots off the selection were tested for expression of the plant selectable marker before transferring to the greenhouse and potting in soil. Plants were maintained under standard greenhouse conditions until R1 seed harvest.

The recipe used for Bean Rooting Medium (BRM) is provided below.



	Compound	Quantity for 4L

	MS Salts***	8.6 g
	Myo-inositol(cell culture grade)	0.40 g
	SBRM Vitamin Stock**	8.0 ml
	L-Cysteine (10 mg/ml)	40.0 ml
	Sucrose (ultra pure)	120 g
	Adjust pH to 5.8
	Washed Agar	32 g
	Additions after autoclaving:
	SBRM/TSG Hormone Stock*	20.0 ml

One ingredient at a time was added and dissolved, the volume was brought to one liter with sterile distilled water, and the solution was stored in a foil-covered bottle in the refrigerator for no longer than one month. [0451]
Soybean Transformation Using [0452] Agrobacterium tumefaciens
For the Agrobacterium transformation method, commercially available soybean seeds (Asgrow A3244, A4922) were germinated overnight (approximately 10-12 hours) and the meristem explants were excised. The primary leaves may or may not have been removed to expose the meristems and the explants were placed in a wounding vessel. [0453]
Agrobacterium strain ABI containing the plasmid of interest was grown to log phase. Cells were harvested by centrifugation and resuspended in inoculation media containing inducers. Soybean explants and the induced Agrobacterium culture were mixed no later than 14 hours from the time of initiation of seed germination and wounded using sonication. [0454]
Following wounding, explants were incubated in Agrobacterium for a period of approximately one hour. Following this inoculation step, the Agrobacterium was removed by pipetting and the explants were placed in co-culture for 2-4 days. At this point, they were transferred to selection media (WPM+0.075 mM glyphosate+antibiotics to control Agrobacterium overgrowth) for 5-7 weeks to allow selection and growth of transgenic shoots. [0455]
Phenotype positive shoots were harvested approximately 5-7 weeks post-bombardment and placed into selective rooting media (BRM+0.025 mM glyphosate) for 2-3 weeks. Shoots producing roots were transferred to the greenhouse and potted in soil. Shoots that remained healthy on selection, but did not produce roots were transferred to non-selective rooting media (BRM without glyphosate) for an additional 2 weeks. The roots from any shoots that produced roots off the selection were tested for expression of the plant selectable marker glyphosate resistance before transferring to the greenhouse and potting in soil. Plants were maintained under standard greenhouse conditions until R1 seed harvest. [0456]
Analysis of Amino Content of R1 Seed [0457]
Mature R1 seed is produced and analyzed for free amino acid content using fluorescence detection as described in Agilent Technologies Technical Bulletin REV14. Five seeds are chosen for single seed analysis from each event. Soy seeds expressing AgroAS F298W, AgroAS S51F, Agro V48F, AgroAS V48Y or AgroAS S5 IC mutant proteins generate very high amounts of tryptophan. The highest levels of tryptophan have a negative impact on germination. Results are shown in Tables K, L and M. [0458]

TABLE K

Protein expression in Seeds Transformed with pMON58046

Pedigree Trp average (ppm) Protein present?

Control 96 no

22817 9922 yes

22891 12955 yes

23026 7968 yes
[0459]

TABLE L

AS Protein expression Correlated with

pMON58123 Transformation

Pedigree Trp average (ppm) Protein present?

Control 96 No

23562 88 No

23590 8795 Yes

23911 388 No

TABLE M


Average and max trp levels in soybeans carrying one
of the following Agro AS alleles: V48F (pMON66877),
V48Y (pMON66878) and S51C (pMON66879).

PMON		Event	Average of trp	Max of trp
number	Description	number	(ppm)	(ppm)

66877	7Salpha-V48F AgroAS	26640	12,283	28,342
66877	7Salpha-V48F AgroAS	26641	5,588	14,579
66877	7Salpha-V48F AgroAS	26642	11,833	18,712
66878	7Salpha-V48Y AgroAS	26872	6,015	11,902
66878	7Salpha-V48Y AgroAS	26875	12,361	17,181
66878	7Salpha-V48Y AgroAS	27010	13,962	19,323
66879	7Salpha-S51C AgroAS	27105	12,614	31,827
66879	7Salpha-S51C AgroAS	27300	16,711	34,263
66879	7Salpha-S51C AgroAS	27568	10,135	20,237

AS Enzyme Activity in R1 Seed Transformed with Agro AS [0461]
Mature R1 seed is produced and analyzed for anthranilate synthase activity. Anthranilate synthase enzymatic activity was determined in R1 soy seeds carrying the AgroAS F298W (SEQ ID NOs: 65 or 91) or the Agro AS S51F (SEQ ID NOs: 60 or 86) mutant alleles. Very high levels of tryptophan-resistant anthranilate synthase activity was observed, consistent with the high amounts of tryptophan generated by these seeds. Results are shown in Tables N and O. [0462]

TABLE N

Specific activity of AS in R1 Seeds

Transformed with pMON58046

Specific activity

Seed Specific activity (pmoles/mg/min)

Event number (pmoles/mg/min) (+25 micromolar Trp)

Control 77.6

23076 23076-1 100.5 1.04

23076-2 4512.8

23076-3 9737.4 9290.4

23076-4 136.12

23076-5 8992.5 9749.9
[0463]

TABLE O

Specific activity of AS in R1 Seeds

Transformed with pMON58123

Specific activity

Seed Specific activity (pmoles/mg/min)

Event number (pmoles/mg/min) (+25 micromolar Trp)

Control 83.7 32.7

23590 23590-1 891 692.3

23590-2 466.2 186.5

23590-3 71.7 38.3

23590-4 320.5 316.2

EXAMPLE 7

Preparation of Transformation Vector Comprising Ruta graveolens Anthranilate Synthase α-Subunit

The anthranilate synthase α gene from [0464] Ruta graveolens (Genbank Accession No. GI 960291) provides another anthranilate synthase domain useful in the present invention (Bohlmann, J et al., Plant Phys., 111:507-514 (1996)). One isoenzyme of anthranilate synthase present in the genome of Ruta graveolens demonstrates less susceptibility to feedback inhibition by L-tryptophan. This allele may also be useful in the present invention to elevate the levels of free L-tryptophan in transgenic plants. The vector pMON58030 (FIG. 14) contains the Ruta graveolens anthranilate synthase α-subunit that is less sensitive to tryptophan inhibition. The Ruta graveolens anthranilate synthase α gene was PCR amplified from pMON58030 to provide a BamHI site at the 5′ end and a BglII site at the 3′ end of the Ruta graveolens anthranilate synthase α gene fragment by utilizing PCR primers that contained these two restriction enzyme sites:

5′-CAAAAGCTGGATCCCCACC-3′; and (SEQ ID NO: 53)

5′-CCTATCCGAGATCTCTCAACTCC-3′. (SEQ ID NO: 54)
The PCR fragment was purified, digested with the respective restriction enzymes, to form pMON58041, which contains the transcriptional fusion of the [0465] Ruta graveolens ASα to the napin promoter. The Agrobacterium mediated plant transformation plasmid, pMON58043, was created comprising the napin promoter, Ruta graveolens AS, NOS terminator, glyphosate resistance (CP4) selectable marker and borders suitable for proper chromosomal integration of the cassette as described. The resulting plant transformation vector was used to transform plants using standard plant transformation techniques as described in Examples 2, 3, and 6.

EXAMPLE 8

Transforming Multi-Polypeptide Anthranilate Synthases into Monomeric Single Polypeptide Anthranilate Synthases

Generation of a monomeric anthranilate synthase by fusion of selected multi-subunit enzymes is desirable, for example, to maximize the catalytic efficiency, to stabilize the enzyme, to achieve coordinated expression, for example, of subunits comprising activities of TrpE and TrpG and for effective communication between the two subunits. In some instances, it may be useful to employ TrpE or α-subunits from either plant or microbial source that are deregulated with respect to feedback inhibition by standard mutagenesis techniques or by rational design as described in the foregoing Examples, e.g. in Example 4. In other instances, wild type TrpE or α-subunits from either plant or microbial source are employed. [0466]
The C-terminus of the selected TrpE or α-subunit is linked to the N-terminus of the TrpG subunit or β-subunit, preferably with a peptide linker. A linker can be rationally designed to provide suitable spacing and flexibility for both subunits to properly align. Alternatively a linker can be identified by sequence alignment of monomeric and heterotetrameric anthranilate synthases. Examples of sequence alignments of monomeric and heterotetrameric anthranilate synthase forms are shown in FIGS. 21 and 35. It is also envisioned that it may be necessary to generate monomeric anthranilate synthases comprising heterologous subunit in order to maximize the benefits. For example, an α-subunit may be obtained from a bacterial source, for example, [0467] E. coli and fused to a β-subunit from a plant source, for example, Arabidopsis.
The novel protein produced can be introduced into plants, for example, as described in Examples 2, 3, or 6. The present invention is not limited to the exact details shown and described, for it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the present invention defined by the claims. [0468]

EXAMPLE 9

Identification of Anthranilate Synthases from Genomic Sequence Databases

Monomeric anthranilate synthases as well as α and β domains useful in the invention can be identified by bioinformatics analysis by searching for example, genbank and/or swissprot databases using BLAST (www.ncbi.nlm.nih.gov/blast/). Useful query sequences to identify monomeric anthranilate synthase include, for example, domains of anthranilate synthase such as the α-domain (GI 1004323) or β-domain (GI 1004324) from [0469] Sulfolobus solfataricus, or monomeric anthranilate synthase such as Agrobacterium tumefaciens AS (GI 15889565). Putative monomeric anthranilate synthase will have between 50% and 100% homology with the query sequence and should minimally contain 700 amino acids. If the AS-α-domain is used to query the genomic database, in addition to identifying putative anthranilate synthase genes it is also likely to identify genes involved in PABA synthesis for example 4-amino-4-deoxychorismate (ADC) synthase. The monomeric ADC synthase genes can be easily identified away from putative monomeric AS genes based on the observation that the amidotransferase domain (β-domain) of ADC synthase resides at the N-terminus of the protein whereas the amidotransferase domain (β-domain) of AS resides at the C-terminus. Monomeric anthranilate synthases useful in the present invention identified by bioinformatics analysis include, but are not limited to, for example, Rhizobium meliloti (GI 95177), Mesorhizobium loti (GI 13472468), Brucella melitensis (GI 17982357), Nostoc sp. PCC7120 (GI 17227910, GI 17230725), Azospirillum brasilense (GI 1174156), Rhodopseudomonas palustris, Anabaena M22983 (GI 152445). FIG. 21 is an example of a sequence alignment of 2 monomeric anthranilate synthases (Agrobacterium tumefaciens and Rhizobium meliloti) with 2 heterotetrameric anthranilate synthases (Sulfolobus solfataricus and Arabidopsis thaliana) useful in the present invention. FIG. 35 is an example of a sequence alignment of several monomeric anthranilate synthases with the Rhodopseudomonas palustris heterotetrameric anthranilate synthase.

EXAMPLE 10

Optimized Codon Usage

This example sets forth a method of improving the expression of an anthranilate synthase gene in the seed of a plant by optimization of the codon usage. [0470]
The nucleotide sequence of the anthranilate synthase (AS) gene from wild type [0471] Agrobacterium tumefaciens (SEQ ID NO: 1) was inspected for the presence of underexpressed codons. To identify underexpressed codons sequences of highly expressed seed proteins from corn and soybeans were examined for relative codon frequency. The relative codon usage frequencies are shown in Table P represented in an expected value format. Expected value format can be exemplified as follows: Assume there are four codons that encode a given amino acid, and assume that they are used equally well, then each codon would be expected to account for 25% (0.25) of the frequency for that amino acid. However, due to redundancy, 0.25 was normalized to 1.0 to give a relative score for each codon as compared to other codons that encode that amino acid. For this analysis, if a codon was more prevalent that the other choices for a given amino acid, it received a number that was greater than 1.0. Correspondingly, if a codon was less prevalent, it received a number less than 1.0. For this study, a particular codon was considered underrepresented if it's relative codon usage frequency was lower than 0.5.
Using the results from Table P, a close examination of the wild type Agrobacterium AS sequence revealed that 125 codons were considered underrepresented (below the threshold of 0.5) in corn and soybeans (Table Q). These underrepresented codons were replaced by more prevalent codons as defined above. The modified nucleotide sequence is shown in FIG. 36. Using bioinformatics tools, the resulting sequence was assembled and analyzed for integrity by translation and alignment of the nucleotide and protein sequences with the corresponding wild type AS sequences. While, the protein sequence was unchanged the nucleotide sequence of the optimized sequence had 94% identity with the wild type Agrobacterium AS sequence (FIG. 37). The optimized nucleotide sequence was analyzed for the absence of cryptic polyadenylation signals (AATAAA, AATAAT) and cryptic introns using Lasergene EditSeq (DNASTAR, Inc., Madison, Wis.) and Grail2 (Oak Ridge National Laboratory, Oak Ridge, TN), respectively. No cryptic signals were found. [0472]

The modified nucleotide sequence is synthesized using techniques well known in the art or by commercial providers such as Egea Biosciencesces, Inc. (San Diego, Calif.). The resulting nucleotide is cloned into an appropriate expression vector and tested for efficacy in corn, soybeans and Arabidopsis using procedures detailed in earlier examples of this specification.

TABLE P


Relative codon usage frequencies
in maize and soybean seed-expressed genes¹.

		Maize	Soy			Maize
Codon	AA	Seed	Seed	Codon	AA	Seed	Soy Seed

TTT	F	0.4211	0.7348	ATC	I	1.7143	1.0563
TTC	F	1.5789	1.2652	ATA	I	0.3673	0.6654
TTA	L	0.4557	0.3875	ATG	M	1.0000	1.0000
TTG	L	0.9494	1.2060	ACT	T	0.6153	1.0008
TCT	S	0.9624	1.4851	ACC	T	1.2213	2.1020
TCC	S	1.3707	1.1249	ACA	T	0.8372	0.7146
TCA	S	0.9107	1.0044	ACG	T	1.3262	0.1826
TCG	S	0.7851	0.3266	AAT	N	0.2885	0.5409
TAT	Y	0.2455	0.6861	AAC	N	1.7115	1.4591
TAC	Y	1.7545	1.3139	AAA	K	0.5333	0.9030
TGT	C	0.2778	0.7572	AAG	K	1.4667	1.0970
TGC	C	1.7222	1.2428	AGT	S	0.2679	0.9714
TGG	W	1.0000	1.0000	AGC	S	1.7032	1.0876
CTT	L	0.7975	1.6298	AGA	R	0.3913	1.9459
CTC	L	1.0610	1.6301	AGG	R	2.9185	1.3087
CTA	L	0.8544	0.5905	GTT	V	0.5714	1.2381
CTG	L	1.8820	0.5562	GTC	V	1.0119	0.6864
CCT	P	0.6500	1.5822	GTA	V	0.3810	0.3472
CCC	P	0.8520	0.7694	GTG	V	2.0357	1.7284
CCA	P	1.2240	1.5838	GCT	A	0.9876	1.3583
CCG	P	1.2740	0.0645	GCC	A	1.1618	1.1283
CAT	H	0.8438	0.6066	GCA	A	0.8011	1.2898
CAC	H	1.1563	1.3934	GCG	A	1.0495	0.2235
CAA	Q	0.8639	1.2162	GAT	D	0.8500	0.9523
CAG	Q	1.1361	0.7838	GAC	D	1.1500	1.0477
CGT	R	0.2582	0.5903	GAA	E	0.6818	1.0463
CGC	R	1.0082	1.1159	GAG	E	1.3182	0.9537
CGA	R	0.1957	0.6700	GGT	G	1.1268	1.1431
CGG	R	1.2283	0.3692	GGC	G	1.8758	0.6577
ATT	I	0.9184	1.2783	GGA	G	0.3085	1.2759
ATC	I	1.7143	1.0563	GGG	G	0.6889	0.9233


#This means that if there are four codons that encode a given amino acid, and they are used equally well, each codon is expected to account for 25% (0.25). Due to the redundancy, 0.25 was normalized to 1 to give a relative score for each codon as compared to all codons that encode that amino acid. In real life if a codon is more prevalent than the other choices for a given amino acid, it would get a number > 1.
#And if it is less preferred than the other codons for the amino acid, it would get a number < 1.

TABLE Q


Underrepresented Agro AS codons and modifications for improved seed expression²

Under-

rep

Codon

Amino

Modified

in

Codon

Amino

Modified

in

Codon

Amino

Modified

in

Codon

(wt)

Acid

Codon

Crop²

Codon

(wt)

Acid

Codon

Crop

Codon

(wt)

Acid

Codon

Crop

2

GTA

V

GTG

corn,

177

TCG

S

TCC

soy

481

GCG

A

GCC

soy

3

ACG

T

ACC

soy

179

GCG

A

GCC

soy

485

AAT

N

AAC

corn,

soy

9

GGA

G

GGT

corn

180

CGT

R

CGC

corn

489

CCG

P

CCA

soy

10

GCG

A

GCC

soy

181

CCG

P

CCA

soy

504

ATA

I

ATC

corn

15

ACG

T

ACC

soy

185

CGT

R

CGC

corn

508

CGT

R

CGC

corn

16

AAA

K

AAG

corn

190

TTT

F

TTC

corn

520

CGT

R

CGC

corn

21

GTC

V

GTG

soy

201

TAT

Y

TAC

corn

543

ACG

T

ACC

soy

23

CGA

R

CGC

corn

209

CGT

R

CGC

corn

545

GCG

A

GCC

soy

26

CGG

R

CGC

soy

218

ACG

T

ACC

soy

546

AAT

N

AAC

corn,

soy

30

TAT

Y

TAC

corn

219

ACG

T

ACC

soy

547

TAT

Y

TAC

corn

36

AAT

N

AAC

corn,

238

CCG

P

CCA

soy

551

ACG

T

ACC

soy

46

GGC

G

GGT

soy

244

CGT

R

CGC

corn

553

GCG

A

GCC

soy

47

GCG

A

GCC

soy

248

TAT

Y

TAC

corn

554

ACG

T

ACC

soy

48

GTT

V

GTG

corn

276

CGT

R

CGC

corn

556

TCG

S

TCC

soy

49

TTT

F

TTC

corn

280

AAT

N

AAC

corn,

559

AGA

R

AGG

corn

soy

50

TCG

S

TCC

soy

281

CCG

P

CCA

soy

561

CCG

P

CCA

soy

53

TAT

Y

TAC

corn

282

TCG

S

TCC

soy

572

CCG

P

CCA

soy

55

TAT

Y

TAC

corn

283

GCG

A

GCC

soy

578

TCG

S

TCC

soy

56

CCG

P

CCA

soy

290

GCG

A

GCC

soy

580

GGA

G

GGT

corn

58

CGT

R

CGC

corn

293

CCG

P

CCA

soy

584

CCG

P

CCA

Soy

64

ACG

T

ACC

soy

294

TCG

S

TCC

soy

585

ACG

T

ACC

Soy

69

CCG

P

CCA

soy

296

TAT

Y

TAC

corn

592

ACG

T

ACC

Soy

70

CCG

P

CCA

soy

301

AAT

N

AAC

corn,

602

CCG

P

CCA

Soy

soy

75

TGT

C

TGC

corn

307

TAT

Y

TAC

corn

617

TAT

Y

TAC

Corn

76

TTT

F

TTC

corn

312

TCG

S

TCC

soy

633

TCG

S

TCC

Soy

85

TAT

Y

TAC

corn

313

CCG

P

CCA

soy

652

ACG

T

ACC

Soy

86

AAT

N

AAC

corn,

322

CGT

R

CGC

corn

655

CGT

R

CGC Corn

soy

97

ACG

T

ACC

soy

328

CCG

P

CCA

soy

658

TCG

S

TCC

Soy

102

GCG

A

GCC

soy

329

ATA

I

ATC

corn

667

CCG

P

CCA

Soy

112

TCG

S

TCC

soy

339

CCG

P

CCA

soy

668

CGT

R

CGC

Corn

115

CGG

R

CGC

soy

352

TCG

S

TCC

soy

680

ACG

T

ACC

Soy

123

CCG

P

CCA

soy

363

TCG

S

TCC

soy

690

CCG

P

CCA

Soy

125

CGT

R

CGC

corn

376

CCG

P

CCA

soy

698

CCG

P

CCA

Soy

133

TCG

S

TCC

soy

378

TCG

S

TCC

soy

700

TCG

S

TCC

Soy

136

CCG

P

CCA

soy

390

TAT

Y

TAC

corn

703

ACG

T

ACC

Soy

137

ACG

T

ACC

soy

411

TTT

F

TTC

corn

705

GGA

C

GGT

Corn

143

AGA

R

AGG

corn

442

CCG

P

CCA

soy

708

GCG

A

GCC

Soy

150

TAT

Y

TAC

corn

446

TAT

Y

TAC

corn

711

CGG

R

CGC

Soy

151

TCG

S

TCC

soy

449

GCG

A

GCC

soy

715

AAT

N

AAC

corn,

soy

153

GCG

A

GCC

soy

460

AAT

N

AAC

corn,

724

GCG

A

GCC

Soy

soy

155

TCG

S

TCC

soy

464

ACG

T

ACC

soy

729

GCG

A

GCC

Soy

173

GCG

A

GCC

soy

469

CGG

R

CGC

soy

EXAMPLE 11

Preparation of a Transformation Vector Comprising Monomeric Rhizobium meliloti Anthranilate Synthase

Gene Cloning of [0475] Rhizobium meliloti
A stab culture of [0476] Rhizobium meliloti 1021 obtained from ATCC was used to streak a YM media (10 g mannitol, 0.5 g K₂HPO₄, 0.2 g MgSO₄.7H₂O, 1.0 g yeast extract, 0.2 g NaCl, 88 mg FeCl₃-6H₂O, 15 g agar per 1 L) plate. This plate was grown for two days at 30° C. A single colony was used to inoculate 1 liter of YM media. This culture was grown overnight at 30° C. The cell pellet was spun down at 5,000×g for 10 minute and frozen at −20° C. The Qiagen Genomic-tip DNA kit (Qiagen Inc., Valencia, Calif.) was used to extract genomic DNA according to the August 1999 Qiagen Genomic DNA Handbook (p. 42).
A PCR reaction was used to amplify the gene. The primers used were Rhizo F2: ATGGCAGCGGTAATTCTGGAAG (SEQ ID NO: 138) and Rhizo R8: TCAGGCTGCCTTGGTCTTC (SEQ ID NO: 139). The resulting PCR fragment was cloned into the pGEM (Promega Corp., Madison, Wis.) vector. [0477]
Finally, the PCR product in pGEM was amplified using PCR with the following primers: Rhizo NcoI ACTGACTCCATGGCAGCGGTAATTCTGGAA (SEQ ID NO: 140) and RhizoSpeI: CTGACTAGTTCAGGCTGCTT (SEQ ID NO: 141) and the product was cloned into TOPO 2.1 PCR vector (Invitrogen Corp., Grand Island, N.Y.). [0478]
Vector Construction [0479]
The vector containing the Rhizobium gene in the TOPO 2.1 vector was digested with SpeI and a klenow reaction was performed to blunt the site. The DNA was PCR purified (Qiagen PCR purification kit and MinElute Handbook, 2001) and then digested with NcoI. This fragment was cloned into pET30a at the EcoRV and NcoI site creating pMON66595 (FIG. 41). [0480]
The Arabidopsis transformation vector was created in several steps by first digesting pMON13773 (FIG. 8) with NcoI/EcoRI to generate a backbone piece. pMON66595 was digested with NcoI and EcoRI and the larger portion of the Rhizobium AS gene (approximately 2000 base pairs) was removed. The two pieces were then ligated together. A positive clone was digested with EcoRI and treated with calf intestinal phosphatase (CIP). The second fragment of the Rhizobium gene was removed by digesting pMON66595 with EcoRI and keeping the approximately 200 base pair piece. The two fragments were ligated together and the resultant clones were sequenced to check for correct orientation of the small Rhizobium fragment. [0481]
One of the above clones, having correct sequence and orientation, was digested with BglII and NcoI. Then pMON58046 (FIG. 12) was digested with BglII and NcoI and the CTP2 transit peptide fragment removed. These fragments were ligated together to complete the cassette. [0482]
The ligated fragments were digested with NotI to remove the cassette. They were then ligated into pMON36524 (FIG. 48) at the CIP treated NotI site. These clones were digested to find a cassette inserted in the same orientation as the NPTII gene creating pMON66599 (FIG. 42). [0483]
The vector pMON66599 was then transformed into Agrobacterium and used to transform Arabidopsis. The control construct in this experiment was pMON66598 (FIG. 43), which is the same cassette insert as described for pMON66599, except containing the Agrobacterium AS wild type gene. [0484]
Complementation Assay [0485]
The Rhizobium AS gene from pMON66595 was excised with BamHI and NcoI and cloned into the corresponding sites of the pSE280 vector (Invitrogen), creating pMON66596 (FIG. 44). pMON66596 was then transformed into a mutant [0486] E. coli strain, EMG2 ΔtrpE (created from the EMG strain WT K12, F+, which was obtained from ATCC) showing that the homomeric gene complements the genome of the trp-strain.
Activity Assay [0487]
pMON66596 was transformed into BL-21 cells and induced with IPTG to express protein. The crude cell extract was assayed by HPLC and found to have activity and an IC[0488] ₅₀around 10 μM trp (Poulson, Journal of Chromatography, 547:155-160 (1991)).
Protein Expression and Purification [0489]
His-tagged protein was expressed by inducing pMON66595 with IPTG. Protein purification was completed using native conditions outlined in the QIAexpressionist 2002 Handbook and nickel resin (Ni-NTA Spin Handbook, 2000). Rabbit sera show recognition of purified protein. [0490]
Plants are transformed with the vector containing the Rhizobium anthranilate synthase gene, as in Examples 2, 3, and 6, and show elevated levels of tryptophan in the seed. [0491]

EXAMPLE 12

Corn Transformation with a Vector Containing Maize Anthranilate Synthase α-Subunit Gene and a Maize Anthranilate Synthase β-Subunit Gene

To create a shuttle vector containing the coding sequence for maize anthranilate synthase α-subunit, pMON65150, was digested with both EcoRI and SacII. The resulting 6195 base pair fragment was gel purified and then dephosphorylated. The plasmid pMON66604 was digested with both EcoRI and SacII, to generate a 1077 base pair fragment that was gel purified. The 1077 base pair fragment was then ligated in the sticky-ended 6195 base pair fragment containing the maize ASα coding sequence to generate pMON67149, a maize L3 (oleosin) promoter-maize hsp70 intron-maizeAScc-[0492] Tr7 3′ UTR expression vector. This vector, was subsequently digested with XhoI, resulting in a 4364 base pair DNA fragment containing the maize oleosin promoter, maize heat shock protein 70 intron, maize anthranilate α-subunit coding sequence, and the Tr7 3′ UTR.
The plasmid pMON30167 was digested with XhoI resulting in an 8.89 Kb DNA fragment. This fragment was then ligated to the 4964 base pair fragment to create pMON79951 (FIG. 45), a transformation vector containing L3 promotor-zmhsp70 intron-maizeASα-[0493] Tr7 3′ UTR.
The coding sequence for a maize anthranilate synthase β-subunit was isolated by PCR from a Monsanto proprietary cDNA library, using the following primers: [0494]
5′ [0495] primer 5′′TGCTGACCATGGCCTGCTCCCACATCGTCG3′ (SEQ ID NO: 142), which contains the NcoI restriction site (shown in bold), and
3′ [0496] primer 5′CAGTGAATTCCTACGAACGCTGCTTCTCCAGTTC3′ (SEQ ID NO: 143), which contains the EcoRI restriction site (shown in bold).
The PCR parameters used were 2°/second to 95°; 95° for 5 minutes; 2°/second to 95°; 95° for 30 seconds; 2°/second to 55°; 55° for 45 sec; 2°/second to 72°; 72° for 55 seconds; [0497] cycle 25 times starting at the third step; 2°/second to 72°; 72° for 10 minutes; 2°/second to 4° forever (all temperatures shown are in ° C., unless otherwise noted). The PCR mix contained: 1 μl of miniprep (Qiagen method) DNA from pMON79952, 1.5 μl of each primer (10 μM stock) 5 μl of Roche 10×PCR buffer with magnesium chloride, 2 μl 10 mM dNTP mix, 1 μL Hi-Fi Taq mix (Roche Expand High Fidelity PCR System #1732650) and water to a total volume of 50 μl. The resulting PCR product was ligated into the pGEM-T vector (Promega pGEM—T Vector System I #A3600). Sequencing the above-described fragment revealed that it was missing restriction sites. The PCR was performed again using the pGEM clone as a template and the product cloned into the TOPO2.1 PCR Vector (Invitrogen TOPO TA Cloning Kit pCR 2.1-TOPO vector #45-0641). This clone was confirmed by sequencing. The resulting vector, containing maize ASβ, was named pMON66592. This vector was then digested with both NcoI and EcoRI, to generate an 850 base pair (bp) fragment. After isolation, the ends of the 850 bp fragment were made blunt and dephosphorylated. The plasmid pMON79953 was digested with BamHI and SmaI, to generate a 5353 bp fragment. After isolation, the ends of the 5353 bp fragment were made blunt. The 850 bp fragment containing the ASβ gene was then ligated into the blunt-ended 5353 bp pMON79953 fragment to generate pMON79954, a maize L3 promotor-zmhsp70 intron-maizeASβ-Tr7 3′ UTR vector.
The vector pMON79954, was subsequently digested with XhoI to generate a 2907 base pair DNA fragment containing the maize oleosin promoter, maize hsp70 intron, maize ASβ coding sequence, and the [0498] Tr7 3′ UTR. The plasmid pMON30167 (FIG. 49) was digested with XhoI to generate an 8.89 Kb fragment. The two fragments were ligated together to generate pMON79955 (FIG. 46), a transformation vector containing L3 promotor-zmhsp70 intron-maizeASβ-Tr7 3′ UTR.
To create the maize ASα and ASβ stacking vector, pMON79955 was digested with HindIII, to generate a 16.57 Kb fragment. The fragment was made blunt and dephosphorylated. The plasmid pMON67149 was digested with XhoI, to generate a 4364 base pair DNA fragment, which was subsequently blunt ended. The two fragments were ligated together to create pMON79956 (FIG. 47), a final transformation vector containing maize L3 promotor-zmhsp70 intron-maizeASα-[0499] Tr7 3′ UTR stacked with maize L3 promotor-zmhsp70 intron-maizeASβ-Tr7 3′ UTR.
Maize Transformation Using [0500] Agrobacterium tumefaciens
Maize plants (inbred line LH198/Hi11) are grown in a greenhouse under standard practices. The ears of the plants are harvested when the embryos are 1.5 to 2.0 mm in length, usually 10-15 days after pollination. The ears are surface sterilized by spraying or soaking in 80% ethanol. [0501]
The immature embryos are isolated from individual kernels using methods known to those of skill in the art. Immature embryos are cultured on medium 211 (N6 salts, 2% sucrose, 1 mg/[0502] L 2,4-dichlorophenyoxyacetic acid (2,4-D), 0.5 mg/L niacin, 1.0 mg/L thiamine-HCl, 0.91 g/L L-asparagine, 100 mg/L: myo-inositol, 0.5 g/L MES, 100 mg/L casein hydrolysate, 1.6 g/L MgCl2, 0.69 g/L L-proline, 2 g/L GELGRO tm, pH 5.8) containing 16.9 mg/L AgNO3 (designated medium 2112V) for 3-6 days prior to transformation.
Methods of Agrobacterium mediated transformation of maize cells and other monocots are known (U.S. Pat. Nos. 5,591,616 and 5,981,840; and [0503] EP 0 672 752). The Agrobacterium strain ABI, and an Agrobacterium tumefaciens binary vector system are used for the transformations.
Prior to co-culture with the maize embryo cells, Agrobacterium cells are grown at 28° C. in LB (DIFCO) liquid medium containing approximately 50 μg/ml kanamycin and 100 μg/ml spectinomycin to select for maintenance of the modified Ti plasmid and binary vector. Prior to inoculation of maize cells the Agrobacterium cells are grown overnight at room temperature in AB medium (Chilton et al., [0504] Proc. Nat. Acad. Sci. (U.S.A.), 71:3672-3676 (1974)) comprising appropriate antibiotics for plasmid maintenance and 200 μM acetosyringone. Immediately prior to inoculation the Agrobacterium cells are pelleted by centrifugation, washed in ½ MSVI medium (2.2 g/L GIBCO MS (Murashige and Skoog, Physiol. Plant 15:473-497 (1962)) basal salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxin-HCl, 0.1 mg/L thiamine, 115 g/L L-proline, 10 g/L D-glucose, and 10 g/L sucrose, pH 5.4) containing 200 μM acetosyringone.
The immature maize embryos are excised, immersed in an Agrobacterium suspension in ½ MSPL medium and incubated at room temperature with Agrobacterium for approximately 5 minutes. [0505]
Following Agrobacterium infection and co-culture, the embryos are transferred to type II delay medium for 5 to 7 days and cultured at 27° C. in the dark. The delay medium consists of MS basal salts containing 2.0 mg/[0506] L 2,4-D (GIBCO), 100 mg/L-casamino acids, 12 mM proline, 500 mg/L carbenicillin and 20 μM silver thiosulfate. All media chemicals were tissue culture grade. Once signs of type II callus initiation from immature embryos are observed, as defined by Selman et al., in The Maize Handbook, Freeling and Walbot, eds., Springer Verlag, p. 672 (1994), the coleoptiles are removed from the embryos. The embryos are then transferred to MS medium containing 2.0 mg/L 2,4-D, 12 mM proline, 20 μM silver thiosulfate, 500 mg/L carbenicillin and 0.5 mM glyphosate (Monsanto Company, St. Louis, Mo.) and incubated at 27° C. in the dark for 2 weeks.
Embryos forming callus are transferred to the MS medium described above, but additionally containing 1.0 mM glyphosate. The cultures are then incubated for 2 weeks in the dark at 27° C. The embryos still having callus are then transferred to MS medium containing 3.0 mM glyphosate for an additional 2 weeks. [0507]
Plant regeneration is achieved by transferring the callus to MS medium containing 0.1 mg/[0508] L 2,4-D and 0.1 μM abscisic acid (ABA) for 2 weeks and then to MS medium containing 6% sucrose and no 2,4-D for another 2 weeks. Both incubations are done in the dark at 27° C. to permit somatic embryo maturation and conversion in the regeneration process.
Somatic embryos that are ready to germinate are transferred to hormone-free MS medium, and incubated in the light until shoots with attached roots are produced. After approximately 2 to 3 weeks, plantlets are produced. [0509]
Plantlets are then transferred to the greenhouse and grown under standard greenhouse conditions. [0510]
Analysis of Amino Acid Content of R1 Seed [0511]
Several transgenic corn lines were established for each vector and propagated through the number of generations. These lines are grown and self-pollinated to generate homozygous lines. At each generation, expression of the transgenes are determined using western blot analysis on immature seed and mature R1 seed is produced and analyzed for free amino acid content using fluorescence detection as described in Agilent Technologies Technical Bulletin REV14. Maize seeds expressing ASα protein generate elevated amounts of tryptophan relative to baseline levels (corresponding to negative isolines and nontransgenic controls). Baseline free tryptophan levels for corn range from about 5 to about 25 ppm. [0512]
All publications and patents are incorporated by reference herein, as though individually incorporated by reference. The invention is not limited to the exact details shown and described, for it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention defined by the claims. [0513]
1 143 1 2190 DNA Agrobacterium tumefaciens 1 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 2 1815 DNA Zea mays 2 atggaatccc tagccgccac ctccgtgttc gcgccctccc gcgtcgccgt cccggcggcg 60 cgggccctgg ttagggcggg gacggtggta ccaaccaggc ggacgagcag ccggagcgga 120 accagcgggg tgaaatgctc tgctgccgtg acgccgcagg cgagcccagt gattagcagg 180 agcgctgcgg cggcgaaggc ggcggaggag gacaagaggc ggttcttcga ggcggcggcg 240 cgggggagcg ggaaggggaa cctggtgccc atgtgggagt gcatcgtgtc ggaccatctc 300 acccccgtgc tcgcctaccg ctgcctcgtc cccgaggaca acgtcgacgc ccccagcttc 360 ctcttcgagt ccgtcgagca ggggccccag ggcaccacca acgtcggccg ctatagcatg 420 gtgggagccc acccagtgat ggagattgtg gccaaagacc acaaggttac gatcatggac 480 cacgagaaga gccaagtgac agagcaggta gtggacgacc cgatgcagat cccgaggacc 540 atgatggagg gatggcaccc acagcagatc gacgagctcc ctgaatcctt ctccggtgga 600 tgggttgggt tcttttccta tgatacggtt aggtatgttg agaagaagaa gctaccgttc 660 tccagtgctc ctcaggacga taggaacctt cctgatgtgc acttgggact ctatgatgat 720 gttctagtct tcgataatgt tgagaagaaa gtatatgtta tccattgggt caatgtggac 780 cggcatgcat ctgttgagga agcataccaa gatggcaggt cccgactaaa catgttgcta 840 tctaaagtgc acaattccaa tgtccccaca ctctctcctg gatttgtgaa gctgcacaca 900 cgcaagtttg gtacaccttt gaacaagtcg accatgacaa gtgatgagta taagaatgct 960 gttctgcagg ctaaggaaca tattatggct ggggatatct tccagattgt tttaagccag 1020 aggttcgaga gacgaacata tgccaaccca tttgaggttt atcgagcatt acggattgtg 1080 aatcctagcc catacatggc gtatgtacag gcaagaggct gtgtattggt tgcgtctagt 1140 cctgaaattc ttacacgagt cagtaagggg aagattatta atcgaccact tgctggaact 1200 gttcgaaggg gcaagacaga gaaggaagat caaatgcaag agcagcaact gttaagtgat 1260 gaaaaacagt gtgccgagca cataatgctt gtggacttgg gaaggaatga tgttggcaag 1320 gtatccaaac caggatcagt gaaggtggag aagttgatga acattgagag atactcccat 1380 gttatgcaca tcagctcaac ggttagtgga cagttggatg atcatctcca gagttgggat 1440 gccttgagag ctgccttgcc cgttggaaca gtcagtggtg caccaaaggt gaaggccatg 1500 gagttgattg ataagttgga agttacgagg cgaggaccat atagtggtgg tctaggagga 1560 atatcgtttg atggtgacat gcaaattgca ctttctctcc gcaccatcgt attctcaaca 1620 gcgccgagcc acaacacgat gtactcatac aaagacgcag ataggcgtcg ggagtgggtc 1680 gctcatcttc aggctggtgc aggcattgtt gccgacagta gcccagatga cgaacaacgt 1740 gaatgcgaga ataaggctgc tgcactagct cgggccatcg atcttgcaga gtcagctttt 1800 gtagacaaag aatag 1815 3 1993 DNA Ruta graveolens 3 aaaaaatctg tctgtttttc gtgtttggac atttcagcgg cactgggtgc catcagttga 60 ttcgactcat ttgatttatt ttgtttgttg gccatgagtg cagcggcaac gtcgatgcaa 120 tcccttaaat tctccaaccg tctggtccca cccagtcgcc gtctgtctcc ggttccgaac 180 aatgtcacct gcaataacct ccccaagtct gcagctcccg tccggacagt caaatgctgc 240 gcttcttcct ggaacagtac catcaacggc gcggccgcca cgaccaacgg tgcgtccgcc 300 gccagtaacg gcgcatccac gaccaccact acatatgtta gtgatgcaac cagatttatc 360 gactcttcta aaagggcaaa tctagtgcca ttataccgtt gcatattcgc ggatcatctc 420 acgccggtgc ttgcctatag atgtttggtt caagaagacg ataaagagac tccaagtttt 480 ttattcgaat cagtagagcc gggtcggatt tctactgttg ggaggtatag tgtggttgga 540 gctcatcccg tgatggaagt tatagctaaa gataatatgg ttacggtgat ggatcatgag 600 aaagggagct tagttgagga ggtggtcgat gatcccatgg agattcctag aagaatttcc 660 gaggattgga agcctcaaat aatcgatgat cttcctgaag ctttttgcgg tggttgggtt 720 ggtttcttct catacgatac agttcgatat gtggagaaga aaaagttacc attctcaaag 780 gcacctcagg atgataggaa tcttgcagat atgcatctag gtctctataa cgatgttatt 840 gtgtttgatc atgtggaaaa gaaagtatat gttattcatt gggtgaggct aaatcaacag 900 tcttctgaag aaaaagcata tgccgagggt ctggaacact tggagagact agtatccaga 960 gtacaggatg agaacacgcc aaggctcgcc ccaggttcca tagacttaca cactggtcat 1020 tttggacctc cattaaaaaa gtcaaacatg acatgtgaag aatacaaaat ggctgtacta 1080 gcggcaaaag aacatattca ggctggggat atttttcaaa tcgtactaag ccaacgtttt 1140 gaacgtcgaa catttgctga tccatttgaa gtttataggg cactgagagt tgttaatccg 1200 agtccctata tgacgtatat gcaggcaaga gggtgtgttc tggtagcttc aagtccagaa 1260 attcttactc gagtaaagaa gaataagatt gtgaatcgac ctttggctgg aacagcccga 1320 agagggagga ctactgaaga agatgagatg ttggaaacac agttgctaaa agacgcaaag 1380 caatgtgctg agcatgttat gctggtcgat ttgggacgga atgatgttgg caaggtttca 1440 aaatctggtt ctgtgaaagt ggaaaagctg atgaatgttg aacgatattc acatgttatg 1500 cacataagct ctacggtcac aggtgagttg caagataatc tcagttgctg ggatgccctg 1560 cgtgctgcac tgcctgtcgg gactgttagt ggagcaccaa aggtgaaggc aatggagtta 1620 atcgatgaat tggaggtaaa tagacgtggc ccctacagtg gtgggtttgg cggtatctcc 1680 ttcaccggag atatggacat tgccctggct ctaaggacca ttgttttcca aaccggtaca 1740 cgctatgaca caatgtactc gtacaagaat gctaccaaac gccggcagtg ggtggcatac 1800 cttcaagccg gggctggcat tgttgctgat agtgatccag acgacgagca tcgtgagtgc 1860 cagaacaaag ccgccggact ggcccgtgcc atcgacctag ctgagtctgc ttttgtgaac 1920 aaatcaagta gctaaagttt tggatttgga agtggagttg agtctcggat aggatttaga 1980 gtaaaaaaag agg 1993 4 729 PRT Agrobacterium tumefaciens 4 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 5 604 PRT Zea mays 5 Met Glu Ser Leu Ala Ala Thr Ser Val Phe Ala Pro Ser Arg Val Ala 1 5 10 15 Val Pro Ala Ala Arg Ala Leu Val Arg Ala Gly Thr Val Val Pro Thr 20 25 30 Arg Arg Thr Ser Ser Arg Ser Gly Thr Ser Gly Val Lys Cys Ser Ala 35 40 45 Ala Val Thr Pro Gln Ala Ser Pro Val Ile Ser Arg Ser Ala Ala Ala 50 55 60 Ala Lys Ala Ala Glu Glu Asp Lys Arg Arg Phe Phe Glu Ala Ala Ala 65 70 75 80 Arg Gly Ser Gly Lys Gly Asn Leu Val Pro Met Trp Glu Cys Ile Val 85 90 95 Ser Asp His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val Pro Glu 100 105 110 Asp Asn Val Asp Ala Pro Ser Phe Leu Phe Glu Ser Val Glu Gln Gly 115 120 125 Pro Gln Gly Thr Thr Asn Val Gly Arg Tyr Ser Met Val Gly Ala His 130 135 140 Pro Val Met Glu Ile Val Ala Lys Asp His Lys Val Thr Ile Met Asp 145 150 155 160 His Glu Lys Ser Gln Val Thr Glu Gln Val Val Asp Asp Pro Met Gln 165 170 175 Ile Pro Arg Thr Met Met Glu Gly Trp His Pro Gln Gln Ile Asp Glu 180 185 190 Leu Pro Glu Ser Phe Ser Gly Gly Trp Val Gly Phe Phe Ser Tyr Asp 195 200 205 Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro Phe Ser Ser Ala Pro 210 215 220 Gln Asp Asp Arg Asn Leu Pro Asp Val His Leu Gly Leu Tyr Asp Asp 225 230 235 240 Val Leu Val Phe Asp Asn Val Glu Lys Lys Val Tyr Val Ile His Trp 245 250 255 Val Asn Val Asp Arg His Ala Ser Val Glu Glu Ala Tyr Gln Asp Gly 260 265 270 Arg Ser Arg Leu Asn Met Leu Leu Ser Lys Val His Asn Ser Asn Val 275 280 285 Pro Thr Leu Ser Pro Gly Phe Val Lys Leu His Thr Arg Lys Phe Gly 290 295 300 Thr Pro Leu Asn Lys Ser Thr Met Thr Ser Asp Glu Tyr Lys Asn Ala 305 310 315 320 Val Leu Gln Ala Lys Glu His Ile Met Ala Gly Asp Ile Phe Gln Ile 325 330 335 Val Leu Ser Gln Arg Phe Glu Arg Arg Thr Tyr Ala Asn Pro Phe Glu 340 345 350 Val Tyr Arg Ala Leu Arg Ile Val Asn Pro Ser Pro Tyr Met Ala Tyr 355 360 365 Val Gln Ala Arg Gly Cys Val Leu Val Ala Ser Ser Pro Glu Ile Leu 370 375 380 Thr Arg Val Ser Lys Gly Lys Ile Ile Asn Arg Pro Leu Ala Gly Thr 385 390 395 400 Val Arg Arg Gly Lys Thr Glu Lys Glu Asp Gln Met Gln Glu Gln Gln 405 410 415 Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu His Ile Met Leu Val Asp 420 425 430 Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys Pro Gly Ser Val Lys 435 440 445 Val Glu Lys Leu Met Asn Ile Glu Arg Tyr Ser His Val Met His Ile 450 455 460 Ser Ser Thr Val Ser Gly Gln Leu Asp Asp His Leu Gln Ser Trp Asp 465 470 475 480 Ala Leu Arg Ala Ala Leu Pro Val Gly Thr Val Ser Gly Ala Pro Lys 485 490 495 Val Lys Ala Met Glu Leu Ile Asp Lys Leu Glu Val Thr Arg Arg Gly 500 505 510 Pro Tyr Ser Gly Gly Leu Gly Gly Ile Ser Phe Asp Gly Asp Met Gln 515 520 525 Ile Ala Leu Ser Leu Arg Thr Ile Val Phe Ser Thr Ala Pro Ser His 530 535 540 Asn Thr Met Tyr Ser Tyr Lys Asp Ala Asp Arg Arg Arg Glu Trp Val 545 550 555 560 Ala His Leu Gln Ala Gly Ala Gly Ile Val Ala Asp Ser Ser Pro Asp 565 570 575 Asp Glu Gln Arg Glu Cys Glu Asn Lys Ala Ala Ala Leu Ala Arg Ala 580 585 590 Ile Asp Leu Ala Glu Ser Ala Phe Val Asp Lys Glu 595 600 6 613 PRT Ruta graveolens 6 Met Ser Ala Ala Ala Thr Ser Met Gln Ser Leu Lys Phe Ser Asn Arg 1 5 10 15 Leu Val Pro Pro Ser Arg Arg Leu Ser Pro Val Pro Asn Asn Val Thr 20 25 30 Cys Asn Asn Leu Pro Lys Ser Ala Ala Pro Val Arg Thr Val Lys Cys 35 40 45 Cys Ala Ser Ser Trp Asn Ser Thr Ile Asn Gly Ala Ala Ala Thr Thr 50 55 60 Asn Gly Ala Ser Ala Ala Ser Asn Gly Ala Ser Thr Thr Thr Thr Thr 65 70 75 80 Tyr Val Ser Asp Ala Thr Arg Phe Ile Asp Ser Ser Lys Arg Ala Asn 85 90 95 Leu Val Pro Leu Tyr Arg Cys Ile Phe Ala Asp His Leu Thr Pro Val 100 105 110 Leu Ala Tyr Arg Cys Leu Val Gln Glu Asp Asp Lys Glu Thr Pro Ser 115 120 125 Phe Leu Phe Glu Ser Val Glu Pro Gly Arg Ile Ser Thr Val Gly Arg 130 135 140 Tyr Ser Val Val Gly Ala His Pro Val Met Glu Val Ile Ala Lys Asp 145 150 155 160 Asn Met Val Thr Val Met Asp His Glu Lys Gly Ser Leu Val Glu Glu 165 170 175 Val Val Asp Asp Pro Met Glu Ile Pro Arg Arg Ile Ser Glu Asp Trp 180 185 190 Lys Pro Gln Ile Ile Asp Asp Leu Pro Glu Ala Phe Cys Gly Gly Trp 195 200 205 Val Gly Phe Phe Ser Tyr Asp Thr Val Arg Tyr Val Glu Lys Lys Lys 210 215 220 Leu Pro Phe Ser Lys Ala Pro Gln Asp Asp Arg Asn Leu Ala Asp Met 225 230 235 240 His Leu Gly Leu Tyr Asn Asp Val Ile Val Phe Asp His Val Glu Lys 245 250 255 Lys Val Tyr Val Ile His Trp Val Arg Leu Asn Gln Gln Ser Ser Glu 260 265 270 Glu Lys Ala Tyr Ala Glu Gly Leu Glu His Leu Glu Arg Leu Val Ser 275 280 285 Arg Val Gln Asp Glu Asn Thr Pro Arg Leu Ala Pro Gly Ser Ile Asp 290 295 300 Leu His Thr Gly His Phe Gly Pro Pro Leu Lys Lys Ser Asn Met Thr 305 310 315 320 Cys Glu Glu Tyr Lys Met Ala Val Leu Ala Ala Lys Glu His Ile Gln 325 330 335 Ala Gly Asp Ile Phe Gln Ile Val Leu Ser Gln Arg Phe Glu Arg Arg 340 345 350 Thr Phe Ala Asp Pro Phe Glu Val Tyr Arg Ala Leu Arg Val Val Asn 355 360 365 Pro Ser Pro Tyr Met Thr Tyr Met Gln Ala Arg Gly Cys Val Leu Val 370 375 380 Ala Ser Ser Pro Glu Ile Leu Thr Arg Val Lys Lys Asn Lys Ile Val 385 390 395 400 Asn Arg Pro Leu Ala Gly Thr Ala Arg Arg Gly Arg Thr Thr Glu Glu 405 410 415 Asp Glu Met Leu Glu Thr Gln Leu Leu Lys Asp Ala Lys Gln Cys Ala 420 425 430 Glu His Val Met Leu Val Asp Leu Gly Arg Asn Asp Val Gly Lys Val 435 440 445 Ser Lys Ser Gly Ser Val Lys Val Glu Lys Leu Met Asn Val Glu Arg 450 455 460 Tyr Ser His Val Met His Ile Ser Ser Thr Val Thr Gly Glu Leu Gln 465 470 475 480 Asp Asn Leu Ser Cys Trp Asp Ala Leu Arg Ala Ala Leu Pro Val Gly 485 490 495 Thr Val Ser Gly Ala Pro Lys Val Lys Ala Met Glu Leu Ile Asp Glu 500 505 510 Leu Glu Val Asn Arg Arg Gly Pro Tyr Ser Gly Gly Phe Gly Gly Ile 515 520 525 Ser Phe Thr Gly Asp Met Asp Ile Ala Leu Ala Leu Arg Thr Ile Val 530 535 540 Phe Gln Thr Gly Thr Arg Tyr Asp Thr Met Tyr Ser Tyr Lys Asn Ala 545 550 555 560 Thr Lys Arg Arg Gln Trp Val Ala Tyr Leu Gln Ala Gly Ala Gly Ile 565 570 575 Val Ala Asp Ser Asp Pro Asp Asp Glu His Arg Glu Cys Gln Asn Lys 580 585 590 Ala Ala Gly Leu Ala Arg Ala Ile Asp Leu Ala Glu Ser Ala Phe Val 595 600 605 Asn Lys Ser Ser Ser 610 7 729 PRT Rhizobium meliloti 7 Met Ala Ala Val Ile Leu Glu Asp Gly Ala Glu Ser Tyr Thr Thr Lys 1 5 10 15 Gly Gly Ile Val Val Thr Arg Arg Arg Arg Glu Ala Ser Tyr Ser Asp 20 25 30 Ala Ile Ala Gly Tyr Val Asp Arg Leu Asp Glu Arg Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Val Val Asp Pro Pro Leu Ala Ile Ser Ser Phe Gly Arg Ser Leu 65 70 75 80 Trp Ile Glu Ala Tyr Asn Glu Arg Gly Glu Val Leu Leu Ala Leu Ile 85 90 95 Ala Glu Asp Leu Lys Ser Val Ala Asp Ile Thr Leu Gly Ser Leu Ala 100 105 110 Ala Arg Arg Leu Asp Leu Thr Ile Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Met Pro Thr Val Phe Thr Val Leu Arg Ala 130 135 140 Val Thr Asn Leu Phe His Ser Glu Glu Asp Ser Asn Leu Gly Leu Tyr 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Glu Leu 165 170 175 Lys Leu Ser Arg Pro Asp Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ala Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Ala Arg Glu Asn Leu Ser Thr Glu Gly Lys Ala Ala 210 215 220 Asp Ile Ala Pro Glu Pro Phe Arg Ser Val Asp Ser Ile Pro Pro His 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ala Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Tyr Glu Arg Cys Glu Ser Arg Pro Ser Glu Ile Ser Asn Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asn 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Val Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Ser His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Tyr Asp Ser Asn Pro Glu Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ala Ala Ile Arg Asp Ala Lys Ser 500 505 510 Ala Asn Ser Ala Lys Ser Ala Arg Asp Val Ala Ala Val Gly Ala Gly 515 520 525 Val Ser Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Ser Val Thr Thr Val Arg Thr 545 550 555 560 Pro Val Ala Glu Glu Ile Phe Asp Arg Val Lys Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Thr Pro Lys Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Lys Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Asp Leu Arg Gln Leu 610 615 620 Ala Ile Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Ile Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ser Asn Leu Pro Arg Glu Phe Val Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ser Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gly Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Ala His Leu 705 710 715 720 Ala Lys Arg Ala Lys Thr Lys Ala Ala 725 8 421 PRT Sulfolobus solfataricus 8 Met Glu Val His Pro Ile Ser Glu Phe Ala Ser Pro Phe Glu Val Phe 1 5 10 15 Lys Cys Ile Glu Arg Asp Phe Lys Val Ala Gly Leu Leu Glu Ser Ile 20 25 30 Gly Gly Pro Gln Tyr Lys Ala Arg Tyr Ser Val Ile Ala Trp Ser Thr 35 40 45 Asn Gly Tyr Leu Lys Ile His Asp Asp Pro Val Asn Ile Leu Asn Gly 50 55 60 Tyr Leu Lys Asp Leu Lys Leu Ala Asp Ile Pro Gly Leu Phe Lys Gly 65 70 75 80 Gly Met Ile Gly Tyr Ile Ser Tyr Asp Ala Val Arg Phe Trp Glu Lys 85 90 95 Ile Arg Asp Leu Lys Pro Ala Ala Glu Asp Trp Pro Tyr Ala Glu Phe 100 105 110 Phe Thr Pro Asp Asn Ile Ile Ile Tyr Asp His Asn Glu Gly Lys Val 115 120 125 Tyr Val Asn Ala Asp Leu Ser Ser Val Gly Gly Cys Gly Asp Ile Gly 130 135 140 Glu Phe Lys Val Ser Phe Tyr Asp Glu Ser Leu Asn Lys Asn Ser Tyr 145 150 155 160 Glu Arg Ile Val Ser Glu Ser Leu Glu Tyr Ile Arg Ser Gly Tyr Ile 165 170 175 Phe Gln Val Val Leu Ser Arg Phe Tyr Arg Tyr Ile Phe Ser Gly Asp 180 185 190 Pro Leu Arg Ile Tyr Tyr Asn Leu Arg Arg Ile Asn Pro Ser Pro Tyr 195 200 205 Met Phe Tyr Leu Lys Phe Asp Glu Lys Tyr Leu Ile Gly Ser Ser Pro 210 215 220 Glu Leu Leu Phe Arg Val Gln Asp Asn Ile Val Glu Thr Tyr Pro Ile 225 230 235 240 Ala Gly Thr Arg Pro Arg Gly Ala Asp Gln Glu Glu Asp Leu Lys Leu 245 250 255 Glu Leu Glu Leu Met Asn Ser Glu Lys Asp Lys Ala Glu His Leu Met 260 265 270 Leu Val Asp Leu Ala Arg Asn Asp Leu Gly Lys Val Cys Val Pro Gly 275 280 285 Thr Val Lys Val Pro Glu Leu Met Tyr Val Glu Lys Tyr Ser His Val 290 295 300 Gln His Ile Val Ser Lys Val Ile Gly Thr Leu Lys Lys Lys Tyr Asn 305 310 315 320 Ala Leu Asn Val Leu Ser Ala Thr Phe Pro Ala Gly Thr Val Ser Gly 325 330 335 Arg Pro Lys Pro Met Ala Met Asn Ile Ile Glu Thr Leu Glu Glu Tyr 340 345 350 Lys Arg Gly Pro Tyr Ala Gly Ala Val Gly Phe Ile Ser Ala Asp Gly 355 360 365 Asn Ala Glu Phe Ala Ile Ala Ile Arg Thr Ala Phe Leu Asn Lys Glu 370 375 380 Leu Leu Arg Ile His Ala Gly Ala Gly Ile Val Tyr Asp Ser Asn Pro 385 390 395 400 Glu Ser Glu Tyr Phe Glu Thr Glu His Lys Leu Lys Ala Leu Lys Thr 405 410 415 Ala Ile Gly Val Arg 420 9 32 DNA Artificial Sequence A primer. 9 ccatcgcggc gcgttttttt cgtccaacta tg 32 10 32 DNA Artificial Sequence A primer. 10 catagttgga cgaaaaaaac gcgccgcgat gg 32 11 39 DNA Artificial Sequence A primer. 11 ccatcgcggc gcgtattttt cgtccaacta tgaatatcc 39 12 39 DNA Artificial Sequence A primer. 12 ggatattcat agttggacga aaaatacgcg ccgcgatgg 39 13 39 DNA Artificial Sequence A primer. 13 ccatcgcggc gcgtggtttt cgtccaacta tgaatatcc 39 14 39 DNA Artificial Sequence A primer. 14 ggatattcat agttggacga aaaccacgcg ccgcgatgg 39 15 39 DNA Artificial Sequence A primer. 15 ccatcgcggc gcggttttta agtccaacta tgaatatcc 39 16 39 DNA Artificial Sequence A primer. 16 ggatattcat agttggactt aaaaaccgcg ccgcgatgg 39 17 34 DNA Artificial Sequence A primer. 17 gcgcggtttt ttcgtgcaac tatgaatatc cggg 34 18 34 DNA Artificial Sequence A primer. 18 cccggatatt catagttgca cgaaaaaacc gcgc 34 19 34 DNA Artificial Sequence A primer. 19 cgcggttttt tcgttcaact atgaatatcc gggc 34 20 34 DNA Artificial Sequence A primer. 20 gcccggatat tcatagttga acgaaaaaac cgcg 34 21 37 DNA Artificial Sequence A primer. 21 cggcgcggtt ttttcgatca actatgaata tccgggc 37 22 37 DNA Artificial Sequence A primer. 22 gcccggatat tcatagttga tcgaaaaaac cgcgccg 37 23 36 DNA Artificial Sequence A primer. 23 ggcgcggttt tttcgctcaa ctatgaatat ccgggc 36 24 36 DNA Artificial Sequence A primer. 24 gcccggatat tcatagttga gcgaaaaaac cgcgcc 36 25 39 DNA Artificial Sequence A primer. 25 cggcgcggtt ttttcgatga actatgaata tccgggccg 39 26 39 DNA Artificial Sequence A primer. 26 cggcccggat attcatagtt catcgaaaaa accgcgccg 39 27 34 DNA Artificial Sequence A primer. 27 cgcggttttt tcgaccaact atgaatatcc gggc 34 28 34 DNA Artificial Sequence A primer. 28 gcccggatat tcatagttgg tcgaaaaaac cgcg 34 29 36 DNA Artificial Sequence A primer. 29 ggcgcggttt tttcggtcaa ctatgaatat ccgggc 36 30 36 DNA Artificial Sequence A primer. 30 gcccggatat tcatagttga ccgaaaaaac cgcgcc 36 31 35 DNA Artificial Sequence A primer. 31 gcgcggtttt ttcgtacaac tatgaatatc cgggc 35 32 35 DNA Artificial Sequence A primer. 32 gcccggatat tcatagttgt acgaaaaaac cgcgc 35 33 36 DNA Artificial Sequence A primer. 33 cggcgcggtt ttttcgtcct tctatgaata tccggg 36 34 36 DNA Artificial Sequence A primer. 34 cccggatatt catagaagga cgaaaaaacc gcgccg 36 35 29 DNA Artificial Sequence A primer. 35 ctgaaggcga tcaacgcgtc gccctattc 29 36 29 DNA Artificial Sequence A primer. 36 gaatagggcg acgcgttgat cgccttcag 29 37 31 DNA Artificial Sequence A primer. 37 cctgaaggcg atcaacgggt cgccctattc c 31 38 31 DNA Artificial Sequence A primer. 38 ggaatagggc gacccgttga tcgccttcag g 31 39 33 DNA Artificial Sequence A primer. 39 cgtcgcccta ttccgccttc atcaatctcg gcg 33 40 33 DNA Artificial Sequence A primer. 40 cgccgagatt gatgaaggcg gaatagggcg acg 33 41 33 DNA Artificial Sequence A primer. 41 cgtcgcccta ttcctggttc atcaatctcg gcg 33 42 33 DNA Artificial Sequence A primer. 42 cgccgagatt gatgaaccag gaatagggcg acg 33 43 729 PRT Rhizobium meliloti 43 Met Ala Ala Val Ile Leu Glu Asp Gly Ala Glu Ser Tyr Thr Thr Lys 1 5 10 15 Gly Gly Ile Val Val Thr Arg Arg Arg Arg Glu Ala Ser Tyr Ser Asp 20 25 30 Ala Ile Ala Gly Tyr Val Asp Arg Leu Asp Glu Arg Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Val Val Asp Pro Pro Leu Ala Ile Ser Ser Phe Gly Arg Ser Leu 65 70 75 80 Trp Ile Glu Ala Tyr Asn Glu Arg Gly Glu Val Leu Leu Ala Leu Ile 85 90 95 Ala Glu Asp Leu Lys Ser Val Ala Asp Ile Thr Leu Gly Ser Leu Ala 100 105 110 Ala Arg Arg Leu Asp Leu Thr Ile Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Met Pro Thr Val Phe Thr Val Leu Arg Ala 130 135 140 Val Thr Asn Leu Phe His Ser Glu Glu Asp Ser Asn Leu Gly Leu Tyr 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Glu Leu 165 170 175 Lys Leu Ser Arg Pro Asp Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ala Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Ala Arg Glu Asn Leu Ser Thr Glu Gly Lys Ala Ala 210 215 220 Asp Ile Ala Pro Glu Pro Phe Arg Ser Val Asp Ser Ile Pro Pro His 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ala Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Tyr Glu Arg Cys Glu Ser Arg Pro Ser Glu Ile Ser Asn Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asn 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Val Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Ser His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Tyr Asp Ser Asn Pro Glu Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ala Ala Ile Arg Asp Ala Lys Ser 500 505 510 Ala Asn Ser Ala Lys Ser Ala Arg Asp Val Ala Ala Val Gly Ala Gly 515 520 525 Val Ser Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Ser Val Thr Thr Val Arg Thr 545 550 555 560 Pro Val Ala Glu Glu Ile Phe Asp Arg Val Lys Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Thr Pro Lys Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Lys Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Asp Leu Arg Gln Leu 610 615 620 Ala Ile Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Ile Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ser Asn Leu Pro Arg Glu Phe Val Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ser Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gly Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Ala His Leu 705 710 715 720 Ala Lys Arg Ala Lys Thr Lys Ala Ala 725 44 616 PRT Sulfolobus solfataricus 44 Met Glu Val His Pro Ile Ser Glu Phe Ala Ser Pro Phe Glu Val Phe 1 5 10 15 Lys Cys Ile Glu Arg Asp Phe Lys Val Ala Gly Leu Leu Glu Ser Ile 20 25 30 Gly Gly Pro Gln Tyr Lys Ala Arg Tyr Ser Val Ile Ala Trp Ser Thr 35 40 45 Asn Gly Tyr Leu Lys Ile His Asp Asp Pro Val Asn Ile Leu Asn Gly 50 55 60 Tyr Leu Lys Asp Leu Lys Leu Ala Asp Ile Pro Gly Leu Phe Lys Gly 65 70 75 80 Gly Met Ile Gly Tyr Ile Ser Tyr Asp Ala Val Arg Phe Trp Glu Lys 85 90 95 Ile Arg Asp Leu Lys Pro Ala Ala Glu Asp Trp Pro Tyr Ala Glu Phe 100 105 110 Phe Thr Pro Asp Asn Ile Ile Ile Tyr Asp His Asn Glu Gly Lys Val 115 120 125 Tyr Val Asn Ala Asp Leu Ser Ser Val Gly Gly Cys Gly Asp Ile Gly 130 135 140 Glu Phe Lys Val Ser Phe Tyr Asp Glu Ser Leu Asn Lys Asn Ser Tyr 145 150 155 160 Glu Arg Ile Val Ser Glu Ser Leu Glu Tyr Ile Arg Ser Gly Tyr Ile 165 170 175 Phe Gln Val Val Leu Ser Arg Phe Tyr Arg Tyr Ile Phe Ser Gly Asp 180 185 190 Pro Leu Arg Ile Tyr Tyr Asn Leu Arg Arg Ile Asn Pro Ser Pro Tyr 195 200 205 Met Phe Tyr Leu Lys Phe Asp Glu Lys Tyr Leu Ile Gly Ser Ser Pro 210 215 220 Glu Leu Leu Phe Arg Val Gln Asp Asn Ile Val Glu Thr Tyr Pro Ile 225 230 235 240 Ala Gly Thr Arg Pro Arg Gly Ala Asp Gln Glu Glu Asp Leu Lys Leu 245 250 255 Glu Leu Glu Leu Met Asn Ser Glu Lys Asp Lys Ala Glu His Leu Met 260 265 270 Leu Val Asp Leu Ala Arg Asn Asp Leu Gly Lys Val Cys Val Pro Gly 275 280 285 Thr Val Lys Val Pro Glu Leu Met Tyr Val Glu Lys Tyr Ser His Val 290 295 300 Gln His Ile Val Ser Lys Val Ile Gly Thr Leu Lys Lys Lys Tyr Asn 305 310 315 320 Ala Leu Asn Val Leu Ser Ala Thr Phe Pro Ala Gly Thr Val Ser Gly 325 330 335 Arg Pro Lys Pro Met Ala Met Asn Ile Ile Glu Thr Leu Glu Glu Tyr 340 345 350 Lys Arg Gly Pro Tyr Ala Gly Ala Val Gly Phe Ile Ser Ala Asp Gly 355 360 365 Asn Ala Glu Phe Ala Ile Ala Ile Arg Thr Ala Phe Leu Asn Lys Glu 370 375 380 Leu Leu Arg Ile His Ala Gly Ala Gly Ile Val Tyr Asp Ser Asn Pro 385 390 395 400 Glu Ser Glu Tyr Phe Glu Thr Glu His Lys Leu Lys Ala Leu Lys Thr 405 410 415 Ala Ile Gly Val Arg Met Asp Leu Thr Leu Ile Ile Asp Asn Tyr Asp 420 425 430 Ser Phe Val Tyr Asn Ile Ala Gln Ile Val Gly Glu Leu Gly Ser Tyr 435 440 445 Pro Ile Val Ile Arg Asn Asp Glu Ile Ser Ile Lys Gly Ile Glu Arg 450 455 460 Ile Asp Pro Asp Arg Leu Ile Ile Ser Pro Gly Pro Gly Thr Pro Glu 465 470 475 480 Lys Arg Glu Asp Ile Gly Val Ser Leu Asp Val Ile Lys Tyr Leu Gly 485 490 495 Lys Arg Thr Pro Ile Leu Gly Val Cys Leu Gly His Gln Ala Ile Gly 500 505 510 Tyr Ala Phe Gly Ala Lys Ile Arg Arg Ala Arg Lys Val Phe His Gly 515 520 525 Lys Ile Ser Asn Ile Ile Leu Val Asn Asn Ser Pro Leu Ser Leu Tyr 530 535 540 Tyr Gly Ile Ala Lys Glu Phe Lys Ala Thr Arg Tyr His Ser Leu Val 545 550 555 560 Val Asp Glu Val His Arg Pro Leu Ile Val Asp Ala Ile Ser Ala Glu 565 570 575 Asp Asn Glu Ile Met Ala Ile His His Glu Glu Tyr Pro Ile Tyr Gly 580 585 590 Val Gln Phe His Pro Glu Ser Val Gly Thr Ser Leu Gly Tyr Lys Ile 595 600 605 Leu Tyr Asn Phe Leu Asn Arg Val 610 615 45 897 PRT Arabidopsis thaliana 45 Met Ser Ala Val Ser Ile Ser Ala Val Lys Ser Asp Phe Phe Thr Val 1 5 10 15 Glu Ala Ile Ala Val Thr His His Arg Thr Pro His Pro Pro His Phe 20 25 30 Pro Ser Leu Arg Phe Pro Leu Ser Leu Lys Ser Pro Pro Ala Thr Ser 35 40 45 Leu Asn Leu Val Ala Gly Ser Lys Leu Leu His Phe Ser Arg Arg Leu 50 55 60 Pro Ser Ile Lys Cys Ser Tyr Thr Pro Ser Leu Asp Leu Ser Glu Glu 65 70 75 80 Gln Phe Thr Lys Phe Lys Lys Ala Ser Glu Lys Gly Asn Leu Val Pro 85 90 95 Leu Phe Arg Cys Val Phe Ser Asp His Leu Thr Pro Ile Leu Ala Tyr 100 105 110 Arg Cys Leu Val Lys Glu Asp Asp Arg Asp Ala Pro Ser Phe Leu Phe 115 120 125 Glu Ser Val Glu Pro Gly Ser Gln Ser Ser Asn Ile Gly Arg Tyr Ser 130 135 140 Val Val Gly Ala Gln Pro Thr Ile Glu Ile Val Ala Lys Gly Asn Val 145 150 155 160 Val Thr Val Met Asp His Gly Ala Ser Leu Arg Thr Glu Glu Glu Val 165 170 175 Asp Asp Pro Met Met Val Pro Gln Lys Ile Met Glu Glu Trp Asn Pro 180 185 190 Gln Gly Ile Asp Glu Leu Pro Glu Ala Phe Cys Gly Gly Trp Val Gly 195 200 205 Tyr Phe Ser Tyr Asp Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro 210 215 220 Phe Ser Asn Ala Pro Glu Asp Asp Arg Ser Leu Pro Asp Val Asn Leu 225 230 235 240 Gly Leu Tyr Asp Asp Val Ile Val Phe Asp His Val Glu Lys Lys Ala 245 250 255 Tyr Val Ile His Trp Val Arg Ile Asp Lys Asp Arg Ser Val Glu Glu 260 265 270 Asn Phe Arg Glu Gly Met Asn Arg Leu Glu Ser Leu Thr Ser Arg Ile 275 280 285 Gln Asp Gln Lys Pro Pro Lys Met Pro Thr Gly Phe Ile Lys Leu Arg 290 295 300 Thr Gln Leu Phe Gly Pro Lys Leu Glu Lys Ser Thr Met Thr Ser Glu 305 310 315 320 Ala Tyr Lys Glu Ala Val Val Glu Ala Lys Glu His Ile Leu Ala Gly 325 330 335 Asp Ile Phe Gln Ile Val Leu Ser Gln Arg Phe Glu Arg Arg Thr Phe 340 345 350 Ala Asp Pro Phe Glu Ile Tyr Arg Ala Leu Arg Ile Val Asn Pro Ser 355 360 365 Pro Tyr Met Ala Tyr Leu Gln Val Arg Gly Cys Ile Leu Val Ala Ser 370 375 380 Ser Pro Glu Ile Leu Leu Arg Ser Lys Asn Arg Lys Ile Thr Asn Arg 385 390 395 400 Pro Leu Ala Gly Thr Val Arg Arg Gly Lys Thr Pro Lys Glu Asp Leu 405 410 415 Met Leu Glu Lys Glu Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu His 420 425 430 Ile Met Leu Val Asp Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys 435 440 445 Pro Gly Ser Val Glu Val Lys Lys Leu Lys Asp Ile Glu Trp Phe Ser 450 455 460 His Val Met His Ile Ser Ser Thr Val Val Gly Glu Leu Leu Asp His 465 470 475 480 Leu Thr Ser Trp Asp Ala Leu Arg Ala Val Leu Pro Val Gly Thr Val 485 490 495 Ser Gly Ala Pro Lys Val Lys Ala Met Glu Leu Ile Asp Glu Leu Glu 500 505 510 Val Thr Arg Arg Gly Pro Tyr Ser Gly Gly Phe Gly Gly Ile Ser Phe 515 520 525 Asn Gly Asp Met Asp Ile Ala Leu Ala Leu Arg Thr Met Val Phe Pro 530 535 540 Thr Asn Thr Arg Tyr Asp Thr Leu Tyr Ser Tyr Lys His Pro Gln Arg 545 550 555 560 Arg Arg Glu Trp Ile Ala His Ile Gln Ala Gly Ala Gly Ile Val Ala 565 570 575 Asp Ser Asn Pro Asp Asp Glu His Arg Glu Cys Glu Asn Lys Ala Ala 580 585 590 Ala Leu Ala Arg Ala Ile Asp Leu Ala Glu Ser Ser Phe Leu Glu Ala 595 600 605 Pro Glu Phe Thr Thr Ile Thr Pro His Ile Asn Asn Ile Met Ala Ala 610 615 620 Ser Thr Leu Tyr Lys Ser Cys Leu Leu Gln Pro Lys Ser Gly Ser Thr 625 630 635 640 Thr Arg Arg Leu Asn Pro Ser Leu Val Asn Pro Leu Thr Asn Pro Thr 645 650 655 Arg Val Ser Val Leu Gly Lys Ser Arg Arg Asp Val Phe Ala Lys Ala 660 665 670 Ser Ile Glu Met Ala Glu Ser Asn Ser Ile Pro Ser Val Val Val Asn 675 680 685 Ser Ser Lys Gln His Gly Pro Ile Ile Val Ile Asp Asn Tyr Asp Ser 690 695 700 Phe Thr Tyr Asn Leu Cys Gln Tyr Met Gly Glu Leu Gly Cys His Phe 705 710 715 720 Glu Val Tyr Arg Asn Asp Glu Leu Thr Val Glu Glu Leu Lys Lys Lys 725 730 735 Asn Pro Arg Gly Val Leu Ile Ser Pro Gly Pro Gly Thr Pro Gln Asp 740 745 750 Ser Gly Ile Ser Leu Gln Thr Val Leu Glu Leu Gly Pro Leu Val Pro 755 760 765 Leu Phe Gly Val Cys Met Gly Leu Gln Cys Ile Gly Glu Ala Phe Gly 770 775 780 Gly Lys Ile Val Arg Ser Pro Phe Gly Val Met His Gly Lys Ser Ser 785 790 795 800 Met Val His Tyr Asp Glu Lys Gly Glu Glu Gly Leu Phe Ser Gly Leu 805 810 815 Ser Asn Pro Phe Ile Val Gly Arg Tyr His Ser Leu Val Ile Glu Lys 820 825 830 Asp Thr Phe Pro Ser Asp Glu Leu Glu Val Thr Ala Trp Thr Glu Asp 835 840 845 Gly Leu Val Met Ala Ala Arg His Arg Lys Tyr Lys His Ile Gln Gly 850 855 860 Val Gln Phe His Pro Glu Ser Ile Ile Thr Thr Glu Gly Lys Thr Ile 865 870 875 880 Val Arg Asn Phe Ile Lys Ile Val Glu Lys Lys Glu Ser Glu Lys Leu 885 890 895 Thr 46 252 DNA Artificial Sequence A truncated gene 46 atgcaaacac aaaaaccgac tctcgaactg gaattcctgg tggaaaacgg tatcgccacc 60 gtgcaagcgg gtgctggtgt agtccttgat tctgttccgc agtcggaagc cgacgaaacc 120 cgtaacaaag cccgcgctgt actgcgcgct attgccaccg cgcatcatgc acaggagact 180 ttctgatggc tgacattctg ctgctcgata atatcgactc ttttacgtac aacctggcag 240 atcagttgcg ca 252 47 18 DNA Artificial Sequence A primer. 47 ttatgccgcc tgtcatcg 18 48 19 DNA Artificial Sequence A primer. 48 ataggcttaa tggtaaccg 19 49 18 DNA Artificial Sequence A primer. 49 ctgaacaaca gaagtacg 18 50 18 DNA Artificial Sequence A primer. 50 taaccgtgtc atcgagcg 18 51 31 DNA Artificial Sequence A primer. 51 aaaaagatct ccatggtaac gatcattcag g 31 52 35 DNA Artificial Sequence A primer. 52 aaaagaattc ttatcacgcg gccttggtct tcgcc 35 53 19 DNA Artificial Sequence A primer. 53 caaaagctgg atccccacc 19 54 23 DNA Artificial Sequence A primer. 54 cctatccgag atctctcaac tcc 23 55 31 DNA Artificial Sequence A primer. 55 catcccatgg atggtaacga tcattcagga t 31 56 31 DNA Artificial Sequence A primer. 56 gatgtctaga gacactatag aatactcaag c 31 57 719 PRT Rhodopseudomonas palustris 57 Met Asn Arg Thr Val Phe Ser Leu Pro Ala Thr Ser Asp Tyr Lys Thr 1 5 10 15 Ala Ala Gly Leu Ala Val Thr Arg Ser Ala Gln Pro Phe Ala Gly Gly 20 25 30 Gln Ala Leu Asp Glu Leu Ile Asp Leu Leu Asp His Arg Arg Gly Val 35 40 45 Met Leu Ser Ser Gly Thr Thr Val Pro Gly Arg Tyr Glu Ser Phe Asp 50 55 60 Leu Gly Phe Ala Asp Pro Pro Leu Ala Leu Thr Thr Arg Ala Glu Lys 65 70 75 80 Phe Thr Ile Glu Ala Leu Asn Pro Arg Gly Arg Val Leu Ile Ala Phe 85 90 95 Leu Ser Asp Lys Leu Glu Glu Pro Cys Val Val Val Glu Gln Ala Cys 100 105 110 Ala Thr Lys Ile Arg Gly His Ile Val Arg Gly Glu Ala Pro Val Asp 115 120 125 Glu Glu Gln Arg Thr Arg Arg Ala Ser Ala Ile Ser Leu Val Arg Ala 130 135 140 Val Ile Ala Ala Phe Ala Ser Pro Ala Asp Pro Met Leu Gly Leu Tyr 145 150 155 160 Gly Ala Phe Ala Tyr Asp Leu Val Phe Gln Phe Glu Asp Leu Lys Gln 165 170 175 Lys Arg Ala Arg Glu Ala Asp Gln Arg Asp Ile Val Leu Tyr Val Pro 180 185 190 Asp Arg Leu Leu Ala Tyr Asp Arg Ala Thr Gly Arg Gly Val Asp Ile 195 200 205 Ser Tyr Glu Phe Ala Trp Lys Gly Gln Ser Thr Ala Gly Leu Pro Asn 210 215 220 Glu Thr Ala Glu Ser Val Tyr Thr Gln Thr Gly Arg Gln Gly Phe Ala 225 230 235 240 Asp His Ala Pro Gly Asp Tyr Pro Lys Val Val Glu Lys Ala Arg Ala 245 250 255 Ala Phe Ala Arg Gly Asp Leu Phe Glu Ala Val Pro Gly Gln Leu Phe 260 265 270 Gly Glu Pro Cys Glu Arg Ser Pro Ala Glu Val Phe Lys Arg Leu Cys 275 280 285 Arg Ile Asn Pro Ser Pro Tyr Gly Gly Leu Leu Asn Leu Gly Asp Gly 290 295 300 Glu Phe Leu Val Ser Ala Ser Pro Glu Met Phe Val Arg Ser Asp Gly 305 310 315 320 Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Ala Arg Gly Val 325 330 335 Asp Ala Ile Ser Asp Ala Glu Gln Ile Gln Lys Leu Leu Asn Ser Glu 340 345 350 Lys Asp Glu Phe Glu Leu Asn Met Cys Thr Asp Val Asp Arg Asn Asp 355 360 365 Lys Ala Arg Val Cys Val Pro Gly Thr Ile Lys Val Leu Ala Arg Arg 370 375 380 Gln Ile Glu Thr Tyr Ser Lys Leu Phe His Thr Val Asp His Val Glu 385 390 395 400 Gly Met Leu Arg Pro Gly Phe Asp Ala Leu Asp Ala Phe Leu Thr His 405 410 415 Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met Gln 420 425 430 Phe Val Glu Asp His Glu Arg Ser Pro Arg Arg Trp Tyr Ala Gly Ala 435 440 445 Phe Gly Val Val Gly Phe Asp Gly Ser Ile Asn Thr Gly Leu Thr Ile 450 455 460 Arg Thr Ile Arg Met Lys Asp Gly Leu Ala Glu Val Arg Val Gly Ala 465 470 475 480 Thr Cys Leu Phe Asp Ser Asn Pro Val Ala Glu Asp Lys Glu Cys Gln 485 490 495 Val Lys Ala Ala Ala Leu Phe Gln Ala Leu Arg Gly Asp Pro Ala Lys 500 505 510 Pro Leu Ser Ala Val Ala Pro Asp Ala Thr Gly Ser Gly Lys Lys Val 515 520 525 Leu Leu Val Asp His Asp Asp Ser Phe Val His Met Leu Ala Asp Tyr 530 535 540 Phe Arg Gln Val Gly Ala Gln Val Thr Val Val Arg Tyr Val His Gly 545 550 555 560 Leu Lys Met Leu Ala Glu Asn Ser Tyr Asp Leu Leu Val Leu Ser Pro 565 570 575 Gly Pro Gly Arg Pro Glu Asp Phe Lys Ile Lys Asp Thr Ile Asp Ala 580 585 590 Ala Leu Ala Lys Lys Leu Pro Ile Phe Gly Val Cys Leu Gly Val Gln 595 600 605 Ala Met Gly Glu Tyr Phe Gly Gly Thr Leu Gly Gln Leu Ala Gln Pro 610 615 620 Ala His Gly Arg Pro Ser Arg Ile Gln Val Arg Gly Gly Ala Leu Met 625 630 635 640 Arg Gly Leu Pro Asn Glu Val Thr Ile Gly Arg Tyr His Ser Leu Tyr 645 650 655 Val Asp Met Arg Asp Met Pro Lys Glu Leu Thr Val Thr Ala Ser Thr 660 665 670 Asp Asp Gly Ile Ala Met Ala Ile Glu His Lys Thr Leu Pro Val Gly 675 680 685 Gly Val Gln Phe His Pro Glu Ser Leu Met Ser Leu Gly Gly Glu Val 690 695 700 Gly Leu Arg Ile Val Glu Asn Ala Phe Arg Leu Gly Gln Ala Ala 705 710 715 58 729 PRT Artificial Sequence An A. tumefaciens mutant. 58 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Phe 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 59 729 PRT Artificial Sequence An A. tumefaciens mutant. 59 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Tyr 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 60 729 PRT Artificial Sequence An A. tumefaciens mutant. 60 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Phe Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 61 729 PRT Artificial Sequence An A. tumefaciens mutant. 61 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Cys Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 62 729 PRT Artificial Sequence An A. tumefaciens mutant. 62 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Ser Phe Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 63 729 PRT Artificial Sequence An A. tumefaciens mutant. 63 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Ala Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 64 729 PRT Artificial Sequence An A. tumefaciens mutant. 64 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Gly Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 65 729 PRT Artificial Sequence An A. tumefaciens mutant. 65 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Trp Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 66 604 PRT Artificial Sequence An Zea mays mutant. 66 Met Glu Ser Leu Ala Ala Thr Ser Val Phe Ala Pro Ser Arg Val Ala 1 5 10 15 Val Pro Ala Ala Arg Ala Leu Val Arg Ala Gly Thr Val Val Pro Thr 20 25 30 Arg Arg Thr Ser Ser Arg Ser Gly Thr Ser Gly Val Lys Cys Ser Ala 35 40 45 Ala Val Thr Pro Gln Ala Ser Pro Val Ile Ser Arg Ser Ala Ala Ala 50 55 60 Ala Lys Ala Ala Glu Glu Asp Lys Arg Arg Phe Phe Glu Ala Ala Ala 65 70 75 80 Arg Gly Ser Gly Lys Gly Asn Leu Val Pro Met Trp Glu Cys Ile Val 85 90 95 Ser Asp His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val Pro Glu 100 105 110 Asp Asn Val Asp Ala Pro Ser Phe Leu Phe Glu Ser Val Glu Gln Gly 115 120 125 Pro Gln Gly Thr Thr Asn Val Gly Arg Tyr Ser Met Val Gly Ala His 130 135 140 Pro Val Met Glu Ile Val Ala Lys Asp His Lys Val Thr Ile Met Asp 145 150 155 160 His Glu Lys Ser Gln Val Thr Glu Gln Val Val Asp Asp Pro Met Gln 165 170 175 Ile Pro Arg Thr Met Met Glu Gly Trp His Pro Gln Gln Ile Asp Glu 180 185 190 Leu Pro Glu Ser Phe Ser Gly Gly Trp Val Gly Phe Phe Ser Tyr Asp 195 200 205 Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro Phe Ser Ser Ala Pro 210 215 220 Gln Asp Asp Arg Asn Leu Pro Asp Val His Leu Gly Leu Tyr Asp Asp 225 230 235 240 Val Leu Val Phe Asp Asn Val Glu Lys Lys Val Tyr Val Ile His Trp 245 250 255 Val Asn Val Asp Arg His Ala Ser Val Glu Glu Ala Tyr Gln Asp Gly 260 265 270 Arg Ser Arg Leu Asn Met Leu Leu Ser Lys Val His Asn Ser Asn Val 275 280 285 Pro Thr Leu Ser Pro Gly Phe Val Lys Leu His Thr Arg Lys Phe Gly 290 295 300 Thr Pro Leu Asn Lys Ser Thr Met Thr Ser Asp Glu Tyr Lys Asn Ala 305 310 315 320 Val Leu Gln Ala Lys Glu His Ile Met Ala Gly Asp Ile Phe Gln Ile 325 330 335 Val Leu Ser Gln Arg Phe Glu Arg Arg Thr Tyr Ala Asn Pro Phe Glu 340 345 350 Val Tyr Arg Ala Leu Arg Ile Val Asn Pro Ser Pro Tyr Lys Ala Tyr 355 360 365 Val Gln Ala Arg Gly Cys Val Leu Val Ala Ser Ser Pro Glu Ile Leu 370 375 380 Thr Arg Val Ser Lys Gly Lys Ile Ile Asn Arg Pro Leu Ala Gly Thr 385 390 395 400 Val Arg Arg Gly Lys Thr Glu Lys Glu Asp Gln Met Gln Glu Gln Gln 405 410 415 Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu His Ile Met Leu Val Asp 420 425 430 Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys Pro Gly Ser Val Lys 435 440 445 Val Glu Lys Leu Met Asn Ile Glu Arg Tyr Ser His Val Met His Ile 450 455 460 Ser Ser Thr Val Ser Gly Gln Leu Asp Asp His Leu Gln Ser Trp Asp 465 470 475 480 Ala Leu Arg Ala Ala Leu Pro Val Gly Thr Val Ser Gly Ala Pro Lys 485 490 495 Val Lys Ala Met Glu Leu Ile Asp Lys Leu Glu Val Thr Arg Arg Gly 500 505 510 Pro Tyr Ser Gly Gly Leu Gly Gly Ile Ser Phe Asp Gly Asp Met Gln 515 520 525 Ile Ala Leu Ser Leu Arg Thr Ile Val Phe Ser Thr Ala Pro Ser His 530 535 540 Asn Thr Met Tyr Ser Tyr Lys Asp Ala Asp Arg Arg Arg Glu Trp Val 545 550 555 560 Ala His Leu Gln Ala Gly Ala Gly Ile Val Ala Asp Ser Ser Pro Asp 565 570 575 Asp Glu Gln Arg Glu Cys Glu Asn Lys Ala Ala Ala Leu Ala Arg Ala 580 585 590 Ile Asp Leu Ala Glu Ser Ala Phe Val Asp Lys Glu 595 600 67 1815 DNA Artificial Sequence An Zea mays mutant. 67 atggaatccc tagccgccac ctccgtgttc gcgccctccc gcgtcgccgt cccggcggcg 60 cgggccctgg ttagggcggg gacggtggta ccaaccaggc ggacgagcag ccggagcgga 120 accagcgggg tgaaatgctc tgctgccgtg acgccgcagg cgagcccagt gattagcagg 180 agcgctgcgg cggcgaaggc ggcggaggag gacaagaggc ggttcttcga ggcggcggcg 240 cgggggagcg ggaaggggaa cctggtgccc atgtgggagt gcatcgtgtc ggaccatctc 300 acccccgtgc tcgcctaccg ctgcctcgtc cccgaggaca acgtcgacgc ccccagcttc 360 ctcttcgagt ccgtcgagca ggggccccag ggcaccacca acgtcggccg ctatagcatg 420 gtgggagccc acccagtgat ggagattgtg gccaaagacc acaaggttac gatcatggac 480 cacgagaaga gccaagtgac agagcaggta gtggacgacc cgatgcagat cccgaggacc 540 atgatggagg gatggcaccc acagcagatc gacgagctcc ctgaatcctt ctccggtgga 600 tgggttgggt tcttttccta tgatacggtt aggtatgttg agaagaagaa gctaccgttc 660 tccagtgctc ctcaggacga taggaacctt cctgatgtgc acttgggact ctatgatgat 720 gttctagtct tcgataatgt tgagaagaaa gtatatgtta tccattgggt caatgtggac 780 cggcatgcat ctgttgagga agcataccaa gatggcaggt cccgactaaa catgttgcta 840 tctaaagtgc acaattccaa tgtccccaca ctctctcctg gatttgtgaa gctgcacaca 900 cgcaagtttg gtacaccttt gaacaagtcg accatgacaa gtgatgagta taagaatgct 960 gttctgcagg ctaaggaaca tattatggct ggggatatct tccagattgt tttaagccag 1020 aggttcgaga gacgaacata tgccaaccca tttgaggttt atcgagcatt acggattgtg 1080 aatcctagcc catacaaggc gtatgtacag gcaagaggct gtgtattggt tgcgtctagt 1140 cctgaaattc ttacacgagt cagtaagggg aagattatta atcgaccact tgctggaact 1200 gttcgaaggg gcaagacaga gaaggaagat caaatgcaag agcagcaact gttaagtgat 1260 gaaaaacagt gtgccgagca cataatgctt gtggacttgg gaaggaatga tgttggcaag 1320 gtatccaaac caggatcagt gaaggtggag aagttgatga acattgagag atactcccat 1380 gttatgcaca tcagctcaac ggttagtgga cagttggatg atcatctcca gagttgggat 1440 gccttgagag ctgccttgcc cgttggaaca gtcagtggtg caccaaaggt gaaggccatg 1500 gagttgattg ataagttgga agttacgagg cgaggaccat atagtggtgg tctaggagga 1560 atatcgtttg atggtgacat gcaaattgca ctttctctcc gcaccatcgt attctcaaca 1620 gcgccgagcc acaacacgat gtactcatac aaagacgcag ataggcgtcg ggagtgggtc 1680 gctcatcttc aggctggtgc aggcattgtt gccgacagta gcccagatga cgaacaacgt 1740 gaatgcgaga ataaggctgc tgcactagct cgggccatcg atcttgcaga gtcagctttt 1800 gtagacaaag aatag 1815 68 2204 DNA Artificial Sequence An Zea mays mutant. 68 atggaatccc tagccgccac ctccgtgttc gcgccctccc gcgtcgccgt cccggcggcg 60 cgggccctgg ttagggcggg gacggtggta ccaaccaggc ggacgagcag ccggagcgga 120 accagcgggg tgaaatgctc tgctgccgtg acgccgcagg cgagcccagt gattagcagg 180 agcgctgcgg cggcgaaggc ggcggaggag gacaagaggc ggttcttcga ggcggcggcg 240 cgggggagcg ggaaggggaa cctggtgccc atgtgggagt gcatcgtgtc ggaccatctc 300 acccccgtgc tcgcctaccg ctgcctcgtc cccgaggaca acgtcgacgc ccccagcttc 360 ctcttcgagt ccgtcgagca ggggccccag ggcaccacca acgtcggccg ctatagcatg 420 gtgggagccc acccagtgat ggagattgtg gccaaagacc acaaggttac gatcatggac 480 cacgagaaga gccaagtgac agagcaggta gtggacgacc cgatgcagat cccgaggacc 540 atgatggagg gatggcaccc acagcagatc gacgagctcc ctgaatcctt ctccggtgga 600 tgggttgggt tcttttccta tgatacggtt aggtatgttg agaagaagaa gctaccgttc 660 tccagtgctc ctcaggacga taggaacctt cctgatgtgc acttgggact ctatgatgat 720 gttctagtct tcgataatgt tgagaagaaa gtatatgtta tccattgggt caatgtggac 780 cggcatgcat ctgttgagga agcataccaa gatggcaggt cccgactaaa catgttgcta 840 tctaaagtgc acaattccaa tgtccccaca ctctctcctg gatttgtgaa gctgcacaca 900 cgcaagtttg gtacaccttt gaacaagtcg accatgacaa gtgatgagta taagaatgct 960 gttctgcagg ctaaggaaca tattatggct ggggatatct tccagattgt tttaagccag 1020 aggttcgaga gacgaacata tgccaaccca tttgaggttt atcgagcatt acggattgtg 1080 aatcctagcc catacaaggc gtatgtacag gcaagaggct gtgtattggt tgcgtctagt 1140 cctgaaattc ttacacgagt cagtaagggg aagattatta atcgaccact tgctggaact 1200 gttcgaaggg gcaagacaga gaaggaagat caaatgcaag agcagcaact gttaagtgat 1260 gaaaaacagt gtgccgagca cataatgctt gtggacttgg gaaggaatga tgttggcaag 1320 gtatccaaac caggatcagt gaaggtggag aagttgatga acattgagag atactcccat 1380 gttatgcaca tcagctcaac ggttagtgga cagttggatg atcatctcca gagttgggat 1440 gccttgagag ctgccttgcc cgttggaaca gtcagtggtg caccaaaggt gaaggccatg 1500 gagttgattg ataagttgga agttacgagg cgaggaccat atagtggtgg tctaggagga 1560 atatcgtttg atggtgacat gcaaattgca ctttctctcc gcaccatcgt attctcaaca 1620 gcgccgagcc acaacacgat gtactcatac aaagacgcag ataggcgtcg ggagtgggtc 1680 gctcatcttc aggctggtgc aggcattgtt gccgacagta gcccagatga cgaacaacgt 1740 gaatgcgaga ataaggctgc tgcactagct cgggccatcg atcttgcaga gtcagctttt 1800 gtagacaaag aatagtgtgc tatggttatc gtttagttct tgttcatgtt tcttttaccc 1860 actttccgtt aaaaaaagat gtcattagtg ggtggagaaa agcaataaga ctgttctcta 1920 gaattcgagc tcggtaccgg atccaattcc cgatcgttca aacatttggc aataaagttt 1980 cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta 2040 cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat 2100 gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa 2160 ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatc 2204 69 729 PRT Artificial Sequence An A. tumefaciens mutant. 69 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Lys Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 70 729 PRT Artificial Sequence An A. tumefaciens mutant. 70 Met Val Thr Ile Ile Gln Asp Asp Gly Ala Glu Thr Tyr Glu Thr Lys 1 5 10 15 Gly Gly Ile Gln Val Ser Arg Lys Arg Arg Pro Thr Asp Tyr Ala Asn 20 25 30 Ala Ile Asp Asn Tyr Ile Glu Lys Leu Asp Ser His Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Leu Gly Ile Ser Cys Phe Gly Arg Lys Met 65 70 75 80 Trp Ile Glu Ala Tyr Asn Gly Arg Gly Glu Val Leu Leu Asp Phe Ile 85 90 95 Thr Glu Lys Leu Lys Ala Thr Pro Asp Leu Thr Leu Gly Ala Ser Ser 100 105 110 Thr Arg Arg Leu Asp Leu Thr Val Asn Glu Pro Asp Arg Val Phe Thr 115 120 125 Glu Glu Glu Arg Ser Lys Ile Pro Thr Val Phe Thr Ala Leu Arg Ala 130 135 140 Ile Val Asp Leu Phe Tyr Ser Ser Ala Asp Ser Ala Ile Gly Leu Phe 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Ala Ile Lys Leu 165 170 175 Ser Leu Ala Arg Pro Glu Asp Gln Arg Asp Met Val Leu Phe Leu Pro 180 185 190 Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys Ala Trp Ile Asp 195 200 205 Arg Tyr Asp Phe Glu Lys Asp Gly Met Thr Thr Asp Gly Lys Ser Ser 210 215 220 Asp Ile Thr Pro Asp Pro Phe Lys Thr Thr Asp Thr Ile Pro Pro Lys 225 230 235 240 Gly Asp His Arg Pro Gly Glu Tyr Ser Glu Leu Val Val Lys Ala Lys 245 250 255 Glu Ser Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Lys 260 265 270 Phe Met Glu Arg Cys Glu Ser Asn Pro Ser Ala Ile Ser Arg Arg Leu 275 280 285 Lys Ala Ile Asn Pro Ser Pro Tyr Ser Ala Phe Ile Asn Leu Gly Asp 290 295 300 Gln Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Ser 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Asp Asp Pro Ile Ala Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Asp Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Ile Glu Gly His Glu Lys Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Val Gly Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu Val Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Asn Asp Ser Asn Pro Gln Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ser Ala Ile Arg Asp Ala Lys Gly 500 505 510 Thr Asn Ser Ala Ala Thr Lys Arg Asp Ala Ala Lys Val Gly Thr Gly 515 520 525 Val Lys Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Thr Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Ala Asp Val Phe Asp Arg Phe Gln Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Thr Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Lys Ala Ala Arg Ala Arg Asp Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu Leu Arg Gln Leu 610 615 620 Ala Val Pro Met His Gly Lys Pro Ser Arg Ile Arg Val Leu Glu Pro 625 630 635 640 Gly Leu Val Phe Ser Gly Leu Gly Lys Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Ala Thr Leu Pro Arg Asp Phe Ile Ile 660 665 670 Thr Ala Glu Ser Glu Asp Gly Thr Ile Met Gly Ile Glu His Ala Lys 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly Gln Asp Ala Gly Met Arg Met Ile Glu Asn Val Val Val His Leu 705 710 715 720 Thr Arg Lys Ala Lys Thr Lys Ala Ala 725 71 264 DNA Artificial Sequence The sequence of a CTP. 71 atggcttcct ctatgctctc ttccgctact atggttgcct ctccggctca ggccactatg 60 gtcgctcctt tcaacggact taagtcctcc gctgccttcc cagccacccg caaggctaac 120 aacgacatta cttccatcac aagcaacggc ggaagagtta actgcatgca ggtgtggcct 180 ccgattggaa agaagaagtt tgagactctc tcttaccttc ctgaccttac cgattccggt 240 ggtcgcgtca actgcatgca ggcc 264 72 88 PRT Artificial Sequence The sequence of a CTP. 72 Met Ala Ser Ser Met Leu Ser Ser Ala Thr Met Val Ala Ser Pro Ala 1 5 10 15 Gln Ala Thr Met Val Ala Pro Phe Asn Gly Leu Lys Ser Ser Ala Ala 20 25 30 Phe Pro Ala Thr Arg Lys Ala Asn Asn Asp Ile Thr Ser Ile Thr Ser 35 40 45 Asn Gly Gly Arg Val Asn Cys Met Gln Val Trp Pro Pro Ile Gly Lys 50 55 60 Lys Lys Phe Glu Thr Leu Ser Tyr Leu Pro Asp Leu Thr Asp Ser Gly 65 70 75 80 Gly Arg Val Asn Cys Met Gln Ala 85 73 264 DNA Artificial Sequence The sequence of a CTP. 73 atggcttcct ctatgctctc ttccgctact atggttgcct ctccggctca ggccactatg 60 gtcgctcctt tcaacggact taagtcctcc gctgccttcc cagccacccg caaggctaac 120 aacgacatta cttccatcac aagcaacggc ggaagagtta actgcatgca ggtgtggcct 180 ccgattgaaa agaagaagtt tgagactctc tcttaccttc ctgaccttac cgattccggt 240 ggtcgcgtca actgcatgca ggcc 264 74 88 PRT Artificial Sequence The sequence of a CTP. 74 Met Ala Ser Ser Met Leu Ser Ser Ala Thr Met Val Ala Ser Pro Ala 1 5 10 15 Gln Ala Thr Met Val Ala Pro Phe Asn Gly Leu Lys Ser Ser Ala Ala 20 25 30 Phe Pro Ala Thr Arg Lys Ala Asn Asn Asp Ile Thr Ser Ile Thr Ser 35 40 45 Asn Gly Gly Arg Val Asn Cys Met Gln Val Trp Pro Pro Ile Glu Lys 50 55 60 Lys Lys Phe Glu Thr Leu Ser Tyr Leu Pro Asp Leu Thr Asp Ser Gly 65 70 75 80 Gly Arg Val Asn Cys Met Gln Ala 85 75 2190 DNA Artificial Sequence An optimized A. tumefaciens. 75 atggtgacca tcattcagga tgacggtgcc gagacctacg agaccaaggg cggcatccag 60 gtgagccgca agcgccgccc caccgattac gccaacgcca tcgataacta catcgaaaag 120 cttgattccc atcgcggtgc cgtgttctcc tccaactacg aatacccagg ccgctacacc 180 cgctgggata ccgccatcgt cgatccacca ctcggcattt cctgcttcgg ccgcaagatg 240 tggatcgaag cctacaacgg ccgcggcgaa gtgctgctcg atttcattac cgaaaagctg 300 aaggccacac ccgatctcac cctcggcgct tcctccaccc gccgcctcga tcttaccgtc 360 aacgaaccag accgcgtctt caccgaagaa gaacgctcca aaatcccaac cgtcttcacc 420 gctctcaggg ccatcgtcga cctcttctac tccagcgccg attccgccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcca tcaagctttc cctggcccgc 540 ccagaagacc agcgcgacat ggtgctgttc ctgcccgatg aaatcctcgt cgttgatcac 600 tactccgcca aggcctggat cgaccgctac gatttcgaga aggacggcat gaccaccgac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccacccaag 720 ggcgatcacc gccccggcga atactccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgctg cgaaagcaac 840 ccatccgcca tttcccgccg cctgaaggcc atcaacccat ccccctactc cttcttcatc 900 aacctcggcg atcaggaata cctggtcggc gcctccccag aaatgttcgt gcgcgtctcc 960 ggccgccgca tcgagacctg cccaatctca ggcaccatca agcgcggcga cgatccaatt 1020 gccgacagcg agcagatttt gaaactgctc aactccaaaa aggacgaatc cgaactgacc 1080 atgtgctccg acgtggaccg caacgacaag agccgcgtct gcgagccagg ttccgtgaag 1140 gtcattggcc gccgccagat cgagatgtac tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc ttcgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccacgcg cctggtacgg cggtgccatc ggcatggtcg gcttcaacgg cgacatgaac 1380 accggcctga ccctgcgcac catccgcatc aaggacggta ttgccgaagt gcgcgccggc 1440 gccaccctgc tcaacgattc caacccacag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tctcagccat tcgcgacgca aaaggcacca actctgccgc caccaagcgc 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacaccc tggccaacta cttccgccag accggcgcca ccgtctccac cgtcaggtca 1680 ccagtcgcag ccgacgtgtt cgatcgcttc cagccagacc tcgttgtcct gtcccccggt 1740 cccggcagcc caaccgattt cgactgcaag gcaaccatca aggccgcccg cgcccgcgat 1800 ctgccaatct tcggcgtttg cctcggtctg caggcattgg cagaagccta cggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttccc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcaccgtcg gtcgctacca ttccatcttc 1980 gccgatcccg ccaccctgcc acgcgatttc atcatcaccg cagaaagcga ggacggcacc 2040 atcatgggca tcgaacacgc caaggaacca gtggccgccg ttcagttcca cccagaatcc 2100 atcatgaccc tcggtcagga cgccggcatg cgcatgatcg agaacgtcgt ggtgcatctg 2160 acccgcaagg ccaagaccaa ggccgcctga 2190 76 2160 DNA Rhodopseudomonas palustris 76 atgaacagga ccgttttctc gcttcccgcg accagcgact ataagaccgc cgcgggcctc 60 gcggtgacgc gcagcgccca gccttttgcc ggcggccagg cgctcgacga gctgatcgat 120 ctgctcgacc accgccgcgg cgtgatgctg tcgtccggca caaccgtgcc gggccgctac 180 gagagcttcg acctcggctt tgccgatccg ccgctggcgc tcaccactag ggccgaaaaa 240 ttcaccatcg aggcgctcaa tccgcgcggc cgggtgctga tcgcgttcct gtccgacaag 300 cttgaagagc cctgcgtggt ggtggagcag gcctgcgcca ccaagatcag gggccacatc 360 gtccgcggcg aggccccggt cgacgaagaa caacgcaccc gccgcgccag cgcgatctcc 420 ctggtgcgcg cggtgattgc tgccttcgcc tcgccggccg atccgatgct cgggctgtac 480 ggcgccttcg cctacgacct tgtgttccag ttcgaggatc tgaagcagaa gcgtgcccgc 540 gaagccgacc agcgcgacat cgtgctgtac gtgccggatc gcctgctggc ctacgatcgc 600 gccaccggcc gcggcgtcga catttcctac gaattcgcct ggaagggcca gtccaccgcc 660 ggcctgccga acgagaccgc cgagagcgtc tacacccaga ccggccggca gggtttcgcc 720 gaccacgccc cgggcgacta tcccaaggtg gtcgagaagg cccgcgcggc gttcgcccgc 780 ggcgacctgt tcgaggcggt gccgggccag ctgttcggcg agccatgcga gcggtcgccg 840 gccgaagtgt tcaagcggtt gtgccggatc aacccgtcgc cctatggcgg cctgctcaat 900 ctcggcgacg gcgaattcct ggtgtcggcc tcgccggaaa tgttcgtccg ctcggacggc 960 cgccggatcg agacctgccc gatctccggc actatcgccc gcggcgtcga tgcgatcagc 1020 gatgctgagc agatccagaa gctcttgaac tccgagaagg acgagttcga gctgaatatg 1080 tgcaccgacg tcgaccgcaa cgacaaggcg cgggtctgcg tgccgggcac gatcaaagtt 1140 ctcgcgcgcc gccagatcga gacctattcg aagctgttcc acaccgtcga tcacgtcgag 1200 ggcatgctgc gaccgggttt cgacgcgctc gacgccttcc tcacccacgc ctgggcggtc 1260 accgtcaccg gcgcgccgaa gctgtgggcg atgcagttcg tcgaggatca cgagcgtagc 1320 ccgcggcgct ggtatgccgg cgcgttcggc gtggtcggct tcgatggctc gatcaacacc 1380 ggcctcacca tccgcaccat ccggatgaag gacggcctcg ccgaagttcg cgtcggcgcc 1440 acctgcctgt tcgacagcaa tccggtcgcc gaggacaagg aatgccaggt caaggccgcg 1500 gcactgttcc aggcgctgcg cggcgatccc gccaagccgc tgtcggcggt ggcgccggac 1560 gccactggct cgggcaagaa ggtgctgctg gtcgaccacg acgacagctt cgtgcacatg 1620 ctggcggact atttcaggca ggtcggcgcc caggtcaccg tggtgcgcta cgttcacggc 1680 ctgaagatgc tggccgaaaa cagctatgat cttctggtgc tgtcgcccgg tcccggccgg 1740 ccggaggact tcaagatcaa ggatacgatc gacgccgcgc tcgccaagaa gctgccgatc 1800 ttcggcgtct gcctcggcgt ccaggcgatg ggcgaatatt ttggcggtac gctcggccag 1860 ctcgcgcagc cggctcacgg ccgcccgtcg cggattcagg tgcgcggcgg cgcgctgatg 1920 cgcggtctcc cgaacgaggt caccatcggc cgctaccact cgctctatgt cgacatgcgc 1980 gacatgccga aggagctgac cgtcaccgcc tccaccgatg acggcatcgc gatggcgatc 2040 gagcacaaga ccctgccggt cggcggcgtg cagttccacc ccgagtcgct gatgtcgctc 2100 ggcggcgagg tcgggctgcg gatcgtcgaa aacgccttcc ggctcggcca ggcggcctaa 2160 77 733 PRT Mesorhizobium loti 77 Met Glu Thr Ala Met Thr Met Lys Val Leu Glu Asn Gly Ala Glu Ser 1 5 10 15 Phe Val Thr Ala Gly Gly Ile Thr Ile Thr Arg Glu Arg His Asp Arg 20 25 30 Pro Tyr Ala Gly Ala Ile Asp Ala Tyr Val Asp Gly Leu Asn Ser Arg 35 40 45 Arg Gly Ala Val Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr 50 55 60 Arg Trp Asp Thr Ala Ile Ile Asp Pro Pro Leu Val Ile Ser Ala Arg 65 70 75 80 Gly Arg Ala Met Arg Ile Glu Ala Leu Asn Arg Arg Gly Glu Ala Leu 85 90 95 Leu Pro Val Ile Gly Lys Thr Leu Gly Gly Leu Ala Asp Ile Thr Ile 100 105 110 Ala Glu Thr Thr Lys Thr Leu Ile Arg Leu Asp Val Ala Lys Pro Gly 115 120 125 Arg Val Phe Thr Glu Glu Glu Arg Ser Arg Val Pro Ser Val Phe Thr 130 135 140 Val Leu Arg Ala Ile Thr Ala Leu Phe Lys Thr Asp Glu Asp Ala Asn 145 150 155 160 Leu Gly Leu Tyr Gly Ala Phe Gly Tyr Asp Leu Ser Phe Gln Phe Asp 165 170 175 Pro Val Asp Tyr Lys Leu Glu Arg Lys Pro Ser Gln Arg Asp Leu Val 180 185 190 Leu Phe Leu Pro Asp Glu Ile Leu Val Val Asp His Tyr Ser Ala Lys 195 200 205 Ala Trp Thr Asp Arg Tyr Asp Tyr Ser Gly Glu Gly Phe Ser Thr Glu 210 215 220 Gly Leu Pro Arg Asp Ala Ile Ala Glu Pro Phe Lys Thr Ala Asp Arg 225 230 235 240 Ile Pro Pro Arg Gly Asp His Glu Pro Gly Glu Tyr Ala Asn Leu Val 245 250 255 Arg Arg Ala Met Asp Ser Phe Lys Arg Gly Asp Leu Phe Glu Val Val 260 265 270 Pro Gly Gln Met Phe Tyr Glu Arg Cys Glu Thr Gln Pro Ser Asp Ile 275 280 285 Ser Arg Lys Leu Lys Ser Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile 290 295 300 Asn Leu Gly Glu Asn Glu Tyr Leu Ile Gly Ala Ser Pro Glu Met Phe 305 310 315 320 Val Arg Val Asn Gly Arg Arg Val Glu Thr Cys Pro Ile Ser Gly Thr 325 330 335 Ile Lys Arg Gly Asp Asp Ala Ile Ser Asp Ser Glu Gln Ile Leu Lys 340 345 350 Leu Leu Asn Ser Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp 355 360 365 Val Asp Arg Asn Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Arg 370 375 380 Val Ile Gly Arg Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr 385 390 395 400 Val Asp His Ile Glu Gly Arg Leu Arg Glu Gly Met Asp Ala Phe Asp 405 410 415 Ala Phe Leu Ser His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys 420 425 430 Leu Trp Ala Met Arg Phe Ile Glu Gln Asn Glu Lys Ser Pro Arg Ala 435 440 445 Trp Tyr Gly Gly Ala Ile Gly Met Val Asn Phe Asn Gly Asp Met Asn 450 455 460 Thr Gly Leu Thr Leu Arg Thr Ile Arg Ile Lys Asp Gly Ile Ala Glu 465 470 475 480 Val Arg Ala Gly Ala Thr Leu Leu Phe Asp Ser Ile Pro Glu Glu Glu 485 490 495 Glu Ala Glu Thr Glu Leu Lys Ala Ser Ala Met Leu Ser Ala Ile Arg 500 505 510 Asp Ala Lys Thr Gly Asn Ser Ala Ser Thr Glu Arg Thr Thr Ala Arg 515 520 525 Val Gly Asp Gly Val Asn Ile Leu Leu Val Asp His Glu Asp Ser Phe 530 535 540 Val His Thr Leu Ala Asn Tyr Phe Arg Gln Thr Gly Ala Asn Val Ser 545 550 555 560 Thr Val Arg Thr Pro Val Pro Asp Glu Val Phe Glu Arg Leu Lys Pro 565 570 575 Asp Leu Val Val Leu Ser Pro Gly Pro Gly Thr Pro Lys Asp Phe Asp 580 585 590 Cys Ala Ala Thr Ile Arg Arg Ala Arg Ala Arg Asp Leu Pro Ile Phe 595 600 605 Gly Val Cys Leu Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Glu 610 615 620 Leu Arg Gln Leu His Ile Pro Met His Gly Lys Pro Ser Arg Ile Arg 625 630 635 640 Val Ser Lys Pro Gly Ile Ile Phe Ser Gly Leu Pro Lys Glu Val Thr 645 650 655 Val Gly Arg Tyr His Ser Ile Phe Ala Asp Pro Val Arg Leu Pro Asp 660 665 670 Asp Phe Ile Val Thr Ala Glu Thr Glu Asp Gly Ile Ile Met Ala Phe 675 680 685 Glu His Arg Lys Glu Pro Ile Ala Ala Val Gln Phe His Pro Glu Ser 690 695 700 Ile Met Thr Leu Gly His Asn Ala Gly Met Arg Ile Ile Glu Asn Ile 705 710 715 720 Val Ala His Leu Pro Arg Lys Ala Lys Glu Lys Ala Ala 725 730 78 732 PRT Azospirillum brasilense 78 Met Tyr Pro Ala Asp Leu Leu Ala Ser Pro Asp Leu Leu Glu Pro Leu 1 5 10 15 Arg Phe Gln Thr Arg Gly Gly Val Thr Val Thr Arg Arg Ala Thr Ala 20 25 30 Leu Asp Pro Arg Thr Ala Leu Asp Pro Val Ile Asp Ala Leu Asp Arg 35 40 45 Arg Arg Gly Leu Leu Leu Ser Ser Gly Val Glu Ala Pro Gly Arg Tyr 50 55 60 Arg Arg His Ala Leu Gly Phe Thr Asp Pro Ala Val Ala Leu Thr Ala 65 70 75 80 Arg Gly Arg Thr Leu Arg Ile Asp Ala Leu Asn Gly Arg Gly Gln Val 85 90 95 Leu Leu Pro Ala Val Ala Glu Ala Leu Arg Gly Leu Glu Ala Leu Ala 100 105 110 Gly Leu Glu Glu Ala Pro Ser Arg Val Thr Ala Ser Ser Ala Ser Pro 115 120 125 Ala Pro Leu Pro Gly Glu Glu Arg Ser Arg Gln Pro Ser Val Phe Ser 130 135 140 Val Leu Arg Ala Val Leu Asp Leu Phe Ala Ala Pro Asp Asp Pro Leu 145 150 155 160 Leu Gly Leu Tyr Gly Ala Phe Ala Tyr Asp Leu Ala Phe Gln Phe Glu 165 170 175 Pro Ile Arg Gln Arg Leu Glu Arg Pro Asp Asp Gln Arg Asp Leu Leu 180 185 190 Leu Tyr Leu Pro Asp Arg Leu Val Ala Leu Asp Pro Ile Ala Gly Leu 195 200 205 Ala Arg Leu Val Ala Tyr Glu Phe Ile Thr Ala Ala Gly Ser Thr Glu 210 215 220 Gly Leu Glu Cys Gly Gly Arg Asp His Pro Tyr Arg Pro Asp Thr Asn 225 230 235 240 Ala Glu Ala Gly Cys Asp His Ala Pro Gly Asp Tyr Gln Arg Val Val 245 250 255 Glu Ser Ala Lys Ala Ala Phe Arg Arg Gly Asp Leu Phe Glu Val Val 260 265 270 Pro Gly Gln Thr Phe Ala Glu Pro Cys Ala Asp Ala Pro Ser Ser Val 275 280 285 Phe Arg Arg Leu Arg Ala Ala Asn Pro Ala Pro Tyr Glu Ala Phe Val 290 295 300 Asn Leu Gly Arg Gly Glu Phe Leu Val Ala Ala Ser Pro Glu Met Tyr 305 310 315 320 Val Arg Val Ala Gly Gly Arg Val Glu Thr Cys Pro Ile Ser Gly Thr 325 330 335 Val Ala Arg Gly Ala Asp Ala Leu Gly Asp Ala Ala Gln Val Leu Arg 340 345 350 Leu Leu Thr Ser Ala Lys Asp Ala Ala Glu Leu Thr Met Cys Thr Asp 355 360 365 Val Asp Arg Asn Asp Lys Ala Arg Val Cys Glu Pro Gly Ser Val Arg 370 375 380 Val Ile Gly Arg Arg Met Ile Glu Leu Tyr Ser Arg Leu Ile His Thr 385 390 395 400 Val Asp His Val Glu Gly Arg Leu Arg Ser Gly Met Asp Ala Leu Asp 405 410 415 Ala Phe Leu Thr His Ser Trp Ala Val Thr Val Thr Gly Ala Pro Lys 420 425 430 Arg Trp Ala Met Gln Phe Leu Glu Asp Thr Glu Gln Ser Pro Arg Arg 435 440 445 Trp Tyr Gly Gly Ala Phe Gly Arg Leu Gly Phe Asp Gly Gly Met Asp 450 455 460 Thr Gly Leu Thr Leu Arg Thr Ile Arg Met Ala Glu Gly Val Ala Tyr 465 470 475 480 Val Arg Ala Gly Ala Thr Leu Leu Ser Asp Ser Asp Pro Asp Ala Glu 485 490 495 Asp Ala Glu Cys Arg Leu Lys Ala Ala Ala Phe Arg Asp Ala Ile Arg 500 505 510 Gly Thr Ala Ala Gly Ala Ala Pro Thr Leu Pro Ala Ala Pro Arg Gly 515 520 525 Gly Glu Gly Arg Arg Val Leu Leu Val Asp His Asp Asp Ser Phe Val 530 535 540 His Thr Leu Ala Asp Tyr Leu Arg Gln Thr Gly Ala Ser Val Thr Thr 545 550 555 560 Leu Arg His Ser His Ala Arg Ala Ala Leu Ala Glu Arg Arg Pro Asp 565 570 575 Leu Val Val Leu Ser Pro Gly Pro Gly Arg Pro Ala Asp Phe Asp Val 580 585 590 Ala Gly Thr Ile Asp Ala Ala Leu Ala Leu Gly Leu Pro Val Phe Gly 595 600 605 Val Cys Leu Gly Leu Gln Gly Met Val Glu Arg Phe Gly Gly Ala Leu 610 615 620 Asp Val Leu Pro Glu Pro Val His Gly Lys Ala Thr Glu Val Arg Val 625 630 635 640 Leu Gly Gly Ala Leu Phe Ala Gly Leu Pro Glu Arg Leu Thr Val Gly 645 650 655 Arg Tyr His Ser Leu Val Ala Arg Arg Asp Arg Leu Pro Ala Asp Leu 660 665 670 Thr Val Thr Ala Glu Thr Ala Asp Gly Leu Val Met Ala Val Glu His 675 680 685 Arg Arg Leu Pro Leu Ala Ala Val Gln Phe His Pro Glu Ser Ile Leu 690 695 700 Ser Leu Asp Gly Gly Ala Gly Leu Ala Leu Leu Gly Asn Val Met Asp 705 710 715 720 Arg Leu Ala Ala Gly Ala Leu Thr Asp Ala Ala Ala 725 730 79 731 PRT Brucella melitensis 79 Met Asn Ala Lys Thr Ala Asp Ser Glu Ile Phe Gln His Glu Thr Ala 1 5 10 15 Gly Gly Ile Ile Val Glu Arg Val Arg His Leu Thr Ala Tyr Lys Gly 20 25 30 Ala Ile Glu Ser Tyr Ile Asp Val Leu Asn Glu Trp Arg Gly Ala Val 35 40 45 Phe Ser Ser Asn Tyr Glu Tyr Pro Gly Arg Tyr Thr Arg Trp Asp Thr 50 55 60 Ala Ile Val Asp Pro Pro Val Val Ile Thr Ser Arg Ala Arg Thr Met 65 70 75 80 Arg Ile Glu Ala Leu Asn Ala Arg Gly Val Ile Leu Leu Arg Pro Ile 85 90 95 Leu Asp Thr Val Lys Ala Leu Ser Glu Val Lys Ile Asp Gln Ser Gly 100 105 110 Glu Asn Arg Ile Asp Leu Thr Ile Val Glu Pro Val Gly Thr Phe Thr 115 120 125 Glu Glu Glu Arg Ser Arg Met Pro Ser Val Phe Thr Val Leu Arg Ala 130 135 140 Ile Val Gly Leu Phe Phe Ser Glu Glu Asp Ala Asn Leu Gly Leu Tyr 145 150 155 160 Gly Ala Phe Gly Tyr Asp Leu Ala Phe Gln Phe Asp Pro Ile Gln Tyr 165 170 175 Lys Leu Lys Arg Pro Asp Asp Gln Arg Asp Leu Val Leu Phe Ile Pro 180 185 190 Asp Glu Ile Phe Val Ala Asp His Tyr Ala Ala Arg Ala Trp Val Asp 195 200 205 Arg Tyr Glu Phe Arg Cys Gly Gly Ser Ser Thr His Gly Leu Asp Arg 210 215 220 Ala Thr Pro Val Val Pro Phe Lys Pro Ser Glu Arg Lys Leu Ala Arg 225 230 235 240 Gly Asp His Asn Pro Gly Glu Tyr Ala Arg Leu Val Glu Arg Ala Lys 245 250 255 Glu Ser Phe Lys Arg Gly Asp Leu Phe Glu Val Val Pro Gly Gln Thr 260 265 270 Phe Tyr Glu Arg Cys His Thr Ala Pro Ser Glu Ile Phe Arg Arg Leu 275 280 285 Lys Ser Ile Asn Pro Ser Pro Tyr Ser Phe Phe Ile Asn Leu Gly Glu 290 295 300 Ser Glu Tyr Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Asn 305 310 315 320 Gly Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys Arg Gly 325 330 335 Glu Asp Ala Ile Ser Asp Ser Glu Gln Ile Leu Lys Leu Leu Asn Ser 340 345 350 Lys Lys Asp Glu Ser Glu Leu Thr Met Cys Ser Asp Val Asp Arg Asn 355 360 365 Asp Lys Ser Arg Val Cys Glu Pro Gly Ser Val Arg Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp His Ile 385 390 395 400 Glu Gly Arg Leu Arg Asp Gly Met Asp Ala Phe Asp Gly Phe Leu Ser 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Arg Phe Leu Glu Glu Asn Glu Arg Ser Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Met Met His Phe Asn Gly Asp Met Asn Thr Gly Leu Thr 450 455 460 Leu Arg Thr Ile Arg Ile Lys Asp Gly Val Ala Glu Ile Arg Ala Gly 465 470 475 480 Ala Thr Leu Leu Phe Asp Ser Asn Pro Asp Glu Glu Glu Ala Glu Thr 485 490 495 Glu Leu Lys Ala Ser Ala Met Ile Ala Ala Val Arg Asp Ala Gln Lys 500 505 510 Ser Asn Gln Ile Ala Glu Glu Ser Val Ala Ala Lys Val Gly Glu Gly 515 520 525 Val Ser Ile Leu Leu Val Asp His Glu Asp Ser Phe Val His Thr Leu 530 535 540 Ala Asn Tyr Phe Arg Gln Thr Gly Ala Lys Val Ser Thr Val Arg Ser 545 550 555 560 Pro Val Ala Glu Glu Ile Phe Asp Arg Val Asn Pro Asp Leu Val Val 565 570 575 Leu Ser Pro Gly Pro Gly Ser Pro Gln Asp Phe Asp Cys Lys Ala Thr 580 585 590 Ile Asp Lys Ala Arg Lys Arg Gln Leu Pro Ile Phe Gly Val Cys Leu 595 600 605 Gly Leu Gln Ala Leu Ala Glu Ala Tyr Gly Gly Ala Leu Arg Gln Leu 610 615 620 Arg Val Pro Val His Gly Lys Pro Ser Arg Ile Arg Val Ser Lys Pro 625 630 635 640 Glu Arg Ile Phe Ser Gly Leu Pro Glu Glu Val Thr Val Gly Arg Tyr 645 650 655 His Ser Ile Phe Ala Asp Pro Glu Arg Leu Pro Asp Asp Phe Leu Val 660 665 670 Thr Ala Glu Thr Glu Asp Gly Ile Ile Met Ala Phe Glu His Lys His 675 680 685 Glu Pro Val Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr Leu 690 695 700 Gly His Asn Ala Gly Met Arg Met Ile Glu Asn Ile Val Thr His Leu 705 710 715 720 Ala Gly Lys His Lys Ala Arg Arg Thr Asn Tyr 725 730 80 735 PRT Nostoc sp. 80 Met Ile Ala Asp Ser His Ser Tyr Arg Thr Asn Gly Asn Val Arg Val 1 5 10 15 Ser Arg Ser Ile Thr Gln Val Lys Met Glu Thr Ala Leu Glu Glu Ile 20 25 30 Leu Phe Tyr Leu Asn Ser Gln Arg Gly Gly Leu Leu Thr Ser Ser Tyr 35 40 45 Glu Tyr Pro Gly Arg Tyr Lys Arg Trp Ala Ile Gly Phe Val Asn Pro 50 55 60 Pro Val Glu Leu Ser Thr Ser Gly Asn Thr Phe Thr Leu Thr Ala Leu 65 70 75 80 Asn Glu Arg Gly Tyr Val Leu Leu Pro Val Ile Phe Glu Cys Leu Ser 85 90 95 Lys Ser Glu Gln Leu Gln Lys Leu Thr Glu His His His Lys Ile Thr 100 105 110 Gly Leu Val Lys Ser Thr Pro Glu Phe Phe Ala Glu Glu Glu Arg Ser 115 120 125 Lys Gln Pro Ser Thr Phe Thr Val Ile Arg Glu Ile Leu His Ile Phe 130 135 140 Ser Ser Gln Glu Asp Glu His Leu Gly Leu Tyr Gly Ala Phe Gly Tyr 145 150 155 160 Asp Leu Val Phe Gln Phe Glu Gln Ile Thr Gln Cys Leu Glu Arg Pro 165 170 175 Gln Asp Gln Arg Asp Leu Val Leu Tyr Leu Pro Asp Glu Leu Ile Val 180 185 190 Val Asp Tyr Tyr Gln Gln Gln Ala Phe Arg Leu Glu Tyr Asp Phe Ile 195 200 205 Thr Ala His Gly Ser Thr Tyr Asp Leu Pro Arg Thr Gly Glu Ser Val 210 215 220 Asp Tyr Arg Gly Gln Cys Leu Thr Pro Pro Gln Asn Ala Asp His Lys 225 230 235 240 Ile Gly Glu Tyr Ala Lys Leu Val Glu Phe Ala Leu Asp Tyr Phe Arg 245 250 255 Arg Gly Asp Leu Phe Glu Val Val Pro Ser Gln Asn Phe Phe Thr Ala 260 265 270 Cys Glu Ala Pro Pro Ser Gln Leu Phe Glu Thr Leu Lys Gln Ile Asn 275 280 285 Pro Ser Pro Tyr Gly Phe Ile Phe Asn Leu Gly Gly Glu Tyr Ile Ile 290 295 300 Gly Ala Ser Pro Glu Met Phe Val Arg Val Glu Gly Arg Arg Val Glu 305 310 315 320 Thr Cys Pro Ile Ser Gly Thr Ile Thr Arg Gly His Asp Ala Ile Asp 325 330 335 Asp Ala Val Gln Ile Arg Gln Leu Leu Asn Ser His Lys Asp Glu Ala 340 345 350 Glu Leu Thr Met Cys Thr Asp Val Asp Arg Asn Asp Lys Ser Arg Ile 355 360 365 Cys Glu Pro Gly Ser Val Lys Val Ile Gly Arg Arg Gln Ile Glu Leu 370 375 380 Tyr Ser His Leu Ile His Thr Val Asp His Val Glu Gly Ile Leu Arg 385 390 395 400 Pro Glu Phe Asp Ala Leu Asp Ala Phe Leu Ser His Thr Trp Ala Val 405 410 415 Thr Val Thr Gly Ala Pro Lys Arg Ala Ala Ile Gln Phe Ile Glu Lys 420 425 430 Asn Glu Arg Ser Val Arg Arg Trp Tyr Gly Gly Ala Val Gly Tyr Leu 435 440 445 Asn Phe Asn Gly Asn Leu Asn Thr Gly Leu Ile Leu Arg Thr Ile Arg 450 455 460 Leu Gln Asp Ser Ile Ala Glu Val Arg Val Gly Ala Thr Leu Leu Tyr 465 470 475 480 Asp Ser Ile Pro Gln Ala Glu Glu Gln Glu Thr Ile Thr Lys Ala Ala 485 490 495 Ala Ala Phe Glu Thr Ile Arg Arg Ala Lys Gln Ile Asp Pro Gln Ile 500 505 510 Glu Glu Ser Ser Thr Arg Lys Leu Ser Lys Tyr Leu Pro Asp Gly Gln 515 520 525 Ser Gly Lys His Ile Leu Leu Ile Asp His Glu Asp Ser Phe Val His 530 535 540 Thr Leu Ala Asn Tyr Ile Arg Ser Thr Gly Ala Thr Val Thr Thr Leu 545 550 555 560 Arg His Gly Phe Ser Glu Ser Leu Phe Asp Thr Glu Arg Pro Asp Leu 565 570 575 Val Val Leu Ser Pro Gly Pro Gly Arg Pro Ser Glu Phe Lys Val Gln 580 585 590 Glu Thr Val Ala Ala Cys Val Arg Arg Gln Ile Pro Leu Phe Gly Val 595 600 605 Cys Leu Gly Leu Gln Gly Ile Val Glu Ala Phe Gly Gly Glu Leu Gly 610 615 620 Val Leu Asn Tyr Pro Gln His Gly Lys Ser Ser Arg Ile Phe Val Thr 625 630 635 640 Ala Pro Asp Ser Val Met Phe Gln Asp Leu Pro Glu Ser Phe Thr Val 645 650 655 Gly Arg Tyr His Ser Leu Phe Ala Leu Ser Gln Arg Leu Pro Lys Glu 660 665 670 Leu Lys Val Thr Ala Ile Ser Asp Asp Glu Val Ile Met Ala Ile Glu 675 680 685 His Gln Thr Leu Pro Ile Ala Ala Val Gln Phe His Pro Glu Ser Ile 690 695 700 Met Thr Leu Ala Gly Glu Val Gly Leu Met Met Ile Lys Asn Val Val 705 710 715 720 Gln Lys Tyr Thr Gln Ser Gln Gln Ser Thr Val Pro Ile Tyr Asp 725 730 735 81 715 PRT Nostoc sp. 81 Met Arg Val Ser Arg Ser Thr Thr Glu Val Lys Met Asp Thr Ala Leu 1 5 10 15 Asp Glu Ile Leu Phe His Leu Asn Gln Val Arg Gly Gly Leu Leu Thr 20 25 30 Ser Ser Tyr Glu Tyr Pro Gly Arg Tyr Lys Arg Trp Ala Ile Gly Phe 35 40 45 Ile Asn Pro Pro Leu Gln Leu Thr Thr Arg Glu Asn Ala Phe Thr Ile 50 55 60 Ser Ser Leu Asn Pro Arg Gly Gln Val Leu Leu Pro Thr Leu Phe Gln 65 70 75 80 His Leu Ser Ala Gln Ser Gln Leu Gln Gln Ile Ser Leu Asn His Asp 85 90 95 Tyr Ile Thr Gly Glu Ile Arg Pro Thr Lys Gln Leu Phe Thr Glu Glu 100 105 110 Gln Arg Ser Lys Gln Pro Ser Ala Phe Thr Val Ile Arg Glu Ile Leu 115 120 125 Gln Ile Phe Ala Ser Asp Glu Asp Glu His Leu Gly Leu Tyr Gly Ala 130 135 140 Phe Gly Tyr Asp Leu Val Phe Gln Phe Glu Pro Ile Pro Gln Lys Ile 145 150 155 160 Ala Arg Pro Ala Asp Gln Arg Asp Leu Val Leu Tyr Leu Pro Asp Glu 165 170 175 Leu Ile Val Val Asp Tyr Tyr Leu Gln Lys Ala Tyr Arg His Gln Tyr 180 185 190 Glu Phe Ala Thr Glu His Gly Asn Thr Glu His Leu Pro Arg Thr Gly 195 200 205 Gln Ser Ile Asp Tyr Gln Gly Lys His Leu Leu Pro Asn Gln Thr Ala 210 215 220 Asp His Gln Pro Gly Glu Tyr Ala Asn Leu Val Glu Gln Ala Leu Asp 225 230 235 240 Tyr Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Ser Gln Asn Phe 245 250 255 Phe Thr Ala Cys Glu Gln Ser Pro Ser Gln Leu Phe Gln Thr Leu Arg 260 265 270 Gln Ile Asn Pro Ser Pro Tyr Gly Phe Leu Leu Asn Leu Gly Gly Glu 275 280 285 Tyr Leu Ile Gly Ala Ser Pro Glu Met Phe Val Arg Val Asp Gly Arg 290 295 300 Arg Val Glu Thr Cys Pro Ile Ser Gly Thr Ile Arg Arg Gly Glu Asp 305 310 315 320 Ala Leu Gly Asp Ala Val Gln Ile Arg Gln Leu Leu Asn Ser His Lys 325 330 335 Asp Glu Ala Glu Leu Thr Met Cys Thr Asp Val Asp Arg Asn Asp Lys 340 345 350 Ser Arg Ile Cys Glu Pro Gly Ser Val Arg Val Ile Gly Arg Arg Gln 355 360 365 Ile Glu Leu Tyr Ser His Leu Ile His Thr Val Asp His Val Glu Gly 370 375 380 Ile Leu Arg Pro Glu Phe Asp Ala Leu Asp Ala Phe Leu Ser His Thr 385 390 395 400 Trp Ala Val Thr Val Thr Gly Ala Pro Lys Arg Ala Ala Met Gln Phe 405 410 415 Ile Glu Gln His Glu Arg Ser Ala Arg Arg Trp Tyr Gly Gly Ala Val 420 425 430 Gly Tyr Leu Gly Phe Asn Gly Asn Leu Asn Thr Gly Leu Thr Leu Arg 435 440 445 Thr Ile Arg Leu Gln Asp Ser Ile Ala Glu Val Arg Val Gly Ala Thr 450 455 460 Val Leu Tyr Asp Ser Ile Pro Ser Ala Glu Glu Glu Glu Thr Ile Thr 465 470 475 480 Lys Ala Thr Ala Leu Phe Glu Thr Ile Arg Arg His Thr Thr Ala Asn 485 490 495 Lys Thr Gln Gly Asn Asp Ser His Arg Pro Gly Asp Ile Ala His Asn 500 505 510 Lys Arg Ile Leu Leu Ile Asp Tyr Glu Asp Ser Phe Val His Thr Leu 515 520 525 Ala Asn Tyr Ile Arg Thr Thr Gly Ala Thr Val Thr Thr Leu Arg His 530 535 540 Gly Phe Ala Glu Ser Tyr Phe Asp Ala Glu Arg Pro Asp Leu Val Val 545 550 555 560 Leu Ser Pro Gly Pro Gly Arg Pro Ser Asp Phe Arg Val Pro Gln Thr 565 570 575 Val Ala Ala Leu Val Gly Arg Glu Ile Pro Ile Phe Gly Val Cys Leu 580 585 590 Gly Leu Gln Gly Ile Val Glu Ala Phe Gly Gly Glu Leu Gly Val Leu 595 600 605 Asp Tyr Pro Gln His Gly Lys Pro Ala Arg Ile Ser Val Thr Ala Pro 610 615 620 Asp Ser Val Leu Phe Gln Asn Leu Pro Ala Ser Phe Ile Val Gly Arg 625 630 635 640 Tyr His Ser Leu Phe Ala Gln Pro Gln Thr Ile Pro Gly Glu Leu Lys 645 650 655 Val Thr Ala Ile Ser Glu Asp Asn Val Ile Met Ala Ile Glu His Gln 660 665 670 Thr Leu Pro Ile Ala Ala Val Gln Phe His Pro Glu Ser Ile Met Thr 675 680 685 Leu Ala Gly Glu Val Gly Gln Thr Ile Ile Lys Asn Val Val Gln Thr 690 695 700 Tyr Thr Gln Thr Leu Glu Thr Ser Ile Tyr Ser 705 710 715 82 719 PRT Rhodopseudomonas palustris 82 Met Asn Arg Thr Val Phe Ser Leu Pro Ala Thr Ser Asp Tyr Lys Thr 1 5 10 15 Ala Ala Gly Leu Ala Val Thr Arg Ser Ala Gln Pro Phe Ala Gly Gly 20 25 30 Gln Ala Leu Asp Glu Leu Ile Asp Leu Leu Asp His Arg Arg Gly Val 35 40 45 Met Leu Ser Ser Gly Thr Thr Val Pro Gly Arg Tyr Glu Ser Phe Asp 50 55 60 Leu Gly Phe Ala Asp Pro Pro Leu Ala Leu Thr Thr Arg Ala Glu Lys 65 70 75 80 Phe Thr Ile Glu Ala Leu Asn Pro Arg Gly Arg Val Leu Ile Ala Phe 85 90 95 Leu Ser Asp Lys Leu Glu Glu Pro Cys Val Val Val Glu Gln Ala Cys 100 105 110 Ala Thr Lys Ile Arg Gly His Ile Val Arg Gly Glu Ala Pro Val Asp 115 120 125 Glu Glu Gln Arg Thr Arg Arg Ala Ser Ala Ile Ser Leu Val Arg Ala 130 135 140 Val Ile Ala Ala Phe Ala Ser Pro Ala Asp Pro Met Leu Gly Leu Tyr 145 150 155 160 Gly Ala Phe Ala Tyr Asp Leu Val Phe Gln Phe Glu Asp Leu Lys Gln 165 170 175 Lys Arg Ala Arg Glu Ala Asp Gln Arg Asp Ile Val Leu Tyr Val Pro 180 185 190 Asp Arg Leu Leu Ala Tyr Asp Arg Ala Thr Gly Arg Gly Val Asp Ile 195 200 205 Ser Tyr Glu Phe Ala Trp Lys Gly Gln Ser Thr Ala Gly Leu Pro Asn 210 215 220 Glu Thr Ala Glu Ser Val Tyr Thr Gln Thr Gly Arg Gln Gly Phe Ala 225 230 235 240 Asp His Ala Pro Gly Asp Tyr Pro Lys Val Val Glu Lys Ala Arg Ala 245 250 255 Ala Phe Ala Arg Gly Asp Leu Phe Glu Ala Val Pro Gly Gln Leu Phe 260 265 270 Gly Glu Pro Cys Glu Arg Ser Pro Ala Glu Val Phe Lys Arg Leu Cys 275 280 285 Arg Ile Asn Pro Ser Pro Tyr Gly Gly Leu Leu Asn Leu Gly Asp Gly 290 295 300 Glu Phe Leu Val Ser Ala Ser Pro Glu Met Phe Val Arg Ser Asp Gly 305 310 315 320 Arg Arg Ile Glu Thr Cys Pro Ile Ser Gly Thr Ile Ala Arg Gly Val 325 330 335 Asp Ala Ile Ser Asp Ala Glu Gln Ile Gln Lys Leu Leu Asn Ser Glu 340 345 350 Lys Asp Glu Phe Glu Leu Asn Met Cys Thr Asp Val Asp Arg Asn Asp 355 360 365 Lys Ala Arg Val Cys Val Pro Gly Thr Ile Lys Val Leu Ala Arg Arg 370 375 380 Gln Ile Glu Thr Tyr Ser Lys Leu Phe His Thr Val Asp His Val Glu 385 390 395 400 Gly Met Leu Arg Pro Gly Phe Asp Ala Leu Asp Ala Phe Leu Thr His 405 410 415 Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met Gln 420 425 430 Phe Val Glu Asp His Glu Arg Ser Pro Arg Arg Trp Tyr Ala Gly Ala 435 440 445 Phe Gly Val Val Gly Phe Asp Gly Ser Ile Asn Thr Gly Leu Thr Ile 450 455 460 Arg Thr Ile Arg Met Lys Asp Gly Leu Ala Glu Val Arg Val Gly Ala 465 470 475 480 Thr Cys Leu Phe Asp Ser Asn Pro Val Ala Glu Asp Lys Glu Cys Gln 485 490 495 Val Lys Ala Ala Ala Leu Phe Gln Ala Leu Arg Gly Asp Pro Ala Lys 500 505 510 Pro Leu Ser Ala Val Ala Pro Asp Ala Thr Gly Ser Gly Lys Lys Val 515 520 525 Leu Leu Val Asp His Asp Asp Ser Phe Val His Met Leu Ala Asp Tyr 530 535 540 Phe Arg Gln Val Gly Ala Gln Val Thr Val Val Arg Tyr Val His Gly 545 550 555 560 Leu Lys Met Leu Ala Glu Asn Ser Tyr Asp Leu Leu Val Leu Ser Pro 565 570 575 Gly Pro Gly Arg Pro Glu Asp Phe Lys Ile Lys Asp Thr Ile Asp Ala 580 585 590 Ala Leu Ala Lys Lys Leu Pro Ile Phe Gly Val Cys Leu Gly Val Gln 595 600 605 Ala Met Gly Glu Tyr Phe Gly Gly Thr Leu Gly Gln Leu Ala Gln Pro 610 615 620 Ala His Gly Arg Pro Ser Arg Ile Gln Val Arg Gly Gly Ala Leu Met 625 630 635 640 Arg Gly Leu Pro Asn Glu Val Thr Ile Gly Arg Tyr His Ser Leu Tyr 645 650 655 Val Asp Met Arg Asp Met Pro Lys Glu Leu Thr Val Thr Ala Ser Thr 660 665 670 Asp Asp Gly Ile Ala Met Ala Ile Glu His Lys Thr Leu Pro Val Gly 675 680 685 Gly Val Gln Phe His Pro Glu Ser Leu Met Ser Leu Gly Gly Glu Val 690 695 700 Gly Leu Arg Ile Val Glu Asn Ala Phe Arg Leu Gly Gln Ala Ala 705 710 715 83 2160 DNA Rhodopseudomonas palustris 83 atgaacagga ccgttttctc gcttcccgcg accagcgact ataagaccgc cgcgggcctc 60 gcggtgacgc gcagcgccca gccttttgcc ggcggccagg cgctcgacga gctgatcgat 120 ctgctcgacc accgccgcgg cgtgatgctg tcgtccggca caaccgtgcc gggccgctac 180 gagagcttcg acctcggctt tgccgatccg ccgctggcgc tcaccactag ggccgaaaaa 240 ttcaccatcg aggcgctcaa tccgcgcggc cgggtgctga tcgcgttcct gtccgacaag 300 cttgaagagc cctgcgtggt ggtggagcag gcctgcgcca ccaagatcag gggccacatc 360 gtccgcggcg aggccccggt cgacgaagaa caacgcaccc gccgcgccag cgcgatctcc 420 ctggtgcgcg cggtgattgc tgccttcgcc tcgccggccg atccgatgct cgggctgtac 480 ggcgccttcg cctacgacct tgtgttccag ttcgaggatc tgaagcagaa gcgtgcccgc 540 gaagccgacc agcgcgacat cgtgctgtac gtgccggatc gcctgctggc ctacgatcgc 600 gccaccggcc gcggcgtcga catttcctac gaattcgcct ggaagggcca gtccaccgcc 660 ggcctgccga acgagaccgc cgagagcgtc tacacccaga ccggccggca gggtttcgcc 720 gaccacgccc cgggcgacta tcccaaggtg gtcgagaagg cccgcgcggc gttcgcccgc 780 ggcgacctgt tcgaggcggt gccgggccag ctgttcggcg agccatgcga gcggtcgccg 840 gccgaagtgt tcaagcggtt gtgccggatc aacccgtcgc cctatggcgg cctgctcaat 900 ctcggcgacg gcgaattcct ggtgtcggcc tcgccggaaa tgttcgtccg ctcggacggc 960 cgccggatcg agacctgccc gatctccggc actatcgccc gcggcgtcga tgcgatcagc 1020 gatgctgagc agatccagaa gctcttgaac tccgagaagg acgagttcga gctgaatatg 1080 tgcaccgacg tcgaccgcaa cgacaaggcg cgggtctgcg tgccgggcac gatcaaagtt 1140 ctcgcgcgcc gccagatcga gacctattcg aagctgttcc acaccgtcga tcacgtcgag 1200 ggcatgctgc gaccgggttt cgacgcgctc gacgccttcc tcacccacgc ctgggcggtc 1260 accgtcaccg gcgcgccgaa gctgtgggcg atgcagttcg tcgaggatca cgagcgtagc 1320 ccgcggcgct ggtatgccgg cgcgttcggc gtggtcggct tcgatggctc gatcaacacc 1380 ggcctcacca tccgcaccat ccggatgaag gacggcctcg ccgaagttcg cgtcggcgcc 1440 acctgcctgt tcgacagcaa tccggtcgcc gaggacaagg aatgccaggt caaggccgcg 1500 gcactgttcc aggcgctgcg cggcgatccc gccaagccgc tgtcggcggt ggcgccggac 1560 gccactggct cgggcaagaa ggtgctgctg gtcgaccacg acgacagctt cgtgcacatg 1620 ctggcggact atttcaggca ggtcggcgcc caggtcaccg tggtgcgcta cgttcacggc 1680 ctgaagatgc tggccgaaaa cagctatgat cttctggtgc tgtcgcccgg tcccggccgg 1740 ccggaggact tcaagatcaa ggatacgatc gacgccgcgc tcgccaagaa gctgccgatc 1800 ttcggcgtct gcctcggcgt ccaggcgatg ggcgaatatt ttggcggtac gctcggccag 1860 ctcgcgcagc cggctcacgg ccgcccgtcg cggattcagg tgcgcggcgg cgcgctgatg 1920 cgcggtctcc cgaacgaggt caccatcggc cgctaccact cgctctatgt cgacatgcgc 1980 gacatgccga aggagctgac cgtcaccgcc tccaccgatg acggcatcgc gatggcgatc 2040 gagcacaaga ccctgccggt cggcggcgtg cagttccacc ccgagtcgct gatgtcgctc 2100 ggcggcgagg tcgggctgcg gatcgtcgaa aacgccttcc ggctcggcca ggcggcctaa 2160 84 2190 DNA Artificial Sequence An A. tumefaciens mutant. 84 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc gtttttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 85 2190 DNA Artificial Sequence An A. tumefaciens mutant. 85 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc gtatttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 86 2190 DNA Artificial Sequence An A. tumefaciens mutant. 86 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg ttcaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 87 2190 DNA Artificial Sequence An A. tumefaciens mutant. 87 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tgcaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 88 2190 DNA Artificial Sequence An A. tumefaciens mutant. 88 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tccttctatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 89 2190 DNA Artificial Sequence An A. tumefaciens mutant. 89 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacgcgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 90 2190 DNA Artificial Sequence An A. tumefaciens mutant. 90 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacgggt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 91 2190 DNA Artificial Sequence An A. tumefaciens mutant. 91 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc ctggttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 92 2190 DNA Artificial Sequence An A. tumefaciens mutant. 92 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggtttttaag tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cttcttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 93 2190 DNA Artificial Sequence An A. tumefaciens mutant. 93 atggtaacga tcattcagga tgacggagcg gagacctacg agacgaaagg cggcatccag 60 gtcagccgaa agcgccggcc caccgattat gccaacgcca tcgataatta catcgaaaag 120 cttgattccc atcgcggcgc ggttttttcg tccaactatg aatatccggg ccgttacacc 180 cgctgggata cggccatcgt cgatccgccg ctcggcattt cctgttttgg ccgcaagatg 240 tggatcgaag cctataatgg ccgcggcgaa gtgctgctcg atttcattac ggaaaagctg 300 aaggcgacac ccgatctcac cctcggcgct tcctcgaccc gccggctcga tcttaccgtc 360 aacgaaccgg accgtgtctt caccgaagaa gaacgctcga aaatcccgac ggtcttcacc 420 gctctcagag ccatcgtcga cctcttctat tcgagcgcgg attcggccat cggcctgttc 480 ggtgccttcg gttacgatct cgccttccag ttcgacgcga tcaagctttc gctggcgcgt 540 ccggaagacc agcgtgacat ggtgctgttt ctgcccgatg aaatcctcgt cgttgatcac 600 tattccgcca aggcctggat cgaccgttac gatttcgaga aggacggcat gacgacggac 660 ggcaaatcct ccgacattac ccccgatccc ttcaagacca ccgataccat cccgcccaag 720 ggcgatcacc gtcccggcga atattccgag cttgtggtga aggccaagga aagcttccgc 780 cgcggcgacc tgttcgaggt cgttcccggc cagaaattca tggagcgttg cgaaagcaat 840 ccgtcggcga tttcccgccg cctgaaggcg atcaacccgt cgccctattc cgccttcatc 900 aatctcggcg atcaggaata tctggtcggc gcctcgccgg aaatgttcgt gcgcgtctcc 960 ggccgtcgca tcgagacctg cccgatatca ggcaccatca agcgcggcga cgatccgatt 1020 gccgacagcg agcagatttt gaaactgctc aactcgaaaa aggacgaatc cgaactgacc 1080 atgtgctcgg acgtggaccg caacgacaag agccgcgtct gcgagccggg ttcggtgaag 1140 gtcattggcc gccgccagat cgagatgtat tcacgcctca tccacaccgt cgatcacatc 1200 gaaggccgcc tgcgcgacga tatggacgcc tttgacggtt tcctcagcca cgcctgggcc 1260 gtcaccgtca ccggtgcacc aaagctgtgg gccatgcgct tcatcgaagg tcatgaaaag 1320 agcccgcgcg cctggtatgg cggtgcgatc ggcatggtcg gcttcaacgg cgacatgaat 1380 accggcctga cgctgcgcac catccggatc aaggacggta ttgccgaagt gcgcgccggc 1440 gcgaccctgc tcaatgattc caacccgcag gaagaagaag ccgaaaccga actgaaggcc 1500 tccgccatga tatcagccat tcgtgacgca aaaggcacca actctgccgc caccaagcgt 1560 gatgccgcca aagtcggcac cggcgtcaag atcctgctcg tcgaccacga agacagcttc 1620 gtgcacacgc tggcgaatta tttccgccag acgggcgcga cggtctcgac cgtcagatca 1680 ccggtcgcag ccgacgtgtt cgatcgcttc cagccggacc tcgttgtcct gtcgcccgga 1740 cccggcagcc cgacggattt cgactgcaag gcaacgatca aggccgcccg cgcccgcgat 1800 ctgccgatct tcggcgtttg cctcggtctg caggcattgg cagaagccta tggcggcgag 1860 ctgcgccagc ttgctgtgcc catgcacggc aagccttcgc gcatccgcgt gctggaaccc 1920 ggcctcgtct tctccggtct cggcaaggaa gtcacggtcg gtcgttacca ttcgatcttc 1980 gccgatcccg ccaccctgcc gcgtgatttc atcatcaccg cagaaagcga ggacggcacg 2040 atcatgggca tcgaacacgc caaggaaccg gtggccgccg ttcagttcca cccggaatcg 2100 atcatgacgc tcggacagga cgcgggcatg cggatgatcg agaatgtcgt ggtgcatctg 2160 acccgcaagg cgaagaccaa ggccgcgtga 2190 94 1821 DNA Oryza sativa 94 atggagtcca tcgccgccgc cacgttcacg ccctcgcgcc tcgccgcccg ccccgccact 60 ccggcggcgg cggcggcccc ggttagagcg agggcggcgg tagcggcagg agggaggagg 120 aggacgagta ggcgcggcgg cgtgaggtgc tccgcgggga agccagaggc aagcgcggtg 180 atcaacggga gcgcggcggc gcgggcggcg gaggaggaca ggaggcgctt cttcgaggcg 240 gcggagcgtg ggagcgggaa gggcaacctg gtgcccatgt gggagtgcat cgtctccgac 300 cacctcaccc ccgtgctcgc ctaccgctgc ctcgtccccg aggacaacat ggagacgccc 360 agcttcctct tcgagtccgt cgagcagggg cccgagggca ccaccaacgt cggtcgctat 420 agcatggtgg gagcccaccc agtgatggag gtcgtggcaa aggagcacaa ggtcacaatc 480 atggaccacg agaagggcaa ggtgacggag caggtcgtgg atgatcctat gcagatcccc 540 aggagcatga tggaaggatg gcacccgcag cagatcgatc agctccccga ttccttcacc 600 ggtggatggg tcgggttctt ttcctatgat acagtccgtt atgttgaaaa gaagaagctg 660 cccttctccg gtgctcccca ggacgatagg aaccttcctg atgttcacct tgggctttat 720 gatgatgttc tcgtcttcga caatgtcgag aagaaagtat atgtcatcca ttgggtaaat 780 cttgatcggc atgcaaccac cgaggatgca ttccaagatg gcaagtcccg gctgaacctg 840 ttgctatcta aagtgcacaa ttcaaatgta cccaagcttt ctccaggatt tgtaaagtta 900 cacactcggc agtttggtac acctttgaac aaatcaacca tgacaagtga tgagtacaag 960 aatgctgtta tgcaggctaa ggagcatatt atggctggtg atattttcca gattgtttta 1020 agccagaggt ttgagaggca gacatacgcc aatccatttg aagtctatcg agctttacga 1080 attgtgaacc caagtccata catggcatat gtacaggcaa gaggctgtgt cctggtagca 1140 tctagtccag aaattcttac tcgtgtgagg aagggtaaaa ttattaaccg tccacttgct 1200 gggactgttc gaaggggcaa gacagagaag gaagatgaaa tgcaagagca acaactacta 1260 agtgatgaaa aacagtgtgc tgaacatatt atgcttgtag atttgggaag gaatgatgtt 1320 ggaaaggtct ccaaacctgg atctgtgaag gtggagaaat taatgaacat tgaacgctac 1380 tcccatgtca tgcacatcag ttccacggtg agtggagagt tggatgatca tctccaaagt 1440 tgggatgccc tgcgagccgc gttgcctgtt ggaacagtta gtggagcacc aaaggtgaaa 1500 gccatggagc tgatagacga gctagaggtc acaagacgag gaccatacag tggcggcctt 1560 ggagggatat catttgacgg ggacatgctt atcgctcttg cactccgcac cattgtgttc 1620 tcaacagcgc caagccacaa cacgatgtac tcatacaaag acaccgagag gcgccgggag 1680 tgggtcgctc accttcaggc tggtgctggc attgtcgctg atagcagccc agacgacgag 1740 caacgtgaat gcgagaacaa ggcagccgct ctggctcgag ccatcgatct tgctgaatca 1800 gctttcgtag acaaggaata g 1821 95 1498 DNA Oryza sativa 95 gaattcaaat tttttatata gagtatttct atacatgaat ttttctaact ttttgttttt 60 taaaaaaaat ttgtgtggtg tactgtaata ggaagagaag aaggggagga ggaaggaggg 120 agaagaggga ggagtatatg gggagggggg gatgaactga tcgcccagcg tgatagctgg 180 cgatcgagca cccattagaa gggcccaata aaccctggat aattgtcatt gagtggcacc 240 tttcattgag aagacgttat taggaattgt agaagtggat aattatgcta tctgttgtat 300 tgagtgtcac tgtcaccgat aaagctttgc tggttaatgc attgtatttc tccatcaacg 360 cttcatgata caatggtatt tggacgtgtt tataaaataa tatacgtata atgtgggtgg 420 cctagcggcg gccggttaca catagcagcg atcggtccga tgctagtctt cattcattca 480 ggtatgtatt caggtatcag tgtgtgggtg atagtttttt tttttcgttt ttctagttac 540 gatatctcat atctcatagt tgtgatctta taaacttttt catgtttatc aatataaatt 600 tcgtgttatc tagtcgttaa aagaaccgta taatgtggca aaaaaaatgt ataatgtgtc 660 agagtttgca cgtgtttatc ttgctgcccc gaaacgatta attcagtgat ttggcaacaa 720 caaaatgtcg tggcggataa gcatatccgt cccaaaagga aaaaaagaaa aggaaaaata 780 atctttagaa ataaagccct tactttttcc aagaagcaga ggtaaccgta gctggtattc 840 cgcggctaac tcaatccctt tctctggagt cttggagcgg cacggcggct gcgcacccga 900 cctcgcccac cacctgctcg gcgaaacgcc cggctcggcc gcgacgtgtc ccaccgcacc 960 gcgcgcgcac ccgcgcgccc cgagcccctc gccgcctccg cgcgggcgcc gcacctattt 1020 aaatgcggcc ccgatcccgc attctctcaa ctgcactagt ccccaccaac ggctcggtcc 1080 agtagagttt atcccccacc tatggccagc ctcgtgctct ccctgcgcat cgcccgttcc 1140 acgccgccgc tggggctggg cggggggcga ttccgcggcc gacgaggggc cgtcgcctgc 1200 cgcgccgcca cgttccagca gctcgacgcc gtcggtgagt ctccgtatca aatgtggggg 1260 ggcatgtctt ggtttgcgga ttggtgggtt gatttgaatg tgtgttctcg tggccgcagc 1320 ggtgagggag gaggagtcca agttcaaggc gggggcggcg gagggttgca acatcctgcc 1380 gctcaagcga tgcatcttct ccgaccacct cacgccggtg ctcgcgtacc gctgcctcgt 1440 cagggaggac gaccgcgagg cgcccagctt cctgtttgag tccgtcgagc agggatcc 1498 96 2073 DNA Zea mays 96 gaattccgcc aaatcgggct atagatcaaa cgctgcactg tagggagcgt gaagccagcg 60 gcgaatggaa tccctagccg ccacctccgt gttcgcgccc tcccgcgtcg ccgtcccggc 120 ggcgcgggcc ctggttaggg cggggacggt ggtaccaacc aggcggacga gcagccggag 180 cggaaccagc ggggtgaaat gctctgctgc cgtgacgccg caggcgagcc cagtgattag 240 caggagcgct gcggcggcga aggcggcgga ggaggacaag aggcggttct tcgaggcggc 300 ggcgcggggg agcgggaagg ggaacctggt gcccatgtgg gagtgcatca aggggaacct 360 ggtgcccatg tgggagtgca tcgtgtcgga ccatctcacc cccgtgctcg cctaccgctg 420 cctcgtcccc gaggacaacg tcgacgcccc cagcttcctc ttcgagtccg tcgagcaggg 480 gccccagggc accaccaacg tcggccgcta tagcatggtg ggagcccacc cagtgatgga 540 gattgtggcc aaagaccaca aggttacgat catggaccac gagaagagcc aagtgacaga 600 gcaggtagtg gacgacccga tgcagatccc gaggaccatg atggagggat ggcacccaca 660 gcagatcgac gagctccctg aatccttctc cggtggatgg gttgggttct tttcctatga 720 tacggttagg tatgttgaga agaagaagct accgttctcc agtgctcctc aggacgatag 780 gaaccttcct gatgtgcact tgggactcta tgatgatgtt ctagtcttcg ataatgttga 840 gaagaaagta tatgttatcc attgggtcaa tgtggaccgg catgcatctg ttgaggaagc 900 ataccaagat ggcaggtccc gactaaacat gttgctatct aaagtgcaca attccaatgt 960 ccccacactc tctcctggat ttgtgaagct gcacacacgc aagtttggta cacctttgaa 1020 caagtcgacc atgacaagtg atgagtataa gaatgctgtt ctgcaggcta aggaacatat 1080 tatggctggg gatatcttcc agattgtttt aagccagagg ttcgagagac gaacatatgc 1140 caacccattt gaggtttatc gagcattacg gattgtgaat cctagcccat acatggcgta 1200 tgtacaggca agaggctgtg tattggttgc gtctagtcct gaaattctta cacgagtcag 1260 taaggggaag attattaatc gaccacttgc tggaactgtt cgaaggggca agacagagaa 1320 ggaagatcaa atgcaagagc agcaactgtt aagtgatgaa aaacagtgtg ccgagcacat 1380 aatgcttgtg gacttgggaa ggaatgatgt tggcaaggta tccaaaccag gaggatcagt 1440 gaaggtggag aagttgatta ttgagagata ctcccatgtt atgcacataa gctcaacggt 1500 tagtggacag ttggatgatc atctccagag ttgggatgcc ttgagagctg ccttgcccgt 1560 tggaacagtc agtggtgcac caaaggtgaa ggccatggag ttgattgata agttggaagt 1620 tacgaggcga ggaccatata gtggtggtct aggaggaata tcgtttgatg gtgacatgca 1680 aattgcactt tctctccgca ccatcgtatt ctcaacagcg ccgagccaca acacgatgta 1740 ctcatacaaa gacgcagata ggcgtcggga gtgggtcgct catcttcagg ctggtgcagg 1800 cattgttgcc gacagtagcc cagatgacga acaacgtgaa tgcgagaata aggctgctgc 1860 actagctcgg gccatcgatc ttgcagagtc agcttttgtg aacaaagaat agtgtgctat 1920 ggttatcgtt tagttcttgt tcatgtttct tttacccact ttccgttaaa aaaagatgtc 1980 attagtgggt ggagaaaagc aataagactg ttctctagag aaccgaagaa atatggaaat 2040 tgaggttatg gccggaattc ctgcagcccg ggg 2073 97 504 DNA Triticum aestivum 97 cccaaacagt ggtggcttag gagggatatc atttgatggt gacatgctta tcgctcttgc 60 tctccgcacc attgtgtttt caacagctcc aagccccaat aggatgtact catacaaaag 120 ctcagatagg ccccgagagt gggttgctca tcttcaggct ggtgcgggca ttgttgctga 180 tagtatccca gacgatgagc aaaaagaatt tgagaataag gcggctgccc tagctcgggc 240 aattgatctt gcagagtcgg cttttttaga caaagaatag agtgtctatt aaattatttt 300 ttttagttgt tcatcatttt tcacccagtt cattttggaa agttgttcat cgttttttca 360 ccgagttcat attggggaaa aaaagcaata ccgttttgtt gtcctttgaa atgaataaat 420 ttgagctata ataagatgta ttttgctcat cgggcaaaaa aaaaaaaaaa aatataaaaa 480 aaaaaaaaaa aaaaaaaaaa aata 504 98 2161 DNA Nicotiana tabacum 98 gtcaaaaatc cccatttcac cgtttcctcg tttctcctcc tcactaattt tgtctctttc 60 tcttggtttg ctattgtgct cttgtaggaa tgcagtcgtt acctatctca taccggttgt 120 ttccggccac ccaccggaaa gttctgccat tcgccgtcat ttctagccgg agctcaactt 180 ctgcacttgc gcttcgtgtc cgtacactac aatgccgctg ccttcactct tcatctctag 240 ttatggatga ggacaggttc attgaagctt ctaaaagcgg gaacttgatt ccgctgcaca 300 aaaccatttt ttctgatcat ctgactccgg tgctggctta ccggtgtttg gtgaaagaag 360 acgaccgtga agctccaagc tttctctttg aatccgttga acctggtttt cgaggttcta 420 gtgttggtcg ctacagcgtg gtgggggctc aaccatctat ggaaattgtg gctaaggaac 480 acaatgtgac tatattggac caccacactg gaaaattgac ccagaagact gtccaagatc 540 ccatgacgat tccgaggagt atttctgagg gatggaagcc cagactcatt gatgaacttc 600 ctgatacctt ttgtggtgga tgggttggtt atttctcata tgacacagtt cggtatgtag 660 agaacaggaa gttgccattc ctaagggctc cagaggatga ccggaacctt gcagatattc 720 aattaggact atacgaagat gtcattgtgt ttgatcatgt tgagaagaaa gcacatgtga 780 ttcactgggt gcagttggat cagtattcat ctcttcctga ggcatatctt gatgggaaga 840 aacgcttgga aatattagtg tctagagtac aaggaattga gtctccaagg ttatctcccg 900 gttctgtgga tttctgtact catgcttttg gaccttcatt aaccaaggga aacatgacaa 960 gtgaggagta caagaatgct gtcttacaag caaaggagca cattgctgca ggagacatat 1020 ttcaaatcgt tttaagtcaa cgctttgaga gaagaacatt tgctgaccca tttgaagtgt 1080 acagagcatt aagaattgtg aatccaagcc catatatgac ttacatacaa gccagaggct 1140 gtattttagt tgcatcgagc ccagaaattt tgacacgtgt gaagaagaga agaattgtta 1200 atcgaccact ggctgggaca agcagaagag ggaagacacc tgatgaggat gtgatgttgg 1260 aaatgcagat gttaaaagat gagaaacaac gcgcagagca catcatgctg gttgatttag 1320 gacgaaatga tgtaggaaag gtgtcaaaac ctggttctgt gaatgtcgaa aagctcatga 1380 gcgttgagcg gtattcccat gtgatgcaca taagctccac ggtctctgga gagttgcttg 1440 atcatttaac ctgttgggat gcactacgtg ctgcattgcc tgttgggacc gtcagtggag 1500 caccaaaggt aaaggccatg gagttgattg atcagctaga agtagctcgg agagggcctt 1560 acagtggtgg gtttggaggc atttcctttt caggtgacat ggacatcgca ctagctctaa 1620 ggacgatggt attcctcaat ggagctcgtt atgacacaat gtattcatat acagatgcca 1680 gcaagcgtca ggaatgggtt gctcatctcc aatccggggc tggaattgtg gctgatagta 1740 atcctgatga ggaacagata gaatgcgaga ataaagtagc cggtctgtgc cgagccattg 1800 acttggccga gtcagctttt gtaaagggaa gacacaaacc gtcagtcaag ataaatggtt 1860 ctgtgccaaa tctattttca agggtacaac gtcaaacatc tgttatgtcg aaggacagag 1920 tacatgagaa aagaaactag cgaatatgaa gatgtacata aattctaaag tggttttctt 1980 gttcagttta atcttttact ggattgagac tgtagttgct gaagatagtt gtttagaatg 2040 accttcattt tggtgttcct gaaaggacag tgcacatata tagcaaattg atcaaatgtt 2100 taatccttgt atgcgggtga gaatcaatgc catcagcaat ttggaaaaaa aaaaaaaaaa 2160 a 2161 99 606 PRT Oryza sativa 99 Met Glu Ser Ile Ala Ala Ala Thr Phe Thr Pro Ser Arg Leu Ala Ala 1 5 10 15 Arg Pro Ala Thr Pro Ala Ala Ala Ala Ala Pro Val Arg Ala Arg Ala 20 25 30 Ala Val Ala Ala Gly Gly Arg Arg Arg Thr Ser Arg Arg Gly Gly Val 35 40 45 Arg Cys Ser Ala Gly Lys Pro Glu Ala Ser Ala Val Ile Asn Gly Ser 50 55 60 Ala Ala Ala Arg Ala Ala Glu Glu Asp Arg Arg Arg Phe Phe Glu Ala 65 70 75 80 Ala Glu Arg Gly Ser Gly Lys Gly Asn Leu Val Pro Met Trp Glu Cys 85 90 95 Ile Val Ser Asp His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val 100 105 110 Pro Glu Asp Asn Met Glu Thr Pro Ser Phe Leu Phe Glu Ser Val Glu 115 120 125 Gln Gly Pro Glu Gly Thr Thr Asn Val Gly Arg Tyr Ser Met Val Gly 130 135 140 Ala His Pro Val Met Glu Val Val Ala Lys Glu His Lys Val Thr Ile 145 150 155 160 Met Asp His Glu Lys Gly Lys Val Thr Glu Gln Val Val Asp Asp Pro 165 170 175 Met Gln Ile Pro Arg Ser Met Met Glu Gly Trp His Pro Gln Gln Ile 180 185 190 Asp Gln Leu Pro Asp Ser Phe Thr Gly Gly Trp Val Gly Phe Phe Ser 195 200 205 Tyr Asp Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro Phe Ser Gly 210 215 220 Ala Pro Gln Asp Asp Arg Asn Leu Pro Asp Val His Leu Gly Leu Tyr 225 230 235 240 Asp Asp Val Leu Val Phe Asp Asn Val Glu Lys Lys Val Tyr Val Ile 245 250 255 His Trp Val Asn Leu Asp Arg His Ala Thr Thr Glu Asp Ala Phe Gln 260 265 270 Asp Gly Lys Ser Arg Leu Asn Leu Leu Leu Ser Lys Val His Asn Ser 275 280 285 Asn Val Pro Lys Leu Ser Pro Gly Phe Val Lys Leu His Thr Arg Gln 290 295 300 Phe Gly Thr Pro Leu Asn Lys Ser Thr Met Thr Ser Asp Glu Tyr Lys 305 310 315 320 Asn Ala Val Met Gln Ala Lys Glu His Ile Met Ala Gly Asp Ile Phe 325 330 335 Gln Ile Val Leu Ser Gln Arg Phe Glu Arg Gln Thr Tyr Ala Asn Pro 340 345 350 Phe Glu Val Tyr Arg Ala Leu Arg Ile Val Asn Pro Ser Pro Tyr Met 355 360 365 Ala Tyr Val Gln Ala Arg Gly Cys Val Leu Val Ala Ser Ser Pro Glu 370 375 380 Ile Leu Thr Arg Val Arg Lys Gly Lys Ile Ile Asn Arg Pro Leu Ala 385 390 395 400 Gly Thr Val Arg Arg Gly Lys Thr Glu Lys Glu Asp Glu Met Gln Glu 405 410 415 Gln Gln Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu His Ile Met Leu 420 425 430 Val Asp Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys Pro Gly Ser 435 440 445 Val Lys Val Glu Lys Leu Met Asn Ile Glu Arg Tyr Ser His Val Met 450 455 460 His Ile Ser Ser Thr Val Ser Gly Glu Leu Asp Asp His Leu Gln Ser 465 470 475 480 Trp Asp Ala Leu Arg Ala Ala Leu Pro Val Gly Thr Val Ser Gly Ala 485 490 495 Pro Lys Val Lys Ala Met Glu Leu Ile Asp Glu Leu Glu Val Thr Arg 500 505 510 Arg Gly Pro Tyr Ser Gly Gly Leu Gly Gly Ile Ser Phe Asp Gly Asp 515 520 525 Met Leu Ile Ala Leu Ala Leu Arg Thr Ile Val Phe Ser Thr Ala Pro 530 535 540 Ser His Asn Thr Met Tyr Ser Tyr Lys Asp Thr Glu Arg Arg Arg Glu 545 550 555 560 Trp Val Ala His Leu Gln Ala Gly Ala Gly Ile Val Ala Asp Ser Ser 565 570 575 Pro Asp Asp Glu Gln Arg Glu Cys Glu Asn Lys Ala Ala Ala Leu Ala 580 585 590 Arg Ala Ile Asp Leu Ala Glu Ser Ala Phe Val Asp Lys Glu 595 600 605 100 67 PRT Oryza sativa 100 Met Cys Val Leu Val Ala Ala Ala Val Arg Glu Glu Glu Ser Lys Phe 1 5 10 15 Lys Ala Gly Ala Ala Glu Gly Cys Asn Ile Leu Pro Leu Lys Arg Cys 20 25 30 Ile Phe Ser Asp His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val 35 40 45 Arg Glu Asp Asp Arg Glu Ala Pro Ser Phe Leu Phe Glu Ser Val Glu 50 55 60 Gln Gly Ser 65 101 525 PRT Zea mays 101 Met Trp Glu Cys Ile Lys Gly Asn Leu Val Pro Met Trp Glu Cys Ile 1 5 10 15 Val Ser Asp His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val Pro 20 25 30 Glu Asp Asn Val Asp Ala Pro Ser Phe Leu Phe Glu Ser Val Glu Gln 35 40 45 Gly Pro Gln Gly Thr Thr Asn Val Gly Arg Tyr Ser Met Val Gly Ala 50 55 60 His Pro Val Met Glu Ile Val Ala Lys Asp His Lys Val Thr Ile Met 65 70 75 80 Asp His Glu Lys Ser Gln Val Thr Glu Gln Val Val Asp Asp Pro Met 85 90 95 Gln Ile Pro Arg Thr Met Met Glu Gly Trp His Pro Gln Gln Ile Asp 100 105 110 Glu Leu Pro Glu Ser Phe Ser Gly Gly Trp Val Gly Phe Phe Ser Tyr 115 120 125 Asp Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro Phe Ser Ser Ala 130 135 140 Pro Gln Asp Asp Arg Asn Leu Pro Asp Val His Leu Gly Leu Tyr Asp 145 150 155 160 Asp Val Leu Val Phe Asp Asn Val Glu Lys Lys Val Tyr Val Ile His 165 170 175 Trp Val Asn Val Asp Arg His Ala Ser Val Glu Glu Ala Tyr Gln Asp 180 185 190 Gly Arg Ser Arg Leu Asn Met Leu Leu Ser Lys Val His Asn Ser Asn 195 200 205 Val Pro Thr Leu Ser Pro Gly Phe Val Lys Leu His Thr Arg Lys Phe 210 215 220 Gly Thr Pro Leu Asn Lys Ser Thr Met Thr Ser Asp Glu Tyr Lys Asn 225 230 235 240 Ala Val Leu Gln Ala Lys Glu His Ile Met Ala Gly Asp Ile Phe Gln 245 250 255 Ile Val Leu Ser Gln Arg Phe Glu Arg Arg Thr Tyr Ala Asn Pro Phe 260 265 270 Glu Val Tyr Arg Ala Leu Arg Ile Val Asn Pro Ser Pro Tyr Met Ala 275 280 285 Tyr Val Gln Ala Arg Gly Cys Val Leu Val Ala Ser Ser Pro Glu Ile 290 295 300 Leu Thr Arg Val Ser Lys Gly Lys Ile Ile Asn Arg Pro Leu Ala Gly 305 310 315 320 Thr Val Arg Arg Gly Lys Thr Glu Lys Glu Asp Gln Met Gln Glu Gln 325 330 335 Gln Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu His Ile Met Leu Val 340 345 350 Asp Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys Pro Gly Gly Ser 355 360 365 Val Lys Val Glu Lys Leu Ile Ile Glu Arg Tyr Ser His Val Met His 370 375 380 Ile Ser Ser Thr Val Ser Gly Gln Leu Asp Asp His Leu Gln Ser Trp 385 390 395 400 Asp Ala Leu Arg Ala Ala Leu Pro Val Gly Thr Val Ser Gly Ala Pro 405 410 415 Lys Val Lys Ala Met Glu Leu Ile Asp Lys Leu Glu Val Thr Arg Arg 420 425 430 Gly Pro Tyr Ser Gly Gly Leu Gly Gly Ile Ser Phe Asp Gly Asp Met 435 440 445 Gln Ile Ala Leu Ser Leu Arg Thr Ile Val Phe Ser Thr Ala Pro Ser 450 455 460 His Asn Thr Met Tyr Ser Tyr Lys Asp Ala Asp Arg Arg Arg Glu Trp 465 470 475 480 Val Ala His Leu Gln Ala Gly Ala Gly Ile Val Ala Asp Ser Ser Pro 485 490 495 Asp Asp Glu Gln Arg Glu Cys Glu Asn Lys Ala Ala Ala Leu Ala Arg 500 505 510 Ala Ile Asp Leu Ala Glu Ser Ala Phe Val Asn Lys Glu 515 520 525 102 92 PRT Triticum aestivum 102 Pro Asn Ser Gly Gly Leu Gly Gly Ile Ser Phe Asp Gly Asp Met Leu 1 5 10 15 Ile Ala Leu Ala Leu Arg Thr Ile Val Phe Ser Thr Ala Pro Ser Pro 20 25 30 Asn Arg Met Tyr Ser Tyr Lys Ser Ser Asp Arg Pro Arg Glu Trp Val 35 40 45 Ala His Leu Gln Ala Gly Ala Gly Ile Val Ala Asp Ser Ile Pro Asp 50 55 60 Asp Glu Gln Lys Glu Phe Glu Asn Lys Ala Ala Ala Leu Ala Arg Ala 65 70 75 80 Ile Asp Leu Ala Glu Ser Ala Phe Leu Asp Lys Glu 85 90 103 616 PRT Nicotiana tabacum 103 Met Gln Ser Leu Pro Ile Ser Tyr Arg Leu Phe Pro Ala Thr His Arg 1 5 10 15 Lys Val Leu Pro Phe Ala Val Ile Ser Ser Arg Ser Ser Thr Ser Ala 20 25 30 Leu Ala Leu Arg Val Arg Thr Leu Gln Cys Arg Cys Leu His Ser Ser 35 40 45 Ser Leu Val Met Asp Glu Asp Arg Phe Ile Glu Ala Ser Lys Ser Gly 50 55 60 Asn Leu Ile Pro Leu His Lys Thr Ile Phe Ser Asp His Leu Thr Pro 65 70 75 80 Val Leu Ala Tyr Arg Cys Leu Val Lys Glu Asp Asp Arg Glu Ala Pro 85 90 95 Ser Phe Leu Phe Glu Ser Val Glu Pro Gly Phe Arg Gly Ser Ser Val 100 105 110 Gly Arg Tyr Ser Val Val Gly Ala Gln Pro Ser Met Glu Ile Val Ala 115 120 125 Lys Glu His Asn Val Thr Ile Leu Asp His His Thr Gly Lys Leu Thr 130 135 140 Gln Lys Thr Val Gln Asp Pro Met Thr Ile Pro Arg Ser Ile Ser Glu 145 150 155 160 Gly Trp Lys Pro Arg Leu Ile Asp Glu Leu Pro Asp Thr Phe Cys Gly 165 170 175 Gly Trp Val Gly Tyr Phe Ser Tyr Asp Thr Val Arg Tyr Val Glu Asn 180 185 190 Arg Lys Leu Pro Phe Leu Arg Ala Pro Glu Asp Asp Arg Asn Leu Ala 195 200 205 Asp Ile Gln Leu Gly Leu Tyr Glu Asp Val Ile Val Phe Asp His Val 210 215 220 Glu Lys Lys Ala His Val Ile His Trp Val Gln Leu Asp Gln Tyr Ser 225 230 235 240 Ser Leu Pro Glu Ala Tyr Leu Asp Gly Lys Lys Arg Leu Glu Ile Leu 245 250 255 Val Ser Arg Val Gln Gly Ile Glu Ser Pro Arg Leu Ser Pro Gly Ser 260 265 270 Val Asp Phe Cys Thr His Ala Phe Gly Pro Ser Leu Thr Lys Gly Asn 275 280 285 Met Thr Ser Glu Glu Tyr Lys Asn Ala Val Leu Gln Ala Lys Glu His 290 295 300 Ile Ala Ala Gly Asp Ile Phe Gln Ile Val Leu Ser Gln Arg Phe Glu 305 310 315 320 Arg Arg Thr Phe Ala Asp Pro Phe Glu Val Tyr Arg Ala Leu Arg Ile 325 330 335 Val Asn Pro Ser Pro Tyr Met Thr Tyr Ile Gln Ala Arg Gly Cys Ile 340 345 350 Leu Val Ala Ser Ser Pro Glu Ile Leu Thr Arg Val Lys Lys Arg Arg 355 360 365 Ile Val Asn Arg Pro Leu Ala Gly Thr Ser Arg Arg Gly Lys Thr Pro 370 375 380 Asp Glu Asp Val Met Leu Glu Met Gln Met Leu Lys Asp Glu Lys Gln 385 390 395 400 Arg Ala Glu His Ile Met Leu Val Asp Leu Gly Arg Asn Asp Val Gly 405 410 415 Lys Val Ser Lys Pro Gly Ser Val Asn Val Glu Lys Leu Met Ser Val 420 425 430 Glu Arg Tyr Ser His Val Met His Ile Ser Ser Thr Val Ser Gly Glu 435 440 445 Leu Leu Asp His Leu Thr Cys Trp Asp Ala Leu Arg Ala Ala Leu Pro 450 455 460 Val Gly Thr Val Ser Gly Ala Pro Lys Val Lys Ala Met Glu Leu Ile 465 470 475 480 Asp Gln Leu Glu Val Ala Arg Arg Gly Pro Tyr Ser Gly Gly Phe Gly 485 490 495 Gly Ile Ser Phe Ser Gly Asp Met Asp Ile Ala Leu Ala Leu Arg Thr 500 505 510 Met Val Phe Leu Asn Gly Ala Arg Tyr Asp Thr Met Tyr Ser Tyr Thr 515 520 525 Asp Ala Ser Lys Arg Gln Glu Trp Val Ala His Leu Gln Ser Gly Ala 530 535 540 Gly Ile Val Ala Asp Ser Asn Pro Asp Glu Glu Gln Ile Glu Cys Glu 545 550 555 560 Asn Lys Val Ala Gly Leu Cys Arg Ala Ile Asp Leu Ala Glu Ser Ala 565 570 575 Phe Val Lys Gly Arg His Lys Pro Ser Val Lys Ile Asn Gly Ser Val 580 585 590 Pro Asn Leu Phe Ser Arg Val Gln Arg Gln Thr Ser Val Met Ser Lys 595 600 605 Asp Arg Val His Glu Lys Arg Asn 610 615 104 1776 DNA Gossypium hirsutum misc_feature Alpha subunit. 104 atgcaggcat ccatgtcggt tacctcgacg aactccacat taccaatgcc agtgcaaagc 60 agccttggat tctctcaccg cttccttcct tcatctcatc ggttttctca acttccgatc 120 acccgctttt ctcccgctcc tacttcactc aaatgcaggg gctctctttc aagctttcca 180 cttgttaatg atgaaaagaa gtttgtggag gcggccaaaa aagcaaattt agtccccctt 240 tatcgttgca ttttctctga tcaactgact ccagtgcttg cataccggtg tttggttaaa 300 gaagatgata gagaggctcc aagttttctc tttgagtcag tggagcctgg ttctcgggtt 360 tctagtgttg gtcgatatag cgtggttgga gctcaaccga caatggaaat tgtggcaaaa 420 gaaaacaaag ttatgattat ggatcatgag gcagggaatt tgactgagga ggtcgttgag 480 gatccgatgt gtattcccaa gagaatctca gagacttgga aaccccgact tgttgaagat 540 cttcctgatg cgttttgtgg tggatgggtt ggttatttct cctatgatac agttcgttat 600 gtggagaaga aaaagcttcc gttcactaag gcaccacgtg atgacagaaa cctgccagat 660 atacatctag gactctacaa cgacgtgatt gtatttgatc atgtggaaaa gaaagcatat 720 ataattcact gggtgaggct agataaacac tcgtctgttg agaaagctta taatgaagga 780 gttgaacacc tagagaaatt ggtagctaga gtacaagatg ttgagctacc aaagctatct 840 ccaggctctg tagcattaca aacccatcac tttggccctt ctttaaagaa ctcaaatatg 900 gaaaaggaag agttcaagaa agctgtactg aaagcgaaag agcatattct ggcaggggat 960 attttccaga ttgtattaag ccaacgtttt gaacggagaa catttgctga cccctttgaa 1020 atatatagag ctttgcgagt tgtgaatcca agtccatata tggcctactt gcaagctaga 1080 ggaagtattc tagttgcttc aagtcccgaa attcttacca gggtaaagaa gaataagatt 1140 gtgaataggc cattggctgg aacaacaagg agaggaaaga ctcaggctga agatgagctg 1200 gcagaaaagc tattgctaag taatgaaaag gaatgtgcag aacacatcat gcttgttgat 1260 ttgggtcgca atgatgttgg aaaggtctcc aaatatggtt ctgtaaaggt ggagaagctg 1320 atgaatattg aacgatattc ccatgtgatg cacataagct ccacggttac tggtgagttg 1380 caggatcatc tcactagttg ggatgtcctc cgtgctgcac ttcccgttgg aactgttagt 1440 ggagcaccaa aggtgaaggc gatggagcta atcgatgagt tagaggtgtc aagacgaggt 1500 ccttatagcg gaggatttgg gggcatttcc ttcactgggg atatggatat tgcgttggct 1560 ctcaggacca tggtattccc tacaggtagc cgctatgaca caatgtactc atacaaaggt 1620 tccagcagac gccaagaatg ggtagcttat cttcaagccg gcgctggtgt agttgcagac 1680 agtgatcctg atgccgagca cctcgaatgt caaaacaaag ctgctggcct tgctcgttcc 1740 attgacctag cggaggctgc attcgttcat aaatga 1776 105 843 DNA Gossypium hirsutum misc_feature Beta subunit. 105 atggcagcta atattataac ccaatcatct ctgcttcagc caaaacctgc actttctgct 60 aaaacccttc aaatcccatc tctgcatcgc ttatccggcc tccctcctcc atcaagggtt 120 ggcttttttc tggaaaagaa aacggggatt gttggaaaag ctccattaaa atcggctgta 180 tcggactcaa cctcgtcagt tttggagaac aagaaaaaca gcaagaatcc cattgtcgtc 240 attgacaatt acgacagttt cacttacaat ctttgccagt atattggaga gcttggatgt 300 tacttcgagg tttttcgaaa tgacgaatta actgtagaag acttaaaaat gaaaaaccct 360 aggggagtgc ttatctctcc tggtccagga acaccccaag attccggaat atcactgcag 420 actgttttgg aacttggacc tactgtacct ttgtttggtg tttgtatggg tttgcagtgc 480 attggtgagg cttttggagg aaagatagtg cgttctccct atggtgttat gcatggcaaa 540 agttcccctg tatattatga cgaaaagggg gaagacggtt tgttatctgg attgtcaaac 600 cctttcaatg ctggcagata tcatagcctc gtgattgaaa aggacagttt ccctgaggaa 660 gcacttgagg ttactgcttg gacagaagat ggactgataa tggctgctag gcacaaagtt 720 tataagcatc tgcagggtgt tcaattccat ccagagagca tcataacctc tgaaggaaaa 780 acaattgttc ggaatttcat caaactaatc gagagaaagg aggtggcagg atccaagaat 840 tag 843 106 1704 DNA Glycine max misc_feature Alpha subunit. 106 atggcgactg ttccgcaccc attatccctc gcaagtgtag gttttgctaa ccgaacctcc 60 tccatctcca gatccactct caaatgctgc gctcaatctc cttctccttc actagttgac 120 aacgcccaga agtttctcga agcttccaag aaggggaacg tcattcctct cttccgctgc 180 atattttccg atcacctcac tccggtgctt gcgtaccggt gcctggttaa ggaggacgag 240 agagatgctc cgagttttct ctttgaatcg gtcgagccag gccaaatttc tagcatcgga 300 cggtacagtg tggttggagc acagccgtgt atggaaattg tggcgaaaga gaacgtggtt 360 actattatgg accacgtgga agggcgcagg agtgaggaaa ttgtagagga tcctctggtg 420 attcctcgta ggatcatgga gaagtggacg cctcaactct tagatgaact tcctgaagcg 480 ttttgtggtg gttgggtagg gtatttctct tatgatacaa tgcgctatgt agaaaagaag 540 aaacttccat tttctaatgc cccagtagat gacagaaacc ttcctgatgt tcatctgggc 600 ctttatgaca gtgtgattgt gtttgatcat gttgaaaaga aagcatatgt gattcattgg 660 gttcgggtgg atcgatattc ttcagctgag gaggccttcg aagatggaag gaaccggctg 720 gaaactctag tatctcgggt gcatgatata attaccccaa ggctgcctac aggttcgata 780 aagttataca ctcgtctctt tggtcctaaa ctggagatgt caaacatgac aaatgaggag 840 tataagaggg cagtattgaa ggctaaagag cacatacggg ctggtgatat ttttcaaatt 900 gtactaagtc aacgttttga acagagaact tttgcagacc catttgaaat ctacagagca 960 ttgaggattg ttaatcctag tccatatatg acttatttac aggccagagg aagtattttg 1020 gttgcttcaa gtccagaaat tcttacacgg gtgaagaaga gaaagatcac caatcggccc 1080 cttgctggta ctgttagaag aggaaaaaca ccaaaagaag atatcatgtt ggagaaacaa 1140 cttttgaatg atgaaaagca atgtgcagag cacgtaatgc tagttgattt ggggagaaat 1200 gatgttggaa aggtctccaa accgggttct gttcaagttg aaaagcttat gaatattgag 1260 cgctattccc atgttatgca catcagctca acagtcacag gggagttatt agatcactta 1320 acaagctggg atgcattgcg tgctgcttta cctgttggta cagttagcgg agcaccgaag 1380 gtcaaagcca tgcagttgat tgatgagttg gaagtcgcaa gaagggggcc ctatagtggg 1440 ggatttggag gtatatcatt caatggcgat atggacatag cccttgctct gaggaccata 1500 gttttcccta caaatgctcg ttatgacaca atgtactcct acaaggataa gaacaaacgc 1560 agagaatggg ttgcccatct ccaggctgga gcgggaattg tggctgacag tgatcctgct 1620 gatgaacaaa gagagtgcga gaacaaagct gcagctcttg ctcgtgccat tgatcttgca 1680 gaatcttcat ttgttgataa ataa 1704 107 837 DNA Glycine max misc_feature Beta subunit. 107 atggctgcca cattcttctc tcacttgtcg cttcttcaat ccaacaacaa cccttctctc 60 tctcacacac cctctcgctt ccctcattct ctcaccaacc gtgtcaaacc ctccctcggt 120 gtggtatctg tggccaaaag ggtaagtgga gtggtgccaa aggccaattt gaatgccttg 180 gaggccaatt cgggtttccc catttcggct aagaagtcca acaacaaccc cattgttgtt 240 attgacaact atgacagttt cacctataat ctttgccagt atatggggga gttagggttt 300 cactttgagg tctaccgcaa tgatgagttg acagtggagg agttaagaag gaaaaatccc 360 agaggagtgc tgatatcacc tgggccagga gaacctcaag attcaggcat atctttgcaa 420 acggttttgg aacttggacc aactgtgcca ttgtttggtg tgtgcatggg tttgcaatgc 480 attggagagg cttttggagg gaagattgtt cgttctcctc atggtgttat gcatggaaaa 540 agctctatgg tttactatga tgagaaagga gaagatggat tacttgctgg actatcaaat 600 cctttcttgg ctggtagata tcacagcctt gtaattgaaa aagagagctt tcctcatgat 660 gaacttgagg caacagcatg gacagaagat ggtcttataa tggctgctcg tcataagaaa 720 tataagcatc tacagggtgt tcagtttcat ccagagagca tcataacccc agaaggcaag 780 acaattgtcc gtaattttgt caagcttatc gagaaaaggg aggctggtgg ctcttga 837 108 591 PRT Gossypium hirsutum MISC_FEATURE Alpha subunit. 108 Met Gln Ala Ser Met Ser Val Thr Ser Thr Asn Ser Thr Leu Pro Met 1 5 10 15 Pro Val Gln Ser Ser Leu Gly Phe Ser His Arg Phe Leu Pro Ser Ser 20 25 30 His Arg Phe Ser Gln Leu Pro Ile Thr Arg Phe Ser Pro Ala Pro Thr 35 40 45 Ser Leu Lys Cys Arg Gly Ser Leu Ser Ser Phe Pro Leu Val Asn Asp 50 55 60 Glu Lys Lys Phe Val Glu Ala Ala Lys Lys Ala Asn Leu Val Pro Leu 65 70 75 80 Tyr Arg Cys Ile Phe Ser Asp Gln Leu Thr Pro Val Leu Ala Tyr Arg 85 90 95 Cys Leu Val Lys Glu Asp Asp Arg Glu Ala Pro Ser Phe Leu Phe Glu 100 105 110 Ser Val Glu Pro Gly Ser Arg Val Ser Ser Val Gly Arg Tyr Ser Val 115 120 125 Val Gly Ala Gln Pro Thr Met Glu Ile Val Ala Lys Glu Asn Lys Val 130 135 140 Met Ile Met Asp His Glu Ala Gly Asn Leu Thr Glu Glu Val Val Glu 145 150 155 160 Asp Pro Met Cys Ile Pro Lys Arg Ile Ser Glu Thr Trp Lys Pro Arg 165 170 175 Leu Val Glu Asp Leu Pro Asp Ala Phe Cys Gly Gly Trp Val Gly Tyr 180 185 190 Phe Ser Tyr Asp Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro Phe 195 200 205 Thr Lys Ala Pro Arg Asp Asp Arg Asn Leu Pro Asp Ile His Leu Gly 210 215 220 Leu Tyr Asn Asp Val Ile Val Phe Asp His Val Glu Lys Lys Ala Tyr 225 230 235 240 Ile Ile His Trp Val Arg Leu Asp Lys His Ser Ser Val Glu Lys Ala 245 250 255 Tyr Asn Glu Gly Val Glu His Leu Glu Lys Leu Val Ala Arg Val Gln 260 265 270 Asp Val Glu Leu Pro Lys Leu Ser Pro Gly Ser Val Ala Leu Gln Thr 275 280 285 His His Phe Gly Pro Ser Leu Lys Asn Ser Asn Met Glu Lys Glu Glu 290 295 300 Phe Lys Lys Ala Val Leu Lys Ala Lys Glu His Ile Leu Ala Gly Asp 305 310 315 320 Ile Phe Gln Ile Val Leu Ser Gln Arg Phe Glu Arg Arg Thr Phe Ala 325 330 335 Asp Pro Phe Glu Ile Tyr Arg Ala Leu Arg Val Val Asn Pro Ser Pro 340 345 350 Tyr Met Ala Tyr Leu Gln Ala Arg Gly Ser Ile Leu Val Ala Ser Ser 355 360 365 Pro Glu Ile Leu Thr Arg Val Lys Lys Asn Lys Ile Val Asn Arg Pro 370 375 380 Leu Ala Gly Thr Thr Arg Arg Gly Lys Thr Gln Ala Glu Asp Glu Leu 385 390 395 400 Ala Glu Lys Leu Leu Leu Ser Asn Glu Lys Glu Cys Ala Glu His Ile 405 410 415 Met Leu Val Asp Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys Tyr 420 425 430 Gly Ser Val Lys Val Glu Lys Leu Met Asn Ile Glu Arg Tyr Ser His 435 440 445 Val Met His Ile Ser Ser Thr Val Thr Gly Glu Leu Gln Asp His Leu 450 455 460 Thr Ser Trp Asp Val Leu Arg Ala Ala Leu Pro Val Gly Thr Val Ser 465 470 475 480 Gly Ala Pro Lys Val Lys Ala Met Glu Leu Ile Asp Glu Leu Glu Val 485 490 495 Ser Arg Arg Gly Pro Tyr Ser Gly Gly Phe Gly Gly Ile Ser Phe Thr 500 505 510 Gly Asp Met Asp Ile Ala Leu Ala Leu Arg Thr Met Val Phe Pro Thr 515 520 525 Gly Ser Arg Tyr Asp Thr Met Tyr Ser Tyr Lys Gly Ser Ser Arg Arg 530 535 540 Gln Glu Trp Val Ala Tyr Leu Gln Ala Gly Ala Gly Val Val Ala Asp 545 550 555 560 Ser Asp Pro Asp Ala Glu His Leu Glu Cys Gln Asn Lys Ala Ala Gly 565 570 575 Leu Ala Arg Ser Ile Asp Leu Ala Glu Ala Ala Phe Val His Lys 580 585 590 109 280 PRT Gossypium hirsutum MISC_FEATURE Beta subunit. 109 Met Ala Ala Asn Ile Ile Thr Gln Ser Ser Leu Leu Gln Pro Lys Pro 1 5 10 15 Ala Leu Ser Ala Lys Thr Leu Gln Ile Pro Ser Leu His Arg Leu Ser 20 25 30 Gly Leu Pro Pro Pro Ser Arg Val Gly Phe Phe Leu Glu Lys Lys Thr 35 40 45 Gly Ile Val Gly Lys Ala Pro Leu Lys Ser Ala Val Ser Asp Ser Thr 50 55 60 Ser Ser Val Leu Glu Asn Lys Lys Asn Ser Lys Asn Pro Ile Val Val 65 70 75 80 Ile Asp Asn Tyr Asp Ser Phe Thr Tyr Asn Leu Cys Gln Tyr Ile Gly 85 90 95 Glu Leu Gly Cys Tyr Phe Glu Val Phe Arg Asn Asp Glu Leu Thr Val 100 105 110 Glu Asp Leu Lys Met Lys Asn Pro Arg Gly Val Leu Ile Ser Pro Gly 115 120 125 Pro Gly Thr Pro Gln Asp Ser Gly Ile Ser Leu Gln Thr Val Leu Glu 130 135 140 Leu Gly Pro Thr Val Pro Leu Phe Gly Val Cys Met Gly Leu Gln Cys 145 150 155 160 Ile Gly Glu Ala Phe Gly Gly Lys Ile Val Arg Ser Pro Tyr Gly Val 165 170 175 Met His Gly Lys Ser Ser Pro Val Tyr Tyr Asp Glu Lys Gly Glu Asp 180 185 190 Gly Leu Leu Ser Gly Leu Ser Asn Pro Phe Asn Ala Gly Arg Tyr His 195 200 205 Ser Leu Val Ile Glu Lys Asp Ser Phe Pro Glu Glu Ala Leu Glu Val 210 215 220 Thr Ala Trp Thr Glu Asp Gly Leu Ile Met Ala Ala Arg His Lys Val 225 230 235 240 Tyr Lys His Leu Gln Gly Val Gln Phe His Pro Glu Ser Ile Ile Thr 245 250 255 Ser Glu Gly Lys Thr Ile Val Arg Asn Phe Ile Lys Leu Ile Glu Arg 260 265 270 Lys Glu Val Ala Gly Ser Lys Asn 275 280 110 567 PRT Glycine max MISC_FEATURE Alpha subunit. 110 Met Ala Thr Val Pro His Pro Leu Ser Leu Ala Ser Val Gly Phe Ala 1 5 10 15 Asn Arg Thr Ser Ser Ile Ser Arg Ser Thr Leu Lys Cys Cys Ala Gln 20 25 30 Ser Pro Ser Pro Ser Leu Val Asp Asn Ala Gln Lys Phe Leu Glu Ala 35 40 45 Ser Lys Lys Gly Asn Val Ile Pro Leu Phe Arg Cys Ile Phe Ser Asp 50 55 60 His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val Lys Glu Asp Glu 65 70 75 80 Arg Asp Ala Pro Ser Phe Leu Phe Glu Ser Val Glu Pro Gly Gln Ile 85 90 95 Ser Ser Ile Gly Arg Tyr Ser Val Val Gly Ala Gln Pro Cys Met Glu 100 105 110 Ile Val Ala Lys Glu Asn Val Val Thr Ile Met Asp His Val Glu Gly 115 120 125 Arg Arg Ser Glu Glu Ile Val Glu Asp Pro Leu Val Ile Pro Arg Arg 130 135 140 Ile Met Glu Lys Trp Thr Pro Gln Leu Leu Asp Glu Leu Pro Glu Ala 145 150 155 160 Phe Cys Gly Gly Trp Val Gly Tyr Phe Ser Tyr Asp Thr Met Arg Tyr 165 170 175 Val Glu Lys Lys Lys Leu Pro Phe Ser Asn Ala Pro Val Asp Asp Arg 180 185 190 Asn Leu Pro Asp Val His Leu Gly Leu Tyr Asp Ser Val Ile Val Phe 195 200 205 Asp His Val Glu Lys Lys Ala Tyr Val Ile His Trp Val Arg Val Asp 210 215 220 Arg Tyr Ser Ser Ala Glu Glu Ala Phe Glu Asp Gly Arg Asn Arg Leu 225 230 235 240 Glu Thr Leu Val Ser Arg Val His Asp Ile Ile Thr Pro Arg Leu Pro 245 250 255 Thr Gly Ser Ile Lys Leu Tyr Thr Arg Leu Phe Gly Pro Lys Leu Glu 260 265 270 Met Ser Asn Met Thr Asn Glu Glu Tyr Lys Arg Ala Val Leu Lys Ala 275 280 285 Lys Glu His Ile Arg Ala Gly Asp Ile Phe Gln Ile Val Leu Ser Gln 290 295 300 Arg Phe Glu Gln Arg Thr Phe Ala Asp Pro Phe Glu Ile Tyr Arg Ala 305 310 315 320 Leu Arg Ile Val Asn Pro Ser Pro Tyr Met Thr Tyr Leu Gln Ala Arg 325 330 335 Gly Ser Ile Leu Val Ala Ser Ser Pro Glu Ile Leu Thr Arg Val Lys 340 345 350 Lys Arg Lys Ile Thr Asn Arg Pro Leu Ala Gly Thr Val Arg Arg Gly 355 360 365 Lys Thr Pro Lys Glu Asp Ile Met Leu Glu Lys Gln Leu Leu Asn Asp 370 375 380 Glu Lys Gln Cys Ala Glu His Val Met Leu Val Asp Leu Gly Arg Asn 385 390 395 400 Asp Val Gly Lys Val Ser Lys Pro Gly Ser Val Gln Val Glu Lys Leu 405 410 415 Met Asn Ile Glu Arg Tyr Ser His Val Met His Ile Ser Ser Thr Val 420 425 430 Thr Gly Glu Leu Leu Asp His Leu Thr Ser Trp Asp Ala Leu Arg Ala 435 440 445 Ala Leu Pro Val Gly Thr Val Ser Gly Ala Pro Lys Val Lys Ala Met 450 455 460 Gln Leu Ile Asp Glu Leu Glu Val Ala Arg Arg Gly Pro Tyr Ser Gly 465 470 475 480 Gly Phe Gly Gly Ile Ser Phe Asn Gly Asp Met Asp Ile Ala Leu Ala 485 490 495 Leu Arg Thr Ile Val Phe Pro Thr Asn Ala Arg Tyr Asp Thr Met Tyr 500 505 510 Ser Tyr Lys Asp Lys Asn Lys Arg Arg Glu Trp Val Ala His Leu Gln 515 520 525 Ala Gly Ala Gly Ile Val Ala Asp Ser Asp Pro Ala Asp Glu Gln Arg 530 535 540 Glu Cys Glu Asn Lys Ala Ala Ala Leu Ala Arg Ala Ile Asp Leu Ala 545 550 555 560 Glu Ser Ser Phe Val Asp Lys 565 111 278 PRT Glycine max MISC_FEATURE Beta subunit. 111 Met Ala Ala Thr Phe Phe Ser His Leu Ser Leu Leu Gln Ser Asn Asn 1 5 10 15 Asn Pro Ser Leu Ser His Thr Pro Ser Arg Phe Pro His Ser Leu Thr 20 25 30 Asn Arg Val Lys Pro Ser Leu Gly Val Val Ser Val Ala Lys Arg Val 35 40 45 Ser Gly Val Val Pro Lys Ala Asn Leu Asn Ala Leu Glu Ala Asn Ser 50 55 60 Gly Phe Pro Ile Ser Ala Lys Lys Ser Asn Asn Asn Pro Ile Val Val 65 70 75 80 Ile Asp Asn Tyr Asp Ser Phe Thr Tyr Asn Leu Cys Gln Tyr Met Gly 85 90 95 Glu Leu Gly Phe His Phe Glu Val Tyr Arg Asn Asp Glu Leu Thr Val 100 105 110 Glu Glu Leu Arg Arg Lys Asn Pro Arg Gly Val Leu Ile Ser Pro Gly 115 120 125 Pro Gly Glu Pro Gln Asp Ser Gly Ile Ser Leu Gln Thr Val Leu Glu 130 135 140 Leu Gly Pro Thr Val Pro Leu Phe Gly Val Cys Met Gly Leu Gln Cys 145 150 155 160 Ile Gly Glu Ala Phe Gly Gly Lys Ile Val Arg Ser Pro His Gly Val 165 170 175 Met His Gly Lys Ser Ser Met Val Tyr Tyr Asp Glu Lys Gly Glu Asp 180 185 190 Gly Leu Leu Ala Gly Leu Ser Asn Pro Phe Leu Ala Gly Arg Tyr His 195 200 205 Ser Leu Val Ile Glu Lys Glu Ser Phe Pro His Asp Glu Leu Glu Ala 210 215 220 Thr Ala Trp Thr Glu Asp Gly Leu Ile Met Ala Ala Arg His Lys Lys 225 230 235 240 Tyr Lys His Leu Gln Gly Val Gln Phe His Pro Glu Ser Ile Ile Thr 245 250 255 Pro Glu Gly Lys Thr Ile Val Arg Asn Phe Val Lys Leu Ile Glu Lys 260 265 270 Arg Glu Ala Gly Gly Ser 275 112 2210 DNA Glycine max 3′UTR (1919)..(2210) 112 aaagaaatga cctgaagtct ctatatattc caggtaacga agaccttagc aacccaatga 60 acgcgtcccc atgaacggca cgtgtagcgg agtactaggc cgccgttaca cgctactgct 120 gtccgtcgtc accgtttgaa ttacccaccg ctactttgtc gtcattcttc ttcttcttcc 180 cttttcattg accttttcct tccttcgtcc tccaatggcg actgttccgc acccattatc 240 cctcgcaagt gtaggttttg ctaaccgaac ctcctccatc tccagatcca ctctcaaatg 300 ctgcgctcaa tctccttctc cttcactagt tgacaacgcc cagaagtttc tcgaagcttc 360 caagaagggg aacgtcattc ctctcttccg ctgcatattt tccgatcacc tcactccggt 420 gcttgcgtac cggtgcctgg ttaaggagga cgagagagat gctccgagtt ttctctttga 480 atcggtcgag ccaggccaaa tttctagcat cggacggtac agtgtggttg gagcacagcc 540 gtgtatggaa attgtggcga aagagaacgt ggttactatt atggaccacg tggaagggcg 600 caggagtgag gaaattgtag aggatcctct ggtgattcct cgtaggatca tggagaagtg 660 gacgcctcaa ctcttagatg aacttcctga agcgttttgt ggtggttggg tagggtattt 720 ctcttatgat acaatgcgct atgtagaaaa gaagaaactt ccattttcta atgccccagt 780 agatgacaga aaccttcctg atgttcatct gggcctttat gacagtgtga ttgtgtttga 840 tcatgttgaa aagaaagcat atgtgattca ttgggttcgg gtggatcgat attcttcagc 900 tgaggaggcc ttcgaagatg gaaggaaccg gctggaaact ctagtatctc gggtgcatga 960 tataattacc ccaaggctgc ctacaggttc gataaagtta tacactcgtc tctttggtcc 1020 taaactggag atgtcaaaca tgacaaatga ggagtataag agggcagtat tgaaggctaa 1080 agagcacata cgggctggtg atatttttca aattgtacta agtcaacgtt ttgaacagag 1140 aacttttgca gacccatttg aaatctacag agcattgagg attgttaatc ctagtccata 1200 tatgacttat ttacaggcca gaggaagtat tttggttgct tcaagtccag aaattcttac 1260 acgggtgaag aagagaaaga tcaccaatcg gccccttgct ggtactgtta gaagaggaaa 1320 aacaccaaaa gaagatatca tgttggagaa acaacttttg aatgatgaaa agcaatgtgc 1380 agagcacgta atgctagttg atttggggag aaatgatgtt ggaaaggtct ccaaaccggg 1440 ttctgttcaa gttgaaaagc ttatgaatat tgagcgctat tcccatgtta tgcacatcag 1500 ctcaacagtc acaggggagt tattagatca cttaacaagc tgggatgcat tgcgtgctgc 1560 tttacctgtt ggtacagtta gcggagcacc gaaggtcaaa gccatgcagt tgattgatga 1620 gttggaagtc gcaagaaggg ggccctatag tgggggattt ggaggtatat cattcaatgg 1680 cgatatggac atagcccttg ctctgaggac catagttttc cctacaaatg ctcgttatga 1740 cacaatgtac tcctacaagg ataagaacaa acgcagagaa tgggttgccc atctccaggc 1800 tggagcggga attgtggctg acagtgatcc tgctgatgaa caaagagagt gcgagaacaa 1860 agctgcagct cttgctcgtg ccattgatct tgcagaatct tcatttgttg ataaataatt 1920 tggattgatc catcatcagt gatgctcctt gataactgag gggcatcctt tttaaatggt 1980 agagaggaag tttgtggtgt gggcagatga taggggatat gaattacgga gaatctgaaa 2040 ctttgataat gttatgacag aagtgatgaa cataataagg tatttaatga taatgacagc 2100 tttgtgactt tagttaagtc gtcgtttaag agacttcaat agccatttcc gtcggtccat 2160 cttaaaccaa agaaaggtgc ctttgacgga gtttcttttg ctatcataaa 2210 113 988 DNA Glycine max 3′UTR (926)..(988) 113 actcggctat gcatccaacg cgttgggagc tctcccatat ggtcgacctg caggcggccg 60 cgaattcact agtgattaac atttgaacat ggctgccaca ttcttctctc acttgtcgct 120 tcttcaatcc aacaacaacc cttctctctc tcacacaccc tctcgcttcc ctcattctct 180 caccaaccgt gtcaaaccct ccctcggtgt ggtatctgtg gccaaaaggg taagtggagt 240 ggtgccaaag gccaatttga atgccttgga ggccaattcg ggtttcccca tttcggctaa 300 gaagtccaac aacaacccca ttgttgttat tgacaactat gacagtttca cctataatct 360 ttgccagtat atgggggagt tagggtttca ctttgaggtc taccgcaatg atgagttgac 420 agtggaggag ttaagaagga aaaatcccag aggagtgctg atatcacctg ggccaggaga 480 acctcaagat tcaggcatat ctttgcaaac ggttttggaa cttggaccaa ctgtgccatt 540 gtttggtgtg tgcatgggtt tgcaatgcat tggagaggct tttggaggga agattgttcg 600 ttctcctcat ggtgttatgc atggaaaaag ctctatggtt tactatgatg agaaaggaga 660 agatggatta cttgctggac tatcaaatcc tttcttggct ggtagatatc acagccttgt 720 aattgaaaaa gagagctttc ctcatgatga acttgaggca acagcatgga cagaagatgg 780 tcttataatg gctgctcgtc ataagaaata taagcatcta cagggtgttc agtttcatcc 840 agagagcatc ataaccccag aaggcaagac aattgtccgt aattttgtca agcttatcga 900 gaaaagggag gctggtggct cttgaaaatc gaattcccgc ggccgccatg gcggccggga 960 gcatgcgacg tcgggccbaw kcggmgtt 988 114 47 PRT Zea mays misc_feature The sequence of a CTP. 114 Met Glu Ser Leu Ala Ala Thr Ser Val Phe Ala Pro Ser Arg Val Ala 1 5 10 15 Val Pro Ala Ala Arg Ala Leu Val Arg Ala Gly Thr Val Val Pro Thr 20 25 30 Arg Arg Thr Ser Ser Arg Ser Gly Thr Ser Gly Val Lys Cys Ser 35 40 45 115 32 PRT Zea mays misc_feature The sequence of a CTP. 115 Met Ala Thr Ala Ser Leu Ala Leu Ser Leu Arg Leu Ala Pro Ser Ser 1 5 10 15 Arg Pro Leu Ser Leu Arg Arg Arg Gly Ala Ala Gly Val Thr Cys Arg 20 25 30 116 849 DNA Zea mays 116 atggcctgct cccacatcgt cgccgccgcg ggggtctcct cccccgccgc agcggcggct 60 cgttccccgg cgcattctcc cgctgccgcc ttcgcgcgcc tccggtcgac gcctcgtttc 120 gcgagcgctg gcttgtcggt taagggaaac ggagcggcgt tcccgttggt cgccgccgcg 180 gggccggccg cggcggcacc ggtggccgac ctggacggcc gcccggccac ggagaagcag 240 cccatcatcg tcatcgacaa ctacgacagc ttcacataca acctctgcca gtatatgggg 300 gagcttggat tgaacttcga agtataccgc aatgatgaac tgaccataga agatgtgaga 360 aggaagaacc caaggggaat acttatttct ccaggacctg gtgaaccaca agattcggga 420 atatcattgc agactgttct tgaattaggc ccaaccatcc caatttttgg agtttgcatg 480 ggtctgcaat gcattggaga ggcatttgga ggaaagatta tccgtgctcc ttctggagtg 540 atgcatggga aaagctctcc agtttattac gatgaggaat taggaaaggc attgttcaat 600 ggcttgccaa acccttttac tgccgcgagg taccacagct tggtcattga gcaagaaacc 660 ttcccacatg atgctttgga ggctactgca tggactgaag atggacttat catggctgct 720 cgccacaaga agtacaaaca catccagggt gtccaattcc acccggagag catcatcacc 780 cctgaaggca agaaaatcat cctcaacttt gtcagattca ttgaggaact ggagaagcag 840 cgttcgtag 849 117 273 PRT Oryza sativa 117 Met Ala Thr Ala Ala Arg Leu Leu Pro Lys Ile Gln Ser Pro Ala Ser 1 5 10 15 Pro Ala Val Ala Glu Ala Arg Arg Arg Arg Pro Ser Ser Leu Arg Leu 20 25 30 Gly Val Thr Ser Gly Pro Ala Arg Thr Leu Lys Gln Lys Leu Val Ala 35 40 45 Lys Ser Ala Val Ser Val Val Glu Gly Glu Asn Ala Phe Asp Gly Val 50 55 60 Lys Gln Asp Thr Arg Pro Ile Ile Val Ile Asp Asn Tyr Asp Ser Phe 65 70 75 80 Thr Tyr Asn Leu Cys Gln Tyr Met Gly Glu Val Gly Ala Asn Phe Glu 85 90 95 Val Tyr Arg Asn Asp Asp Ile Thr Val Glu Glu Ile Lys Lys Ile Ser 100 105 110 Pro Arg Gly Ile Leu Ile Ser Pro Gly Pro Gly Thr Pro Gln Asp Ser 115 120 125 Gly Ile Ser Leu Gln Thr Val Gln Asp Leu Gly Pro Ser Thr Pro Leu 130 135 140 Phe Gly Val Cys Met Gly Leu Gln Cys Ile Gly Glu Ala Phe Gly Gly 145 150 155 160 Lys Val Val Arg Ser Pro Tyr Gly Val Val His Gly Lys Gly Ser Leu 165 170 175 Val His Tyr Glu Glu Lys Leu Asp Gly Thr Leu Phe Ser Gly Leu Pro 180 185 190 Asn Pro Phe Gln Ala Gly Arg Tyr His Ser Leu Val Ile Glu Lys Asp 195 200 205 Ser Phe Pro His Asp Ala Leu Glu Ile Thr Ala Trp Thr Asp Asp Gly 210 215 220 Leu Ile Met Ala Ala Arg His Arg Lys Tyr Lys His Ile Gln Gly Val 225 230 235 240 Gln Phe His Pro Glu Ser Ile Ile Thr Thr Glu Gly Arg Leu Met Val 245 250 255 Lys Asn Phe Ile Lys Ile Ile Glu Gly Tyr Glu Ala Leu Asn Cys Leu 260 265 270 Pro 118 282 PRT Zea mays 118 Met Ala Cys Ser His Ile Val Ala Ala Ala Gly Val Ser Ser Pro Ala 1 5 10 15 Ala Ala Ala Ala Arg Ser Pro Ala His Ser Pro Ala Ala Ala Phe Ala 20 25 30 Arg Leu Arg Ser Thr Pro Arg Phe Ala Ser Ala Gly Leu Ser Val Lys 35 40 45 Gly Asn Gly Ala Ala Phe Pro Leu Val Ala Ala Ala Gly Pro Ala Ala 50 55 60 Ala Ala Pro Val Ala Asp Leu Asp Gly Arg Pro Ala Thr Glu Lys Gln 65 70 75 80 Pro Ile Ile Val Ile Asp Asn Tyr Asp Ser Phe Thr Tyr Asn Leu Cys 85 90 95 Gln Tyr Met Gly Glu Leu Gly Leu Asn Phe Glu Val Tyr Arg Asn Asp 100 105 110 Glu Leu Thr Ile Glu Asp Val Arg Arg Lys Asn Pro Arg Gly Ile Leu 115 120 125 Ile Ser Pro Gly Pro Gly Glu Pro Gln Asp Ser Gly Ile Ser Leu Gln 130 135 140 Thr Val Leu Glu Leu Gly Pro Thr Ile Pro Ile Phe Gly Val Cys Met 145 150 155 160 Gly Leu Gln Cys Ile Gly Glu Ala Phe Gly Gly Lys Ile Ile Arg Ala 165 170 175 Pro Ser Gly Val Met His Gly Lys Ser Ser Pro Val Tyr Tyr Asp Glu 180 185 190 Glu Leu Gly Lys Ala Leu Phe Asn Gly Leu Pro Asn Pro Phe Thr Ala 195 200 205 Ala Arg Tyr His Ser Leu Val Ile Glu Gln Glu Thr Phe Pro His Asp 210 215 220 Ala Leu Glu Ala Thr Ala Trp Thr Glu Asp Gly Leu Ile Met Ala Ala 225 230 235 240 Arg His Lys Lys Tyr Lys His Ile Gln Gly Val Gln Phe His Pro Glu 245 250 255 Ser Ile Ile Thr Pro Glu Gly Lys Lys Ile Ile Leu Asn Phe Val Arg 260 265 270 Phe Ile Glu Glu Leu Glu Lys Gln Arg Ser 275 280 119 822 DNA Oryza sativa 119 atggccaccg ccgcgcggct cctccccaag atccagtccc ccgcctcccc ggccgtcgcg 60 gaggcgcgga ggcgccgccc ctccagtctc cgattaggag ttactagtgg acccgcaaga 120 actctgaagc aaaagcttgt tgctaagagt gctgtttctg tggtggaagg tgaaaacgca 180 tttgatggag taaagcaaga tactagacca atcatagtta tagataacta cgatagcttc 240 acgtataatt tatgccagta catgggtgag gtgggagcta actttgaggt gtaccgcaat 300 gatgatatca ccgtggaaga aattaagaag atttctccta gaggaatact catctcccct 360 ggccctggca cacctcaaga ttcaggaata tcattgcaaa cagttcaaga tcttggacct 420 tctacacctt tgtttggggt ttgcatgggt ttgcagtgta ttggggaggc atttggaggg 480 aaggttgttc gttctcctta tggagttgtg catgggaaag gatcccttgt tcactatgag 540 gagaaacttg atggaacact gttttctggt ctcccaaacc cattccaagc gggaagatac 600 cacagccttg taattgagaa ggatagcttc ccacatgatg ccctggaaat tactgcttgg 660 acagacgatg ggctgatcat ggctgctcgc cacaggaagt acaaacatat acagggtgtg 720 cagttccatc cagagagcat cataacaaca gaagggaggc tcatggtcaa gaatttcatc 780 aagattattg aaggctacga ggccttgaat tgcttaccgt ga 822 120 867 DNA Oryza sativa 120 atggcgtgct cccacctggc cgccgccgcc gccgcggcct ccccggcggc cgcgcgttca 60 ccggcggcct ccagcgccgc aaccgcgagc gccttcgcgc gcctctcggc gacgccccgg 120 gtcgcgagcg gcgggttggc cgttaggggc cagaggggtg tagccgctgt tgtcgccgcc 180 gccgccgggg ccgccgcggc gacgcccgtg gccgacatcg aggaacgccg ggccaccgag 240 aagcagccca tcattgtcat cgataactac gacagcttta cctacaacct ctgccagtat 300 atgggggagc ttggattgaa ctttgaggta tatcgcaatg atgaacttac catagaggat 360 gtaaagagga agaacccaag aggaatactt atttctccag ggcctggtga gccacaagat 420 tcaggtatat cattgcagac tgttctggaa cttggaccta ccatcccaat ttttggtgtc 480 tgcatgggtc tgcagtgtat cggggaagct tttggaggaa agattatccg tgctccttct 540 ggtgtcatgc atggaaaaag ctctccagtt cgctacgatg aggagctagg gaaggccttg 600 ttcaatggct tgccaaaccc atttaccgct gcaagatacc atagcttggt gatcgagcag 660 gagaccttcc cccatgacgc tctggaagcc accgcgtgga ctgaagatgg ccttatcatg 720 gctgctcgcc acaagaagta caggcacatc cagggagtcc aattccaccc agagagcatc 780 atcaccccag aaggcaagag gatcattctc aacttcgtga ggttcatcga ggagctggag 840 aagcagcgtg ccggagagaa gaactag 867 121 2202 DNA Mesorhizobium loti 121 atggagacgg caatgacgat gaaggttctg gaaaacggcg ctgaaagctt cgtgaccgcg 60 ggtggcatca ccattacgcg tgagcgccac gaccggccct atgcgggtgc gatcgacgct 120 tatgtcgatg gcttgaactc gcgccgcggc gcggtgtttt cctccaacta cgaatatccc 180 ggccgctata cgcgctggga caccgccatc atcgatccgc cgctggtcat ttccgcgcgg 240 ggccgcgcca tgcgcatcga agcgctgaac cgccgcggcg aggcgctgtt gccggtgatc 300 ggcaaaacgc tgggcggcct tgccgacatc accatcgccg agacgacgaa gacgctcatc 360 cgcctcgacg tcgccaagcc cggccgcgtc ttcacggagg aagagcgcag ccgcgtgccc 420 tcggtcttca ccgtgctgcg cgccatcacc gctttgttca aaaccgacga ggacgccaat 480 ctcggcctct atggcgcctt cggctacgac ctctccttcc agttcgaccc ggtcgactac 540 aagctcgagc gcaagcccag ccagcgcgac ctcgtgctgt tcctgcccga cgagatcctg 600 gtcgtcgacc actattccgc caaagcctgg accgaccgct acgactattc gggcgaagga 660 ttttcgaccg aaggtctgcc gcgcgacgca atcgccgagc cgttcaagac cgccgaccgc 720 atcccgccgc gcggtgacca tgagccgggc gaatacgcta atctggtgcg gcgtgccatg 780 gactcgttca agcgcggcga cctgttcgag gtcgtgcccg gccagatgtt ctacgagcgc 840 tgcgagacgc agccctccga catttcgcgc aagctgaaat cgatcaaccc ctcgccttat 900 tcgttcttca tcaacctcgg cgaaaacgaa tatctgatcg gcgcctcgcc cgaaatgttc 960 gtgcgcgtca atggccgccg cgtcgaaacc tgcccgattt cgggcaccat caaacgcggc 1020 gacgacgcca tttccgatag cgagcagatc ctgaagctgc tcaattcgaa gaaggacgaa 1080 tccgagctca caatgtgctc ggacgtcgac cgcaacgaca agtcgcgggt ctgcgagccc 1140 ggctcggtgc gcgtcatcgg ccgccgccag atcgagatgt attcgcgcct catccacacc 1200 gtcgatcaca tcgaaggccg gctgcgcgaa ggcatggacg ctttcgacgc cttcctgtcg 1260 catgcctggg cggtcactgt caccggcgcg ccgaaactgt gggccatgcg cttcatcgag 1320 cagaacgaga agagcccgcg cgcctggtat ggcggcgcaa tcggcatggt caacttcaac 1380 ggcgacatga acaccggcct gacgctgcgc accatccgca tcaaggacgg cattgccgaa 1440 gtgcgggccg gcgcgacatt gctgttcgac agcattcccg aggaagaaga agccgaaacc 1500 gaactgaagg catccgccat gctctccgcc atccgcgacg ccaagacggg caactccgcc 1560 agcaccgagc gcaccaccgc gcgggtcggc gacggcgtca acatcctgct cgtcgaccac 1620 gaggactctt tcgtccacac gctggccaac tacttccgcc agaccggcgc caatgtctcg 1680 accgtgcgca cgccggtgcc ggacgaagtg ttcgagcggc tgaagccgga ccttgtcgtg 1740 ctctcacccg gaccgggtac gccgaaggat ttcgattgcg ccgcgaccat cagacgagcg 1800 cgcgcccgcg acctgccgat cttcggcgtc tgcctaggcc tgcaggcgct ggccgaggcc 1860 tatggcgggg aactgcgcca gctgcatatt cccatgcacg gcaagccctc gcgcatccgc 1920 gtctccaagc ccggcatcat cttctccggc ctgcccaagg aagtcactgt cggccgttac 1980 cactcgatct tcgccgatcc ggtgcgcttg cccgatgatt tcattgtcac ggcagagact 2040 gaggacggca tcatcatggc tttcgagcac cgcaaggagc cgatcgcggc ggtgcagttc 2100 cacccggaat cgatcatgac gctcggccac aatgccggca tgcgcatcat cgagaacatc 2160 gtcgcccatt tgccgcgcaa ggccaaggaa aaggcagcct ga 2202 122 2199 DNA Azospirillum brasilense 122 atgtaccccg ccgaccttct tgcctcgccc gacctcctcg aaccgctgcg tttccagacg 60 cgcggcggcg tcaccgtcac gcggcgggcg acggcgctcg acccgcggac cgccctcgac 120 ccggtgatcg acgcgctgga ccgccgccgc ggcctgctgc tgtccagcgg ggtggaggcg 180 ccgggccgct accgccgtca cgcgctgggc ttcaccgacc ccgcggtggc gctcacggcg 240 cgtgggcgga cgctgcgcat cgacgcgctg aacgggcggg ggcaagtgct gctgcccgcc 300 gtcgccgagg ccctgcgtgg cctggaggcc ctggccggtc tagaggaggc gccgtcgcgg 360 gtcactgcct cgtccgcaag cccagcaccc cttcccggag aggagcggag ccgccagccc 420 tccgttttct cggtcctgcg ggcggtgctg gatctgtttg ccgcccccga cgacccgttg 480 ctcgggctct acggggcctt cgcctacgac ctcgccttcc agttcgagcc gatccgccag 540 cggttggagc ggcccgacga ccagcgcgat ctgctgctct acctgccgga ccggctcgtc 600 gcgctggacc ccatcgcagg actcgcccgg ctcgtcgcgt atgagttcat cacggcggcg 660 ggcagcaccg aggggctgga gtgcggcggg cgcgaccacc cctaccgtcc cgacaccaac 720 gccgaggccg gctgcgacca cgcgcccggt gactatcagc gcgtcgtcga gagcgccaag 780 gccgccttcc gccgcggcga cctgttcgag gtggtgcccg gccagacctt cgccgagccc 840 tgcgccgacg cgccttcgtc ggtgttccgg cggctgcgcg ccgccaaccc ggcgccttac 900 gaggccttcg tcaacctcgg gcggggcgag ttcctcgtcg ccgccagccc ggagatgtat 960 gtgcgggtgg cgggcgggcg ggtggaaacc tgcccgatct ccggcaccgt ggcgcgcggg 1020 gccgacgcgc tgggcgacgc cgcgcaggtc ctgcgcctgc tgacctcggc caaggacgcg 1080 gcggagctga ccatgtgcac cgacgtggac cgcaacgaca aggcgcgggt gtgcgagccg 1140 ggatccgtcc gggtgatcgg gcggcggatg atcgagctgt actcccgtct gatccacacg 1200 gtggaccatg tggagggacg gctgcggtcc ggaatggacg cgctggacgc cttcctcacc 1260 cacagctggg cggtgacggt gaccggcgcg cccaagcgct gggccatgca gttcctggag 1320 gatacggagc aatcgccgcg ccgctggtac ggcggggcct tcggccggct gggcttcgac 1380 ggcgggatgg acaccggcct gaccctgcgc accatccgca tggccgaggg cgttgcctac 1440 gtgcgggcgg gggcgacgct gctgtccgac agcgatccgg acgcggagga cgcggagtgc 1500 cgcctgaagg ccgccgcctt ccgcgacgcc atccgcggga cggcggcggg tgcggcgccc 1560 acgctgccgg cggctccccg tggcggggag ggcaggcggg tgctgctggt ggatcacgac 1620 gacagcttcg tccacacgct ggccgactat ctgcgccaga cgggcgcttc ggtgacgacg 1680 ctgcgtcaca gtcacgcacg ggcggcgctg gcggagcgga ggccggatct ggtcgtgctg 1740 tcccccggtc cggggcgccc ggcggatttc gacgtggcgg gcaccatcga cgcggcgctg 1800 gcgctcggcc tgccggtgtt cggcgtctgc ctgggcctgc aagggatggt ggagcgcttc 1860 ggcggcgcgc tggacgtgct gccggagccc gtccacggca aggcgacgga ggtccgggtg 1920 ctgggcggcg cgctgttcgc cggcctgccg gagcggctga cggtcgggcg ctaccactct 1980 ctggtggccc ggcgcgaccg gctgccggcg gacctcacgg tgaccgcgga gaccgccgac 2040 ggtctggtga tggcggtcga gcaccggcgg cttccgctcg ccgccgtgca gttccacccc 2100 gagtcgatcc tgtcgctcga cggtggggcc ggtcttgccc tgctgggcaa cgtgatggac 2160 cggctggccg ccggcgccct gacggacgct gcggcttga 2199 123 2196 DNA Brucella melitensis 123 atgaatgcga agactgcgga tagcgagata ttccagcacg aaacggcagg cggtatcatc 60 gtcgagcggg tgcgccacct cacggcctat aagggcgcca ttgaaagcta tatcgatgtg 120 ctgaacgaat ggcgcggtgc ggtgttctcg tccaattacg aatatccggg ccgctatacg 180 cgatgggata ccgcaattgt cgatccgccg gtcgtcatca cgtcgcgtgc ccgcacgatg 240 cgcatcgagg cgctgaacgc gcgcggcgtc atcctgcttc ggcccattct ggataccgtc 300 aaggcgcttt cggaagtaaa gatcgaccag tccggcgaaa accgtatcga tctgacgatt 360 gtggaaccgg tcggcacctt cacggaagaa gaacgctcgc gcatgccctc ggtctttacg 420 gtgctgcgcg ccatagtcgg gcttttcttc tcggaggagg atgccaatct cggcctttat 480 ggcgcctttg gctatgatct ggcgttccag ttcgatccca tccagtacaa gctgaagcgc 540 ccggacgacc agcgtgacct cgtgctgttc attcccgacg aaatcttcgt cgccgaccat 600 tatgcggcgc gcgcctgggt ggaccgttat gaatttcgct gcggcggttc gtccacgcac 660 ggtcttgatc gcgcgacgcc ggtggtgcct ttcaagccat cggagcgcaa gcttgcgcgc 720 ggcgatcata atccgggtga atatgccagg cttgtcgagc gcgccaagga aagcttcaag 780 cgcggcgacc tgttcgaggt tgtgccgggc cagaccttct atgagcgctg ccacacggcg 840 ccgtcggaga ttttccgccg gctgaagtcg atcaatcctt cgccctattc ctttttcatc 900 aatctgggcg agagcgaata tctggtcggc gcatcgccgg aaatgtttgt gcgcgtcaat 960 gggcggcgca tcgagacctg cccgatttcc ggcaccatca agcgcggtga agatgcaatt 1020 tcggattctg agcagatatt gaaactgctt aattccaaga aggacgaatc cgagctgacc 1080 atgtgttcgg atgtggaccg caacgacaag agccgcgttt gcgagccggg ttcggtgcgt 1140 gttatcggtc gccgccagat cgagatgtat tcccgcctga tccatacggt cgatcatatc 1200 gaaggccgcc tgcgtgacgg catggatgcg tttgacggct tcctcagcca tgcatgggct 1260 gtgacggtga caggcgcgcc gaagctgtgg gcaatgcgct ttcttgagga aaacgaacgc 1320 agcccgcgcg catggtatgg cggcgcgatc ggcatgatgc atttcaatgg cgatatgaat 1380 acagggctga cgctgcgcac catccgcatc aaggatggtg tggcggaaat ccgtgcaggg 1440 gcgacgcttc tgttcgattc caaccctgac gaggaagaag ccgagaccga attgaaggca 1500 tcggccatga ttgcggctgt gcgggacgca cagaagagca atcagatcgc ggaagaaagt 1560 gtggcggcaa aggtgggtga gggggtttcg atcctgctgg tcgatcacga ggattccttc 1620 gtccatacgc ttgccaatta tttccgccag acgggcgcca aggtttccac cgtgcgttca 1680 ccggtggcag aggagatatt cgaccgcgtc aatcccgatc tggtggtgtt atcgccggga 1740 ccgggctcgc cgcaggattt cgattgcaag gcgaccatcg ataaggcgcg caagcgccag 1800 cttccgattt ttggcgtctg cctcggcctt caggccctgg cggaagccta tggcggggcg 1860 ttgcgccagc ttcgcgttcc ggtgcatggc aagccttcac gcatccgcgt atcaaagccg 1920 gagcgcattt tctccggctt gccggaggaa gtgacggtgg ggcgttatca ttcgatcttc 1980 gccgatcctg aacgcctgcc ggatgatttt ctcgtcacag ccgaaacgga agacgggatc 2040 atcatggctt ttgaacataa acatgaaccg gtggcagccg ttcaattcca tcccgaatcc 2100 atcatgacgc ttggccataa tgccggtatg cgcatgatcg agaatatcgt gacgcatctt 2160 gcaggcaagc acaaggcgcg ccgcaccaac tattga 2196 124 2148 DNA Nostoc sp. 124 gtgcgcgtat ctcgtagcac aaccgaggtg aagatggaca ctgcactaga tgaaattctc 60 tttcacctaa atcaagtacg tggaggtttg ttaaccagta gttacgaata tccagggcga 120 tacaaaagat gggcgattgg attcattaat cccccattac aactgacaac aagagagaac 180 gcatttacca tctcttcact caatcctcgc ggacaggtgc tactaccaac cttgttccag 240 catctatcag cccagtcgca actacaacaa atcagcctca atcatgacta catcacaggt 300 gaaattcgac ccacaaaaca gttattcaca gaagaacaac ggagtaaaca accgtcagcc 360 tttacagtca tccgcgaaat tctccagatt tttgcgagtg atgaagacga gcatttaggg 420 ttatatggtg catttggtta cgacttagta tttcaatttg aaccaattcc ccaaaaaatt 480 gctcgtcccg cagaccaacg ggatttagtc ctgtatctac ccgatgaact catagttgta 540 gattactatc tacaaaaagc atatcgtcac cagtatgaat ttgccacaga acatggcaac 600 accgagcatc ttccacggac aggccagtcc atcgactacc agggtaaaca tcttctacca 660 aaccaaactg ctgaccatca accaggagaa tatgccaacc tagttgagca agcactcgac 720 tacttccgcc ggggtgactt atttgaagta gttcctagtc aaaacttttt tacagcctgt 780 gaacaatcac ccagtcaact attccagacc ttaaggcaaa ttaatcctag tccttatgga 840 tttctgttga atttgggtgg tgaatatctc ataggtgcat caccagaaat gtttgtgcga 900 gttgatggta ggcgagtgga aacctgtccc attagtggca ctattagacg gggagaagat 960 gctttaggcg acgctgtaca aattcgtcag ttgcttaact cccataaaga tgaagccgag 1020 ttaacaatgt gtactgacgt agaccgcaac gataaatcgc ggatttgtga acccggttca 1080 gtcagggtga ttggtcgtcg ccagattgaa ctgtacagcc acctcattca tacagtagac 1140 catgtagaag ggatactgag gccggaattt gacgctttag atgccttctt gagtcatact 1200 tgggcagtta cagtcacagg cgcacccaaa cgagccgcca tgcagttcat cgaacagcat 1260 gaacgcagcg cccgtcgttg gtatggggga gcagttggtt atttaggctt taatggtaac 1320 ttgaataccg gattaacctt gcggacaatt cgtttacaag actccatcgc cgaagtgcga 1380 gttggtgcaa cagtccttta cgactccatt ccgtcagccg aagaagagga aacaattact 1440 aaagcgactg cattatttga gaccattcgc cgtcatacca ctgccaataa aactcaagga 1500 aacgatagtc atcgccctgg ggatatcgcc cacaataagc gtatcctcct catcgactac 1560 gaagattcat ttgttcacac attagccaat tacatccgca ccaccggcgc aaccgtcacc 1620 accctacgtc atggttttgc tgaatcatat tttgatgcag aacgcccaga cttagtggta 1680 ttgtctcccg gccctggtag acccagtgac ttccgagttc cccaaacggt tgcagccttg 1740 gtaggtcgag aaatccccat ttttggcgtt tgtctgggat tacaaggcat agtggaagct 1800 tttggcggag aattaggcgt gcttgattat ccccaacacg gtaaacccgc acggatttca 1860 gtgactgcac ctgattctgt gctgtttcaa aatttaccag catccttcat cgtgggtaga 1920 taccattcct tatttgccca accccaaact atacccggtg aactcaaagt cacagcgatt 1980 tctgaggaca atgtaattat ggcaattgaa caccaaacac tacctatagc cgccgtccaa 2040 tttcatccag agtcaatcat gaccctagca ggagaagttg gtcagacaat cattaaaaat 2100 gtggtgcaga catataccca aactttagaa acatcaattt actcttag 2148 125 2208 DNA Nostoc sp. 125 atgattgccg attcccacag ctacagaact aatggtaacg tgcgtgtctc tcgctccatc 60 acacaagtta aaatggagac agctttagaa gagattcttt tctacttaaa ctctcagcgt 120 ggtggattgc tgactagtag ctatgaatat ccaggaagat ataaaagatg ggcaattggt 180 tttgttaatc cacctgtaga attatccaca agcggaaata cttttactct cacagcatta 240 aatgagcgtg gctatgtact tttaccagtg atctttgagt gtttatcaaa atcagaacaa 300 ctccagaaac tcactgaaca tcatcataaa attactggat tagttaaatc tacaccagaa 360 ttttttgccg aagaagaacg tagtaaacaa ccttctacat ttacggttat tcgggaaata 420 ctacatatct tctctagtca agaagacgaa catttaggat tatatggtgc gtttggttat 480 gacttagttt tccaatttga gcaaataacc caatgcttag aacgtccaca agaccaacga 540 gatttagttc tatatttacc cgacgaattg atagttgtag actactatca acaacaagca 600 tttcggctag agtatgactt catcacagcg catggtagta cttatgattt gccccgcacg 660 ggagaatctg ttgattatcg aggtcaatgt ttaacacctc ctcaaaatgc tgaccataaa 720 ataggtgagt atgccaaact agtagaattt gcccttgatt atttccgtcg gggtgactta 780 tttgaagtgg ttcccagtca gaattttttc acagcttgcg aagcaccacc aagccaacta 840 tttgaaactt taaaacaaat aaatcctagt ccctatggat ttatttttaa tcttggtgga 900 gaatacatca ttggcgcttc accagaaatg tttgtacggg tggaaggtag gcgtgtagaa 960 acttgtccta ttagtggcac tattactaga gggcatgatg ctatagatga tgctgtgcag 1020 attcgtcagt tactcaactc ccacaaagac gaagcagagt tgactatgtg tactgacgta 1080 gaccgtaacg ataagtctcg catctgtgaa cccggttcag tcaaggtgat tggtcgccgg 1140 caaattgaat tatatagcca cttaattcat acggtagacc atgtagaagg cattctccga 1200 ccagagtttg atgctttaga tgctttcctc agtcacactt gggctgttac agtcacaggc 1260 gcaccgaaaa gggctgctat tcaattcatc gaaaagaacg aacgcagcgt cagacgttgg 1320 tatggtggcg cggttgggta tttgaatttt aacgggaatt taaatactgg gttaatttta 1380 aggacaatca gattgcaaga ctcaattgct gaagtgcgag ttggtgctac tctactgtat 1440 gactccatac cccaagcaga agaacaagaa accatcacta aagctgcggc tgcttttgaa 1500 acgattcggc gtgctaaaca aatagaccca cagattgaag aatctagtac tagaaagtta 1560 agcaaatatc ttcccgatgg acaatcaggt aaacacatct tactaattga ccatgaagac 1620 tcatttgttc ataccctagc taactacatc cgttccactg gtgcaactgt caccacactg 1680 cgtcacggct tctcagaatc cctatttgat acagaacgcc cagacttagt agtattatct 1740 cctggccccg gtagaccgag tgaatttaaa gtacaggaaa ccgtcgccgc ctgcgtccgt 1800 cgccaaatac ctctgtttgg tgtctgttta ggactgcaag gtattgtgga agctttcggt 1860 ggagaattgg gagtattgaa ttatccccaa catggtaaat cttcgcggat ttttgttaca 1920 gcacccgatt ctgtgatgtt tcaagatttg cccgaatctt ttacagtcgg gagatatcat 1980 tcattatttg cactatcaca acgcttacca aaagaactga aggtgacagc gatttctgat 2040 gatgaggtga ttatggcgat tgaacatcag acactaccta tcgccgccgt ccagtttcat 2100 ccagaatcaa tcatgactct agctggagaa gttggtttaa tgatgatcaa aaatgtggtg 2160 caaaaatata cacaaagtca acagtcaaca gttcccatct atgactaa 2208 126 2160 DNA Rhodopseudomonas palustris 126 atgaacagga ccgttttctc gcttcccgcg accagcgact ataagaccgc cgcgggcctc 60 gcggtgacgc gcagcgccca gccttttgcc ggcggccagg cgctcgacga gctgatcgat 120 ctgctcgacc accgccgcgg cgtgatgctg tcgtccggca caaccgtgcc gggccgctac 180 gagagcttcg acctcggctt tgccgatccg ccgctggcgc tcaccactag ggccgaaaaa 240 ttcaccatcg aggcgctcaa tccgcgcggc cgggtgctga tcgcgttcct gtccgacaag 300 cttgaagagc cctgcgtggt ggtggagcag gcctgcgcca ccaagatcag gggccacatc 360 gtccgcggcg aggccccggt cgacgaagaa caacgcaccc gccgcgccag cgcgatctcc 420 ctggtgcgcg cggtgattgc tgccttcgcc tcgccggccg atccgatgct cgggctgtac 480 ggcgccttcg cctacgacct tgtgttccag ttcgaggatc tgaagcagaa gcgtgcccgc 540 gaagccgacc agcgcgacat cgtgctgtac gtgccggatc gcctgctggc ctacgatcgc 600 gccaccggcc gcggcgtcga catttcctac gaattcgcct ggaagggcca gtccaccgcc 660 ggcctgccga acgagaccgc cgagagcgtc tacacccaga ccggccggca gggtttcgcc 720 gaccacgccc cgggcgacta tcccaaggtg gtcgagaagg cccgcgcggc gttcgcccgc 780 ggcgacctgt tcgaggcggt gccgggccag ctgttcggcg agccatgcga gcggtcgccg 840 gccgaagtgt tcaagcggtt gtgccggatc aacccgtcgc cctatggcgg cctgctcaat 900 ctcggcgacg gcgaattcct ggtgtcggcc tcgccggaaa tgttcgtccg ctcggacggc 960 cgccggatcg agacctgccc gatctccggc actatcgccc gcggcgtcga tgcgatcagc 1020 gatgctgagc agatccagaa gctcttgaac tccgagaagg acgagttcga gctgaatatg 1080 tgcaccgacg tcgaccgcaa cgacaaggcg cgggtctgcg tgccgggcac gatcaaagtt 1140 ctcgcgcgcc gccagatcga gacctattcg aagctgttcc acaccgtcga tcacgtcgag 1200 ggcatgctgc gaccgggttt cgacgcgctc gacgccttcc tcacccacgc ctgggcggtc 1260 accgtcaccg gcgcgccgaa gctgtgggcg atgcagttcg tcgaggatca cgagcgtagc 1320 ccgcggcgct ggtatgccgg cgcgttcggc gtggtcggct tcgatggctc gatcaacacc 1380 ggcctcacca tccgcaccat ccggatgaag gacggcctcg ccgaagttcg cgtcggcgcc 1440 acctgcctgt tcgacagcaa tccggtcgcc gaggacaagg aatgccaggt caaggccgcg 1500 gcactgttcc aggcgctgcg cggcgatccc gccaagccgc tgtcggcggt ggcgccggac 1560 gccactggct cgggcaagaa ggtgctgctg gtcgaccacg acgacagctt cgtgcacatg 1620 ctggcggact atttcaggca ggtcggcgcc caggtcaccg tggtgcgcta cgttcacggc 1680 ctgaagatgc tggccgaaaa cagctatgat cttctggtgc tgtcgcccgg tcccggccgg 1740 ccggaggact tcaagatcaa ggatacgatc gacgccgcgc tcgccaagaa gctgccgatc 1800 ttcggcgtct gcctcggcgt ccaggcgatg ggcgaatatt ttggcggtac gctcggccag 1860 ctcgcgcagc cggctcacgg ccgcccgtcg cggattcagg tgcgcggcgg cgcgctgatg 1920 cgcggtctcc cgaacgaggt caccatcggc cgctaccact cgctctatgt cgacatgcgc 1980 gacatgccga aggagctgac cgtcaccgcc tccaccgatg acggcatcgc gatggcgatc 2040 gagcacaaga ccctgccggt cggcggcgtg cagttccacc ccgagtcgct gatgtcgctc 2100 ggcggcgagg tcgggctgcg gatcgtcgaa aacgccttcc ggctcggcca ggcggcctaa 2160 127 2166 DNA Bradyrhizobium japonicum 127 atgaacagga cagtctttgc cctcccggcc agaagcgatt acgtgacccg cggcggtctc 60 gcgatcacgc gcgtggcgga gcagtttacc ggcggcgcga gccggctcga cgatctcgtc 120 aacctgctcg accgccgccg cggcgtggtg ctgtcctcgg gcacgaccgt gccgggccgc 180 tacgagagct tcgacctcgg cttctccgat ccgccgctca agctcgagac cacaggcgtc 240 aatttcaagc tggaagccct gaacgagcgc ggccaggtgc tgatcgcctt ccttgccgat 300 gtcctgcgcg agccctgcgt ggtgatatcc gaaaagaccg cttcgcgcct cgccggccac 360 atcatccgcg gcgatgcccc ggtcgaggaa gaccagcgca cccggcgcgc cagcgtggtg 420 tcgctggtgc gcgacctcgt cgccgccttc tccgccaatg acgacgggct gctcggcctg 480 ttcggcgcct tcgcctacga tctcgtgttc cagatcgagg atctcgtgca gaagcgcgcg 540 cgcgagagcg accagcgcga catcgtgctc tacgttcccg atcgcctgct ggcctatgac 600 cgcgccaccg gccgcggcgt cgtgctcagc tacgacttca cgtggaaggg cagatccacc 660 gagggcctgc cgcgcgagac cgccgacagc ccgtacatga agacaccgcg ccagggcttt 720 gccgatcatg cgcccggcga ataccaggcc accgtcgaga ccgcgcgcgc ggcctttgcc 780 cgcggcgatc tgttcgaggc cgtgccgggc cagctgttcg ccgagccctg cgatcgttct 840 ccggcggaag tgttccagcg cctctgtgtc atcaacccgt cgccctacgg cgcgctgatg 900 aatctcggcg acggcgagtt tctcgtctcc gcctcgcccg agatgttcgt gcgttcggac 960 ggccgccgcg tcgagacctg cccgatctcg ggcaccatcg cgcgcggcac cgatgcgatc 1020 ggcgatgccg agcagatccg ccagctcctg aattcggaga aggacgagtt cgagctcaac 1080 atgtgcaccg acgttgatcg caacgacaag gcgcgcgtct gcgtccccgg caccatcaag 1140 gtgctggcgc gccggcagat cgagacctac tcaaaactgt tccacaccgt cgaccacgtc 1200 gagggcatgc tgcgtcccgg cttcgacgcg ctcgatgcct tcctcaccca tgcctgggcc 1260 gtcaccgtga caggtgcgcc gaagctctgg gcgatgcagt tcgtcgagga tcacgagcgg 1320 tcgccgcggc gctggtatgc gggtgcgatc ggcgcggtga atttcgacgg cagcatcaat 1380 accggcctca ccatccgcac catccgcatg aaggatggtc tcgccgaggt gcgcgtcggc 1440 gccacctgcc tgttcgattc cgatcccgct gccgaggacc gcgaatgcca ggtcaaggcg 1500 gcggcgctgt tccaggcgct gcgcggcgat ccgccaaaac cgctctcgac ctttgcgccc 1560 gatgcgaccg gaagcggcaa gcgggtgctg ctgatcgacc acgacgacag cttcgtgcac 1620 atgctcgccg actatttccg ccaggtcggc gccagcgtca ccgtggtccg ctatgtgcat 1680 gcgctcgaca tgctcaagca gaagaggtgg gatttgctgg tgctgtcgcc cggcccgggc 1740 aggcccgaag atttcgggat caggaagacg atcgatgcgg cgctggagaa caagctgccg 1800 gtgttcggcg tctgcctcgg cgtgcaggcg atcggcgaat attttggcgg cgagctcggc 1860 cagctcacgc atcccgccca cggccggccc tcgcgggtgc aggtgcgcgg cggccgcctg 1920 atgcgcaatt tgccgagcga gatcgtgatc ggccgctatc actcgctcta tgtcgagcgc 1980 gacagcatgc cggaggtttt gtccgtcacc gccagcaccg aggacggcgt cgctatggcg 2040 ctggagcaca agaccctgcc ggtcgcgggc gtgcaattcc acccggagtc gctgatgtcg 2100 ctcggcggcg aggtgggctt gaggattgtc gagaacgcgt tccggctgga tgcgcgtgtt 2160 gattga 2166 128 2187 DNA Rhodospirillum rubrum 128 atgcaaacat cgaccttcac caccgccggc ggttttacca tcagcagttg cctacgcccg 60 cttgccgggg cggatggcgc cttcgaggcg ctgatcgacc gactcgatcg ccatcgcggc 120 atggtgatcg cctcgaccta tgagtatccc ggccgctatc gccgccacgc cctggggttt 180 tgcgatccgc cgctggtgct ggagggcaag gggcgcgagg cccatctgct ggcgctcaat 240 cgccgggggc gggccctgct gccggccctg gccgttggct tggagggggc ggccgggctg 300 gagggcctgc gccgcgaggc cgaccggctg gtcttgcgtg tcaaggccat ggcgccctgg 360 ttccccgagg aggagcgctc gcgccaaccc tcgctgatgt cggtggtgcg cgccctcgcc 420 gggctgttcg ccgccgaaaa cgacccgttt ttcgggcttg tcggcgcctt tggctatgac 480 ctgggcttgg ctttcgagcg cctgccccat gcccggccgc gatcggccga tcaccgcgat 540 ctggtgcttt acctgcccga ccgtctgctg atcgacgatc ccgaagccgg cggccttgcc 600 gaacgccttt acgacatcac cgcggccgat ggggcaagca ccgccggctt ggcgcgggaa 660 accgccgctt acaccgccga ccaccccgcc ggcggcgtgc cgatcgagga tgatatgccc 720 ccgggcgctt acggggcgat cgtccgtggg ctgaaggagg ccttcgccgc cggggatctg 780 ttcgaggcgg tgccctcgcg cgccctgcgc cggccttgcg ccgaggcgcc gagccgtttg 840 taccggcggc tgcgcgcggc caatccggcg ccctatctgt tcctggccaa tctgggggcg 900 ggcgaacatc tgatcggcgc ctcgcccgaa atgttcgtgc gcgtcggtgg agcgccgggg 960 gcgcggcggg tggaaacctg cccgatctcg ggcaccatcg cccgggggcc cgacgccctg 1020 ggcgatgccg aggccatccg caccctgctc aattcgacca aggacgaggc cgaattgacc 1080 atgtgcaccg atgtcgaccg caacgacaag gcgcgggtct gcgtggccgg cagcgttacc 1140 gtcatcggtc gccgccagat cgagctatat tcccggctga tccacacggt cgaccatgtg 1200 gagggccggc tgcgccccga gcttgacgcc cttgacgcct ttctcagcca ctgctgggcg 1260 gtgacggtga ccggagcgcc caagcgcgcc gccatggccg ccgtcgaagc cgtggagcgg 1320 gcgccgcgcg cctggtatgg cggcgccatc ggccgcctgg gcttcgacgg taccctcgac 1380 accggactgg tgctgcgcac catccgcctg cgtcacggcg tcgccgaggt gcgggtgggg 1440 gcgacgctgc tccaccgttc cgatcccgag gaggaggagg ccgaaaccct gctcaaggcc 1500 tcggccctgc tcgccctgct cgatgccacc accccggcca agccgaatgc cccgcatctt 1560 ccgttgcgcg gccgggcgcc gcgcgtgctg gtcatcgacc acgaggacag cttcgtccat 1620 accctggcgt cttatctgcg caatgccggg gccgagacca ccgtgctgcg ctgggacgtg 1680 ccggcggcgg tgcgcgccgg cgtcgaggcc gatctgctgg tgctgtcgcc gggaccgggc 1740 acgccgtcgc gcttcgccct gggggccagc ctggactggg cggtggcgcg cggcttgccg 1800 gtcttcggcg tctgcctggg gctgcagggc atcgtcgaac aggccggggg ccgccttgcc 1860 cggctggcgg ttcccgccca tggcatggcc tcgacgctgc ggctggtcgc ccccggggac 1920 ccgctgttcg ccggcctgcc cacgaccatg agagtgggcc gctaccacag cctgcacgcc 1980 gagcgcgcca gcctgcccga cagcctggag atcctggccg aaagcgacga cggggtgatc 2040 atggcgctgc gccaccgcct gctgcccttc agcgccgtgc aattccaccc cgaaagcctg 2100 atgaccctgg acggcggcgc cggaccccga ttgatcgcca atcttctgga aaccctaagc 2160 gtcccgcgaa cgcgccacgc cgcctaa 2187 129 2181 DNA Thermobifida fusca 129 gtggacgaca actcctacac caccagtggt ggtatcaccg tgcaccgcac ggcagtgccg 60 tgcgatcccc gtgcgctcgc cgatctgacg gtcaacgtgg aacagcgccg aggcggcgtg 120 ctctcctccg ggatggagta tcccggccgc tacagccgtt ggcatttggg atacgtggac 180 ccgtgcctgg aagttgtcgc gcgcggccgc acgatcgggg cgacggccct caacgaccgc 240 ggccgtgtcc tgctgcccgc ggtagcccgg gcgctcaccg cgcacggcgc ggtggtggag 300 cacaccgacg acacggtcgc tgtcacggtc cctgaaccgg atcccaccga gttcttcact 360 gaggaagagc gcagccgccg gctcagtgtt ttttctgcgc tccgcgccct cgtgggcgtg 420 ttcttccacg cggaagaacc ccacctgggg ttgtacgggg cgttcggcta cgatctggcg 480 ttccagttcg aaccgatcga gcaggtgctg ccgcgcgacc cggaggaccg ggacctggtg 540 ttgcacctgc ccgacgagat catcgtccac gaccggaaac gggagatctg ccagcgctac 600 tcctacgact tcacgctgcc ggaggagttg cgcggcccgg caggggcgac cacgcggggc 660 ctgccacgcc acaccgagcc cacacccccg gtgaccccgg ctgccgaggt gccgccgcag 720 ccggaacccg ggtcgtatgc gcggatcgtg gctgaggcca aggagcggtt ccgccgcggc 780 gacttgttcg aagtggtgcc cagccaccgc ttgtacgcgc cgtgtgcgtc gcctgcgcgg 840 ttctacgagc ggctgcggga acgcaaccct gccccgtacg agttcttcct caacctgggg 900 gagggcgagt acctggtcgg cgcgtccccg gaaatgtttg tgcgggtcac gggccgtccc 960 ggagaggggc agcgggtgga gacctgcccg atctccggca cgatcaagcg tggcgcggac 1020 gcggtcggcg acgcggagaa catcaaggag ctgctgtcgt ccgcgaagga agagtcggag 1080 ctgaccatgt gcaccgacgt ggaccgcaac gacaagtccc gggtgtgcgt gccaggcagt 1140 gtgcgggtga tcggccgccg gcagatcgaa atgtacagtc ggctcatcca cacggtcgac 1200 cacattgagg ggattctgcg ccccgagttg gacgctattg acgcgttcct cacccacatg 1260 tgggcggtga ccgtgacggg ggcgccgaag acgtgggcga tgcggttcat cgaacagcat 1320 gagagttcgc cgcgccgctg gtatgggggc gcggtcggtg tcatcaattt tgatggttcg 1380 atgaacaccg ggttgacgtt gcggaccgcg cacatccggg acggggtggc gacggtgcgg 1440 gcgggcgcca cactgctgta cgactctgat ccggaagctg aagagcggga gactttcctc 1500 aaagcccgtg ccctgttgga gaccctcacc gacgagggtg aggaaacctc caaggctgcg 1560 cctgcggtgg agcaggtggg ggcggggatg cgggtgctgc tcgtcgacca cgaagactcg 1620 ttcgtcaaca cgctcgcgga ctacgtccgg cggcacggcg ccgaggtcac cacggtgcgc 1680 tacgggttcg acccggccct gctcgaccag atgcgtcccg acctggtggt gctctccccg 1740 gggccggggc tgcccgccga tttcgcgatg agcgcgctgt tgaaggagtt ggacgcgcgc 1800 ggcctgcctg tgttcggggt gtgcctgggg ctgcaggcga tggtggagta cgcgggcggg 1860 gagctgctca ctttggacac gccggtgcac ggtaaacccg gccgggttcg ggtcaccggg 1920 ggcgcgctgc tggctgggct gggagaggac ggggagttca ccgcggcccg ctaccactcc 1980 gtgtacgcga ccccggaccg ggtgaaaggg ttcgaggtga cggcggtgac ggaggacgac 2040 ggtttccccg tggtcatggc gatcgagaat gctgaggcgc ggcggtgggc ggtccagttc 2100 caccccgagt cgatcctcac cggccgggtg ggggagcaga tcgtggcgaa cgtgctgcgc 2160 ttggccaggg agagcagctg a 2181 130 721 PRT Bradyrhizobium japonicum 130 Met Asn Arg Thr Val Phe Ala Leu Pro Ala Arg Ser Asp Tyr Val Thr 1 5 10 15 Arg Gly Gly Leu Ala Ile Thr Arg Val Ala Glu Gln Phe Thr Gly Gly 20 25 30 Ala Ser Arg Leu Asp Asp Leu Val Asn Leu Leu Asp Arg Arg Arg Gly 35 40 45 Val Val Leu Ser Ser Gly Thr Thr Val Pro Gly Arg Tyr Glu Ser Phe 50 55 60 Asp Leu Gly Phe Ser Asp Pro Pro Leu Lys Leu Glu Thr Thr Gly Val 65 70 75 80 Asn Phe Lys Leu Glu Ala Leu Asn Glu Arg Gly Gln Val Leu Ile Ala 85 90 95 Phe Leu Ala Asp Val Leu Arg Glu Pro Cys Val Val Ile Ser Glu Lys 100 105 110 Thr Ala Ser Arg Leu Ala Gly His Ile Ile Arg Gly Asp Ala Pro Val 115 120 125 Glu Glu Asp Gln Arg Thr Arg Arg Ala Ser Val Val Ser Leu Val Arg 130 135 140 Asp Leu Val Ala Ala Phe Ser Ala Asn Asp Asp Gly Leu Leu Gly Leu 145 150 155 160 Phe Gly Ala Phe Ala Tyr Asp Leu Val Phe Gln Ile Glu Asp Leu Val 165 170 175 Gln Lys Arg Ala Arg Glu Ser Asp Gln Arg Asp Ile Val Leu Tyr Val 180 185 190 Pro Asp Arg Leu Leu Ala Tyr Asp Arg Ala Thr Gly Arg Gly Val Val 195 200 205 Leu Ser Tyr Asp Phe Thr Trp Lys Gly Arg Ser Thr Glu Gly Leu Pro 210 215 220 Arg Glu Thr Ala Asp Ser Pro Tyr Met Lys Thr Pro Arg Gln Gly Phe 225 230 235 240 Ala Asp His Ala Pro Gly Glu Tyr Gln Ala Thr Val Glu Thr Ala Arg 245 250 255 Ala Ala Phe Ala Arg Gly Asp Leu Phe Glu Ala Val Pro Gly Gln Leu 260 265 270 Phe Ala Glu Pro Cys Asp Arg Ser Pro Ala Glu Val Phe Gln Arg Leu 275 280 285 Cys Val Ile Asn Pro Ser Pro Tyr Gly Ala Leu Met Asn Leu Gly Asp 290 295 300 Gly Glu Phe Leu Val Ser Ala Ser Pro Glu Met Phe Val Arg Ser Asp 305 310 315 320 Gly Arg Arg Val Glu Thr Cys Pro Ile Ser Gly Thr Ile Ala Arg Gly 325 330 335 Thr Asp Ala Ile Gly Asp Ala Glu Gln Ile Arg Gln Leu Leu Asn Ser 340 345 350 Glu Lys Asp Glu Phe Glu Leu Asn Met Cys Thr Asp Val Asp Arg Asn 355 360 365 Asp Lys Ala Arg Val Cys Val Pro Gly Thr Ile Lys Val Leu Ala Arg 370 375 380 Arg Gln Ile Glu Thr Tyr Ser Lys Leu Phe His Thr Val Asp His Val 385 390 395 400 Glu Gly Met Leu Arg Pro Gly Phe Asp Ala Leu Asp Ala Phe Leu Thr 405 410 415 His Ala Trp Ala Val Thr Val Thr Gly Ala Pro Lys Leu Trp Ala Met 420 425 430 Gln Phe Val Glu Asp His Glu Arg Ser Pro Arg Arg Trp Tyr Ala Gly 435 440 445 Ala Ile Gly Ala Val Asn Phe Asp Gly Ser Ile Asn Thr Gly Leu Thr 450 455 460 Ile Arg Thr Ile Arg Met Lys Asp Gly Leu Ala Glu Val Arg Val Gly 465 470 475 480 Ala Thr Cys Leu Phe Asp Ser Asp Pro Ala Ala Glu Asp Arg Glu Cys 485 490 495 Gln Val Lys Ala Ala Ala Leu Phe Gln Ala Leu Arg Gly Asp Pro Pro 500 505 510 Lys Pro Leu Ser Thr Phe Ala Pro Asp Ala Thr Gly Ser Gly Lys Arg 515 520 525 Val Leu Leu Ile Asp His Asp Asp Ser Phe Val His Met Leu Ala Asp 530 535 540 Tyr Phe Arg Gln Val Gly Ala Ser Val Thr Val Val Arg Tyr Val His 545 550 555 560 Ala Leu Asp Met Leu Lys Gln Lys Arg Trp Asp Leu Leu Val Leu Ser 565 570 575 Pro Gly Pro Gly Arg Pro Glu Asp Phe Gly Ile Arg Lys Thr Ile Asp 580 585 590 Ala Ala Leu Glu Asn Lys Leu Pro Val Phe Gly Val Cys Leu Gly Val 595 600 605 Gln Ala Ile Gly Glu Tyr Phe Gly Gly Glu Leu Gly Gln Leu Thr His 610 615 620 Pro Ala His Gly Arg Pro Ser Arg Val Gln Val Arg Gly Gly Arg Leu 625 630 635 640 Met Arg Asn Leu Pro Ser Glu Ile Val Ile Gly Arg Tyr His Ser Leu 645 650 655 Tyr Val Glu Arg Asp Ser Met Pro Glu Val Leu Ser Val Thr Ala Ser 660 665 670 Thr Glu Asp Gly Val Ala Met Ala Leu Glu His Lys Thr Leu Pro Val 675 680 685 Ala Gly Val Gln Phe His Pro Glu Ser Leu Met Ser Leu Gly Gly Glu 690 695 700 Val Gly Leu Arg Ile Val Glu Asn Ala Phe Arg Leu Asp Ala Arg Val 705 710 715 720 Asp 131 728 PRT Rhodospirillum rubrum 131 Met Gln Thr Ser Thr Phe Thr Thr Ala Gly Gly Phe Thr Ile Ser Ser 1 5 10 15 Cys Leu Arg Pro Leu Ala Gly Ala Asp Gly Ala Phe Glu Ala Leu Ile 20 25 30 Asp Arg Leu Asp Arg His Arg Gly Met Val Ile Ala Ser Thr Tyr Glu 35 40 45 Tyr Pro Gly Arg Tyr Arg Arg His Ala Leu Gly Phe Cys Asp Pro Pro 50 55 60 Leu Val Leu Glu Gly Lys Gly Arg Glu Ala His Leu Leu Ala Leu Asn 65 70 75 80 Arg Arg Gly Arg Ala Leu Leu Pro Ala Leu Ala Val Gly Leu Glu Gly 85 90 95 Ala Ala Gly Leu Glu Gly Leu Arg Arg Glu Ala Asp Arg Leu Val Leu 100 105 110 Arg Val Lys Ala Met Ala Pro Trp Phe Pro Glu Glu Glu Arg Ser Arg 115 120 125 Gln Pro Ser Leu Met Ser Val Val Arg Ala Leu Ala Gly Leu Phe Ala 130 135 140 Ala Glu Asn Asp Pro Phe Phe Gly Leu Val Gly Ala Phe Gly Tyr Asp 145 150 155 160 Leu Gly Leu Ala Phe Glu Arg Leu Pro His Ala Arg Pro Arg Ser Ala 165 170 175 Asp His Arg Asp Leu Val Leu Tyr Leu Pro Asp Arg Leu Leu Ile Asp 180 185 190 Asp Pro Glu Ala Gly Gly Leu Ala Glu Arg Leu Tyr Asp Ile Thr Ala 195 200 205 Ala Asp Gly Ala Ser Thr Ala Gly Leu Ala Arg Glu Thr Ala Ala Tyr 210 215 220 Thr Ala Asp His Pro Ala Gly Gly Val Pro Ile Glu Asp Asp Met Pro 225 230 235 240 Pro Gly Ala Tyr Gly Ala Ile Val Arg Gly Leu Lys Glu Ala Phe Ala 245 250 255 Ala Gly Asp Leu Phe Glu Ala Val Pro Ser Arg Ala Leu Arg Arg Pro 260 265 270 Cys Ala Glu Ala Pro Ser Arg Leu Tyr Arg Arg Leu Arg Ala Ala Asn 275 280 285 Pro Ala Pro Tyr Leu Phe Leu Ala Asn Leu Gly Ala Gly Glu His Leu 290 295 300 Ile Gly Ala Ser Pro Glu Met Phe Val Arg Val Gly Gly Ala Pro Gly 305 310 315 320 Ala Arg Arg Val Glu Thr Cys Pro Ile Ser Gly Thr Ile Ala Arg Gly 325 330 335 Pro Asp Ala Leu Gly Asp Ala Glu Ala Ile Arg Thr Leu Leu Asn Ser 340 345 350 Thr Lys Asp Glu Ala Glu Leu Thr Met Cys Thr Asp Val Asp Arg Asn 355 360 365 Asp Lys Ala Arg Val Cys Val Ala Gly Ser Val Thr Val Ile Gly Arg 370 375 380 Arg Gln Ile Glu Leu Tyr Ser Arg Leu Ile His Thr Val Asp His Val 385 390 395 400 Glu Gly Arg Leu Arg Pro Glu Leu Asp Ala Leu Asp Ala Phe Leu Ser 405 410 415 His Cys Trp Ala Val Thr Val Thr Gly Ala Pro Lys Arg Ala Ala Met 420 425 430 Ala Ala Val Glu Ala Val Glu Arg Ala Pro Arg Ala Trp Tyr Gly Gly 435 440 445 Ala Ile Gly Arg Leu Gly Phe Asp Gly Thr Leu Asp Thr Gly Leu Val 450 455 460 Leu Arg Thr Ile Arg Leu Arg His Gly Val Ala Glu Val Arg Val Gly 465 470 475 480 Ala Thr Leu Leu His Arg Ser Asp Pro Glu Glu Glu Glu Ala Glu Thr 485 490 495 Leu Leu Lys Ala Ser Ala Leu Leu Ala Leu Leu Asp Ala Thr Thr Pro 500 505 510 Ala Lys Pro Asn Ala Pro His Leu Pro Leu Arg Gly Arg Ala Pro Arg 515 520 525 Val Leu Val Ile Asp His Glu Asp Ser Phe Val His Thr Leu Ala Ser 530 535 540 Tyr Leu Arg Asn Ala Gly Ala Glu Thr Thr Val Leu Arg Trp Asp Val 545 550 555 560 Pro Ala Ala Val Arg Ala Gly Val Glu Ala Asp Leu Leu Val Leu Ser 565 570 575 Pro Gly Pro Gly Thr Pro Ser Arg Phe Ala Leu Gly Ala Ser Leu Asp 580 585 590 Trp Ala Val Ala Arg Gly Leu Pro Val Phe Gly Val Cys Leu Gly Leu 595 600 605 Gln Gly Ile Val Glu Gln Ala Gly Gly Arg Leu Ala Arg Leu Ala Val 610 615 620 Pro Ala His Gly Met Ala Ser Thr Leu Arg Leu Val Ala Pro Gly Asp 625 630 635 640 Pro Leu Phe Ala Gly Leu Pro Thr Thr Met Arg Val Gly Arg Tyr His 645 650 655 Ser Leu His Ala Glu Arg Ala Ser Leu Pro Asp Ser Leu Glu Ile Leu 660 665 670 Ala Glu Ser Asp Asp Gly Val Ile Met Ala Leu Arg His Arg Leu Leu 675 680 685 Pro Phe Ser Ala Val Gln Phe His Pro Glu Ser Leu Met Thr Leu Asp 690 695 700 Gly Gly Ala Gly Pro Arg Leu Ile Ala Asn Leu Leu Glu Thr Leu Ser 705 710 715 720 Val Pro Arg Thr Arg His Ala Ala 725 132 726 PRT Thermobifida fusca 132 Val Asp Asp Asn Ser Tyr Thr Thr Ser Gly Gly Ile Thr Val His Arg 1 5 10 15 Thr Ala Val Pro Cys Asp Pro Arg Ala Leu Ala Asp Leu Thr Val Asn 20 25 30 Val Glu Gln Arg Arg Gly Gly Val Leu Ser Ser Gly Met Glu Tyr Pro 35 40 45 Gly Arg Tyr Ser Arg Trp His Leu Gly Tyr Val Asp Pro Cys Leu Glu 50 55 60 Val Val Ala Arg Gly Arg Thr Ile Gly Ala Thr Ala Leu Asn Asp Arg 65 70 75 80 Gly Arg Val Leu Leu Pro Ala Val Ala Arg Ala Leu Thr Ala His Gly 85 90 95 Ala Val Val Glu His Thr Asp Asp Thr Val Ala Val Thr Val Pro Glu 100 105 110 Pro Asp Pro Thr Glu Phe Phe Thr Glu Glu Glu Arg Ser Arg Arg Leu 115 120 125 Ser Val Phe Ser Ala Leu Arg Ala Leu Val Gly Val Phe Phe His Ala 130 135 140 Glu Glu Pro His Leu Gly Leu Tyr Gly Ala Phe Gly Tyr Asp Leu Ala 145 150 155 160 Phe Gln Phe Glu Pro Ile Glu Gln Val Leu Pro Arg Asp Pro Glu Asp 165 170 175 Arg Asp Leu Val Leu His Leu Pro Asp Glu Ile Ile Val His Asp Arg 180 185 190 Lys Arg Glu Ile Cys Gln Arg Tyr Ser Tyr Asp Phe Thr Leu Pro Glu 195 200 205 Glu Leu Arg Gly Pro Ala Gly Ala Thr Thr Arg Gly Leu Pro Arg His 210 215 220 Thr Glu Pro Thr Pro Pro Val Thr Pro Ala Ala Glu Val Pro Pro Gln 225 230 235 240 Pro Glu Pro Gly Ser Tyr Ala Arg Ile Val Ala Glu Ala Lys Glu Arg 245 250 255 Phe Arg Arg Gly Asp Leu Phe Glu Val Val Pro Ser His Arg Leu Tyr 260 265 270 Ala Pro Cys Ala Ser Pro Ala Arg Phe Tyr Glu Arg Leu Arg Glu Arg 275 280 285 Asn Pro Ala Pro Tyr Glu Phe Phe Leu Asn Leu Gly Glu Gly Glu Tyr 290 295 300 Leu Val Gly Ala Ser Pro Glu Met Phe Val Arg Val Thr Gly Arg Pro 305 310 315 320 Gly Glu Gly Gln Arg Val Glu Thr Cys Pro Ile Ser Gly Thr Ile Lys 325 330 335 Arg Gly Ala Asp Ala Val Gly Asp Ala Glu Asn Ile Lys Glu Leu Leu 340 345 350 Ser Ser Ala Lys Glu Glu Ser Glu Leu Thr Met Cys Thr Asp Val Asp 355 360 365 Arg Asn Asp Lys Ser Arg Val Cys Val Pro Gly Ser Val Arg Val Ile 370 375 380 Gly Arg Arg Gln Ile Glu Met Tyr Ser Arg Leu Ile His Thr Val Asp 385 390 395 400 His Ile Glu Gly Ile Leu Arg Pro Glu Leu Asp Ala Ile Asp Ala Phe 405 410 415 Leu Thr His Met Trp Ala Val Thr Val Thr Gly Ala Pro Lys Thr Trp 420 425 430 Ala Met Arg Phe Ile Glu Gln His Glu Ser Ser Pro Arg Arg Trp Tyr 435 440 445 Gly Gly Ala Val Gly Val Ile Asn Phe Asp Gly Ser Met Asn Thr Gly 450 455 460 Leu Thr Leu Arg Thr Ala His Ile Arg Asp Gly Val Ala Thr Val Arg 465 470 475 480 Ala Gly Ala Thr Leu Leu Tyr Asp Ser Asp Pro Glu Ala Glu Glu Arg 485 490 495 Glu Thr Phe Leu Lys Ala Arg Ala Leu Leu Glu Thr Leu Thr Asp Glu 500 505 510 Gly Glu Glu Thr Ser Lys Ala Ala Pro Ala Val Glu Gln Val Gly Ala 515 520 525 Gly Met Arg Val Leu Leu Val Asp His Glu Asp Ser Phe Val Asn Thr 530 535 540 Leu Ala Asp Tyr Val Arg Arg His Gly Ala Glu Val Thr Thr Val Arg 545 550 555 560 Tyr Gly Phe Asp Pro Ala Leu Leu Asp Gln Met Arg Pro Asp Leu Val 565 570 575 Val Leu Ser Pro Gly Pro Gly Leu Pro Ala Asp Phe Ala Met Ser Ala 580 585 590 Leu Leu Lys Glu Leu Asp Ala Arg Gly Leu Pro Val Phe Gly Val Cys 595 600 605 Leu Gly Leu Gln Ala Met Val Glu Tyr Ala Gly Gly Glu Leu Leu Thr 610 615 620 Leu Asp Thr Pro Val His Gly Lys Pro Gly Arg Val Arg Val Thr Gly 625 630 635 640 Gly Ala Leu Leu Ala Gly Leu Gly Glu Asp Gly Glu Phe Thr Ala Ala 645 650 655 Arg Tyr His Ser Val Tyr Ala Thr Pro Asp Arg Val Lys Gly Phe Glu 660 665 670 Val Thr Ala Val Thr Glu Asp Asp Gly Phe Pro Val Val Met Ala Ile 675 680 685 Glu Asn Ala Glu Ala Arg Arg Trp Ala Val Gln Phe His Pro Glu Ser 690 695 700 Ile Leu Thr Gly Arg Val Gly Glu Gln Ile Val Ala Asn Val Leu Arg 705 710 715 720 Leu Ala Arg Glu Ser Ser 725 133 281 PRT Sorghum bicolor 133 Met Val Cys Ser Gln Leu Thr Ala Ala Gly Ala Ser Ser Leu Ala Ala 1 5 10 15 Ala Ala Val Arg Ser Arg Ala His Ser Pro Ala Ala Ala Phe Ala Gln 20 25 30 Leu Arg Ser Thr Pro Arg Ile Ala Ser Ala Gly Leu Ser Val Lys Gly 35 40 45 Asn Arg Ala Ala Leu Pro Leu Val Ala Ala Ala Gly Pro Ala Ala Ala 50 55 60 Ala Pro Val Ala Asp Leu Asp Gly Pro Pro Ala Thr Glu Lys Gln Pro 65 70 75 80 Ile Ile Val Ile Asp Asn Tyr Asp Ser Phe Thr Tyr Asn Leu Cys Gln 85 90 95 Tyr Met Gly Glu Leu Gly Leu Asn Phe Glu Val Tyr Arg Asn Asp Glu 100 105 110 Leu Thr Ile Glu Asp Val Lys Arg Lys Asn Pro Arg Gly Ile Leu Ile 115 120 125 Ser Pro Gly Pro Gly Glu Pro Gln Asp Ser Gly Ile Ser Leu Gln Ala 130 135 140 Val Leu Glu Leu Gly Pro Thr Ile Pro Ile Phe Gly Val Cys Met Gly 145 150 155 160 Leu Gln Cys Ile Gly Glu Ala Phe Gly Gly Lys Ile Ile Arg Ala Pro 165 170 175 Ser Gly Val Met His Gly Lys Ser Ser Pro Val Tyr Tyr Asp Glu Glu 180 185 190 Leu Gly Lys Ala Leu Phe Asn Gly Leu Pro Asn Pro Phe Thr Ala Ala 195 200 205 Arg Tyr His Ser Leu Val Ile Glu Glu Glu Thr Phe Pro His Asp Ala 210 215 220 Leu Glu Ala Thr Ala Trp Thr Glu Asp Gly Leu Ile Met Ala Ala Arg 225 230 235 240 His Lys Lys Tyr Lys His Ile Gln Gly Val Gln Phe His Pro Glu Ser 245 250 255 Ile Ile Thr Pro Asp Gly Lys Lys Ile Ile Leu Asn Phe Val Arg Phe 260 265 270 Ile Glu Glu Leu Glu Lys Gln Arg Ser 275 280 134 1122 DNA Sorghum bicolor 134 gtcgacccac gcgtccgccg cctccccacc ctcgctccct ctcaccgccc gccaccgccg 60 agatggtctg ctcccagctc accgccgcgg gggcctcctc cctcgccgcc gcagcggttc 120 gttcccgggc gcattcccca gccgccgcct tcgcgcaact acggtcgacg cctcgcattg 180 cgagcgctgg cttgtcggtt aagggaaaca gggcggctct tccgttggtc gccgccgcgg 240 ggccggccgc ggcggcgccg gtggccgacc tggacggccc cccggccacg gagaagcagc 300 ccatcattgt catcgataac tacgacagct tcacctacaa cctctgccag tatatggggg 360 agcttggatt gaactttgaa gtataccgca atgatgaact gaccatagaa gatgtaaaga 420 ggaagaaccc aagaggaata cttatttctc cagggcctgg tgaaccacaa gattcaggaa 480 tatcattgca ggctgttctt gaattaggcc caaccatccc aatttttgga gtttgcatgg 540 gcctgcagtg cattggggag gcatttgggg gaaagattat ccgtgctcct tctggagtga 600 tgcatgggaa aagctctcca gtttattacg acgaggaatt aggaaaggcc ttattcaatg 660 gcttgccaaa cccttttacc gctgcgaggt accacagctt ggtcattgag gaagaaacct 720 tcccgcatga tgctttagag gccactgcat ggactgaaga tggacttatc atggctgctc 780 gccacaagaa gtacaaacac atccagggtg tccaattcca cccggagagc atcatcaccc 840 ctgacggcaa gaaaatcatc ctcaatttcg tcagattcat tgaggaactg gagaagcagc 900 gttcctaggg aggtagatgc caccggtggc ttcatagatc agtcagaagc agagacaaag 960 gcgcttgaag ctgcgtagta ccgggtctgg cagtggaagt tagctaggaa acagcctttt 1020 tcctccctta attcgttgtg ctcgtggtaa tataatctgt gtggactgaa tttcgaataa 1080 agtccagctg ttcaaataaa aaaaaaaaaa aagggcggcc gc 1122 135 1934 DNA Sorghum bicolor 135 gtcgacccac gcgtccgcgt gacaccccgc gcggcacctc cgcctcccca ccctcgctcc 60 ctctcaccgc ccgccaccgc cgagatggtc tgctcccagc tcaccgccgc gggggcctcc 120 tccctcgccg ccgcagcggt tcgttcccgg gcgcattccc cagccgccgc cttcgcgcaa 180 ctacggtcga cgcctcgcat tgcgagcgct ggcttgtcgg ttaagggaaa cagggcggct 240 cttccgttgg tcgccgccgc ggggccggcc gcggcggcgc cggtggccga cctggacggc 300 cccccggcca cggagaagca gcccatcatt gtcatcgata actacgacag cttcacctac 360 aacctctgcc agtatatggg ggagcttgga ttgaactttg aagtataccg caatgatgaa 420 ctgaccatag aagatgtaaa gaggaagaac ccaagaggaa tacttatttc tccagggcct 480 ggtgaaccac aagattcagg aatatcattg caggctgttc ttgaattagg cccaaccatc 540 ccaatttttg gagtttgcat gggcctgcag tgcattgggg aggcatttgg gggaaagatt 600 atccgtgctc cttctggagt gatgcatggg aaaagctctc cagtttatta cgacgaggaa 660 ttaggaaagg ccttattcaa tggcttgcca aaccctttta ccgctgcgag gtaccacagc 720 ttggtcattg aggaagaaac cttcccgcat gatgctttag aggccactgc atggactgaa 780 gatggactta tcatggctgc tcgccacaag aagtacaaac acatccaggg tgtccaattc 840 cacccggaga gcatcatcac ccctgacggc aagaaaatca tcctcaattt cgtcagattc 900 attgaggaac tggagaagca gcgttcctag ggaggtagat gccaccggtg gcttcataga 960 tcagtcagaa gcagagacaa aggcgcttga agctgcgtag taccgggtct ggcagtggaa 1020 gttagctagg aaacagcctt tttcctccct taattcgttg tgctcgtggt aatataatct 1080 gtgtggactg aatttcgaat aaagtccagc tgttcaaata aaaaaaaaaa aaaagggcgg 1140 ccgctaccct cgaggccggc cgggccggga agccgcgatg ttaaatgtgt ggtccttagc 1200 aatcaaatct gcgtacaaga tggaatctct attattttca gcgaaaccaa gggattccgt 1260 gagcgcatcc gagggaggaa ggtgggcgta cctttaggct tctttccgac ctccgggaag 1320 tgcggcgagg gtttcatggc gatgttggcg gctgcaaggc cggcgcgccg gatagaggcg 1380 ggggcagggg aactgacaag ggtttaacta cgcgaacgcg cactgcagga atggacgagc 1440 tcgctctctc aaatcggccg aatgcgctcg tcccaccgag acgccgtctt gctccgtctc 1500 cctgtctcgc tcacgcggac gctccacgcg agcagggcag gccgaggagg gcgacggcgc 1560 agccgggcga cggcgcgagg agagcgatgg cgcgaagagt gcagaacgcg cggctcggcg 1620 gcggcgcagc tgtgcggcgg cgcggttggg ccgcggtggc ggagaacggt gaacggaaga 1680 acgaagaaga aagggaaaga agcctttgta tgacacgtgg gtcccgcagt tagaagggtt 1740 aaatctgttg tctcatccat cacgtagtct taattttttt ttcactagtc tgtgttaatg 1800 ctacgatctt aagaagccag cgacaataag agtagctcta ataaaaaaaa aaaaaaaaag 1860 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaacaaaaa aaaaaaaaaa aaaggcccct 1920 agggccctcg agct 1934 136 2055 DNA Zea mays 136 ggccggccgg gactccactc cactccactc gcccgcgccc gccgcccgcg tgctcctccc 60 tcgcgcccgc cccgccccgc tccgccccta tctatatcca ttcccgctcg tccccctcaa 120 caaccctcct cacggcgcac tcgtgttcgt gtcatcccgc ccgcaggccg cagtccatgg 180 ccaccgccag cctcgcgctc tcgctgcgcc tcgcgccgta ctcgcacccg ctgagcctcc 240 gccgccgggg ggccgccggc gtcacctgcc gcgccaccac cgccacgttc caccagcttg 300 acgccgtcgc ggtgagggag gaggagtcca ggttccggac ggcggcggcg gagggccgca 360 acctgctgcc gctcacgagg tgcatcttct ccgatcacct cacgcccgtg ctcgcctacc 420 gctgcctcgt caaggaggac gaacgcgagg cgcccagctt tctattcgag tctgtcgagc 480 aggggtccga gggcaccaat gtggggaggt acagcgtggt cggggcgcag ccttctatgg 540 aggtcgtggc caaggctaac catgtgacgg tcatggacca tgagatgaag tcgaggaggg 600 agcacttcgt gcctgatccc atgaggatcc ccaggacaat catggagcag tggaacccgc 660 agattgctga cagcctccct gatgcatttt gtggaggatg ggttggattc ttctcatatg 720 atacagtgcg ttatgttgaa acaaagaagc ttcctttcag taaggcacca catgatgata 780 ggaaccttcc tgatattcat ttaggcctct atagtgacgt cattgtgttt gatcatgttg 840 aaaagaaaac acatgttatt cattgggtga ggacagactg ctatcgttct gttgatgaag 900 catatgaaga tggaagaaat cggcttgaag ctttgttatc aagattacat tgcctcaatg 960 tcccaacact ttcttctggt tctataaaac tcaatgttga aaactttggc ccagtaatgc 1020 aaaaatcaac gatgtcaagc gaagaatata aaaatatcgt tgtccaagct aaagaacaca 1080 tcttggccgg tgacattttc caagttgttt taagccagcg ttttgagaga cggacattcg 1140 ccgacccctt tgaaatctat cgtgcattgc gcatcgtaaa tcctagtcca tatatggcct 1200 atctacaggc acgaggttgt attctcgtgg catcgagtcc tgaaattctt acccgggtac 1260 aaaagaggac aataatcaat cgtccgcttg ctggaaccat aagaagaggc aaaacaaaag 1320 cagaagacaa aactttagaa caattgcttt tgagtgacga aaagcagtgt gctgaacata 1380 ttatgctagt agatcttggc cgaaatgatg ttgggaaggt gtccaaacca ggttcagtaa 1440 aggtagagaa attgatgaat atcgaacgat attctcatgt catgcacatc agctcaacag 1500 taactggaga gctacgcgat gatcttacgt gttgggatgc gctacgagcc gcattgccag 1560 ttggaaccgt tagtggcgct ccaaaggtga gagcaatgga gttgattgat cagctagaag 1620 tgagtatgcg tgggccgtat agtggtggct ttggagggat ttcctttcgc ggcgacatgg 1680 acattgcact ggctcttcgc actatcgtct tccccaccgc atctcggttt gataccatgt 1740 actcgtacac agacagtaag tcccgacagg agtgggtggc tcacctccag gccggagctg 1800 gcatagttgc tgatagcaaa ccggatgacg agcaccaaga gtgtataaac aaggctgcag 1860 gtgttgctcg tgccattgac cttgctgaat ctacatttct tgaagactag tctagtctaa 1920 tgaaggaaat gtatgtttaa gttctctgta caattatgga ttgtcctaga aaacaggctt 1980 tcttaggccg aataaaaact caattgtaat aaagttaata aatggacaac tttagctaaa 2040 aaaaaaaaaa aaaaa 2055 137 577 PRT Zea mays 137 Met Ala Thr Ala Ser Leu Ala Leu Ser Leu Arg Leu Ala Pro Tyr Ser 1 5 10 15 His Pro Leu Ser Leu Arg Arg Arg Gly Ala Ala Gly Val Thr Cys Arg 20 25 30 Ala Thr Thr Ala Thr Phe His Gln Leu Asp Ala Val Ala Val Arg Glu 35 40 45 Glu Glu Ser Arg Phe Arg Thr Ala Ala Ala Glu Gly Arg Asn Leu Leu 50 55 60 Pro Leu Thr Arg Cys Ile Phe Ser Asp His Leu Thr Pro Val Leu Ala 65 70 75 80 Tyr Arg Cys Leu Val Lys Glu Asp Glu Arg Glu Ala Pro Ser Phe Leu 85 90 95 Phe Glu Ser Val Glu Gln Gly Ser Glu Gly Thr Asn Val Gly Arg Tyr 100 105 110 Ser Val Val Gly Ala Gln Pro Ser Met Glu Val Val Ala Lys Ala Asn 115 120 125 His Val Thr Val Met Asp His Glu Met Lys Ser Arg Arg Glu His Phe 130 135 140 Val Pro Asp Pro Met Arg Ile Pro Arg Thr Ile Met Glu Gln Trp Asn 145 150 155 160 Pro Gln Ile Ala Asp Ser Leu Pro Asp Ala Phe Cys Gly Gly Trp Val 165 170 175 Gly Phe Phe Ser Tyr Asp Thr Val Arg Tyr Val Glu Thr Lys Lys Leu 180 185 190 Pro Phe Ser Lys Ala Pro His Asp Asp Arg Asn Leu Pro Asp Ile His 195 200 205 Leu Gly Leu Tyr Ser Asp Val Ile Val Phe Asp His Val Glu Lys Lys 210 215 220 Thr His Val Ile His Trp Val Arg Thr Asp Cys Tyr Arg Ser Val Asp 225 230 235 240 Glu Ala Tyr Glu Asp Gly Arg Asn Arg Leu Glu Ala Leu Leu Ser Arg 245 250 255 Leu His Cys Leu Asn Val Pro Thr Leu Ser Ser Gly Ser Ile Lys Leu 260 265 270 Asn Val Glu Asn Phe Gly Pro Val Met Gln Lys Ser Thr Met Ser Ser 275 280 285 Glu Glu Tyr Lys Asn Ile Val Val Gln Ala Lys Glu His Ile Leu Ala 290 295 300 Gly Asp Ile Phe Gln Val Val Leu Ser Gln Arg Phe Glu Arg Arg Thr 305 310 315 320 Phe Ala Asp Pro Phe Glu Ile Tyr Arg Ala Leu Arg Ile Val Asn Pro 325 330 335 Ser Pro Tyr Met Ala Tyr Leu Gln Ala Arg Gly Cys Ile Leu Val Ala 340 345 350 Ser Ser Pro Glu Ile Leu Thr Arg Val Gln Lys Arg Thr Ile Ile Asn 355 360 365 Arg Pro Leu Ala Gly Thr Ile Arg Arg Gly Lys Thr Lys Ala Glu Asp 370 375 380 Lys Thr Leu Glu Gln Leu Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu 385 390 395 400 His Ile Met Leu Val Asp Leu Gly Arg Asn Asp Val Gly Lys Val Ser 405 410 415 Lys Pro Gly Ser Val Lys Val Glu Lys Leu Met Asn Ile Glu Arg Tyr 420 425 430 Ser His Val Met His Ile Ser Ser Thr Val Thr Gly Glu Leu Arg Asp 435 440 445 Asp Leu Thr Cys Trp Asp Ala Leu Arg Ala Ala Leu Pro Val Gly Thr 450 455 460 Val Ser Gly Ala Pro Lys Val Arg Ala Met Glu Leu Ile Asp Gln Leu 465 470 475 480 Glu Val Ser Met Arg Gly Pro Tyr Ser Gly Gly Phe Gly Gly Ile Ser 485 490 495 Phe Arg Gly Asp Met Asp Ile Ala Leu Ala Leu Arg Thr Ile Val Phe 500 505 510 Pro Thr Ala Ser Arg Phe Asp Thr Met Tyr Ser Tyr Thr Asp Ser Lys 515 520 525 Ser Arg Gln Glu Trp Val Ala His Leu Gln Ala Gly Ala Gly Ile Val 530 535 540 Ala Asp Ser Lys Pro Asp Asp Glu His Gln Glu Cys Ile Asn Lys Ala 545 550 555 560 Ala Gly Val Ala Arg Ala Ile Asp Leu Ala Glu Ser Thr Phe Leu Glu 565 570 575 Asp 138 22 DNA Artificial A primer. 138 atggcagcgg taattctgga ag 22 139 19 DNA Artificial A primer. 139 tcaggctgcc ttggtcttc 19 140 30 DNA Artificial A primer. 140 actgactcca tggcagcggt aattctggaa 30 141 20 DNA Artificial A primer. 141 ctgactagtt caggctgctt 20 142 30 DNA Artificial A primer. 142 tgctgaccat ggcctgctcc cacatcgtcg 30 143 34 DNA Artificial A primer. 143 cagtgaattc ctacgaacgc tgcttctcca gttc 34

Claims

What is claimed:

1. An isolated DNA molecule encoding an anthranilate synthase, wherein the DNA molecule encodes a protein substantially homologous to a protein selected from the group consisting of SEQ ID NOs: 66, 108, 109, 110, 111, 133, and 137.

2. The isolated DNA molecule of claim 1, wherein the DNA molecule is substantially homologous to a DNA molecule selected from a group consisting of SEQ ID NOs: 67, 68, 104, 105, 106, 107, 134, 135, and 136.

3. A DNA construct comprising an expression cassette, wherein the expression cassette in operable linkage comprises (i) a heterologous promoter; (ii) a DNA molecule encoding a monomeric anthranilate synthase protein, wherein the monomeric anthranilate synthase comprises a single polypeptide comprising an anthranilate synthase α-domain and an anthranilate synthase β-domain; and (iii) a transcriptional terminator.

4. The DNA construct of claim 3, wherein the monomeric anthranilate synthase protein is substantially homologous to a protein selected from the group consisting of SEQ ID NOs: 4, 7, 43, 57, 77, 78, 79, 80, 81, 82, 130, 131, and 132.

5. The DNA construct of claim 3, wherein the protein is SEQ ID NO: 4.

6. The DNA construct of claim 3, wherein the DNA molecule is substantially homologous to a DNA molecule selected from the group consisting of SEQ ID NOs: 1, 75, 76, 83, 121, 122, 123, 124, 125, 126, 127, 128, and 129.

7. The DNA construct of claim 3, wherein the expression cassette further encodes a plastid transit peptide.

8. The DNA construct of claim 7, wherein the plastid transit peptide is selected from the group consisting of SEQ ID NOs: 72, 74, 114, and 115.

9. A DNA construct comprising a first expression cassette, wherein the first expression cassette in operable linkage comprises (i) a heterologous promoter; (ii) a DNA molecule encoding an anthranilate synthase α-domain protein; and (iii) a transcriptional terminator.

10. The DNA construct of claim 9, further comprising a second expression cassette in operable linkage comprising (i) a heterologous promoter; (ii) a DNA molecule encoding an anthranilate synthase β-domain protein; and (iii) a transcriptional terminator.

11. The DNA construct of claim 10, wherein the α-domain or β-domain protein is substantially homologous to a protein selected from the group consisting of SEQ ID NOs: 5, 6, 8, 44, 45, 66, 99, 100, 101, 102, 103, 108, 109, 110, 111, 117, 118, 133, and 137.

12. The DNA construct of claim 10, wherein the DNA molecule encoding an anthranilate synthase α-domain or β-domain protein is substantially homologous to a DNA molecule selected from the group consisting of SEQ ID NOs: 2, 3, 67, 94, 95, 96, 97, 98, 104, 105, 106, 112, 116, 119, 120, 134, 135, and 136.

13. The DNA construct of claim 10, wherein the DNA molecule encoding an anthranilate synthase α-domain or β-domain protein is selected from the group consisting of SEQ ID NOs: 2, 3, 67, 94, 95, 96, 97, 98, 104, 105, 106, 112, 116, 119, 120, 134, 135, and 136.

14. The DNA construct of claim 10, wherein the α-domain protein is SEQ ID NO: 66 and the β-domain protein is SEQ ID NO: 118.

15. A method for altering the tryptophan content in a plant comprising:

a. introducing into regenerable cells of a plant a transgene comprising an isolated DNA molecule encoding an anthranilate synthase wherein the isolated DNA is operably linked to a promoter functional in a plant cell, to yield transformed plant cells; and

b. regenerating a plant from the transformed plant cells wherein the cells of the plant express the anthranilate synthase encoded by the isolated DNA in an amount effective to increase the tryptophan content in the plant relative to the tryptophan content in a second plant of the same or similar genetic background that does not include the transgene.

16. The method of claim 15, wherein the anthranilate synthase is substantially homologous to a monomeric anthranilate synthase selected from the group consisting of Agrobacterium tumefaciens, Anabaena M22983, Azospirillum brasilense, Bradyrhizobium japonicum, Brucella melitensis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Rhodospirillum rubrum, Rhodopseudomonas palustris, and Thermobifida fusca.

17. The method of claim 15, wherein the anthranilate synthase is selected from the group consisting of SEQ ID NOs: 4, 7, 43, 57, 77, 78, 79, 80, 81, 82, 130, 131, and 132.

18. The method of claim 15, wherein the anthranilate synthase is encoded by a DNA molecule substantially homologous to a DNA molecule selected from the group consisting of SEQ ID NOs: 1, 75, 76, 83, 121, 122, 123, 124, 125, 126, 127, 128, and 129.

19. The method of claim 15, wherein the anthranilate synthase comprises a chimeric monomeric anthranilate synthase comprising a fusion of an anthranilate synthase α-domain of a first species and an anthranilate synthase β-domain from a second species, wherein the first species and the second species are selected from the group consisting of Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Bradyrhizobium japonicum, Brucella melitensis, Escherichia coli, Euglena gracilis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Rhodospirillum rubrum, Ruta graveolens, Rhodopseudomonas palustris, Salmonella typhimurium, Serratia marcescens, Sulfolobus solfataricus, Thermobifida fusca, sorghum, soybean, rice, cotton, wheat, tobacco, and Zea mays.

20. The method of claim 19, wherein the α-domain or the β-domain is at least a portion of SEQ ID NOs: 4, 5, 6, 7, 8, 43, 44, 45, 57, 66, 77, 78, 79, 80, 81, 82, 99, 100, 101, 102, 103, 108, 109, 110, 111, 117, 118, 130, 131, 132, 133, and 137.

21. The method of claim 15, wherein the DNA molecule further encodes a plastid transit peptide.

22. The method of claim 21, wherein the plastid transit peptide is selected from the group consisting of SEQ ID NOs: 72, 74, 114, and 115.

23. The method of claim 15, wherein the plant is a dicot.

24. The method of claim 33, wherein the dicot is selected from the group consisting of soybean, cotton, and canola.

25. The method of claim 20, wherein the plant is a monocot.

26. The method of claim 25, wherein the monocot is selected from the group consisting of maize, rice, wheat, barley, and sorghum.

27. A method for making an animal feed or a human food comprising:

a. introducing into regenerable cells of a plant a transgene comprising an isolated DNA molecule encoding an anthranilate synthase wherein the isolated DNA molecule is operably linked to a promoter functional in a plant cell, to yield transformed plant cells; and

b. regenerating a plant from the transformed plant cells wherein the cells of the plant express the anthranilate synthase encoded by the isolated DNA molecule in an amount effective to increase the tryptophan content in the plant relative to the tryptophan content in a second plant of the same or similar genetic background that does not include the transgene.

28. The method of claim 27, wherein the anthranilate synthase is selected from the group consisting of SEQ ID NOs: 4, 7, 43, 57, 77, 78, 79, 80, 81, 82, 130, 131, and 132.

29. The method of claim 27, wherein the anthranilate synthase comprises a chimeric monomeric anthranilate synthase comprising a fusion of an anthranilate synthase α-domain of a first species and an anthranilate synthase β-domain from a second species, wherein the first species and the second species are selected from the group consisting of Agrobacterium tumefaciens, Anabaena M22983, Arabidopsis thaliana, Azospirillum brasilense, Bradyrhizobium japonicum, Brucella melitensis, Escherichia coli, Euglena gracilis, Mesorhizobium loti, Nostoc sp. PCC7120, Rhizobium meliloti, Rhodospirillum rubrum, Ruta graveolens, Rhodopseudomonas palustris, Salmonella typhimurium, Serratia marcescens, Sulfolobus solfataricus, Thermobifida fusca, sorghum, soybean, rice, cotton, wheat, tobacco, and Zea mays.

30. An animal feed or human food made by the method of claim 27.

31. An animal feed or human food comprising the DNA construct of claim 10.

32. A transgenic plant made by the method of claim 27.

33. A transgenic plant comprising the DNA construct of claim 10.