US20030199684A1

US20030199684A1 - Novel gene involved in brassinosteroid responses

Info

Publication number: US20030199684A1
Application number: US10/447,135
Authority: US
Inventors: Hirohiko Hirochika; Muneo Yamazaki; Akio Miyao
Original assignee: National Institute of Agrobiological Sciences
Current assignee: National Institute of Agrobiological Sciences; National Agriculture and Bio Oriented Research Organization NARO
Priority date: 2000-05-19
Filing date: 2003-05-27
Publication date: 2003-10-23
Also published as: AU7172800A; JP2001327287A; AU750939B2; US6984727B1; JP3520302B2; CA2325089A1

Abstract

There is provided a polynucleotide encoding a plant gene capable of controlling a signal transduction system for brassinosteroid hormone, the polynucleotide encoding an amino acid sequence from Met at position 1 to Arg at position 1057 of SEQ ID NO: 2 in the SEQUENCE LISTING, including any polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added to the amino acid sequence.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a novel gene. In particular, the present invention relates to a novel gene in plants which encodes a protein having the function of controlling an in-vivo signal transduction system in a physiological reaction system against brassinosteroid hormone.

2. Description of the Related Art

Transposons are mutagenic genes which are known to be ubiquitous in animal, yeast, bacterial, and plant genomes. Transposons are classified into two classes, Class I and Class II, depending on their transposition mechanisms. Transposons belonging to Class II are transposed in the form of DNAs without being replicated. Known Class II transposons include the Ac/Ds, Spm/dSpm and Mu elements of Zea mays (Fedoroff, 1989, Cell 56, 181-191: Fedoroff et al., 1983, Cell 35, 235-242; Schiefelbein et al., 1985, Proc. Natl. Acad. Sci. USA 82, 4783-4787), and the Tam element of Antirrhinum majus (Bonas et al., 1984, EMBO J., 3, 1015-1019). Class II transposons are widely used for gene isolation techniques which utilize transposon tagging. Such techniques utilize the fact that a transposon induces physiological and morphological changes when inserted into genes. The affected gene can be isolated by detecting such changes (Bancroft et al., 1993, The Plant Cell, 5, 631-638; Colasanti et al., 1998, Cell, 93, 593-603: Gray et al., 1997, Cell, 89, 25-31; Keddie et al., 1998, The Plant Cell, 10, 877-887: Whitham et al., 1994, Cell, 78, 1101-1115).

Transposons belonging to Class I, also referred to as retrotransposons, are replicated and transposed via RNA intermediates. Class I transposons were first identified and characterized in Drosophila and in yeasts. However, recent studies have revealed that Class I transposons are ubiquitous in plant genomes and account for a substantial portion of the genomes (Bennetzen, 1996, Trends Microbiolo., 4, 347-353; Voytas, 1996, Science, 274, 737-738). A large majority of retrotransposons appear to be inactive. Recent studies indicate that some of these retrotransposons are activated under stress conditions such as injuries, pathogenic attacks, or cell culture (Grandbastien, 1998, Trends in Plant Science, 3, 181-187; Wessler, 1996, Curr. Biol. 6, 959-961; Wessler et al., 1995, Curr. Opin. Genet. Devel. 5, 814-821). Activation under stress conditions has been reported for Tnt1 A and Tto1 in tobacco (Pouteau et al., 1994, Plant J., 5, 535-542: Takeda et al., 1988, Plant Mol. Biol., 36, 365-376), and Tos17 in rice (Hirochika et al., 1996, Proc. Natl. Acad. Sci. USA, 93, 7783-7788), for example.

The Tos17 retrotransposon of rice is one of the most-extensively studied plant Class I elements in plants. Tosl7 was cloned by an RT-PCR method using a degenerate primer prepared based on a conservative amino acid sequence in reverse transcription enzyme domains between Ty1-copia retroelements (Hirochika et al., 1992, Mol. Gen. Genet., 233, 209-216). Tos17 is 4.3 kb long, and has two 138 bp LTRs (long chain terminal repetitions) and PBS (primer binding sites) complementary to the 3′ end of the start methionine tRNA (Hirochika et al., 1996, supra). Tos17 transcription is strongly activated through tissue culture, and its copy number increases with culture time. In Nipponbare, a model Japonica cultivar used for genome analysis, two copies of Tos17 are initially present, which are increased to 5 to 30 copies in a regenerated plant after tissue culture (Hirochika et al., 1996, supra). Unlike Class II transposons which were characterized in yeasts and Drosophila, Tos17 is transposed in chromosomes in random manners and causes stable mutation, and therefore provides a powerful tool for functional analysis of rice genes (Hirochika, 1997, Plant Mol. Biol. 35, 231-240; 1999, Molecular Biology of. Rice (ed. by K. Shimamoto, Springer-Verlag, 43-58).

SUMMARY OF THE INVENTION

The present invention relates to a polynucleotide encoding a plant gene capable of controlling a signal transduction system for brassinosteroid hormone, the polynucleotide encoding an amino acid sequence from Met at position 1 to Arg at position 1057 of SEQ ID NO: 2 in the SEQUENCE LISTING, including any polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added to the amino acid sequence.

In one embodiment of the invention, the polynucleotide may be derived from rice.

In another embodiment of the invention, the polynucleotide may be as represented by SEQ ID NO: 1 in the SEQUENCE LISTING.

The present invention further relates to methods for controlling various effects in plants in which brassinosteroid hormone is involved, e.g., growth promotion, yield increase, quality improvement, maturation enhancement, and tolerance against biotic and abiotic stresses.

The inventors diligently conducted systematic analyses of phenotypes of plants having a newly transposed To1 7 copy and sequences adjoining Tos17 target sites with respect to rice. As a result, the inventors found a dwarf rice mutation obtained from Tos17 insertion, and isolated the gene responsible for this mutation by utilizing Tos17 as a tag, thereby accomplishing the present invention.

Thus, the invention described herein makes possible the advantage of providing a novel plant gene which can be provided by using Tos17.

This and other advantages of the present invention will become apparent to those skilled in the art upon reading and understanding the following detailed description with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A and 1B are photographs showing a brassinosteroid non-sensitive mutant having Tos17 inserted therein, which was found among regenerated Akitakomachi lineage. On the left of each figure is shown a brassinosteroid non-sensitive mutant having Tos17 inserted therein. On the right of each figure is shown a wild type plant body. FIG. 1A evidences an influence toward dwarfism and upright form. FIG. 1B evidences an influence toward malformation of grain hulls. [0014]
FIGS. 2A and 2B are photographs showing a brassinosteroid non-sensitive mutant having Tos17 inserted therein, which was found among regenerated Nipponbare lineage. On the left of each figure is shown a brassinosteroid non-sensitive mutant having Tos17 inserted therein. On the right of each figure is shown a wild type plant body. FIG. 2A evidences an influence toward dwarfism and upright form. FIG. 2B evidences an influence toward malformation of grain hulls. [0015]
FIG. 3A shows a Northern analysis autoradiogram of RNA extracted from the leaves of a brassinosteroid non-sensitive mutant (Akitakomachi) and RNA extracted from various organs of a wild type rice plant (Nipponbare). [0016]
FIG. 3B shows a Northern analysis autoradiogram of RNA extracted from brassinosteroid non-sensitive mutants and RNA extracted from wild type rice plants. The left-hand side of FIG. 3B shows a comparison between wild types and mutants obtained by using a 5′ probe. The right-hand side of FIG. 3B shows a comparison between wild types and mutants obtained by using a 3′ probe. [0017]
FIG. 4 shows an amino acid sequence of the novel rice gene which controls a physiological reaction system induced by brassinosteroid hormone, together with characteristic sequences found therein (where nuclear localization signals and an ATP/GTP binding motif can be observed). [0018]
FIG. 5A shows a brassinosteroid leaf blade bending experimentation using a mutated line (A0369) derived from Akitakomachi. The left-hand side shows results of wild type plants, whereas the right-hand side shows results of mutants. [0019]
FIG. 5B shows a brassinosteroid leaf blade bending experimentation using a mutated line (NC6148) derived from Nipponbare. The left-hand side shows results of wild type plants, whereas the right-hand side shows results of mutants.[0020]

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention provides a method for producing an improved plant, the method utilizing a novel plant gene which can be provided by using Tos17. [0021]
According to the present invention, there is provided a polynucleotide encoding a plant gene capable of controlling various effects in which brassinosteroid hormone is involved. As used herein, the term “capable of controlling various effects” means the ability to control various effects in plants in which brassinosteroid hormone is involved, e.g., growth promotion, yield increase, quality improvement, maturation enhancement, and tolerance against biotic and abiotic stresses, including dwarfism, upright form, and malformation of grain hulls, thereby providing a number of agriculturally useful effects as are attained by treatments with brassinosteroid hormone agricultural chemicals. The term “plants” encompasses both monocotyledons and dicotyledons. [0022]
A polynucleotide encoding a plant gene capable of controlling a signal transduction system for brassinosteroid hormone according to the present invention is, for example, a polynucleotide encoding an amino acid sequence from Met at [0023] position 1 to Arg at position 1057 of SEQ ID NO: 2 in the SEQUENCE LISTING, including any polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added to the aforementioned amino acid sequence.
A polynucleotide encoding a plant gene capable of controlling various effects in which brassinosteroid hormone is involved encompasses any polynucleotides which have at least about 80% sequence homology, preferably at least about 85% sequence homology, and more preferably at least about 90% sequence homology, still more preferably at least about 95% sequence homology, and most preferably at least about 99% sequence homology, with an amino acid sequence from Met at [0024] position 1 to Arg at position 1057 of SEQ ID NO: 2 in the SEQUENCE LISTING, so long as they are capable of controlling various effects in plants in which brassinosteroid hormone is involved. The term “sequence homology” indicates a degree of identity between two polynucleotide sequences to be compared with each other. The rate (%) of sequence homology between two polynucleotide sequences for comparison is calculated by, after optimally aligning the two polynucleotide sequences for comparison, obtaining a matched position number indicating the number of positions at which identical (“matched”) nucleic acid bases (e.g., A, T, C, G, U, or I) are present in both sequences, dividing the matched position number by total number of bases in the polynucleotide sequences for comparison, and multiplying the quotient by 100. The sequence homology can be calculated by using the following sequencing tools, for example: a Unix base program designated GCG Wisconsin Package (Program Manual for the Wisconsin Package, Version 8, September 1994, Genetics Computer Group, 575 Science Drive Madison, Wis., USA 53711; Rice, P. (1996) Program Manual for EGCG Package, Peter Rice, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, England), and the ExPASy World Wide Web molecular biology server (Geneva University Hospital and University of Geneva, Geneva, Switzerland).
Cells into which genes have been introduced are first selected based on drug resistance, e.g., hygromycin resistance, and then regenerated into plant bodies by using usual methods. [0025]
The terminology and laboratory procedures described throughout the present specification are directed to those which are well-known and commonly employed in the art. Standard techniques may be used for recombination methods, polynucleotide synthesis, microorganisms culturing, and transformation (e.g., electroporation). Such techniques and procedures are generally known from various standard textbooks available in the field or by way of the present specification (including a generally-referenced textbook by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Such literature is incorporated herein by reference. [0026]
The polynucleotide according to the present invention can be obtained by using the method described herein, for example. However, the polynucleotide according to the present invention may also be obtained by any chemical synthesis process based on the sequence disclosed herein. For example, the polynucleotide according to the present invention may be synthesized by using a polynucleotide synthesizer available from Applied Bio Systems in accordance with the instructions provided by the manufacturer. [0027]
Methods of PCR amplification are well-known in the art (PCR Technology: Principles and Applications for DNA Amplification, ed. H A Erlich, Freeman Press, NewYork, N.Y. (1992); PCR Protocols: A Guide to Methods and Applications, Innis, Gelfland, Snisky, and White, Academic Press, San Diego, Calif. (1990); Mattila et al. (1991) Nucleic Acids Res. 19: 4967; Eckert, K. A. and Kunkel, T. A. (1991) PCR Methods and Applications 1: 17; PCR, McPherson, Quirkes, and Taylor, IRL Press, Oxford). Such literature is incorporated herein by reference. [0028]

EXAMPLES

Hereinafter, the present invention will be described by way of examples which are of illustrative but non-limiting nature. [0029]

Example 1

Activation of Tos17 Via Culture [0030]
Using fully ripened seeds of Nipponbare and Akitakomachi, which are varieties of Japonica subspecies, induction of calli and cell suspension culture were carried out as described earlier (Hirochika et al., 1996, supra). The activation of Tos17 which was used for gene destruction was carried out following the method of Ohtsuki (1990) (rice protoplast culture system, Food and Agricultural Research Development Association). In summary, fully ripened seeds of rice were cultured in an MS medium having 2,4-dichlorophenoxyacetic acid (2,4-D) added thereto (2 mg/ml) (Ohtsuki (1990), supra) (25° C., 1 month), to induce callus formation. The resultant calluses were cultured for 5 months in an N6 liquid medium having 2,4-D added thereto (Ohtsuki (1990), supra), and thereafter placed on a redifferentiation medium (Ohtsuki (1990), supra), whereby redifferentiated rice plants were obtained (first generation (R1) plants). [0031]

Example 2

Isolation of sequences adjoining Tos17 [0032]
Utilizing each of the regenerated R1 rice plants obtained according to Example 1 as a first strain, about 1000 R1 seeds were collected from each strain and grown on a paddy field to obtain second generation (R2) plants, which were subjected to a morphological analysis. As a result of observing the phenotypes of the respective plant bodies in the R2 group, it was learned that about ¼ of the R2 group of an Akitakomachi strain A0369 exhibit the “dwarfism, upright form, and malformation of grain hulls” phenotype (FIGS. 1A and 1B). In the regenerated group of Akitakomachi, dwarfism, upright form, and malformation of grain hulls were observed for brassinosteroid insensitive mutants (FIG. 1A, left, and FIG. 1B, left), as compared with the wild type (FIG. 1A, right, and FIG. 1B, right). The isolation of adjacent sequences of transposed Tos17, which is co-segragating with the phenotypes, was carried out by an IPCR method (Ochman et al., Genetics Nov; 120(3): 621-3(1988) and Triglia et al., Nucleic Acids Res Aug,25: (16): 8186(1988)) The total DNA of A0369 was digested with XbaI, and a ligation process was performed in a large quantity of solution, thereby obtaining self-ligated circular molecules. In the self-ligated circular molecules, the adjacent sequences are flanking the internal sequence of Tos17. As a result, amplification was successfully carried out by usual PCR methods using an outward primer pair (T17TAIL3: GAGAGCATCATCGGTTACATCTTCTC; T17-1950R: TCTAGCAGTCTCAATGATGTGGCG) based on the known sequence of Tos17. [0033]

Example 3

Search for Alleles [0034]
Using the sequence obtained according to Example 2, lineage in which Tos17 had been inserted at a different site in the same gene was selected by PCR from the regenerated rice group of Nipponbare. As a result, a line (NC6148) which similarly exhibited dwarfism, upright form, and malformation of grain hulls were observed for brassinosteroid was selected. That is, in the regenerated rice group of Nipponbare, as well, dwarfism, upright form, and malformation of grain hulls were observed for brassinosteroid insensitive mutants (FIG. 2A, left, and FIG. 2B, left), relative to the wild type (FIG. 2A, right, and FIG. 2B, right). It was concluded that these common mutations were results of the same gene having been destroyed. [0035]

Example 4

Expression and Analysis of the Causative Gene [0036]
From the group of R2 rice plants (selfed progeny from the A0369 and NC6148 strains) obtained according to Examples 2 and 3, individuals exhibiting mutation were identified from normal individuals. RNA was prepared from both groups of individuals, and the expression specificity was analyzed through Northern analysis. After agarose electrophoresis, the RNA obtained from individuals exhibiting mutation and the RNA obtained from normal individuals were allowed to adsorb to nylon membranes. DNA fragments which were obtained by amplifying via PCR a sequence (positions 5775-6638 of the genomic sequence) on the 5′ side and a sequence (positions 8175-8765 of the genomic sequence) on the 3′ side of the Tos17 insertion site in both mutated lines were labeled with [0037] ³²P-dCTP. By using these as probes, expression specificity was analyzed through Northern analysis (FIGS. 3A and 3B). As seen from the Northern analysis autoradiogram shown in FIG. 3A, a band (about 4.3 kb) indicated by an arrow was confirmed to be expressed in all observed organs of the wild type. However, in the mutants, transcripts of abnormal sizes were observed due to the insertion of Tos17, indicating that the natural function of the wild type is lost (FIG. 3B).

Example 5

Structural Analysis of the Causative Gene [0038]
Using the sequence obtained according to Example 2 as a probe, the corresponding cDNA and genomic clone were obtained from a cDNA library and a genomic library. Their structures are shown in SEQ ID Nos: 1 and 3. It was learned that this gene includes 6 exons and 5 introns, encoding 1057 amino acids, and that Tos17 had been inserted at the 4th and 5th exons in two mutants, respectively. Moreover, motif search results suggested the presence of nuclear localization signal 1 (amino acid residues 329-367 of SEQ ID NO: 2, Robbins & Dingwall consensus sequence; a search result by PSORT program (http://psort.ims.u-tokyo.ac.jp/)) and nuclear localization signal 2 (amino acid residues 457-460, 595-600 of SEQ ID NO: 2, 4 amino acid nuclear localization pattern signal; a search result by PSORT program (http://psort.ims.u-tokyo.ac.jp/)) as well as the presence of an ATP/GTP binding domain (amino acid residues 526-533 of SEQ ID NO: 2; a search result by a motif search service on Genomenet(http://www.genome.ad.jp/)). Thus, the possibility of this gene being involved in signal transduction was suggested (FIG. 4). [0039]

Example 6

Brassinosteroid Sensitivity Evaluation [0040]
The present gene was deduced to be a factor involved in the signal transduction system for plant hormones, taking note of the facts that the present gene was expressed in all plant bodies and that pleiotropic influences resulted from destroying this gene, as well as the possibility that the gene might be a factor involved in the signal transduction system. Presuming that the signal transduction system is that for brassinosteroid hormone in view of the resultant upright form, the inventors performed a leaf blade bend response test as a brassinosteroid response test, by using brassinolide, which is one kind of brassinosteroid hormone. The second leaf of rice which was allowed to germinate in the dark was cut off, and immersed in a 1 ng/ml of brassinosteroid solution for 48 hours. The wild type individuals having the wild type genes showed bending of the leaf blades and leaf sheath junctions (left-hand side in FIGS. 5A and 5B), showing response to brassinolide, whereas mutant individuals showed little bending thereof (right-hand side in FIGS. 5A and 5B), indicating that the destruction of the present gene resulted in the loss of response to brassinosteroid. From the above results, it was revealed that the present gene is a gene involved in the signal transduction system for brassinosteroid hormone. [0041]
The above examples are illustrative, and by no means limiting, of various aspects of the present invention and the manners in which the oligonucleotide according to the present invention can be made and utilized. [0042]
Thus, according to the present invention, a novel polynucleotide is provided which is capable of controlling various effects in which brassinosteroid hormone is involved, the polynucleotide being of use in plant breeding. By introducing the present polynucleotide into plants and artificially controlling various effects in which brassinosteroid hormone is involved, it is expected that effects such as growth promotion, yield increase, quality improvement, maturation enhancement, and tolerance against biotic and abiotic stresses can be controlled, thereby providing a number of agriculturally useful effects as are attained by treatments with brassinosteroid hormone agricultural chemicals. [0043]
Various other modifications will be apparent to and can be readily made by those skilled in the art without departing from the scope and spirit of this invention. Accordingly, it is not intended that the scope of the claims appended hereto be limited to the description as set forth herein, but rather that the claims be broadly construed. [0044]
1 3 1 4310 DNA Oryza sativa CDS (655)..(3828) 1 ctcttctcca ctccaaatcc cttcttaccc tattcccctc cccccgcagc ttctcttcct 60 cctgcagtac tcgccgccac caccaccgcg ccgccgccgc cggccgcgtt ccgagaccca 120 ctcgatcgga atccaccgcg gcgcgcccgc gcgcctgcgt cctcttcctt ccccgggagc 180 cgaccgacca cggcgaccag tcgatctccc tctccgggcg ccaaccgcgt cttagcttca 240 tcgaatccac cgccccaccc cgcatctcct cctcctcctc cgacgacgac gactactact 300 agtcttctcc aataagcccc cctcccgctc cccccgcctg aagaagaagc agcagctagc 360 tccggggaga ggtcgacggc gcgccgggta gatcgcgccc cgccccgcct gcgtcgcggc 420 tgtcggagca aacgcaaacc ccccaggttg ttctagcgtg tgcagcggct agctgattga 480 ttgtcttctg tgatatatcc agagctcgtg ttttgtggtt tgtggtttgt ggtttgtgct 540 tggattgttg atgtgctaat tcgcggcgtt acaagatcac tgctggattg atattgagtt 600 gtgcctcggc tgtgctagct gtgtgttgat tctctcctcg tcgtggtgat cgat atg 657 Met 1 gag att gtt gca gta gat cag gag gga gct cgt gtt gtt ggg acg aac 705 Glu Ile Val Ala Val Asp Gln Glu Gly Ala Arg Val Val Gly Thr Asn 5 10 15 tgt atg ctt gct cgt ggt gga act ggt gct gta gcg cca gtg ttg gag 753 Cys Met Leu Ala Arg Gly Gly Thr Gly Ala Val Ala Pro Val Leu Glu 20 25 30 ctg aca gcg acg cct cgt cag gat gca gcc gct gaa gct ggt gta gac 801 Leu Thr Ala Thr Pro Arg Gln Asp Ala Ala Ala Glu Ala Gly Val Asp 35 40 45 gaa ccg gca caa cac caa tgc gag cat ttc tcc ata aga ggg tat gtt 849 Glu Pro Ala Gln His Gln Cys Glu His Phe Ser Ile Arg Gly Tyr Val 50 55 60 65 gct ctt ctt cag aag aag gat cca aaa ttc tgc tct cta tct cgg att 897 Ala Leu Leu Gln Lys Lys Asp Pro Lys Phe Cys Ser Leu Ser Arg Ile 70 75 80 ttc cat gac cag aaa aaa tgt gat gaa cac aaa gct agt tca agc cca 945 Phe His Asp Gln Lys Lys Cys Asp Glu His Lys Ala Ser Ser Ser Pro 85 90 95 ttt tct gta gca aag ttt cga cga tgg gat tgc tcg aag tgc ttg gat 993 Phe Ser Val Ala Lys Phe Arg Arg Trp Asp Cys Ser Lys Cys Leu Asp 100 105 110 aag ttg aaa act tca gat aat gga aca gca cca aga act ctt ccc gca 1041 Lys Leu Lys Thr Ser Asp Asn Gly Thr Ala Pro Arg Thr Leu Pro Ala 115 120 125 aag cag aat ggc aca agt gat ggt tgc tcc atc aca ttt gtt cgg agc 1089 Lys Gln Asn Gly Thr Ser Asp Gly Cys Ser Ile Thr Phe Val Arg Ser 130 135 140 145 act ttt gtg cct gct agt gtt ggt tcc caa aaa gtg tct cct agc aca 1137 Thr Phe Val Pro Ala Ser Val Gly Ser Gln Lys Val Ser Pro Ser Thr 150 155 160 caa tca tct caa ggg aag aat gct gat aga tca act ctt cca aag agt 1185 Gln Ser Ser Gln Gly Lys Asn Ala Asp Arg Ser Thr Leu Pro Lys Ser 165 170 175 gtg caa gaa ggc aat gac tcc aaa tgc aat gcg cct tct ggc aag aat 1233 Val Gln Glu Gly Asn Asp Ser Lys Cys Asn Ala Pro Ser Gly Lys Asn 180 185 190 gga gct gct gag gcc aat act gat tca cca atg aaa gat ttg caa ggg 1281 Gly Ala Ala Glu Ala Asn Thr Asp Ser Pro Met Lys Asp Leu Gln Gly 195 200 205 cca gcc caa aat tat gat gtg gca gca aat gtc tct gag gac aac act 1329 Pro Ala Gln Asn Tyr Asp Val Ala Ala Asn Val Ser Glu Asp Asn Thr 210 215 220 225 tct gtt gat gtt ggg gct tta cct gaa gtt ccc cag att aca tgg cac 1377 Ser Val Asp Val Gly Ala Leu Pro Glu Val Pro Gln Ile Thr Trp His 230 235 240 ata gaa gta aat ggt gca gat caa cct cca tcc act cca aaa ctt tct 1425 Ile Glu Val Asn Gly Ala Asp Gln Pro Pro Ser Thr Pro Lys Leu Ser 245 250 255 gaa gtg gtc ctc aaa aga aat gaa gat gaa aat gga aaa act gaa gag 1473 Glu Val Val Leu Lys Arg Asn Glu Asp Glu Asn Gly Lys Thr Glu Glu 260 265 270 act ctt gtt gct gag cag tgc aat ttg acc aaa gat cct aac cca atg 1521 Thr Leu Val Ala Glu Gln Cys Asn Leu Thr Lys Asp Pro Asn Pro Met 275 280 285 tct gga aag gaa cgt gat cag gtt gct gag cag tgc aat ttg acc aaa 1569 Ser Gly Lys Glu Arg Asp Gln Val Ala Glu Gln Cys Asn Leu Thr Lys 290 295 300 305 gat ccg aaa cca gtg tct ggg cag aaa tgt gag cag atc tgc aat gag 1617 Asp Pro Lys Pro Val Ser Gly Gln Lys Cys Glu Gln Ile Cys Asn Glu 310 315 320 cca tgt gaa gaa gtt gtt ctc aaa aga agc tcc aaa tct aag agg aag 1665 Pro Cys Glu Glu Val Val Leu Lys Arg Ser Ser Lys Ser Lys Arg Lys 325 330 335 acg gat aag aag ttg atg aag aag cag cag cac agc aag aaa cgc act 1713 Thr Asp Lys Lys Leu Met Lys Lys Gln Gln His Ser Lys Lys Arg Thr 340 345 350 gcc cag gct gat gtt tca gat gca aag ctt tgt cgg aga aag cca aaa 1761 Ala Gln Ala Asp Val Ser Asp Ala Lys Leu Cys Arg Arg Lys Pro Lys 355 360 365 aag gtg cgg ctt cta tca gaa att ata aat gct aac cag gtt gag gat 1809 Lys Val Arg Leu Leu Ser Glu Ile Ile Asn Ala Asn Gln Val Glu Asp 370 375 380 385 tct aga agt gac gaa gtt cat cgt gaa aat gcc gct gat ccc tgt gag 1857 Ser Arg Ser Asp Glu Val His Arg Glu Asn Ala Ala Asp Pro Cys Glu 390 395 400 gat gat aga agt acc atc ccg gtc ccg atg gaa gta agc atg gat att 1905 Asp Asp Arg Ser Thr Ile Pro Val Pro Met Glu Val Ser Met Asp Ile 405 410 415 cct gtt agc aac cat aca gtg gga gaa gat ggg tta aaa tca agt aag 1953 Pro Val Ser Asn His Thr Val Gly Glu Asp Gly Leu Lys Ser Ser Lys 420 425 430 aac aag aca aaa cgc aaa tac tct gat gtt gta gat gat gga tca tca 2001 Asn Lys Thr Lys Arg Lys Tyr Ser Asp Val Val Asp Asp Gly Ser Ser 435 440 445 ctt atg aac tgg ctg aat gga aaa aag aaa aga act gga agt gtg cat 2049 Leu Met Asn Trp Leu Asn Gly Lys Lys Lys Arg Thr Gly Ser Val His 450 455 460 465 cac aca gtt gct cat cca gct ggg aat ttg agc aac aaa aaa gtg aca 2097 His Thr Val Ala His Pro Ala Gly Asn Leu Ser Asn Lys Lys Val Thr 470 475 480 ccc act gcg agt act cag cat gat gat gag aat gat act gaa aat ggt 2145 Pro Thr Ala Ser Thr Gln His Asp Asp Glu Asn Asp Thr Glu Asn Gly 485 490 495 ctt gac aca aat atg cat aag aca gat gtc tgt cag cat gta tca gaa 2193 Leu Asp Thr Asn Met His Lys Thr Asp Val Cys Gln His Val Ser Glu 500 505 510 atc tcc aca cag agg tgc tca tca aag ggg aaa aca gcg ggt ttg agt 2241 Ile Ser Thr Gln Arg Cys Ser Ser Lys Gly Lys Thr Ala Gly Leu Ser 515 520 525 aag ggg aaa aca cat tca gct gct agt acc aaa tat ggt ggt gaa agc 2289 Lys Gly Lys Thr His Ser Ala Ala Ser Thr Lys Tyr Gly Gly Glu Ser 530 535 540 545 acc aga aat ggt cag aac ata cat gta ctc agc gca gaa gat caa tgc 2337 Thr Arg Asn Gly Gln Asn Ile His Val Leu Ser Ala Glu Asp Gln Cys 550 555 560 cag atg gaa acc gaa aac tct gtt ctg agt cac tcg gca aag gtt tct 2385 Gln Met Glu Thr Glu Asn Ser Val Leu Ser His Ser Ala Lys Val Ser 565 570 575 cca gct gag cat gat atc caa att atg tct gac ctt cat gag cag agt 2433 Pro Ala Glu His Asp Ile Gln Ile Met Ser Asp Leu His Glu Gln Ser 580 585 590 cta ccc aag aag aaa aag aag caa aaa ctt gaa gtg act cgt gaa aaa 2481 Leu Pro Lys Lys Lys Lys Lys Gln Lys Leu Glu Val Thr Arg Glu Lys 595 600 605 cag acc atg ata gat gac atc ccc atg gat att gtt gaa ctg cta gct 2529 Gln Thr Met Ile Asp Asp Ile Pro Met Asp Ile Val Glu Leu Leu Ala 610 615 620 625 aaa aac cag cat gag agg cag ctt atg act gag act gat tgt tct gac 2577 Lys Asn Gln His Glu Arg Gln Leu Met Thr Glu Thr Asp Cys Ser Asp 630 635 640 atc aac cgt att caa tcc aag aca act gct gat gat gat tgt gta ata 2625 Ile Asn Arg Ile Gln Ser Lys Thr Thr Ala Asp Asp Asp Cys Val Ile 645 650 655 gta gct gcc aag gat ggt tca gat tat gca tca agt gtg ttt gac act 2673 Val Ala Ala Lys Asp Gly Ser Asp Tyr Ala Ser Ser Val Phe Asp Thr 660 665 670 aat tcc caa cag aag tcc ttg gca tcc caa agt aca cag aag gag tta 2721 Asn Ser Gln Gln Lys Ser Leu Ala Ser Gln Ser Thr Gln Lys Glu Leu 675 680 685 cag ggt cat ttg gca ttg acc aca caa gag tct cca cat cct cag aac 2769 Gln Gly His Leu Ala Leu Thr Thr Gln Glu Ser Pro His Pro Gln Asn 690 695 700 705 ttt cag tct act cag gaa cag cag aca cat ttg cgg atg gaa gaa atg 2817 Phe Gln Ser Thr Gln Glu Gln Gln Thr His Leu Arg Met Glu Glu Met 710 715 720 gtc act att gct gca agc tca cca cta ttt tca cat cat gat gat cag 2865 Val Thr Ile Ala Ala Ser Ser Pro Leu Phe Ser His His Asp Asp Gln 725 730 735 tat att gct gaa gca cca act gaa cat tgg ggc cgt aag gac gca aag 2913 Tyr Ile Ala Glu Ala Pro Thr Glu His Trp Gly Arg Lys Asp Ala Lys 740 745 750 aag cta acg tgg gag caa ttt aag gcc act aca aga aat tct cca gca 2961 Lys Leu Thr Trp Glu Gln Phe Lys Ala Thr Thr Arg Asn Ser Pro Ala 755 760 765 gca aca tgt ggt gct caa ttt aga cct ggt atc caa gca gtt gac ttg 3009 Ala Thr Cys Gly Ala Gln Phe Arg Pro Gly Ile Gln Ala Val Asp Leu 770 775 780 785 act tct act cat gtc atg gga tct tcc agc aat tat gca tct cgc caa 3057 Thr Ser Thr His Val Met Gly Ser Ser Ser Asn Tyr Ala Ser Arg Gln 790 795 800 cca gta att gcg cca ctg gac cgc tat gct gaa aga gcg gtt aac cag 3105 Pro Val Ile Ala Pro Leu Asp Arg Tyr Ala Glu Arg Ala Val Asn Gln 805 810 815 gtc cat gca aga aat ttt cca agc aca ata gca acc atg gaa gcg agt 3153 Val His Ala Arg Asn Phe Pro Ser Thr Ile Ala Thr Met Glu Ala Ser 820 825 830 aag tta tgt gat cgg aga aat gct gga caa gta gtc ttg tat cct aaa 3201 Lys Leu Cys Asp Arg Arg Asn Ala Gly Gln Val Val Leu Tyr Pro Lys 835 840 845 gaa tcc atg cct gcg acg cat ctt ctg aga atg atg gat cca tca aca 3249 Glu Ser Met Pro Ala Thr His Leu Leu Arg Met Met Asp Pro Ser Thr 850 855 860 865 tta gca agc ttc ccc aac tat gga act tct agc agg aac cag atg gag 3297 Leu Ala Ser Phe Pro Asn Tyr Gly Thr Ser Ser Arg Asn Gln Met Glu 870 875 880 tct caa ctt cat aat tct cag tat gca cat aat cag tac aaa gga tca 3345 Ser Gln Leu His Asn Ser Gln Tyr Ala His Asn Gln Tyr Lys Gly Ser 885 890 895 acc agc aca tca tat ggc agt aac ctg aat gga aag att cca ttg aca 3393 Thr Ser Thr Ser Tyr Gly Ser Asn Leu Asn Gly Lys Ile Pro Leu Thr 900 905 910 ttc gaa gac tta tca cgg cat cag ctg cat gat ctg cac aga cct tta 3441 Phe Glu Asp Leu Ser Arg His Gln Leu His Asp Leu His Arg Pro Leu 915 920 925 cgc cca cat cct aga gtt ggt gtg ctt ggc tcc ttg ctg cag aag gaa 3489 Arg Pro His Pro Arg Val Gly Val Leu Gly Ser Leu Leu Gln Lys Glu 930 935 940 945 att gca aac tgg tcg gag aac tgt ggc aca caa tct ggt tat aag tta 3537 Ile Ala Asn Trp Ser Glu Asn Cys Gly Thr Gln Ser Gly Tyr Lys Leu 950 955 960 gga gtg tca aca gga ata aca tcg cat cag atg aac aga aag gaa cat 3585 Gly Val Ser Thr Gly Ile Thr Ser His Gln Met Asn Arg Lys Glu His 965 970 975 ttt gaa gcc ctg aat tct gga atg ttt tca gca aaa tgg aat gca ttg 3633 Phe Glu Ala Leu Asn Ser Gly Met Phe Ser Ala Lys Trp Asn Ala Leu 980 985 990 cag ttg ggt tct gtt agc tcc agt gca gat ttt tta tca gcg agg aac 3681 Gln Leu Gly Ser Val Ser Ser Ser Ala Asp Phe Leu Ser Ala Arg Asn 995 1000 1005 agc ata gct caa tct tgg acc aga ggc aag ggt aaa atg gtt cat ccc 3729 Ser Ile Ala Gln Ser Trp Thr Arg Gly Lys Gly Lys Met Val His Pro 1010 1015 1020 1025 ttg gat cgg ttt gtg aga cag gat atc tgt ata act aac aag aac cca 3777 Leu Asp Arg Phe Val Arg Gln Asp Ile Cys Ile Thr Asn Lys Asn Pro 1030 1035 1040 gct gat ttt act aca atc agt aac gat aac gag tat atg gat tac cgc 3825 Ala Asp Phe Thr Thr Ile Ser Asn Asp Asn Glu Tyr Met Asp Tyr Arg 1045 1050 1055 tga agcagaaagt ggtgtgcata attcctgaac atttacaatc atacatttca 3878 tctttatggc gccaaatagt catactgtaa gaggagggct ttgctggatc tgctgtaagg 3938 cttcttgtaa gttgtggatg ccccattttc tggatgggaa cctgccagac agtgaacaag 3998 ggctttgcaa ggtgcagcat ccggtttttg ttttgccagt ccaagaaacg tcctcctgtt 4058 actttgtagt tgtactcata ctagtgcgct tgtttgtaca aggagaaatg tgtaaccttg 4118 ttgaaaaaat gtctccccca ttttgtaatt accataagga ggtttatagt gttgtgagct 4178 gtgtgtgact gacggcgaga aatggttttg tcggtgttaa ggttgaaacg actagctctc 4238 gttatcaatg tgttgtaaac ttctagattg atgtgttacc ttactcttga agtcaacacc 4298 ggagaattta ca 4310 2 1057 PRT Oryza sativa 2 Met Glu Ile Val Ala Val Asp Gln Glu Gly Ala Arg Val Val Gly Thr 1 5 10 15 Asn Cys Met Leu Ala Arg Gly Gly Thr Gly Ala Val Ala Pro Val Leu 20 25 30 Glu Leu Thr Ala Thr Pro Arg Gln Asp Ala Ala Ala Glu Ala Gly Val 35 40 45 Asp Glu Pro Ala Gln His Gln Cys Glu His Phe Ser Ile Arg Gly Tyr 50 55 60 Val Ala Leu Leu Gln Lys Lys Asp Pro Lys Phe Cys Ser Leu Ser Arg 65 70 75 80 Ile Phe His Asp Gln Lys Lys Cys Asp Glu His Lys Ala Ser Ser Ser 85 90 95 Pro Phe Ser Val Ala Lys Phe Arg Arg Trp Asp Cys Ser Lys Cys Leu 100 105 110 Asp Lys Leu Lys Thr Ser Asp Asn Gly Thr Ala Pro Arg Thr Leu Pro 115 120 125 Ala Lys Gln Asn Gly Thr Ser Asp Gly Cys Ser Ile Thr Phe Val Arg 130 135 140 Ser Thr Phe Val Pro Ala Ser Val Gly Ser Gln Lys Val Ser Pro Ser 145 150 155 160 Thr Gln Ser Ser Gln Gly Lys Asn Ala Asp Arg Ser Thr Leu Pro Lys 165 170 175 Ser Val Gln Glu Gly Asn Asp Ser Lys Cys Asn Ala Pro Ser Gly Lys 180 185 190 Asn Gly Ala Ala Glu Ala Asn Thr Asp Ser Pro Met Lys Asp Leu Gln 195 200 205 Gly Pro Ala Gln Asn Tyr Asp Val Ala Ala Asn Val Ser Glu Asp Asn 210 215 220 Thr Ser Val Asp Val Gly Ala Leu Pro Glu Val Pro Gln Ile Thr Trp 225 230 235 240 His Ile Glu Val Asn Gly Ala Asp Gln Pro Pro Ser Thr Pro Lys Leu 245 250 255 Ser Glu Val Val Leu Lys Arg Asn Glu Asp Glu Asn Gly Lys Thr Glu 260 265 270 Glu Thr Leu Val Ala Glu Gln Cys Asn Leu Thr Lys Asp Pro Asn Pro 275 280 285 Met Ser Gly Lys Glu Arg Asp Gln Val Ala Glu Gln Cys Asn Leu Thr 290 295 300 Lys Asp Pro Lys Pro Val Ser Gly Gln Lys Cys Glu Gln Ile Cys Asn 305 310 315 320 Glu Pro Cys Glu Glu Val Val Leu Lys Arg Ser Ser Lys Ser Lys Arg 325 330 335 Lys Thr Asp Lys Lys Leu Met Lys Lys Gln Gln His Ser Lys Lys Arg 340 345 350 Thr Ala Gln Ala Asp Val Ser Asp Ala Lys Leu Cys Arg Arg Lys Pro 355 360 365 Lys Lys Val Arg Leu Leu Ser Glu Ile Ile Asn Ala Asn Gln Val Glu 370 375 380 Asp Ser Arg Ser Asp Glu Val His Arg Glu Asn Ala Ala Asp Pro Cys 385 390 395 400 Glu Asp Asp Arg Ser Thr Ile Pro Val Pro Met Glu Val Ser Met Asp 405 410 415 Ile Pro Val Ser Asn His Thr Val Gly Glu Asp Gly Leu Lys Ser Ser 420 425 430 Lys Asn Lys Thr Lys Arg Lys Tyr Ser Asp Val Val Asp Asp Gly Ser 435 440 445 Ser Leu Met Asn Trp Leu Asn Gly Lys Lys Lys Arg Thr Gly Ser Val 450 455 460 His His Thr Val Ala His Pro Ala Gly Asn Leu Ser Asn Lys Lys Val 465 470 475 480 Thr Pro Thr Ala Ser Thr Gln His Asp Asp Glu Asn Asp Thr Glu Asn 485 490 495 Gly Leu Asp Thr Asn Met His Lys Thr Asp Val Cys Gln His Val Ser 500 505 510 Glu Ile Ser Thr Gln Arg Cys Ser Ser Lys Gly Lys Thr Ala Gly Leu 515 520 525 Ser Lys Gly Lys Thr His Ser Ala Ala Ser Thr Lys Tyr Gly Gly Glu 530 535 540 Ser Thr Arg Asn Gly Gln Asn Ile His Val Leu Ser Ala Glu Asp Gln 545 550 555 560 Cys Gln Met Glu Thr Glu Asn Ser Val Leu Ser His Ser Ala Lys Val 565 570 575 Ser Pro Ala Glu His Asp Ile Gln Ile Met Ser Asp Leu His Glu Gln 580 585 590 Ser Leu Pro Lys Lys Lys Lys Lys Gln Lys Leu Glu Val Thr Arg Glu 595 600 605 Lys Gln Thr Met Ile Asp Asp Ile Pro Met Asp Ile Val Glu Leu Leu 610 615 620 Ala Lys Asn Gln His Glu Arg Gln Leu Met Thr Glu Thr Asp Cys Ser 625 630 635 640 Asp Ile Asn Arg Ile Gln Ser Lys Thr Thr Ala Asp Asp Asp Cys Val 645 650 655 Ile Val Ala Ala Lys Asp Gly Ser Asp Tyr Ala Ser Ser Val Phe Asp 660 665 670 Thr Asn Ser Gln Gln Lys Ser Leu Ala Ser Gln Ser Thr Gln Lys Glu 675 680 685 Leu Gln Gly His Leu Ala Leu Thr Thr Gln Glu Ser Pro His Pro Gln 690 695 700 Asn Phe Gln Ser Thr Gln Glu Gln Gln Thr His Leu Arg Met Glu Glu 705 710 715 720 Met Val Thr Ile Ala Ala Ser Ser Pro Leu Phe Ser His His Asp Asp 725 730 735 Gln Tyr Ile Ala Glu Ala Pro Thr Glu His Trp Gly Arg Lys Asp Ala 740 745 750 Lys Lys Leu Thr Trp Glu Gln Phe Lys Ala Thr Thr Arg Asn Ser Pro 755 760 765 Ala Ala Thr Cys Gly Ala Gln Phe Arg Pro Gly Ile Gln Ala Val Asp 770 775 780 Leu Thr Ser Thr His Val Met Gly Ser Ser Ser Asn Tyr Ala Ser Arg 785 790 795 800 Gln Pro Val Ile Ala Pro Leu Asp Arg Tyr Ala Glu Arg Ala Val Asn 805 810 815 Gln Val His Ala Arg Asn Phe Pro Ser Thr Ile Ala Thr Met Glu Ala 820 825 830 Ser Lys Leu Cys Asp Arg Arg Asn Ala Gly Gln Val Val Leu Tyr Pro 835 840 845 Lys Glu Ser Met Pro Ala Thr His Leu Leu Arg Met Met Asp Pro Ser 850 855 860 Thr Leu Ala Ser Phe Pro Asn Tyr Gly Thr Ser Ser Arg Asn Gln Met 865 870 875 880 Glu Ser Gln Leu His Asn Ser Gln Tyr Ala His Asn Gln Tyr Lys Gly 885 890 895 Ser Thr Ser Thr Ser Tyr Gly Ser Asn Leu Asn Gly Lys Ile Pro Leu 900 905 910 Thr Phe Glu Asp Leu Ser Arg His Gln Leu His Asp Leu His Arg Pro 915 920 925 Leu Arg Pro His Pro Arg Val Gly Val Leu Gly Ser Leu Leu Gln Lys 930 935 940 Glu Ile Ala Asn Trp Ser Glu Asn Cys Gly Thr Gln Ser Gly Tyr Lys 945 950 955 960 Leu Gly Val Ser Thr Gly Ile Thr Ser His Gln Met Asn Arg Lys Glu 965 970 975 His Phe Glu Ala Leu Asn Ser Gly Met Phe Ser Ala Lys Trp Asn Ala 980 985 990 Leu Gln Leu Gly Ser Val Ser Ser Ser Ala Asp Phe Leu Ser Ala Arg 995 1000 1005 Asn Ser Ile Ala Gln Ser Trp Thr Arg Gly Lys Gly Lys Met Val His 1010 1015 1020 Pro Leu Asp Arg Phe Val Arg Gln Asp Ile Cys Ile Thr Asn Lys Asn 1025 1030 1035 1040 Pro Ala Asp Phe Thr Thr Ile Ser Asn Asp Asn Glu Tyr Met Asp Tyr 1045 1050 1055 Arg 3 9455 DNA Oryza sativa 3 gatctatcgt tgattggatt tcgctgggct agctaggtag acaagggttc aaaatgtgac 60 gaacattatt gagctaataa ataacgagaa accaacttgg tatataggtc aatttcaaaa 120 gaaacaagct gacaaaattc gtccaatttc actagttttt gtcagtaatt gaatggcaat 180 catggttatc gacaaaaccg cttaggagtg ctatttggtg atggaatggt ttataaaact 240 ttggaccgga gtagcagtac aatggcttgt ctgaacaggc taggtagcat agtaggtcct 300 tttgccttgg ttgcactgtt ctgtcggctt ataggggaat ctattggctt aatggaaggg 360 aaaatagtgt gactagcatc atcgatttgc ttgctatcat gtttgagcat cattgacatg 420 tgggtgtcga tctaggagac tatgaatcta gcgaatcctc actagtatgc acatgcacaa 480 cgacatcatg cagctatatg tacaacaatg taggaatggt agctctactc ggattggtgg 540 ccgcattcct acattgctag aaaaacacaa acacacacac acacacacac aaacaaacat 600 aggacgctgc aacacctctt ccctggctac cactatcgcc aaatgccaag catggttgtg 660 ttgacctccc tccttagctg ccactgtgtc cacttcaaaa tccataacca cgacatcttc 720 ccttcttcta caattgttac tactgttctt gaagaggttc ttgtcctacc gacttactaa 780 agaccaacca ttggtcagca gagcatctcg agacttctat accaaagtaa cattgagagg 840 tcaatggcat gtaggaccat cactccgttt gcattgacca atcagagatg agtctgaaca 900 atttcaaccc gtaaaaacgg tccacaattt gattcatcta ttggtttgct gtctgcccat 960 ggccctgcat cttgattgtt tatgatcttt cttagttatc tcttgagatt taatctacct 1020 aattgtgtca ttttaatcct ttgatttatc ttgattggat tcggtctact ttggtttcac 1080 catcttagcc ccgatatgat cttggtagcc cttttttcct cgcactaatc attttcgatt 1140 ctcgactcca atctaagttc ccatggtaga tttaggtcaa taagtgaaaa acaatttccc 1200 ttacaattta atcccctttt gagtaatgac cttcgtactt cctcaaacga tggtttcatg 1260 gataaagatt tgatatttgt ggcgcacgga tggggcatgg cttatgaaga aaatgagctc 1320 attggattgg tattttctcc tccatgctcc tattggtaaa aatattggtt tagttggata 1380 gtcaggttag aacgggattt aaaaatgtga ctacaactag tcgtttatcg cggttgcaca 1440 tgggtgtcaa cgggtgactg cctgtgttgg catcaataat ttagaattag aggtgtcggc 1500 ttaatgctgg tagattgtgg atatcctccc atacacgtag gcgtcgatgg cttcatgtgc 1560 gtacgtgccg tcctgcatag gatgggtagc aacggaggaa ggctggcttt gttgacttgt 1620 agcctcacta aggccaactg cctattggca atgaagttgt ttttgtttaa ggagaaacaa 1680 acttttgagc taggcaacat cggtatgtag caggccattc tctaggtcaa tggcacttag 1740 agtcggagca tgccggccgt gcctattaca acatggttat catgtgcatg tggcaagggc 1800 acacattaca cgtccccatt gtctaacatc gtagactatg agtttgatag aagaaaccca 1860 actgaaaggt cagtgtcaaa tccattctac ctgtgtcgag aactaaggtt aagcgtttta 1920 tatagattag gacactcaca tacatatgct gtgcatgggg tggtgagagc cattatgtac 1980 cactagtgac atgtgtctac ctagttatat gatctattga ttgaaaattc gactgagata 2040 agaataacta tgtggtatat ttaacttggt acaacatata gtggttggaa catcacatta 2100 gacatgcctt ggcaggaaga aagccgctgt agtttaattt aacatgttaa acaccacata 2160 gtgagtaatc aatctaggct taaaaaaaat aaagacaaca caaacaaaca cagagaacac 2220 ataaacacag agggggcaat caactctgtt gtttgatcta tacttcgtca gagtttgata 2280 tatctctgct ctctgcattt taaaactact tatattacaa agcactgtat gttatatagt 2340 aatactttgt agatcacgag tataaaacac agataggtac aatttttttt actcctacgt 2400 atttacgtat taaccggtac aatattattt agcatgcatg tacgcgtgat attagagtgg 2460 agtatactac ctacgcatgc tcgggcagta tcggtacctc tatacctacc tatatacaca 2520 taccaggtag agtacagcgg caggtagagt acacagtagt atatggagct tattttatca 2580 tttttattac tggagataga agaagaagag aaaggagaga gagagagaaa gagtggaagg 2640 gaaaggcgtg cggggcccac acacgcagca gggcagcgct gcggaggtga ggtgagggca 2700 ggggcagggg cagggcggac tggccaacgc caactccaac tccaactccc gtacaaataa 2760 aatatacaat cctttctttt tcctcctcct cttttccctt ccattccacc cccctctctc 2820 tctcttctcc actccaaatc ccttcttacc ctattcccct ccccccgcag cttctcttcc 2880 tcctgcagta ctcgccgcca ccaccaccgc gccgccgccg ccggccgcgt tccgagaccc 2940 actcgatcgg aatccaccgc ggcgcgcccg cgcgcctgcg tcctcttcct tccccgggag 3000 ccgaccgacc acggcgacca gtcgatctcc ctctccgggc gccaaccgcg tcttagcttc 3060 atcgaatcca ccgccccacc ccgcatctcc tcctcctcct ccgacgacga cgactactac 3120 tagtcttctc caataagccc ccctcccgct ccccccgcct gaagaagaag cagcagctag 3180 ctccggggag aggtcgacgg cgcgccgggt agatcgcgcc ccgccccgcc tgcgtcgcgg 3240 ctgtcggagc aaacgcaaac cccccaggta atcaacgaac ttttcctccg ccgcaagaac 3300 agctcccgcg gggggtttgg ttttgaccga tttcttcccc cctcccccca aatcgaccca 3360 tccaatttcg cctcgattta cttccgattt ccccactttt ttttcttcct ttcgggttgg 3420 ggggttgcgg ttttggggga ggagaggggt tcagctcatc cgaagcccca cgttaggtcc 3480 gccccctttc cagctgtgcc cctctctcgg gcctcgagct cctcgcctcc atgggaacca 3540 aagcccttat atttcatgtc gcggaagaaa aaaaaatccc gtcttttgcg gggatcctcg 3600 cggctacgta cgagccctag ttaccgcgcg gattttagtt acggcggttt atgcggcccc 3660 tccctctagg ttttagatct acccatctct ctctctctct ctctctctct ctctgtgcat 3720 gcatgtgtct atcttagcta tacctgtatt atttggaagg ttaattatgg ttgtgtatat 3780 gtggcgcggt aattaattag tttaattcgc accccctctc tctttgttta tctaggtttt 3840 gggggaattt atttcttgct ataattttgc ccgctcgaat ttctggtgct cttatattcc 3900 atgagctgat tgaagtggat atatattgtg cgtgcgtgcg tgctattgct acatcggctt 3960 gacttcttct tgcctactac ttcattaatt tgtttcttct ggtttctgtt tcaggttgtt 4020 ctagcgtgtg cagcggctag ctgattgatt gtcttctgtg atatatccag agctcgtgtt 4080 ttgtggtttg tggtttgtgg tttgtgcttg gattgttgat gtgctaattc gcggcgttac 4140 aagatcactg ctggattgat attgagttgt gcctcggctg tgctagctgt gtgttgattc 4200 tctcctcgtc gtggtgatcg atatggagat tgttgcagta gatcaggagg gagctcgtgt 4260 tgttgggacg aactgtatgc ttgctcgtgg tggaactggt gctgtagcgc cagtgttgga 4320 gctgacagcg acgcctcgtc aggatgcagc cgctgaagct ggtgtagacg aaccggcaca 4380 acaccaatgc gagcatttct ccataaggta atcattttct gtatttccaa ttccagtatc 4440 gcgttgtgga tgaataatga atcggcatgt catgccatat tgcactgttt gatggaagag 4500 tatgattgat cgtggttttt gcacagtttg ctgttgggac ttatatggtc atctgttttg 4560 tacgatcgta tacactgggt cgacatgctt atgactttgg ttcgatttag gaagtcaata 4620 catccactac tagctctata tctagccatg tgaactcatt tatgccatag cacagctagc 4680 aggctagcag caaaaaatat atataatatt tgcatatatg ttggtgtttc atgtatcttt 4740 atactctacg tacatccatt aatatcttca atgtatgaat ctgagcacat gattgtgagt 4800 gctacacata tgcatgtctg tatgtgtgtt cattaggtgt ttgatcatat ttgtttgtgt 4860 tggggtgcgc atgcatttat tcaggccatg ctgtaggctg tagctagata tttgtgtttg 4920 tatattattt ctgttgaaca agctgattac taatgaaatt aacctttttg gggtacactc 4980 atatattggg ccctacattt ttgtaatcat ttttcctttg tgctgaggtt cagcataaaa 5040 cttttttatc ataagcatgt ttacatccta ggagattctt agaactgatg gtttcttcat 5100 atttgcatta tgtttgattt gatagtccat tattatttta agccttttca attgtttaga 5160 gattctagag atgatatata tcaaccatag acttgtcacg ttttggttta atactttcta 5220 gaactaatta gattattatt tttgtagttt atcctgtcat gctatttgta ttatctttga 5280 attcaaactg caatacttag attatcttga aggtcctctt tttctggact gtacaagcta 5340 tgtatgaaat gcctacctcc cagcatcctt tagattatgt agggcctttt ctgagtttat 5400 cagttgtata ttgactgaag cacgcaatgt gctatatata tgtgccatgc atctttataa 5460 tgataatctt atttttcttg taccagaggg tatgttgctc ttcttcagaa gaaggatcca 5520 aaattctgct ctctatctcg gattttccat gaccagaaaa aatgtgatga acacaaagct 5580 agttcaagcc cattttctgt agcaaagttt cgacgatggg attgctcgaa gtgcttggat 5640 aagttgaaaa cttcagataa tggaacagca ccaagaactc ttcccgcaaa gcagaatggc 5700 acaagtgatg gttgctccat cacatttgtt cggagcactt ttgtgcctgc tagtgttggt 5760 tcccaaaaag tgtctcctag cacacaatca tctcaaggga agaatgctga tagatcaact 5820 cttccaaaga gtgtgcaaga aggcaatgac tccaaatgca atgcgccttc tggcaagaat 5880 ggagctgctg aggccaatac tgattcacca atgaaaggta tggtagatgt agagcctttc 5940 aaattcctaa gtaggatttt atttaaggta tagaataaac taatgtttgt gtgattttct 6000 cagatttgca agggccagcc caaaattatg atgtggcagc aaatgtctct gaggacaaca 6060 cttctgttga tgttggggct ttacctgaag ttccccagat tacatggcac atagaagtaa 6120 atggtgcaga tcaacctcca tccactccaa aactttctga agtggtcctc aaaagaaatg 6180 aagatgaaaa tggaaaaact gaagagactc ttgttgctga gcagtgcaat ttgaccaaag 6240 atcctaaccc aatgtctgga aaggaacgtg atcaggttgc tgagcagtgc aatttgacca 6300 aagatccgaa accagtgtct gggcagaaat gtgagcagat ctgcaatgag ccatgtgaag 6360 aagttgttct caaaagaagc tccaaatcta agaggaagac ggataagaag ttgatgaaga 6420 agcagcagca cagcaagaaa cgcactgccc aggctgatgt ttcagatgca aagctttgtc 6480 ggagaaagcc aaaaaaggtg cggcttctat cagaaattat aaatgctaac caggttgagg 6540 attctagaag tgacgaagtt catcgtgaaa atgccgctga tccctgtgag gatgatagaa 6600 gtaccatccc ggtcccgatg gaagtaagca tggatattcc tgttagcaac catacagtgg 6660 gagaagatgg gttaaaatca agtaagaaca agacaaaacg caaatactct gatgttgtag 6720 atgatggatc atcacttatg aactggctga atggaaaaaa gaaaagaact ggaagtgtgc 6780 atcacacagt tgctcatcca gctgggaatt tgagcaacaa aaaagtgaca cccactgcga 6840 gtactcagca tgatgatgag aatgatactg aaaatggtct tgacacaaat atgcataaga 6900 cagatgtctg tcagcatgta tcagaaatct ccacacagag gtgctcatca aaggggaaaa 6960 cagcgggttt gagtaagggg aaaacacatt cagctgctag taccaaatat ggtggtgaaa 7020 gcaccagaaa tggtcagaac atacatgtac tcagcgcaga agatcaatgc cagatggaaa 7080 ccgaaaactc tgttctgagt cactcggcaa aggtacgaat tttgtgaatc atgaggaatt 7140 tttgcttttt aaattgactg aatcaacatt tatctgtatg aaggaataat attggtgcat 7200 aacaatgtta agaaatatgc atacaatgtt tatttatatg ctttccactg ttcttcttta 7260 cttatgtttt gatactcttt ttgtgtgtgc gtgcatgtgt gcatgtgtgt gtgtgtgtgt 7320 gtgtgcgcgc gtgtgtgtgc acgtgcgtgg cgcaatattc ttttttagac tcatattata 7380 gtgattgtaa tggactgaca ttttcctcat ttctcatctc aggtttctcc agctgagcat 7440 gatatccaaa ttatgtctga ccttcatgag cagagtctac ccaagaagaa aaagaagcaa 7500 aaacttgaag tgactcgtga aaaacagacc atgatagatg acatccccat ggatattgtt 7560 gaactgctag ctaaaaacca gcatgagagg cagcttatga ctgagactga ttgttctgac 7620 atcaaccgta ttcaatccaa gacaactgct gatgatgatt gtgtaatagt agctgccaag 7680 gatggttcag attatgcatc aagtgtgttt gacactaatt cccaacagaa gtccttggca 7740 tcccaaagta cacagaagga gttacagggt catttggcat tgaccacaca agagtctcca 7800 catcctcaga actttcagtc tactcaggaa cagcagacac atttgcggat ggaagaaatg 7860 gtcactattg ctgcaagctc accactattt tcacatcatg atgatcagta tattgctgaa 7920 gcaccaactg aacattgggg ccgtaaggac gcaaagaagc taacgtggga gcaatttaag 7980 gccactacaa gaaattctcc agcagcaaca tgtggtgctc aatttagacc tggtatccaa 8040 gcagttgact tgacttctac tcatgtcatg ggatcttcca gcaattatgc atctcgccaa 8100 ccagtaattg cgccactgga ccgctatgct gaaagagcgg ttaaccaggt ccatgcaaga 8160 aattttccaa gcacaatagc aaccatggaa gcgagtaagt tatgtgatcg gagaaatgct 8220 ggacaagtag tcttgtatcc taaagaatcc atgcctgcga cgcatcttct gagaatgatg 8280 gatccatcaa cattagcaag cttccccaac tatggaactt ctagcaggaa ccagatggag 8340 tctcaacttc ataattctca gtatgcacat aatcagtaca aaggatcaac cagcacatca 8400 tatggcagta acctgaatgg aaagattcca ttgacattcg aagacttatc acggcatcag 8460 ctgcatgatc tgcacagacc tttacgccca catcctagag ttggtgtgct tggctccttg 8520 ctgcagaagg aaattgcaaa ctggtcggag aactgtggca cacaatctgg ttataagtta 8580 ggagtgtcaa caggaataac atcgcatcag atgaacagaa aggaacattt tgaagccctg 8640 aattctggaa tgttttcagc aaaatggaat gcattgcagt tgggttctgt tagctccagt 8700 gcagattttt tatcagcgag gaacagcata gctcaatctt ggaccagagg caagggtaaa 8760 atggttcatc ccttggatcg gtttgtgaga caggatatct gtataactaa caagaaccca 8820 gctgatttta ctacaatcag taacgataac gagtatatgg attaccgctg aagcagaaag 8880 tggtgtgcat aattcctgaa catttacaat catacatttc atctttatgg cgccaaatag 8940 tcatactgta agaggagggc tttgctggat ctgctgtaag gtaagttgaa ctttttcttc 9000 ttgcaagttt atcagtttaa gaaaaaagaa tgattactta tgttagcaag gatggttctt 9060 gcaggcttct tgtaagttgt ggatgcccca ttttctggat gggaacctgc cagacagtga 9120 acaagggctt tgcaaggtgc agcatccggt ttttgttttg ccagtccaag aaacgtcctc 9180 ctgttacttt gtagttgtac tcatactagt gcgcttgttt gtacaaggag aaatgtgtaa 9240 ccttgttgaa aaaatgtctc ccccattttg taattaccat aaggaggttt atagtgttgt 9300 gagctgtgtg tgactgacgg cgagaaatgg ttttgtcggt gttaaggttg aaacgactag 9360 ctctcgttat caatgtgttg taaacttcta gattgatgtg ttaccttact cttgaagtca 9420 acaccggaga atttacagta cttttttgcc gtgcc 9455

Claims

What is claimed is:

1. A polynucleotide encoding a plant gene capable of controlling a signal transduction system for brassinosteroid hormone, the polynucleotide encoding an amino acid sequence from Met at position 1 to Arg at position 1057 of SEQ ID NO: 2 in the SEQUENCE LISTING, including any polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added to the amino acid sequence.

2. A polynucleotide according to claim 1 derived from rice.

3. A polynucleotide according to claim 1 as represented by SEQ ID NO: 1 in the SEQUENCE LISTING.