Connect public, paid and private patent data with Google Patents Public Datasets

Diagnosis of diseases associated with metastasis

Download PDF


Publication number
US20030148327A1 US10240485 US24048503A US20030148327A1 US 20030148327 A1 US20030148327 A1 US 20030148327A1 US 10240485 US10240485 US 10240485 US 24048503 A US24048503 A US 24048503A US 20030148327 A1 US20030148327 A1 US 20030148327A1
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Alexander Olek
Christian Piepenbrock
Kurt Berlin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date




    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • C12Q1/6886Hybridisation probes for diseases caused by alterations of genetic material for cancer
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers


The present invention relates to the chemically modified genomic sequences of genes associated with metastasis, to oligonucleotides and/or PNA-oligomers for detecting the cytosine methylation state of genes associated with metastasis which are directed against the sequence, as well as to a method for ascertaining genetic and/or epigenetic parameters of genes associated with metastasis.


  • [0001]
    The levels of observation that have been well studied by the methodological developments of recent years in molecular biology, are the genes themselves, the translation of these genes into RNA, and the resulting proteins. The question of which gene is switched on at which point in the course of the development of an individual, and how the activation and inhibition of specific genes in specific cells and tissues are controlled is correlatable to the degree and character of the methylation of the genes or of the genome. In this respect, pathogenic conditions may manifest themselves in a changed methylation pattern of individual genes or of the genome.
  • [0002]
    The present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with metastasis and, in particular, with the methylation status thereof.
  • [0003]
    The key feature of malignant cells is their ability to invade normal healthy tissue and to be disseminated through the body to distant organs. This ability, known as metastasis, is one of the most fatal metastasis of cancer. In breast cancer for example, the extent of metastasis to the lymph nodes is a key prognostic factor of the disease. Approximately 30% of cancers are metastatic at the time of diagnosis, and a further 30-40% of the remaining case harbour occult metastases.
  • [0004]
    Metastasis is a highly complicated pathway involving multiple proteolytic enzymes, cell adhesion, deformability, cell receptors and motility. Cancer metastasis can be described in the following steps. The initial events involve establishment of the primary tumour. These comprise prise the initial transforming event and proliferation of the transformed cells followed by evasion of the immune mechanism and establishment of a nutritional supply.
  • [0005]
    From the primary tumour, metastasis proceeds by local invasion and destruction of extracellular matrix and parenchymal cells. It is hypothesised that destruction of the basement membrane proceeds in a two step manner. Firstly, the cancer cell attaches itself to the membrane, this is mediated by the binding of tumour cell surface proteins to glycoproteins, such as laminin, type IV collagen, and fibronectin. Invasion then proceeds by enzymatic means, both proteinases (serine, cysteine, aspartic proteinases and metalloproteinases) and tumour secreted hydrolytic enzymes (e.g. glycosidase, hyaluronidase and heparanase) have been implicated.
  • [0006]
    The next step involves the migration of tumour cells from the primary tumour. The movement of the cells through biological barriers may be driven by a number of factors. These include tumour-derived chemotactic factors, host-derived chemoattractants, and combinations of the two. Studies have shown that tumor cells respond chemotactically to growth factors, collagen, peptides, matrix components and proteolytic fragments of matrix components, adhesion proteins such as laminin and fibronectin, and tumour-derived attractants. Furthermore, the importance of autocrine growth factors for transformed cell motility has also been demonstrated.
  • [0007]
    The mobilised cells then attempt to penetrate blood vessel walls. Once the mobilised cells enter the blood stream they are embolized to distant organs. The cells may then be arrested in the lumen of small blood vessels or lymphatics. The cancer cells then proceed to extrude themselves through the walls of the vessels. Establishment of secondary tumours then proceeds by proliferation of the transformed cells followed by evasion of the immune mechanism and establishment of a nutritional supply.
  • [0008]
    The metastatic pathways involve the recruitment of enzymes used in many different normal pathways. Therefore the key difference between normal cells and malignant cancerous cells can be defined as one of gene regulation. DNA methylation has been implicated as a key regulatory mechanism in tumorigenesis, the role of methylation in tumorigenesis has been reviewed by Singal and Ginder ‘DNA Methylation’ Blood, Vol. 93 No. 12 (June 15), 1999: pp. 4059-4070. Examples of methylation linked oncogenesis include:
  • [0009]
    Head and neck cancer (Sanchez-Cespedes M et al. “Gene promoter hypermethylation in tumours and serum of head and neck cancer patients” Cancer Res. 2000 Feb. 15; 60 (4):892-5)
  • [0010]
    Hodgkin's disease (Garcia J F et al “Loss of p16 protein expression associated with methylation of the p16INK4A gene is a frequent finding in Hodgkin's disease” Lab invest 1999 December; 79 (12):1453-9)
  • [0011]
    Gastric cancer (Yanagisawa Y et al. “Methylation of the hMLH1 promoter in familial gastric cancer with microsatellite instability” Int J Cancer 2000 Jan. 1; 85 (1):50-3)
  • [0012]
    There is a continuing need to develop new methods of treatment and diagnosis of cancer. The identification of the methylation dependant regulation of cancer genes has opened up the possibility of creating alternative methods of cancer treatment and diagnosis. Treatment with DNA methylation inhibitors has been shown to restore gene expression of the key tumor suppressor genes and oncogenes gene p16, Bender et. al. “Inhibition of DNA methylation by 5-aza-2′-deoxycydine suppresses the growth of human tumor cell lines.” Cancer research 58; 95-101 (1998). This resulted in heritable levels of gene expression leading to suppression of growth in tumor cell lines.
  • [0013]
    Methylation based therapies could have considerable advantages over current methods of treatment, such as chemotherapy, surgery and radiotherapy. They may even provide a means of treating tumors which are resistant to conventional methods of therapy, as demonstrated by Soengas et al “Inactivation of the apoptosis effector Apaf-1 in malignant melanoma” Nature 409; 207-211(2001). In addition to the development of methylation specific therapies, experiments with Min mice have shown that inhibition of DNA methylation can suppress tumor initiation, Laird et. al. “Suppression of intestinal neoplasia by DNA hypomethylation” Cell 81; 197-205 (1995). Furthermore, DNA methylation analysis may provide novel means for cancer diagnosis.
  • [0014]
    The identification of methylation as a regulatory mechanism, and of the characterisation of the components of the metastatic cascade provides a novel basis for the development of therapies and diagnostics, through the methylation analysis of metastasis related genes.
  • [0015]
    5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • [0016]
    A relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior. However, 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited. In terms of sensitivity, the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec. 15; 24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method. However, currently only individual regions of a length of up to approximately 3000 base pairs are analyzed, a global analysis of cells for thousands of possible methylation events is not possible. However, this method cannot reliably analyze very small fragments from small sample quantities either. These are lost through the matrix in spite of the diffusion protection.
  • [0017]
    An overview of the further known methods of detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
  • [0018]
    To date, barring few exceptions (e.g., Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 March-April; 5(2):94-8) the bisulfite technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 November; 17(3):275-6) or individual cytosine positions are detected by a primer extension reaction (Gonzalgo M L, Jones P A. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun. 15; 25(12):2529-31, WO 95/00669) or by enzymatic digestion (Xiong Z, Laird P W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun. 15; 25(12):2532-4). In addition, detection by hybridization has also been described (Olek et al., WO 99/28498).
  • [0019]
    Further publications dealing with the use of the bisulfite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 June; 16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 March; 6(3):387-95; Feil R, Charlton J, Bird A P, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb. 25; 22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio M C, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5′ region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19; 157(1-2):261-4; WO 97 46705, WO 95 15373 and WO 97/45560.
  • [0020]
    An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.
  • [0021]
    Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
  • [0022]
    Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct. 15; 60(20):2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
  • [0023]
    MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57). The sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size. For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallization. There are now several responsive matrixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. Phosphorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a chargeneutral neutral DNA using simple alkylation chemistry (Gut I G, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr. 25; 23(8):1367-73). The coupling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities which make the detection of unmodified substrates considerably more difficult.
  • [0024]
    Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
  • [0025]
    The object of the present invention is to provide the chemically modified DNA of genes associated with metastasis, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with metastasis. The present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with metastasis are particularly suitable for the diagnosis and/or therapy of diseases associated with metastasis.
  • [0026]
    This objective is achieved according to the present invention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with metastasis according to one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto. In the table, after the listed gene designations, the respective data bank numbers (accession numbers) are specified which define the appertaining gene sequences as unique. GenBank was used as the underlying data bank, which is located at the National Institute of Health, interact address
  • [0027]
    The chemically modified nucleic acid could heretofore not be connected with the ascertainment of genetic and epigenetic parameters.
  • [0028]
    The object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with metastasis according to Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto. The oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with metastasis. The base sequence of the oligomers preferably contains at least one CpG dinucleotide. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th-9th nucleotide from the 5′-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th-6th nucleotide from the 5′-end of the 9-mer.
  • [0029]
    The oligomers according to the present invention are normally used in so called “sets” which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto. Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • [0030]
    Moreover, the present invention makes available a set of at least two oligonucleotides which can be used as so-called “primer oligonucleotides” for amplifying DNA sequences of one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto, or segments thereof.
  • [0031]
    In the case of the sets of oligonucleotides according to the present invention, it is preferred that at least one oligonucleotide is bound to a solid phase.
  • [0032]
    The present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementry thereto). These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with metastasis. The set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with metastasis according to one of Seq. ID No.1 through Seq. ID No. 198 and sequences complementary thereto of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto.
  • [0033]
    According to the present invention, it is preferred that an arrangement of different oligonucleotides- and/or PNA-oligomers (a so-called “array”) made available by the present invention is present in a manner that it is likewise bound to a solid phase. This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid phase surface is preferably composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold. However, nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
  • [0034]
    Therefore, a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with metastasis in which method at least one oligomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
  • [0035]
    A further subject matter of the present invention relates to a DNA chip for the analysis of disease associated with metastasis which contains at least one nucleic acid according to the present invention. DNA chips are known, for example, for U.S. Pat. No. 5,837,832.
  • [0036]
    Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table I and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method. However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
  • [0037]
    The present invention also makes available a method for ascertaining genetic and/or epigenetic netic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
  • [0038]
    In the first step of the method, a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5′-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as ‘chemical pretreatmnent’ hereinafter.
  • [0039]
    The genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal spinal fluid, tissue embedded in paraffm such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • [0040]
    The above described treatment of genomic DNA is preferably carried out with bisulfite (hydroben sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
  • [0041]
    Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
  • [0042]
    In a preferred embodiment of the method, the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto). The primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides.
  • [0043]
    According to the present invention, it is preferred that at least one primer oligonucleotide is bonded to a solid phase during amplification. The different oligonucleotide and/or PNA oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
  • [0044]
    The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer, it being preferred that the fragments that are produced have a single positive or negative net charge for better detectability in the mass spectrometer. The detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • [0045]
    The amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes. In this context, the hybridization takes place in the manner described in the following. The set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers. In the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed. Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5′-end of the 13-mer. One oligonucleotide exists for each CpG dinucleotide. Said PNA-oligomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 4th to 6th nucleotide seen from the 5′-end of the 9-mer. One oligonucleotide exists for each CpG dinucleotide.
  • [0046]
    In the fourth step of the method, the non-hybridized amplificates are removed.
  • [0047]
    In the final step of the method, the hybridized amplificates are detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
  • [0048]
    According to the present invention, it is preferred that the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer. The mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • [0049]
    The produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer. The aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with metastasis.
  • [0050]
    The oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and/or therapy of diseases associated with metastasis by analyzing methylation patterns of genes associated with metastasis. According to the present invention, the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenctic parameters within genes associated with metastasis.
  • [0051]
    The method according to the present invention is used, for example, for the diagnosis and/or therapy of solid tumours and cancer.
  • [0052]
    The nucleic acids according to the present invention of Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or of genes according to one of the sequences of the genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with metastasis
  • [0053]
    The present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with metastasis by analyzing methylation patterns of genes associated with metastasis, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
  • [0054]
    A further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with metastasis by analyzing methylation patterns of genes associated with metastasis, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
  • [0055]
    The present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with metastasis said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
  • [0056]
    In the context of the present invention the term “hybridization” is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the WatsonCrick Crick base pairings in the sample DNA, forming a duplex structure. To be understood by “stringent hybridization conditions” are those conditions in which a hybridization is carried out at 60° C. in 2.5×SSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable.
  • [0057]
    The term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
  • [0058]
    In the context of the present invention, “genetic parameters” are mutations and polymorphisms of genes associated with metastasis and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
  • [0059]
    In the context of the present invention, “epigenetic parameters” are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with metastasis and sequences further required for their regulation. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
  • [0060]
    In the following, the present invention will be explained in greater detail on the basis of the sequences and examples without being limited thereto.
  • Sequence ID Nos. 1 to 198
  • [0061]
    Sequences having odd sequence numbers (e.g., Seq. ID No. 1, 3, 5, . . . ) exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with metastasis. Sequences having even sequence numbers (e.g., Seq. ID No. 2, 4, 6, . . . ) exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with metastasis which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
  • Sequence ID Nos. 199 to 202
  • [0062]
    Sequence ID Nos. 199 to 202 show the sequences of oligonucleotides used in Example 1.
  • [0063]
    The following example relates to a fragment of a gene associated with metastasis, in this case, CD22 in which a specific CG-position is analyzed for its methylation status.
  • EXAMPLE 1 Methylation analysis of the gene CD22 associated with metastasis.
  • [0064]
    The following example relates to a fragment of the gene CD22 in which a specific CG-position is to be analyzed for methylation.
  • [0065]
    In the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
  • [0066]
    If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subsequent alkaline hydrolysis then gives rise to the conversion of nonmethylated cytosine nucleobases to uracil. The chemically converted DNA (sequence ID No. 159) is then used for the detection of methylated cytosines. In the second method step, the treated DNA sample is diluted with water or an aqueous solution. Preferably, the DNA is subsequently desulfonated (10-30 min, 90-100 ° C.) at an alkaline pH value. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably using a heatresistant DNA polymerase. In the present case, cytosines of the gene CD22 are analyzed. To this end, a defined fragment having a length of 470 bp is amplified with the specific primer oligonucleotides TGTGTGTTGTTAAATGAAGA (Sequence ID No. 199) and ACACAAATATTAAAATTATC (Sequence ID No. 200). This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example TTGTTATACGTTTTGTTT (Sequence ID No. 201), the cytosine to be detected being located at position 210 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 fluorescently labelled primer oligonucleotides which have been used for the amplification. A hybridization reaction of the amplified DNA with the oligonucleotide takes place only if a methylated cytosine was present at this location in the bisulfite-treated DNA. Thus, the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
  • [0067]
    In order to verify the methylation status of the position, a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase. Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question. At the position to be analysed said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e TTGTTATATGTTTTGTTT (Sequence ID No. 202). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed.
  • EXAMPLE 2 Diagnosis of diseases associated with metastasis
  • [0068]
    In order to relate the methylation patterns to one of the diseases associated with metastasis, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation-sensitive “primer extension reaction”. It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
  • [0069]
    Subsequently, it is possible to allocate the examined patients to a specific therapy group and to treat these patients selectively with an individualized therapy.
  • [0070]
    Example 2 can be carried out, for example, for cancer and solid tumours.
    TABLE 1
    List of preferred genes associated with metastasis according to the
    GenBank Entry No.
    Gene (
    CD20 L23418
    FN1 M10905
    SDC2 H04621
    ACTG1 NM_001614
    CDH2 NM_001792
    CDH4 NM_001794
    CDW52 NM_001803
    ITGAX NM_000887
    UTGB1 NM_002211
    ITGB5 NM_002213
    ITGB7 NM_000889
    NEO1 NM_002499
    PCDH1 NM_002587
    ENPP1 NM_006208
    RTN1 NM_021136
    SELPLG NM_003006
    TM4SF2 NM_004615
    ITGAE NM_002208
    SPTB NM_000347
    ITGB1 NM_002211
  • [0071]
  • 0
    The patent application contains a lengthy “Sequence Listing” section. A copy of the “Sequence Listing” is available in electronic form from the USPTO
    web site ( An electronic copy of the “Sequence Listing” will also be available from the
    USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

Claims (32)

1. A nucleic acid comprising a sequence at least 18 bases in length of a segment of the chemically pretreated DNA of genes associated with metastasis according to one of the sequences taken from the group of Seq. ID No. 1 to Seq. ID No. 198 and sequences complementary thereto.
2. A nucleic acid comprising a sequence at least 18 base pairs in length of the chemically pretreated DNA of genes associated with metastasis according to one of the sequences according to one of the genes CD20 (L23418), FN1 (M10905), SDC2 (J04621), ACTG1 (NM001614), CDH2 (NM001792), CDH4 (NM001794), CDW52 (NM001803), ITGAX (NM000887), NM002211, ITGB5 (NM002213), ITGB7 (NM000889), NEOI (NM002499), PCDH1 (NM002587), ENPPI (NM006208), RTNI (NM021136), SELPLG (NM003006), TM4sf2 (NM004615), ITGEA (NM002208), SPTB (NM000347), ITGB1 (NM002211) and sequences complementary thereto.
3. An oligomer, in particular an oligonucleotide or peptide nucleic acid (PNA)-oligomer, said oligomer comprising in each case at least one base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to a chemically pretreated DNA of genes associated with metastasis according to one of the Seq ID Nos 1 to 198 according to claim 1 or to a chemically pretreated DNA of genes according to claim 2 and sequences complementary thereto.
4. The oligomer as recited in claim 3; wherein the base sequence includes at least one CpG dinucleotide.
5. The oligomer as recited in claim 3; characterized in that the cytosine of the CpG dinucleotide is located approximately in the middle third of the oligomer.
6. A set of oligomers, comprising at least two oligomers according to any of claims 3 to 5.
7. A set of oligomers as recited in claim 6, comprising oligomers for detecting the methylation state of all CpG dinucleotides within one of the sequences according to Seq. ID Nos. 1 through 198 according to claim 1 or a chemically pretreated DNA of genes according to claim 2, and sequences complementary thereto.
8. A set of at least two oligonucleotides as recited in claim 3, which can be used as primer oligonucleotides for the amplification of DNA sequences of one of Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or sequences of a chemically pretreated DNA of genes according to claim 2, and sequences complementary thereto and segments thereof.
9. A set of oligonucleotides as recited in claim 8, characterized in that at least one oligonucleotide is bound to a solid phase.
10. Use of a set of oligomer probes comprising at least ten of the oligomers according to any of claims 6 through 9 for detecting the cytosine methylation state and/or single nucleotide polymorphisms (SNPs) in a chemically pretreated genomic DNA according to claim 1 or a chemically pretreated DNA of genes according to claim 2.
11. A method for manufacturing an arrangement of different oligomers (array) fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinucleotides of one of the Seq. ID No. 1 through Seq. ID No. 198 and sequences complementary thereto and/or chemically pretreated DNA of genes according to claim 2, wherein at least one oligomer according to any of the claims 3 through 5 is coupled to a solid phase.
12. An arrangement of different oligomers (array) obtainable according to claim 11.
13. An array of different oligonucleotide- and/or PNA-oligomer sequences as recited in claim 12, characterized in that these are arranged on a plane solid phase in the form of a rectangular or hexagonal lattice.
14. The array as recited in any of the claims 12 or 13, characterized in that the solid phase surface is composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold.
15. A DNA- and/or PNA-array for analyzing diseases associated with the methylation state of genes, comprising at least one nucleic acid according to one of the preceeding claims.
16. A method for ascertaining genetic and/or epigenetic parameters for the diagnosis and/or therapy of existing diseases or the predisposition to specific diseases by analyzing cytosine methylations, characterized in that the following steps are carried out:
a) in a genomic DNA sample, cytosine bases which are unmethylated at the 5-position are converted, by chemical treatment, to uracil or another base which is dissimilar to cytosine in terms of hybridization behavior;
b) fragments of the chemically pretreated genomic DNA are amplified using sets of primer oligonucleotides according to claim 8 or 9 and a polymerase, the amplificates carrying a detectable label;
c) Amplificates are hybridized to a set of oligonucleotides and/or PNA probes according to the claims 6 and 7, or else to an array according to one of the claims 12 through 15;
d) the hybridized amplificates are subsequently detected.
17. The method as recited in claim 16, characterized in that the chemical treatment is carried out by means of a solution of a bisulfite, hydrogen sulfite or disulfite.
18. The method as recited in one of the claims 16 or 17, characterized in that more than ten different fragments having a length of 100-2000 base pairs are amplified.
19. The method as recited in one of the claims 16 through 18, characterized in that the amplifiction of several DNA segments is carried out in one reaction vessel.
20. The method as recited in one of the claims 16 through 19, characterized in that the polymerase is a heat-resistant DNA polymerase.
21. The method as recited in claim 20, characterized in that the amplification is carried out by means of the polymerase chain reaction (PCR).
22. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are fluorescence labels.
23. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are radionuclides.
24. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are detachable molecule fragments having a typical mass which are detected in a mass spectrometer.
25. The method as recited in one of the claims 16 through 21, characterized in that the amplificates or fragments of the amplificates are detected in the mass spectrometer.
26. The method as recited in one of the claims 24 and/or 25, characterized in that the produced fragments have a single positive or negative net charge for better detectability in the mass spectrometer
27. The method as recited in one of the claims 24 through 26, characterized in that detection is carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
28. The method as recited in one of the claims 16 through 27, characterized in that the genomic DNA is obtained from cells or cellular components which contain DNA, sources of DNA comprising, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, and all possible combinations thereof.
29. A kit comprising a bisulfite (=disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of the claims 3 through 5.
30. The use of a nucleic acid according to claims 1 or 2, of an oligonucleotide or PNA-oligomer according to one of the claims 3 through 5, of a kit according to claim 29, of an array according to one of the claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the diagnosis of solid tumours and cancer.
31. The use of a nucleic acid according to claims 1 or 2, of an oligonucleotide or PNA-oligomer according to one of claims 3 through 5, of a kit according to claim 29, of an array according to one of the claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the therapy of solid tumours and cancer.
32. A kit, comprising a bisulfite (=disulfite, hydrogen sulfite) reagent as well as oligonucleotides tides and/or PNA-oligomers according to one of claims 3 through 5.
US10240485 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis Abandoned US20030148327A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
DE2000119058 DE10019058A1 (en) 2000-04-06 2000-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10019058.8 2000-04-06
DE10019173.8 2000-04-07
DE10019173 2000-04-07
DE2000132529 DE10032529A1 (en) 2000-06-30 2000-06-30 Diagnosis of important genetic parameters within the major histocompatibility complex (MHC)
DE100529.7 2000-06-30
DE10043826 2000-09-01
DE10043826.1 2000-09-01

Publications (1)

Publication Number Publication Date
US20030148327A1 true true US20030148327A1 (en) 2003-08-07



Family Applications (7)

Application Number Title Priority Date Filing Date
US10240485 Abandoned US20030148327A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
US10240452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10240454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10240589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
US10240708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication
US10240453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription
US10239676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation

Family Applications After (6)

Application Number Title Priority Date Filing Date
US10240452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10240454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10240589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
US10240708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication
US10240453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription
US10239676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation

Country Status (5)

Country Link
US (7) US20030148327A1 (en)
JP (3) JP2003531589A (en)
DE (2) DE60126593D1 (en)
EP (9) EP1268861A2 (en)
WO (8) WO2001076451A3 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040052763A1 (en) * 2000-06-07 2004-03-18 Mond James J. Immunostimulatory RNA/DNA hybrid molecules
WO2005017207A2 (en) * 2003-08-14 2005-02-24 Case Western Reserve University Methods and compositions for detecting colon cancers
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US20090321626A1 (en) * 2006-05-26 2009-12-31 Akos Vertes Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
WO2012149245A3 (en) * 2011-04-28 2013-01-17 Ostrer Harry Genomic signatures of metastasis in prostate cancer
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20140287940A1 (en) * 2007-10-23 2014-09-25 Commonwealth Scientific And Industrial Research Organisation Method of diagnosing neoplasms - ii
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays

Families Citing this family (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6780982B2 (en) 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US20030148327A1 (en) * 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
US20040023230A1 (en) * 2000-06-30 2004-02-05 Alexander Olek Method and nucleic acids for pharmacogenomic methylation analysis
EP1337662A4 (en) * 2000-11-13 2004-09-08 Human Genetic Signatures Pty Detection of methylated dna molecules
DE10128508A1 (en) 2001-06-14 2003-02-06 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate tumors
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
WO2003031932A3 (en) 2001-10-05 2006-10-19 Univ Case Western Reserve Methods and compositions for detecting colon cancers
JP2003144172A (en) * 2001-11-16 2003-05-20 Nisshinbo Ind Inc Oligonucleotide-immobilized board for detecting methylation
DE10161625A1 (en) * 2001-12-14 2003-07-10 Epigenomics Ag Methods and nucleic acids for the analysis of a lung cell-cell division disruption
EP1497462A4 (en) * 2002-03-07 2007-11-07 Univ Johns Hopkins Med Genomic screen for epigenetically silenced genes associated with cancer
EP1344832A1 (en) * 2002-03-15 2003-09-17 Epigenomics AG Methods and nucleic acids for the analysis of methylation within the gene melastatin
WO2003083107A1 (en) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis
JP2005532067A (en) * 2002-07-03 2005-10-27 コーリー ファーマシューティカル グループ,インコーポレイテッド The nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
EP1554407B1 (en) * 2002-10-01 2009-07-29 Epigenomics AG Method for the treatment of breast cell proliferative disorders
DE60331852D1 (en) * 2002-12-02 2010-05-06 Illumina Cambridge Ltd Determining the methylation of nucleic acid sequences
DE10304219B3 (en) * 2003-01-30 2004-08-19 Epigenomics Ag A method for detection of cytosine methylation patterns with high sensitivity
WO2004070062A3 (en) * 2003-02-04 2004-11-18 Eugene Brown Compositions and methods for diagnosing and treating cancers
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
DE602004028478D1 (en) 2003-06-17 2010-09-16 Human Genetic Signatures Pty A process for genomamplifikation
DE10338308B4 (en) 2003-08-15 2006-10-19 Epigenomics Ag A method for detection of cytosine methylations in DNA
DE602004018801D1 (en) 2003-09-04 2009-02-12 Human Genetic Signatures Pty Nucleic acid detection test
EP1689885B1 (en) * 2003-10-20 2012-10-17 St Vincent's Hospital Sydney Limited Assessment of predisposition to cancer by quantitative determination of methylation in normal cells of healthy persons.
WO2005054517A3 (en) * 2003-12-01 2006-02-16 Susan Cottrell Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP1561821B1 (en) 2003-12-11 2011-02-16 Epigenomics AG Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients
US20050196792A1 (en) * 2004-02-13 2005-09-08 Affymetrix, Inc. Analysis of methylation status using nucleic acid arrays
DK1794173T3 (en) 2004-09-10 2010-10-25 Human Genetic Signatures Pty Amplification blocker comprising intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
KR20060026595A (en) 2004-09-21 2006-03-24 (주)지노믹트리 Method for detecting methylaion of promoter using restriction enzyme and dna chip
KR100617649B1 (en) * 2004-09-24 2006-09-04 (주)지노믹트리 Composition For Cancer diagnosis Containing Methylated Promoters of Colon Cancer Specific Expression-decreased Genes and Use Thereof
ES2399054T3 (en) 2004-12-03 2013-03-25 Human Genetic Signatures Pty Ltd Methods for simplifying microbial nucleic acids by chemical modification of cytosine
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088978A1 (en) 2005-02-16 2006-08-24 Epigenomics, Inc. Method for determining the methylation pattern of a polynucleic acid
WO2006113770A1 (en) 2005-04-15 2006-10-26 Epigenomics Ag A method for providing dna fragments derived from a remote sample
WO2006111586B1 (en) * 2005-04-20 2007-01-11 Proyecto Biomedicina Cima Sl Method for the in vitro determination of the degree of methylation of the line-1 promoter
WO2006125267A1 (en) 2005-05-26 2006-11-30 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
WO2007030882A1 (en) 2005-09-14 2007-03-22 Human Genetic Signatures Pty Ltd Assay for a health state
US7465544B2 (en) * 2006-01-11 2008-12-16 Wisconsin Alumni Research Foundation Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use
US7695913B2 (en) 2006-01-11 2010-04-13 Genomic Health, Inc. Gene expression markers for colorectal cancer prognosis
DE602007014278D1 (en) * 2006-02-28 2011-06-16 Charite Universitaetsmedizin Detection and quality control of regulatory T cells by means of DNA-methylation analysis of the FoxP3 gene
EP2471951A1 (en) * 2006-05-02 2012-07-04 University of Southhampton Predicting cognitive development by gene methylation analysis
WO2008096146A1 (en) 2007-02-07 2008-08-14 Solexa Limited Preparation of templates for methylation analysis
EP2215250B1 (en) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzymes for amplification and copying bisulphite modified nucleic acids
EP2660337B1 (en) 2008-07-15 2016-09-14 Epigenomics AG Method of prediciting the prognosis of a breast cancer therapy based on gene methylation analysis
EP2340314B8 (en) 2008-10-22 2015-02-18 Illumina, Inc. Preservation of information related to genomic dna methylation
EP2470673B1 (en) 2009-08-28 2014-07-30 Cellular Dynamics International, Inc. Identifying genetic variation in affected tissues
KR20140064918A (en) 2011-09-07 2014-05-28 휴먼 제네틱 시그너처스 피티와이 엘티디 Molecular detection assay
EP2821487B1 (en) * 2012-02-29 2016-10-26 Sysmex Corporation Method for determining presence or absence of cancer cell derived from hepatocellular carcinoma, and determination marker and kit
KR101302173B1 (en) 2012-12-07 2013-08-30 이화여자대학교 산학협력단 Composition for diagnosing alzheimer's disease using methylation status of hmox1 gene and method for diagnosing alzheimer's disease using the same
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer
CN106460050A (en) * 2014-04-28 2017-02-22 西格马-奥尔德里奇有限责任公司 Epigenetic modification of mammalian genomes using targeted endonucleases

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6214556B1 (en) * 1997-11-27 2001-04-10 Epigenomics Ag Method for producing complex DNA methylation fingerprints
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US20030180748A1 (en) * 1999-10-13 2003-09-25 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
EP0969103A3 (en) 1993-06-22 2004-01-02 Baylor College Of Medicine Parallel primer extension approach to nucleic acid sequence analysis
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
DE69433180D1 (en) 1993-10-26 2003-10-30 Affymetrix Inc Fields of nukleinsaeuresonden on biological chips
JPH09506253A (en) 1993-11-30 1997-06-24 マクギル・ユニヴァーシティ Inhibition of Dna methyl transferase
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6251594B1 (en) * 1997-06-09 2001-06-26 Usc/Norris Comprehensive Cancer Ctr. Cancer diagnostic method based upon DNA methylation differences
DE19750172C1 (en) * 1997-11-12 1998-10-01 Deutsches Krebsforsch DNA with promoter activity
EP1036202B1 (en) * 1997-12-05 2002-05-02 Max-Planck-Gesellschaft Zur Förderung Der Wissenschaften E.V. Method for identifying nucleic acids by means of matrix-assisted laser desorption/ionisation mass spectrometry
US6255293B1 (en) * 1998-07-24 2001-07-03 Yeda Research And Development Co., Ltd. Prevention of metastasis with 5-aza-2′-deoxycytidine
DE19905082C1 (en) * 1999-01-29 2000-05-18 Epigenomics Gmbh Identification of methylation patterns of cytosine in genome DNA comprises chemical treatment to produce different base pairing behavior between cytosine and 5-methylcytosine
US6783933B1 (en) * 1999-09-15 2004-08-31 The Johns Hopkins University School Of Medicine CACNA1G polynucleotide, polypeptide and methods of use therefor
US20040029123A1 (en) * 2000-03-15 2004-02-12 Alexander Olek Diagnosis of diseases associated with the cell cycle
US20030148327A1 (en) 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
US20040023230A1 (en) 2000-06-30 2004-02-05 Alexander Olek Method and nucleic acids for pharmacogenomic methylation analysis
DE10037769A1 (en) 2000-08-03 2002-02-21 Epigenomics Gmbh Diagnosis of diseases associated with CD24
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
DE10054972A1 (en) 2000-11-06 2002-06-06 Epigenomics Ag Diagnosis of diseases associated with humos
DE10054974A1 (en) 2000-11-06 2002-06-06 Epigenomics Ag Diagnosis of diseases associated with Cdk4

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6214556B1 (en) * 1997-11-27 2001-04-10 Epigenomics Ag Method for producing complex DNA methylation fingerprints
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US20030180748A1 (en) * 1999-10-13 2003-09-25 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040052763A1 (en) * 2000-06-07 2004-03-18 Mond James J. Immunostimulatory RNA/DNA hybrid molecules
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US20110151438A9 (en) * 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US8221977B2 (en) 2003-08-14 2012-07-17 Case Western Reserve University Methods and compositions for detecting colon cancers
US8481707B2 (en) 2003-08-14 2013-07-09 Case Western Reserve University Methods and compositions for detecting colon cancers
JP2007502121A (en) * 2003-08-14 2007-02-08 ケース ウエスタン リザーブ ユニバーシティ The methods and compositions for detecting colon cancer
US20050106593A1 (en) * 2003-08-14 2005-05-19 Markowitz Sanford D. Methods and compositions for detecting colon cancers
US7485420B2 (en) * 2003-08-14 2009-02-03 Case Western Reserve University Methods and compositions for detecting colon cancers
US9580754B2 (en) 2003-08-14 2017-02-28 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20100009359A1 (en) * 2003-08-14 2010-01-14 Case Western Reserve University Methods and compositions for detecting colon cancers
US20100209906A1 (en) * 2003-08-14 2010-08-19 Case Western Reserve University Methods and compositions for detecting colon cancers
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
JP4781267B2 (en) * 2003-08-14 2011-09-28 ケース ウエスタン リザーブ ユニバーシティ The methods and compositions for detecting colon cancer
US7964353B2 (en) 2003-08-14 2011-06-21 Case Western Reserve University Methods and compositions for detecting colon cancers
WO2005017207A2 (en) * 2003-08-14 2005-02-24 Case Western Reserve University Methods and compositions for detecting colon cancers
WO2005017207A3 (en) * 2003-08-14 2005-10-27 Sanford D Markowitz Methods and compositions for detecting colon cancers
US20110217708A1 (en) * 2003-08-14 2011-09-08 Case Western Reserve University Methods and compositions for detecting colon cancers
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8709716B2 (en) 2006-03-31 2014-04-29 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20110166037A1 (en) * 2006-03-31 2011-07-07 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US9828640B2 (en) 2006-03-31 2017-11-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20090321626A1 (en) * 2006-05-26 2009-12-31 Akos Vertes Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US8084734B2 (en) 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US20140287940A1 (en) * 2007-10-23 2014-09-25 Commonwealth Scientific And Industrial Research Organisation Method of diagnosing neoplasms - ii
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US9490113B2 (en) 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
WO2012149245A3 (en) * 2011-04-28 2013-01-17 Ostrer Harry Genomic signatures of metastasis in prostate cancer

Also Published As

Publication number Publication date Type
EP1274865A2 (en) 2003-01-15 application
WO2001081622A2 (en) 2001-11-01 application
WO2001077377A8 (en) 2002-02-28 application
WO2001077378A3 (en) 2002-10-17 application
US20040067491A1 (en) 2004-04-08 application
WO2001081622A8 (en) 2002-05-16 application
EP1278893A2 (en) 2003-01-29 application
JP2003531589A (en) 2003-10-28 application
WO2001077377A2 (en) 2001-10-18 application
WO2001077376A2 (en) 2001-10-18 application
WO2001077164A8 (en) 2002-03-21 application
WO2001077164A2 (en) 2001-10-18 application
WO2001077375A2 (en) 2001-10-18 application
EP1274865B1 (en) 2007-02-14 grant
DE60126593D1 (en) 2007-03-29 grant
US20030162194A1 (en) 2003-08-28 application
EP1274866A2 (en) 2003-01-15 application
EP1370685A2 (en) 2003-12-17 application
US20050282157A1 (en) 2005-12-22 application
WO2001081622A3 (en) 2003-09-04 application
EP2014776A3 (en) 2009-04-01 application
US7195870B2 (en) 2007-03-27 grant
WO2001076451A3 (en) 2003-09-04 application
EP1360319A2 (en) 2003-11-12 application
EP1272670A2 (en) 2003-01-08 application
EP1268857A2 (en) 2003-01-02 application
US20030148326A1 (en) 2003-08-07 application
WO2001076451A9 (en) 2002-08-08 application
DE60126593T2 (en) 2007-10-31 grant
EP2014776A2 (en) 2009-01-14 application
WO2001092565A3 (en) 2002-09-06 application
JP2003534780A (en) 2003-11-25 application
WO2001077375A8 (en) 2002-10-24 application
WO2001076451A2 (en) 2001-10-18 application
US20040076956A1 (en) 2004-04-22 application
WO2001092565A2 (en) 2001-12-06 application
WO2001077376A3 (en) 2002-08-08 application
WO2001077164A3 (en) 2002-06-20 application
US20030082609A1 (en) 2003-05-01 application
WO2001077376A8 (en) 2002-03-21 application
JP2004508807A (en) 2004-03-25 application
WO2001092565A8 (en) 2002-05-30 application
WO2001077375A3 (en) 2002-06-27 application
WO2001077378A2 (en) 2001-10-18 application
EP1268861A2 (en) 2003-01-02 application
WO2001077377A3 (en) 2002-07-11 application

Similar Documents

Publication Publication Date Title
Wong et al. p16INK4a promoter is hypermethylated at a high frequency in esophageal adenocarcinomas
Sun et al. An infrequent point mutation of the p53 gene in human nasopharyngeal carcinoma
Sato et al. The H-cadherin (CDH13) gene is inactivated in human lung cancer
Agathanggelou et al. Epigenetic inactivation of the candidate 3p21. 3 suppressor gene BLU in human cancers
Spugnardi et al. Epigenetic inactivation of RAS association domain family protein 1 (RASSF1A) in malignant cutaneous melanoma
Abdollahi et al. LOT1 (PLAGL1/ZAC1), the candidate tumor suppressor gene at chromosome 6q24–25, is epigenetically regulated in cancer
Van Gele et al. Mutation analysis of P73 and TP53 in Merkel cell carcinoma
Hesson et al. Frequent epigenetic inactivation of RASSF1A and BLU genes located within the critical 3p21. 3 region in gliomas
Yamashita et al. Chemical genomic screening for methylation‐silenced genes in gastric cancer cell lines using 5‐aza‐2′‐deoxycytidine treatment and oligonucleotide microarray
Dammann et al. Hypermethylation of the cpG island of Ras association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21. 3 locus, occurs in a large percentage of human breast cancers
US20040234960A1 (en) Method for determining the degree of methylation of defined cytosines in genomic dna in the sequence context 5'-cpg-3'
Furuta et al. Promoter methylation profiling of 30 genes in human malignant melanoma
Kaneda et al. Identification of silencing of nine genes in human gastric cancers
US20070259368A1 (en) Gastric cancer biomarker discovery
US20060234254A1 (en) Colon cancer biomarker discovery
US20050069879A1 (en) Method for high sensitivity detection of cytosine-methylation
US20090215709A1 (en) Methylation markers for diagnosis and treatment of cancers
WO1998056952A1 (en) A cancer diagnostic method based upon dna methylation differences
US20070048738A1 (en) Methods and compositions for diagnosis, staging and prognosis of prostate cancer
US20030148290A1 (en) Quantitative methylation detection in DNA samples
US20050064428A1 (en) Method for detecting cytosine-methylation patterns by exponential ligation of hybridised probe oligo-nucleotides (mla)
US20050064401A1 (en) Diagnosis of illnesses or predisposition to certain illnesses
Yue et al. Expression of ECRG4, a novel esophageal cancer-related gene, downregulated by CpG island hypermethylation in human esophageal squamous cell carcinoma
US20040081976A1 (en) Genomic screen for epigenetically silenced tumor suppressor genes
US20040265833A1 (en) Methods and nucleic acids for the analysis of colorectal cell proliferative disorders

Legal Events

Date Code Title Description
AS Assignment



Effective date: 20021001