US20030140382A1 - Process for generating genetically modified pearl millet through agrobacterium and biolistic transformation - Google Patents

Process for generating genetically modified pearl millet through agrobacterium and biolistic transformation Download PDF

Info

Publication number
US20030140382A1
US20030140382A1 US10/204,851 US20485102A US2003140382A1 US 20030140382 A1 US20030140382 A1 US 20030140382A1 US 20485102 A US20485102 A US 20485102A US 2003140382 A1 US2003140382 A1 US 2003140382A1
Authority
US
United States
Prior art keywords
calli
biolistic
gene
days
media
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/204,851
Other languages
English (en)
Inventor
Villoo Patell
Naganand Rayapuram
Ranjini Krishnan
Divya Chandran
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Avesthagen Ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Assigned to AVESTHA GENGRAINE TECHNOLOGIES PVT. LTD. reassignment AVESTHA GENGRAINE TECHNOLOGIES PVT. LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHANDRAN, DIVYA, KRISHNAN, RANJINI, PATELL, VILLOO MORAWALA, RAYAPURAM, NAGANAND
Publication of US20030140382A1 publication Critical patent/US20030140382A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
    • C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance

Definitions

  • the present invention relates to a process for biolistic transformation and regeneration of Pearl millet, in particular transformation of pearl millet variety 843B which confers stress tolerance.
  • a wide range of environmental stresses can damage crop plants, resulting in high yield losses.
  • AOS activated oxygen species
  • active oxygen species are involved in the damage to the plant cell that is caused by environmental stress such as air pollution, high temperature, low water content etc.
  • O* highly active oxygen radicals
  • Chloroplast are potentially the major source of toxic oxygen derivatives in plant tissues. They generate singlet oxygen under high doses of illumination or any other stress conditions. Accumulation of active oxygen species is an unavoidable consequence of photosynthesis, even under the most favourable conditions.
  • plants have developed a highly efficient anti-oxidant defense system, composed of both enzymatic and non-enzymatic constituents.
  • SOD superoxide dismutase
  • APX ascorbate peroxidases
  • catalases By enhancing the levels of these proteins in transgenic plants, it was attempted to improve the tolerance against oxidative stress.
  • the chloroplast being one of the primary sites of AOS production requires enhanced protection and MnSOD targeted to the chloroplast is for efficient scavenging of AOS in the chloroplast.
  • MnSOD is a nuclear-encoded protein, that scavenges superoxide radicals in the mitochondrial matrix.
  • Superoxide radicals are ubiquitously generated in many biological oxidations within all compartments of the cell.
  • Increased production of superoxide radicals is associated with a number of physiological disorders in plants.
  • MnSOD enzyme By targeting MnSOD enzyme to the chloroplast, where the generation of superoxide radicals is high during stress conditions, the capacity to scavenge any radical that may be produced can be increased.
  • chloroplast transit peptide of the small subunit of Rubisco had been used successfully used in both monocotyledonous and dicotyledonous plants to target different transgenic non-plastid proteins (Cashmore et al 1983).
  • the object of the present invention to enhance the levels of these proteins in transgenic plants and improving the tolerance against oxidative stress.
  • the present invention provides a process for biolistic transformation and regeneration of Pennisetum glaucum (Pearl millet) comprising:
  • P. glaucam var. 843B The variety of said P. glaucam used is P. glaucam var. 843B.
  • Said pre-identified gene is a marker gene selected from GUS encoding gene, Hygromycin resistance gene or MnSOD gene.
  • the plasmids used in step (e) for transforming genes are selected from and pGV4 construct.
  • Said pIG121Hm plasmid is used for conferring GUS and hygromycin resistance gene and contains CaMV35s promoter.
  • Said pGV4 plasmid is used in step (e) is for providing MnSOD gene and contains ubiquitin promoter and NOS terminator.
  • the media used for differentiating the said calli obtained in step (f) into shoots is MS basal medium with 0.3 ppm on Benzyl Amino purine (BAP).
  • the said calli was kept under light for a period of 30 days for shoot formation.
  • the media used for differentiating the said calli obtained in step (f) into root is MS media with 2-3 ppm, Indole Acetic Acid (IAA) or 0.3% of activated charcoal.
  • Said process further comprises acclimatizing the plant in sterile water for at least 2 days and transferring it into sterile soil.
  • the sterile soil contains soil and sand in the ratio 1:1.
  • step (b) The calli is incubated under dark conditions in step (b) for 30 days.
  • the calli is incubated under light conditions in step (d) for 30 days.
  • Said biolistic gun used for transformation is the PDS-1000/He gun.
  • Said biolistic gun uses high velocity microcarriers selected from gold.
  • the microcarriers are coated with DNA molecule, spermicide and CaCl 2
  • the concentration of said DNA molecule is about 5 ⁇ g/ ⁇ l.
  • the size of gold used is between 1.5-3.0 ⁇ .
  • the rupture disc pressure is 900 psi
  • the helium pressure is 1100 psi
  • a vacuum of 25 mg/Hg was created in the gun chamber.
  • Step 1 Collection of Plant Material
  • Seeds of Pearl millet variety 843B also called the ICMB -2 line is an inbred highly uniform line and is a selection of BKM2068 that was bred at Fort Hays branch experiment station, Kansas State University. It is a maintainer line of the male sterile line 843A. These were recommended by AICPMIP in 1984 for large-scale distribution and production of commercial hybrids. 843B is a d2 dwarf, is early in maturity (42 days), shows good tillering (4-5 panicles), has small semi compact panicles and large seeds (ICRISAT, millet research group, India).
  • the seeds were rinsed in water and then treated with 70% ethanol for surface sterilization. They were then washed thoroughly with distilled water and sterilized with 50% commercial bleach solution for 20 minutes. The use of 0.1% mercuric chloride was found to be useless as the seeds due to over exposure to these chemicals failed to callus. The seeds were given 6 thorough washes in the laminar airflow unit with sterile distilled water. The scutellar tissue in the explant proliferates in vitro and has the maximum potential for regeneration and organogenesis.
  • Embryogenic calli were initiated from the seeds in MS media containing 5 mg/l, 2 , 4 -D (MS5). These callus cultures were placed in the BOD at 25° C. in the dark. The calli were shifted to fresh media every 5 days to reduce the browning in the calli caused due to the high phenolic content. The calli were subcultured at 30 days intervals into media containing decreasing concentrations of 2,4-D. The calli in the MS3 stage were used for biolistic transformation. The sterile seeds were placed in the MS5 medium at 30 seeds per plate count. The seeds start callusing within 2-3 days. The hard compact mass of embryogenic callus is found enclosed within a mass of soft calli which lack organisation.
  • the embryogenic calli are subcultured into MS3 plates and are placed under light for a period of 30 days. It is at this stage that the calli are best suited for bombardment.
  • the proliferating calli are passed onto MS1 and later plain MS media for further differentiation.
  • the calli in a shooting medium containing 0.3% BAP start proliferating very well and differentiate to form green shoots. These plates are kept under light.
  • the plantlets are shifted to a rooting medium containing activated charcoal till fine white roots are formed.
  • the mature plantlets are let to harden in sterile water for a couple of days before being transferred into pots containing 1:1 soil and sand mixture.
  • pIG121Hm (16.2 kb) which contains the GUS coding sequence and the Hph gene which confers resistance to hygromycin under the control of CaMV35s promoter and the NOS terminator.
  • pGV4 (4.2 kb) carrying the MnSOD sequence driven by the UBI promoter and the NOS terminator.
  • Ubiquitin driven promoters are relatively stronger and more active than the other monocot promoters. It also aids in maintaining the stability of the transgene in the plant. (9).
  • the biolistic gun used is the PDS-1000/He gun from Biorad. It is a device used to introduce foreign DNA into calli or other tissue with the help of high velocity microcarriers like gold or tungsten. Gold is used in our experiments because of its inert and non-reactive nature in the plant system. Helium gas is used to accelerate the microcarrier, which have been coated with DNA molecules. By this method any type of tissue can be used for transformation and false positive results are reduced to a great extent. Transient assay can be conducted easily. During standardization experiments different distances were tried for the calli plate from the stopping screens. Also three different stages namely MS5, MS3, MS1 of the calli were tested for the bombardment. The size of gold used was between 1.5-3.0 ⁇ . The rupture disc pressure was 900 psi while the helium pressure had to be 1100 psi. A vacuum of 25 mg/Hg was created in the gun chamber. The concentration of the DNA used was around 5 ⁇ g/ ⁇ l.
  • the microcarrier with the bound DNA was coated on to a macrocarrier disc. After the ethanol evaporated the macrocarrier was placed in its holder. The rupture disc and stopping screens were put in place and the other necessary parameters also maintained.
  • the calli were placed in osmoticum 4 hrs prior to bombardment. Osmoticum had 30 g/l of either Mannitol or Sorbitol. This step in the preparation of material for bombardment helps in increasing the transient expression of the bombarded genes. Transient expression and stable transformation of cells is facilitated through plasmolysis of the target cells. (10). Plasmolysed cells are less likely to extrude their protoplasm following penetration of cells by particles (10).
  • the calli were placed in osmoticum for 16 hrs in the dark.
  • the calli were shifted to MS3 plates with 30 mg/l hygromycin (1 st selection).
  • the calli were transferred into Gus buffer overnight for 24 hrs in the dark.
  • the calli in the first selection medium were transferred into the second selection medium after 15 days (MS3 with 50 mg/l hyg). This was subcultured every 2 weeks until resistant colonies of calli were seen in the plates.
  • GUS activity was determined with x-Gluc as substrate in 0.2M phosphate buffer, triton-x 100%. chloramphenicol (100 mg ml),/sodium azide(100 mg ml), milliQ water. The calli were incubated at 37° C. for 24 hrs. (Jefferson's protocol)
  • the calli were collected in a sterile eppendorf tube and macerated without the extraction buffer at room temperature for 15 minutes.
  • 400 ⁇ l of extraction buffer 200 mM tris HCl, 250 mMNaCl, 25 mM EDTA. 0.5% SDS pH 7.5
  • the extract was centrifuged at 13000 rpm for 1 minute.
  • 300 ⁇ l of the supernatant was taken in a fresh tube and 300 ⁇ l of iso-propanol was added. This was left at room temperature for 2 minutes.
  • the PCR analysis was performed in a 25 ⁇ l volume of 2.5 ⁇ l of PCR buffer, 1 ul of 50 mM MgCl2, 0.5 ul of 10 mM dNTPs 0.5 ul of forward primer and 0.5 ul of reverse primer, 0.2 ul of TaqDNA polymerase and 25 ng of template DNA.
  • GUS forward primer 5′′CCATACCTGTTCACCGACGA3′′
  • GUS reverse primer 5′′GGAATTGATCAGCGTTGGTG 3′′.
  • SOD forward primer 5′′CTACGTCGCCAACTACAACAACAA3′′.
  • SOD reverse primer TAGTCTGGTCTGACATTCTTG 3′′ were used for the PCR analysis.
  • PCR was performed using the Peltier thermal cycler (MJ) for 40 cycles of initial 3 minutes of 93° C., 45 secs of 93° C., 45 seconds of 50° and a final extension temperature of 72° C. for 5 minutes. Amplified products were separated by agarose gel electrophoresis and stained with ethidium bromide.
  • the PCR gel was used for the purpose of southern blotting.
  • the gel was blotted for three hours and the DNA was transferred onto a nylon membrane (hybond-N, amersham).
  • Prehybridisation was performed at 60° C. for three hours (5% Dextran sulphate, 5 ⁇ SSC, 0.1% SDS) with 2% w/v of liquid block.
  • the membrane was probed using the GUS and MnSOD specific probes for 16 hrs.
  • the membranes were washed twice with 1 ⁇ SSC and 0.1% SDS at 60° C. for 15 mins each.
  • the membranes were incubated in a solution of buffer-A and liquid block for 1 hr at room temperature.
  • the membranes were then treated with the antifluoroscein-AP conjugate antibody for 1 hour.
  • the membranes were washed thoroughly with buffer A and 0.3% tween-20 twice for 5 mins each. They were placed with their DNA side on the CDP-star detection reagent in the dark. The excess reagent was wiped out and the plastic bag sealed before being exposed for 1 hour and 24 hours to detect the desired bands.
  • the probes used were the 2.08 kb Sac1 and BamH1 fragment of GUS from PAHC27 plasmid and 900 bp pst1 fragment of MnSOD fragment from pGV4 plasmid.
  • the scutellar region in cereal crops is a highly proliferating region, which can callus profusely giving rise to totipotent callus tissues.
  • the callusing rate was better than when they were placed with their scutellar regions away from the media.
  • the callusing rate was very efficient in MS medium having 30 g/l sucrose 10 mg/l myoinositol and varying concentrations of 2,4-D (5 mg/l, 3 mg/l, and 1 mg/l), light had a major effect on the callusing efficiency of the seeds.
  • Embryogenic calli were bombarded with the GUS and MnSOD constructs. These were plated on to hygromycin containing selective media. A total of 20 resistant calli were obtained in a period of one month. No calli survived in the control plates. Growth of calli in the selective medium was similar to growth of calli in the non -transformed lines on non-selective medium. All the calli were resistant to hygromycin concentrations up to 50 mg/l.
  • PCR analysis of the randomly selected resistant calli was carried out using the appropriate primers for GUS and MnSOD. All the appropriate parameters were maintained during the runs. (Materials and methods). Of the 12 calli analysed for the presence of the GUS gene, 3 calli showed bands corresponding to the GUS gene in the positive control (2.0 kb) (FIG. 5). The transformation efficiency based on the PCR results was found to be 23%. The PCR was repeated to confirm the results. The PCR analysis of MnSOD bombarded calli showed one calli out of the 14 analysed having the desired MnSOD gene insert corresponding to the band in the positive control (900 bp). In both the cases the negative control did not show any bands. The PCR was repeated to confirm the results.
  • Table 1 Shows the transformation efficiency of pearl millet 843B.
  • GUS assay revealed varied results for different stages of calli. MS3 stage calli showed the best transformation efficiency at 6 cms distance.
  • Vasil.,V and Vasil., I. K Somatic embryogenesis and plant regeneration from tissue cultures of P. americanum x P. purpureum hybrid. Amer. J. Bot, 68(6): 864-872, 1981
  • Vasil., v Vasil., I. K, somatic embryogenesis and plant regeneration from the suspension cultures of pearl millet, Amer. J. Bot, 47,(1981) 669-698.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US10/204,851 2000-02-25 2001-02-26 Process for generating genetically modified pearl millet through agrobacterium and biolistic transformation Abandoned US20030140382A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN155/MAS/2000 2000-02-25
IN155CH2000 2000-02-25

Publications (1)

Publication Number Publication Date
US20030140382A1 true US20030140382A1 (en) 2003-07-24

Family

ID=11097162

Family Applications (1)

Application Number Title Priority Date Filing Date
US10/204,851 Abandoned US20030140382A1 (en) 2000-02-25 2001-02-26 Process for generating genetically modified pearl millet through agrobacterium and biolistic transformation

Country Status (8)

Country Link
US (1) US20030140382A1 (xx)
EP (2) EP1261729A2 (xx)
JP (1) JP2004505605A (xx)
CN (1) CN1426476A (xx)
AU (1) AU5505001A (xx)
CA (1) CA2401247A1 (xx)
WO (1) WO2001062890A2 (xx)
ZA (1) ZA200206918B (xx)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070107077A1 (en) * 2005-11-10 2007-05-10 Pioneer Hi-Bred International, Inc. Microprojectile bombardment transformation of brassica
US20080201797A1 (en) * 2007-01-25 2008-08-21 Board Of Regents Of The University Of Nebraska Pearl millet line 53 1 1 with PP3 gene and all derivatives produced by any method

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941100B (zh) * 2021-03-04 2023-08-15 北京齐禾生科生物科技有限公司 一种中间偃麦草遗传转化方法及其专用引物

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7102056B1 (en) * 1997-04-29 2006-09-05 The Regents Of The University Of California Compositions and methods for plant transformation and regeneration

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0772687A2 (en) * 1994-07-29 1997-05-14 Pioneer Hi-Bred International, Inc. Transgenic cereal plants

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7102056B1 (en) * 1997-04-29 2006-09-05 The Regents Of The University Of California Compositions and methods for plant transformation and regeneration

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070107077A1 (en) * 2005-11-10 2007-05-10 Pioneer Hi-Bred International, Inc. Microprojectile bombardment transformation of brassica
US8796508B2 (en) * 2005-11-10 2014-08-05 Pioneer Hi-Bred International, Inc. Microprojectile bombardment transformation of Brassica
US8993845B2 (en) 2005-11-10 2015-03-31 Pioneer Hi-Bred International Inc Microprojectile bombardment transformation of Brassica
US20080201797A1 (en) * 2007-01-25 2008-08-21 Board Of Regents Of The University Of Nebraska Pearl millet line 53 1 1 with PP3 gene and all derivatives produced by any method
US7750214B2 (en) 2007-01-25 2010-07-06 Board Of Regents Of The University Of Nebraska Pearl millet line 53-1-1 with PP3 gene and all derivatives produced by any method
US20100212044A1 (en) * 2007-01-25 2010-08-19 Board Of Regents Of The University Of Nebraska Pearl millet line 53-1-1 with PP3 gene and all derivatives produced by any method

Also Published As

Publication number Publication date
ZA200206918B (en) 2004-03-30
CA2401247A1 (en) 2001-08-30
EP1876242A2 (en) 2008-01-09
CN1426476A (zh) 2003-06-25
WO2001062890A2 (en) 2001-08-30
EP1876242A3 (en) 2008-03-05
JP2004505605A (ja) 2004-02-26
AU5505001A (en) 2001-09-03
EP1261729A2 (en) 2002-12-04
WO2001062890A3 (en) 2001-12-27
WO2001062890A8 (en) 2002-03-21

Similar Documents

Publication Publication Date Title
AU774441B2 (en) Method for the regeneration of cotton
Christou et al. Production of transgenic rice (Oryza sativa L.) plants from agronomically important indica and japonica varieties via electric discharge particle acceleration of exogenous DNA into immature zygotic embryos
Ozias-Akins et al. Regeneration of transgenic peanut plants from stably transformed embryogenic callus
Christou Strategies for variety-independent genetic transformation of important cereals, legumes and woody species utilizing particle bombardment
ES2260886T3 (es) Procedimiento para transformar plantas monocotiledoneas.
US5405765A (en) Method for the production of transgenic wheat plants
US5681730A (en) Particle-mediated transformation of gymnosperms
US5120657A (en) Apparatus for genetic transformation
Dutt et al. Effects of antioxidants on Agrobacterium-mediated transformation and accelerated production of transgenic plants of Mexican lime (Citrus aurantifolia Swingle)
JPH05308960A (ja) アグロバクテリウム種を使用する植物の形質転換方法
JPH07505531A (ja) 単子葉植物細胞の形質転換法
CA2352488A1 (en) Plant transformation process
US20030140382A1 (en) Process for generating genetically modified pearl millet through agrobacterium and biolistic transformation
ES2267307T3 (es) Procedimiento de transformacion de vegetales inducido por agrobacterium con eficacia mejorada.
Van Boxtel et al. Glufosinate as an efficient inhibitor of callus proliferation in coffee tissue
Lambe et al. Transgenic pearl millet (Pennisetum glaucum)
AU2001255050B2 (en) A process for generating genetically modified pearl millet through agrobacteriumand biolistic transformation
AU2001255050A1 (en) A process for generating genetically modified pearl millet through agrobacteriumand biolistic transformation
Li et al. Expression of foreign genes, GUS and hygromycin resistance, in the halophyte Kosteletzkya virginica in response to bombardment with the Particle Inflow Gun
Bohorova et al. Laboratory protocols: CIMMYT Applied genetic engineering laboratory
US20020042929A1 (en) Method of creating transformed maize
Ramesh et al. Genetic transformation of embryogenic callus cultures of indica rice using particle bombardment and selection of stably transformed hygromycin resistant plants
KR100363122B1 (ko) 유전자 조작을 통한 마늘 식물체의 형질전환 방법 및 형질전환 마늘
Dommisse Development of an Agrobacterium transformation system for onion (Allium cepa L.)
Vahdati et al. Agrobacterium Mediated Transformation of Somatic Em bryos of Persian Walnut Using fld Gene for Osmotic Stress Tolerance

Legal Events

Date Code Title Description
AS Assignment

Owner name: AVESTHA GENGRAINE TECHNOLOGIES PVT. LTD., INDIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:PATELL, VILLOO MORAWALA;RAYAPURAM, NAGANAND;KRISHNAN, RANJINI;AND OTHERS;REEL/FRAME:013923/0915

Effective date: 20020820

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION