US20030045491A1 - TTK in diagnosis and as a therapeutic target in cancer - Google Patents

TTK in diagnosis and as a therapeutic target in cancer Download PDF

Info

Publication number
US20030045491A1
US20030045491A1 US10/081,119 US8111902A US2003045491A1 US 20030045491 A1 US20030045491 A1 US 20030045491A1 US 8111902 A US8111902 A US 8111902A US 2003045491 A1 US2003045491 A1 US 2003045491A1
Authority
US
United States
Prior art keywords
ttk
ser
leu
lys
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/081,119
Inventor
Christoph Reinhard
Anne Jefferson
Vivien Chan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US10/081,119 priority Critical patent/US20030045491A1/en
Publication of US20030045491A1 publication Critical patent/US20030045491A1/en
Priority to US10/951,477 priority patent/US7501244B2/en
Priority to US10/951,406 priority patent/US7501243B2/en
Priority to US10/951,389 priority patent/US7501242B2/en
Priority to US10/977,087 priority patent/US7867731B2/en
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: REINHARD, CHRISTOPH, CHAN, VIVIEN W., JEFFERSON, ANNE B.
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: REINHARD, CHRISTOPH, CHAN, VIVIEN W., JEFFERSON, ANNE B.
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNMENT DOCUMENTS PREVIOUSLY RECORDED ON REEL 016162 FRAME 0375. ASSIGNOR(S) HEREBY CONFIRMS THE INFORMATION ON THE REVISED ASSIGNMENT DOCUMENTS IS CORRECT. Assignors: JEFFERSON, ANNE B., CHAN, VIVIEN W., REINHARD, CHRISTOPH
Abandoned legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6842—Proteomic analysis of subsets of protein mixtures with reduced complexity, e.g. membrane proteins, phosphoproteins, organelle proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01037—Protein kinase (2.7.1.37)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/57595—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving intracellular compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the field of the present invention relates to disease diagnosis and treatment of cancer and identification of anti-cancer agents.
  • Mitotic checkpoint genes have become widely studied for their roles in development as well as for their potential role in disease such as cancer.
  • the mitotic checkpoint involves a number of different mechanisms to ensure proper cellular division.
  • the spindle assembly checkpoint modulates the timing of anaphase initiation in response to the improper alignment of chromosomes at the metaphase plate. If defects are detected, a signal is transduced to halt further progression of the cell cycle until correct bipolar attachment to the spindle is achieved.
  • TTK Tyrosine threonine kinase
  • the kinases most closely related to TTK include SPK1 serine, threonine, and tyrosine kinase, the Pim1, PBS2, and CDC2 serine/threonine kinases, and the TIK kinase (Mills et al. J. Biol. Chem. 267 : 16000 -6 (1992)).
  • TTK human TTK
  • GenBank Accession No. M86699 The nucleotide and amino acid sequences of human TTK are provided at, for example, GenBank Accession No. M86699. Expression of TTK is markedly reduced or absent in resting cells and in tissues with a low proliferative index (Hogg et al. Oncogene 9:89-96 (1994)). TTK mRNA is expressed in human testis, thymus, bone marrow, and other tissues that contain a large number of proliferating cells and is not detected in tissues that contain few or no dividing cells. TTK expression was detected in several rapidly proliferating cells lines, including various cancer cell lines.
  • TTK expression was also detected and in samples tissue samples from two patients with malignant ovarian cancer (Mills et al., ibid.; Schmandt et al. J. Immunol. 152:96-105 (1994)). TTK expression is correlated with cell proliferation, and plays a role in cell cycle control (Hogg et al., ibid.). Very low levels of TTK mRNA and protein are present in starved cells. When cells are induced to enter the cell cycle, levels of TTK mRNA, protein, and kinase activity increase at the G1/S phase of the cell cycle and peak in G2/M. TTK mRNA levels, as well as kinase activity, drop sharply in early G1, whereas protein levels are largely maintained.
  • TTK is a human homologue of the S. cerevesiae kinase mps1 and the S. pombe protein mph1, both of which are involved in cell cycle spindle assembly checkpoint, thus indicating that TTK is a spindle checkpoint gene (see, e.g., Cahill et al. Genomics 58:181-7 (1999).
  • mitotic checkpoint impairment has been detected in human cancers (e.g., such impairment is present in about 40% of human lung cancer cell lines) mutations in the MAD mitotic checkpoint genes and the BUB gene family are infrequent. Haruki N et al., Cancer Lett. 162:201-205 (2001); Mimori K et al., Oncol Rep. 8:39-42 (2001); Cahill et al., ibid.). There is thus a need for identification of mitotic checkpoint genes that have a role in human cancers, as they can serve as informative diagnostic and/or prognostic indicators, and therapeutic targets.
  • the present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage of the differential expression of these genes in mammalian cancer. Such methods can be useful in determining the ability of a subject to respond to a particular therapy, e.g., as the basis of rational therapy.
  • the invention provides assays for identifying pharmaceuticals that modulate activity of these genes in cancers in which these genes are involved, as well as methods of inhibiting tumor growth by inhibiting activity of TTK.
  • the present invention provides a method for identifying TTK levels in a sample of a subject suspected of having cancer (e.g., a lung, colon, prostrate or breast tissue biopsy) comprising quantifying the level of TTK in the sample.
  • the identification of increased levels of TTK in the sample provides an indication of impairment of the cell cycle checkpoint in the sampled cells.
  • the invention provides a method for determining the characteristics of a malignant or pre-malignant growth comprising determining (either qualitatively or quantitatively) the level of TTK in the cells of the growth, and comparing levels with known levels in various stages of cancer and/or normal tissue. For example, to determine the characteristics of a particular subject's colon cancer, a sample of the cancer may be removed, the levels of TTK in the cancer determined, and the levels compared to normal tissue and/or levels in various stage colon cancers derived from the same cell type. The levels of TTK identified in the sample can thus be indicative of various characteristics of the malignant or pre-malignant growth, as determined by the characteristics of known tissue and cancers. The TTK levels can be compared directly to the levels in other single samples, or may be compared to a standard that is derived from the data of multiple samples.
  • the TTK levels of a sample can be used as one index for determining the appropriate therapeutic intervention for a subject with a malignant or pre-malignant growth. Highly increased levels of TTK, for example, can be indicative of the need for more aggressive therapy, as it is indicative of a later stage cancer.
  • the level of TTK expression may be indicative of the responsiveness of a subject to a particular pharmaceutical, and in particular to a therapeutic intervention that affects the cancer via the mitotic checkpoint.
  • the invention features a method for identifying agents for inhibiting growth of a tumor, particular by a breast or colon tumor, by contacting a cell expressing TTK with a candidate agent, and assessing the effect of the agent upon TTK activity.
  • the invention features a method of diagnosing cancer in a subject, the method comprising detection of TTK polynucleotide or polypeptide in a test sample obtained from a subject so as to determine a level of expression of the gene product; and comparing the level of expression of the TTK in the test sample to a level of expression in a normal cell corresponding to the same tissue; wherein detection of an expression level of TTK in the test sample that is significantly increased from the level of expression in a normal cell indicates that the test cell is cancerous.
  • the cancer is other than ovarian cancer, with colon cancer and breast cancer being of particular interest.
  • the invention features a method for determining the prognosis of a cancerous disease in a subject, the method comprising detecting expression of TTK in a test cell from the subject; and comparing a level of expression of TTK in the test cell with a level of TTK expression in a control cell; wherein the level of expression of TTK in the test cell relative to the level of expression in the control cell is indicative of the prognosis of the cancerous disease.
  • an elevated level of TTK expression in the test cell relative to the normal cell is indicative of the continued presence of cancerous cells in the subject and thus a relatively poorer prognosis than where the level of TTK expression in the test cell is at a level comparable to that found in an normal (non-cancer) cell.
  • progress of a cancer other than ovarian cancer is of particular interest, especially colon and breast cancer.
  • the invention features a method for inhibiting growth of a cancerous cell comprising introducing into a cell an antisense polynucleotide for inhibition of TTK expression, wherein inhibition of TTK expression inhibits replication of the cancerous cell.
  • the invention features a method for assessing the tumor burden of a subject, the method comprising detecting a level of TTK expression in a test sample from a subject, the test sample suspected of comprising increased TTK expression; wherein detection of the level of TTK expression in the test sample is indicative of the tumor burden in the subject, with an increased level of TTK expression in the test sample relative to a control non-cancer cell indicates the presence of a tumor in the subject.
  • the invention features a method of identifying an agent having anti-TTK activity, the method comprising contacting a cancerous cell displaying elevated expression of TTK with a candidate agent; and determining the effect of the candidate agent on TTK activity; wherein a decrease in TTK activity indicates that the agent has anti-TTK activity.
  • TTK activity is detected by detecting TTK expression or by detecting a biological activity of TTK
  • the invention features an assay for identifying a candidate agent that inhibits growth of a cancerous cell, comprising contacting a cell expressing TTK polypeptide with a candidate agent; and detecting activity of the TTK polypeptide, comparing the activity of the TTK polypeptide in the cell in the presence of the candidate agent to activity of a TTK polypeptide in a cell in the absence of the candidate agent; wherein reduction of TTK activity in the presence of the candidate agent relative to TTK activity in the absence of the candidate agent indicates that the candidate agent reduces TTK activity and inhibits growth of a cancerous cell.
  • a primary object of the invention is to exploit TTK as a therapeutic target, e.g. by identifying candidate agents that modulate, usually that decrease, TTK activity in a target cell in order to, for example, inhibit cell growth.
  • An object of the present invention is to inhibit tumor growth by inhibition of activity of a mitotic checkpoint gene product, particularly though inhibition of TTK activity in the target tumor cell.
  • Another object of the invention is to facilitate rational cancer therapy.
  • a therapeutic agent is selected accordingly so as to facilitate reduction of TTK activity levels.
  • Another object of the present invention is to design clinical trials based on levels of TTK expression in a cancer, and more particularly to design clinical trials based on TTK expression in combination with other patient attributes.
  • Yet another object of the invention is to identify the association of TTK expression and intervention attributes that yield efficacious changes in selected disease progression measures.
  • An advantage of the invention is the ability to project disease progression based on expression of TTK in a malignant or pre-malignant growth.
  • Another advantage of the present invention is that it allows a more systematic approach for intervention of a cancerous disease based upon objective indicia.
  • FIG. 1 is a bar graph illustrating expression of TTK in various normal tissue types as detected by PCR.
  • FIG. 2 is a bar graph illustrating expression of TTK in various tumor cell lines as detected by PCR.
  • FIGS. 3 - 6 are graphs illustrating expression profiles for IGF2, MAPKAPK2, TTK, and MARCKS in patients with colorectal carcinoma.
  • FIGS. 7 and 8 are graphs illustrating growth suppression of MDA-MB-231 cells following antisense suppression of TTK expression.
  • FIG. 9 is a graph illustrating growth suppression of SW620 cells following antisense suppression of TTK expression.
  • FIG. 10 is a graph illustrating suppression of colony formation of SW620 cells in soft agar following antisense suppression of TTK expression.
  • FIG. 11 is a graph illustrating that antisense suppression of TTK has no detectable effect on normal immortal fibroblasts.
  • FIG. 12 is a bar graph illustrating induction of cell death upon depletion of TTK from SW620 cells.
  • polynucleotide and “nucleic acid”, used interchangeably herein, refer to a polymeric forms of nucleotides of any length, either ribonucleotides or deoxynucleotides.
  • these terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
  • These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa et al.
  • the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
  • the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucl. Acids Res. 24:2318-2323.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
  • polypeptide and “protein”, used interchangeably herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • the term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
  • TTK polynucleotide and “TTK polypeptide” encompass polynucleotides and polypeptides having sequence similarity or sequence identity to the human TTK (having GenBank accession number M86699; SEQ ID NO:13 and 14), or the S. cerevesiae kinase mps1 gene and gene products (SEQ ID NO:29 and 30), the S.
  • pombe protein mph1 gene and gene products SEQ ID NO:31 and 32
  • other genes and gene products related to TTK such as SPK1 (SEQ ID NO:15 and 16), Pim1 (SEQ ID NO:17 and 18), PBS2 (SEQ ID NO:19 and 20), CDC2 (SEQ ID NO:21 and 22), and TIK (SEQ ID NO:23 and 24) of at least about 65%, preferably at least about 80%, more preferably at least about 85%, and can be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.
  • Sequence similarity and sequence identity are calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc.
  • a reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared.
  • percent sequence identity is calculated by counting the number of residue matches (e.g., nucleotide residue or amino acid residue) between the query and test sequence and dividing total number of matches by the number of residues of the individual sequences found in the region of strongest alignment. Thus, where 10 residues of an 11 residue query sequence matches a test sequence, the percent identity above would be 10 divided by 11, or approximately, 90.9%.
  • BLAST Altschul et al., J. Mol. Biol., 215:403-10 (1990)
  • Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular).
  • a preferred method of calculating percent identity is the Smith-Waterman algorithm, using the following.
  • Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.
  • the human TTK cDNA is represented by the polynucleotide sequence of SEQ ID NO:13 and the human TTK polypeptide is represented by the sequence of SEQ ID NO:14.
  • Antisense polynucleotide or “antisense oligonucleotide” are used interchangeably herein to mean an unmodified or modified nucleic acid having a nucleotide sequence complementary to a given polynucleotide sequence (e.g., a polynucleotide sequence encoding TTK) including polynucleotide sequences associated with the transcription or translation of the given polynucleotide sequence (e.g., a promoter of a polynucleotide encoding TTK), where the antisense polynucleotide is capable of hybridizing to a TTK-encoding polynucleotide sequence.
  • a given polynucleotide sequence e.g., a polynucleotide sequence encoding TTK
  • TTK polynucleotide sequence encoding TTK
  • antisense polynucleotide capable of inhibiting transcription and/or translation of a TTK-encoding poly
  • cDNA as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons (e.g., sequences encoding open reading frames of the encoded polypeptide) and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns removed by nuclear RNA splicing to create a continuous open reading frame encoding TTK.
  • a “variant” as used in the context of a “variant polypeptide” refers to an amino acid sequence that is altered by one or more amino acids relative to a reference amino acid sequence.
  • the variant can have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have “nonconservative” changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software.
  • a “deletion” is defined as a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent as compared to reference amino acid sequence or nucleotide sequence.
  • Deletions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
  • Insertions or additions is that change in an amino acid or nucleotide sequence which has resulted in the addition of one or more amino acid or nucleotide residues, respectively, as compared to a reference amino acid sequence or nucleotide sequence. Insertions or additions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
  • substitution results from the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively, as compared to a reference amino acid sequence or nucleotide sequence.
  • Substitutions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
  • single nucleotide polymorphism and “SNP” refer to polymorphisms of a single base change relative to a reference sequence.
  • biologically active refers to gene product, usually a polypeptide, having structural, regulatory, or biochemical functions of a naturally occurring gene product, e.g., protein. “Immunologically active” defines the capability of the natural, recombinant, or synthetic polypeptide, or any oligopeptide thereof, to elicit a specific immune response in appropriate animals or cells and to bind with specific antibodies.
  • nucleic acid derivative refers to the chemical modification of a nucleic acid or amino acid sequence relative to a reference nucleic acid or amino acid sequence. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group.
  • a nucleic acid derivative generally encodes a polypeptide which retains essential biological characteristics of the polypeptide encoded by the reference nucleic acid (e.g., the “parent” molecule).
  • isolated is meant to describe a compound of interest (e.g., either a polynucleotide or a polypeptide) that is in an environment different from that in which the compound naturally occurs. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
  • a compound of interest e.g., either a polynucleotide or a polypeptide
  • substantially purified refers to a compound (e.g., either a polynucleotide or a polypeptide) that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated.
  • “Stringency” typically occurs in a range from about Tm ⁇ 5° C. (5° C. below the Tm of the probe or antibody) to about 20° C. to 25° C. below Tm.
  • a stringency hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences.
  • hybridization shall include “any process by which a strand of nucleic acid joins with a complementary strand through base pairing” (Coombs, Dictionary of Biotechnology, Stockton Press, New York N.Y. (1994)). Amplification as carried out in the polymerase chain reaction technologies is described in Dieffenbach et al., PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. (1995).
  • transformation refers to a permanent or transient genetic change, induced in a cell following incorporation of new DNA (i.e., DNA exogenous to the cell). Genetic change can be accomplished either by incorporation of the new DNA into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element. Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell.
  • construct refers to a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences.
  • the term “differentially expressed” generally refers to a polynucleotide that is expressed at levels in a test cell that differ significantly from levels in a reference cell, e.g., mRNA is found at levels at least about 25%, at least about 50% to about 75%, at least about 90% increased or decreased, generally at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or at least about 50-fold or more increased or decreased in a cancerous cell when compared with a cell of the same type that is not cancerous.
  • the comparison can be made between two tissues, for example, if one is using in situ hybridization or another assay method that allows some degree of discrimination among cell types in the tissue.
  • the comparison may also be made between cells removed from their tissue source.
  • “Differential expression” refers to both quantitative, as well as qualitative, differences in the genes' temporal and/or cellular expression patterns among, for example, normal and neoplastic tumor cells, and/or among tumor cells which have undergone different tumor progression events.
  • polynucleotide corresponds to a differentially expressed gene are used to refer to the relationship between a given polynucleotide and the gene from which the polynucleotide sequence is derived (e.g., a polynucleotide that is derived from a coding region of the gene, a splice variant of the gene, an exon, and the like) or to which the polynucleotide hybridizes to under stringer conditions.
  • “Differentially expressed polynucleotide” as used herein refers to a nucleic acid molecule (RNA or DNA) comprising a sequence that represents or corresponds to a differentially expressed gene, e.g., the differentially expressed polynucleotide comprises a sequence (e.g., an open reading frame encoding a gene product; a non-coding sequence) that uniquely identifies a differentially expressed gene so that detection of the differentially expressed polynucleotide in a sample is correlated with the presence of a differentially expressed gene in a sample.
  • RNA or DNA nucleic acid molecule
  • “Differentially expressed polynucleotides” is also meant to encompass fragments of the disclosed polynucleotides, e.g., fragments retaining biological activity, as well as nucleic acids homologous, substantially similar, or substantially identical (e.g., having about 90% sequence identity) to the disclosed polynucleotides.
  • Diagnosis generally includes determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy), and therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy).
  • prognosis of a subject affected by a disease or disorder e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy
  • therametrics e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy.
  • a polypeptide associated with cancer refers to a polypeptide that is present at relatively higher or lower levels in a cancer cell relative to a normal cell of the same type.
  • biological sample encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay.
  • the term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
  • the term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components.
  • the term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.
  • treatment used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease.
  • Treatment covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or relieving the disease symptom, i.e., causing regression of the disease or symptom.
  • treatment of cancer thus encompasses one or more of inhibition of cellular proliferation, inhibition of metastasis, and the like.
  • antibody is meant an immunoglobulin protein which is capable of binding an antigen.
  • Antibody as used herein is meant to include the entire antibody as well as any antibody fragments (e.g., F(ab′) 2 , Fab′, Fab, Fv) capable of binding the epitope, antigen, or antigenic fragment of interest.
  • Antibodies of the invention are immunoreactive or immunospecific for and therefore specifically and selectively bind to a protein of interest, e.g., human TTK protein. Antibodies which are immunoreactive and immunospecific for human TTK are preferred. Antibodies for human TTK are preferably immunospecific—i.e., not substantially cross-reactive with related materials, although they may recognize TTK homologs across species.
  • the term “antibody” encompasses all types of antibodies (e.g., monoclonal and polyclonal).
  • binds specifically is meant high avidity and/or high affinity binding of an antibody to a specific polypeptide, e.g., epitope of a TTK protein. Antibody binding to its epitope on this specific polypeptide is stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest. Antibodies which bind specifically to a polypeptide of interest may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to the compound or polypeptide of interest, e.g., by use of appropriate controls.
  • cancer neoplasm
  • tumor tumor cells
  • tumor tumor cells
  • non-metastatic cells pre-malignant cells
  • pre-malignant e.g., benign hyperplasiac
  • malignant e.g., metastatic
  • non-metastatic cells e.g., benign hyperplasiac
  • TTK activity refers to activity of the TTK polypeptide in phosphorylation of a recipient substrate.
  • Modulation of TTK activity refers to an increase or decrease in TTK activity that can be a result of, for example, interaction of an agent with a TTK polypeptide (e.g., reversible or irreversible binding of an inhibitory agent so as to interfere with TTK polypeptide interaction with a donor molecule or a recipient (acceptor) molecule in the phosphorylation activity of TTK), inhibition of TTK transcription and/or translation (e.g., through antisense interaction with the TTK gene or TTK transcript, through modulation of transcription factors that facilitate TTK expression), and the like. Modulation of TTK activity that results in a decrease of TTK activity is of particular interest in the invention.
  • TTK activity can be decreased by an inhibitory agent at least 10%, 25%, 50%, 75%, 85%, 90%, up to 100% relative to TTK activity in the absence of an agent.
  • TTK activity can be assessed by assaying enzymatic activity, by assessing TTK polypeptide levels, or by assessing TTK transcription levels. Comparisons of TTK activity can also be accomplished by comparing TTK activity assessed (either qualitatively or quantitatively) in a test sample to a standard TTK activity (e.g., a level of TTK activity in the absence of an inhibitory agent or agonist, that is associated with a normal cell, a level of TTK activity of a cancerous cell of a selected tissue type, and the like).
  • a standard TTK activity e.g., a level of TTK activity in the absence of an inhibitory agent or agonist, that is associated with a normal cell, a level of TTK activity of a cancerous cell of a selected tissue type, and the like.
  • Human TTK is a mitotic checkpoint gene which encodes an 857 amino acid protein that exhibits activity of a mixed specificity (tyr/thr) kinase. TTK is expressed in rapidly proliferating tissues such as testis and thymus. See, e.g., Mills G B et al., J Biol Chem. 267:16000-6 (1992). The present invention is based upon the finding that TTK is differentially expressed in colon tumor cells relative to normal colon cells as detected by microarray analysis. Differential expression was confirmed in cell lines derived from various forms of cancer, indicating that the involvement of TTK in cancer as a more general mechanism.
  • TTK can be a therapeutic target for chemotherapy in cancers in which TTK is overexpressed.
  • the identification of the association of TTK with cancer, and the confirmation that inhibition of TTK activity serves as the basis for the materials and methods of the invention, such as are disclosed and discussed herein, for use in, for example, diagnosing cancer of a patient, particularly a cancer that is susceptible to treatment by decreasing activity of TTK.
  • the invention also provides for planning and selection of appropriate therapeutic and/or prophylactic treatment, permitting streamlining of treatment by targeting those most likely to benefit.
  • the invention also provides for treatment of a cancer associated with aberrant TTK levels (e.g., associated with overexpression or overproduction of TTK), e.g.
  • TTK activity e.g., by decreasing TTK gene product production (e.g., at the level of transcription or translation) and/or by reducing one or more of TTK's kinase activities.
  • the invention is based on the discovery that TTK activity is present at higher levels in cancerous cells (particularly in colon cancer and breast cancer) than in normal cells of the same cell type. This discovery serves as the basis for identification of cancerous cells, as well as identification of tumors that are susceptible to therapy by inhibiting activity of TTK, e.g., by inhibiting TTK expression at the level of transcription or translation or both, by inhibiting TTK activity, and the like.
  • TTK gene products e.g. TTK encoding mRNA or TTK polypeptides are of particular interest as markers (e.g., in bodily fluids (such as blood) or in tissues) to detect the earliest changes along the carcinogenesis pathway (e.g., to differentiate cancerous tissue from non-cancerous tissue) and/or to monitor the efficacy of various therapies and preventive interventions.
  • markers e.g., in bodily fluids (such as blood) or in tissues
  • the carcinogenesis pathway e.g., to differentiate cancerous tissue from non-cancerous tissue
  • a relatively increased level of expression of TTK compared to normal cells or tissues of the same type can be indicative of a poorer prognosis, and therefore warrant more aggressive therapy (e.g., chemo- or radio-therapy) for a patient or vice versa.
  • the correlation of surrogate tumor specific features with response to treatment and outcome in patients can define prognostic indicators that allow the design of tailored therapy based on the molecular profile of the tumor.
  • These therapies include antibody targeting, antagonists (e.g., small molecules), and gene therapy. Determining TTK expression and comparison of a patient's profile with known expression in normal tissue and variants of the disease allows a determination of the best possible treatment for a patient, both in terms of specificity of treatment and in terms of comfort level of the patient.
  • Surrogate tumor markers such as polynucleotide expression, can also be used to better classify, and thus diagnose and treat, different forms and disease states of cancer. Two classifications widely used in oncology that can benefit from identification of TTK expression levels are staging of the cancerous disorder, and grading the nature of the cancerous tissue.
  • TTK polynucleotides as well as their encoded gene products, can be useful to monitor patients having or susceptible to cancer to detect potentially malignant events at a molecular level before they are detectable at a gross morphological level.
  • detection of TTK gene products can be useful as therametrics, e.g., to assess the effectiveness of therapy by using the polynucleotides or their encoded gene products, to assess, for example, tumor burden in the patient before, during, and after therapy.
  • a polynucleotide identified as corresponding to a gene that is differentially expressed in, and thus is important for, one type of cancer can also have implications for development or risk of development of other types of cancer, e.g., where a polynucleotide represents a gene differentially expressed across various cancer types.
  • expression of a polynucleotide corresponding to a gene that has clinical implications for metastatic colon cancer can also have clinical implications for stomach cancer or endometrial cancer.
  • activity or expression levels may be compared to those of suitable cancerous or non-cancerous control samples.
  • a diagnosis of cancer can be made if TTK activity is increased at by 25%, 50%, 75%, 90%, up to 100%, or, alternatively by 5-fold, 10-fold, 50-fold, or more than 100-fold relative to a normal non-cancerous cell of the same tissue type.
  • gene products that are differentially expressed in cancerous cells relative to, for example, non-cancer cells of between cancer cells of differing malignant potential can also be assayed in addition to TTK for differential expression in a test cell.
  • exemplary gene products include, but are not necessarily limited to MAPKAP kinase 2 (SEQ ID. No. 33 and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and 38).
  • Staging is a process used by physicians to describe how advanced the cancerous state is in a patient. Staging assists the physician in determining a prognosis, planning treatment and evaluating the results of such treatment. Staging systems vary with the types of cancer, but generally involve the following “TNM” system: the type of tumor, indicated by T; whether the cancer has metastasized to nearby lymph nodes, indicated by N; and whether the cancer has metastasized to more distant parts of the body, indicated by M. Generally, if a cancer is only detectable in the area of the primary lesion without having spread to any lymph nodes it is called Stage I. If it has spread only to the closest lymph nodes, it is called Stage II. In Stage II, the cancer has generally spread to the lymph nodes in near proximity to the site of the primary lesion. Cancers that have spread to a distant part of the body, such as the liver, bone, brain or other site, are Stage IV, the most advanced stage.
  • the differential expression level of TTK can facilitate fine-tuning of the staging process by identifying markers for the aggressiveness of a cancer, e.g. the metastatic potential, as well as the presence in different areas of the body.
  • a Stage II cancer with a large differential level of expression of TTK can signify a cancer with a high metastatic potential and can be used to change a borderline Stage II tumor to a Stage III tumor, justifying more aggressive therapy.
  • Grade is a term used to describe how closely a tumor resembles normal tissue of its same type.
  • the microscopic appearance of a tumor is used to identify tumor grade based on parameters such as cell morphology, cellular organization, and other markers of differentiation.
  • the grade of a tumor corresponds to its rate of growth or aggressiveness, with undifferentiated or high-grade tumors generally being more aggressive than well differentiated or low-grade tumors.
  • the following guidelines are generally used for grading tumors: 1) GX Grade cannot be assessed; 2) G1 Well differentiated; G2 Moderately well differentiated; 3) G3 Poorly differentiated; 4) G4 Undifferentiated.
  • TTK activity levels can be especially valuable in determining the grade of the tumor, as they not only can aid in determining the differentiation status of the cells of a tumor, they can also identify factors other than differentiation that are valuable in determining the aggressiveness of a tumor, such as metastatic potential.
  • Colorectal cancer is one of the most common neoplasms in humans and perhaps the most frequent form of hereditary neoplasia. Prevention and early detection are key factors in controlling and curing colorectal cancer. Colorectal cancer begins as polyps, which are small, benign growths of cells that form on the inner lining of the colon. Over a period of several years, some of these polyps accumulate additional mutations and become cancerous.
  • Familial adenomatous polyposis FAP
  • Gardner's syndrome Hereditary nonpolyposis colon cancer
  • HNPCC Hereditary nonpolyposis colon cancer
  • Familial colorectal cancer in Ashkenazi Jews The expression of appropriate polypeptide andpolynucleotides can be used in the diagnosis, prognosis and management of colorectal cancer. Detection of colon cancer can be determined using expression levels of TTK alone or in combination with the levels of expression of other genes differentially expressed in colon cancer.
  • Determination of the aggressive nature and/or the metastatic potential of a colon cancer can be determined by comparing levels of TTK with a level associated with a normal cell, and comparing total levels of another sequence known to be differentially expressed, or otherwise be a marker of, cancerous tissue, e.g., expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al., Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957; Bodmer W, et al., Nat Genet. (1994) 4(3):217; Fearon E R, Ann N Y Acad Sci.
  • MAPKAP kinase 2 SEQ ID. No. 33 and 34
  • MARCKS SEQ ID NO:35 and 36
  • IGF2 SEQ ID NO:37 and 38
  • development of colon cancer can be detected by examining the level of expression of a gene corresponding to a polynucleotides described herein to the levels of oncogenes (e.g. ras) or tumor suppressor genes (e.g. FAP or p53).
  • oncogenes e.g. ras
  • tumor suppressor genes e.g. FAP or p53
  • specific marker polynucleotides can be used to discriminate between normal and cancerous colon tissue, to discriminate between colon cancers with different cells of origin, to discriminate between colon cancers with different potential metastatic rates, etc.
  • markers of cancer see, e.g., Hanahan et al. (2000) Cell 100:57-70.
  • adenocarcinomas subtypes which can be summarized as follows: 1) ductal carcinoma in situ (DCIS), including comedocarcinoma; 2) infiltrating (or invasive) ductal carcinoma (IDC); 3) lobular carcinoma in situ (LCIS); 4) infiltrating (or invasive) lobular carcinoma (ILC); 5) inflammatory breast cancer; 6) medullary carcinoma; 7) mucinous carcinoma; 8) Paget's disease of the nipple; 9) Phyllodes tumor; and 10) tubular carcinoma.
  • DCIS ductal carcinoma in situ
  • IDC infiltrating (or invasive) ductal carcinoma
  • LCIS lobular carcinoma in situ
  • ILC infiltrating (or invasive) lobular carcinoma
  • the expression levels of TTK can be used in the diagnosis and management of breast cancer, as well as to distinguish between types of breast cancer. Detection of breast cancer can be determined using expression levels of TTK, either alone or in combination with expression of other gene known to be differentially expressed in breast cancer. Determination of the aggressive nature and/or the metastatic potential of a breast cancer can also be determined by comparing levels of TTK and comparing levels of another sequence known to vary in cancerous tissue, e.g. ER expression. In addition, development of breast cancer can be detected by examining the ratio of expression of TTK to the levels of steroid hormones (e.g., testosterone or estrogen) or to other hormones (e.g., growth hormone, insulin). Thus expression of specific marker polynucleotides and polypeptides can be used to discriminate between normal and cancerous breast tissue, to discriminate between breast cancers with different cells of origin, to discriminate between breast cancers with different potential metastatic rates, etc.
  • steroid hormones e.g., testosterone or estrogen
  • TTK gene product e.g., RNA or protein
  • the purpose of such analysis may be used for diagnosis, to detect the presence of an existing cancer, to help identify the type of cancer, to assist a physician in determining the severity or likely course of the cancer, and/or to optimize treatment of it.
  • the methods are useful for detecting cancer cells, facilitating diagnosis of cancer and the severity of a cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy (e.g., by providing a measure of therapeutic effect through, for example, assessing tumor burden during or following a chemotherapeutic regimen).
  • the methods are useful for classification or stratification of cancer cells, e.g., for the purpose of selecting patients to be included in a clinical trial population, for selecting an appropriate therapy (e.g., selecting therapy according to an expression profile of the cancerous cells), and the like.
  • the detection methods can be provided as part of a kit.
  • the invention further provides kits for detecting the presence and/or a level of TTK activity e.g., by detection of a TTK-encoding mRNA and/or a polypeptide encoded thereby or by measuring TTK activity, in a biological sample. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals.
  • the kits of the invention for detecting TTK polypeptide that is differentially expressed in cancer cells comprise a moiety that specifically binds the polypeptide, which may be a specific antibody.
  • kits of the invention for detecting a TTK-encoding polynucleotide that is differentially expressed in cancer cells comprise a moiety that specifically hybridizes to such a polynucleotide such as a primer.
  • the kits of the invention for detecting TTK activity comprise a recipient substrate capable of being phosphorylated by TTK, and a labeled donor substrate.
  • the kits may optionally provide additional components that are useful in the procedure, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detection, control samples, standards, instructions, and interpretive information.
  • Methods for detection of TTK activity include screening for the presence of TTK nucleic acid sequences representing an expressed TTK gene or alleles or variants thereof, and detecting the TTK polypeptide.
  • the methods make use of biological samples from individuals that are suspected of contain the nucleic acid sequences or polypeptide. Examples of biological samples include blood, plasma, serum, tissue samples, tumor samples, saliva and urine.
  • Exemplary approaches for detecting TTK nucleic acid or polypeptides include: (a) determining the presence of the polypeptide encoded by the TTK gene; (b) using a specific binding member capable of binding to a TTK nucleic acid sequence (e.g., a known complementary sequence), the specific binding member comprising a nucleic acid that hybridizes with the TTK sequence under stringent conditions (c) using a substance comprising an antibody domain with specificity for a TTK nucleic acid sequence or the polypeptide encoded by it, the specific binding member being labeled to allow detection of the specific binding member to its binding partner is detectable; (d) using PCR involving one or more primers to determine relative levels of TTK in a sample from a patient; and (e) using an assay for TTK activity, e.g., phosphorylation of a TTK substrate.
  • a specific binding member capable of binding to a TTK nucleic acid sequence e.g., a known complementary sequence
  • the specific binding member compris
  • TTK levels can include both levels of normal TTK and/or variant forms of TTK.
  • a variant form of the gene may contain one or more insertions, deletions, substitutions and/or additions of one or more nucleotides compared with the wild-type sequence which may or may not alter the gene function. Differences at the nucleic acid level are not necessarily reflected by a difference in the amino acid sequence of the encoded polypeptide due to the degeneracy of the genetic code.
  • a mutation or other difference in a gene may result in a frame-shift or stop codon, which could seriously affect the nature of the polypeptide produced (if any), or a point mutation or gross mutational change to the encoded polypeptide, including insertion, deletion, substitution and/or addition of one or more amino acids or regions in the polypeptide.
  • a mutation in a promoter sequence or other regulatory region may alter (e.g., reduce or enhance) expression from the gene or affect the processing or stability of the mRNA transcript.
  • Tests may be carried out on preparations containing mRNA or cDNA generated from isolated mRNA in a manner that reflects the relative levels of mRNA transcripts in the sample.
  • Levels of RNA can be determined specific amplification reaction such as PCR using one or more pairs of primers may be employed to amplify a region of the nucleic acid, and preferably a region with less homology to other genes.
  • Nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.
  • Nucleic acid may be screened using a TTK-specific probe.
  • a TTK-specific probe corresponds in sequence to a region of the TTK gene, or its complement.
  • specific hybridization of such a probe to test nucleic acid is indicative of the presence of the TTK nucleic acid in a sample.
  • more than one probe may be used on the same test sample.
  • the probe may contain as few as 15, 20, 50 or 100 nucleotides of the TTK gene of SEQ ID. No. 13 or may be as long as or 500, 1 kb or as much as 3.8 kb or longer in length.
  • Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample.
  • Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art.
  • the PCR product may for instance be treated in a way that enables one to display the mutation or polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected. This can be done simultaneous to or sequentially to determining the level of a normal TTK sequence, e.g., to determine the combinatory levels of total TTK.
  • the presence of absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA.
  • the presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene or a variant or allele is digested with the same enzyme or enzymes.
  • a test sample of nucleic acid may be provided for example by extracting nucleic acid from cells, e.g., cells from a tumor biopsy.
  • TTK polypeptide there are various methods for determining the presence or absence in a test sample of a TTK polypeptide.
  • a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies), specific for wild-type TTK and/or one or more particular variants (e.g., allelic variants) of the TTK polypeptide.
  • the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding.
  • a specific binding member such as an antibody under appropriate conditions for specific binding.
  • different reporting labels may be employed for each antibody so that binding of each can be determined.
  • TTK polypeptide can also be identified using TTK-specific activity assays.
  • Binding agents can also be immobilized in small, discrete locations and/or as arrays on solid supports or on diagnostic chips. These approaches can be particularly valuable as they can provide great sensitivity, particularly through the use of fluorescently labeled reagents, require only very small amounts of biological sample from individuals being tested and allow a variety of separate assays can be carried out simultaneously. This latter advantage can be useful as it provides an assay for different proteins (e.g., an oncogene or tumor suppressor) in tandem with the assay for TTK.
  • the present invention provides a support or diagnostic chip having immobilized thereon one or more binding agents capable of specifically binding TTK nucleic acid or polypeptides, optionally in combination with other reagents needed to carrying out an assay.
  • the full-length or partial polypeptides encoded by TTK may be expressed in any expression system, including, for example, bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells for which are described in U.S. Pat. No. 5,654,173. Appropriate polynucleotide constructs are purified using standard recombinant DNA techniques as described in, for example, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), and under current regulations described in United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.
  • yeast Expression systems in yeast include those described in Hinnen et al., Proc. Natl. Acad. Sci. ( USA ) (1978) 75:1929; Ito et al., J. Bacteriol. (1983) 153:163; Kurtz et al., Mol. Cell. Biol. (1986) 6:142; Kunze et al., J. Basic Microbiol. (1985) 25:141; Gleeson et al., J. Gen. Microbiol. (1986) 132:3459, Roggenkamp et al., Mol. Gen. Genet. (1986) 202:302) Das et al., J. Bacteriol.
  • Insect Cells Expression of heterologous genes in insects is accomplished as described in U.S. Pat. No. 4,745,051, Friesen et al. (1986) “The Regulation of Baculovirus Gene Expression” in: The Molecular Biology Of Baculoviruses (W. Doerfler, ed.), EP 0 127,839, EP 0 155,476, and Vlak et al., J. Gen. Virol. (1988) 69:765-776, Miller et al., Ann. Rev. Microbiol.
  • Mammalian Cells Mammalian expression is accomplished as described in Dijkema et al., EMBO J. (1985) 4:761, Gorman et al., Proc. Natl. Acad. Sci. ( USA ) (1982) 79:6777, Boshart et al., Cell (1985) 41:521 and U.S. Pat. No. 4,399,216. Other features of mammalian expression are facilitated as described in Ham and Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem. (1980) 102:255, U.S. Pat. Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.
  • the invention also encompasses screening assays to identify agents that modulate TTK activity, specifically that decrease aberrant TTK activity in an affected cell, e.g., a cancerous or pre-cancerous cell in which TTK is differentially expressed. Such assays may be performed either in vitro or in vivo.
  • agent as used herein describes any molecule with the capability of altering the expression or physiological function of a gene product of a differentially expressed gene. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
  • Candidate agents encompass numerous chemical classes, including, but not limited to, organic molecules (e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons), peptides, monoclonal antibodies, antisense polynucleotides, and ribozymes, and the like.
  • Candidate agents can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules including, but not limited to: polynucleotides, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs. Candidate agents can be assessed for modulation of TTK activity either singly or in pools.
  • a wide variety of in vitro assays may be used to screen candidate agents for the desired biological activity, including, but not limited to, labeled in vitro protein-protein binding assays, protein-DNA binding assays (e.g., to identify agents that affect expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
  • labeled in vitro protein-protein binding assays protein-DNA binding assays (e.g., to identify agents that affect expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
  • protein-DNA binding assays e.g., to identify agents that affect expression
  • electrophoretic mobility shift assays e.g., to identify agents that affect expression
  • immunoassays for protein binding e.g., immunoassays for protein binding
  • the purified polypeptide may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions, transcriptional regulation, etc.
  • the screening assay can be a binding assay, wherein one or more of the molecules may be joined to a label, and the label directly or indirectly provide a detectable signal.
  • Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g.,magnetic particles, and the like.
  • Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
  • the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
  • a variety of other reagents may be included in the screening assays described herein. Where the assay is a binding assay, these include reagents like salts, neutral proteins, e.g.,albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
  • reagents like salts, neutral proteins, e.g.,albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions.
  • yeast has been shown to be a powerful tool for studying protein-protein interactions through the two hybrid system described in Chien et al. 1991 Proc. Natl. Acad. Sci. USA 88:9578-9582.
  • Candidate agents can be screened in a non-human animal model of cancer (e.g., in animals into which have been injected cancerous cells; in animals that are transgenic for an alteration in expression of a differentially expressed gene as described herein, e.g., a transgenic “knock-out,” or a transgenic “knock-in,” a polynucleotide encoding all or a portion of a differentially expressed gene product and comprising an operably linked reporter gene, and the like).
  • a non-human animal model of cancer e.g., in animals into which have been injected cancerous cells; in animals that are transgenic for an alteration in expression of a differentially expressed gene as described herein, e.g., a transgenic “knock-out,” or a transgenic “knock-in,” a polynucleotide encoding all or a portion of a differentially expressed gene product and comprising an operably linked reporter gene, and the like).
  • the candidate agent is administered to the animal, and the effects of the candidate agent determined.
  • the candidate agent can be administered in any manner desired and/or appropriate for delivery of the agent in order to effect a desired result.
  • the candidate agent can be administered by injection (e.g., by injection intravenously, intramuscularly, subcutaneously, or directly into the tissue in which the desired affect is to be achieved), orally, or by any other desirable means.
  • the in vivo screen will involve a number of animals receiving varying amounts and concentrations of the candidate agent (from no agent to an amount of agent hat approaches an upper limit of the amount that can be delivered successfully to the animal), and may include delivery of the agent in different formulation.
  • the agents can be administered singly or can be combined in combinations of two or more, especially where administration of a combination of agents may result in a synergistic effect.
  • the effect of agent administration upon the transgenic animal can be monitored by assessing expression of the gene product, growth of the injected tumor cells, and the like.
  • Compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host for treatment of a condition that is amenable to treatment by modulation of expression of a differentially expressed gene product.
  • the therapeutic agents may be administered in a variety of ways, orally, topically, parenterally e.g., subcutaneously, intraperitoneally, by viral infection, intravascularly, etc. Oral and inhaled treatments are of particular interest.
  • the compounds may be formulated in a variety of ways.
  • the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt. %.
  • the therapeutic agents can be administered in a single dose, or as multiple doses over a course of treatment.
  • compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
  • Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds.
  • Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
  • a TTK polypeptide or TTK-encoding nucleic acid according to the present invention may be used in screening for molecules which affect or modulate TTK activity or function. Such molecules may be useful in a therapeutic and/or prophylactic context. Means for screening for substances potentially useful in treating or preventing cancer is provided by the present invention.
  • the methods of the invention are to facilitate identification of modulators of TTK activity (e.g., by modulating activity of TTK polypeptide or other TTK gene product, or by affecting TTK activity by targeting activity of gene products that act either upstream or downstream of TTK in a cascade that leads to TTK activity), with agents that decrease TTK activity generally being of particular interest.
  • Substances identified as modulators of the TTK activity represent an advance in the fight against cancer since they provide basis for design and investigation of pharmaceuticals for in vivo use.
  • a method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide (e.g., the ability to phosphorylate its substrate) and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.
  • Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide.
  • Such libraries and their use are known in the art.
  • the use of peptide libraries is preferred.
  • Test substances may also be screened for ability to interact with the polypeptide, e.g., in a yeast two-hybrid system. This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide. Alternatively, the screen could be used to screen test substances for binding to a TTK specific binding partner.
  • a substance identified using as a modulator of TTK polypeptide function may be peptide or non-peptide in nature.
  • Non-peptide “small molecules” are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
  • the activity of the TTK may be measured using any suitable kinase assay known in the art.
  • any suitable kinase assay known in the art.
  • the methods described in Hogg et al Oncogene 1994 9:98-96
  • Mills et al J. Biol. Chem. 1992 267:16000-006
  • Tomizawa et al 2001 FEBS Lett. 2001 492: 221-7
  • Schmandt et al J. Immunol. 1994, 152:96-105
  • serine, threonine and tyrosine kinase assays are described in Ausubel et al. (Short Protocols in Molecular Biology, 1999, unit 17.6).
  • TTK assays generally use TTK polypeptide, a labeled donor substrate, and a receptor substrate that is either specific or non-specific for TTK. In such assays TTK transfers a labeled moiety from the donor substrate to the receptor substrate, and kinase activity is measured by the amount of labeled moiety transferred from the donor substrate to the receptor substrate.
  • TTK polypeptide may be produced using various expression systems as detailed above, may be purified from cells, may be in the form of a cleaved or uncleaved recombinant fusion protein and may have non-TTK polypeptide sequences, for example a His tag or ⁇ -galactosidase at its N- or C-terminus. TTK activity may be assayed in cancerous cells lines if the cancerous cell lines are used as a source of the TTK to be assayed.
  • Suitable donor substrates for TTK assays include any molecule that is susceptible to dephosphorylation by TTK include ⁇ -labeled ATP and ATP analogs, wherein the label is 33 P, 32 P, 35 S or any other radioactive isotope or a suitable fluorescent marker.
  • Suitable recipient substrates for TTK assays include any polypeptide or other molecule that is susceptible to phosphorylation by TTK.
  • Recipient substrates are usually derived from fragments of in vivo targets of TTK. Recipient substrates fragments may be 8 to 50 amino acids in length, usually 10 to 30 amino acids and preferably of about 10, 12, 15, 18, 20 and 25 amino acids in length Further recipient substrates can be determined empirically using a set of different polypeptides or other molecules.
  • Targets of TTK suitable for TTK assays include tau and cdc25.
  • Recipient substrates for TTK are typically capable of being purified from other components of the reaction once the reaction has been performed. This purification is usually done through a molecular interaction, where the recipient substrates is biotinylated and purified through its interaction with streptavidin, or a specific antibody is available that can specifically recognize the recipient substrates.
  • the reaction can be performed in a variety of conditions, such as on a solid support, in a gel, in solution or in living cells.
  • One exemplary recipient substrate for TTK phosphorylation is the human protein cdc25, SEQ ID NO:26, which is phosphorylated by TTK at the serine residues of amino acid position 214 and 216.
  • Two fragments of cdc25 are used as substrates in the kinase assay described below. These fragments comprise peptides A (SEQ ID NO:27), corresponding to amino acids 209 to 225 of the cdc25 polypeptide sequence or peptide B (SEQ ID NO:28), corresponds to amino acids 210 to 223 of the cdc25 polypeptide.
  • biotinylated polypeptides comprising either SEQ ID NO:27 (Biotin-SGSGSGLYRSPSMPENLNRPR-NH2) or SEQ ID NO:28 (Biotin-GGGGLYRSPSMPENLNRK-OH) are used.
  • the choice of detection methods depends on type of label used for the donor molecule and may include, for example, measurement of incorporated radiation or fluorescence by autoradiography, scintillation, scanning or fluorography.
  • the invention further provides methods for reducing growth of cancer cells, particular breast or colon cancer cells.
  • the methods comprise contacting a cancer cell that expresses TTK at an aberrant level relative to normal cells with a substance that (1) modulates, generally decreases, expression of TTK (e.g., a antisense polynucleotide corresponding to TTK); or (2) otherwise modulates, generally decreases, TTK polypeptide levels and/or TTK activity in a cancerous cell having aberrant TTK activity.
  • a substance that (1) modulates, generally decreases, expression of TTK e.g., a antisense polynucleotide corresponding to TTK
  • TTK e.g., a antisense polynucleotide corresponding to TTK
  • “Reducing growth of a cancer cell” includes, but is not limited to, reducing proliferation of cancer cells, and reducing the incidence of a normal cell from developing a cancerous phenotype or morphology. Whether a reduction in cancer cell growth has been achieved can be readily determined using any known assay, including, but not limited to, [ 3 H]-thymidine incorporation; counting cell number over a period of time; detecting, measuring a marker associated with colon cancer (e.g., CEA, CA19-9, and LASA), and/or methods well known in the art for assessing tumor burden.
  • a marker associated with colon cancer e.g., CEA, CA19-9, and LASA
  • the present invention provides methods for treating cancer (particularly breast and colon cancer or other cancer that is associated with aberrantly high TTK activity) which methods generally comprise administering to an individual an agent that reduces TTK activity in an amount sufficient to reduce cancer cell growth to treat the cancer.
  • a substance, or a specific amount of the substance, is effective in treating cancer can be assessed using any of a variety of known diagnostic assays, e.g. in the case of colon cancer, sigmoidoscopy, proctoscopy, rectal examination, colonoscopy with biopsy, contrast radiographic studies, CAT scans, angiography, and detection of a tumor marker associated with colon cancer in the blood of the individual.
  • the substance can be administered systemically or locally. Thus, in some embodiments, the substance is administered locally, and colon cancer growth is decreased at the site of administration. Local administration may be useful in treating, e.g., a solid tumor.
  • the invention features polynucleotides that act as antisense polynucleotides and decrease TTK activity.
  • Antisense TTK polynucleotides generally comprise a polynucleotide of at least about 20 to 3000 nucleotides, usually at least about 20 to 1000 nucleotides and more usually at least about 8 to 50 nucleotides, and preferably about 26, 20, 18, 17, 15, 10 and 8 nucleotides.
  • Exemplary TTK polynucleotides are provided in the Examples and in SEQ ID NO:1-12, although any antisense fragment of SEQ ID NO:13 will suffice.
  • the therapeutic regimen is selected according to the expression profile. For example, if a patient's tumor indicates that the tumor produces aberrantly high level of TTK relative to normal cells, then a drug having efficacy in the treatment of such TTK-expressing tumors is selected for therapy of that patient.
  • compositions of the invention can comprise a therapeutically effective amount of a polypeptide, antibody, polynucleotide (including antisense nucleotides and ribozymes), or small molecule or other compound identified as modulating activity of TTK, preferably decreasing TTK activity.
  • therapeutically effective amount refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels.
  • Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature, and/or in the effect upon tumor load in the subject (e.g., decrease in tumor size or inhibition in tumor growth).
  • an effective dose will generally be from about 0.01 mg/ kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA constructs in the individual to which it is administered.
  • a pharmaceutical composition can also contain a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to a carrier for administration of a therapeutic agent, such as antibodies or a polypeptide, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which can be administered without undue toxicity.
  • Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Such carriers are well known to those of ordinary skill in the art.
  • Pharmaceutically acceptable carriers in therapeutic compositions can include liquids such as water, saline, glycerol and ethanol.
  • the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared.
  • Liposomes are included within the definition of a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable salts can also be present in the pharmaceutical composition, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • compositions for oral administration may be in tablet, capsule, powder or liquid form.
  • a tablet may include a solid carrier such as gelatin or an adjuvant.
  • Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is has suitable pH, isotonicity and stability.
  • Suitable solutions for example, optionally include but are not limited to isotonic vehicles such as sodium chloride, preservatives, stabilizers, buffers, antioxidants and/or other additives as required.
  • Administration of the pharmaceutical is administered in a prophylactically effective amount or a therapeutically effective amount.
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Decisions on dosage etc, can be determined by one skilled in the art based upon the disclosed methods, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.
  • targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands.
  • Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.
  • Targeting can be accomplished by, for example, administering a drug-antibody complex to a subject, wherein the antibody is specific for a cancer-associated antigen, and the drug is one that reduces cancer cell growth.
  • Targeting can be accomplished by coupling (e.g., linking, directly or via a linker molecule, either covalently or non-covalently, so as to form a drug-antibody complex) a drug to an antibody specific for a cancer-associated antigen.
  • Methods of coupling a drug to an antibody are well known in the art and need not be elaborated upon herein.
  • Pharmaceutical agents can also be produced in the target cells by expression from an encoding gene introduced into the cells, e.g., in a viral or liposomal vector.
  • the vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
  • the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
  • a composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • compositions of the invention or identified using the methods of the invention can be administered directly to the subject (e.g., as polynucleotide or polypeptides).
  • Direct delivery of the compositions will generally be accomplished by parenteral injection, e.g., subcutaneously, intraperitoneally, intravenously or intramuscularly, intratumoral or to the interstitial space of a tissue.
  • Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications, needles, and gene guns or hyposprays.
  • Dosage treatment can be a single dose schedule or a multiple dose schedule.
  • the disorder can be amenable to treatment by administration of a therapeutic agent based on the provided polynucleotide, corresponding polypeptide or other corresponding molecule (e.g., antisense, ribozyme, etc.).
  • the dose and the means of administration are determined based on the specific qualities of the therapeutic composition, the condition, age, and weight of the patient, the progression of the disease, and other relevant factors.
  • administration of polynucleotide therapeutic compositions agents of the invention includes local or systemic administration, including injection, oral administration, particle gun or catheterized administration, and topical administration.
  • the therapeutic polynucleotide composition contains an expression construct comprising a promoter operably linked to a polynucleotide of at least 12, 15, 17, 18, 22, 25, 30, or 35 contiguous-nucleotides of the polynucleotide disclosed herein.
  • Various methods can be used to administer the therapeutic composition directly to a specific site in the body.
  • a small metastatic lesion is located and the therapeutic composition injected several times in several different locations within the body of tumor.
  • arteries which serve a tumor are identified, and the therapeutic composition injected into such an artery, in order to deliver the composition directly into the tumor.
  • a tumor that has a necrotic center is aspirated and the composition injected directly into the now empty center of the tumor.
  • the antisense composition is directly administered to the surface of the tumor, for example, by topical application of the composition.
  • X-ray imaging is used to assist in certain of the above delivery methods.
  • Receptor-mediated targeted delivery of therapeutic compositions containing an antisense polynucleotide, subgenomic polynucleotides, or antibodies to specific tissues can also be used.
  • Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad.
  • compositions containing a polynucleotide are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA can also be used during a gene therapy protocol.
  • Factors such as method of action (e.g., for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations which will affect the dosage required for ultimate efficacy of the antisense subgenomic polynucleotides. Where greater expression is desired over a larger area of tissue, larger amounts of antisense subgenomic polynucleotides or the same amounts readministered in a successive protocol of administrations, or several administrations to different adjacent or close tissue portions of, for example, a tumor site, may be required to effect a positive therapeutic outcome. In all cases, routine experimentation in clinical trials will determine specific ranges for optimal therapeutic effect. For polynucleotide related genes encoding polypeptides or proteins with anti-inflammatory activity, suitable use, doses, and administration are described in U.S. Pat. No. 5,654,173.
  • the therapeutic polynucleotides and polypeptides of the present invention can be delivered using gene delivery vehicles.
  • the gene delivery vehicle can be of viral or non-viral origin (see generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995) 1:185; and Kaplitt, Nature Genetics (1994) 6:148).
  • Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or regulated.
  • Viral-based vectors for delivery of a desired polynucleotide and expression in a desired cell are well known in the art.
  • Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5, 219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No.
  • alphavirus-based vectors e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655).
  • AAV adeno-associated virus
  • Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone (see, e.g., Curiel, Hum. Gene Ther. (1992) 3:147); ligand-linked DNA(see, e.g., Wu, J. Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed.
  • Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Pat. No. 5,580,859.
  • Liposomes that can act as gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO 95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional approaches are described in Philip, Mol. Cell Biol. (1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.
  • non-viral delivery suitable for use includes mechanical delivery systems such as the approach described in Woffendin et al., Proc. Natl. Acad. Sci. USA (1994) 91(24): 11581.
  • the coding sequence and the product of expression of such can be delivered through deposition of photopolymerized hydrogel materials or use of ionizing radiation (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033).
  • Other conventional methods for gene delivery that can be used for delivery of the coding sequence include, for example, use of hand-held gene transfer particle gun (see, e.g., U.S. Pat. No. 5,149,655); use of ionizing radiation for activating transferred gene (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033).
  • nucleic acid As an alternative to the use of viral vectors other known methods of introducing nucleic acid into cells includes electroporation, calcium phosphate co-precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer. Gene transfer techniques which selectively target the TTK nucleic acid to the affected cell type are preferred. Examples of this included receptor-mediated gene transfer, in which the nucleic acid is linked to a protein ligand via polylysine, with the ligand being specific for a receptor present on the surface of the target cells.
  • the present invention also provides the use of all or part of the nucleic acid sequence of the TTK promoter and/or enhancer regions in methods of screening for substances which modulate the activity of the promoter and increase or decrease the level of TTK expression.
  • This assay can be performed to identify anti-cancer agents for therapeutic and/or prophylactic purposes.
  • the level of promoter activity i.e., the ability to initiate transcription, is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter.
  • the amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridize with the mRNA and which are labeled or may be used in a specific amplification reaction such as PCR.
  • Use of a reporter gene facilitates determination of promoter activity by reference to protein production.
  • a reporter gene under control of the TTK promoter and/or enhancers may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression.
  • the reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product.
  • a detectable signal preferably a visually detectable signal, such as a coloured product.
  • Many examples are known, including ⁇ -galactosidase and luciferase. ⁇ -galactosidase activity may be assayed by production of blue color on substrate, the assay being by eye or by use of a spectrophotometer to measure absorbance.
  • Fluorescence for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer. Radioactive assays may be used, for instance using choloramphenicol acetyltransferase, which may also be used in non-radioactive assays.
  • the presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof.
  • the binding molecule may be labeled directly or indirectly using any standard technique.
  • the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug.
  • TTK information determined according to the methods of the invention can be used in a system such as that described in U.S. Pat. No. 6,108,635 issued todorf, et al. on Aug. 22, 2000.
  • Such a system can be for collecting the results of medical treatments given to patients in a plurality of locations. See, e.g., U.S. Pat. No. 5,713,350 issued to Yokota, et al. on Feb. 3, 1998.
  • Table 1 (inserted following the last page of the Examples ) provides information about each patient from which the samples were isolated, including: the Patient ID and Path ReportID, numbers assigned to the patient and the pathology reports for identification purposes; the anatomical location of the tumor (AnatomicalLoc); The Primary Tumor Size; the Primary Tumor Grade; the Histopathologic Grade; a description of local sites to which the tumor had invaded (Local Invasion); the presence of lymph node metastases (Lymph Node Metastasis); incidence of lymph node metastases (provided as number of lymph nodes positive for metastasis over the number of lymph nodes examined) (Incidence Lymphnode Metastasis); the Regional Lymphnode Grade; the identification or detection of metastases to sites distant to the tumor and their location (Distant Met & Loc); a description of the distant metastases (Description Distant Met); the grade of distant metastasis (Distant Met Grade); and general comments about the patient or the tumor (Comments).
  • Adenoma was not described in any of the patients; adenoma dysplasia (described as hyperplasia by the pathologist) was described in Patient ID No. 695. Extranodal extensions were described in two patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in seven patients, Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
  • cDNA probes were prepared from total RNA isolated from the patient cells described in Example 1. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
  • RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis.
  • cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA.
  • the second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA.
  • the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA.
  • Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red).
  • Each array used had an identical spatial layout and control spot set.
  • Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32 ⁇ 12 spots for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array. Spotting was accomplished using PCR amplified products from 0.5 kb to 2.0 kb and spotted using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations.
  • the first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides.
  • test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1 .
  • concentrations from 2-600 pg/slide and ratios of 1:1 .
  • two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about 4 duplicate measurements for each clone, two of one color and two of the other, for each sample.
  • the differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient.
  • the arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5 ⁇ SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol.
  • the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5 ⁇ SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1 ⁇ SSC/0.2% SDS; 2) second wash in 0.1 ⁇ SSC/0.2% SDS; and 3) third wash in 0.1 ⁇ SSC.
  • the experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction).
  • the level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation.
  • the data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential.
  • the fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
  • Quantitative PCR of a number of normal tissues and tumor cell lines, particularly colorectal carcinoma cell lines was used to analyze expression of TTK. Quantitative real-time PCR was performed by first isolating RNA from cells using a Roche RNA Isolation kit according to manufacturer's directions. One microgram of RNA was used to synthesize a first-strand cDNA using MMLV reverse transcriptase (Ambion) using the manufacturers buffer and recommended concentrations of oligo dT, nucleotides, and Rnasin. This first-strand cDNA served as a template for quantitative real-time PCR using the Roche light-cycler as recommended in the machine manual.
  • TTK was amplified with the forward primer CGGAATCAAGTCTTCTAGCT (SEQ ID NO: 1) and reverse primer GGTTGCTCAAAAGTTGGTATG (SEQ ID NO:2) PCR product was quantified based on the cycle at which the amplification entered the linear phase of amplification in comparison to an internal standard and using the software supplied by the manufacturer. Small differences in amounts or total template in the first-strand cDNA reaction were eliminated by normalizing to amount of actin amplified in a separate quantitative PCR reaction using the forward primer 5′-CGGGAAATCGTGCGTGACATTAAG-3′ (SEQ ID NO:3) and the reverse primer: 5′-TGATCTCCTTCTGCATCCTGTCGG-3′ (SEQ ID NO:4).
  • FIG. 1 The results for TTK mRNA levels in normal tissues are shown in FIG. 1; the results for TTK mRNA levels in tumor cell lines are shown in FIG. 2.
  • FIG. 2 A brief description of the cell lines analyzed is provided in the table below.
  • TTK was expressed in normal cells (FIG. 1), with thymus and testis identified as the normal tissues that most highly expressed the gene for TTK. Numerous cancer cells, however, displayed a significantly elevated level of TTK expression (FIG. 2) as compared to most wild-type tissues.
  • IGF2 insulin-like growth factor 2
  • TTK serotonine, tyrosine kinase implicated in the cell cycle
  • MAPKAPK2 mitogen-activated protein (MAP) kinase-activated protein kinase
  • MARCKS myristoylated alanine-rich C kinase substrate, which is a substrate of protein kinase C
  • the data for these experiments is presented in graphical form in FIGS. 3 - 6 .
  • the concurrent upregulation suggests that these genes are co-regulated and that patients with an elevated serum level of IGF2 may be candidates for treatment with inhibitors to TTK, MAPKAP kinase 2, MARCKS and/or IGF2.
  • TTK expression in cancerous cells was further analyzed to confirm the role and function of the gene product in tumorgenesis, e.g., in promoting a metastatic phenotype.
  • oligonucleotides complementary to TTK mRNA were designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of TTK.
  • the ability of each designed antisense oligonucleotide to inhibit gene expression was tested through transfection into SW620 colon colorectal carcinoma cells.
  • a carrier molecule preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 ⁇ m PVDF membrane.
  • the antisense or control oligonucleotide was then prepared to a working concentration of 100 ⁇ M in sterile Millipore water.
  • the oligonucleotide was further diluted in OptiMEMTM (Gibco/BRL), in a microfuge tube, to 2 ⁇ M, or approximately 20 ⁇ g oligo/ml of OptiMEMTM.
  • OptiMEMTM Gabco/BRL
  • lipitoid or cholesteroid typically in the amount of about 1.5-2 nmol lipitoid/pg antisense oligonucleotide
  • the diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM.
  • TTK target mRNA
  • a buffer/enzyme mixture prepared by mixing (in the order listed) 2.5 ⁇ l H 2 O, 2.0 ⁇ l 10 ⁇ reaction buffer, 10 ⁇ l oligo dT (20 pmol), 1.0 ⁇ l dNTP mix (10 mM each), 0.5 ⁇ l RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 ⁇ l MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
  • An amplification mixture was prepared by mixing in the following order: 1 ⁇ PCR buffer II, 3 mM MgCl 2 , 140 ⁇ M each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H 2 O to 20 ⁇ l.
  • PCR buffer II is available in 10 ⁇ concentration from Perkin-Elmer, Norwalk, Conn.). In 1 ⁇ concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl.
  • SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA.
  • Oligo 79-5AS GGGACTCTTCCAAATGGGCATGACT (SEQ ID NO:5)
  • Oligo 79-9AS TCCAGTAACTCTTGCGTTCCCATGG (SEQ ID NO:6)
  • Oligo 79-5RC TCAGTACGGGTAAACCTTCTCAGGG (SEQ ID NO:7)
  • Oligo 79-9RC GGTACCCTTGCGTTCTCAATGACCT (SEQ ID NO:8)
  • the antisense oligonucleotides were introduced into a test cell and the effect upon TTK expression of the corresponding gene, as well as the effect induction of the cancerous phenotype, was examined as described below.
  • TTK tumor necrosis factor
  • MDA-MB-231 metastatic breast cancer cell lines
  • SW620 colon colorectal carcinoma cells or 847 human immortal fibroblast cells.
  • Transfection was carried out as described above in Example 4.
  • oligonucleotide was diluted to 2 ⁇ M in OptiMEMTM and added to OptiMEMTM into which the delivery vehicle, lipitoid 116-6 in the case of SW620 cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231 cells, had been diluted.
  • the oligo/ delivery vehicle mixture was then further diluted into medium with serum on the cells.
  • the final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/ ⁇ g oligonucleotide.
  • Cells were transfected overnight at 37° C. and the transfection mixture was replaced with fresh medium the next morning.
  • TTK expression upon colony formation was tested in a soft agar assay.
  • Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 ⁇ l aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for soft agar assay.
  • 2000 cells are plated in 800 ⁇ l 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies are formed in 10 days to 3 weeks. Fields of colonies were counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
  • antisense oligonucleotides to TTK led to decreased colony size and number compared to control reverse control oligonucleotides (79-9RC) or to control oligonucleotides (52-3AS: TAGGTCTTTGGCCGGTGATGGGTCG (SEQ ID NO:9) and 52-3RC: GCTGGGTAGTGGCCGGTTTCTGGAT (SEQ ID NO:10)).
  • the 52-3 antisense oligonucleotide is directed to the hD53 mRNA, and serves as a negative control in the experiment.
  • SW620 cells were transfected as described for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol was followed but cells were left in the presence of 2 ⁇ M drug. Each day, cytotoxicity was monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH was measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH).
  • a positive control using antisense and reverse control oligonucleotides for BCL2 shows that loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
  • Oligo Name AS or RC provides the name of the target gene or name of the oligo, and whether the oligo is antisense (AS) or a reverse control (RC).
  • Oligo Name Antisense (AS) or Reverse Control (RC) Oligo Sequence SEQ ID NO: Chir39-5:AS ACTCATCTGGCTGGGCTATGGTGGT SEQ ID NO:11 Chir39-5:RC TGGTGGTATCGGGTCGGTCTACTCA SEQ ID NO:12 Chir79-9:AS TCCAGTAACTCTTGCGTTCCCATGG SEQ ID NO:6 Chir79-9:RC GGTACCCTTGCGTTCTCAATGACCT SEQ ID NO:8
  • Chiron 79-9 (TTK) antisense does not sensitize the cells to treatment by cisplatin at a detectable level, but leads to increased death compared to control oligo at day 3.
  • TTK was purified as a 6 ⁇ IIis tagged fusion protein using a baculovirus expression system. Essentially 20 ul of 20 nM TTK (100 k Da) in TTK kinase buffer comprising 50 mM Hepes pH 7.4, 2mM MgCl 2 , 10 mM MnCl 2 , 1 mM NaF, 50 mM NaCl, 1 mM DTT and 1 mg/ml BSA was added to 5 ul of a candidate agent diluted in 20% DMSO, 10 ul of a 2.8 uM solution of a biotinylated substrate peptide derived from cdc25, such as Biotin-SGSGSGLYRSPSMPENLNRPR-NH2 (SEQ ID NO:27) or Biotin-GGGGLYRSPSMPENLNRK-OH (SEQ ID NO:28) and 5 ul of 80 nM 33 P- ⁇ ATP
  • Agents modulating TTK activity can be identified by comparing the activity of TTK in the presence of a candidate agent to the activity of TTK in the absence of a candidate agent.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage of the differential expression of these genes in mammalian cancer. Such methods can be useful in determining the ability of a subject to respond to a particular therapy, e.g., as the basis of rational therapy. In addition, the invention provides assays for identifying pharmaceuticals that modulate activity of these genes in cancers in which these genes are involved, as well as methods of inhibiting tumor growth by inhibiting activity of TTK.

Description

    CROSS-REFERENCE TO RELATED APPLICATION
  • This application claims the benefit of U.S. provisional application serial No. 60/289,813, filed Feb. 21, 2001, which application is hereby incorporated by reference.[0001]
  • FIELD OF THE INVENTION
  • The field of the present invention relates to disease diagnosis and treatment of cancer and identification of anti-cancer agents. [0002]
  • BACKGROUND OF THE INVENTION
  • Mitotic checkpoint genes have become widely studied for their roles in development as well as for their potential role in disease such as cancer. The mitotic checkpoint involves a number of different mechanisms to ensure proper cellular division. For example, the spindle assembly checkpoint modulates the timing of anaphase initiation in response to the improper alignment of chromosomes at the metaphase plate. If defects are detected, a signal is transduced to halt further progression of the cell cycle until correct bipolar attachment to the spindle is achieved. Initially identified in budding yeast, several mammalian spindle checkpoint-associated proteins have recently been identified and partially characterized. These proteins associate with all active human centromeres, including neocentromeres, in the early stages of mitosis prior to the commencement of anaphase. The proteins associated with the checkpoint protein complex (BUB1, BUBR1, BUB3, MAD2), the anaphase-promoting complex (Tsg24, p55CDC), and other proteins associated with mitotic checkpoint control (ERK1, 3F3/2 epitope, hZW10), were found to specifically associate with only the active centromere, suggesting that only active centromeres participate in the spindle checkpoint. Saffery R et al., [0003] Hum Genet. 107:376-84 (2000).
  • Tyrosine threonine kinase (TTK), a protein kinase, phosphorylates serine, threonine, and tyrosine hydroxyamino acids (Mills et al,. [0004] Biol. Chem. 267:16000-6 (1992)). The kinases most closely related to TTK include SPK1 serine, threonine, and tyrosine kinase, the Pim1, PBS2, and CDC2 serine/threonine kinases, and the TIK kinase (Mills et al. J. Biol. Chem. 267:16000 -6 (1992)). The nucleotide and amino acid sequences of human TTK are provided at, for example, GenBank Accession No. M86699. Expression of TTK is markedly reduced or absent in resting cells and in tissues with a low proliferative index (Hogg et al. Oncogene 9:89-96 (1994)). TTK mRNA is expressed in human testis, thymus, bone marrow, and other tissues that contain a large number of proliferating cells and is not detected in tissues that contain few or no dividing cells. TTK expression was detected in several rapidly proliferating cells lines, including various cancer cell lines. TTK expression was also detected and in samples tissue samples from two patients with malignant ovarian cancer (Mills et al., ibid.; Schmandt et al. J. Immunol. 152:96-105 (1994)). TTK expression is correlated with cell proliferation, and plays a role in cell cycle control (Hogg et al., ibid.). Very low levels of TTK mRNA and protein are present in starved cells. When cells are induced to enter the cell cycle, levels of TTK mRNA, protein, and kinase activity increase at the G1/S phase of the cell cycle and peak in G2/M. TTK mRNA levels, as well as kinase activity, drop sharply in early G1, whereas protein levels are largely maintained. TTK is a human homologue of the S. cerevesiae kinase mps1 and the S. pombe protein mph1, both of which are involved in cell cycle spindle assembly checkpoint, thus indicating that TTK is a spindle checkpoint gene (see, e.g., Cahill et al. Genomics 58:181-7 (1999).
  • Although mitotic checkpoint impairment has been detected in human cancers (e.g., such impairment is present in about 40% of human lung cancer cell lines) mutations in the MAD mitotic checkpoint genes and the BUB gene family are infrequent. Haruki N et al., [0005] Cancer Lett. 162:201-205 (2001); Mimori K et al., Oncol Rep. 8:39-42 (2001); Cahill et al., ibid.). There is thus a need for identification of mitotic checkpoint genes that have a role in human cancers, as they can serve as informative diagnostic and/or prognostic indicators, and therapeutic targets.
  • SUMMARY OF THE INVENTION
  • The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage of the differential expression of these genes in mammalian cancer. Such methods can be useful in determining the ability of a subject to respond to a particular therapy, e.g., as the basis of rational therapy. In addition, the invention provides assays for identifying pharmaceuticals that modulate activity of these genes in cancers in which these genes are involved, as well as methods of inhibiting tumor growth by inhibiting activity of TTK. [0006]
  • In a first embodiment, the present invention provides a method for identifying TTK levels in a sample of a subject suspected of having cancer (e.g., a lung, colon, prostrate or breast tissue biopsy) comprising quantifying the level of TTK in the sample. The identification of increased levels of TTK in the sample provides an indication of impairment of the cell cycle checkpoint in the sampled cells. [0007]
  • In another embodiment, the invention provides a method for determining the characteristics of a malignant or pre-malignant growth comprising determining (either qualitatively or quantitatively) the level of TTK in the cells of the growth, and comparing levels with known levels in various stages of cancer and/or normal tissue. For example, to determine the characteristics of a particular subject's colon cancer, a sample of the cancer may be removed, the levels of TTK in the cancer determined, and the levels compared to normal tissue and/or levels in various stage colon cancers derived from the same cell type. The levels of TTK identified in the sample can thus be indicative of various characteristics of the malignant or pre-malignant growth, as determined by the characteristics of known tissue and cancers. The TTK levels can be compared directly to the levels in other single samples, or may be compared to a standard that is derived from the data of multiple samples. [0008]
  • In another embodiment, the TTK levels of a sample can be used as one index for determining the appropriate therapeutic intervention for a subject with a malignant or pre-malignant growth. Highly increased levels of TTK, for example, can be indicative of the need for more aggressive therapy, as it is indicative of a later stage cancer. Alternatively, the level of TTK expression may be indicative of the responsiveness of a subject to a particular pharmaceutical, and in particular to a therapeutic intervention that affects the cancer via the mitotic checkpoint. [0009]
  • In another embodiment, the invention features a method for identifying agents for inhibiting growth of a tumor, particular by a breast or colon tumor, by contacting a cell expressing TTK with a candidate agent, and assessing the effect of the agent upon TTK activity. [0010]
  • Accordingly, in one aspect the invention features a method of diagnosing cancer in a subject, the method comprising detection of TTK polynucleotide or polypeptide in a test sample obtained from a subject so as to determine a level of expression of the gene product; and comparing the level of expression of the TTK in the test sample to a level of expression in a normal cell corresponding to the same tissue; wherein detection of an expression level of TTK in the test sample that is significantly increased from the level of expression in a normal cell indicates that the test cell is cancerous. In specific embodiments, the cancer is other than ovarian cancer, with colon cancer and breast cancer being of particular interest. [0011]
  • In another aspect, the invention features a method for determining the prognosis of a cancerous disease in a subject, the method comprising detecting expression of TTK in a test cell from the subject; and comparing a level of expression of TTK in the test cell with a level of TTK expression in a control cell; wherein the level of expression of TTK in the test cell relative to the level of expression in the control cell is indicative of the prognosis of the cancerous disease. For example, where the control cell is a normal cell, an elevated level of TTK expression in the test cell relative to the normal cell is indicative of the continued presence of cancerous cells in the subject and thus a relatively poorer prognosis than where the level of TTK expression in the test cell is at a level comparable to that found in an normal (non-cancer) cell. In specific embodiments, progress of a cancer other than ovarian cancer is of particular interest, especially colon and breast cancer. [0012]
  • In another aspect, the invention features a method for inhibiting growth of a cancerous cell comprising introducing into a cell an antisense polynucleotide for inhibition of TTK expression, wherein inhibition of TTK expression inhibits replication of the cancerous cell. [0013]
  • In still another aspect, the invention features a method for assessing the tumor burden of a subject, the method comprising detecting a level of TTK expression in a test sample from a subject, the test sample suspected of comprising increased TTK expression; wherein detection of the level of TTK expression in the test sample is indicative of the tumor burden in the subject, with an increased level of TTK expression in the test sample relative to a control non-cancer cell indicates the presence of a tumor in the subject. [0014]
  • In yet another aspect, the invention features a method of identifying an agent having anti-TTK activity, the method comprising contacting a cancerous cell displaying elevated expression of TTK with a candidate agent; and determining the effect of the candidate agent on TTK activity; wherein a decrease in TTK activity indicates that the agent has anti-TTK activity. In specific embodiments, TTK activity is detected by detecting TTK expression or by detecting a biological activity of TTK [0015]
  • In yet another aspect, the invention features an assay for identifying a candidate agent that inhibits growth of a cancerous cell, comprising contacting a cell expressing TTK polypeptide with a candidate agent; and detecting activity of the TTK polypeptide, comparing the activity of the TTK polypeptide in the cell in the presence of the candidate agent to activity of a TTK polypeptide in a cell in the absence of the candidate agent; wherein reduction of TTK activity in the presence of the candidate agent relative to TTK activity in the absence of the candidate agent indicates that the candidate agent reduces TTK activity and inhibits growth of a cancerous cell. [0016]
  • A primary object of the invention is to exploit TTK as a therapeutic target, e.g. by identifying candidate agents that modulate, usually that decrease, TTK activity in a target cell in order to, for example, inhibit cell growth. [0017]
  • An object of the present invention is to inhibit tumor growth by inhibition of activity of a mitotic checkpoint gene product, particularly though inhibition of TTK activity in the target tumor cell. [0018]
  • Another object of the invention is to facilitate rational cancer therapy. For example, where the cancer in the subject is associated with increased TTK activity levels, a therapeutic agent is selected accordingly so as to facilitate reduction of TTK activity levels. [0019]
  • Another object of the present invention is to design clinical trials based on levels of TTK expression in a cancer, and more particularly to design clinical trials based on TTK expression in combination with other patient attributes. [0020]
  • Yet another object of the invention is to identify the association of TTK expression and intervention attributes that yield efficacious changes in selected disease progression measures. [0021]
  • An advantage of the invention is the ability to project disease progression based on expression of TTK in a malignant or pre-malignant growth. [0022]
  • Another advantage of the present invention is that it allows a more systematic approach for intervention of a cancerous disease based upon objective indicia. [0023]
  • These and other objects, advantages, and features of the invention will become apparent to those persons skilled in the art upon reading the details of the methods as more fully described below. [0024]
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 is a bar graph illustrating expression of TTK in various normal tissue types as detected by PCR. [0025]
  • FIG. 2 is a bar graph illustrating expression of TTK in various tumor cell lines as detected by PCR. [0026]
  • FIGS. [0027] 3-6 are graphs illustrating expression profiles for IGF2, MAPKAPK2, TTK, and MARCKS in patients with colorectal carcinoma.
  • FIGS. 7 and 8 are graphs illustrating growth suppression of MDA-MB-231 cells following antisense suppression of TTK expression. [0028]
  • FIG. 9 is a graph illustrating growth suppression of SW620 cells following antisense suppression of TTK expression. [0029]
  • FIG. 10 is a graph illustrating suppression of colony formation of SW620 cells in soft agar following antisense suppression of TTK expression. [0030]
  • FIG. 11 is a graph illustrating that antisense suppression of TTK has no detectable effect on normal immortal fibroblasts. [0031]
  • FIG. 12 is a bar graph illustrating induction of cell death upon depletion of TTK from SW620 cells.[0032]
  • DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
  • Before the present invention is described, it is to be understood that this invention is not limited to particular methodologies described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. [0033]
  • Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. [0034]
  • Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. [0035]
  • It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the agent” includes reference to one or more agents and equivalents thereof known to those skilled in the art, and so forth. [0036]
  • The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. [0037]
  • DEFINITIONS
  • The terms “polynucleotide” and “nucleic acid”, used interchangeably herein, refer to a polymeric forms of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, these terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa et al. (1999) [0038] Cell 99(7):691-702). The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucl. Acids Res. 24:2318-2323. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
  • The terms “polypeptide” and “protein”, used interchangeably herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like. [0039]
  • As used herein “TTK polynucleotide” and “TTK polypeptide” encompass polynucleotides and polypeptides having sequence similarity or sequence identity to the human TTK (having GenBank accession number M86699; SEQ ID NO:13 and 14), or the [0040] S. cerevesiae kinase mps1 gene and gene products (SEQ ID NO:29 and 30), the S. pombe protein mph1 gene and gene products (SEQ ID NO:31 and 32), and other genes and gene products related to TTK, such as SPK1 (SEQ ID NO:15 and 16), Pim1 (SEQ ID NO:17 and 18), PBS2 (SEQ ID NO:19 and 20), CDC2 (SEQ ID NO:21 and 22), and TIK (SEQ ID NO:23 and 24) of at least about 65%, preferably at least about 80%, more preferably at least about 85%, and can be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Sequence similarity and sequence identity are calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. In general, percent sequence identity is calculated by counting the number of residue matches (e.g., nucleotide residue or amino acid residue) between the query and test sequence and dividing total number of matches by the number of residues of the individual sequences found in the region of strongest alignment. Thus, where 10 residues of an 11 residue query sequence matches a test sequence, the percent identity above would be 10 divided by 11, or approximately, 90.9%. Algorithms for computer-based sequence analysis are known in the art, such as BLAST (see, e.g., Altschul et al., J. Mol. Biol., 215:403-10 (1990)), particularly the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). For the purposes of this invention, a preferred method of calculating percent identity is the Smith-Waterman algorithm, using the following. Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1. The human TTK cDNA is represented by the polynucleotide sequence of SEQ ID NO:13 and the human TTK polypeptide is represented by the sequence of SEQ ID NO:14.
  • “Antisense polynucleotide” or “antisense oligonucleotide” are used interchangeably herein to mean an unmodified or modified nucleic acid having a nucleotide sequence complementary to a given polynucleotide sequence (e.g., a polynucleotide sequence encoding TTK) including polynucleotide sequences associated with the transcription or translation of the given polynucleotide sequence (e.g., a promoter of a polynucleotide encoding TTK), where the antisense polynucleotide is capable of hybridizing to a TTK-encoding polynucleotide sequence. Of particular interest are antisense polynucleotides capable of inhibiting transcription and/or translation of a TTK-encoding polynucleotide either in vitro or in vivo. [0041]
  • The term “cDNA” as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons (e.g., sequences encoding open reading frames of the encoded polypeptide) and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns removed by nuclear RNA splicing to create a continuous open reading frame encoding TTK. [0042]
  • A “variant” as used in the context of a “variant polypeptide” refers to an amino acid sequence that is altered by one or more amino acids relative to a reference amino acid sequence. The variant can have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have “nonconservative” changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software. [0043]
  • A “deletion” is defined as a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent as compared to reference amino acid sequence or nucleotide sequence. Deletions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length. [0044]
  • An “insertion” or “addition” is that change in an amino acid or nucleotide sequence which has resulted in the addition of one or more amino acid or nucleotide residues, respectively, as compared to a reference amino acid sequence or nucleotide sequence. Insertions or additions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length. [0045]
  • A “substitution” results from the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively, as compared to a reference amino acid sequence or nucleotide sequence. Substitutions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length. [0046]
  • The terms “single nucleotide polymorphism” and “SNP” refer to polymorphisms of a single base change relative to a reference sequence. [0047]
  • The term “biologically active” refers to gene product, usually a polypeptide, having structural, regulatory, or biochemical functions of a naturally occurring gene product, e.g., protein. “Immunologically active” defines the capability of the natural, recombinant, or synthetic polypeptide, or any oligopeptide thereof, to elicit a specific immune response in appropriate animals or cells and to bind with specific antibodies. [0048]
  • The term “derivative” as used herein refers to the chemical modification of a nucleic acid or amino acid sequence relative to a reference nucleic acid or amino acid sequence. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group. A nucleic acid derivative generally encodes a polypeptide which retains essential biological characteristics of the polypeptide encoded by the reference nucleic acid (e.g., the “parent” molecule). [0049]
  • As used herein the term “isolated” is meant to describe a compound of interest (e.g., either a polynucleotide or a polypeptide) that is in an environment different from that in which the compound naturally occurs. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified. [0050]
  • As used herein, the term “substantially purified” refers to a compound (e.g., either a polynucleotide or a polypeptide) that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated. [0051]
  • “Stringency” typically occurs in a range from about Tm −5° C. (5° C. below the Tm of the probe or antibody) to about 20° C. to 25° C. below Tm. As will be understood by those of skill in the art, a stringency hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences. [0052]
  • The term “hybridization” as used herein shall include “any process by which a strand of nucleic acid joins with a complementary strand through base pairing” (Coombs, Dictionary of Biotechnology, Stockton Press, New York N.Y. (1994)). Amplification as carried out in the polymerase chain reaction technologies is described in Dieffenbach et al., PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. (1995). [0053]
  • The term “transformation” as used herein refers to a permanent or transient genetic change, induced in a cell following incorporation of new DNA (i.e., DNA exogenous to the cell). Genetic change can be accomplished either by incorporation of the new DNA into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element. Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell. [0054]
  • The term “construct” as used herein refers to a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences. [0055]
  • As used herein, the term “differentially expressed” generally refers to a polynucleotide that is expressed at levels in a test cell that differ significantly from levels in a reference cell, e.g., mRNA is found at levels at least about 25%, at least about 50% to about 75%, at least about 90% increased or decreased, generally at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or at least about 50-fold or more increased or decreased in a cancerous cell when compared with a cell of the same type that is not cancerous. The comparison can be made between two tissues, for example, if one is using in situ hybridization or another assay method that allows some degree of discrimination among cell types in the tissue. The comparison may also be made between cells removed from their tissue source. “Differential expression” refers to both quantitative, as well as qualitative, differences in the genes' temporal and/or cellular expression patterns among, for example, normal and neoplastic tumor cells, and/or among tumor cells which have undergone different tumor progression events. [0056]
  • The terms “correspond to” or “represents” as used in, for example, the phrase “polynucleotide corresponds to a differentially expressed gene” are used to refer to the relationship between a given polynucleotide and the gene from which the polynucleotide sequence is derived (e.g., a polynucleotide that is derived from a coding region of the gene, a splice variant of the gene, an exon, and the like) or to which the polynucleotide hybridizes to under stringer conditions. [0057]
  • “Differentially expressed polynucleotide” as used herein refers to a nucleic acid molecule (RNA or DNA) comprising a sequence that represents or corresponds to a differentially expressed gene, e.g., the differentially expressed polynucleotide comprises a sequence (e.g., an open reading frame encoding a gene product; a non-coding sequence) that uniquely identifies a differentially expressed gene so that detection of the differentially expressed polynucleotide in a sample is correlated with the presence of a differentially expressed gene in a sample. “Differentially expressed polynucleotides” is also meant to encompass fragments of the disclosed polynucleotides, e.g., fragments retaining biological activity, as well as nucleic acids homologous, substantially similar, or substantially identical (e.g., having about 90% sequence identity) to the disclosed polynucleotides. [0058]
  • “Diagnosis” as used herein generally includes determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy), and therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy). [0059]
  • As used herein, the term “a polypeptide associated with cancer” (e.g., as in polypeptide associated with colon cancer) refers to a polypeptide that is present at relatively higher or lower levels in a cancer cell relative to a normal cell of the same type. [0060]
  • The term “biological sample” encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples. [0061]
  • The terms “treatment”, “treating”, “treat” and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or relieving the disease symptom, i.e., causing regression of the disease or symptom. Thus “treatment of cancer” thus encompasses one or more of inhibition of cellular proliferation, inhibition of metastasis, and the like. [0062]
  • The terms “individual,” “subject,” “host,” and “patient,” used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on. [0063]
  • The phrase “specific binding pair” as used herein comprises a specific binding member and a binding partner which have a particular specificity for each other and which bind to each other in preference to other molecules under stringent conditions. Examples of specific binding pairs are antigens and antibodies, molecules and receptors and complementary nucleotide sequences. Other examples of binding pairs will be apparent to one skilled in the art upon reading the present disclosure. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a larger molecule. In embodiments in which the specific binding pair are nucleic acid sequences, they are preferably between 10 to 200 nucleotides long, more preferably greater than 15 to 100 nucleotides long. [0064]
  • By “antibody” is meant an immunoglobulin protein which is capable of binding an antigen. Antibody as used herein is meant to include the entire antibody as well as any antibody fragments (e.g., F(ab′)[0065] 2, Fab′, Fab, Fv) capable of binding the epitope, antigen, or antigenic fragment of interest.
  • Antibodies of the invention are immunoreactive or immunospecific for and therefore specifically and selectively bind to a protein of interest, e.g., human TTK protein. Antibodies which are immunoreactive and immunospecific for human TTK are preferred. Antibodies for human TTK are preferably immunospecific—i.e., not substantially cross-reactive with related materials, although they may recognize TTK homologs across species. The term “antibody” encompasses all types of antibodies (e.g., monoclonal and polyclonal). [0066]
  • By “binds specifically” is meant high avidity and/or high affinity binding of an antibody to a specific polypeptide, e.g., epitope of a TTK protein. Antibody binding to its epitope on this specific polypeptide is stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest. Antibodies which bind specifically to a polypeptide of interest may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to the compound or polypeptide of interest, e.g., by use of appropriate controls. [0067]
  • The terms “cancer”, “neoplasm”, “tumor”, and the like are used interchangeably herein to refer to cells which exhibit relatively autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In general, cells of interest for detection or treatment in the present application include pre-malignant (e.g., benign hyperplasiac), malignant, metastatic, and non-metastatic cells. [0068]
  • “TTK activity” as used herein refers to activity of the TTK polypeptide in phosphorylation of a recipient substrate. [0069]
  • “Modulation of TTK activity” as used herein refers to an increase or decrease in TTK activity that can be a result of, for example, interaction of an agent with a TTK polypeptide (e.g., reversible or irreversible binding of an inhibitory agent so as to interfere with TTK polypeptide interaction with a donor molecule or a recipient (acceptor) molecule in the phosphorylation activity of TTK), inhibition of TTK transcription and/or translation (e.g., through antisense interaction with the TTK gene or TTK transcript, through modulation of transcription factors that facilitate TTK expression), and the like. Modulation of TTK activity that results in a decrease of TTK activity is of particular interest in the invention. In this context, TTK activity can be decreased by an inhibitory agent at least 10%, 25%, 50%, 75%, 85%, 90%, up to 100% relative to TTK activity in the absence of an agent. TTK activity can be assessed by assaying enzymatic activity, by assessing TTK polypeptide levels, or by assessing TTK transcription levels. Comparisons of TTK activity can also be accomplished by comparing TTK activity assessed (either qualitatively or quantitatively) in a test sample to a standard TTK activity (e.g., a level of TTK activity in the absence of an inhibitory agent or agonist, that is associated with a normal cell, a level of TTK activity of a cancerous cell of a selected tissue type, and the like). [0070]
  • Overview [0071]
  • Human TTK is a mitotic checkpoint gene which encodes an 857 amino acid protein that exhibits activity of a mixed specificity (tyr/thr) kinase. TTK is expressed in rapidly proliferating tissues such as testis and thymus. See, e.g., Mills G B et al., [0072] J Biol Chem. 267:16000-6 (1992). The present invention is based upon the finding that TTK is differentially expressed in colon tumor cells relative to normal colon cells as detected by microarray analysis. Differential expression was confirmed in cell lines derived from various forms of cancer, indicating that the involvement of TTK in cancer as a more general mechanism. In addition, disruption of TTK function using antisense oligonucleotides to “knock-out” TTK message decreased proliferation, inhibited anchorage independent growth, and induced apoptosis of cancer cell lines, including a metastatic breast cancer cell line (MDA-MB-213) and a colorectal carcinoma cell line (SW620). These data indicate that TTK can be a therapeutic target for chemotherapy in cancers in which TTK is overexpressed.
  • The identification of the association of TTK with cancer, and the confirmation that inhibition of TTK activity (e.g., by reducing TTK expression) serves as the basis for the materials and methods of the invention, such as are disclosed and discussed herein, for use in, for example, diagnosing cancer of a patient, particularly a cancer that is susceptible to treatment by decreasing activity of TTK. The invention also provides for planning and selection of appropriate therapeutic and/or prophylactic treatment, permitting streamlining of treatment by targeting those most likely to benefit. The invention also provides for treatment of a cancer associated with aberrant TTK levels (e.g., associated with overexpression or overproduction of TTK), e.g. by inhibition of gene product production (e.g., decreasing levels of transcription and/or translation), by decreasing TTK activity (e.g., by decreasing TTK gene product production (e.g., at the level of transcription or translation) and/or by reducing one or more of TTK's kinase activities). [0073]
  • Various aspects of the invention will now be described in more detail. [0074]
  • Diagnostic Methods [0075]
  • In one aspect the invention is based on the discovery that TTK activity is present at higher levels in cancerous cells (particularly in colon cancer and breast cancer) than in normal cells of the same cell type. This discovery serves as the basis for identification of cancerous cells, as well as identification of tumors that are susceptible to therapy by inhibiting activity of TTK, e.g., by inhibiting TTK expression at the level of transcription or translation or both, by inhibiting TTK activity, and the like. [0076]
  • TTK gene products e.g. TTK encoding mRNA or TTK polypeptides are of particular interest as markers (e.g., in bodily fluids (such as blood) or in tissues) to detect the earliest changes along the carcinogenesis pathway (e.g., to differentiate cancerous tissue from non-cancerous tissue) and/or to monitor the efficacy of various therapies and preventive interventions. For example, a relatively increased level of expression of TTK compared to normal cells or tissues of the same type can be indicative of a poorer prognosis, and therefore warrant more aggressive therapy (e.g., chemo- or radio-therapy) for a patient or vice versa. The correlation of surrogate tumor specific features with response to treatment and outcome in patients can define prognostic indicators that allow the design of tailored therapy based on the molecular profile of the tumor. These therapies include antibody targeting, antagonists (e.g., small molecules), and gene therapy. Determining TTK expression and comparison of a patient's profile with known expression in normal tissue and variants of the disease allows a determination of the best possible treatment for a patient, both in terms of specificity of treatment and in terms of comfort level of the patient. Surrogate tumor markers, such as polynucleotide expression, can also be used to better classify, and thus diagnose and treat, different forms and disease states of cancer. Two classifications widely used in oncology that can benefit from identification of TTK expression levels are staging of the cancerous disorder, and grading the nature of the cancerous tissue. [0077]
  • TTK polynucleotides, as well as their encoded gene products, can be useful to monitor patients having or susceptible to cancer to detect potentially malignant events at a molecular level before they are detectable at a gross morphological level. In addition, detection of TTK gene products can be useful as therametrics, e.g., to assess the effectiveness of therapy by using the polynucleotides or their encoded gene products, to assess, for example, tumor burden in the patient before, during, and after therapy. [0078]
  • Furthermore, a polynucleotide identified as corresponding to a gene that is differentially expressed in, and thus is important for, one type of cancer can also have implications for development or risk of development of other types of cancer, e.g., where a polynucleotide represents a gene differentially expressed across various cancer types. Thus, for example, expression of a polynucleotide corresponding to a gene that has clinical implications for metastatic colon cancer can also have clinical implications for stomach cancer or endometrial cancer. [0079]
  • In making a diagnosis, prognosis, risk assessment, or measurement of tumor burden based on the enzymatic activity of TTK or the expression levels of TTK polypeptide or TTK encoding polynucleotides, activity or expression levels may be compared to those of suitable cancerous or non-cancerous control samples. For example, a diagnosis of cancer can be made if TTK activity is increased at by 25%, 50%, 75%, 90%, up to 100%, or, alternatively by 5-fold, 10-fold, 50-fold, or more than 100-fold relative to a normal non-cancerous cell of the same tissue type. [0080]
  • Other gene products that are differentially expressed in cancerous cells relative to, for example, non-cancer cells of between cancer cells of differing malignant potential (e.g., non-malignant tumor cells versus cells of high potential malignancy) can also be assayed in addition to TTK for differential expression in a test cell. Such exemplary gene products include, but are not necessarily limited to MAPKAP kinase 2 (SEQ ID. No. 33 and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and 38). [0081]
  • Staging. Staging is a process used by physicians to describe how advanced the cancerous state is in a patient. Staging assists the physician in determining a prognosis, planning treatment and evaluating the results of such treatment. Staging systems vary with the types of cancer, but generally involve the following “TNM” system: the type of tumor, indicated by T; whether the cancer has metastasized to nearby lymph nodes, indicated by N; and whether the cancer has metastasized to more distant parts of the body, indicated by M. Generally, if a cancer is only detectable in the area of the primary lesion without having spread to any lymph nodes it is called Stage I. If it has spread only to the closest lymph nodes, it is called Stage II. In Stage II, the cancer has generally spread to the lymph nodes in near proximity to the site of the primary lesion. Cancers that have spread to a distant part of the body, such as the liver, bone, brain or other site, are Stage IV, the most advanced stage. [0082]
  • The differential expression level of TTK can facilitate fine-tuning of the staging process by identifying markers for the aggressiveness of a cancer, e.g. the metastatic potential, as well as the presence in different areas of the body. Thus, a Stage II cancer with a large differential level of expression of TTK can signify a cancer with a high metastatic potential and can be used to change a borderline Stage II tumor to a Stage III tumor, justifying more aggressive therapy. [0083]
  • Grading of cancers. Grade is a term used to describe how closely a tumor resembles normal tissue of its same type. The microscopic appearance of a tumor is used to identify tumor grade based on parameters such as cell morphology, cellular organization, and other markers of differentiation. As a general rule, the grade of a tumor corresponds to its rate of growth or aggressiveness, with undifferentiated or high-grade tumors generally being more aggressive than well differentiated or low-grade tumors. The following guidelines are generally used for grading tumors: 1) GX Grade cannot be assessed; 2) G1 Well differentiated; G2 Moderately well differentiated; 3) G3 Poorly differentiated; 4) G4 Undifferentiated. TTK activity levels (e.g., expression levels) can be especially valuable in determining the grade of the tumor, as they not only can aid in determining the differentiation status of the cells of a tumor, they can also identify factors other than differentiation that are valuable in determining the aggressiveness of a tumor, such as metastatic potential. [0084]
  • Detection of colon cancer. Polynucleotides and polypeptides corresponding to TTK can be used to detect colon cancer in a subject. Colorectal cancer is one of the most common neoplasms in humans and perhaps the most frequent form of hereditary neoplasia. Prevention and early detection are key factors in controlling and curing colorectal cancer. Colorectal cancer begins as polyps, which are small, benign growths of cells that form on the inner lining of the colon. Over a period of several years, some of these polyps accumulate additional mutations and become cancerous. Multiple familial colorectal cancer disorders have been identified, which are summarized as follows: 1) Familial adenomatous polyposis (FAP); 2) Gardner's syndrome; 3) Hereditary nonpolyposis colon cancer (HNPCC); and 4) Familial colorectal cancer in Ashkenazi Jews. The expression of appropriate polypeptide andpolynucleotides can be used in the diagnosis, prognosis and management of colorectal cancer. Detection of colon cancer can be determined using expression levels of TTK alone or in combination with the levels of expression of other genes differentially expressed in colon cancer. Determination of the aggressive nature and/or the metastatic potential of a colon cancer can be determined by comparing levels of TTK with a level associated with a normal cell, and comparing total levels of another sequence known to be differentially expressed, or otherwise be a marker of, cancerous tissue, e.g., expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al., [0085] Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957; Bodmer W, et al., Nat Genet. (1994) 4(3):217; Fearon E R, Ann N Y Acad Sci. (1995) 768:101)or MAPKAP kinase 2 (SEQ ID. No. 33 and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and 38). For example, development of colon cancer can be detected by examining the level of expression of a gene corresponding to a polynucleotides described herein to the levels of oncogenes (e.g. ras) or tumor suppressor genes (e.g. FAP or p53). Thus expression of specific marker polynucleotides can be used to discriminate between normal and cancerous colon tissue, to discriminate between colon cancers with different cells of origin, to discriminate between colon cancers with different potential metastatic rates, etc. For a review of markers of cancer, see, e.g., Hanahan et al. (2000) Cell 100:57-70.
  • Detection of breast cancer. The majority of breast cancers are adenocarcinomas subtypes, which can be summarized as follows: 1) ductal carcinoma in situ (DCIS), including comedocarcinoma; 2) infiltrating (or invasive) ductal carcinoma (IDC); 3) lobular carcinoma in situ (LCIS); 4) infiltrating (or invasive) lobular carcinoma (ILC); 5) inflammatory breast cancer; 6) medullary carcinoma; 7) mucinous carcinoma; 8) Paget's disease of the nipple; 9) Phyllodes tumor; and 10) tubular carcinoma. [0086]
  • The expression levels of TTK can be used in the diagnosis and management of breast cancer, as well as to distinguish between types of breast cancer. Detection of breast cancer can be determined using expression levels of TTK, either alone or in combination with expression of other gene known to be differentially expressed in breast cancer. Determination of the aggressive nature and/or the metastatic potential of a breast cancer can also be determined by comparing levels of TTK and comparing levels of another sequence known to vary in cancerous tissue, e.g. ER expression. In addition, development of breast cancer can be detected by examining the ratio of expression of TTK to the levels of steroid hormones (e.g., testosterone or estrogen) or to other hormones (e.g., growth hormone, insulin). Thus expression of specific marker polynucleotides and polypeptides can be used to discriminate between normal and cancerous breast tissue, to discriminate between breast cancers with different cells of origin, to discriminate between breast cancers with different potential metastatic rates, etc. [0087]
  • Detection Methods [0088]
  • A number of methods are known in the art for analyzing biological samples from individuals to determine whether the individual has increased expression of a TTK gene product (e.g., RNA or protein) by detecting the TTK gene product in a biological sample from that subject. As discussed above, the purpose of such analysis may be used for diagnosis, to detect the presence of an existing cancer, to help identify the type of cancer, to assist a physician in determining the severity or likely course of the cancer, and/or to optimize treatment of it. In specific non-limiting embodiments, the methods are useful for detecting cancer cells, facilitating diagnosis of cancer and the severity of a cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy (e.g., by providing a measure of therapeutic effect through, for example, assessing tumor burden during or following a chemotherapeutic regimen). In additional embodiments, the methods are useful for classification or stratification of cancer cells, e.g., for the purpose of selecting patients to be included in a clinical trial population, for selecting an appropriate therapy (e.g., selecting therapy according to an expression profile of the cancerous cells), and the like. [0089]
  • Kits [0090]
  • The detection methods can be provided as part of a kit. Thus, the invention further provides kits for detecting the presence and/or a level of TTK activity e.g., by detection of a TTK-encoding mRNA and/or a polypeptide encoded thereby or by measuring TTK activity, in a biological sample. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals. The kits of the invention for detecting TTK polypeptide that is differentially expressed in cancer cells comprise a moiety that specifically binds the polypeptide, which may be a specific antibody. The kits of the invention for detecting a TTK-encoding polynucleotide that is differentially expressed in cancer cells comprise a moiety that specifically hybridizes to such a polynucleotide such as a primer. The kits of the invention for detecting TTK activity comprise a recipient substrate capable of being phosphorylated by TTK, and a labeled donor substrate. The kits may optionally provide additional components that are useful in the procedure, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detection, control samples, standards, instructions, and interpretive information. [0091]
  • Screening for TTK Nucleic Acid or Polypeptide [0092]
  • Methods for detection of TTK activity include screening for the presence of TTK nucleic acid sequences representing an expressed TTK gene or alleles or variants thereof, and detecting the TTK polypeptide. The methods make use of biological samples from individuals that are suspected of contain the nucleic acid sequences or polypeptide. Examples of biological samples include blood, plasma, serum, tissue samples, tumor samples, saliva and urine. [0093]
  • Exemplary approaches for detecting TTK nucleic acid or polypeptides include: (a) determining the presence of the polypeptide encoded by the TTK gene; (b) using a specific binding member capable of binding to a TTK nucleic acid sequence (e.g., a known complementary sequence), the specific binding member comprising a nucleic acid that hybridizes with the TTK sequence under stringent conditions (c) using a substance comprising an antibody domain with specificity for a TTK nucleic acid sequence or the polypeptide encoded by it, the specific binding member being labeled to allow detection of the specific binding member to its binding partner is detectable; (d) using PCR involving one or more primers to determine relative levels of TTK in a sample from a patient; and (e) using an assay for TTK activity, e.g., phosphorylation of a TTK substrate. [0094]
  • The determination of TTK levels can include both levels of normal TTK and/or variant forms of TTK. A variant form of the gene may contain one or more insertions, deletions, substitutions and/or additions of one or more nucleotides compared with the wild-type sequence which may or may not alter the gene function. Differences at the nucleic acid level are not necessarily reflected by a difference in the amino acid sequence of the encoded polypeptide due to the degeneracy of the genetic code. However, a mutation or other difference in a gene may result in a frame-shift or stop codon, which could seriously affect the nature of the polypeptide produced (if any), or a point mutation or gross mutational change to the encoded polypeptide, including insertion, deletion, substitution and/or addition of one or more amino acids or regions in the polypeptide. [0095]
  • A mutation in a promoter sequence or other regulatory region may alter (e.g., reduce or enhance) expression from the gene or affect the processing or stability of the mRNA transcript. [0096]
  • There are various methods for detecting a particular nucleic acid sequence in a test sample. Tests may be carried out on preparations containing mRNA or cDNA generated from isolated mRNA in a manner that reflects the relative levels of mRNA transcripts in the sample. Levels of RNA can be determined specific amplification reaction such as PCR using one or more pairs of primers may be employed to amplify a region of the nucleic acid, and preferably a region with less homology to other genes. Nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis. [0097]
  • Nucleic acid may be screened using a TTK-specific probe. Such a probe corresponds in sequence to a region of the TTK gene, or its complement. Under stringent conditions, specific hybridization of such a probe to test nucleic acid is indicative of the presence of the TTK nucleic acid in a sample. For efficient screening purposes, more than one probe may be used on the same test sample. The probe may contain as few as 15, 20, 50 or 100 nucleotides of the TTK gene of SEQ ID. No. 13 or may be as long as or 500, 1 kb or as much as 3.8 kb or longer in length. [0098]
  • Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample. Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art. The PCR product may for instance be treated in a way that enables one to display the mutation or polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected. This can be done simultaneous to or sequentially to determining the level of a normal TTK sequence, e.g., to determine the combinatory levels of total TTK. [0099]
  • The presence of absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA. The presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene or a variant or allele is digested with the same enzyme or enzymes. [0100]
  • A test sample of nucleic acid may be provided for example by extracting nucleic acid from cells, e.g., cells from a tumor biopsy. [0101]
  • Detection of TTK Polypeptides [0102]
  • There are various methods for determining the presence or absence in a test sample of a TTK polypeptide. A sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies), specific for wild-type TTK and/or one or more particular variants (e.g., allelic variants) of the TTK polypeptide. In such cases, the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding. Where a panel of antibodies is used, different reporting labels may be employed for each antibody so that binding of each can be determined. In addition to detection of TTK polypeptides using anti-TTK antibodies, TTK polypeptide can also be identified using TTK-specific activity assays. [0103]
  • Arrays [0104]
  • Binding agents (such as antibodies or nucleic acid sequences) can also be immobilized in small, discrete locations and/or as arrays on solid supports or on diagnostic chips. These approaches can be particularly valuable as they can provide great sensitivity, particularly through the use of fluorescently labeled reagents, require only very small amounts of biological sample from individuals being tested and allow a variety of separate assays can be carried out simultaneously. This latter advantage can be useful as it provides an assay for different proteins (e.g., an oncogene or tumor suppressor) in tandem with the assay for TTK. Thus, in a further aspect, the present invention provides a support or diagnostic chip having immobilized thereon one or more binding agents capable of specifically binding TTK nucleic acid or polypeptides, optionally in combination with other reagents needed to carrying out an assay. [0105]
  • Methods for Expression of TTK Polypeptide [0106]
  • The full-length or partial polypeptides encoded by TTK may be expressed in any expression system, including, for example, bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells for which are described in U.S. Pat. No. 5,654,173. Appropriate polynucleotide constructs are purified using standard recombinant DNA techniques as described in, for example, Sambrook et al., (1989) [0107] Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), and under current regulations described in United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.
  • Bacteria. Expression systems in bacteria include those described in Chang et al., [0108] Nature (1978) 275:615, Goeddel et al., Nature (1979) 281:544, Goeddel et al., Nucleic Acids Res. (1980) 8:4057; EP 0 036,776, U.S. Pat. No. 4,551,433, DeBoer et al., Proc. Natl. Acad. Sci. (USA) (1983) 80:21-25, and Siebenlist et al., Cell (1980) 20:269.
  • Yeast. Expression systems in yeast include those described in Hinnen et al., [0109] Proc. Natl. Acad. Sci. (USA) (1978) 75:1929; Ito et al., J. Bacteriol. (1983) 153:163; Kurtz et al., Mol. Cell. Biol. (1986) 6:142; Kunze et al., J. Basic Microbiol. (1985) 25:141; Gleeson et al., J. Gen. Microbiol. (1986) 132:3459, Roggenkamp et al., Mol. Gen. Genet. (1986) 202:302) Das et al., J. Bacteriol. (1984) 158:1165; De Louvencourt et al., J. Bacteriol. (1983) 154:737, Van den Berg et al., Bio/Technology (1990) 8:135; Kunze et al., J. Basic Microbiol. (1985) 25:141; Cregg et al., Mol. Cell. Biol. (1985) 5:3376, U.S. Pat. Nos. 4,837,148 and 4,929,555; Beach and Nurse, Nature (1981) 300:706; Davidow et al., Curr. Genet. (1985) 10:380, Gaillardin et al., Curr. Genet. (1985) 10:49, Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112:284-289; Tilburn et al., Gene (1983) 26:205-221, Yelton et al., Proc. Natl. Acad. Sci. (USA) (1984) 81:1470-1474, Kelly and Hynes, EMBO J. (1985) 4:475479; EP 0 244,234, and WO 91/00357.
  • Insect Cells. Expression of heterologous genes in insects is accomplished as described in U.S. Pat. No. 4,745,051, Friesen et al. (1986) “The Regulation of Baculovirus Gene Expression” in: The Molecular Biology Of Baculoviruses (W. Doerfler, ed.), [0110] EP 0 127,839, EP 0 155,476, and Vlak et al., J. Gen. Virol. (1988) 69:765-776, Miller et al., Ann. Rev. Microbiol. (1988) 42:177, Carbonell et al., Gene (1988) 73:409, Maeda et al., Nature (1985) 315:592-594, Lebacq-Verheyden et al., Mol. Cell Biol. (1988) 8:3129; Smith et al., Proc. Natl. Acad. Sci. (USA) (1985) 82:8404, Miyajima et al., Gene (1987) 58:273; and Martin et al., DNA (1988) 7:99. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts are described in Luckow et al., Bio/Technology (1988) 6:47-55, Miller et al., Generic Engineering (Setlow, J. K. et al. eds.), Vol. 8 (Plenum Publishing, 1986), pp. 277-279, and Maeda et al., Nature, (1985) 315:592-594.
  • Mammalian Cells. Mammalian expression is accomplished as described in Dijkema et al., [0111] EMBO J. (1985) 4:761, Gorman et al., Proc. Natl. Acad. Sci. (USA) (1982) 79:6777, Boshart et al., Cell (1985) 41:521 and U.S. Pat. No. 4,399,216. Other features of mammalian expression are facilitated as described in Ham and Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem. (1980) 102:255, U.S. Pat. Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.
  • Screening Assays to Identify Chemotherapeutic Agents [0112]
  • The invention also encompasses screening assays to identify agents that modulate TTK activity, specifically that decrease aberrant TTK activity in an affected cell, e.g., a cancerous or pre-cancerous cell in which TTK is differentially expressed. Such assays may be performed either in vitro or in vivo. [0113]
  • Candidate Agents [0114]
  • The term “agent” as used herein describes any molecule with the capability of altering the expression or physiological function of a gene product of a differentially expressed gene. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection. [0115]
  • Candidate agents encompass numerous chemical classes, including, but not limited to, organic molecules (e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons), peptides, monoclonal antibodies, antisense polynucleotides, and ribozymes, and the like. Candidate agents can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including, but not limited to: polynucleotides, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. [0116]
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs. Candidate agents can be assessed for modulation of TTK activity either singly or in pools. [0117]
  • Screening of Candidate Agents In Vitro [0118]
  • A wide variety of in vitro assays may be used to screen candidate agents for the desired biological activity, including, but not limited to, labeled in vitro protein-protein binding assays, protein-DNA binding assays (e.g., to identify agents that affect expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like. For example, by providing for the production of large amounts of a differentially expressed polypeptide, one can identify ligands or substrates that bind to, modulate or mimic the action of the polypeptide. Further methods for identifying these ligands and substrates are provided below. The purified polypeptide may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions, transcriptional regulation, etc. [0119]
  • The screening assay can be a binding assay, wherein one or more of the molecules may be joined to a label, and the label directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g.,magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures. [0120]
  • A variety of other reagents may be included in the screening assays described herein. Where the assay is a binding assay, these include reagents like salts, neutral proteins, e.g.,albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient. [0121]
  • Many mammalian genes have homologs in yeast and lower animals. The study of such homologs physiological role and interactions with other proteins in vivo or in vitro can facilitate understanding of biological function. In addition to model systems based on genetic complementation, yeast has been shown to be a powerful tool for studying protein-protein interactions through the two hybrid system described in Chien et al. 1991 [0122] Proc. Natl. Acad. Sci. USA 88:9578-9582.
  • Screening of Candidate Agents In Vivo [0123]
  • Candidate agents can be screened in a non-human animal model of cancer (e.g., in animals into which have been injected cancerous cells; in animals that are transgenic for an alteration in expression of a differentially expressed gene as described herein, e.g., a transgenic “knock-out,” or a transgenic “knock-in,” a polynucleotide encoding all or a portion of a differentially expressed gene product and comprising an operably linked reporter gene, and the like). [0124]
  • In general, the candidate agent is administered to the animal, and the effects of the candidate agent determined. The candidate agent can be administered in any manner desired and/or appropriate for delivery of the agent in order to effect a desired result. For example, the candidate agent can be administered by injection (e.g., by injection intravenously, intramuscularly, subcutaneously, or directly into the tissue in which the desired affect is to be achieved), orally, or by any other desirable means. Normally, the in vivo screen will involve a number of animals receiving varying amounts and concentrations of the candidate agent (from no agent to an amount of agent hat approaches an upper limit of the amount that can be delivered successfully to the animal), and may include delivery of the agent in different formulation. The agents can be administered singly or can be combined in combinations of two or more, especially where administration of a combination of agents may result in a synergistic effect. [0125]
  • The effect of agent administration upon the transgenic animal can be monitored by assessing expression of the gene product, growth of the injected tumor cells, and the like. [0126]
  • Identified Candidate Agents [0127]
  • Compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host for treatment of a condition that is amenable to treatment by modulation of expression of a differentially expressed gene product. The therapeutic agents may be administered in a variety of ways, orally, topically, parenterally e.g., subcutaneously, intraperitoneally, by viral infection, intravascularly, etc. Oral and inhaled treatments are of particular interest. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways. The concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt. %. The therapeutic agents can be administered in a single dose, or as multiple doses over a course of treatment. [0128]
  • The pharmaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like. Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds. Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents. [0129]
  • Methods of Screening for Drugs that Modulate TTK Activity [0130]
  • A TTK polypeptide or TTK-encoding nucleic acid according to the present invention may be used in screening for molecules which affect or modulate TTK activity or function. Such molecules may be useful in a therapeutic and/or prophylactic context. Means for screening for substances potentially useful in treating or preventing cancer is provided by the present invention. In general, the methods of the invention are to facilitate identification of modulators of TTK activity (e.g., by modulating activity of TTK polypeptide or other TTK gene product, or by affecting TTK activity by targeting activity of gene products that act either upstream or downstream of TTK in a cascade that leads to TTK activity), with agents that decrease TTK activity generally being of particular interest. Substances identified as modulators of the TTK activity represent an advance in the fight against cancer since they provide basis for design and investigation of pharmaceuticals for in vivo use. [0131]
  • A method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide (e.g., the ability to phosphorylate its substrate) and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances. [0132]
  • Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide. Such libraries and their use are known in the art. The use of peptide libraries is preferred. Test substances may also be screened for ability to interact with the polypeptide, e.g., in a yeast two-hybrid system. This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide. Alternatively, the screen could be used to screen test substances for binding to a TTK specific binding partner. [0133]
  • A substance identified using as a modulator of TTK polypeptide function may be peptide or non-peptide in nature. Non-peptide “small molecules” are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use. [0134]
  • TTK activity assays [0135]
  • The activity of the TTK may be measured using any suitable kinase assay known in the art. For example, and not by way of limitation, the methods described in Hogg et al (Oncogene 1994 9:98-96), Mills et al (J. Biol. Chem. 1992 267:16000-006) and Tomizawa et al 2001 (FEBS Lett. 2001 492: 221-7), Schmandt et al, (J. Immunol. 1994, 152:96-105) may be used. Further serine, threonine and tyrosine kinase assays are described in Ausubel et al. (Short Protocols in Molecular Biology, 1999, unit 17.6). [0136]
  • TTK assays generally use TTK polypeptide, a labeled donor substrate, and a receptor substrate that is either specific or non-specific for TTK. In such assays TTK transfers a labeled moiety from the donor substrate to the receptor substrate, and kinase activity is measured by the amount of labeled moiety transferred from the donor substrate to the receptor substrate. [0137]
  • TTK polypeptide may be produced using various expression systems as detailed above, may be purified from cells, may be in the form of a cleaved or uncleaved recombinant fusion protein and may have non-TTK polypeptide sequences, for example a His tag or β-galactosidase at its N- or C-terminus. TTK activity may be assayed in cancerous cells lines if the cancerous cell lines are used as a source of the TTK to be assayed. Suitable donor substrates for TTK assays include any molecule that is susceptible to dephosphorylation by TTK include γ-labeled ATP and ATP analogs, wherein the label is [0138] 33P, 32P, 35S or any other radioactive isotope or a suitable fluorescent marker. Suitable recipient substrates for TTK assays include any polypeptide or other molecule that is susceptible to phosphorylation by TTK. Recipient substrates are usually derived from fragments of in vivo targets of TTK. Recipient substrates fragments may be 8 to 50 amino acids in length, usually 10 to 30 amino acids and preferably of about 10, 12, 15, 18, 20 and 25 amino acids in length Further recipient substrates can be determined empirically using a set of different polypeptides or other molecules. Targets of TTK suitable for TTK assays include tau and cdc25. Recipient substrates for TTK are typically capable of being purified from other components of the reaction once the reaction has been performed. This purification is usually done through a molecular interaction, where the recipient substrates is biotinylated and purified through its interaction with streptavidin, or a specific antibody is available that can specifically recognize the recipient substrates. The reaction can be performed in a variety of conditions, such as on a solid support, in a gel, in solution or in living cells.
  • One exemplary recipient substrate for TTK phosphorylation is the human protein cdc25, SEQ ID NO:26, which is phosphorylated by TTK at the serine residues of amino acid position 214 and 216. Two fragments of cdc25 are used as substrates in the kinase assay described below. These fragments comprise peptides A (SEQ ID NO:27), corresponding to amino acids 209 to 225 of the cdc25 polypeptide sequence or peptide B (SEQ ID NO:28), corresponds to amino acids 210 to 223 of the cdc25 polypeptide. In this assay, two biotinylated polypeptides of comprising either SEQ ID NO:27 (Biotin-SGSGSGLYRSPSMPENLNRPR-NH2) or SEQ ID NO:28 (Biotin-GGGGLYRSPSMPENLNRK-OH) are used. [0139]
  • The choice of detection methods depends on type of label used for the donor molecule and may include, for example, measurement of incorporated radiation or fluorescence by autoradiography, scintillation, scanning or fluorography. [0140]
  • Methods of Inhibiting Tumor Growth and Other Treatment Goals [0141]
  • The invention further provides methods for reducing growth of cancer cells, particular breast or colon cancer cells. In general, the methods comprise contacting a cancer cell that expresses TTK at an aberrant level relative to normal cells with a substance that (1) modulates, generally decreases, expression of TTK (e.g., a antisense polynucleotide corresponding to TTK); or (2) otherwise modulates, generally decreases, TTK polypeptide levels and/or TTK activity in a cancerous cell having aberrant TTK activity. [0142]
  • “Reducing growth of a cancer cell” includes, but is not limited to, reducing proliferation of cancer cells, and reducing the incidence of a normal cell from developing a cancerous phenotype or morphology. Whether a reduction in cancer cell growth has been achieved can be readily determined using any known assay, including, but not limited to, [[0143] 3H]-thymidine incorporation; counting cell number over a period of time; detecting, measuring a marker associated with colon cancer (e.g., CEA, CA19-9, and LASA), and/or methods well known in the art for assessing tumor burden.
  • The present invention provides methods for treating cancer (particularly breast and colon cancer or other cancer that is associated with aberrantly high TTK activity) which methods generally comprise administering to an individual an agent that reduces TTK activity in an amount sufficient to reduce cancer cell growth to treat the cancer. Whether a substance, or a specific amount of the substance, is effective in treating cancer can be assessed using any of a variety of known diagnostic assays, e.g. in the case of colon cancer, sigmoidoscopy, proctoscopy, rectal examination, colonoscopy with biopsy, contrast radiographic studies, CAT scans, angiography, and detection of a tumor marker associated with colon cancer in the blood of the individual. The substance can be administered systemically or locally. Thus, in some embodiments, the substance is administered locally, and colon cancer growth is decreased at the site of administration. Local administration may be useful in treating, e.g., a solid tumor. [0144]
  • In one embodiment, the invention features polynucleotides that act as antisense polynucleotides and decrease TTK activity. Antisense TTK polynucleotides generally comprise a polynucleotide of at least about 20 to 3000 nucleotides, usually at least about 20 to 1000 nucleotides and more usually at least about 8 to 50 nucleotides, and preferably about 26, 20, 18, 17, 15, 10 and 8 nucleotides. Exemplary TTK polynucleotides are provided in the Examples and in SEQ ID NO:1-12, although any antisense fragment of SEQ ID NO:13 will suffice. [0145]
  • The therapeutic regimen is selected according to the expression profile. For example, if a patient's tumor indicates that the tumor produces aberrantly high level of TTK relative to normal cells, then a drug having efficacy in the treatment of such TTK-expressing tumors is selected for therapy of that patient. [0146]
  • Pharmaceutical Compositions [0147]
  • Pharmaceutical compositions of the invention can comprise a therapeutically effective amount of a polypeptide, antibody, polynucleotide (including antisense nucleotides and ribozymes), or small molecule or other compound identified as modulating activity of TTK, preferably decreasing TTK activity. The term “therapeutically effective amount” as used herein refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels. Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature, and/or in the effect upon tumor load in the subject (e.g., decrease in tumor size or inhibition in tumor growth). The precise effective amount for a subject will depend upon the subject's size and health, the nature and extent of the condition, and the therapeutics or combination of therapeutics selected for administration. Thus, it is not useful to specify an exact effective amount in advance. However, the effective amount for a given situation is determined by routine experimentation and is within the judgment of the clinician. For purposes of the present invention, an effective dose will generally be from about 0.01 mg/ kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA constructs in the individual to which it is administered. [0148]
  • A pharmaceutical composition can also contain a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent, such as antibodies or a polypeptide, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which can be administered without undue toxicity. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in therapeutic compositions can include liquids such as water, saline, glycerol and ethanol. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, can also be present in such vehicles. Typically, the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. Liposomes are included within the definition of a pharmaceutically acceptable carrier. Pharmaceutically acceptable salts can also be present in the pharmaceutical composition, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in [0149] Remington 's Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991). The precise nature of the carrier or other material may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. [0150]
  • For intravenous, cutaneous or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is has suitable pH, isotonicity and stability. Suitable solutions, for example, optionally include but are not limited to isotonic vehicles such as sodium chloride, preservatives, stabilizers, buffers, antioxidants and/or other additives as required. [0151]
  • Administration of the pharmaceutical is administered in a prophylactically effective amount or a therapeutically effective amount. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Decisions on dosage etc, can be determined by one skilled in the art based upon the disclosed methods, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980. [0152]
  • Alternatively, targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells. Targeting can be accomplished by, for example, administering a drug-antibody complex to a subject, wherein the antibody is specific for a cancer-associated antigen, and the drug is one that reduces cancer cell growth. Targeting can be accomplished by coupling (e.g., linking, directly or via a linker molecule, either covalently or non-covalently, so as to form a drug-antibody complex) a drug to an antibody specific for a cancer-associated antigen. Methods of coupling a drug to an antibody are well known in the art and need not be elaborated upon herein. [0153]
  • Pharmaceutical agents can also be produced in the target cells by expression from an encoding gene introduced into the cells, e.g., in a viral or liposomal vector. The vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells. [0154]
  • Alternatively, the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated. A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated. [0155]
  • Delivery Methods for Therapy [0156]
  • Once formulated, the compositions of the invention or identified using the methods of the invention can be administered directly to the subject (e.g., as polynucleotide or polypeptides). Direct delivery of the compositions will generally be accomplished by parenteral injection, e.g., subcutaneously, intraperitoneally, intravenously or intramuscularly, intratumoral or to the interstitial space of a tissue. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications, needles, and gene guns or hyposprays. Dosage treatment can be a single dose schedule or a multiple dose schedule. [0157]
  • Once a gene corresponding to a polynucleotide of the invention has been found to correlate with a proliferative disorder, such as neoplasia, dysplasia, and hyperplasia, the disorder can be amenable to treatment by administration of a therapeutic agent based on the provided polynucleotide, corresponding polypeptide or other corresponding molecule (e.g., antisense, ribozyme, etc.). [0158]
  • The dose and the means of administration are determined based on the specific qualities of the therapeutic composition, the condition, age, and weight of the patient, the progression of the disease, and other relevant factors. For example, administration of polynucleotide therapeutic compositions agents of the invention includes local or systemic administration, including injection, oral administration, particle gun or catheterized administration, and topical administration. Preferably, the therapeutic polynucleotide composition contains an expression construct comprising a promoter operably linked to a polynucleotide of at least 12, 15, 17, 18, 22, 25, 30, or 35 contiguous-nucleotides of the polynucleotide disclosed herein. Various methods can be used to administer the therapeutic composition directly to a specific site in the body. For example, a small metastatic lesion is located and the therapeutic composition injected several times in several different locations within the body of tumor. Alternatively, arteries which serve a tumor are identified, and the therapeutic composition injected into such an artery, in order to deliver the composition directly into the tumor. A tumor that has a necrotic center is aspirated and the composition injected directly into the now empty center of the tumor. The antisense composition is directly administered to the surface of the tumor, for example, by topical application of the composition. X-ray imaging is used to assist in certain of the above delivery methods. [0159]
  • Receptor-mediated targeted delivery of therapeutic compositions containing an antisense polynucleotide, subgenomic polynucleotides, or antibodies to specific tissues can also be used. Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., [0160] Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. (USA) (1990) 87:3655; Wu et al., J. Biol. Chem. (1991) 266:338. Therapeutic compositions containing a polynucleotide are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA can also be used during a gene therapy protocol. Factors such as method of action (e.g., for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations which will affect the dosage required for ultimate efficacy of the antisense subgenomic polynucleotides. Where greater expression is desired over a larger area of tissue, larger amounts of antisense subgenomic polynucleotides or the same amounts readministered in a successive protocol of administrations, or several administrations to different adjacent or close tissue portions of, for example, a tumor site, may be required to effect a positive therapeutic outcome. In all cases, routine experimentation in clinical trials will determine specific ranges for optimal therapeutic effect. For polynucleotide related genes encoding polypeptides or proteins with anti-inflammatory activity, suitable use, doses, and administration are described in U.S. Pat. No. 5,654,173.
  • The therapeutic polynucleotides and polypeptides of the present invention can be delivered using gene delivery vehicles. The gene delivery vehicle can be of viral or non-viral origin (see generally, Jolly, [0161] Cancer Gene Therapy (1994) 1:51; Kimura, Human Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995) 1:185; and Kaplitt, Nature Genetics (1994) 6:148). Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or regulated.
  • Viral-based vectors for delivery of a desired polynucleotide and expression in a desired cell are well known in the art. Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5, 219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No. 2,200,651; [0162] EP 0 345 242; and WO 91/02805), alphavirus-based vectors (e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655). Administration of DNA linked to killed adenovirus as described in Curiel, Hum. Gene Ther. (1992) 3:147 can also be employed.
  • Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone (see, e.g., Curiel, [0163] Hum. Gene Ther. (1992) 3:147); ligand-linked DNA(see, e.g., Wu, J. Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed. Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Pat. No. 5,580,859. Liposomes that can act as gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO 95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional approaches are described in Philip, Mol. Cell Biol. (1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.
  • Further non-viral delivery suitable for use includes mechanical delivery systems such as the approach described in Woffendin et al., [0164] Proc. Natl. Acad. Sci. USA (1994) 91(24): 11581. Moreover, the coding sequence and the product of expression of such can be delivered through deposition of photopolymerized hydrogel materials or use of ionizing radiation (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033). Other conventional methods for gene delivery that can be used for delivery of the coding sequence include, for example, use of hand-held gene transfer particle gun (see, e.g., U.S. Pat. No. 5,149,655); use of ionizing radiation for activating transferred gene (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033).
  • As an alternative to the use of viral vectors other known methods of introducing nucleic acid into cells includes electroporation, calcium phosphate co-precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer. Gene transfer techniques which selectively target the TTK nucleic acid to the affected cell type are preferred. Examples of this included receptor-mediated gene transfer, in which the nucleic acid is linked to a protein ligand via polylysine, with the ligand being specific for a receptor present on the surface of the target cells. [0165]
  • Screening for Substances Affecting TTK Expression [0166]
  • The present invention also provides the use of all or part of the nucleic acid sequence of the TTK promoter and/or enhancer regions in methods of screening for substances which modulate the activity of the promoter and increase or decrease the level of TTK expression. This assay can be performed to identify anti-cancer agents for therapeutic and/or prophylactic purposes. The level of promoter activity, i.e., the ability to initiate transcription, is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter. The amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridize with the mRNA and which are labeled or may be used in a specific amplification reaction such as PCR. Use of a reporter gene facilitates determination of promoter activity by reference to protein production. [0167]
  • Generally, a reporter gene under control of the TTK promoter and/or enhancers may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression. The reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product. Many examples are known, including β-galactosidase and luciferase. β-galactosidase activity may be assayed by production of blue color on substrate, the assay being by eye or by use of a spectrophotometer to measure absorbance. Fluorescence, for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer. Radioactive assays may be used, for instance using choloramphenicol acetyltransferase, which may also be used in non-radioactive assays. The presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof. The binding molecule may be labeled directly or indirectly using any standard technique. [0168]
  • Those skilled in the art are well aware of a multitude of possible reporter genes and assay techniques which may be used to determine gene activity according to the presently disclosed methods. Any suitable reporter/assay may be used and the present invention is intended to encompass such systems. [0169]
  • Following identification of a substance which modulates or affects promoter activity, the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. [0170]
  • Integrated Disease Information System [0171]
  • The levels of TTK in a sample can be used in an integrated disease information system to aid in analysis such as proposed patient interventions, designing clinical trials, performing pharmacoeconomic analysis, and illustrating disease progression for various patients over time. For example, TTK information determined according to the methods of the invention can be used in a system such as that described in U.S. Pat. No. 6,108,635 issued to Herren, et al. on Aug. 22, 2000. Such a system can be for collecting the results of medical treatments given to patients in a plurality of locations. See, e.g., U.S. Pat. No. 5,713,350 issued to Yokota, et al. on Feb. 3, 1998. [0172]
  • EXAMPLES
  • The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric. [0173]
  • Example 1 Source of Patient Tissue Samples
  • Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) [0174] Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al (1998) Trends Genet 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:998-1001). Table 1 (inserted following the last page of the Examples ) provides information about each patient from which the samples were isolated, including: the Patient ID and Path ReportID, numbers assigned to the patient and the pathology reports for identification purposes; the anatomical location of the tumor (AnatomicalLoc); The Primary Tumor Size; the Primary Tumor Grade; the Histopathologic Grade; a description of local sites to which the tumor had invaded (Local Invasion); the presence of lymph node metastases (Lymph Node Metastasis); incidence of lymph node metastases (provided as number of lymph nodes positive for metastasis over the number of lymph nodes examined) (Incidence Lymphnode Metastasis); the Regional Lymphnode Grade; the identification or detection of metastases to sites distant to the tumor and their location (Distant Met & Loc);a description of the distant metastases (Description Distant Met); the grade of distant metastasis (Distant Met Grade); and general comments about the patient or the tumor (Comments). Adenoma was not described in any of the patients; adenoma dysplasia (described as hyperplasia by the pathologist) was described in Patient ID No. 695. Extranodal extensions were described in two patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in seven patients, Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
  • Example 2 Differential Expression of TTK
  • cDNA probes were prepared from total RNA isolated from the patient cells described in Example 1. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample. [0175]
  • Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) [0176] Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling. Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red).
  • Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array. Spotting was accomplished using PCR amplified products from 0.5 kb to 2.0 kb and spotted using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1 . For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about 4 duplicate measurements for each clone, two of one color and two of the other, for each sample. [0177]
  • The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC. [0178]
  • The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference. [0179]
  • The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample. [0180]
  • A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10[0181] −3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
  • The difference in the expression level of TTK in the colon tumor cells relative to the matched normal colon cells was greater than or equal to 2 fold (“>=2×”) in 39% of the patients, greater than or equal to 2.5 fold in 36% of the patients, and greater than or equal to 5 fold in 27% of the patients examined. [0182]
  • Quantitative PCR of a number of normal tissues and tumor cell lines, particularly colorectal carcinoma cell lines was used to analyze expression of TTK. Quantitative real-time PCR was performed by first isolating RNA from cells using a Roche RNA Isolation kit according to manufacturer's directions. One microgram of RNA was used to synthesize a first-strand cDNA using MMLV reverse transcriptase (Ambion) using the manufacturers buffer and recommended concentrations of oligo dT, nucleotides, and Rnasin. This first-strand cDNA served as a template for quantitative real-time PCR using the Roche light-cycler as recommended in the machine manual. TTK was amplified with the forward primer CGGAATCAAGTCTTCTAGCT (SEQ ID NO: 1) and reverse primer GGTTGCTCAAAAGTTGGTATG (SEQ ID NO:2) PCR product was quantified based on the cycle at which the amplification entered the linear phase of amplification in comparison to an internal standard and using the software supplied by the manufacturer. Small differences in amounts or total template in the first-strand cDNA reaction were eliminated by normalizing to amount of actin amplified in a separate quantitative PCR reaction using the forward primer 5′-CGGGAAATCGTGCGTGACATTAAG-3′ (SEQ ID NO:3) and the reverse primer: 5′-TGATCTCCTTCTGCATCCTGTCGG-3′ (SEQ ID NO:4). The results for TTK mRNA levels in normal tissues are shown in FIG. 1; the results for TTK mRNA levels in tumor cell lines are shown in FIG. 2. A brief description of the cell lines analyzed is provided in the table below. [0183]
    Cell Line Tissue Source Cell Line Tissue Source
    MDA-MB-231 Human breast; high Caco-2 Human colorectal
    metastatic potential adenocarcinoma
    (micromets in lung;
    adenocarcinoma;
    pleural effusion
    MDA-MB-435 Human breast, high SW620 Human colorectal
    metastatic potential adenocarcinoma;
    (macrometastases in from metastatic
    lung) site (lymph node)
    MCF-7 Human breast; non- LS174T High metastatic
    metastatic potential human
    colorectal
    adenocarcinoma
    MDA-MB-468 Human breast; LOVO Human colorectal
    adenocarcinoma adenocarcinoma;
    colon; from
    metastatic site
    (colon)
    Alab Human breast, HT29 Human colorectal
    metastatic adenocarcinoma;
    colon
    SKOV3 Human ovarian SW480 Human colorectal
    adenocarcinoma adenocarcinoma;
    colon
    OVCAR3 Human ovarian HCT116 Human colorectal
    adenocarcinoma carcinoma; colon
    KM12C Human colon; low Colo 320DN Human colorectal
    metastatic potential adenocarcinoma;
    colon
    KM12L4 Human colon; high T84 Human colorectal
    metastatic potential carcinoma; colon;
    (derived from from metastatic site
    Km12C) (lung)
    DU 145 Human prostate; HCT15 Human colorectal
    carcinoma; from adenocarcinoma;
    metastatic site: brain colon
    HT1080 Human sarcoma cell CCD112 Human colorectal
    line; adenocarcinoma,
    low metastatic
    potential
    HMVEC Primary human DLD1 Human colon;
    microvascular colorectal
    endothelial cells adenocarcinoma
    184B5 normal breast 293 kidney epithelial
    epithelial cells; cells
    chemically trans-
    formed
    LNCAP prostate carcinoma; GRDP2 primary prostate
    metastasis to left epithelium
    supraclavicular
    lymph
    U373MG glioblastoma cell IMR90 primary lung
    fibroblast
    WOCA primary prostate PC3 prostate cancer;
    epithelium androgen receptor
    negative
  • TTK was expressed in normal cells (FIG. 1), with thymus and testis identified as the normal tissues that most highly expressed the gene for TTK. Numerous cancer cells, however, displayed a significantly elevated level of TTK expression (FIG. 2) as compared to most wild-type tissues. [0184]
  • Example 3 Hierarchical Clustering and Stratification of Colon Cancers Using Differential Expression Data
  • Differential expression patterns from Example 2 were analyzed by applying hierarchical clustering methods to the data sets (see Eisen et al. (1998) [0185] PNAS 95:14863-14868). In short, hierarchical clustering algorithms are based on the average-linkage method of Sokal and Michener (Sokal, R R & Michener, C D (1958) Univ. Kans. Sci. Bull. 38, 1409-1438), which was developed for clustering correlation matrixes. The object of this algorithm is to compute a dendrogram that assembles all elements into a single tree. For any set of n genes, an upper-diagonal similarity matrix is computed which contains similarity scores for all pairs of genes. The matrix is scanned to identify the highest value (representing a similar pair of genes). Using this technique, four groups of differential expression patterns were identified and assigned to clusters.
  • Application of hierarchical clustering to the data from Example 2 revealed that IGF2 (insulin-like growth factor 2), TTK (serine, threonine, tyrosine kinase implicated in the cell cycle), MAPKAPK2 (mitogen-activated protein (MAP) kinase-activated protein kinase), and MARCKS (myristoylated alanine-rich C kinase substrate, which is a substrate of protein kinase C) are concurrently upregulated as detected in 9 out of the 33 colon cancer patient samples examined. The data for these experiments is presented in graphical form in FIGS. [0186] 3-6. The concurrent upregulation suggests that these genes are co-regulated and that patients with an elevated serum level of IGF2 may be candidates for treatment with inhibitors to TTK, MAPKAP kinase 2, MARCKS and/or IGF2.
  • Example 4 Antisense Regulation of TTK Expression
  • Additional functional information on TTK was generated using antisense knockout technology. TTK expression in cancerous cells was further analyzed to confirm the role and function of the gene product in tumorgenesis, e.g., in promoting a metastatic phenotype. [0187]
  • A number of different oligonucleotides complementary to TTK mRNA were designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of TTK. The ability of each designed antisense oligonucleotide to inhibit gene expression was tested through transfection into SW620 colon colorectal carcinoma cells. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol lipitoid/pg antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM. [0188]
  • The level of target mRNA (TTK) in the transfected cells was quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA were normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H[0189] 2O, 2.0 μl 10×reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
  • An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl[0190] 2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10×concentration from Perkin-Elmer, Norwalk, Conn.). In 1×concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.
  • The following antisense oligonucleotides were shown to effectively deplete TTK RNA in the transfection assays: [0191]
  • Oligo 79-5AS: GGGACTCTTCCAAATGGGCATGACT (SEQ ID NO:5) [0192]
  • Oligo 79-9AS: TCCAGTAACTCTTGCGTTCCCATGG (SEQ ID NO:6) [0193]
  • The reverse control of each of these antisense oligonucleotides were synthesized, as were oligonucleotides with the identical sequence of the antisense oligonucleotides in reverse orientation (Reverse Control): [0194]
  • Oligo 79-5RC: TCAGTACGGGTAAACCTTCTCAGGG (SEQ ID NO:7) [0195]
  • Oligo 79-9RC: GGTACCCTTGCGTTCTCAATGACCT (SEQ ID NO:8) [0196]
  • The antisense oligonucleotides were introduced into a test cell and the effect upon TTK expression of the corresponding gene, as well as the effect induction of the cancerous phenotype, was examined as described below. [0197]
  • Example 5 Effect of TTK Expression on Proliferation
  • The effect of TTK on proliferation was assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)), SW620 colon colorectal carcinoma cells, or 847 human immortal fibroblast cells. Transfection was carried out as described above in Example 4. [0198]
  • Cells were plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide was diluted to 2 μM in OptiMEM™ and added to OptiMEM™ into which the delivery vehicle, lipitoid 116-6 in the case of SW620 cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231 cells, had been diluted. The oligo/ delivery vehicle mixture was then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/μg oligonucleotide. Cells were transfected overnight at 37° C. and the transfection mixture was replaced with fresh medium the next morning. [0199]
  • Transfection of the antisense oligonucleotides into both SW620 colorectal carcinoma cells (FIG. 7) and 231 cells (FIG. 8) resulted in a decreased rate of proliferation compared to matched reverse control (RC) and oligonucleotides, but no inhibition of growth of 847 human immortal fibroblast cells (FIG. 11), suggesting possible tissue or transformation specificity in the functional role for the TTK protein. [0200]
  • Example 6 Effect of TTK Expression on Colony Formation
  • The effect of TTK expression upon colony formation was tested in a soft agar assay. Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies are formed in 10 days to 3 weeks. Fields of colonies were counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences. [0201]
  • As shown in FIG. 9, antisense oligonucleotides to TTK (79-9AS) led to decreased colony size and number compared to control reverse control oligonucleotides (79-9RC) or to control oligonucleotides (52-3AS: TAGGTCTTTGGCCGGTGATGGGTCG (SEQ ID NO:9) and 52-3RC: GCTGGGTAGTGGCCGGTTTCTGGAT (SEQ ID NO:10)). The 52-3 antisense oligonucleotide is directed to the hD53 mRNA, and serves as a negative control in the experiment. [0202]
  • Example 7 Induction of Cell Death Upon Depletion of TTK (“Antisense Knockout”)
  • SW620 cells were transfected as described for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol was followed but cells were left in the presence of 2 μM drug. Each day, cytotoxicity was monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH was measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) shows that loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection). [0203]
  • The following antisense oligonucleotides were tested for the ability to deplete the message levels of the gene corresponding to the indicated cluster. Oligo Name: AS or RC provides the name of the target gene or name of the oligo, and whether the oligo is antisense (AS) or a reverse control (RC). [0204]
    Oligo Name: Antisense
    (AS) or Reverse
    Control (RC) Oligo Sequence SEQ ID NO:
    Chir39-5:AS ACTCATCTGGCTGGGCTATGGTGGT SEQ ID NO:11
    Chir39-5:RC TGGTGGTATCGGGTCGGTCTACTCA SEQ ID NO:12
    Chir79-9:AS TCCAGTAACTCTTGCGTTCCCATGG SEQ ID NO:6
    Chir79-9:RC GGTACCCTTGCGTTCTCAATGACCT SEQ ID NO:8
  • As shown in FIG. 12, Chiron 79-9 (TTK) antisense does not sensitize the cells to treatment by cisplatin at a detectable level, but leads to increased death compared to control oligo at [0205] day 3.
  • Example 8 Sample Assay for Agents that Modulate TTK Activity
  • This assay may be performed in microtitre plates. TTK was purified as a 6×IIis tagged fusion protein using a baculovirus expression system. Essentially 20 ul of 20 nM TTK (100 k Da) in TTK kinase buffer comprising 50 mM Hepes pH 7.4, 2mM MgCl[0206] 2, 10 mM MnCl2, 1 mM NaF, 50 mM NaCl, 1 mM DTT and 1 mg/ml BSA was added to 5 ul of a candidate agent diluted in 20% DMSO, 10 ul of a 2.8 uM solution of a biotinylated substrate peptide derived from cdc25, such as Biotin-SGSGSGLYRSPSMPENLNRPR-NH2 (SEQ ID NO:27) or Biotin-GGGGLYRSPSMPENLNRK-OH (SEQ ID NO:28) and 5 ul of 80 nM 33P-γATP in a well of a microtitre plate. Samples were mixed, incubated for 2 hours and each reaction is terminated using 20 ul of 0.5 M EDTA pH 8.0. 50 ul of the sample is transferred to a 96 well flat bottom Streptavidin coated flash plate, and the sample is incubated with the plate for 1 hr at room temperature. The wells of the plate are washed four times with 250 ul of calcium and magnesium-free phosphate buffered saline, and scintillation fluid is added to the sample. Activity of TTK was measured by calculating the emission of 33P, transferred by TTK from 33P-γATP to a substrate peptide, by scintillation.
  • Agents modulating TTK activity can be identified by comparing the activity of TTK in the presence of a candidate agent to the activity of TTK in the absence of a candidate agent. [0207]
  • While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the invention. [0208]
  • 0
    SEQUENCE LISTING
    <160> NUMBER OF SEQ ID NOS: 38
    <210> SEQ ID NO 1
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 1
    cggaatcaag tcttctagct 20
    <210> SEQ ID NO 2
    <211> LENGTH: 21
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 2
    ggttgctcaa aagttggtat g 21
    <210> SEQ ID NO 3
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 3
    cgggaaatcg tgcgtgacat taag 24
    <210> SEQ ID NO 4
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 4
    tgatctcctt ctgcatcctg tcgg 24
    <210> SEQ ID NO 5
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 5
    gggactcttc caaatgggca tgact 25
    <210> SEQ ID NO 6
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 6
    tccagtaact cttgcgttcc catgg 25
    <210> SEQ ID NO 7
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 7
    tcagtacggg taaaccttct caggg 25
    <210> SEQ ID NO 8
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 8
    ggtacccttg cgttctcaat gacct 25
    <210> SEQ ID NO 9
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 9
    taggtctttg gccggtgatg ggtcg 25
    <210> SEQ ID NO 10
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 10
    gctgggtagt ggccggtttc tggat 25
    <210> SEQ ID NO 11
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 11
    actcatctgg ctgggctatg gtggt 25
    <210> SEQ ID NO 12
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: synthesized oligonucleotide
    <400> SEQUENCE: 12
    tggtggtatc gggtcggtct actca 25
    <210> SEQ ID NO 13
    <211> LENGTH: 3866
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapien
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1026)...(3551)
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (0)...(0)
    <223> OTHER INFORMATION: TTK
    <400> SEQUENCE: 13
    ggaattcctt tttttttttt tttgagatgg agtttcactc ttgttggcca ggctggagtg 60
    caatggcaca atctcagctt actgcaacct ccgcctcccg ggttcaagcg attctcctgc 120
    ctcagcctct caagtagctg ggattacagg catgtgccac cacccctggc taactaattt 180
    cttttctatt tagtagagat ggggtttcac catgttggtc aggctggtct tgaactcctg 240
    acctcaggtg atccacttgc cttggcctcc caaagtgcta ggattacagc cgtgaaactg 300
    tgcctggctg attctttttt tgttgttgga tttttgaaac agggtctccc ttggtcgccc 360
    aggctggagt gcagtggtgc gatcttggct cactataacc tccacctcct ggtttcaagt 420
    gatcctccca ctttagcctc ctgagtagct gtgattacag gcgtgcacca ccacacccgg 480
    ctaatttttg tatttttatt agagacaggg tttcaccatg ttggccaggc tgttctcaaa 540
    ctcctggact caagggatcc gcctgcctcc acttcccaaa gtcccgagat tacaggtgtg 600
    agtcaccatg cctgacctta taattcttaa gtcatttttt ctggtccatt tcttccttag 660
    ggtcctcaca acaaatctgc attaggcggt acaataatcc ttaacttcat gattcacaaa 720
    aggaagatga agtgattcat gatttagaaa ggggaagtag taagcccact gcacactcct 780
    ggatgatgat cctaaatcca gatacagtaa aaatggggta tgggaaggta gaatacaaaa 840
    tttggtttaa attaattatc taaatatcta aaaacatttt tggatacatt gttgatgtga 900
    atgtaagact gtacagactt cctagaaaac agtttgggtt ccatcttttc atttccccag 960
    tgcagttttc tgtagaaatg gaatccgagg atttaagtgg cagagaattg acaattgatt 1020
    ccata atg aac aaa gtg aga gac att aaa aat aag ttt aaa aat gaa gac 1070
    Met Asn Lys Val Arg Asp Ile Lys Asn Lys Phe Lys Asn Glu Asp
    1 5 10 15
    ctt act gat gaa cta agc ttg aat aaa att tct gct gat act aca gat 1118
    Leu Thr Asp Glu Leu Ser Leu Asn Lys Ile Ser Ala Asp Thr Thr Asp
    20 25 30
    aac tcg gga act gtt aac caa att atg atg atg gca aac aac cca gag 1166
    Asn Ser Gly Thr Val Asn Gln Ile Met Met Met Ala Asn Asn Pro Glu
    35 40 45
    gac tgg ttg agt ttg ttg ctc aaa cta gag aaa aac agt gtt ccg cta 1214
    Asp Trp Leu Ser Leu Leu Leu Lys Leu Glu Lys Asn Ser Val Pro Leu
    50 55 60
    agt gat gct ctt tta aat aaa ttg att ggt cgt tac agt caa gca att 1262
    Ser Asp Ala Leu Leu Asn Lys Leu Ile Gly Arg Tyr Ser Gln Ala Ile
    65 70 75
    gaa gcg ctt ccc cca gat aaa tat ggc caa aat gag agt ttt gct aga 1310
    Glu Ala Leu Pro Pro Asp Lys Tyr Gly Gln Asn Glu Ser Phe Ala Arg
    80 85 90 95
    att caa gtg aga ttt gct gaa tta aaa gct att caa gag cca gat gat 1358
    Ile Gln Val Arg Phe Ala Glu Leu Lys Ala Ile Gln Glu Pro Asp Asp
    100 105 110
    gca cgt gac tac ttt caa atg gcc aga gca aac tgc aag aaa ttt gct 1406
    Ala Arg Asp Tyr Phe Gln Met Ala Arg Ala Asn Cys Lys Lys Phe Ala
    115 120 125
    ttt gtt cat ata tct ttt gca caa ttt gaa ctg tca caa ggt aat gtc 1454
    Phe Val His Ile Ser Phe Ala Gln Phe Glu Leu Ser Gln Gly Asn Val
    130 135 140
    aaa aaa agt aaa caa ctt ctt caa aaa gct gta gaa cgt gga gca gta 1502
    Lys Lys Ser Lys Gln Leu Leu Gln Lys Ala Val Glu Arg Gly Ala Val
    145 150 155
    cca cta gaa atg ctg gaa att gcc ctg cgg aat tta aac ctc caa aaa 1550
    Pro Leu Glu Met Leu Glu Ile Ala Leu Arg Asn Leu Asn Leu Gln Lys
    160 165 170 175
    aag cag ctg ctt tca gag gag gaa aag aag aat tta tca gca tct acg 1598
    Lys Gln Leu Leu Ser Glu Glu Glu Lys Lys Asn Leu Ser Ala Ser Thr
    180 185 190
    gta tta act gcc caa gaa tca ttt tcc ggt tca ctt ggg cat tta cag 1646
    Val Leu Thr Ala Gln Glu Ser Phe Ser Gly Ser Leu Gly His Leu Gln
    195 200 205
    aat agg aac aac agt tgt gat tcc aga gga cag act act aaa gcc agg 1694
    Asn Arg Asn Asn Ser Cys Asp Ser Arg Gly Gln Thr Thr Lys Ala Arg
    210 215 220
    ttt tta tat gga gag aac atg cca cca caa gat gca gaa ata ggt tac 1742
    Phe Leu Tyr Gly Glu Asn Met Pro Pro Gln Asp Ala Glu Ile Gly Tyr
    225 230 235
    cgg aat tca ttg aga caa act aac aaa act aaa cag tca tgc cca ttt 1790
    Arg Asn Ser Leu Arg Gln Thr Asn Lys Thr Lys Gln Ser Cys Pro Phe
    240 245 250 255
    gga aga gtc cca gtt aac ctt cta aat agc cca gat tgt gat gtg aag 1838
    Gly Arg Val Pro Val Asn Leu Leu Asn Ser Pro Asp Cys Asp Val Lys
    260 265 270
    aca gat gat tca gtt gta cct tgt ttt atg aaa aga caa acc tct aga 1886
    Thr Asp Asp Ser Val Val Pro Cys Phe Met Lys Arg Gln Thr Ser Arg
    275 280 285
    tca gaa tgc cga gat ttg gtt gtg cct gga tct aaa cca agt gga aat 1934
    Ser Glu Cys Arg Asp Leu Val Val Pro Gly Ser Lys Pro Ser Gly Asn
    290 295 300
    gat tcc tgt gaa tta aga aat tta aag tct gtt caa aat agt cat ttc 1982
    Asp Ser Cys Glu Leu Arg Asn Leu Lys Ser Val Gln Asn Ser His Phe
    305 310 315
    aag gaa cct ctg gtg tca gat gaa aag agt tct gaa ctt att att act 2030
    Lys Glu Pro Leu Val Ser Asp Glu Lys Ser Ser Glu Leu Ile Ile Thr
    320 325 330 335
    gat tca ata acc ctg aag aat aaa acg gaa tca agt ctt cta gct aaa 2078
    Asp Ser Ile Thr Leu Lys Asn Lys Thr Glu Ser Ser Leu Leu Ala Lys
    340 345 350
    tta gaa gaa act aaa gag tat caa gaa cca gag gtt cca gag agt aac 2126
    Leu Glu Glu Thr Lys Glu Tyr Gln Glu Pro Glu Val Pro Glu Ser Asn
    355 360 365
    cag aaa cag tgg caa gct aag aga aag tca gag tgt att aac cag aat 2174
    Gln Lys Gln Trp Gln Ala Lys Arg Lys Ser Glu Cys Ile Asn Gln Asn
    370 375 380
    cct gct gca tct tca aat cac tgg cag att ccg gag tta gcc cga aaa 2222
    Pro Ala Ala Ser Ser Asn His Trp Gln Ile Pro Glu Leu Ala Arg Lys
    385 390 395
    gtt aat aca gag cag aaa cat acc act ttt gag caa cct gtc ttt tca 2270
    Val Asn Thr Glu Gln Lys His Thr Thr Phe Glu Gln Pro Val Phe Ser
    400 405 410 415
    gtt tca aaa cag tca cca cca ata tca aca tct aaa tgg ttt gac cca 2318
    Val Ser Lys Gln Ser Pro Pro Ile Ser Thr Ser Lys Trp Phe Asp Pro
    420 425 430
    aaa tct att tgt aag aca cca agc agc aat acc ttg gat gat tac atg 2366
    Lys Ser Ile Cys Lys Thr Pro Ser Ser Asn Thr Leu Asp Asp Tyr Met
    435 440 445
    agc tgt ttt aga act cca gtt gta aag aat gac ttt cca cct gct tgt 2414
    Ser Cys Phe Arg Thr Pro Val Val Lys Asn Asp Phe Pro Pro Ala Cys
    450 455 460
    cag ttg tca aca cct tat ggc caa cct gcc tgt ttc cag cag caa cag 2462
    Gln Leu Ser Thr Pro Tyr Gly Gln Pro Ala Cys Phe Gln Gln Gln Gln
    465 470 475
    cat caa ata ctt gcc act cca ctt caa aat tta cag gtt tta gca tct 2510
    His Gln Ile Leu Ala Thr Pro Leu Gln Asn Leu Gln Val Leu Ala Ser
    480 485 490 495
    tct tca gca aat gaa tgc att tcg gtt aaa gga aga att tat tcc ata 2558
    Ser Ser Ala Asn Glu Cys Ile Ser Val Lys Gly Arg Ile Tyr Ser Ile
    500 505 510
    tta aag cag ata gga agt gga ggt tca agc aag gta ttt cag gtg tta 2606
    Leu Lys Gln Ile Gly Ser Gly Gly Ser Ser Lys Val Phe Gln Val Leu
    515 520 525
    aat gaa aag aaa cag ata tat gct ata aaa tat gtg aac tta gaa gaa 2654
    Asn Glu Lys Lys Gln Ile Tyr Ala Ile Lys Tyr Val Asn Leu Glu Glu
    530 535 540
    gca gat aac caa act ctt gat agt tac cgg aac gaa ata gct tat ttg 2702
    Ala Asp Asn Gln Thr Leu Asp Ser Tyr Arg Asn Glu Ile Ala Tyr Leu
    545 550 555
    aat aaa cta caa caa cac agt gat aag atc atc cga ctt tat gat tat 2750
    Asn Lys Leu Gln Gln His Ser Asp Lys Ile Ile Arg Leu Tyr Asp Tyr
    560 565 570 575
    gaa atc acg gac cag tac atc tac atg gta atg gag tgt gga aat att 2798
    Glu Ile Thr Asp Gln Tyr Ile Tyr Met Val Met Glu Cys Gly Asn Ile
    580 585 590
    gat ctt aat agt tgg ctt aaa aag aaa aaa tcc att gat cca tgg gaa 2846
    Asp Leu Asn Ser Trp Leu Lys Lys Lys Lys Ser Ile Asp Pro Trp Glu
    595 600 605
    cgc aag agt tac tgg aaa aat atg tta gag gca gtt cac aca atc cat 2894
    Arg Lys Ser Tyr Trp Lys Asn Met Leu Glu Ala Val His Thr Ile His
    610 615 620
    caa cat ggc att gtt cac agt gat ctt aaa cca gct aac ttt ctg ata 2942
    Gln His Gly Ile Val His Ser Asp Leu Lys Pro Ala Asn Phe Leu Ile
    625 630 635
    gtt gat gga atg cta aag cta att gat ttt ggg att gca aac caa atg 2990
    Val Asp Gly Met Leu Lys Leu Ile Asp Phe Gly Ile Ala Asn Gln Met
    640 645 650 655
    caa cca gat aca aca agt gtt gtt aaa gat tct cag gtt ggc aca gtt 3038
    Gln Pro Asp Thr Thr Ser Val Val Lys Asp Ser Gln Val Gly Thr Val
    660 665 670
    aat tat atg cca cca gaa gca atc aaa gat atg tct tcc tcc aga gag 3086
    Asn Tyr Met Pro Pro Glu Ala Ile Lys Asp Met Ser Ser Ser Arg Glu
    675 680 685
    aat ggg aaa tct aag tca aag ata agc ccc aaa agt gat gtt tgg tcc 3134
    Asn Gly Lys Ser Lys Ser Lys Ile Ser Pro Lys Ser Asp Val Trp Ser
    690 695 700
    tta gga tgt att ttg tac tat atg act tac ggg aaa aca cca ttt cag 3182
    Leu Gly Cys Ile Leu Tyr Tyr Met Thr Tyr Gly Lys Thr Pro Phe Gln
    705 710 715
    cag ata att aat cag att tct aaa tta cat gcc ata att gat cct aat 3230
    Gln Ile Ile Asn Gln Ile Ser Lys Leu His Ala Ile Ile Asp Pro Asn
    720 725 730 735
    cat gaa att gaa ttt ccc gat att cca gag aaa gat ctt caa gat gtg 3278
    His Glu Ile Glu Phe Pro Asp Ile Pro Glu Lys Asp Leu Gln Asp Val
    740 745 750
    tta aag tgt tgt tta aaa agg gac cca aaa cag agg ata tcc att cct 3326
    Leu Lys Cys Cys Leu Lys Arg Asp Pro Lys Gln Arg Ile Ser Ile Pro
    755 760 765
    gag ctc ctg gct cat cca tat gtt caa att caa act cat cca gtt aac 3374
    Glu Leu Leu Ala His Pro Tyr Val Gln Ile Gln Thr His Pro Val Asn
    770 775 780
    caa atg gcc aag gga acc act gaa gaa atg aaa tat gtt ctg ggc caa 3422
    Gln Met Ala Lys Gly Thr Thr Glu Glu Met Lys Tyr Val Leu Gly Gln
    785 790 795
    ctt gtt ggt ctg aat tct cct aac tcc att ttg aaa gct gct aaa act 3470
    Leu Val Gly Leu Asn Ser Pro Asn Ser Ile Leu Lys Ala Ala Lys Thr
    800 805 810 815
    tta tat gaa cac tat agt ggt ggt gaa agt cat aat tct tca tcc tcc 3518
    Leu Tyr Glu His Tyr Ser Gly Gly Glu Ser His Asn Ser Ser Ser Ser
    820 825 830
    aag act ttt gaa aaa aaa agg gga aaa aaa tga tttgcagtta ttcgtaatgt 3571
    Lys Thr Phe Glu Lys Lys Arg Gly Lys Lys *
    835 840
    cagataggag gtataaaata tattggactg ttatactctt gaatccctgt ggaaatctac 3631
    atttgaagac aacatcactc tgaagtgtta tcagcaaaaa aaattcagtg agattatctt 3691
    taaaagaaaa ctgtaaaaat agcaaccact tatggcactg tatatattgt agacttgttt 3751
    tctctgtttt atgctcttgt gtaatctact tgacatcatt ttactcttgg aatagtgggt 3811
    ggatagcaag tatattctaa aaaactttgt aaataaagtt ttgtggctaa aatga 3866
    <210> SEQ ID NO 14
    <211> LENGTH: 841
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 14
    Met Asn Lys Val Arg Asp Ile Lys Asn Lys Phe Lys Asn Glu Asp Leu
    1 5 10 15
    Thr Asp Glu Leu Ser Leu Asn Lys Ile Ser Ala Asp Thr Thr Asp Asn
    20 25 30
    Ser Gly Thr Val Asn Gln Ile Met Met Met Ala Asn Asn Pro Glu Asp
    35 40 45
    Trp Leu Ser Leu Leu Leu Lys Leu Glu Lys Asn Ser Val Pro Leu Ser
    50 55 60
    Asp Ala Leu Leu Asn Lys Leu Ile Gly Arg Tyr Ser Gln Ala Ile Glu
    65 70 75 80
    Ala Leu Pro Pro Asp Lys Tyr Gly Gln Asn Glu Ser Phe Ala Arg Ile
    85 90 95
    Gln Val Arg Phe Ala Glu Leu Lys Ala Ile Gln Glu Pro Asp Asp Ala
    100 105 110
    Arg Asp Tyr Phe Gln Met Ala Arg Ala Asn Cys Lys Lys Phe Ala Phe
    115 120 125
    Val His Ile Ser Phe Ala Gln Phe Glu Leu Ser Gln Gly Asn Val Lys
    130 135 140
    Lys Ser Lys Gln Leu Leu Gln Lys Ala Val Glu Arg Gly Ala Val Pro
    145 150 155 160
    Leu Glu Met Leu Glu Ile Ala Leu Arg Asn Leu Asn Leu Gln Lys Lys
    165 170 175
    Gln Leu Leu Ser Glu Glu Glu Lys Lys Asn Leu Ser Ala Ser Thr Val
    180 185 190
    Leu Thr Ala Gln Glu Ser Phe Ser Gly Ser Leu Gly His Leu Gln Asn
    195 200 205
    Arg Asn Asn Ser Cys Asp Ser Arg Gly Gln Thr Thr Lys Ala Arg Phe
    210 215 220
    Leu Tyr Gly Glu Asn Met Pro Pro Gln Asp Ala Glu Ile Gly Tyr Arg
    225 230 235 240
    Asn Ser Leu Arg Gln Thr Asn Lys Thr Lys Gln Ser Cys Pro Phe Gly
    245 250 255
    Arg Val Pro Val Asn Leu Leu Asn Ser Pro Asp Cys Asp Val Lys Thr
    260 265 270
    Asp Asp Ser Val Val Pro Cys Phe Met Lys Arg Gln Thr Ser Arg Ser
    275 280 285
    Glu Cys Arg Asp Leu Val Val Pro Gly Ser Lys Pro Ser Gly Asn Asp
    290 295 300
    Ser Cys Glu Leu Arg Asn Leu Lys Ser Val Gln Asn Ser His Phe Lys
    305 310 315 320
    Glu Pro Leu Val Ser Asp Glu Lys Ser Ser Glu Leu Ile Ile Thr Asp
    325 330 335
    Ser Ile Thr Leu Lys Asn Lys Thr Glu Ser Ser Leu Leu Ala Lys Leu
    340 345 350
    Glu Glu Thr Lys Glu Tyr Gln Glu Pro Glu Val Pro Glu Ser Asn Gln
    355 360 365
    Lys Gln Trp Gln Ala Lys Arg Lys Ser Glu Cys Ile Asn Gln Asn Pro
    370 375 380
    Ala Ala Ser Ser Asn His Trp Gln Ile Pro Glu Leu Ala Arg Lys Val
    385 390 395 400
    Asn Thr Glu Gln Lys His Thr Thr Phe Glu Gln Pro Val Phe Ser Val
    405 410 415
    Ser Lys Gln Ser Pro Pro Ile Ser Thr Ser Lys Trp Phe Asp Pro Lys
    420 425 430
    Ser Ile Cys Lys Thr Pro Ser Ser Asn Thr Leu Asp Asp Tyr Met Ser
    435 440 445
    Cys Phe Arg Thr Pro Val Val Lys Asn Asp Phe Pro Pro Ala Cys Gln
    450 455 460
    Leu Ser Thr Pro Tyr Gly Gln Pro Ala Cys Phe Gln Gln Gln Gln His
    465 470 475 480
    Gln Ile Leu Ala Thr Pro Leu Gln Asn Leu Gln Val Leu Ala Ser Ser
    485 490 495
    Ser Ala Asn Glu Cys Ile Ser Val Lys Gly Arg Ile Tyr Ser Ile Leu
    500 505 510
    Lys Gln Ile Gly Ser Gly Gly Ser Ser Lys Val Phe Gln Val Leu Asn
    515 520 525
    Glu Lys Lys Gln Ile Tyr Ala Ile Lys Tyr Val Asn Leu Glu Glu Ala
    530 535 540
    Asp Asn Gln Thr Leu Asp Ser Tyr Arg Asn Glu Ile Ala Tyr Leu Asn
    545 550 555 560
    Lys Leu Gln Gln His Ser Asp Lys Ile Ile Arg Leu Tyr Asp Tyr Glu
    565 570 575
    Ile Thr Asp Gln Tyr Ile Tyr Met Val Met Glu Cys Gly Asn Ile Asp
    580 585 590
    Leu Asn Ser Trp Leu Lys Lys Lys Lys Ser Ile Asp Pro Trp Glu Arg
    595 600 605
    Lys Ser Tyr Trp Lys Asn Met Leu Glu Ala Val His Thr Ile His Gln
    610 615 620
    His Gly Ile Val His Ser Asp Leu Lys Pro Ala Asn Phe Leu Ile Val
    625 630 635 640
    Asp Gly Met Leu Lys Leu Ile Asp Phe Gly Ile Ala Asn Gln Met Gln
    645 650 655
    Pro Asp Thr Thr Ser Val Val Lys Asp Ser Gln Val Gly Thr Val Asn
    660 665 670
    Tyr Met Pro Pro Glu Ala Ile Lys Asp Met Ser Ser Ser Arg Glu Asn
    675 680 685
    Gly Lys Ser Lys Ser Lys Ile Ser Pro Lys Ser Asp Val Trp Ser Leu
    690 695 700
    Gly Cys Ile Leu Tyr Tyr Met Thr Tyr Gly Lys Thr Pro Phe Gln Gln
    705 710 715 720
    Ile Ile Asn Gln Ile Ser Lys Leu His Ala Ile Ile Asp Pro Asn His
    725 730 735
    Glu Ile Glu Phe Pro Asp Ile Pro Glu Lys Asp Leu Gln Asp Val Leu
    740 745 750
    Lys Cys Cys Leu Lys Arg Asp Pro Lys Gln Arg Ile Ser Ile Pro Glu
    755 760 765
    Leu Leu Ala His Pro Tyr Val Gln Ile Gln Thr His Pro Val Asn Gln
    770 775 780
    Met Ala Lys Gly Thr Thr Glu Glu Met Lys Tyr Val Leu Gly Gln Leu
    785 790 795 800
    Val Gly Leu Asn Ser Pro Asn Ser Ile Leu Lys Ala Ala Lys Thr Leu
    805 810 815
    Tyr Glu His Tyr Ser Gly Gly Glu Ser His Asn Ser Ser Ser Ser Lys
    820 825 830
    Thr Phe Glu Lys Lys Arg Gly Lys Lys
    835 840
    <210> SEQ ID NO 15
    <211> LENGTH: 2735
    <212> TYPE: DNA
    <213> ORGANISM: Saccharomyces cerevisiae
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (34)...(2499)
    <400> SEQUENCE: 15
    agaaaagata gtgttacaca acatcaacta aaa atg gaa aat att aca caa ccc 54
    Met Glu Asn Ile Thr Gln Pro
    1 5
    aca cag caa tcc acg cag gct act caa agg ttt ttg att gag aag ttt 102
    Thr Gln Gln Ser Thr Gln Ala Thr Gln Arg Phe Leu Ile Glu Lys Phe
    10 15 20
    tct caa gaa cag atc ggc gaa aac att gtg tgc agg gtc att tgt acc 150
    Ser Gln Glu Gln Ile Gly Glu Asn Ile Val Cys Arg Val Ile Cys Thr
    25 30 35
    acg ggt caa att ccc atc cga gat ttg tca gct gat att tca caa gtg 198
    Thr Gly Gln Ile Pro Ile Arg Asp Leu Ser Ala Asp Ile Ser Gln Val
    40 45 50 55
    ctt aag gaa aaa cga tcc ata aag aaa gtt tgg aca ttt ggt aga aac 246
    Leu Lys Glu Lys Arg Ser Ile Lys Lys Val Trp Thr Phe Gly Arg Asn
    60 65 70
    cca gcc tgt gac tat cat tta gga aac att tca aga ctg tca aat aag 294
    Pro Ala Cys Asp Tyr His Leu Gly Asn Ile Ser Arg Leu Ser Asn Lys
    75 80 85
    cat ttc caa ata cta cta gga gaa gac ggt aac ctt tta ttg aat gac 342
    His Phe Gln Ile Leu Leu Gly Glu Asp Gly Asn Leu Leu Leu Asn Asp
    90 95 100
    att tcc act aat ggg acc tgg tta aat ggg caa aaa gtc gag aag aac 390
    Ile Ser Thr Asn Gly Thr Trp Leu Asn Gly Gln Lys Val Glu Lys Asn
    105 110 115
    agc aat cag tta ctg tct caa ggt gat gaa ata acc gtt ggt gta ggc 438
    Ser Asn Gln Leu Leu Ser Gln Gly Asp Glu Ile Thr Val Gly Val Gly
    120 125 130 135
    gtg gaa tca gat att tta tct ctg gtc att ttc ata aac gac aaa ttt 486
    Val Glu Ser Asp Ile Leu Ser Leu Val Ile Phe Ile Asn Asp Lys Phe
    140 145 150
    aag cag tgc ctc gag cag aac aaa gtt gat cgc ata aga tct aac ctg 534
    Lys Gln Cys Leu Glu Gln Asn Lys Val Asp Arg Ile Arg Ser Asn Leu
    155 160 165
    aaa aat acc tct aaa ata gct tct cct ggt ctt aca tca tct act gca 582
    Lys Asn Thr Ser Lys Ile Ala Ser Pro Gly Leu Thr Ser Ser Thr Ala
    170 175 180
    tca tca atg gtg gcc aac aag act ggt att ttt aag gat ttt tcg att 630
    Ser Ser Met Val Ala Asn Lys Thr Gly Ile Phe Lys Asp Phe Ser Ile
    185 190 195
    att gac gaa gtg gtg ggc cag ggt gca ttt gcc aca gta aag aaa gcc 678
    Ile Asp Glu Val Val Gly Gln Gly Ala Phe Ala Thr Val Lys Lys Ala
    200 205 210 215
    att gaa aga act act ggg aaa aca ttc gcg gtg aag att ata agt aaa 726
    Ile Glu Arg Thr Thr Gly Lys Thr Phe Ala Val Lys Ile Ile Ser Lys
    220 225 230
    cgc aaa gta ata ggc aat atg gat ggt gtg aca aga gag tta gaa gta 774
    Arg Lys Val Ile Gly Asn Met Asp Gly Val Thr Arg Glu Leu Glu Val
    235 240 245
    ttg caa aag ctc aat cat cca agg ata gta cga ttg aaa gga ttt tat 822
    Leu Gln Lys Leu Asn His Pro Arg Ile Val Arg Leu Lys Gly Phe Tyr
    250 255 260
    gaa gat act gag agt tat tat atg gtg atg gag ttc gtt tct ggt ggt 870
    Glu Asp Thr Glu Ser Tyr Tyr Met Val Met Glu Phe Val Ser Gly Gly
    265 270 275
    gac tta atg gat ttt gtt gct gct cat ggt gcg gtt gga gaa gat gct 918
    Asp Leu Met Asp Phe Val Ala Ala His Gly Ala Val Gly Glu Asp Ala
    280 285 290 295
    ggg agg gag ata tcc agg cag ata ctc aca gca ata aaa tac att cac 966
    Gly Arg Glu Ile Ser Arg Gln Ile Leu Thr Ala Ile Lys Tyr Ile His
    300 305 310
    tct atg ggc atc agc cat cgt gac cta aag ccc gat aat att ctt att 1014
    Ser Met Gly Ile Ser His Arg Asp Leu Lys Pro Asp Asn Ile Leu Ile
    315 320 325
    gaa caa gac gat cct gta ttg gta aag ata acc gac ttt ggt ctg gca 1062
    Glu Gln Asp Asp Pro Val Leu Val Lys Ile Thr Asp Phe Gly Leu Ala
    330 335 340
    aaa gta caa gga aat ggg tct ttt atg aaa acc ttc tgt ggc act ttg 1110
    Lys Val Gln Gly Asn Gly Ser Phe Met Lys Thr Phe Cys Gly Thr Leu
    345 350 355
    gca tat gtg gca cct gaa gtc atc aga ggt aaa gat aca tcc gta tct 1158
    Ala Tyr Val Ala Pro Glu Val Ile Arg Gly Lys Asp Thr Ser Val Ser
    360 365 370 375
    cct gat gaa tac gaa gaa agg aat gag tac tct tcg tta gtg gat atg 1206
    Pro Asp Glu Tyr Glu Glu Arg Asn Glu Tyr Ser Ser Leu Val Asp Met
    380 385 390
    tgg tca atg gga tgt ctt gtg tat gtt atc cta acg ggc cac tta cct 1254
    Trp Ser Met Gly Cys Leu Val Tyr Val Ile Leu Thr Gly His Leu Pro
    395 400 405
    ttt agt ggt agc aca cag gac caa tta tat aaa cag att gga aga ggc 1302
    Phe Ser Gly Ser Thr Gln Asp Gln Leu Tyr Lys Gln Ile Gly Arg Gly
    410 415 420
    tca tat cat gaa ggg ccc ctc aaa gat ttc cgg ata tct gaa gaa gca 1350
    Ser Tyr His Glu Gly Pro Leu Lys Asp Phe Arg Ile Ser Glu Glu Ala
    425 430 435
    aga gat ttc ata gat tca ttg tta cag gtg gat cca aat aat agg tcg 1398
    Arg Asp Phe Ile Asp Ser Leu Leu Gln Val Asp Pro Asn Asn Arg Ser
    440 445 450 455
    aca gct gca aaa gcc ttg aat cat ccc tgg atc aag atg agt cca ttg 1446
    Thr Ala Ala Lys Ala Leu Asn His Pro Trp Ile Lys Met Ser Pro Leu
    460 465 470
    ggc tca caa tca tat ggt gat ttt tca caa ata tcc tta tca caa tcg 1494
    Gly Ser Gln Ser Tyr Gly Asp Phe Ser Gln Ile Ser Leu Ser Gln Ser
    475 480 485
    ttg tcg cag cag aaa tta tta gaa aat atg gac gat gct caa tac gaa 1542
    Leu Ser Gln Gln Lys Leu Leu Glu Asn Met Asp Asp Ala Gln Tyr Glu
    490 495 500
    ttt gtc aaa gcg caa agg aaa tta caa atg gag caa caa ctt caa gaa 1590
    Phe Val Lys Ala Gln Arg Lys Leu Gln Met Glu Gln Gln Leu Gln Glu
    505 510 515
    cag gat cag gaa gac caa gat gga aaa att caa gga ttt aaa ata ccc 1638
    Gln Asp Gln Glu Asp Gln Asp Gly Lys Ile Gln Gly Phe Lys Ile Pro
    520 525 530 535
    gca cac gcc cct att cga tat aca cag ccc aaa agc att gaa gca gaa 1686
    Ala His Ala Pro Ile Arg Tyr Thr Gln Pro Lys Ser Ile Glu Ala Glu
    540 545 550
    act aga gaa caa aaa ctt tta cat tcc aat aat act gag aat gtc aag 1734
    Thr Arg Glu Gln Lys Leu Leu His Ser Asn Asn Thr Glu Asn Val Lys
    555 560 565
    agc tca aag aaa aag ggt aat ggt agg ttt tta act tta aaa cca ttg 1782
    Ser Ser Lys Lys Lys Gly Asn Gly Arg Phe Leu Thr Leu Lys Pro Leu
    570 575 580
    cct gac agc att att caa gaa agc ctg gag att cag caa ggt gtg aat 1830
    Pro Asp Ser Ile Ile Gln Glu Ser Leu Glu Ile Gln Gln Gly Val Asn
    585 590 595
    cca ttt ttc att ggt aga tcc gag gat tgc aat tgt aaa att gaa gac 1878
    Pro Phe Phe Ile Gly Arg Ser Glu Asp Cys Asn Cys Lys Ile Glu Asp
    600 605 610 615
    aat agg ttg tct cga gtt cat tgc ttc att ttc aaa aag agg cat gct 1926
    Asn Arg Leu Ser Arg Val His Cys Phe Ile Phe Lys Lys Arg His Ala
    620 625 630
    gta ggc aaa agc atg tat gaa tct ccg gca caa ggt tta gat gat att 1974
    Val Gly Lys Ser Met Tyr Glu Ser Pro Ala Gln Gly Leu Asp Asp Ile
    635 640 645
    tgg tat tgc cac acc gga act aac gtg agc tat tta aat aat aac cgc 2022
    Trp Tyr Cys His Thr Gly Thr Asn Val Ser Tyr Leu Asn Asn Asn Arg
    650 655 660
    atg ata cag ggt acg aaa ttc ctt tta caa gac gga gat gaa atc aag 2070
    Met Ile Gln Gly Thr Lys Phe Leu Leu Gln Asp Gly Asp Glu Ile Lys
    665 670 675
    atc att tgg gat aaa aac aat aaa ttt gtc att ggc ttt aaa gtg gaa 2118
    Ile Ile Trp Asp Lys Asn Asn Lys Phe Val Ile Gly Phe Lys Val Glu
    680 685 690 695
    att aac gat act aca ggt ctg ttt aac gag gga tta ggt atg tta caa 2166
    Ile Asn Asp Thr Thr Gly Leu Phe Asn Glu Gly Leu Gly Met Leu Gln
    700 705 710
    gaa caa aga gta gta ctt aag caa aca gcc gaa gaa aaa gat ttg gtg 2214
    Glu Gln Arg Val Val Leu Lys Gln Thr Ala Glu Glu Lys Asp Leu Val
    715 720 725
    aaa aag tta acc cag atg atg gca gct caa cgt gca aat caa ccc tcg 2262
    Lys Lys Leu Thr Gln Met Met Ala Ala Gln Arg Ala Asn Gln Pro Ser
    730 735 740
    gct tct tct tca tca atg tcg gct aag aag ccg cca gtt agc gat aca 2310
    Ala Ser Ser Ser Ser Met Ser Ala Lys Lys Pro Pro Val Ser Asp Thr
    745 750 755
    aat aat aac ggc aat aat tcg gta cta aac gac ttg gta gag tca ccg 2358
    Asn Asn Asn Gly Asn Asn Ser Val Leu Asn Asp Leu Val Glu Ser Pro
    760 765 770 775
    att aat gcg aat acg ggg aac att ttg aag aga ata cat tcg gta agt 2406
    Ile Asn Ala Asn Thr Gly Asn Ile Leu Lys Arg Ile His Ser Val Ser
    780 785 790
    tta tcg caa tca caa att gat cct agt aag aag gtt aaa agg gca aaa 2454
    Leu Ser Gln Ser Gln Ile Asp Pro Ser Lys Lys Val Lys Arg Ala Lys
    795 800 805
    ttg gac caa acc tca aaa ggc ccc gag aat ttg caa ttt tcg taa 2499
    Leu Asp Gln Thr Ser Lys Gly Pro Glu Asn Leu Gln Phe Ser *
    810 815 820
    ccaaggacaa atacccatag aaaatgctgc ccctttttaa gagagaagat ggtagatacc 2559
    aatactcaga attcccagta caaagaacca atatcggagt caataaacag tatgatgaac 2619
    ttgctttcgc aaataaaaga tatcactcag aagcacccag taataaagga tgcagatagc 2679
    tcgagatttg gtaaggttga gtttagggac ttttatgacg aagtttcacg gaattc 2735
    <210> SEQ ID NO 16
    <211> LENGTH: 821
    <212> TYPE: PRT
    <213> ORGANISM: Saccharomyces cerevisiae
    <400> SEQUENCE: 16
    Met Glu Asn Ile Thr Gln Pro Thr Gln Gln Ser Thr Gln Ala Thr Gln
    1 5 10 15
    Arg Phe Leu Ile Glu Lys Phe Ser Gln Glu Gln Ile Gly Glu Asn Ile
    20 25 30
    Val Cys Arg Val Ile Cys Thr Thr Gly Gln Ile Pro Ile Arg Asp Leu
    35 40 45
    Ser Ala Asp Ile Ser Gln Val Leu Lys Glu Lys Arg Ser Ile Lys Lys
    50 55 60
    Val Trp Thr Phe Gly Arg Asn Pro Ala Cys Asp Tyr His Leu Gly Asn
    65 70 75 80
    Ile Ser Arg Leu Ser Asn Lys His Phe Gln Ile Leu Leu Gly Glu Asp
    85 90 95
    Gly Asn Leu Leu Leu Asn Asp Ile Ser Thr Asn Gly Thr Trp Leu Asn
    100 105 110
    Gly Gln Lys Val Glu Lys Asn Ser Asn Gln Leu Leu Ser Gln Gly Asp
    115 120 125
    Glu Ile Thr Val Gly Val Gly Val Glu Ser Asp Ile Leu Ser Leu Val
    130 135 140
    Ile Phe Ile Asn Asp Lys Phe Lys Gln Cys Leu Glu Gln Asn Lys Val
    145 150 155 160
    Asp Arg Ile Arg Ser Asn Leu Lys Asn Thr Ser Lys Ile Ala Ser Pro
    165 170 175
    Gly Leu Thr Ser Ser Thr Ala Ser Ser Met Val Ala Asn Lys Thr Gly
    180 185 190
    Ile Phe Lys Asp Phe Ser Ile Ile Asp Glu Val Val Gly Gln Gly Ala
    195 200 205
    Phe Ala Thr Val Lys Lys Ala Ile Glu Arg Thr Thr Gly Lys Thr Phe
    210 215 220
    Ala Val Lys Ile Ile Ser Lys Arg Lys Val Ile Gly Asn Met Asp Gly
    225 230 235 240
    Val Thr Arg Glu Leu Glu Val Leu Gln Lys Leu Asn His Pro Arg Ile
    245 250 255
    Val Arg Leu Lys Gly Phe Tyr Glu Asp Thr Glu Ser Tyr Tyr Met Val
    260 265 270
    Met Glu Phe Val Ser Gly Gly Asp Leu Met Asp Phe Val Ala Ala His
    275 280 285
    Gly Ala Val Gly Glu Asp Ala Gly Arg Glu Ile Ser Arg Gln Ile Leu
    290 295 300
    Thr Ala Ile Lys Tyr Ile His Ser Met Gly Ile Ser His Arg Asp Leu
    305 310 315 320
    Lys Pro Asp Asn Ile Leu Ile Glu Gln Asp Asp Pro Val Leu Val Lys
    325 330 335
    Ile Thr Asp Phe Gly Leu Ala Lys Val Gln Gly Asn Gly Ser Phe Met
    340 345 350
    Lys Thr Phe Cys Gly Thr Leu Ala Tyr Val Ala Pro Glu Val Ile Arg
    355 360 365
    Gly Lys Asp Thr Ser Val Ser Pro Asp Glu Tyr Glu Glu Arg Asn Glu
    370 375 380
    Tyr Ser Ser Leu Val Asp Met Trp Ser Met Gly Cys Leu Val Tyr Val
    385 390 395 400
    Ile Leu Thr Gly His Leu Pro Phe Ser Gly Ser Thr Gln Asp Gln Leu
    405 410 415
    Tyr Lys Gln Ile Gly Arg Gly Ser Tyr His Glu Gly Pro Leu Lys Asp
    420 425 430
    Phe Arg Ile Ser Glu Glu Ala Arg Asp Phe Ile Asp Ser Leu Leu Gln
    435 440 445
    Val Asp Pro Asn Asn Arg Ser Thr Ala Ala Lys Ala Leu Asn His Pro
    450 455 460
    Trp Ile Lys Met Ser Pro Leu Gly Ser Gln Ser Tyr Gly Asp Phe Ser
    465 470 475 480
    Gln Ile Ser Leu Ser Gln Ser Leu Ser Gln Gln Lys Leu Leu Glu Asn
    485 490 495
    Met Asp Asp Ala Gln Tyr Glu Phe Val Lys Ala Gln Arg Lys Leu Gln
    500 505 510
    Met Glu Gln Gln Leu Gln Glu Gln Asp Gln Glu Asp Gln Asp Gly Lys
    515 520 525
    Ile Gln Gly Phe Lys Ile Pro Ala His Ala Pro Ile Arg Tyr Thr Gln
    530 535 540
    Pro Lys Ser Ile Glu Ala Glu Thr Arg Glu Gln Lys Leu Leu His Ser
    545 550 555 560
    Asn Asn Thr Glu Asn Val Lys Ser Ser Lys Lys Lys Gly Asn Gly Arg
    565 570 575
    Phe Leu Thr Leu Lys Pro Leu Pro Asp Ser Ile Ile Gln Glu Ser Leu
    580 585 590
    Glu Ile Gln Gln Gly Val Asn Pro Phe Phe Ile Gly Arg Ser Glu Asp
    595 600 605
    Cys Asn Cys Lys Ile Glu Asp Asn Arg Leu Ser Arg Val His Cys Phe
    610 615 620
    Ile Phe Lys Lys Arg His Ala Val Gly Lys Ser Met Tyr Glu Ser Pro
    625 630 635 640
    Ala Gln Gly Leu Asp Asp Ile Trp Tyr Cys His Thr Gly Thr Asn Val
    645 650 655
    Ser Tyr Leu Asn Asn Asn Arg Met Ile Gln Gly Thr Lys Phe Leu Leu
    660 665 670
    Gln Asp Gly Asp Glu Ile Lys Ile Ile Trp Asp Lys Asn Asn Lys Phe
    675 680 685
    Val Ile Gly Phe Lys Val Glu Ile Asn Asp Thr Thr Gly Leu Phe Asn
    690 695 700
    Glu Gly Leu Gly Met Leu Gln Glu Gln Arg Val Val Leu Lys Gln Thr
    705 710 715 720
    Ala Glu Glu Lys Asp Leu Val Lys Lys Leu Thr Gln Met Met Ala Ala
    725 730 735
    Gln Arg Ala Asn Gln Pro Ser Ala Ser Ser Ser Ser Met Ser Ala Lys
    740 745 750
    Lys Pro Pro Val Ser Asp Thr Asn Asn Asn Gly Asn Asn Ser Val Leu
    755 760 765
    Asn Asp Leu Val Glu Ser Pro Ile Asn Ala Asn Thr Gly Asn Ile Leu
    770 775 780
    Lys Arg Ile His Ser Val Ser Leu Ser Gln Ser Gln Ile Asp Pro Ser
    785 790 795 800
    Lys Lys Val Lys Arg Ala Lys Leu Asp Gln Thr Ser Lys Gly Pro Glu
    805 810 815
    Asn Leu Gln Phe Ser
    820
    <210> SEQ ID NO 17
    <211> LENGTH: 2525
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (289)...(1230)
    <400> SEQUENCE: 17
    tcctgccccg cggcgctgcc gcacgagccc cacgagccgc tcaccccgcc gttctcagcg 60
    ctgcccgacc ccgctggcgc gccctcccgc cgccagtccc ggcagcgccc tcagttgtcc 120
    tccgactcgc cctcggcctt ccgcgccagc cgcagccaca gccgcaacgc cacccgcagc 180
    cacagccaca gccacagccc caggcatagc cttcggcaca gccccggctc cggctcctgc 240
    ggcagctcct ctgggcaccg tccctgcgcc gacatcctgg aggttggg atg ctc ttg 297
    Met Leu Leu
    1
    tcc aaa atc aac tcg ctt gcc cac ctg cgc gcc gcg ccc tgc aac gac 345
    Ser Lys Ile Asn Ser Leu Ala His Leu Arg Ala Ala Pro Cys Asn Asp
    5 10 15
    ctg cac gcc acc aag ctg gcg ccc ggc aag gag aag gag ccc ctg gag 393
    Leu His Ala Thr Lys Leu Ala Pro Gly Lys Glu Lys Glu Pro Leu Glu
    20 25 30 35
    tcg cag tac cag gtg ggc ccg cta ctg ggc agc ggc ggc ttc ggc tcg 441
    Ser Gln Tyr Gln Val Gly Pro Leu Leu Gly Ser Gly Gly Phe Gly Ser
    40 45 50
    gtc tac tca ggc atc cgc gtc tcc gac aac ttg ccg gtg gcc atc aaa 489
    Val Tyr Ser Gly Ile Arg Val Ser Asp Asn Leu Pro Val Ala Ile Lys
    55 60 65
    cac gtg gag aag gac cgg att tcc gac tgg gga gag ctg cct aat ggc 537
    His Val Glu Lys Asp Arg Ile Ser Asp Trp Gly Glu Leu Pro Asn Gly
    70 75 80
    act cga gtg ccc atg gaa gtg gtc ctg ctg aag aag gtg agc tcg ggt 585
    Thr Arg Val Pro Met Glu Val Val Leu Leu Lys Lys Val Ser Ser Gly
    85 90 95
    ttc tcc ggc gtc att agg ctc ctg gac tgg ttc gag agg ccc gac agt 633
    Phe Ser Gly Val Ile Arg Leu Leu Asp Trp Phe Glu Arg Pro Asp Ser
    100 105 110 115
    ttc gtc ctg atc ctg gag agg ccc gag ccg gtg caa gat ctc ttc gac 681
    Phe Val Leu Ile Leu Glu Arg Pro Glu Pro Val Gln Asp Leu Phe Asp
    120 125 130
    ttc atc acg gaa agg gga gcc ctg caa gag gag ctc gcc cgc agc ttc 729
    Phe Ile Thr Glu Arg Gly Ala Leu Gln Glu Glu Leu Ala Arg Ser Phe
    135 140 145
    ttc tgg cag gtg ctg gag gcc gtg cgg cac tgc cac aac tgc ggg gtg 777
    Phe Trp Gln Val Leu Glu Ala Val Arg His Cys His Asn Cys Gly Val
    150 155 160
    ctc cac cgc gac atc aag gac gaa aac atc ctt atc gac ctc aat cgc 825
    Leu His Arg Asp Ile Lys Asp Glu Asn Ile Leu Ile Asp Leu Asn Arg
    165 170 175
    ggc gag ctc aag ctc atc gac ttc ggg tcg ggg gcg ctg ctc aaa gac 873
    Gly Glu Leu Lys Leu Ile Asp Phe Gly Ser Gly Ala Leu Leu Lys Asp
    180 185 190 195
    acc gtc tac acg gac ttc gat ggg acc cga gtg tat agc cct cca gag 921
    Thr Val Tyr Thr Asp Phe Asp Gly Thr Arg Val Tyr Ser Pro Pro Glu
    200 205 210
    tgg atc cgc tac cat cgc tac cat ggc agg tcg gcg gca gtc tgg tcc 969
    Trp Ile Arg Tyr His Arg Tyr His Gly Arg Ser Ala Ala Val Trp Ser
    215 220 225
    ctg ggg atc ctg ctg tat gat atg gtg tgt gga gat att cct ttc gag 1017
    Leu Gly Ile Leu Leu Tyr Asp Met Val Cys Gly Asp Ile Pro Phe Glu
    230 235 240
    cat gac gaa gag atc atc agg ggc cag gtt ttc ttc agg cag agg gtc 1065
    His Asp Glu Glu Ile Ile Arg Gly Gln Val Phe Phe Arg Gln Arg Val
    245 250 255
    tct tca gaa tgt cag cat ctc att aga tgg tgc ttg gcc ctg aga cca 1113
    Ser Ser Glu Cys Gln His Leu Ile Arg Trp Cys Leu Ala Leu Arg Pro
    260 265 270 275
    tca gat agg cca acc ttc gaa gaa atc cag aac cat cca tgg atg caa 1161
    Ser Asp Arg Pro Thr Phe Glu Glu Ile Gln Asn His Pro Trp Met Gln
    280 285 290
    gat gtt ctc ctg ccc cag gaa act gct gag atc cac ctc cac agc ctg 1209
    Asp Val Leu Leu Pro Gln Glu Thr Ala Glu Ile His Leu His Ser Leu
    295 300 305
    tcg ccg ggg ccc agc aaa tag cagcctttct ggcaggtcct cccctctctt 1260
    Ser Pro Gly Pro Ser Lys *
    310
    gtcagatgcc cgagggaggg gaagcttctg tctccagctt cccgagtacc agtgacacgt 1320
    ctcgccaagc aggacagtgc ttgatacagg aacaacattt acaactcatt ccagatccca 1380
    ggcccctgga ggctgcctcc caacagtgag gaagagtgac tctccagggg tcctaggcct 1440
    caactcctcc catagatact ctcttcttct cataggtgtc cagcattgct ggactgctga 1500
    aatatcccgg gggtgggggg tgggggtggg tcagaaccct gccatggaac tgtttccttc 1560
    atcatgagtt ctgctgaatg ccgcgatggg tcaggtaggg gggaaacagg ttgggatggg 1620
    ataggactag caccatttta agtccctgtc acctcttccg actctttctg agtgccttct 1680
    gtggggactc cggctgtgct gggagaaata cttgaacttg cctcttttac ctgctgcttc 1740
    tccaaaaatc tgcctgggtt ttgttcccta tttttctctc ctgtcctccc tcaccccctc 1800
    cttcatatga aaggtgccat ggaagaggct acagggccaa acgctgagcc acctgccctt 1860
    ttttctgcct cctttagtaa aactccgagt gaactggtct tcctttttgg tttttactta 1920
    actgtttcaa agccaagacc tcacacacag aaaaaatgca caaacaatgc aatcaacaga 1980
    aaagctgtaa atgtgtgtac agttggcatg gtagtataca aaaagattgt agtggatcta 2040
    atttttcaga aattttgcct ttaagttatt ttacctgttt ttgtttcttg ttttgaaaga 2100
    tgcgcattct aacctggagg tcaatgttat gtatttattt atttatttat ttggttccct 2160
    tcctattcca agcttccata gctgctgccc tagttttctt tcctcctttc ctcctctgac 2220
    ttggggacct tttgggggag ggctgcgacg cttgctctgt ttgtggggtg acgggactca 2280
    ggcgggacag tgctgcagct ccctggcttc tgtggggccc ctcacctact tacccaggtg 2340
    ggtcccggct ctgtgggtga tggggagggg cattgctgac tgtgtatata ggataattat 2400
    gaaaagcagt tctggatggt gtgccttcca gatcctctct ggggctgtgt tttgagcagc 2460
    aggtagcctg gctggtttta tctgagtgaa atactgtaca ggggaataaa agagatctta 2520
    ttttt 2525
    <210> SEQ ID NO 18
    <211> LENGTH: 313
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 18
    Met Leu Leu Ser Lys Ile Asn Ser Leu Ala His Leu Arg Ala Ala Pro
    1 5 10 15
    Cys Asn Asp Leu His Ala Thr Lys Leu Ala Pro Gly Lys Glu Lys Glu
    20 25 30
    Pro Leu Glu Ser Gln Tyr Gln Val Gly Pro Leu Leu Gly Ser Gly Gly
    35 40 45
    Phe Gly Ser Val Tyr Ser Gly Ile Arg Val Ser Asp Asn Leu Pro Val
    50 55 60
    Ala Ile Lys His Val Glu Lys Asp Arg Ile Ser Asp Trp Gly Glu Leu
    65 70 75 80
    Pro Asn Gly Thr Arg Val Pro Met Glu Val Val Leu Leu Lys Lys Val
    85 90 95
    Ser Ser Gly Phe Ser Gly Val Ile Arg Leu Leu Asp Trp Phe Glu Arg
    100 105 110
    Pro Asp Ser Phe Val Leu Ile Leu Glu Arg Pro Glu Pro Val Gln Asp
    115 120 125
    Leu Phe Asp Phe Ile Thr Glu Arg Gly Ala Leu Gln Glu Glu Leu Ala
    130 135 140
    Arg Ser Phe Phe Trp Gln Val Leu Glu Ala Val Arg His Cys His Asn
    145 150 155 160
    Cys Gly Val Leu His Arg Asp Ile Lys Asp Glu Asn Ile Leu Ile Asp
    165 170 175
    Leu Asn Arg Gly Glu Leu Lys Leu Ile Asp Phe Gly Ser Gly Ala Leu
    180 185 190
    Leu Lys Asp Thr Val Tyr Thr Asp Phe Asp Gly Thr Arg Val Tyr Ser
    195 200 205
    Pro Pro Glu Trp Ile Arg Tyr His Arg Tyr His Gly Arg Ser Ala Ala
    210 215 220
    Val Trp Ser Leu Gly Ile Leu Leu Tyr Asp Met Val Cys Gly Asp Ile
    225 230 235 240
    Pro Phe Glu His Asp Glu Glu Ile Ile Arg Gly Gln Val Phe Phe Arg
    245 250 255
    Gln Arg Val Ser Ser Glu Cys Gln His Leu Ile Arg Trp Cys Leu Ala
    260 265 270
    Leu Arg Pro Ser Asp Arg Pro Thr Phe Glu Glu Ile Gln Asn His Pro
    275 280 285
    Trp Met Gln Asp Val Leu Leu Pro Gln Glu Thr Ala Glu Ile His Leu
    290 295 300
    His Ser Leu Ser Pro Gly Pro Ser Lys
    305 310
    <210> SEQ ID NO 19
    <211> LENGTH: 3401
    <212> TYPE: DNA
    <213> ORGANISM: Saccharomyces cerevisiae
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (789)...(2795)
    <400> SEQUENCE: 19
    atcgatacaa ctccccagaa atatcactgt tgagagttca tgtcaagacg tagtatagta 60
    ttgcaacagg aaaaaaaaat cttattgcgt agcactctgt atctatttta tatatctgtt 120
    tctatatttg attaatctct tgttatcttg gtgatgatcg cacaagtatg tactcctgta 180
    tctgcaagaa tatctgtttt aaacttttca aagcaaggaa accccgtctt atataggtta 240
    tccgcaaagg tcacattttc ttgcaaatag aagaaaaagc acccacaagc acactaacac 300
    agtgccagag caaaactata tcctttgcat ccgatctcaa acgctgttct tatcgcatct 360
    gtcttcgtcc tttcatctgc atttaccttt tctttttcat cctctatttg ccttttcatt 420
    agtggcaatt tttccagttt tttccctctg cgtcccgttg cacctgaaag gatctttcta 480
    acgtgtgttg tctactagtg agcgatttcg tgagccatac acgttctata gaaaattgaa 540
    taaactttac ttcaaaggga tctggacaca gagataactg cttacctgct tgccggaaga 600
    aaagaattac taaaaaagaa gacaagggta gctgctattg tgggtacacg tttcacagaa 660
    ctactttttc cttgtccttc tccagacatc aacgtcatac aactaaaact gataaagtac 720
    ccgtttttcc gtacatttct atagatacat tattatatta agcagatcga gacgttaatt 780
    tctcaaag atg gaa gac aag ttt gct aac ctc agt ctc cat gag aaa act 830
    Met Glu Asp Lys Phe Ala Asn Leu Ser Leu His Glu Lys Thr
    1 5 10
    ggt aag tca tct atc caa tta aac gag caa aca ggc tca gat aat ggc 878
    Gly Lys Ser Ser Ile Gln Leu Asn Glu Gln Thr Gly Ser Asp Asn Gly
    15 20 25 30
    tct gct gtc aag aga aca tct tcg acg tcc tcg cac tac aat aac atc 926
    Ser Ala Val Lys Arg Thr Ser Ser Thr Ser Ser His Tyr Asn Asn Ile
    35 40 45
    aac gct gac ctt cat gct cgt gta aaa gct ttt caa gaa caa cgt gca 974
    Asn Ala Asp Leu His Ala Arg Val Lys Ala Phe Gln Glu Gln Arg Ala
    50 55 60
    ttg aaa agg tct gcc agc gtg ggc agt aat caa agc gag caa gac aaa 1022
    Leu Lys Arg Ser Ala Ser Val Gly Ser Asn Gln Ser Glu Gln Asp Lys
    65 70 75
    ggc agt tca caa tca cct aaa cat att cag cag att gtt aat aag cca 1070
    Gly Ser Ser Gln Ser Pro Lys His Ile Gln Gln Ile Val Asn Lys Pro
    80 85 90
    ttg ccg cct ctt ccc gta gca gga agt tct aag gtt tca caa aga atg 1118
    Leu Pro Pro Leu Pro Val Ala Gly Ser Ser Lys Val Ser Gln Arg Met
    95 100 105 110
    agt agc caa gtc gtg caa gcg tcc tcc aag agc act ctt aag aac gtt 1166
    Ser Ser Gln Val Val Gln Ala Ser Ser Lys Ser Thr Leu Lys Asn Val
    115 120 125
    ctg gac aat caa gaa aca caa aac att acc gac gta aat att aac atc 1214
    Leu Asp Asn Gln Glu Thr Gln Asn Ile Thr Asp Val Asn Ile Asn Ile
    130 135 140
    gat aca acc aaa att acc gcc aca aca att ggt gta aat act ggc cta 1262
    Asp Thr Thr Lys Ile Thr Ala Thr Thr Ile Gly Val Asn Thr Gly Leu
    145 150 155
    cct gct act gac att acg ccg tca gtt tct aat act gca tca gca aca 1310
    Pro Ala Thr Asp Ile Thr Pro Ser Val Ser Asn Thr Ala Ser Ala Thr
    160 165 170
    cat aag gcg caa ttg ctg aat cct aac aga agg gca cca aga agg ccg 1358
    His Lys Ala Gln Leu Leu Asn Pro Asn Arg Arg Ala Pro Arg Arg Pro
    175 180 185 190
    ctt tct acc cag cac cct aca aga cca aat gtt gcc ccg cat aag gcc 1406
    Leu Ser Thr Gln His Pro Thr Arg Pro Asn Val Ala Pro His Lys Ala
    195 200 205
    cct gct ata atc aac aca cca aaa caa agt tta agt gcc cgt cga ggg 1454
    Pro Ala Ile Ile Asn Thr Pro Lys Gln Ser Leu Ser Ala Arg Arg Gly
    210 215 220
    ctc aaa tta cca cca gga gga atg tca tta aaa atg ccc act aaa aca 1502
    Leu Lys Leu Pro Pro Gly Gly Met Ser Leu Lys Met Pro Thr Lys Thr
    225 230 235
    gct caa cag ccg cag cag ttt gcc cca agc cct tca aac aaa aaa cat 1550
    Ala Gln Gln Pro Gln Gln Phe Ala Pro Ser Pro Ser Asn Lys Lys His
    240 245 250
    ata gaa acc tta tca aac agc aaa gtt gtt gaa ggg aaa aga tcg aat 1598
    Ile Glu Thr Leu Ser Asn Ser Lys Val Val Glu Gly Lys Arg Ser Asn
    255 260 265 270
    ccg ggt tct ttg ata aat ggt gtg caa agc aca tcc acc tca tca agt 1646
    Pro Gly Ser Leu Ile Asn Gly Val Gln Ser Thr Ser Thr Ser Ser Ser
    275 280 285
    acc gaa ggc cca cat gac act gta ggc act aca ccc aga act gga aac 1694
    Thr Glu Gly Pro His Asp Thr Val Gly Thr Thr Pro Arg Thr Gly Asn
    290 295 300
    agc aac aac tct tca aat tct ggt agt agt ggt ggt ggt ggt ctt ttc 1742
    Ser Asn Asn Ser Ser Asn Ser Gly Ser Ser Gly Gly Gly Gly Leu Phe
    305 310 315
    gca aat ttc tcg aaa tac gtg gat atc aaa tcc ggc tct ttg aat ttt 1790
    Ala Asn Phe Ser Lys Tyr Val Asp Ile Lys Ser Gly Ser Leu Asn Phe
    320 325 330
    gca ggc aaa cta tcg cta tcc tct aaa gga ata gat ttc agc aat ggt 1838
    Ala Gly Lys Leu Ser Leu Ser Ser Lys Gly Ile Asp Phe Ser Asn Gly
    335 340 345 350
    tct agt tcg aga att aca ttg gac gaa cta gaa ttt ttg gat gaa ctg 1886
    Ser Ser Ser Arg Ile Thr Leu Asp Glu Leu Glu Phe Leu Asp Glu Leu
    355 360 365
    ggt cat ggt aac tat ggt aac gtc tca aag gta ctg cat aag ccc aca 1934
    Gly His Gly Asn Tyr Gly Asn Val Ser Lys Val Leu His Lys Pro Thr
    370 375 380
    aat gtt att atg gcg acg aag gaa gtc cgt ttg gag cta gat gag gct 1982
    Asn Val Ile Met Ala Thr Lys Glu Val Arg Leu Glu Leu Asp Glu Ala
    385 390 395
    aaa ttt aga caa att tta atg gaa cta gaa gtt ttg cat aaa tgc aat 2030
    Lys Phe Arg Gln Ile Leu Met Glu Leu Glu Val Leu His Lys Cys Asn
    400 405 410
    tct ccc tat att gtg gat ttt tat ggt gca ttc ttt att gag ggc gcc 2078
    Ser Pro Tyr Ile Val Asp Phe Tyr Gly Ala Phe Phe Ile Glu Gly Ala
    415 420 425 430
    gtc tac atg tgt atg gaa tac atg gat ggt ggt tcc ttg gat aaa ata 2126
    Val Tyr Met Cys Met Glu Tyr Met Asp Gly Gly Ser Leu Asp Lys Ile
    435 440 445
    tac gac gaa tca tct gaa atc ggc ggc att gat gaa cct cag cta gcg 2174
    Tyr Asp Glu Ser Ser Glu Ile Gly Gly Ile Asp Glu Pro Gln Leu Ala
    450 455 460
    ttt att gcc aat gct gtc att cat gga cta aaa gaa ctc aaa gag cag 2222
    Phe Ile Ala Asn Ala Val Ile His Gly Leu Lys Glu Leu Lys Glu Gln
    465 470 475
    cat aat atc ata cac aga gat gtc aaa cca aca aat att tta tgt tca 2270
    His Asn Ile Ile His Arg Asp Val Lys Pro Thr Asn Ile Leu Cys Ser
    480 485 490
    gcc aac caa ggc acc gta aag ctg tgc gat ttc ggt gtt tct ggt aat 2318
    Ala Asn Gln Gly Thr Val Lys Leu Cys Asp Phe Gly Val Ser Gly Asn
    495 500 505 510
    ttg gtg gca tct tta gcg aag act aat att ggt tgt cag tca tac atg 2366
    Leu Val Ala Ser Leu Ala Lys Thr Asn Ile Gly Cys Gln Ser Tyr Met
    515 520 525
    gca cct gaa cga atc aaa tcg ttg aat cca gat aga gcc acc tat acc 2414
    Ala Pro Glu Arg Ile Lys Ser Leu Asn Pro Asp Arg Ala Thr Tyr Thr
    530 535 540
    gta cag tca gac atc tgg tct tta ggt tta agc att ctg gaa atg gca 2462
    Val Gln Ser Asp Ile Trp Ser Leu Gly Leu Ser Ile Leu Glu Met Ala
    545 550 555
    cta ggt aga tat ccg tat cca cca gaa aca tac gac aac att ttc tct 2510
    Leu Gly Arg Tyr Pro Tyr Pro Pro Glu Thr Tyr Asp Asn Ile Phe Ser
    560 565 570
    caa ttg agc gct att gtt gat ggg ccg cca ccg aga tta cct tca gat 2558
    Gln Leu Ser Ala Ile Val Asp Gly Pro Pro Pro Arg Leu Pro Ser Asp
    575 580 585 590
    aaa ttc agt tct gac gca caa gat ttt gtt tct tta tgt cta caa aag 2606
    Lys Phe Ser Ser Asp Ala Gln Asp Phe Val Ser Leu Cys Leu Gln Lys
    595 600 605
    att ccg gaa aga aga cct aca tac gca gct tta aca gag cat cct tgg 2654
    Ile Pro Glu Arg Arg Pro Thr Tyr Ala Ala Leu Thr Glu His Pro Trp
    610 615 620
    tta gta aaa tac aga aac cag gat gtc cac atg agt gag tat atc act 2702
    Leu Val Lys Tyr Arg Asn Gln Asp Val His Met Ser Glu Tyr Ile Thr
    625 630 635
    gaa cga tta gaa agg cgc aac aaa atc tta cgg gaa cgt ggt gag aat 2750
    Glu Arg Leu Glu Arg Arg Asn Lys Ile Leu Arg Glu Arg Gly Glu Asn
    640 645 650
    ggt tta tct aaa aat gta ccg gca tta cat atg ggt ggt tta tag 2795
    Gly Leu Ser Lys Asn Val Pro Ala Leu His Met Gly Gly Leu *
    655 660 665
    cgttaatatc caaataaaag caaacaggca cgtgaatata acaacaaaaa aaaagcagac 2855
    gaaaagctac tgtggaaatg atgcggcgaa tacaaaaaaa ccttacatat acatatgttt 2915
    attgtaataa acttgcatta tactcgttat agacatatat atatatatat attcatatat 2975
    atatatcgtc tgacttcctt ttgtcgaacc taaaaaaggg cacgaattat gacagagtat 3035
    tgaggggatg ttatttcaag caccggcaag tgaagcgatg tggacgtcaa tatattgtgt 3095
    tattcgatta ttgctacggc catcgactcc tcgaaattat ttacgttcgg ggctgacaac 3155
    gcaagaaaga aaaaatgctc tggaattgtc tgatggtttt tccgctcttt acggctcaag 3215
    gctaggaaag aaaaaaaagt ccaaaatcat cgagaaaata aaaggtgttt tgaaagttca 3275
    aatccacgtt attgagagta gatgtggagt ctggaccagg aactatacct gtatcttacc 3335
    ctaacttcta aattttgcta ctttcacgga aaacagtaaa taattaccta tcaagataaa 3395
    gagctc 3401
    <210> SEQ ID NO 20
    <211> LENGTH: 668
    <212> TYPE: PRT
    <213> ORGANISM: Saccharomyces cerevisiae
    <400> SEQUENCE: 20
    Met Glu Asp Lys Phe Ala Asn Leu Ser Leu His Glu Lys Thr Gly Lys
    1 5 10 15
    Ser Ser Ile Gln Leu Asn Glu Gln Thr Gly Ser Asp Asn Gly Ser Ala
    20 25 30
    Val Lys Arg Thr Ser Ser Thr Ser Ser His Tyr Asn Asn Ile Asn Ala
    35 40 45
    Asp Leu His Ala Arg Val Lys Ala Phe Gln Glu Gln Arg Ala Leu Lys
    50 55 60
    Arg Ser Ala Ser Val Gly Ser Asn Gln Ser Glu Gln Asp Lys Gly Ser
    65 70 75 80
    Ser Gln Ser Pro Lys His Ile Gln Gln Ile Val Asn Lys Pro Leu Pro
    85 90 95
    Pro Leu Pro Val Ala Gly Ser Ser Lys Val Ser Gln Arg Met Ser Ser
    100 105 110
    Gln Val Val Gln Ala Ser Ser Lys Ser Thr Leu Lys Asn Val Leu Asp
    115 120 125
    Asn Gln Glu Thr Gln Asn Ile Thr Asp Val Asn Ile Asn Ile Asp Thr
    130 135 140
    Thr Lys Ile Thr Ala Thr Thr Ile Gly Val Asn Thr Gly Leu Pro Ala
    145 150 155 160
    Thr Asp Ile Thr Pro Ser Val Ser Asn Thr Ala Ser Ala Thr His Lys
    165 170 175
    Ala Gln Leu Leu Asn Pro Asn Arg Arg Ala Pro Arg Arg Pro Leu Ser
    180 185 190
    Thr Gln His Pro Thr Arg Pro Asn Val Ala Pro His Lys Ala Pro Ala
    195 200 205
    Ile Ile Asn Thr Pro Lys Gln Ser Leu Ser Ala Arg Arg Gly Leu Lys
    210 215 220
    Leu Pro Pro Gly Gly Met Ser Leu Lys Met Pro Thr Lys Thr Ala Gln
    225 230 235 240
    Gln Pro Gln Gln Phe Ala Pro Ser Pro Ser Asn Lys Lys His Ile Glu
    245 250 255
    Thr Leu Ser Asn Ser Lys Val Val Glu Gly Lys Arg Ser Asn Pro Gly
    260 265 270
    Ser Leu Ile Asn Gly Val Gln Ser Thr Ser Thr Ser Ser Ser Thr Glu
    275 280 285
    Gly Pro His Asp Thr Val Gly Thr Thr Pro Arg Thr Gly Asn Ser Asn
    290 295 300
    Asn Ser Ser Asn Ser Gly Ser Ser Gly Gly Gly Gly Leu Phe Ala Asn
    305 310 315 320
    Phe Ser Lys Tyr Val Asp Ile Lys Ser Gly Ser Leu Asn Phe Ala Gly
    325 330 335
    Lys Leu Ser Leu Ser Ser Lys Gly Ile Asp Phe Ser Asn Gly Ser Ser
    340 345 350
    Ser Arg Ile Thr Leu Asp Glu Leu Glu Phe Leu Asp Glu Leu Gly His
    355 360 365
    Gly Asn Tyr Gly Asn Val Ser Lys Val Leu His Lys Pro Thr Asn Val
    370 375 380
    Ile Met Ala Thr Lys Glu Val Arg Leu Glu Leu Asp Glu Ala Lys Phe
    385 390 395 400
    Arg Gln Ile Leu Met Glu Leu Glu Val Leu His Lys Cys Asn Ser Pro
    405 410 415
    Tyr Ile Val Asp Phe Tyr Gly Ala Phe Phe Ile Glu Gly Ala Val Tyr
    420 425 430
    Met Cys Met Glu Tyr Met Asp Gly Gly Ser Leu Asp Lys Ile Tyr Asp
    435 440 445
    Glu Ser Ser Glu Ile Gly Gly Ile Asp Glu Pro Gln Leu Ala Phe Ile
    450 455 460
    Ala Asn Ala Val Ile His Gly Leu Lys Glu Leu Lys Glu Gln His Asn
    465 470 475 480
    Ile Ile His Arg Asp Val Lys Pro Thr Asn Ile Leu Cys Ser Ala Asn
    485 490 495
    Gln Gly Thr Val Lys Leu Cys Asp Phe Gly Val Ser Gly Asn Leu Val
    500 505 510
    Ala Ser Leu Ala Lys Thr Asn Ile Gly Cys Gln Ser Tyr Met Ala Pro
    515 520 525
    Glu Arg Ile Lys Ser Leu Asn Pro Asp Arg Ala Thr Tyr Thr Val Gln
    530 535 540
    Ser Asp Ile Trp Ser Leu Gly Leu Ser Ile Leu Glu Met Ala Leu Gly
    545 550 555 560
    Arg Tyr Pro Tyr Pro Pro Glu Thr Tyr Asp Asn Ile Phe Ser Gln Leu
    565 570 575
    Ser Ala Ile Val Asp Gly Pro Pro Pro Arg Leu Pro Ser Asp Lys Phe
    580 585 590
    Ser Ser Asp Ala Gln Asp Phe Val Ser Leu Cys Leu Gln Lys Ile Pro
    595 600 605
    Glu Arg Arg Pro Thr Tyr Ala Ala Leu Thr Glu His Pro Trp Leu Val
    610 615 620
    Lys Tyr Arg Asn Gln Asp Val His Met Ser Glu Tyr Ile Thr Glu Arg
    625 630 635 640
    Leu Glu Arg Arg Asn Lys Ile Leu Arg Glu Arg Gly Glu Asn Gly Leu
    645 650 655
    Ser Lys Asn Val Pro Ala Leu His Met Gly Gly Leu
    660 665
    <210> SEQ ID NO 21
    <211> LENGTH: 1883
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (121)...(1203)
    <400> SEQUENCE: 21
    gtgagccacc gcccccagcc tggcctggca tttctttgag ttcaggaagt gtgacaagga 60
    tttggacacc cagaaataag cgtgtcgaga agagcacaag cagaggatcc agcgctcggc 120
    atg gcg gag cca gat ctg gag tgc gag cag atc cgt ctg aag tgt att 168
    Met Ala Glu Pro Asp Leu Glu Cys Glu Gln Ile Arg Leu Lys Cys Ile
    1 5 10 15
    cgt aag gag ggc ttc ttc acg gtg cct ccg gaa cac agg ctg gga cga 216
    Arg Lys Glu Gly Phe Phe Thr Val Pro Pro Glu His Arg Leu Gly Arg
    20 25 30
    tgc cgg agt gtg aag gag ttt gag aag ctg aac cgc att gga gag ggt 264
    Cys Arg Ser Val Lys Glu Phe Glu Lys Leu Asn Arg Ile Gly Glu Gly
    35 40 45
    acc tac ggc att gtg tat cgg gcc cgg gac acc cag aca gat gag att 312
    Thr Tyr Gly Ile Val Tyr Arg Ala Arg Asp Thr Gln Thr Asp Glu Ile
    50 55 60
    gtc gca ctg aag aag gtg cgg atg gac aag gag aag gat ggc atc ccc 360
    Val Ala Leu Lys Lys Val Arg Met Asp Lys Glu Lys Asp Gly Ile Pro
    65 70 75 80
    atc agc agc ttg cgg gag atc acg ctg ctg ctc cgc ctg cgt cat ccg 408
    Ile Ser Ser Leu Arg Glu Ile Thr Leu Leu Leu Arg Leu Arg His Pro
    85 90 95
    aac atc gtg gag ctg aag gag gtg gtt gtg ggg aac cac ctg gag agc 456
    Asn Ile Val Glu Leu Lys Glu Val Val Val Gly Asn His Leu Glu Ser
    100 105 110
    atc ttc ctg gtg atg ggt tac tgt gag cag gac ctg gcc agc ctc ctg 504
    Ile Phe Leu Val Met Gly Tyr Cys Glu Gln Asp Leu Ala Ser Leu Leu
    115 120 125
    gag aat atg cca aca ccc ttc tcg gag gct cag gtc aag tgc atc gtg 552
    Glu Asn Met Pro Thr Pro Phe Ser Glu Ala Gln Val Lys Cys Ile Val
    130 135 140
    ctg cag gtg ctc cgg ggc ctc cag tat ctg cac agg aac ttc att atc 600
    Leu Gln Val Leu Arg Gly Leu Gln Tyr Leu His Arg Asn Phe Ile Ile
    145 150 155 160
    cac agg gac ctg aag gtt tcc aac ttg ctc atg acc gac aag ggt tgt 648
    His Arg Asp Leu Lys Val Ser Asn Leu Leu Met Thr Asp Lys Gly Cys
    165 170 175
    gtg aag aca gcg gat ttc ggc ctg gcc cgg gcc tat ggt gtc cca gta 696
    Val Lys Thr Ala Asp Phe Gly Leu Ala Arg Ala Tyr Gly Val Pro Val
    180 185 190
    aag cca atg acc ccc aag gtg gtc act ctc tgg tac cga gcc cct gaa 744
    Lys Pro Met Thr Pro Lys Val Val Thr Leu Trp Tyr Arg Ala Pro Glu
    195 200 205
    ctg ctg ttg gga acc acc acg cag acc acc agc atc gac atg tgg gct 792
    Leu Leu Leu Gly Thr Thr Thr Gln Thr Thr Ser Ile Asp Met Trp Ala
    210 215 220
    gtg ggc tgc ata ctg gcc gag ctg ctg gcg cac agg cct ctt ctc ccc 840
    Val Gly Cys Ile Leu Ala Glu Leu Leu Ala His Arg Pro Leu Leu Pro
    225 230 235 240
    ggc act tcc gag atc cac cag atc gac ttg atc gtg cag ctg ctg ggc 888
    Gly Thr Ser Glu Ile His Gln Ile Asp Leu Ile Val Gln Leu Leu Gly
    245 250 255
    acg ccc agt gag aac atc tgg ccg ggc ttt tcc aag ctg cca ctg gtc 936
    Thr Pro Ser Glu Asn Ile Trp Pro Gly Phe Ser Lys Leu Pro Leu Val
    260 265 270
    ggc cag tac agc ctc cgg aag cag ccc tac aac aac ctg aag cac aag 984
    Gly Gln Tyr Ser Leu Arg Lys Gln Pro Tyr Asn Asn Leu Lys His Lys
    275 280 285
    ttc cca tgg ctg tcg gag gcc ggg ctg cgc ctg ctg cac ttc ctg ttc 1032
    Phe Pro Trp Leu Ser Glu Ala Gly Leu Arg Leu Leu His Phe Leu Phe
    290 295 300
    atg tac gac cct aag aaa agg gcg acg gcc ggg gac tgc ctg gag agc 1080
    Met Tyr Asp Pro Lys Lys Arg Ala Thr Ala Gly Asp Cys Leu Glu Ser
    305 310 315 320
    tcc tat ttc aag gag aag ccc cta ccc tgt gag ccg gag ctc atg ccg 1128
    Ser Tyr Phe Lys Glu Lys Pro Leu Pro Cys Glu Pro Glu Leu Met Pro
    325 330 335
    acc ttt ccc cac cac cgc aac aag cgg gcc gcc cca gcc acc tcc gag 1176
    Thr Phe Pro His His Arg Asn Lys Arg Ala Ala Pro Ala Thr Ser Glu
    340 345 350
    ggc cag agc aag cgc tgt aaa ccc tga cggtgggcct ggcacacgcc 1223
    Gly Gln Ser Lys Arg Cys Lys Pro *
    355 360
    tgtattccca caccaggtct tccgatcagt ggtgtctgtg aagggtgccg cgagccaggc 1283
    tgaccaggcg cccgggatcc agctcatccc cttggctggg aacatcctcc actgacttcc 1343
    tcccactgtc tgccctgaac ccactgctgc ccccagaaaa aggccgggtg acaccggggg 1403
    ctcccagccc gtgcaccctg gaagggcagg tctggcggct ccatccgtgg ctgcaggggt 1463
    ctcatgtggt cctcctcgct atgttggaaa tgtgcaacca ctgcttcttg ggaggagtgg 1523
    tgggtgcagt ccccccgctg tctttgagtt gtggtggacc gctggcctgg gatgagaggg 1583
    cccagaagac cttcgtatcc cctctcagtc gcccggggct gtcccgtgca tgggttggct 1643
    gtggggaccc caggtgggcc tggcaggact ccagatgagg acaagaggga caaggtatgg 1703
    ggtgggagcc acaattgagg ataccccgag ctaccaggag agccctgggc tggaggctga 1763
    gctggatccc tgctccccac acggaggacc caacaggagg ccgtggctct gatgctgagc 1823
    gaagctatag gctcttgttg gataaaagct tttttaacag aaaaaaaaaa aaaaaaaaaa 1883
    <210> SEQ ID NO 22
    <211> LENGTH: 360
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 22
    Met Ala Glu Pro Asp Leu Glu Cys Glu Gln Ile Arg Leu Lys Cys Ile
    1 5 10 15
    Arg Lys Glu Gly Phe Phe Thr Val Pro Pro Glu His Arg Leu Gly Arg
    20 25 30
    Cys Arg Ser Val Lys Glu Phe Glu Lys Leu Asn Arg Ile Gly Glu Gly
    35 40 45
    Thr Tyr Gly Ile Val Tyr Arg Ala Arg Asp Thr Gln Thr Asp Glu Ile
    50 55 60
    Val Ala Leu Lys Lys Val Arg Met Asp Lys Glu Lys Asp Gly Ile Pro
    65 70 75 80
    Ile Ser Ser Leu Arg Glu Ile Thr Leu Leu Leu Arg Leu Arg His Pro
    85 90 95
    Asn Ile Val Glu Leu Lys Glu Val Val Val Gly Asn His Leu Glu Ser
    100 105 110
    Ile Phe Leu Val Met Gly Tyr Cys Glu Gln Asp Leu Ala Ser Leu Leu
    115 120 125
    Glu Asn Met Pro Thr Pro Phe Ser Glu Ala Gln Val Lys Cys Ile Val
    130 135 140
    Leu Gln Val Leu Arg Gly Leu Gln Tyr Leu His Arg Asn Phe Ile Ile
    145 150 155 160
    His Arg Asp Leu Lys Val Ser Asn Leu Leu Met Thr Asp Lys Gly Cys
    165 170 175
    Val Lys Thr Ala Asp Phe Gly Leu Ala Arg Ala Tyr Gly Val Pro Val
    180 185 190
    Lys Pro Met Thr Pro Lys Val Val Thr Leu Trp Tyr Arg Ala Pro Glu
    195 200 205
    Leu Leu Leu Gly Thr Thr Thr Gln Thr Thr Ser Ile Asp Met Trp Ala
    210 215 220
    Val Gly Cys Ile Leu Ala Glu Leu Leu Ala His Arg Pro Leu Leu Pro
    225 230 235 240
    Gly Thr Ser Glu Ile His Gln Ile Asp Leu Ile Val Gln Leu Leu Gly
    245 250 255
    Thr Pro Ser Glu Asn Ile Trp Pro Gly Phe Ser Lys Leu Pro Leu Val
    260 265 270
    Gly Gln Tyr Ser Leu Arg Lys Gln Pro Tyr Asn Asn Leu Lys His Lys
    275 280 285
    Phe Pro Trp Leu Ser Glu Ala Gly Leu Arg Leu Leu His Phe Leu Phe
    290 295 300
    Met Tyr Asp Pro Lys Lys Arg Ala Thr Ala Gly Asp Cys Leu Glu Ser
    305 310 315 320
    Ser Tyr Phe Lys Glu Lys Pro Leu Pro Cys Glu Pro Glu Leu Met Pro
    325 330 335
    Thr Phe Pro His His Arg Asn Lys Arg Ala Ala Pro Ala Thr Ser Glu
    340 345 350
    Gly Gln Ser Lys Arg Cys Lys Pro
    355 360
    <210> SEQ ID NO 23
    <211> LENGTH: 2299
    <212> TYPE: DNA
    <213> ORGANISM: Mus musculus
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (142)...(1698)
    <400> SEQUENCE: 23
    ccggacttcc atgggcagca gcagcggcag ggaacggagg gcgaatagat ttcagagcct 60
    gcacctgaag tacaattcga atcctgctcc agggagcgag ccactgtccg gatccagaaa 120
    ctttggccac tgggaggaaa a atg gcc agt gat acc cca ggt ttc tac atg 171
    Met Ala Ser Asp Thr Pro Gly Phe Tyr Met
    1 5 10
    gac aaa ctt aat aaa tac cgc cag atg cac gga gta gcc att acg tat 219
    Asp Lys Leu Asn Lys Tyr Arg Gln Met His Gly Val Ala Ile Thr Tyr
    15 20 25
    aaa gaa ctt agt act tcg gga cct cca cat gac aga agg ttt aca ttt 267
    Lys Glu Leu Ser Thr Ser Gly Pro Pro His Asp Arg Arg Phe Thr Phe
    30 35 40
    caa gtt tta ata gat gag aag gaa ttt gga gaa gcc aaa ggt aga tca 315
    Gln Val Leu Ile Asp Glu Lys Glu Phe Gly Glu Ala Lys Gly Arg Ser
    45 50 55
    aag acg gag gca aga aac gct gca gcc aaa tta gct gtt gat ata ctt 363
    Lys Thr Glu Ala Arg Asn Ala Ala Ala Lys Leu Ala Val Asp Ile Leu
    60 65 70
    gat aac gaa aac aag gtg gat tgt cac acg agt gca tgt gag caa ggc 411
    Asp Asn Glu Asn Lys Val Asp Cys His Thr Ser Ala Cys Glu Gln Gly
    75 80 85 90
    ttg ttc gtt ggt aac tac ata ggc ctt gtc aat agc ttt gcc cag aag 459
    Leu Phe Val Gly Asn Tyr Ile Gly Leu Val Asn Ser Phe Ala Gln Lys
    95 100 105
    aaa aag ctg tct gta aat tat gaa cag tgt gag ccc aac tct gag ttg 507
    Lys Lys Leu Ser Val Asn Tyr Glu Gln Cys Glu Pro Asn Ser Glu Leu
    110 115 120
    cct caa aga ttt att tgt aaa tgc aaa att ggg cag aca atg tat ggt 555
    Pro Gln Arg Phe Ile Cys Lys Cys Lys Ile Gly Gln Thr Met Tyr Gly
    125 130 135
    act ggt tca ggt gtc acc aaa cag gag gca aag cag ttg gct gcg aaa 603
    Thr Gly Ser Gly Val Thr Lys Gln Glu Ala Lys Gln Leu Ala Ala Lys
    140 145 150
    gaa gcc tat cag aag ctg tta aag agc ccg ccg aaa act gcc gga aca 651
    Glu Ala Tyr Gln Lys Leu Leu Lys Ser Pro Pro Lys Thr Ala Gly Thr
    155 160 165 170
    tcc tct agc gtt gtc aca tct aca ttc agt ggc ttt tcc agc agc tcg 699
    Ser Ser Ser Val Val Thr Ser Thr Phe Ser Gly Phe Ser Ser Ser Ser
    175 180 185
    tct atg aca agt aat ggt gtt tcc cag tca gca cct gga agt ttt tcc 747
    Ser Met Thr Ser Asn Gly Val Ser Gln Ser Ala Pro Gly Ser Phe Ser
    190 195 200
    tca gag aac gtg ttt acg aac ggt ctc gga gaa aat aaa agg aaa tca 795
    Ser Glu Asn Val Phe Thr Asn Gly Leu Gly Glu Asn Lys Arg Lys Ser
    205 210 215
    gga gta aaa gta tcc cct gat gat gtg caa aga aat aaa tat acc ttg 843
    Gly Val Lys Val Ser Pro Asp Asp Val Gln Arg Asn Lys Tyr Thr Leu
    220 225 230
    gac gcc agg ttt aac agc gat ttt gaa gac ata gaa gaa att ggc tta 891
    Asp Ala Arg Phe Asn Ser Asp Phe Glu Asp Ile Glu Glu Ile Gly Leu
    235 240 245 250
    ggt gga ttt ggt caa gtt ttc aaa gcg aaa cac aga att gat gga aag 939
    Gly Gly Phe Gly Gln Val Phe Lys Ala Lys His Arg Ile Asp Gly Lys
    255 260 265
    aga tac gct att aag cgc gtt aaa tat aac acg gag aag gcg gag cac 987
    Arg Tyr Ala Ile Lys Arg Val Lys Tyr Asn Thr Glu Lys Ala Glu His
    270 275 280
    gaa gta caa gcg ctg gca gaa ctc aat cac gtc aac att gtc caa tac 1035
    Glu Val Gln Ala Leu Ala Glu Leu Asn His Val Asn Ile Val Gln Tyr
    285 290 295
    cat agt tgt tgg gag gga gtt gac tat gat cct gag cac agc atg agt 1083
    His Ser Cys Trp Glu Gly Val Asp Tyr Asp Pro Glu His Ser Met Ser
    300 305 310
    gat aca agt cga tac aaa acc cgg tgc ctc ttt att caa atg gaa ttc 1131
    Asp Thr Ser Arg Tyr Lys Thr Arg Cys Leu Phe Ile Gln Met Glu Phe
    315 320 325 330
    tgt gat aaa gga act ttg gag caa tgg atg aga aac aga aat cag agt 1179
    Cys Asp Lys Gly Thr Leu Glu Gln Trp Met Arg Asn Arg Asn Gln Ser
    335 340 345
    aaa gtg gac aaa gct ttg att ttg gac tta tat gaa caa atc gtg acc 1227
    Lys Val Asp Lys Ala Leu Ile Leu Asp Leu Tyr Glu Gln Ile Val Thr
    350 355 360
    gga gtg gag tat ata cac tcg aaa ggg tta att cac aga gat ctt aag 1275
    Gly Val Glu Tyr Ile His Ser Lys Gly Leu Ile His Arg Asp Leu Lys
    365 370 375
    cca ggt aat ata ttt tta gta gat gaa aga cac att aag atc gga gac 1323
    Pro Gly Asn Ile Phe Leu Val Asp Glu Arg His Ile Lys Ile Gly Asp
    380 385 390
    ttt ggc ctt gca aca gcc ctg gaa aat gat gga aaa tcc cga aca agg 1371
    Phe Gly Leu Ala Thr Ala Leu Glu Asn Asp Gly Lys Ser Arg Thr Arg
    395 400 405 410
    aga aca gga act ctt caa tac atg agt cca gaa cag tta ttt tta aag 1419
    Arg Thr Gly Thr Leu Gln Tyr Met Ser Pro Glu Gln Leu Phe Leu Lys
    415 420 425
    cac tat gga aaa gaa gtg gac atc ttt gct ttg ggc ctt att cta gct 1467
    His Tyr Gly Lys Glu Val Asp Ile Phe Ala Leu Gly Leu Ile Leu Ala
    430 435 440
    gaa ctt ctt cac acg tgc ttc acg gag tca gag aaa ata aag ttt ttc 1515
    Glu Leu Leu His Thr Cys Phe Thr Glu Ser Glu Lys Ile Lys Phe Phe
    445 450 455
    gaa agt cta aga aaa ggc gac ttc tct aat gat ata ttc gac aac aaa 1563
    Glu Ser Leu Arg Lys Gly Asp Phe Ser Asn Asp Ile Phe Asp Asn Lys
    460 465 470
    gaa aaa agc ctt cta aaa aaa cta ctc tca gag aaa ccc aag gac cga 1611
    Glu Lys Ser Leu Leu Lys Lys Leu Leu Ser Glu Lys Pro Lys Asp Arg
    475 480 485 490
    cct gag aca tct gaa atc ctg aag acc ttg gct gaa tgg agg aac atc 1659
    Pro Glu Thr Ser Glu Ile Leu Lys Thr Leu Ala Glu Trp Arg Asn Ile
    495 500 505
    tca gag aaa gaa aag aaa cac atg tta ggg cct ttc tga gaaaacattc 1708
    Ser Glu Lys Glu Lys Lys His Met Leu Gly Pro Phe *
    510 515
    cttctgccgt ggttttcctt taacgatctg cagtctgagg ggagtatcag tgaatattat 1768
    ccttcttttc ttaataccac tctcccagac aggttttggt tagggtgacc cacagacatt 1828
    gtatttatta ggctatgaaa aagtatgccc atttcctcaa ttgttaattg ctgggcctgt 1888
    ggctggctag ctagccaaat atgtaaatgc ttgtttctcg tctgcccaaa gagaaaggca 1948
    ggctcctgtg tgggaagtca cagagccccc aaagccaact ggatgaggaa ggactctggc 2008
    ttttggcata aaaaagagct ggtagtcaga gctggggcag aaggtcctgc agacagacag 2068
    acagacagac agacagagac acaaagacat ggactagaat ggaggaggga gggaggaagg 2128
    gagggaggga gagagagaga gagaaagaaa gagagagaga ggacatggag acaaaatggc 2188
    ttaagttagc tgggctacct gagagactgt cccagaaaac aggccaacaa ccttccttat 2248
    gctatataga tgtctcagtg tctttatcat taaacaccaa gcaggagtgc t 2299
    <210> SEQ ID NO 24
    <211> LENGTH: 518
    <212> TYPE: PRT
    <213> ORGANISM: Mus musculus
    <400> SEQUENCE: 24
    Met Ala Ser Asp Thr Pro Gly Phe Tyr Met Asp Lys Leu Asn Lys Tyr
    1 5 10 15
    Arg Gln Met His Gly Val Ala Ile Thr Tyr Lys Glu Leu Ser Thr Ser
    20 25 30
    Gly Pro Pro His Asp Arg Arg Phe Thr Phe Gln Val Leu Ile Asp Glu
    35 40 45
    Lys Glu Phe Gly Glu Ala Lys Gly Arg Ser Lys Thr Glu Ala Arg Asn
    50 55 60
    Ala Ala Ala Lys Leu Ala Val Asp Ile Leu Asp Asn Glu Asn Lys Val
    65 70 75 80
    Asp Cys His Thr Ser Ala Cys Glu Gln Gly Leu Phe Val Gly Asn Tyr
    85 90 95
    Ile Gly Leu Val Asn Ser Phe Ala Gln Lys Lys Lys Leu Ser Val Asn
    100 105 110
    Tyr Glu Gln Cys Glu Pro Asn Ser Glu Leu Pro Gln Arg Phe Ile Cys
    115 120 125
    Lys Cys Lys Ile Gly Gln Thr Met Tyr Gly Thr Gly Ser Gly Val Thr
    130 135 140
    Lys Gln Glu Ala Lys Gln Leu Ala Ala Lys Glu Ala Tyr Gln Lys Leu
    145 150 155 160
    Leu Lys Ser Pro Pro Lys Thr Ala Gly Thr Ser Ser Ser Val Val Thr
    165 170 175
    Ser Thr Phe Ser Gly Phe Ser Ser Ser Ser Ser Met Thr Ser Asn Gly
    180 185 190
    Val Ser Gln Ser Ala Pro Gly Ser Phe Ser Ser Glu Asn Val Phe Thr
    195 200 205
    Asn Gly Leu Gly Glu Asn Lys Arg Lys Ser Gly Val Lys Val Ser Pro
    210 215 220
    Asp Asp Val Gln Arg Asn Lys Tyr Thr Leu Asp Ala Arg Phe Asn Ser
    225 230 235 240
    Asp Phe Glu Asp Ile Glu Glu Ile Gly Leu Gly Gly Phe Gly Gln Val
    245 250 255
    Phe Lys Ala Lys His Arg Ile Asp Gly Lys Arg Tyr Ala Ile Lys Arg
    260 265 270
    Val Lys Tyr Asn Thr Glu Lys Ala Glu His Glu Val Gln Ala Leu Ala
    275 280 285
    Glu Leu Asn His Val Asn Ile Val Gln Tyr His Ser Cys Trp Glu Gly
    290 295 300
    Val Asp Tyr Asp Pro Glu His Ser Met Ser Asp Thr Ser Arg Tyr Lys
    305 310 315 320
    Thr Arg Cys Leu Phe Ile Gln Met Glu Phe Cys Asp Lys Gly Thr Leu
    325 330 335
    Glu Gln Trp Met Arg Asn Arg Asn Gln Ser Lys Val Asp Lys Ala Leu
    340 345 350
    Ile Leu Asp Leu Tyr Glu Gln Ile Val Thr Gly Val Glu Tyr Ile His
    355 360 365
    Ser Lys Gly Leu Ile His Arg Asp Leu Lys Pro Gly Asn Ile Phe Leu
    370 375 380
    Val Asp Glu Arg His Ile Lys Ile Gly Asp Phe Gly Leu Ala Thr Ala
    385 390 395 400
    Leu Glu Asn Asp Gly Lys Ser Arg Thr Arg Arg Thr Gly Thr Leu Gln
    405 410 415
    Tyr Met Ser Pro Glu Gln Leu Phe Leu Lys His Tyr Gly Lys Glu Val
    420 425 430
    Asp Ile Phe Ala Leu Gly Leu Ile Leu Ala Glu Leu Leu His Thr Cys
    435 440 445
    Phe Thr Glu Ser Glu Lys Ile Lys Phe Phe Glu Ser Leu Arg Lys Gly
    450 455 460
    Asp Phe Ser Asn Asp Ile Phe Asp Asn Lys Glu Lys Ser Leu Leu Lys
    465 470 475 480
    Lys Leu Leu Ser Glu Lys Pro Lys Asp Arg Pro Glu Thr Ser Glu Ile
    485 490 495
    Leu Lys Thr Leu Ala Glu Trp Arg Asn Ile Ser Glu Lys Glu Lys Lys
    500 505 510
    His Met Leu Gly Pro Phe
    515
    <210> SEQ ID NO 25
    <211> LENGTH: 2055
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (211)...(1632)
    <400> SEQUENCE: 25
    caggaagact ctgagtccga cgttggccta cccagtcgga aggcagagct gcaatctagt 60
    taactacctc ctttccccta gatttccttt cattctgctc aagtcttcgc ctgtgtccga 120
    tccctatcta ctttctctcc tcttgtagca agcctcagac tccaggcttg agctaggttt 180
    tgtttttctc ctggtgagaa ttcgaagacc atg tct acg gaa ctc ttc tca tcc 234
    Met Ser Thr Glu Leu Phe Ser Ser
    1 5
    aca aga gag gaa gga agc tct ggc tca gga ccc agt ttt agg tct aat 282
    Thr Arg Glu Glu Gly Ser Ser Gly Ser Gly Pro Ser Phe Arg Ser Asn
    10 15 20
    caa agg aaa atg tta aac ctg ctc ctg gag aga gac act tcc ttt acc 330
    Gln Arg Lys Met Leu Asn Leu Leu Leu Glu Arg Asp Thr Ser Phe Thr
    25 30 35 40
    gtc tgt cca gat gtc cct aga act cca gtg ggc aaa ttt ctt ggt gat 378
    Val Cys Pro Asp Val Pro Arg Thr Pro Val Gly Lys Phe Leu Gly Asp
    45 50 55
    tct gca aac cta agc att ttg tct gga gga acc cca aaa tgt tgc ctc 426
    Ser Ala Asn Leu Ser Ile Leu Ser Gly Gly Thr Pro Lys Cys Cys Leu
    60 65 70
    gat ctt tcg aat ctt agc agt ggg gag ata act gcc act cag ctt acc 474
    Asp Leu Ser Asn Leu Ser Ser Gly Glu Ile Thr Ala Thr Gln Leu Thr
    75 80 85
    act tct gca gac ctt gat gaa act ggt cac ctg gat tct tca gga ctt 522
    Thr Ser Ala Asp Leu Asp Glu Thr Gly His Leu Asp Ser Ser Gly Leu
    90 95 100
    cag gaa gtg cat tta gct ggg atg aat cat gac cag cac cta atg aaa 570
    Gln Glu Val His Leu Ala Gly Met Asn His Asp Gln His Leu Met Lys
    105 110 115 120
    tgt agc cca gca cag ctt ctt tgt agc act ccg aat ggt ttg gac cgt 618
    Cys Ser Pro Ala Gln Leu Leu Cys Ser Thr Pro Asn Gly Leu Asp Arg
    125 130 135
    ggc cat aga aag aga gat gca atg tgt agt tca tct gca aat aaa gaa 666
    Gly His Arg Lys Arg Asp Ala Met Cys Ser Ser Ser Ala Asn Lys Glu
    140 145 150
    aat gac aat gga aac ttg gtg gac agt gaa atg aaa tat ttg ggc agt 714
    Asn Asp Asn Gly Asn Leu Val Asp Ser Glu Met Lys Tyr Leu Gly Ser
    155 160 165
    ccc att act act gtt cca aaa ttg gat aaa aat cca aac cta gga gaa 762
    Pro Ile Thr Thr Val Pro Lys Leu Asp Lys Asn Pro Asn Leu Gly Glu
    170 175 180
    gac cag gca gaa gag att tca gat gaa tta atg gag ttt tcc ctg aaa 810
    Asp Gln Ala Glu Glu Ile Ser Asp Glu Leu Met Glu Phe Ser Leu Lys
    185 190 195 200
    gat caa gaa gca aag gtg agc aga agt ggc cta tat cgc tcc ccg tcg 858
    Asp Gln Glu Ala Lys Val Ser Arg Ser Gly Leu Tyr Arg Ser Pro Ser
    205 210 215
    atg cca gag aac ttg aac agg cca aga ctg aag cag gtg gaa aaa ttc 906
    Met Pro Glu Asn Leu Asn Arg Pro Arg Leu Lys Gln Val Glu Lys Phe
    220 225 230
    aag gac aac aca ata cca gat aaa gtt aaa aaa aag tat ttt tct ggc 954
    Lys Asp Asn Thr Ile Pro Asp Lys Val Lys Lys Lys Tyr Phe Ser Gly
    235 240 245
    caa gga aag ctc agg aag ggc tta tgt tta aag aag aca gtc tct ctg 1002
    Gln Gly Lys Leu Arg Lys Gly Leu Cys Leu Lys Lys Thr Val Ser Leu
    250 255 260
    tgt gac att act atc act cag atg ctg gag gaa gat tct aac cag ggg 1050
    Cys Asp Ile Thr Ile Thr Gln Met Leu Glu Glu Asp Ser Asn Gln Gly
    265 270 275 280
    cac ctg att ggt gat ttt tcc aag gta tgt gcg ctg cca acc gtg tca 1098
    His Leu Ile Gly Asp Phe Ser Lys Val Cys Ala Leu Pro Thr Val Ser
    285 290 295
    ggg aaa cac caa gat ctg aag tat gtc aac cca gaa aca gtg gct gcc 1146
    Gly Lys His Gln Asp Leu Lys Tyr Val Asn Pro Glu Thr Val Ala Ala
    300 305 310
    tta ctg tcg ggg aag ttc cag ggt ctg att gag aag ttt tat gtc att 1194
    Leu Leu Ser Gly Lys Phe Gln Gly Leu Ile Glu Lys Phe Tyr Val Ile
    315 320 325
    gat tgt cgc tat cca tat gag tat ctg gga gga cac atc cag gga gcc 1242
    Asp Cys Arg Tyr Pro Tyr Glu Tyr Leu Gly Gly His Ile Gln Gly Ala
    330 335 340
    tta aac tta tat agt cag gaa gaa ctg ttt aac ttc ttt ctg aag aag 1290
    Leu Asn Leu Tyr Ser Gln Glu Glu Leu Phe Asn Phe Phe Leu Lys Lys
    345 350 355 360
    ccc atc gtc cct ttg gac acc cag aag aga ata atc atc gtg ttc cac 1338
    Pro Ile Val Pro Leu Asp Thr Gln Lys Arg Ile Ile Ile Val Phe His
    365 370 375
    tgt gaa ttc tcc tca gag agg ggc ccc cga atg tgc cgc tgt ctg cgt 1386
    Cys Glu Phe Ser Ser Glu Arg Gly Pro Arg Met Cys Arg Cys Leu Arg
    380 385 390
    gaa gag gac agg tct ctg aac cag tat cct gca ttg tac tac cca gag 1434
    Glu Glu Asp Arg Ser Leu Asn Gln Tyr Pro Ala Leu Tyr Tyr Pro Glu
    395 400 405
    cta tat atc ctt aaa ggc ggc tac aga gac ttc ttt cca gaa tat atg 1482
    Leu Tyr Ile Leu Lys Gly Gly Tyr Arg Asp Phe Phe Pro Glu Tyr Met
    410 415 420
    gaa ctg tgt gaa cca cag agc tac tgc cct atg cat cat cag gac cac 1530
    Glu Leu Cys Glu Pro Gln Ser Tyr Cys Pro Met His His Gln Asp His
    425 430 435 440
    aag act gag ttg ctg agg tgt cga agc cag agc aaa gtg cag gaa ggg 1578
    Lys Thr Glu Leu Leu Arg Cys Arg Ser Gln Ser Lys Val Gln Glu Gly
    445 450 455
    gag cgg cag ctg cgg gag cag att gcc ctt ctg gtg aag gac atg agc 1626
    Glu Arg Gln Leu Arg Glu Gln Ile Ala Leu Leu Val Lys Asp Met Ser
    460 465 470
    cca tga taacattcca gccactggct gctaacaagt caccaaaaag acactgcaga 1682
    Pro *
    aaccctgagc agaaagaggc cttctggatg gccaaaccca agattattaa aagatgtctc 1742
    tgcaaaccaa caggctacca acttgtatcc aggcctggga atggattagg tttcagcaga 1802
    gctgaaagct ggtggcagag tcctggagct ggctctataa ggcagccttg agttgcatag 1862
    agatttgtat tggttcaggg aactctggca ttccttttcc caactcctca tgtcttctca 1922
    caagccagcc aactctttct ctctgggctt cgggctatgc aagagcgttg tctaccttct 1982
    ttctttgtat tttccttctt tgtttccccc tctttctttt ttaaaaatgg aaaaataaac 2042
    actacagaat gag 2055
    <210> SEQ ID NO 26
    <211> LENGTH: 473
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 26
    Met Ser Thr Glu Leu Phe Ser Ser Thr Arg Glu Glu Gly Ser Ser Gly
    1 5 10 15
    Ser Gly Pro Ser Phe Arg Ser Asn Gln Arg Lys Met Leu Asn Leu Leu
    20 25 30
    Leu Glu Arg Asp Thr Ser Phe Thr Val Cys Pro Asp Val Pro Arg Thr
    35 40 45
    Pro Val Gly Lys Phe Leu Gly Asp Ser Ala Asn Leu Ser Ile Leu Ser
    50 55 60
    Gly Gly Thr Pro Lys Cys Cys Leu Asp Leu Ser Asn Leu Ser Ser Gly
    65 70 75 80
    Glu Ile Thr Ala Thr Gln Leu Thr Thr Ser Ala Asp Leu Asp Glu Thr
    85 90 95
    Gly His Leu Asp Ser Ser Gly Leu Gln Glu Val His Leu Ala Gly Met
    100 105 110
    Asn His Asp Gln His Leu Met Lys Cys Ser Pro Ala Gln Leu Leu Cys
    115 120 125
    Ser Thr Pro Asn Gly Leu Asp Arg Gly His Arg Lys Arg Asp Ala Met
    130 135 140
    Cys Ser Ser Ser Ala Asn Lys Glu Asn Asp Asn Gly Asn Leu Val Asp
    145 150 155 160
    Ser Glu Met Lys Tyr Leu Gly Ser Pro Ile Thr Thr Val Pro Lys Leu
    165 170 175
    Asp Lys Asn Pro Asn Leu Gly Glu Asp Gln Ala Glu Glu Ile Ser Asp
    180 185 190
    Glu Leu Met Glu Phe Ser Leu Lys Asp Gln Glu Ala Lys Val Ser Arg
    195 200 205
    Ser Gly Leu Tyr Arg Ser Pro Ser Met Pro Glu Asn Leu Asn Arg Pro
    210 215 220
    Arg Leu Lys Gln Val Glu Lys Phe Lys Asp Asn Thr Ile Pro Asp Lys
    225 230 235 240
    Val Lys Lys Lys Tyr Phe Ser Gly Gln Gly Lys Leu Arg Lys Gly Leu
    245 250 255
    Cys Leu Lys Lys Thr Val Ser Leu Cys Asp Ile Thr Ile Thr Gln Met
    260 265 270
    Leu Glu Glu Asp Ser Asn Gln Gly His Leu Ile Gly Asp Phe Ser Lys
    275 280 285
    Val Cys Ala Leu Pro Thr Val Ser Gly Lys His Gln Asp Leu Lys Tyr
    290 295 300
    Val Asn Pro Glu Thr Val Ala Ala Leu Leu Ser Gly Lys Phe Gln Gly
    305 310 315 320
    Leu Ile Glu Lys Phe Tyr Val Ile Asp Cys Arg Tyr Pro Tyr Glu Tyr
    325 330 335
    Leu Gly Gly His Ile Gln Gly Ala Leu Asn Leu Tyr Ser Gln Glu Glu
    340 345 350
    Leu Phe Asn Phe Phe Leu Lys Lys Pro Ile Val Pro Leu Asp Thr Gln
    355 360 365
    Lys Arg Ile Ile Ile Val Phe His Cys Glu Phe Ser Ser Glu Arg Gly
    370 375 380
    Pro Arg Met Cys Arg Cys Leu Arg Glu Glu Asp Arg Ser Leu Asn Gln
    385 390 395 400
    Tyr Pro Ala Leu Tyr Tyr Pro Glu Leu Tyr Ile Leu Lys Gly Gly Tyr
    405 410 415
    Arg Asp Phe Phe Pro Glu Tyr Met Glu Leu Cys Glu Pro Gln Ser Tyr
    420 425 430
    Cys Pro Met His His Gln Asp His Lys Thr Glu Leu Leu Arg Cys Arg
    435 440 445
    Ser Gln Ser Lys Val Gln Glu Gly Glu Arg Gln Leu Arg Glu Gln Ile
    450 455 460
    Ala Leu Leu Val Lys Asp Met Ser Pro
    465 470
    <210> SEQ ID NO 27
    <211> LENGTH: 17
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 27
    Ser Gly Leu Tyr Arg Ser Pro Ser Met Pro Glu Asn Leu Asn Arg Pro
    1 5 10 15
    Arg
    <210> SEQ ID NO 28
    <211> LENGTH: 14
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 28
    Gly Leu Tyr Arg Ser Pro Ser Met Pro Glu Asn Leu Asn Arg
    1 5 10
    <210> SEQ ID NO 29
    <211> LENGTH: 2295
    <212> TYPE: DNA
    <213> ORGANISM: Saccharomyces cerevisiae
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (1)...(2295)
    <400> SEQUENCE: 29
    atg tca aca aac tca ttc cat gat tat gtg gat tta aaa tcg aga act 48
    Met Ser Thr Asn Ser Phe His Asp Tyr Val Asp Leu Lys Ser Arg Thr
    1 5 10 15
    aat aca cga cag ttt tca gat gac gaa gag ttc act acg cct cca aaa 96
    Asn Thr Arg Gln Phe Ser Asp Asp Glu Glu Phe Thr Thr Pro Pro Lys
    20 25 30
    cta agc aat ttc gga tca gct tta ctt tcc cac aca gaa aaa act tca 144
    Leu Ser Asn Phe Gly Ser Ala Leu Leu Ser His Thr Glu Lys Thr Ser
    35 40 45
    gca tca gag ata tta tca agt cat aat aat gac aag atc gca aat cga 192
    Ala Ser Glu Ile Leu Ser Ser His Asn Asn Asp Lys Ile Ala Asn Arg
    50 55 60
    tta gaa gaa atg gac agg agt tca tca agg agt cac ccc cca ccg tca 240
    Leu Glu Glu Met Asp Arg Ser Ser Ser Arg Ser His Pro Pro Pro Ser
    65 70 75 80
    atg ggc aat ttg aca tcc ggt cat act agt acc tca tcg cat tca acc 288
    Met Gly Asn Leu Thr Ser Gly His Thr Ser Thr Ser Ser His Ser Thr
    85 90 95
    ttg ttc gga cga tat ctg aga aat aat cac cag act agc atg acg acg 336
    Leu Phe Gly Arg Tyr Leu Arg Asn Asn His Gln Thr Ser Met Thr Thr
    100 105 110
    atg aac act agt gac ata gag ata aat gtt gga aat agt ctt gat aag 384
    Met Asn Thr Ser Asp Ile Glu Ile Asn Val Gly Asn Ser Leu Asp Lys
    115 120 125
    agt ttt gaa agg ata agg aat ttg cga caa aat atg aaa gaa gat att 432
    Ser Phe Glu Arg Ile Arg Asn Leu Arg Gln Asn Met Lys Glu Asp Ile
    130 135 140
    acg gca aag tat gct gaa agg aga agt aag aga ttt tta ata tcc aat 480
    Thr Ala Lys Tyr Ala Glu Arg Arg Ser Lys Arg Phe Leu Ile Ser Asn
    145 150 155 160
    agg aca acg aag ctg ggt cct gca aag aga gcg atg act ttg aca aat 528
    Arg Thr Thr Lys Leu Gly Pro Ala Lys Arg Ala Met Thr Leu Thr Asn
    165 170 175
    atc ttt gat gag gat gtg cct aac tct cca aac cag cca ata aat gca 576
    Ile Phe Asp Glu Asp Val Pro Asn Ser Pro Asn Gln Pro Ile Asn Ala
    180 185 190
    agg gag aca gtg gaa tta cca ctt gag gat tct cac caa aca aac ttt 624
    Arg Glu Thr Val Glu Leu Pro Leu Glu Asp Ser His Gln Thr Asn Phe
    195 200 205
    aaa gaa cga aga gag aat acg gat tat gat tca att gat ttt gga gat 672
    Lys Glu Arg Arg Glu Asn Thr Asp Tyr Asp Ser Ile Asp Phe Gly Asp
    210 215 220
    ttg aat cct atc cag tat att aaa aaa cat aat ctt ccc aca agt gac 720
    Leu Asn Pro Ile Gln Tyr Ile Lys Lys His Asn Leu Pro Thr Ser Asp
    225 230 235 240
    ctt cca cta ata tct caa atc tac ttt gat aaa caa aga gaa gaa aat 768
    Leu Pro Leu Ile Ser Gln Ile Tyr Phe Asp Lys Gln Arg Glu Glu Asn
    245 250 255
    aga caa gca gca ctc cga aaa cat agt tcc aga gaa ttg ctt tat aaa 816
    Arg Gln Ala Ala Leu Arg Lys His Ser Ser Arg Glu Leu Leu Tyr Lys
    260 265 270
    agt agg tct tct tcc tct tca ctt tct agt aac aac tta ttg gca aac 864
    Ser Arg Ser Ser Ser Ser Ser Leu Ser Ser Asn Asn Leu Leu Ala Asn
    275 280 285
    aag gac aat tct ata aca tcc aat aat ggt tct caa ccc agg cga aaa 912
    Lys Asp Asn Ser Ile Thr Ser Asn Asn Gly Ser Gln Pro Arg Arg Lys
    290 295 300
    gtt tct act gga tca tct tca tct aag tca tcg atc gaa ata aga aga 960
    Val Ser Thr Gly Ser Ser Ser Ser Lys Ser Ser Ile Glu Ile Arg Arg
    305 310 315 320
    gct ctc aag gag aat att gat act agc aat aac agc aat ttc aac agc 1008
    Ala Leu Lys Glu Asn Ile Asp Thr Ser Asn Asn Ser Asn Phe Asn Ser
    325 330 335
    cca att cat aaa att tat aaa gga att tcc aga aat aaa gat tcc gac 1056
    Pro Ile His Lys Ile Tyr Lys Gly Ile Ser Arg Asn Lys Asp Ser Asp
    340 345 350
    tcc gaa aaa aga gaa gta ctg cga aac ata agc ata aat gca aat cac 1104
    Ser Glu Lys Arg Glu Val Leu Arg Asn Ile Ser Ile Asn Ala Asn His
    355 360 365
    gct gat aat ctc ctt caa caa gag aat aag aga cta aaa cga tca ttg 1152
    Ala Asp Asn Leu Leu Gln Gln Glu Asn Lys Arg Leu Lys Arg Ser Leu
    370 375 380
    gat gat gca ata acg aat gag aat ata aac agt aaa aat cta gaa gta 1200
    Asp Asp Ala Ile Thr Asn Glu Asn Ile Asn Ser Lys Asn Leu Glu Val
    385 390 395 400
    ttt tac cat cga cct gct ccc aaa cct cca gtc acc aag aaa gtt gaa 1248
    Phe Tyr His Arg Pro Ala Pro Lys Pro Pro Val Thr Lys Lys Val Glu
    405 410 415
    att gtt gaa cct gca aag tcc gct tct tta tcg aat aat aga aat ata 1296
    Ile Val Glu Pro Ala Lys Ser Ala Ser Leu Ser Asn Asn Arg Asn Ile
    420 425 430
    att aca gta aat gac tcc cag tac gaa aaa ata gaa ctt ttg ggt aga 1344
    Ile Thr Val Asn Asp Ser Gln Tyr Glu Lys Ile Glu Leu Leu Gly Arg
    435 440 445
    ggt gga tcc tcc aga gtt tac aag gtg aaa gga tct ggc aat agg gta 1392
    Gly Gly Ser Ser Arg Val Tyr Lys Val Lys Gly Ser Gly Asn Arg Val
    450 455 460
    tac gcg ctc aaa agg gtg tct ttt gac gct ttt gac gat tca agt att 1440
    Tyr Ala Leu Lys Arg Val Ser Phe Asp Ala Phe Asp Asp Ser Ser Ile
    465 470 475 480
    gat gga ttc aaa gga gaa ata gaa ctt ctg gaa aaa ttg aaa gac caa 1488
    Asp Gly Phe Lys Gly Glu Ile Glu Leu Leu Glu Lys Leu Lys Asp Gln
    485 490 495
    aag cgt gta atc caa cta cta gat tat gaa atg ggg gat ggt tta ttg 1536
    Lys Arg Val Ile Gln Leu Leu Asp Tyr Glu Met Gly Asp Gly Leu Leu
    500 505 510
    tat ttg ata atg gaa tgt ggt gat cat gat ttg tca caa atc ctt aac 1584
    Tyr Leu Ile Met Glu Cys Gly Asp His Asp Leu Ser Gln Ile Leu Asn
    515 520 525
    caa aga agc ggc atg cca ctg gat ttt aat ttt gtt aga ttc tat aca 1632
    Gln Arg Ser Gly Met Pro Leu Asp Phe Asn Phe Val Arg Phe Tyr Thr
    530 535 540
    aag gaa atg ttg ctg tgc att aaa gta gtt cat gat gcg ggc ata gtt 1680
    Lys Glu Met Leu Leu Cys Ile Lys Val Val His Asp Ala Gly Ile Val
    545 550 555 560
    cat tcg gat tta aaa cct gca aat ttt gtt tta gtg aaa ggt atc tta 1728
    His Ser Asp Leu Lys Pro Ala Asn Phe Val Leu Val Lys Gly Ile Leu
    565 570 575
    aaa atc att gat ttt ggt ata gca aac gcg gta ccg gaa cat acg gtg 1776
    Lys Ile Ile Asp Phe Gly Ile Ala Asn Ala Val Pro Glu His Thr Val
    580 585 590
    aat ata tat cgt gaa act caa att ggg act cca aat tat atg gca cca 1824
    Asn Ile Tyr Arg Glu Thr Gln Ile Gly Thr Pro Asn Tyr Met Ala Pro
    595 600 605
    gaa gca cta gtt gct atg aat tac aca caa aat agt gag aac caa cat 1872
    Glu Ala Leu Val Ala Met Asn Tyr Thr Gln Asn Ser Glu Asn Gln His
    610 615 620
    gag gga aac aag tgg aaa gtg ggg aga cca tct gat atg tgg tca tgc 1920
    Glu Gly Asn Lys Trp Lys Val Gly Arg Pro Ser Asp Met Trp Ser Cys
    625 630 635 640
    ggt tgt att ata tat cag atg att tac ggg aaa ccc cca tat ggc agt 1968
    Gly Cys Ile Ile Tyr Gln Met Ile Tyr Gly Lys Pro Pro Tyr Gly Ser
    645 650 655
    ttc caa ggc caa aat agg ctg ttg gct att atg aat cct gat gtg aaa 2016
    Phe Gln Gly Gln Asn Arg Leu Leu Ala Ile Met Asn Pro Asp Val Lys
    660 665 670
    atc cca ttt cct gaa cat act agc aat aat gaa aag att cca aag tct 2064
    Ile Pro Phe Pro Glu His Thr Ser Asn Asn Glu Lys Ile Pro Lys Ser
    675 680 685
    gcc att gaa tta atg aaa gca tgt ctg tac agg aac cca gac aaa aga 2112
    Ala Ile Glu Leu Met Lys Ala Cys Leu Tyr Arg Asn Pro Asp Lys Arg
    690 695 700
    tgg act gtg gat aaa gtc ctg agt agc act ttc ctt caa cct ttt atg 2160
    Trp Thr Val Asp Lys Val Leu Ser Ser Thr Phe Leu Gln Pro Phe Met
    705 710 715 720
    ata tcc gga tcg att atg gaa gac ctt att agg aat gcc gtt aga tat 2208
    Ile Ser Gly Ser Ile Met Glu Asp Leu Ile Arg Asn Ala Val Arg Tyr
    725 730 735
    ggc tct gag aag cct cat ata tca caa gat gat ctc aat gat gtg gta 2256
    Gly Ser Glu Lys Pro His Ile Ser Gln Asp Asp Leu Asn Asp Val Val
    740 745 750
    gac act gtt tta agg aaa ttt gca gat tac aaa att tag 2295
    Asp Thr Val Leu Arg Lys Phe Ala Asp Tyr Lys Ile *
    755 760
    <210> SEQ ID NO 30
    <211> LENGTH: 764
    <212> TYPE: PRT
    <213> ORGANISM: Saccharomyces cerevisiae
    <400> SEQUENCE: 30
    Met Ser Thr Asn Ser Phe His Asp Tyr Val Asp Leu Lys Ser Arg Thr
    1 5 10 15
    Asn Thr Arg Gln Phe Ser Asp Asp Glu Glu Phe Thr Thr Pro Pro Lys
    20 25 30
    Leu Ser Asn Phe Gly Ser Ala Leu Leu Ser His Thr Glu Lys Thr Ser
    35 40 45
    Ala Ser Glu Ile Leu Ser Ser His Asn Asn Asp Lys Ile Ala Asn Arg
    50 55 60
    Leu Glu Glu Met Asp Arg Ser Ser Ser Arg Ser His Pro Pro Pro Ser
    65 70 75 80
    Met Gly Asn Leu Thr Ser Gly His Thr Ser Thr Ser Ser His Ser Thr
    85 90 95
    Leu Phe Gly Arg Tyr Leu Arg Asn Asn His Gln Thr Ser Met Thr Thr
    100 105 110
    Met Asn Thr Ser Asp Ile Glu Ile Asn Val Gly Asn Ser Leu Asp Lys
    115 120 125
    Ser Phe Glu Arg Ile Arg Asn Leu Arg Gln Asn Met Lys Glu Asp Ile
    130 135 140
    Thr Ala Lys Tyr Ala Glu Arg Arg Ser Lys Arg Phe Leu Ile Ser Asn
    145 150 155 160
    Arg Thr Thr Lys Leu Gly Pro Ala Lys Arg Ala Met Thr Leu Thr Asn
    165 170 175
    Ile Phe Asp Glu Asp Val Pro Asn Ser Pro Asn Gln Pro Ile Asn Ala
    180 185 190
    Arg Glu Thr Val Glu Leu Pro Leu Glu Asp Ser His Gln Thr Asn Phe
    195 200 205
    Lys Glu Arg Arg Glu Asn Thr Asp Tyr Asp Ser Ile Asp Phe Gly Asp
    210 215 220
    Leu Asn Pro Ile Gln Tyr Ile Lys Lys His Asn Leu Pro Thr Ser Asp
    225 230 235 240
    Leu Pro Leu Ile Ser Gln Ile Tyr Phe Asp Lys Gln Arg Glu Glu Asn
    245 250 255
    Arg Gln Ala Ala Leu Arg Lys His Ser Ser Arg Glu Leu Leu Tyr Lys
    260 265 270
    Ser Arg Ser Ser Ser Ser Ser Leu Ser Ser Asn Asn Leu Leu Ala Asn
    275 280 285
    Lys Asp Asn Ser Ile Thr Ser Asn Asn Gly Ser Gln Pro Arg Arg Lys
    290 295 300
    Val Ser Thr Gly Ser Ser Ser Ser Lys Ser Ser Ile Glu Ile Arg Arg
    305 310 315 320
    Ala Leu Lys Glu Asn Ile Asp Thr Ser Asn Asn Ser Asn Phe Asn Ser
    325 330 335
    Pro Ile His Lys Ile Tyr Lys Gly Ile Ser Arg Asn Lys Asp Ser Asp
    340 345 350
    Ser Glu Lys Arg Glu Val Leu Arg Asn Ile Ser Ile Asn Ala Asn His
    355 360 365
    Ala Asp Asn Leu Leu Gln Gln Glu Asn Lys Arg Leu Lys Arg Ser Leu
    370 375 380
    Asp Asp Ala Ile Thr Asn Glu Asn Ile Asn Ser Lys Asn Leu Glu Val
    385 390 395 400
    Phe Tyr His Arg Pro Ala Pro Lys Pro Pro Val Thr Lys Lys Val Glu
    405 410 415
    Ile Val Glu Pro Ala Lys Ser Ala Ser Leu Ser Asn Asn Arg Asn Ile
    420 425 430
    Ile Thr Val Asn Asp Ser Gln Tyr Glu Lys Ile Glu Leu Leu Gly Arg
    435 440 445
    Gly Gly Ser Ser Arg Val Tyr Lys Val Lys Gly Ser Gly Asn Arg Val
    450 455 460
    Tyr Ala Leu Lys Arg Val Ser Phe Asp Ala Phe Asp Asp Ser Ser Ile
    465 470 475 480
    Asp Gly Phe Lys Gly Glu Ile Glu Leu Leu Glu Lys Leu Lys Asp Gln
    485 490 495
    Lys Arg Val Ile Gln Leu Leu Asp Tyr Glu Met Gly Asp Gly Leu Leu
    500 505 510
    Tyr Leu Ile Met Glu Cys Gly Asp His Asp Leu Ser Gln Ile Leu Asn
    515 520 525
    Gln Arg Ser Gly Met Pro Leu Asp Phe Asn Phe Val Arg Phe Tyr Thr
    530 535 540
    Lys Glu Met Leu Leu Cys Ile Lys Val Val His Asp Ala Gly Ile Val
    545 550 555 560
    His Ser Asp Leu Lys Pro Ala Asn Phe Val Leu Val Lys Gly Ile Leu
    565 570 575
    Lys Ile Ile Asp Phe Gly Ile Ala Asn Ala Val Pro Glu His Thr Val
    580 585 590
    Asn Ile Tyr Arg Glu Thr Gln Ile Gly Thr Pro Asn Tyr Met Ala Pro
    595 600 605
    Glu Ala Leu Val Ala Met Asn Tyr Thr Gln Asn Ser Glu Asn Gln His
    610 615 620
    Glu Gly Asn Lys Trp Lys Val Gly Arg Pro Ser Asp Met Trp Ser Cys
    625 630 635 640
    Gly Cys Ile Ile Tyr Gln Met Ile Tyr Gly Lys Pro Pro Tyr Gly Ser
    645 650 655
    Phe Gln Gly Gln Asn Arg Leu Leu Ala Ile Met Asn Pro Asp Val Lys
    660 665 670
    Ile Pro Phe Pro Glu His Thr Ser Asn Asn Glu Lys Ile Pro Lys Ser
    675 680 685
    Ala Ile Glu Leu Met Lys Ala Cys Leu Tyr Arg Asn Pro Asp Lys Arg
    690 695 700
    Trp Thr Val Asp Lys Val Leu Ser Ser Thr Phe Leu Gln Pro Phe Met
    705 710 715 720
    Ile Ser Gly Ser Ile Met Glu Asp Leu Ile Arg Asn Ala Val Arg Tyr
    725 730 735
    Gly Ser Glu Lys Pro His Ile Ser Gln Asp Asp Leu Asn Asp Val Val
    740 745 750
    Asp Thr Val Leu Arg Lys Phe Ala Asp Tyr Lys Ile
    755 760
    <210> SEQ ID NO 31
    <211> LENGTH: 2079
    <212> TYPE: DNA
    <213> ORGANISM: Schizosaccharomyces pombe
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (30)...(2066)
    <400> SEQUENCE: 31
    ggaatgctcg ttttttagta actgtgttt atg tct aag cgc aat cct cct gtg 53
    Met Ser Lys Arg Asn Pro Pro Val
    1 5
    act aat atc gcg gac ttg gtg tca gat tct tcc tta gat gaa gac tcg 101
    Thr Asn Ile Ala Asp Leu Val Ser Asp Ser Ser Leu Asp Glu Asp Ser
    10 15 20
    ctt tct ttt ctc gaa gag ctt cag gat cca gaa tta tac ttc aaa aac 149
    Leu Ser Phe Leu Glu Glu Leu Gln Asp Pro Glu Leu Tyr Phe Lys Asn
    25 30 35 40
    gac act ttc tct tcc aag agt agc cat tct gat ggc acc gtt act ggg 197
    Asp Thr Phe Ser Ser Lys Ser Ser His Ser Asp Gly Thr Val Thr Gly
    45 50 55
    gat acg ttg cgt agg cag tca agc ggt gca act gct tta gag aga ttg 245
    Asp Thr Leu Arg Arg Gln Ser Ser Gly Ala Thr Ala Leu Glu Arg Leu
    60 65 70
    gtc tca cat cct cgt act aaa aat ttt gat ttg caa gga aat gga gga 293
    Val Ser His Pro Arg Thr Lys Asn Phe Asp Leu Gln Gly Asn Gly Gly
    75 80 85
    caa aat tct gct ttg aag gaa gtg aat act cca gca tat cag tca atg 341
    Gln Asn Ser Ala Leu Lys Glu Val Asn Thr Pro Ala Tyr Gln Ser Met
    90 95 100
    cac cat ttc gag cat tta ata aca ccc ttg ccc tct act aat gcg tct 389
    His His Phe Glu His Leu Ile Thr Pro Leu Pro Ser Thr Asn Ala Ser
    105 110 115 120
    cac agt gaa gtt tca ctc agt gca gga gtg aat gat ctc aat tct aat 437
    His Ser Glu Val Ser Leu Ser Ala Gly Val Asn Asp Leu Asn Ser Asn
    125 130 135
    tcg gag cat gat ttg tta cct aaa agt gta aac aaa acc ccc ggt tct 485
    Ser Glu His Asp Leu Leu Pro Lys Ser Val Asn Lys Thr Pro Gly Ser
    140 145 150
    tta tca att tca aga cga cga aga atc ggc aga att gga tta ggc cct 533
    Leu Ser Ile Ser Arg Arg Arg Arg Ile Gly Arg Ile Gly Leu Gly Pro
    155 160 165
    cca aag cgt gct gag tac acg ttg acg gat ccc tcg aag act tcc gat 581
    Pro Lys Arg Ala Glu Tyr Thr Leu Thr Asp Pro Ser Lys Thr Ser Asp
    170 175 180
    acc aaa aac tct aca gaa gca gat gag gat att gaa atg aaa tct cga 629
    Thr Lys Asn Ser Thr Glu Ala Asp Glu Asp Ile Glu Met Lys Ser Arg
    185 190 195 200
    gaa gta tca cca gct tcc aac tct gtt gct gca aca act tta aaa cct 677
    Glu Val Ser Pro Ala Ser Asn Ser Val Ala Ala Thr Thr Leu Lys Pro
    205 210 215
    ctg cag ctg cat aac act cct ttg caa aca tcc cag gag cat ccc aaa 725
    Leu Gln Leu His Asn Thr Pro Leu Gln Thr Ser Gln Glu His Pro Lys
    220 225 230
    cct tct ttt cat cct tct cag ttt gag agc tct ttt tct cct agg gtg 773
    Pro Ser Phe His Pro Ser Gln Phe Glu Ser Ser Phe Ser Pro Arg Val
    235 240 245
    cag ttt gat cac gat gtt gaa aga aga gct agt gaa ctt cat tct cgt 821
    Gln Phe Asp His Asp Val Glu Arg Arg Ala Ser Glu Leu His Ser Arg
    250 255 260
    cca gtc acc gtt ttc caa gag cct cag cgt tct gct tct caa cca tat 869
    Pro Val Thr Val Phe Gln Glu Pro Gln Arg Ser Ala Ser Gln Pro Tyr
    265 270 275 280
    gaa tct cat gct ctt tct cca aag gtg gct ccg tta ttt gat aac agt 917
    Glu Ser His Ala Leu Ser Pro Lys Val Ala Pro Leu Phe Asp Asn Ser
    285 290 295
    caa gct act ccc ata ccc aag cgt cag cag gac gtt gtt act gtt gcc 965
    Gln Ala Thr Pro Ile Pro Lys Arg Gln Gln Asp Val Val Thr Val Ala
    300 305 310
    aat cta caa ttt atc aaa tta gga gtt gtt gga aag ggt gga agt agt 1013
    Asn Leu Gln Phe Ile Lys Leu Gly Val Val Gly Lys Gly Gly Ser Ser
    315 320 325
    atg gta tat cgc ata ttt tcc ccc gat aac agt cgt tta tac gct ttg 1061
    Met Val Tyr Arg Ile Phe Ser Pro Asp Asn Ser Arg Leu Tyr Ala Leu
    330 335 340
    aaa gag gtg aac ttt att aat gca gac caa act act ata caa gga tac 1109
    Lys Glu Val Asn Phe Ile Asn Ala Asp Gln Thr Thr Ile Gln Gly Tyr
    345 350 355 360
    aag aac gaa att gca tta tta aga aag ctt tca ggc aat gat cgc ata 1157
    Lys Asn Glu Ile Ala Leu Leu Arg Lys Leu Ser Gly Asn Asp Arg Ile
    365 370 375
    att aaa tta tat gct gcc gaa gtt aat gat act tta ggg caa ctc aat 1205
    Ile Lys Leu Tyr Ala Ala Glu Val Asn Asp Thr Leu Gly Gln Leu Asn
    380 385 390
    atg gtg atg gaa tgc gga gaa acg gat tta gca aac ctt tta atg aaa 1253
    Met Val Met Glu Cys Gly Glu Thr Asp Leu Ala Asn Leu Leu Met Lys
    395 400 405
    aac atg aag aaa ccc att aat ctt aat ttc atc aga atg tat tgg gag 1301
    Asn Met Lys Lys Pro Ile Asn Leu Asn Phe Ile Arg Met Tyr Trp Glu
    410 415 420
    caa atg cta gag gcg gtc cag gta gtt cat gat caa aat ata gtg cat 1349
    Gln Met Leu Glu Ala Val Gln Val Val His Asp Gln Asn Ile Val His
    425 430 435 440
    tcg gat ttg aag ccg gcc aat ttc ctg ctt gta gaa ggg aat ttg aag 1397
    Ser Asp Leu Lys Pro Ala Asn Phe Leu Leu Val Glu Gly Asn Leu Lys
    445 450 455
    ctg att gat ttt ggc att gcc aaa gca att ggt aat gac acc act aat 1445
    Leu Ile Asp Phe Gly Ile Ala Lys Ala Ile Gly Asn Asp Thr Thr Asn
    460 465 470
    atc cat cgt gat tcc cac atc ggt act att aat tat atg gca cct gaa 1493
    Ile His Arg Asp Ser His Ile Gly Thr Ile Asn Tyr Met Ala Pro Glu
    475 480 485
    gct ttg aca gac atg aat gct cac aca aac tct ggc gtg aaa ctc gta 1541
    Ala Leu Thr Asp Met Asn Ala His Thr Asn Ser Gly Val Lys Leu Val
    490 495 500
    aag ttg ggc agg ccc agc gac gtg tgg agt ttg gga tgt ata tta tat 1589
    Lys Leu Gly Arg Pro Ser Asp Val Trp Ser Leu Gly Cys Ile Leu Tyr
    505 510 515 520
    cag atg gtg tat ggg agg gcc ccg ttt gct cat cta aaa atg atc caa 1637
    Gln Met Val Tyr Gly Arg Ala Pro Phe Ala His Leu Lys Met Ile Gln
    525 530 535
    gct ata gca gct atc cct aat gaa caa tat cac att cat ttc ccc gaa 1685
    Ala Ile Ala Ala Ile Pro Asn Glu Gln Tyr His Ile His Phe Pro Glu
    540 545 550
    gtt gcc tta cct gct aat gct gtc cag gag aaa gag gga tcg ttg cca 1733
    Val Ala Leu Pro Ala Asn Ala Val Gln Glu Lys Glu Gly Ser Leu Pro
    555 560 565
    ggt gta act gtc ggg cct gat cta atg gat gtt atg aaa aga tgc ctg 1781
    Gly Val Thr Val Gly Pro Asp Leu Met Asp Val Met Lys Arg Cys Leu
    570 575 580
    gaa agg gat caa cgg aag aga ctt aca ata ccg gaa ttg ctg gtt cat 1829
    Glu Arg Asp Gln Arg Lys Arg Leu Thr Ile Pro Glu Leu Leu Val His
    585 590 595 600
    ccc ttt tta aac cct ttg cca tcc tat ttg aca cct ttg gcc aaa aag 1877
    Pro Phe Leu Asn Pro Leu Pro Ser Tyr Leu Thr Pro Leu Ala Lys Lys
    605 610 615
    ccg tta cct gtt tct ggg cac acc aat aat gct cat cca ctt aga ctc 1925
    Pro Leu Pro Val Ser Gly His Thr Asn Asn Ala His Pro Leu Arg Leu
    620 625 630
    agc aca gaa atc tca gct tct caa tta tca atg att ata gaa agg tcg 1973
    Ser Thr Glu Ile Ser Ala Ser Gln Leu Ser Met Ile Ile Glu Arg Ser
    635 640 645
    gtg gag ttg agt aag cac aag cga tta aat aag gaa ctt att gat agc 2021
    Val Glu Leu Ser Lys His Lys Arg Leu Asn Lys Glu Leu Ile Asp Ser
    650 655 660
    atg gct tat gat tgc gtt agc aat tta cga aaa atg cca gaa tag 2066
    Met Ala Tyr Asp Cys Val Ser Asn Leu Arg Lys Met Pro Glu *
    665 670 675
    aggcactaaa ttt 2079
    <210> SEQ ID NO 32
    <211> LENGTH: 678
    <212> TYPE: PRT
    <213> ORGANISM: Schizosaccharomyces pombe
    <400> SEQUENCE: 32
    Met Ser Lys Arg Asn Pro Pro Val Thr Asn Ile Ala Asp Leu Val Ser
    1 5 10 15
    Asp Ser Ser Leu Asp Glu Asp Ser Leu Ser Phe Leu Glu Glu Leu Gln
    20 25 30
    Asp Pro Glu Leu Tyr Phe Lys Asn Asp Thr Phe Ser Ser Lys Ser Ser
    35 40 45
    His Ser Asp Gly Thr Val Thr Gly Asp Thr Leu Arg Arg Gln Ser Ser
    50 55 60
    Gly Ala Thr Ala Leu Glu Arg Leu Val Ser His Pro Arg Thr Lys Asn
    65 70 75 80
    Phe Asp Leu Gln Gly Asn Gly Gly Gln Asn Ser Ala Leu Lys Glu Val
    85 90 95
    Asn Thr Pro Ala Tyr Gln Ser Met His His Phe Glu His Leu Ile Thr
    100 105 110
    Pro Leu Pro Ser Thr Asn Ala Ser His Ser Glu Val Ser Leu Ser Ala
    115 120 125
    Gly Val Asn Asp Leu Asn Ser Asn Ser Glu His Asp Leu Leu Pro Lys
    130 135 140
    Ser Val Asn Lys Thr Pro Gly Ser Leu Ser Ile Ser Arg Arg Arg Arg
    145 150 155 160
    Ile Gly Arg Ile Gly Leu Gly Pro Pro Lys Arg Ala Glu Tyr Thr Leu
    165 170 175
    Thr Asp Pro Ser Lys Thr Ser Asp Thr Lys Asn Ser Thr Glu Ala Asp
    180 185 190
    Glu Asp Ile Glu Met Lys Ser Arg Glu Val Ser Pro Ala Ser Asn Ser
    195 200 205
    Val Ala Ala Thr Thr Leu Lys Pro Leu Gln Leu His Asn Thr Pro Leu
    210 215 220
    Gln Thr Ser Gln Glu His Pro Lys Pro Ser Phe His Pro Ser Gln Phe
    225 230 235 240
    Glu Ser Ser Phe Ser Pro Arg Val Gln Phe Asp His Asp Val Glu Arg
    245 250 255
    Arg Ala Ser Glu Leu His Ser Arg Pro Val Thr Val Phe Gln Glu Pro
    260 265 270
    Gln Arg Ser Ala Ser Gln Pro Tyr Glu Ser His Ala Leu Ser Pro Lys
    275 280 285
    Val Ala Pro Leu Phe Asp Asn Ser Gln Ala Thr Pro Ile Pro Lys Arg
    290 295 300
    Gln Gln Asp Val Val Thr Val Ala Asn Leu Gln Phe Ile Lys Leu Gly
    305 310 315 320
    Val Val Gly Lys Gly Gly Ser Ser Met Val Tyr Arg Ile Phe Ser Pro
    325 330 335
    Asp Asn Ser Arg Leu Tyr Ala Leu Lys Glu Val Asn Phe Ile Asn Ala
    340 345 350
    Asp Gln Thr Thr Ile Gln Gly Tyr Lys Asn Glu Ile Ala Leu Leu Arg
    355 360 365
    Lys Leu Ser Gly Asn Asp Arg Ile Ile Lys Leu Tyr Ala Ala Glu Val
    370 375 380
    Asn Asp Thr Leu Gly Gln Leu Asn Met Val Met Glu Cys Gly Glu Thr
    385 390 395 400
    Asp Leu Ala Asn Leu Leu Met Lys Asn Met Lys Lys Pro Ile Asn Leu
    405 410 415
    Asn Phe Ile Arg Met Tyr Trp Glu Gln Met Leu Glu Ala Val Gln Val
    420 425 430
    Val His Asp Gln Asn Ile Val His Ser Asp Leu Lys Pro Ala Asn Phe
    435 440 445
    Leu Leu Val Glu Gly Asn Leu Lys Leu Ile Asp Phe Gly Ile Ala Lys
    450 455 460
    Ala Ile Gly Asn Asp Thr Thr Asn Ile His Arg Asp Ser His Ile Gly
    465 470 475 480
    Thr Ile Asn Tyr Met Ala Pro Glu Ala Leu Thr Asp Met Asn Ala His
    485 490 495
    Thr Asn Ser Gly Val Lys Leu Val Lys Leu Gly Arg Pro Ser Asp Val
    500 505 510
    Trp Ser Leu Gly Cys Ile Leu Tyr Gln Met Val Tyr Gly Arg Ala Pro
    515 520 525
    Phe Ala His Leu Lys Met Ile Gln Ala Ile Ala Ala Ile Pro Asn Glu
    530 535 540
    Gln Tyr His Ile His Phe Pro Glu Val Ala Leu Pro Ala Asn Ala Val
    545 550 555 560
    Gln Glu Lys Glu Gly Ser Leu Pro Gly Val Thr Val Gly Pro Asp Leu
    565 570 575
    Met Asp Val Met Lys Arg Cys Leu Glu Arg Asp Gln Arg Lys Arg Leu
    580 585 590
    Thr Ile Pro Glu Leu Leu Val His Pro Phe Leu Asn Pro Leu Pro Ser
    595 600 605
    Tyr Leu Thr Pro Leu Ala Lys Lys Pro Leu Pro Val Ser Gly His Thr
    610 615 620
    Asn Asn Ala His Pro Leu Arg Leu Ser Thr Glu Ile Ser Ala Ser Gln
    625 630 635 640
    Leu Ser Met Ile Ile Glu Arg Ser Val Glu Leu Ser Lys His Lys Arg
    645 650 655
    Leu Asn Lys Glu Leu Ile Asp Ser Met Ala Tyr Asp Cys Val Ser Asn
    660 665 670
    Leu Arg Lys Met Pro Glu
    675
    <210> SEQ ID NO 33
    <211> LENGTH: 2263
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (379)...(1491)
    <400> SEQUENCE: 33
    gatatcacag caacattgaa atgctaaaaa gtttttaaac actctcaatt tctaattcac 60
    catgtcacag actggtgaaa aaaaaaaaaa aagcggccgc ttccccccgg ccgggccccc 120
    gccgccccgc ggtccccaga gcgccaggcc cccgggggga gggagggagg gcgccgggcc 180
    ggtgggagcc agcggcgcgc ggtgggaccc acggagcccc gcgacccgcc gagcctggag 240
    ccgggccggc tcggggaagc cggctccagc ccggagcgaa cttcgcagcc cgtcgggggg 300
    cggcggggag ggggcccgga gccggaggag ggggcggccg cgggcacccc cgcctgtgcc 360
    ccggcgtccc cgggcacc atg ctg tcc aac tcc cag ggc cag agc ccg ccg 411
    Met Leu Ser Asn Ser Gln Gly Gln Ser Pro Pro
    1 5 10
    gtg ccg ttc ccc gcc ccg gcc ccg ccg ccg cag ccc ccc acc cct gcc 459
    Val Pro Phe Pro Ala Pro Ala Pro Pro Pro Gln Pro Pro Thr Pro Ala
    15 20 25
    ctg ccg cac ccc ccg gcg cag ccg ccg ccg ccg ccc ccg cag cag ttc 507
    Leu Pro His Pro Pro Ala Gln Pro Pro Pro Pro Pro Pro Gln Gln Phe
    30 35 40
    ccg cag ttc cac gtc aag tcc ggc ctg cag atc aag aag aac gcc atc 555
    Pro Gln Phe His Val Lys Ser Gly Leu Gln Ile Lys Lys Asn Ala Ile
    45 50 55
    atc gat gac tac aag gtc acc agc cag gtc ctg ggg ctg ggc atc aac 603
    Ile Asp Asp Tyr Lys Val Thr Ser Gln Val Leu Gly Leu Gly Ile Asn
    60 65 70 75
    ggc aaa gtt ttg cag atc ttc aac aag agg acc cag gag aaa ttc gcc 651
    Gly Lys Val Leu Gln Ile Phe Asn Lys Arg Thr Gln Glu Lys Phe Ala
    80 85 90
    ctc aaa atg ctt cag gac tgc ccc aag gcc cgc agg gag gtg gag ctg 699
    Leu Lys Met Leu Gln Asp Cys Pro Lys Ala Arg Arg Glu Val Glu Leu
    95 100 105
    cac tgg cgg gcc tcc cag tgc ccg cac atc gta cgg atc gtg gat gtg 747
    His Trp Arg Ala Ser Gln Cys Pro His Ile Val Arg Ile Val Asp Val
    110 115 120
    tac gag aat ctg tac gca ggg agg aag tgc ctg ctg att gtc atg gaa 795
    Tyr Glu Asn Leu Tyr Ala Gly Arg Lys Cys Leu Leu Ile Val Met Glu
    125 130 135
    tgt ttg gac ggt gga gaa ctc ttt agc cga atc cag gat cga gga gac 843
    Cys Leu Asp Gly Gly Glu Leu Phe Ser Arg Ile Gln Asp Arg Gly Asp
    140 145 150 155
    cag gca ttc aca gaa aga gaa gca tcc gaa atc atg aag agc atc ggt 891
    Gln Ala Phe Thr Glu Arg Glu Ala Ser Glu Ile Met Lys Ser Ile Gly
    160 165 170
    gag gcc atc cag tat ctg cat tca atc aac att gcc cat cgg gat gtc 939
    Glu Ala Ile Gln Tyr Leu His Ser Ile Asn Ile Ala His Arg Asp Val
    175 180 185
    aag cct gag aat ctc tta tac acc tcc aaa agg ccc aac gcc atc ctg 987
    Lys Pro Glu Asn Leu Leu Tyr Thr Ser Lys Arg Pro Asn Ala Ile Leu
    190 195 200
    aaa ctc act gac ttt ggc ttt gcc aag gaa acc acc agc cac aac tct 1035
    Lys Leu Thr Asp Phe Gly Phe Ala Lys Glu Thr Thr Ser His Asn Ser
    205 210 215
    ttg acc act cct tgt tat aca ccg tac tat gtg gct cca gaa gtg ctg 1083
    Leu Thr Thr Pro Cys Tyr Thr Pro Tyr Tyr Val Ala Pro Glu Val Leu
    220 225 230 235
    ggt cca gag aag tat gac aag tcc tgt gac atg tgg tcc ctg ggt gtc 1131
    Gly Pro Glu Lys Tyr Asp Lys Ser Cys Asp Met Trp Ser Leu Gly Val
    240 245 250
    atc atg tac atc ctg ctg tgt ggg tat ccc ccc ttc tac tcc aac cac 1179
    Ile Met Tyr Ile Leu Leu Cys Gly Tyr Pro Pro Phe Tyr Ser Asn His
    255 260 265
    ggc ctt gcc atc tct ccg ggc atg aag act cgc atc cga atg ggc cag 1227
    Gly Leu Ala Ile Ser Pro Gly Met Lys Thr Arg Ile Arg Met Gly Gln
    270 275 280
    tat gaa ttt ccc aac cca gaa tgg tca gaa gta tca gag gaa gtg aag 1275
    Tyr Glu Phe Pro Asn Pro Glu Trp Ser Glu Val Ser Glu Glu Val Lys
    285 290 295
    atg ctc att cgg aat ctg ctg aaa aca gag ccc acc cag aga atg acc 1323
    Met Leu Ile Arg Asn Leu Leu Lys Thr Glu Pro Thr Gln Arg Met Thr
    300 305 310 315
    atc acc gag ttt atg aac cac cct tgg atc atg caa tca aca aag gtc 1371
    Ile Thr Glu Phe Met Asn His Pro Trp Ile Met Gln Ser Thr Lys Val
    320 325 330
    cct caa acc cca ctg cac acc agc cgg gtc ctg aag gag gac aag gag 1419
    Pro Gln Thr Pro Leu His Thr Ser Arg Val Leu Lys Glu Asp Lys Glu
    335 340 345
    cgg tgg gag gat gtc aag ggg tgt ctt cat gac aag aac agc gac cag 1467
    Arg Trp Glu Asp Val Lys Gly Cys Leu His Asp Lys Asn Ser Asp Gln
    350 355 360
    gcc act tgg ctg acc agg ttg tga gcagaggatt ctgtgttcct gtccaaactc 1521
    Ala Thr Trp Leu Thr Arg Leu *
    365 370
    agtgctgttt cttagaatcc ttttattccc tgggtctcta atgggacctt aaagaccatc 1581
    tggtatcatc ttctcatttt gcagaagaga aactgaggcc cagaggcgga gggcagtctg 1641
    ctcaaggtca cgcagctggt gactggttgg ggcagaccgg acccaggttt cctgactcct 1701
    ggcccaagtc tcttcctcct atcctgcggg atcactgggg ggctctcagg gaacagcagc 1761
    agtgccatag ccaggctctc tgctgcccag cgctggggtg aggctgccgt tgtcagcgtg 1821
    gaccactaac cagcccgtct tctctctctg ctcccacccc tgccgccctc accctgccct 1881
    tgttgtctct gtctctcacg tctctcttct gctgtctctc ctacctgtct tctggctctc 1941
    tctgtaccct tcctggtgct gccgtgcccc caggaggaga tgaccagtgc cttggccaca 2001
    atgcgcgttg actacgagca gatcaagata aaaaagattg aagatgcatc caaccctctg 2061
    ctgctgaaga ggcggaagaa agctcgggcc ctggaggctg cggctctggc ccactgagcc 2121
    accgcgccct cctgcccacg ggaggacaag caataactct ctacaggaat atatttttta 2181
    aacgaagaga cagaactgtc cacatctgcc tcctctcctc ctcagctgca tggagcctgg 2241
    aactgcatca gtgactgaat tc 2263
    <210> SEQ ID NO 34
    <211> LENGTH: 370
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 34
    Met Leu Ser Asn Ser Gln Gly Gln Ser Pro Pro Val Pro Phe Pro Ala
    1 5 10 15
    Pro Ala Pro Pro Pro Gln Pro Pro Thr Pro Ala Leu Pro His Pro Pro
    20 25 30
    Ala Gln Pro Pro Pro Pro Pro Pro Gln Gln Phe Pro Gln Phe His Val
    35 40 45
    Lys Ser Gly Leu Gln Ile Lys Lys Asn Ala Ile Ile Asp Asp Tyr Lys
    50 55 60
    Val Thr Ser Gln Val Leu Gly Leu Gly Ile Asn Gly Lys Val Leu Gln
    65 70 75 80
    Ile Phe Asn Lys Arg Thr Gln Glu Lys Phe Ala Leu Lys Met Leu Gln
    85 90 95
    Asp Cys Pro Lys Ala Arg Arg Glu Val Glu Leu His Trp Arg Ala Ser
    100 105 110
    Gln Cys Pro His Ile Val Arg Ile Val Asp Val Tyr Glu Asn Leu Tyr
    115 120 125
    Ala Gly Arg Lys Cys Leu Leu Ile Val Met Glu Cys Leu Asp Gly Gly
    130 135 140
    Glu Leu Phe Ser Arg Ile Gln Asp Arg Gly Asp Gln Ala Phe Thr Glu
    145 150 155 160
    Arg Glu Ala Ser Glu Ile Met Lys Ser Ile Gly Glu Ala Ile Gln Tyr
    165 170 175
    Leu His Ser Ile Asn Ile Ala His Arg Asp Val Lys Pro Glu Asn Leu
    180 185 190
    Leu Tyr Thr Ser Lys Arg Pro Asn Ala Ile Leu Lys Leu Thr Asp Phe
    195 200 205
    Gly Phe Ala Lys Glu Thr Thr Ser His Asn Ser Leu Thr Thr Pro Cys
    210 215 220
    Tyr Thr Pro Tyr Tyr Val Ala Pro Glu Val Leu Gly Pro Glu Lys Tyr
    225 230 235 240
    Asp Lys Ser Cys Asp Met Trp Ser Leu Gly Val Ile Met Tyr Ile Leu
    245 250 255
    Leu Cys Gly Tyr Pro Pro Phe Tyr Ser Asn His Gly Leu Ala Ile Ser
    260 265 270
    Pro Gly Met Lys Thr Arg Ile Arg Met Gly Gln Tyr Glu Phe Pro Asn
    275 280 285
    Pro Glu Trp Ser Glu Val Ser Glu Glu Val Lys Met Leu Ile Arg Asn
    290 295 300
    Leu Leu Lys Thr Glu Pro Thr Gln Arg Met Thr Ile Thr Glu Phe Met
    305 310 315 320
    Asn His Pro Trp Ile Met Gln Ser Thr Lys Val Pro Gln Thr Pro Leu
    325 330 335
    His Thr Ser Arg Val Leu Lys Glu Asp Lys Glu Arg Trp Glu Asp Val
    340 345 350
    Lys Gly Cys Leu His Asp Lys Asn Ser Asp Gln Ala Thr Trp Leu Thr
    355 360 365
    Arg Leu
    370
    <210> SEQ ID NO 35
    <211> LENGTH: 1074
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (628)...(831)
    <400> SEQUENCE: 35
    ttttactttt tttaagcaca aaattttgtt ttttttctcc cctccccaca gatcccatct 60
    caaatcattc tgttaaccac cattccaaca ggtcgaggag agcttaaaca ccttcttcct 120
    ctgccttgtt tctatttttt tatttttttg catcagtatt aatgtttttg catactctcc 180
    atctttatcc aaaaatgtaa acttcctttg tcaatctatg gatatgccca tatatgaaag 240
    agatgggtgg gtcaaaaagg gatatcaaat gaagtgatag gggtcacaat ggggaaatgg 300
    aagtggtaca taacattgcc aaaataatgt gccactagaa atggtgtaaa ggctgtcttt 360
    ttttttaaga aaagttatta ccatgtattt tgtgaggcag gtttacaaca ctacaagtct 420
    tgactaagaa ggaaagagga aaaaagaaaa aacaccaata cccatattta aaaaaaaaaa 480
    aatgatcata gtcttaggag ttcatttaaa ccataggaac ttttcactta tctcatgtta 540
    ggtgtaccag tcagtgatta agtagaacta caagttatat aggctgtatt gtttattgct 600
    ggtttatgac cttaataaag tgtaatt atg tat tac cag cag ggt gtt ttt aac 654
    Met Tyr Tyr Gln Gln Gly Val Phe Asn
    1 5
    tgt gac tat tgt ata aaa aca aat ctt gat atc cag aag cac atg aag 702
    Cys Asp Tyr Cys Ile Lys Thr Asn Leu Asp Ile Gln Lys His Met Lys
    10 15 20 25
    ttt gcg act ttc cac cct gcc cat ttt tgt aaa act gca gtc atc ttg 750
    Phe Ala Thr Phe His Pro Ala His Phe Cys Lys Thr Ala Val Ile Leu
    30 35 40
    gac ctt tta aac aca aat ttt aaa ctc aac caa gct gtg ata agc gga 798
    Asp Leu Leu Asn Thr Asn Phe Lys Leu Asn Gln Ala Val Ile Ser Gly
    45 50 55
    atg gtt act gtt tat act gtg gta tgt ttt tga ttacagcaga taatgctttc 851
    Met Val Thr Val Tyr Thr Val Val Cys Phe *
    60 65
    ttttccagtc atctttgaga ataaaggaaa aaaaaaatct tcagatgcaa tggttttgtg 911
    tagcatcttg tctatcatgt tttgtaaatg ctggagaagc gtcgaccaat ttgacttaga 971
    gatggaatgt aactttgctt acaaaaattg ctattaaact cctacttaag gtgttctaat 1031
    tttctgtgag cacactaaaa acaaaaatat atgtgaataa aat 1074
    <210> SEQ ID NO 36
    <211> LENGTH: 67
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 36
    Met Tyr Tyr Gln Gln Gly Val Phe Asn Cys Asp Tyr Cys Ile Lys Thr
    1 5 10 15
    Asn Leu Asp Ile Gln Lys His Met Lys Phe Ala Thr Phe His Pro Ala
    20 25 30
    His Phe Cys Lys Thr Ala Val Ile Leu Asp Leu Leu Asn Thr Asn Phe
    35 40 45
    Lys Leu Asn Gln Ala Val Ile Ser Gly Met Val Thr Val Tyr Thr Val
    50 55 60
    Val Cys Phe
    65
    <210> SEQ ID NO 37
    <211> LENGTH: 1356
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <220> FEATURE:
    <221> NAME/KEY: CDS
    <222> LOCATION: (553)...(1095)
    <400> SEQUENCE: 37
    ttctcccgca accttccctt cgctccctcc cgtccccccc agctcctagc ctccgactcc 60
    ctccccccct cacgcccgcc ctctcgcctt cgccgaacca aagtggatta attacacgct 120
    ttctgtttct ctccgtgctg ttctctcccg ctgtgcgcct gcccgcctct cgctgtcctc 180
    tctccccctc gccctctctt cggccccccc ctttcacgtt cactctgtct ctcccactat 240
    ctctgccccc ctctatcctt gatacaacag ctgacctcat ttcccgatac cttttccccc 300
    ccgaaaagta caacatctgg cccgccccag cccgaagaca gcccgtcctc cctggacaat 360
    cagacgaatt ctcccccccc ccccaaaaaa aaaagccatc cccccgctct gccccgtcgc 420
    acattcggcc cccgcgactc ggccagagcg gcgctggcag aggagtgtcc ggcaggaggg 480
    ccaacgcccg ctgttcggtt tgcgacacgc agcagggagg tgggcggcag cgtcgccggc 540
    ttccagacac ca atg gga atc cca atg ggg aag tcg atg ctg gtg ctt ctc 591
    Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu
    1 5 10
    acc ttc ttg gcc ttc gcc tcg tgc tgc att gct gct tac cgc ccc agt 639
    Thr Phe Leu Ala Phe Ala Ser Cys Cys Ile Ala Ala Tyr Arg Pro Ser
    15 20 25
    gag acc ctg tgc ggc ggg gag ctg gtg gac acc ctc cag ttc gtc tgt 687
    Glu Thr Leu Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys
    30 35 40 45
    ggg gac cgc ggc ttc tac ttc agc agg ccc gca agc cgt gtg agc cgt 735
    Gly Asp Arg Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg
    50 55 60
    cgc agc cgt ggc atc gtt gag gag tgc tgt ttc cgc agc tgt gac ctg 783
    Arg Ser Arg Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu
    65 70 75
    gcc ctc ctg gag acg tac tgt gct acc ccc gcc aag tcc gag agg gac 831
    Ala Leu Leu Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Arg Asp
    80 85 90
    gtg tcg acc cct ccg acc gtg ctt ccg gac aac ttc ccc aga tac ccc 879
    Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro
    95 100 105
    gtg ggc aag ttc ttc caa tat gac acc tgg aag cag tcc acc cag cgc 927
    Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg
    110 115 120 125
    ctg cgc agg ggc ctg cct gcc ctc ctg cgt gcc cgc cgg ggt cac gtg 975
    Leu Arg Arg Gly Leu Pro Ala Leu Leu Arg Ala Arg Arg Gly His Val
    130 135 140
    ctc gcc aag gag ctc gag gcg ttc agg gag gcc aaa cgt cac cgt ccc 1023
    Leu Ala Lys Glu Leu Glu Ala Phe Arg Glu Ala Lys Arg His Arg Pro
    145 150 155
    ctg att gct cta ccc acc caa gac ccc gcc cac ggg ggc gcc ccc cca 1071
    Leu Ile Ala Leu Pro Thr Gln Asp Pro Ala His Gly Gly Ala Pro Pro
    160 165 170
    gag atg gcc agc aat cgg aag tga gcaaaactgc cgcaagtctg cagcccggcg 1125
    Glu Met Ala Ser Asn Arg Lys *
    175 180
    ccaccatcct gcagcctcct cctgaccacg gacgtttcca tcaggttcca tcccgaaaat 1185
    ctctcggttc cacgtccccc tggggcttct cctgacccag tccccgtgcc ccgcctcccc 1245
    gaaacaggct actctcctcg gccccctcca tcgggctgag gaagcacagc agcatcttca 1305
    aacatgtaca aaatcgattg gctttaaaca cccttcacat accctccccc c 1356
    <210> SEQ ID NO 38
    <211> LENGTH: 180
    <212> TYPE: PRT
    <213> ORGANISM: Homo sapiens
    <400> SEQUENCE: 38
    Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu
    1 5 10 15
    Ala Phe Ala Ser Cys Cys Ile Ala Ala Tyr Arg Pro Ser Glu Thr Leu
    20 25 30
    Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys Gly Asp Arg
    35 40 45
    Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg Arg Ser Arg
    50 55 60
    Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu
    65 70 75 80
    Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Arg Asp Val Ser Thr
    85 90 95
    Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys
    100 105 110
    Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu Arg Arg
    115 120 125
    Gly Leu Pro Ala Leu Leu Arg Ala Arg Arg Gly His Val Leu Ala Lys
    130 135 140
    Glu Leu Glu Ala Phe Arg Glu Ala Lys Arg His Arg Pro Leu Ile Ala
    145 150 155 160
    Leu Pro Thr Gln Asp Pro Ala His Gly Gly Ala Pro Pro Glu Met Ala
    165 170 175
    Ser Asn Arg Lys
    180

Claims (34)

That which is claimed is:
1. A method for reducing growth of a cancerous cell comprising:
contacting a cancerous cell with an amount of an agent effective to redue tyrosine threonine kinase (TTK) polypeptide activity in the cell;
wherein reduction of TTK polypeptide activity in the cancerous cell reduces growth of the cell.
2. The method of claim 1 wherein said reduction of TTK activity is a result of a reduction of TTK polypeptide levels.
3. The method of claim 2 wherein the agent is a TTK antisense polynucleotide.
4. The method of claim 3 wherein the TTK antisense polynucleotide is contained in a viral-based vector.
5. The method of claim 1 wherein said reduction of TTK activity is a result of a reduction of TTK polynucleotide levels.
6. The method of claim 1 wherein the agent is a monoclonal antibody that specifically binds TTK.
7. The method of claim 1 wherein the TTK polypeptide comprises the amino acid sequence of SEQ ID NO:14.
8. An assay for identifying a candidate agent that reduces growth of a cancerous cell, comprising:
detecting the activity of a TTK polypeptide in the presence of a candidate agent; and
comparing the activity of the TTK polypeptide in the presence of the candidate agent relative to TTK polypeptide activity in the absence of the candidate agent;
wherein a reduction of TTK activity in the presence of the candidate agent relative to TTK activity in the absence of the candidate agent indicates the candidate agent reduces growth of a cancerous cell.
9. The assay of claim 8, wherein said detecting step utilizes the polypeptide of SEQ ID NO:26 as a substrate.
10. The assay of claim 8, wherein said detecting step uses a fragment of SEQ ID NO:26 susceptible to TTK phosphorylation as a substrate.
11. The assay of claim 10, wherein said fragment comprises the polypeptide of SEQ ID NO:27 or 28.
12. The assay of claim 10 wherein the polypeptide fragment is biotinylated.
13. The assay of claim 8 wherein the TTK polypeptide is a product of expression using a system selected from the group of baculovirus, bacteria, yeast and mammalian systems.
14. The assay of claim 13 wherein the TTK polypeptide is a product of expression using a baculovirus system.
15. The method of claim 8 wherein the TTK polypeptide comprises the amino acid sequence of SEQ ID NO:14.
16. A method of identifying an agent that reduces TTK activity, the method comprising:
contacting a cancerous cell displaying elevated expression of a TTK-encoding polynucleotide with a candidate agent; and
determining the effect of the candidate agent on TTK polypeptide activity;
wherein a decrease in TTK activity indicates that the agent reduces TTK activity and inhibits growth of the cancerous cell.
17. The method of claim 16 wherein said reduction of TTK activity is a result of a reduction of TTK polypeptide levels.
18. The method of claim 16 wherein said reduction of TTK activity is a result of a reduction of TTK mRNA levels.
19. The method of claim 17 wherein the candidate agent is a TTK antisense polynucleotide.
20. The method of claim 19, wherein the TTK antisense polynucleotide is contained in a viral-based vector.
21. The method of claim 16 wherein the cancerous cell is a breast cancer cell.
22. The method of claim 16 wherein the cancerous cell is a colon cancer cell.
23. The method of claim 16 wherein TTK polypeptide comprises the amino acid sequence of SEQ ID NO:14.
24. The method according to claim 18, wherein TTK activity is detected by detecting expression of a TTK-encoding polynucleotide.
25. A method of detecting cancer other than ovarian cancer in a subject, the method comprising:
detecting a level of expression of a TTK polypeptide in a test cell obtained from a subject suspected of having cancer; and
comparing the level of expression of the TTK polypeptide in the test cell to a level of expression in a normal non-cancer cell of the same tissue type;
wherein detection of an expression level of TTK polypeptide in the test cell that is significantly increased relative to the level of expression in the normal non-cancer cell indicates that the subject has cancer other than ovarian cancer.
26. The method of claim 25, wherein the test cell is a colon cell.
27. The method of claim 25, wherein the test cell is a breast cell.
28. A method of detecting cancer other than ovarian cancer in a subject, the method comprising:
detecting a level of expression of a TTK polynucleotide in a test cell obtained from a subject suspected of having cancer; and
comparing the level of expression of the TTK polynucleotide in the test cell to a level of expression in a normal non-cancer cell of the same tissue type;
wherein detection of an expression level of TTK polynucleotide in the test cell that is significantly increased relative to the level of expression in the normal non-cancer cell indicates that the subject has cancer other than ovarian cancer.
29. The method of claim 29, wherein the test cell is a colon cell.
30. The method of claim 29, wherein the test cell is a breast cell.
31. A method for assessing the prognosis of a cancerous disease other than ovarian cancer in a subject, the method comprising:
detecting expression of a TTK-encoding polynucleotide in a test cancer cell of a subject; and
comparing a level of expression of a TTK-encoding polynucleotide in the test cancer cell with a level of expression the polynucleotide in a control non-cancer cell;
wherein the level of expression of TTK in the test cancer cell relative to the level of expression in the control non-cancer cell is indicative of the prognosis of the cancerous disease
32. The method of claim 31, wherein said detecting expression is by detection of a TTK-encoding transcript.
33. The method of claim 31, wherein the test cell is a colon cell.
34. The method of claim 31, wherein the test cell is a breast cell.
US10/081,119 1998-11-04 2002-02-21 TTK in diagnosis and as a therapeutic target in cancer Abandoned US20030045491A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US10/081,119 US20030045491A1 (en) 2001-02-23 2002-02-21 TTK in diagnosis and as a therapeutic target in cancer
US10/951,477 US7501244B2 (en) 2001-02-21 2004-09-27 Determining prognosis of colon or breast cancer by measuring TTK expression
US10/951,406 US7501243B2 (en) 2001-02-21 2004-09-27 Detection of colon or breast cancer by measuring TTK polypeptide expression
US10/951,389 US7501242B2 (en) 2001-02-21 2004-09-27 Detection of colon or breast cancer by measuring TTK polynucleotide expression
US10/977,087 US7867731B2 (en) 1998-11-04 2004-10-28 HX2004-6 polypeptide expressed in cancerous cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US28981301P 2001-02-23 2001-02-23
US10/081,119 US20030045491A1 (en) 2001-02-23 2002-02-21 TTK in diagnosis and as a therapeutic target in cancer

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US10/951,406 Division US7501243B2 (en) 2001-02-21 2004-09-27 Detection of colon or breast cancer by measuring TTK polypeptide expression
US10/951,477 Division US7501244B2 (en) 2001-02-21 2004-09-27 Determining prognosis of colon or breast cancer by measuring TTK expression
US10/951,389 Division US7501242B2 (en) 2001-02-21 2004-09-27 Detection of colon or breast cancer by measuring TTK polynucleotide expression
US10/977,087 Continuation-In-Part US7867731B2 (en) 1998-11-04 2004-10-28 HX2004-6 polypeptide expressed in cancerous cells

Publications (1)

Publication Number Publication Date
US20030045491A1 true US20030045491A1 (en) 2003-03-06

Family

ID=26765220

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/081,119 Abandoned US20030045491A1 (en) 1998-11-04 2002-02-21 TTK in diagnosis and as a therapeutic target in cancer
US10/951,477 Expired - Fee Related US7501244B2 (en) 2001-02-21 2004-09-27 Determining prognosis of colon or breast cancer by measuring TTK expression

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/951,477 Expired - Fee Related US7501244B2 (en) 2001-02-21 2004-09-27 Determining prognosis of colon or breast cancer by measuring TTK expression

Country Status (1)

Country Link
US (2) US20030045491A1 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040146942A1 (en) * 2001-05-11 2004-07-29 Gruenenthal Gmbh Screening method using PIM1-kinase or PIM3-kinase
US20050130926A1 (en) * 1998-11-04 2005-06-16 Chiron Corporation Gene products differentially expressed in cancerous cells and their methods of use V
US20060014171A1 (en) * 2004-05-06 2006-01-19 Roche Molecular Systems, Inc. SENP1 as a marker for cancer
US20060024692A1 (en) * 2002-09-30 2006-02-02 Oncotherapy Science, Inc. Method for diagnosing non-small cell lung cancers
US20060089321A1 (en) * 2002-02-12 2006-04-27 Walter Annette O Cks1 inhibitors
US20090202576A1 (en) * 2005-02-25 2009-08-13 Oncotherapy Science, Inc. Peptide vaccines for lung cancers expressing ttk, urlc10 or koc1 polypeptides
US20100009920A1 (en) * 2006-12-13 2010-01-14 Yusuke Nakamura Ttk as tumor marker and therapeutic target for lung cancer
WO2012168721A1 (en) 2011-06-10 2012-12-13 The Institute Of Cancer Research: Royal Cancer Hospital Materials and methods for treating pten mutated or deficient cancer
US8530430B2 (en) 2009-05-11 2013-09-10 Oncotherapy Science, Inc. TTK peptides and vaccines including the same
US8551980B2 (en) 2009-11-30 2013-10-08 Bayer Intellectual Property Gmbh Substituted triazolopyridines

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0307403D0 (en) 2003-03-31 2003-05-07 Medical Res Council Selection by compartmentalised screening
GB0307428D0 (en) 2003-03-31 2003-05-07 Medical Res Council Compartmentalised combinatorial chemistry
US20060078893A1 (en) 2004-10-12 2006-04-13 Medical Research Council Compartmentalised combinatorial chemistry by microfluidic control
US20050221339A1 (en) 2004-03-31 2005-10-06 Medical Research Council Harvard University Compartmentalised screening by microfluidic control
US7968287B2 (en) 2004-10-08 2011-06-28 Medical Research Council Harvard University In vitro evolution in microfluidic systems
EP2363205A3 (en) 2006-01-11 2014-06-04 Raindance Technologies, Inc. Microfluidic Devices And Methods Of Use In The Formation And Control Of Nanoreactors
EP2530168B1 (en) 2006-05-11 2015-09-16 Raindance Technologies, Inc. Microfluidic Devices
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
EP2077912B1 (en) 2006-08-07 2019-03-27 The President and Fellows of Harvard College Fluorocarbon emulsion stabilizing surfactants
US8772046B2 (en) 2007-02-06 2014-07-08 Brandeis University Manipulation of fluids and reactions in microfluidic systems
WO2008130623A1 (en) 2007-04-19 2008-10-30 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
WO2010009365A1 (en) 2008-07-18 2010-01-21 Raindance Technologies, Inc. Droplet libraries
US12038438B2 (en) 2008-07-18 2024-07-16 Bio-Rad Laboratories, Inc. Enzyme quantification
US8528589B2 (en) 2009-03-23 2013-09-10 Raindance Technologies, Inc. Manipulation of microfluidic droplets
US8632534B2 (en) 2009-04-03 2014-01-21 Angiodynamics, Inc. Irreversible electroporation (IRE) for congestive obstructive pulmonary disease (COPD)
US8903488B2 (en) 2009-05-28 2014-12-02 Angiodynamics, Inc. System and method for synchronizing energy delivery to the cardiac rhythm
US10520500B2 (en) 2009-10-09 2019-12-31 Abdeslam El Harrak Labelled silica-based nanomaterial with enhanced properties and uses thereof
EP2517025B1 (en) 2009-12-23 2019-11-27 Bio-Rad Laboratories, Inc. Methods for reducing the exchange of molecules between droplets
JP5934657B2 (en) 2010-02-12 2016-06-15 レインダンス テクノロジーズ, インコーポレイテッド Digital specimen analysis
US9399797B2 (en) 2010-02-12 2016-07-26 Raindance Technologies, Inc. Digital analyte analysis
US9366632B2 (en) 2010-02-12 2016-06-14 Raindance Technologies, Inc. Digital analyte analysis
US10351905B2 (en) 2010-02-12 2019-07-16 Bio-Rad Laboratories, Inc. Digital analyte analysis
WO2012045012A2 (en) 2010-09-30 2012-04-05 Raindance Technologies, Inc. Sandwich assays in droplets
US9700368B2 (en) 2010-10-13 2017-07-11 Angiodynamics, Inc. System and method for electrically ablating tissue of a patient
EP3859011A1 (en) 2011-02-11 2021-08-04 Bio-Rad Laboratories, Inc. Methods for forming mixed droplets
EP2675819B1 (en) 2011-02-18 2020-04-08 Bio-Rad Laboratories, Inc. Compositions and methods for molecular labeling
DE202012013668U1 (en) 2011-06-02 2019-04-18 Raindance Technologies, Inc. enzyme quantification
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
US8658430B2 (en) 2011-07-20 2014-02-25 Raindance Technologies, Inc. Manipulating droplet size
US9078665B2 (en) 2011-09-28 2015-07-14 Angiodynamics, Inc. Multiple treatment zone ablation probe
US9414881B2 (en) 2012-02-08 2016-08-16 Angiodynamics, Inc. System and method for increasing a target zone for electrical ablation
WO2013120089A1 (en) 2012-02-10 2013-08-15 Raindance Technologies, Inc. Molecular diagnostic screening assay
EP2844768B1 (en) 2012-04-30 2019-03-13 Raindance Technologies, Inc. Digital analyte analysis
EP2986762B1 (en) 2013-04-19 2019-11-06 Bio-Rad Laboratories, Inc. Digital analyte analysis
US11901041B2 (en) 2013-10-04 2024-02-13 Bio-Rad Laboratories, Inc. Digital analysis of nucleic acid modification
US9944977B2 (en) 2013-12-12 2018-04-17 Raindance Technologies, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
US11193176B2 (en) 2013-12-31 2021-12-07 Bio-Rad Laboratories, Inc. Method for detecting and quantifying latent retroviral RNA species
US12114911B2 (en) 2014-08-28 2024-10-15 Angiodynamics, Inc. System and method for ablating a tissue site by electroporation with real-time pulse monitoring
US10647981B1 (en) 2015-09-08 2020-05-12 Bio-Rad Laboratories, Inc. Nucleic acid library generation methods and compositions
US10905492B2 (en) 2016-11-17 2021-02-02 Angiodynamics, Inc. Techniques for irreversible electroporation using a single-pole tine-style internal device communicating with an external surface electrode
US10998178B2 (en) 2017-08-28 2021-05-04 Purdue Research Foundation Systems and methods for sample analysis using swabs

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7625697B2 (en) 1994-06-17 2009-12-01 The Board Of Trustees Of The Leland Stanford Junior University Methods for constructing subarrays and subarrays made thereby
WO2000056756A2 (en) 1999-03-23 2000-09-28 Mount Sinai School Of Medicine Of New York University Prolactin regulatory element binding protein and uses thereof
WO2001030964A2 (en) 1999-10-22 2001-05-03 Lifespan Biosciences, Inc. Anti-cancer nucleic acid and protein targets

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050130926A1 (en) * 1998-11-04 2005-06-16 Chiron Corporation Gene products differentially expressed in cancerous cells and their methods of use V
US7867731B2 (en) 1998-11-04 2011-01-11 Novartis Vaccines And Diagnostics, Inc. HX2004-6 polypeptide expressed in cancerous cells
US20040146942A1 (en) * 2001-05-11 2004-07-29 Gruenenthal Gmbh Screening method using PIM1-kinase or PIM3-kinase
US20060089321A1 (en) * 2002-02-12 2006-04-27 Walter Annette O Cks1 inhibitors
US20060024692A1 (en) * 2002-09-30 2006-02-02 Oncotherapy Science, Inc. Method for diagnosing non-small cell lung cancers
US7776539B2 (en) 2004-05-06 2010-08-17 Roche Molecular Systems, Inc. SENP1 as a marker for cancer
US20090162846A1 (en) * 2004-05-06 2009-06-25 Roche Molecular Systems, Inc SENP1 as a marker for cancer
US20060014171A1 (en) * 2004-05-06 2006-01-19 Roche Molecular Systems, Inc. SENP1 as a marker for cancer
US7939251B2 (en) 2004-05-06 2011-05-10 Roche Molecular Systems, Inc. SENP1 as a marker for cancer
US20090202576A1 (en) * 2005-02-25 2009-08-13 Oncotherapy Science, Inc. Peptide vaccines for lung cancers expressing ttk, urlc10 or koc1 polypeptides
US7847060B2 (en) 2005-02-25 2010-12-07 Oncotherapy Science, Inc. Peptide vaccines for lung cancers expressing TTK, URLC10 or KOC1 polypeptides
US20110027302A1 (en) * 2005-02-25 2011-02-03 Oncotherapy Science, Inc. Peptide vaccines for lung cancers expressing ttk, urlc10 or koc1 polypeptides
US8614176B2 (en) 2005-02-25 2013-12-24 Oncotherapy Science, Inc. Peptide vaccines for lung cancers expressing TTK, URLC10 or KOC1 polypeptides
US20100009920A1 (en) * 2006-12-13 2010-01-14 Yusuke Nakamura Ttk as tumor marker and therapeutic target for lung cancer
US8530430B2 (en) 2009-05-11 2013-09-10 Oncotherapy Science, Inc. TTK peptides and vaccines including the same
US8551980B2 (en) 2009-11-30 2013-10-08 Bayer Intellectual Property Gmbh Substituted triazolopyridines
WO2012168721A1 (en) 2011-06-10 2012-12-13 The Institute Of Cancer Research: Royal Cancer Hospital Materials and methods for treating pten mutated or deficient cancer

Also Published As

Publication number Publication date
US20050063974A1 (en) 2005-03-24
US7501244B2 (en) 2009-03-10

Similar Documents

Publication Publication Date Title
US7501244B2 (en) Determining prognosis of colon or breast cancer by measuring TTK expression
JP4838835B2 (en) TTK in diagnosis and TTK as a therapeutic target in cancer
EP2094850B1 (en) Cancer-related protein kinases
DK2881402T3 (en) Mutant ROS expression in human liver cancer
US20050266409A1 (en) Compositions and methods for diagnosing, preventing, and treating cancers
JP6259320B2 (en) Translocation and mutant ROS kinase in human non-small cell lung cancer
KR102123963B1 (en) Ros kinase in lung cancer
JP2007289196A (en) Nucleic acid sequences differentially expressed in cancer tissue
AU2002244112A1 (en) TTK in diagnosis and as a therapeutic target in cancer
US7501242B2 (en) Detection of colon or breast cancer by measuring TTK polynucleotide expression
EP1953243A2 (en) Polynucleotides related to colon cancer
AU2007203399B2 (en) TTK in diagnosis and as a therapeutic target in cancer
ES2350089T3 (en) A MEMBER OF THE FAMILY OF THE PROTEIN HUMAN KINASES AND USES OF THE SAME.
RU2813996C2 (en) Fusion protein of dctn1 protein with ret protein
CA2569100A1 (en) Methods for identifying risk of breast cancer and treatment thereof
Class et al. Patent application title: IDENTIFICATION OF A JAK2 MUTATION INVOLVED IN VAQUEZ POLYGLOBULIA Inventors: William Vainchenker (Paris, FR) Assistance Publique Hopitaux De Paris (Paris, FR) Igr&d Sa (Villejuif Cedex, FR) Valerie Ugo (Paris, FR) James Chloe (Montrouge, FR) Jean-Pierre Le Couedic (Champs Sur Marne, FR) Institut Gustave-Roussy (Villejuif, FR) Nicole Casadevall (Paris, FR) Universite De Versailles-St Quentin En Yvelines (Versailles, FR) Universite Paris-Sud (Orsay, FR) Assignees: Assistance Publique-Hopitaux De Paris IGR&D SA Universite Paris-Sud INSTITUT GUSTAVE ROUSSY UNIVERSITE DE VERSAILLES ST QUENTIN EN YVELINES INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM)
US20030144188A1 (en) Androgen regulated nucleic acid molecules and encoded proteins
HK1192285B (en) Translocation and mutant ros kinase in human non-small cell lung carcinoma

Legal Events

Date Code Title Description
AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:REINHARD, CHRISTOPH;JEFFERSON, ANNE B.;CHAN, VIVIEN W.;REEL/FRAME:016162/0319;SIGNING DATES FROM 20050527 TO 20050607

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:REINHARD, CHRISTOPH;JEFFERSON, ANNE B.;CHAN, VIVIEN W.;REEL/FRAME:016162/0375;SIGNING DATES FROM 20050527 TO 20050607

AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNMENT DOCUMENTS PREVIOUSLY RECORDED ON REEL 016162 FRAME 0375;ASSIGNORS:REINHARD, CHRISTOPH;JEFFERSON, ANNE B.;CHAN, VIVIEN W.;REEL/FRAME:016424/0337;SIGNING DATES FROM 20050726 TO 20050802

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE