US20030045491A1 - TTK in diagnosis and as a therapeutic target in cancer - Google Patents
TTK in diagnosis and as a therapeutic target in cancer Download PDFInfo
- Publication number
- US20030045491A1 US20030045491A1 US10/081,119 US8111902A US2003045491A1 US 20030045491 A1 US20030045491 A1 US 20030045491A1 US 8111902 A US8111902 A US 8111902A US 2003045491 A1 US2003045491 A1 US 2003045491A1
- Authority
- US
- United States
- Prior art keywords
- ttk
- ser
- leu
- lys
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6842—Proteomic analysis of subsets of protein mixtures with reduced complexity, e.g. membrane proteins, phosphoproteins, organelle proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01037—Protein kinase (2.7.1.37)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
- G01N33/57595—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving intracellular compounds
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- the field of the present invention relates to disease diagnosis and treatment of cancer and identification of anti-cancer agents.
- Mitotic checkpoint genes have become widely studied for their roles in development as well as for their potential role in disease such as cancer.
- the mitotic checkpoint involves a number of different mechanisms to ensure proper cellular division.
- the spindle assembly checkpoint modulates the timing of anaphase initiation in response to the improper alignment of chromosomes at the metaphase plate. If defects are detected, a signal is transduced to halt further progression of the cell cycle until correct bipolar attachment to the spindle is achieved.
- TTK Tyrosine threonine kinase
- the kinases most closely related to TTK include SPK1 serine, threonine, and tyrosine kinase, the Pim1, PBS2, and CDC2 serine/threonine kinases, and the TIK kinase (Mills et al. J. Biol. Chem. 267 : 16000 -6 (1992)).
- TTK human TTK
- GenBank Accession No. M86699 The nucleotide and amino acid sequences of human TTK are provided at, for example, GenBank Accession No. M86699. Expression of TTK is markedly reduced or absent in resting cells and in tissues with a low proliferative index (Hogg et al. Oncogene 9:89-96 (1994)). TTK mRNA is expressed in human testis, thymus, bone marrow, and other tissues that contain a large number of proliferating cells and is not detected in tissues that contain few or no dividing cells. TTK expression was detected in several rapidly proliferating cells lines, including various cancer cell lines.
- TTK expression was also detected and in samples tissue samples from two patients with malignant ovarian cancer (Mills et al., ibid.; Schmandt et al. J. Immunol. 152:96-105 (1994)). TTK expression is correlated with cell proliferation, and plays a role in cell cycle control (Hogg et al., ibid.). Very low levels of TTK mRNA and protein are present in starved cells. When cells are induced to enter the cell cycle, levels of TTK mRNA, protein, and kinase activity increase at the G1/S phase of the cell cycle and peak in G2/M. TTK mRNA levels, as well as kinase activity, drop sharply in early G1, whereas protein levels are largely maintained.
- TTK is a human homologue of the S. cerevesiae kinase mps1 and the S. pombe protein mph1, both of which are involved in cell cycle spindle assembly checkpoint, thus indicating that TTK is a spindle checkpoint gene (see, e.g., Cahill et al. Genomics 58:181-7 (1999).
- mitotic checkpoint impairment has been detected in human cancers (e.g., such impairment is present in about 40% of human lung cancer cell lines) mutations in the MAD mitotic checkpoint genes and the BUB gene family are infrequent. Haruki N et al., Cancer Lett. 162:201-205 (2001); Mimori K et al., Oncol Rep. 8:39-42 (2001); Cahill et al., ibid.). There is thus a need for identification of mitotic checkpoint genes that have a role in human cancers, as they can serve as informative diagnostic and/or prognostic indicators, and therapeutic targets.
- the present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage of the differential expression of these genes in mammalian cancer. Such methods can be useful in determining the ability of a subject to respond to a particular therapy, e.g., as the basis of rational therapy.
- the invention provides assays for identifying pharmaceuticals that modulate activity of these genes in cancers in which these genes are involved, as well as methods of inhibiting tumor growth by inhibiting activity of TTK.
- the present invention provides a method for identifying TTK levels in a sample of a subject suspected of having cancer (e.g., a lung, colon, prostrate or breast tissue biopsy) comprising quantifying the level of TTK in the sample.
- the identification of increased levels of TTK in the sample provides an indication of impairment of the cell cycle checkpoint in the sampled cells.
- the invention provides a method for determining the characteristics of a malignant or pre-malignant growth comprising determining (either qualitatively or quantitatively) the level of TTK in the cells of the growth, and comparing levels with known levels in various stages of cancer and/or normal tissue. For example, to determine the characteristics of a particular subject's colon cancer, a sample of the cancer may be removed, the levels of TTK in the cancer determined, and the levels compared to normal tissue and/or levels in various stage colon cancers derived from the same cell type. The levels of TTK identified in the sample can thus be indicative of various characteristics of the malignant or pre-malignant growth, as determined by the characteristics of known tissue and cancers. The TTK levels can be compared directly to the levels in other single samples, or may be compared to a standard that is derived from the data of multiple samples.
- the TTK levels of a sample can be used as one index for determining the appropriate therapeutic intervention for a subject with a malignant or pre-malignant growth. Highly increased levels of TTK, for example, can be indicative of the need for more aggressive therapy, as it is indicative of a later stage cancer.
- the level of TTK expression may be indicative of the responsiveness of a subject to a particular pharmaceutical, and in particular to a therapeutic intervention that affects the cancer via the mitotic checkpoint.
- the invention features a method for identifying agents for inhibiting growth of a tumor, particular by a breast or colon tumor, by contacting a cell expressing TTK with a candidate agent, and assessing the effect of the agent upon TTK activity.
- the invention features a method of diagnosing cancer in a subject, the method comprising detection of TTK polynucleotide or polypeptide in a test sample obtained from a subject so as to determine a level of expression of the gene product; and comparing the level of expression of the TTK in the test sample to a level of expression in a normal cell corresponding to the same tissue; wherein detection of an expression level of TTK in the test sample that is significantly increased from the level of expression in a normal cell indicates that the test cell is cancerous.
- the cancer is other than ovarian cancer, with colon cancer and breast cancer being of particular interest.
- the invention features a method for determining the prognosis of a cancerous disease in a subject, the method comprising detecting expression of TTK in a test cell from the subject; and comparing a level of expression of TTK in the test cell with a level of TTK expression in a control cell; wherein the level of expression of TTK in the test cell relative to the level of expression in the control cell is indicative of the prognosis of the cancerous disease.
- an elevated level of TTK expression in the test cell relative to the normal cell is indicative of the continued presence of cancerous cells in the subject and thus a relatively poorer prognosis than where the level of TTK expression in the test cell is at a level comparable to that found in an normal (non-cancer) cell.
- progress of a cancer other than ovarian cancer is of particular interest, especially colon and breast cancer.
- the invention features a method for inhibiting growth of a cancerous cell comprising introducing into a cell an antisense polynucleotide for inhibition of TTK expression, wherein inhibition of TTK expression inhibits replication of the cancerous cell.
- the invention features a method for assessing the tumor burden of a subject, the method comprising detecting a level of TTK expression in a test sample from a subject, the test sample suspected of comprising increased TTK expression; wherein detection of the level of TTK expression in the test sample is indicative of the tumor burden in the subject, with an increased level of TTK expression in the test sample relative to a control non-cancer cell indicates the presence of a tumor in the subject.
- the invention features a method of identifying an agent having anti-TTK activity, the method comprising contacting a cancerous cell displaying elevated expression of TTK with a candidate agent; and determining the effect of the candidate agent on TTK activity; wherein a decrease in TTK activity indicates that the agent has anti-TTK activity.
- TTK activity is detected by detecting TTK expression or by detecting a biological activity of TTK
- the invention features an assay for identifying a candidate agent that inhibits growth of a cancerous cell, comprising contacting a cell expressing TTK polypeptide with a candidate agent; and detecting activity of the TTK polypeptide, comparing the activity of the TTK polypeptide in the cell in the presence of the candidate agent to activity of a TTK polypeptide in a cell in the absence of the candidate agent; wherein reduction of TTK activity in the presence of the candidate agent relative to TTK activity in the absence of the candidate agent indicates that the candidate agent reduces TTK activity and inhibits growth of a cancerous cell.
- a primary object of the invention is to exploit TTK as a therapeutic target, e.g. by identifying candidate agents that modulate, usually that decrease, TTK activity in a target cell in order to, for example, inhibit cell growth.
- An object of the present invention is to inhibit tumor growth by inhibition of activity of a mitotic checkpoint gene product, particularly though inhibition of TTK activity in the target tumor cell.
- Another object of the invention is to facilitate rational cancer therapy.
- a therapeutic agent is selected accordingly so as to facilitate reduction of TTK activity levels.
- Another object of the present invention is to design clinical trials based on levels of TTK expression in a cancer, and more particularly to design clinical trials based on TTK expression in combination with other patient attributes.
- Yet another object of the invention is to identify the association of TTK expression and intervention attributes that yield efficacious changes in selected disease progression measures.
- An advantage of the invention is the ability to project disease progression based on expression of TTK in a malignant or pre-malignant growth.
- Another advantage of the present invention is that it allows a more systematic approach for intervention of a cancerous disease based upon objective indicia.
- FIG. 1 is a bar graph illustrating expression of TTK in various normal tissue types as detected by PCR.
- FIG. 2 is a bar graph illustrating expression of TTK in various tumor cell lines as detected by PCR.
- FIGS. 3 - 6 are graphs illustrating expression profiles for IGF2, MAPKAPK2, TTK, and MARCKS in patients with colorectal carcinoma.
- FIGS. 7 and 8 are graphs illustrating growth suppression of MDA-MB-231 cells following antisense suppression of TTK expression.
- FIG. 9 is a graph illustrating growth suppression of SW620 cells following antisense suppression of TTK expression.
- FIG. 10 is a graph illustrating suppression of colony formation of SW620 cells in soft agar following antisense suppression of TTK expression.
- FIG. 11 is a graph illustrating that antisense suppression of TTK has no detectable effect on normal immortal fibroblasts.
- FIG. 12 is a bar graph illustrating induction of cell death upon depletion of TTK from SW620 cells.
- polynucleotide and “nucleic acid”, used interchangeably herein, refer to a polymeric forms of nucleotides of any length, either ribonucleotides or deoxynucleotides.
- these terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
- These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa et al.
- the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
- the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucl. Acids Res. 24:2318-2323.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches.
- the sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
- polypeptide and “protein”, used interchangeably herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
- the term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
- TTK polynucleotide and “TTK polypeptide” encompass polynucleotides and polypeptides having sequence similarity or sequence identity to the human TTK (having GenBank accession number M86699; SEQ ID NO:13 and 14), or the S. cerevesiae kinase mps1 gene and gene products (SEQ ID NO:29 and 30), the S.
- pombe protein mph1 gene and gene products SEQ ID NO:31 and 32
- other genes and gene products related to TTK such as SPK1 (SEQ ID NO:15 and 16), Pim1 (SEQ ID NO:17 and 18), PBS2 (SEQ ID NO:19 and 20), CDC2 (SEQ ID NO:21 and 22), and TIK (SEQ ID NO:23 and 24) of at least about 65%, preferably at least about 80%, more preferably at least about 85%, and can be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.
- Sequence similarity and sequence identity are calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc.
- a reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared.
- percent sequence identity is calculated by counting the number of residue matches (e.g., nucleotide residue or amino acid residue) between the query and test sequence and dividing total number of matches by the number of residues of the individual sequences found in the region of strongest alignment. Thus, where 10 residues of an 11 residue query sequence matches a test sequence, the percent identity above would be 10 divided by 11, or approximately, 90.9%.
- BLAST Altschul et al., J. Mol. Biol., 215:403-10 (1990)
- Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular).
- a preferred method of calculating percent identity is the Smith-Waterman algorithm, using the following.
- Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.
- the human TTK cDNA is represented by the polynucleotide sequence of SEQ ID NO:13 and the human TTK polypeptide is represented by the sequence of SEQ ID NO:14.
- Antisense polynucleotide or “antisense oligonucleotide” are used interchangeably herein to mean an unmodified or modified nucleic acid having a nucleotide sequence complementary to a given polynucleotide sequence (e.g., a polynucleotide sequence encoding TTK) including polynucleotide sequences associated with the transcription or translation of the given polynucleotide sequence (e.g., a promoter of a polynucleotide encoding TTK), where the antisense polynucleotide is capable of hybridizing to a TTK-encoding polynucleotide sequence.
- a given polynucleotide sequence e.g., a polynucleotide sequence encoding TTK
- TTK polynucleotide sequence encoding TTK
- antisense polynucleotide capable of inhibiting transcription and/or translation of a TTK-encoding poly
- cDNA as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons (e.g., sequences encoding open reading frames of the encoded polypeptide) and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns removed by nuclear RNA splicing to create a continuous open reading frame encoding TTK.
- a “variant” as used in the context of a “variant polypeptide” refers to an amino acid sequence that is altered by one or more amino acids relative to a reference amino acid sequence.
- the variant can have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have “nonconservative” changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software.
- a “deletion” is defined as a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent as compared to reference amino acid sequence or nucleotide sequence.
- Deletions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
- Insertions or additions is that change in an amino acid or nucleotide sequence which has resulted in the addition of one or more amino acid or nucleotide residues, respectively, as compared to a reference amino acid sequence or nucleotide sequence. Insertions or additions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
- substitution results from the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively, as compared to a reference amino acid sequence or nucleotide sequence.
- Substitutions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
- single nucleotide polymorphism and “SNP” refer to polymorphisms of a single base change relative to a reference sequence.
- biologically active refers to gene product, usually a polypeptide, having structural, regulatory, or biochemical functions of a naturally occurring gene product, e.g., protein. “Immunologically active” defines the capability of the natural, recombinant, or synthetic polypeptide, or any oligopeptide thereof, to elicit a specific immune response in appropriate animals or cells and to bind with specific antibodies.
- nucleic acid derivative refers to the chemical modification of a nucleic acid or amino acid sequence relative to a reference nucleic acid or amino acid sequence. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group.
- a nucleic acid derivative generally encodes a polypeptide which retains essential biological characteristics of the polypeptide encoded by the reference nucleic acid (e.g., the “parent” molecule).
- isolated is meant to describe a compound of interest (e.g., either a polynucleotide or a polypeptide) that is in an environment different from that in which the compound naturally occurs. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
- a compound of interest e.g., either a polynucleotide or a polypeptide
- substantially purified refers to a compound (e.g., either a polynucleotide or a polypeptide) that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated.
- “Stringency” typically occurs in a range from about Tm ⁇ 5° C. (5° C. below the Tm of the probe or antibody) to about 20° C. to 25° C. below Tm.
- a stringency hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences.
- hybridization shall include “any process by which a strand of nucleic acid joins with a complementary strand through base pairing” (Coombs, Dictionary of Biotechnology, Stockton Press, New York N.Y. (1994)). Amplification as carried out in the polymerase chain reaction technologies is described in Dieffenbach et al., PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. (1995).
- transformation refers to a permanent or transient genetic change, induced in a cell following incorporation of new DNA (i.e., DNA exogenous to the cell). Genetic change can be accomplished either by incorporation of the new DNA into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element. Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell.
- construct refers to a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences.
- the term “differentially expressed” generally refers to a polynucleotide that is expressed at levels in a test cell that differ significantly from levels in a reference cell, e.g., mRNA is found at levels at least about 25%, at least about 50% to about 75%, at least about 90% increased or decreased, generally at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or at least about 50-fold or more increased or decreased in a cancerous cell when compared with a cell of the same type that is not cancerous.
- the comparison can be made between two tissues, for example, if one is using in situ hybridization or another assay method that allows some degree of discrimination among cell types in the tissue.
- the comparison may also be made between cells removed from their tissue source.
- “Differential expression” refers to both quantitative, as well as qualitative, differences in the genes' temporal and/or cellular expression patterns among, for example, normal and neoplastic tumor cells, and/or among tumor cells which have undergone different tumor progression events.
- polynucleotide corresponds to a differentially expressed gene are used to refer to the relationship between a given polynucleotide and the gene from which the polynucleotide sequence is derived (e.g., a polynucleotide that is derived from a coding region of the gene, a splice variant of the gene, an exon, and the like) or to which the polynucleotide hybridizes to under stringer conditions.
- “Differentially expressed polynucleotide” as used herein refers to a nucleic acid molecule (RNA or DNA) comprising a sequence that represents or corresponds to a differentially expressed gene, e.g., the differentially expressed polynucleotide comprises a sequence (e.g., an open reading frame encoding a gene product; a non-coding sequence) that uniquely identifies a differentially expressed gene so that detection of the differentially expressed polynucleotide in a sample is correlated with the presence of a differentially expressed gene in a sample.
- RNA or DNA nucleic acid molecule
- “Differentially expressed polynucleotides” is also meant to encompass fragments of the disclosed polynucleotides, e.g., fragments retaining biological activity, as well as nucleic acids homologous, substantially similar, or substantially identical (e.g., having about 90% sequence identity) to the disclosed polynucleotides.
- Diagnosis generally includes determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy), and therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy).
- prognosis of a subject affected by a disease or disorder e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy
- therametrics e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy.
- a polypeptide associated with cancer refers to a polypeptide that is present at relatively higher or lower levels in a cancer cell relative to a normal cell of the same type.
- biological sample encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay.
- the term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
- the term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components.
- the term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.
- treatment used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect.
- the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease.
- Treatment covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or relieving the disease symptom, i.e., causing regression of the disease or symptom.
- treatment of cancer thus encompasses one or more of inhibition of cellular proliferation, inhibition of metastasis, and the like.
- antibody is meant an immunoglobulin protein which is capable of binding an antigen.
- Antibody as used herein is meant to include the entire antibody as well as any antibody fragments (e.g., F(ab′) 2 , Fab′, Fab, Fv) capable of binding the epitope, antigen, or antigenic fragment of interest.
- Antibodies of the invention are immunoreactive or immunospecific for and therefore specifically and selectively bind to a protein of interest, e.g., human TTK protein. Antibodies which are immunoreactive and immunospecific for human TTK are preferred. Antibodies for human TTK are preferably immunospecific—i.e., not substantially cross-reactive with related materials, although they may recognize TTK homologs across species.
- the term “antibody” encompasses all types of antibodies (e.g., monoclonal and polyclonal).
- binds specifically is meant high avidity and/or high affinity binding of an antibody to a specific polypeptide, e.g., epitope of a TTK protein. Antibody binding to its epitope on this specific polypeptide is stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest. Antibodies which bind specifically to a polypeptide of interest may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to the compound or polypeptide of interest, e.g., by use of appropriate controls.
- cancer neoplasm
- tumor tumor cells
- tumor tumor cells
- non-metastatic cells pre-malignant cells
- pre-malignant e.g., benign hyperplasiac
- malignant e.g., metastatic
- non-metastatic cells e.g., benign hyperplasiac
- TTK activity refers to activity of the TTK polypeptide in phosphorylation of a recipient substrate.
- Modulation of TTK activity refers to an increase or decrease in TTK activity that can be a result of, for example, interaction of an agent with a TTK polypeptide (e.g., reversible or irreversible binding of an inhibitory agent so as to interfere with TTK polypeptide interaction with a donor molecule or a recipient (acceptor) molecule in the phosphorylation activity of TTK), inhibition of TTK transcription and/or translation (e.g., through antisense interaction with the TTK gene or TTK transcript, through modulation of transcription factors that facilitate TTK expression), and the like. Modulation of TTK activity that results in a decrease of TTK activity is of particular interest in the invention.
- TTK activity can be decreased by an inhibitory agent at least 10%, 25%, 50%, 75%, 85%, 90%, up to 100% relative to TTK activity in the absence of an agent.
- TTK activity can be assessed by assaying enzymatic activity, by assessing TTK polypeptide levels, or by assessing TTK transcription levels. Comparisons of TTK activity can also be accomplished by comparing TTK activity assessed (either qualitatively or quantitatively) in a test sample to a standard TTK activity (e.g., a level of TTK activity in the absence of an inhibitory agent or agonist, that is associated with a normal cell, a level of TTK activity of a cancerous cell of a selected tissue type, and the like).
- a standard TTK activity e.g., a level of TTK activity in the absence of an inhibitory agent or agonist, that is associated with a normal cell, a level of TTK activity of a cancerous cell of a selected tissue type, and the like.
- Human TTK is a mitotic checkpoint gene which encodes an 857 amino acid protein that exhibits activity of a mixed specificity (tyr/thr) kinase. TTK is expressed in rapidly proliferating tissues such as testis and thymus. See, e.g., Mills G B et al., J Biol Chem. 267:16000-6 (1992). The present invention is based upon the finding that TTK is differentially expressed in colon tumor cells relative to normal colon cells as detected by microarray analysis. Differential expression was confirmed in cell lines derived from various forms of cancer, indicating that the involvement of TTK in cancer as a more general mechanism.
- TTK can be a therapeutic target for chemotherapy in cancers in which TTK is overexpressed.
- the identification of the association of TTK with cancer, and the confirmation that inhibition of TTK activity serves as the basis for the materials and methods of the invention, such as are disclosed and discussed herein, for use in, for example, diagnosing cancer of a patient, particularly a cancer that is susceptible to treatment by decreasing activity of TTK.
- the invention also provides for planning and selection of appropriate therapeutic and/or prophylactic treatment, permitting streamlining of treatment by targeting those most likely to benefit.
- the invention also provides for treatment of a cancer associated with aberrant TTK levels (e.g., associated with overexpression or overproduction of TTK), e.g.
- TTK activity e.g., by decreasing TTK gene product production (e.g., at the level of transcription or translation) and/or by reducing one or more of TTK's kinase activities.
- the invention is based on the discovery that TTK activity is present at higher levels in cancerous cells (particularly in colon cancer and breast cancer) than in normal cells of the same cell type. This discovery serves as the basis for identification of cancerous cells, as well as identification of tumors that are susceptible to therapy by inhibiting activity of TTK, e.g., by inhibiting TTK expression at the level of transcription or translation or both, by inhibiting TTK activity, and the like.
- TTK gene products e.g. TTK encoding mRNA or TTK polypeptides are of particular interest as markers (e.g., in bodily fluids (such as blood) or in tissues) to detect the earliest changes along the carcinogenesis pathway (e.g., to differentiate cancerous tissue from non-cancerous tissue) and/or to monitor the efficacy of various therapies and preventive interventions.
- markers e.g., in bodily fluids (such as blood) or in tissues
- the carcinogenesis pathway e.g., to differentiate cancerous tissue from non-cancerous tissue
- a relatively increased level of expression of TTK compared to normal cells or tissues of the same type can be indicative of a poorer prognosis, and therefore warrant more aggressive therapy (e.g., chemo- or radio-therapy) for a patient or vice versa.
- the correlation of surrogate tumor specific features with response to treatment and outcome in patients can define prognostic indicators that allow the design of tailored therapy based on the molecular profile of the tumor.
- These therapies include antibody targeting, antagonists (e.g., small molecules), and gene therapy. Determining TTK expression and comparison of a patient's profile with known expression in normal tissue and variants of the disease allows a determination of the best possible treatment for a patient, both in terms of specificity of treatment and in terms of comfort level of the patient.
- Surrogate tumor markers such as polynucleotide expression, can also be used to better classify, and thus diagnose and treat, different forms and disease states of cancer. Two classifications widely used in oncology that can benefit from identification of TTK expression levels are staging of the cancerous disorder, and grading the nature of the cancerous tissue.
- TTK polynucleotides as well as their encoded gene products, can be useful to monitor patients having or susceptible to cancer to detect potentially malignant events at a molecular level before they are detectable at a gross morphological level.
- detection of TTK gene products can be useful as therametrics, e.g., to assess the effectiveness of therapy by using the polynucleotides or their encoded gene products, to assess, for example, tumor burden in the patient before, during, and after therapy.
- a polynucleotide identified as corresponding to a gene that is differentially expressed in, and thus is important for, one type of cancer can also have implications for development or risk of development of other types of cancer, e.g., where a polynucleotide represents a gene differentially expressed across various cancer types.
- expression of a polynucleotide corresponding to a gene that has clinical implications for metastatic colon cancer can also have clinical implications for stomach cancer or endometrial cancer.
- activity or expression levels may be compared to those of suitable cancerous or non-cancerous control samples.
- a diagnosis of cancer can be made if TTK activity is increased at by 25%, 50%, 75%, 90%, up to 100%, or, alternatively by 5-fold, 10-fold, 50-fold, or more than 100-fold relative to a normal non-cancerous cell of the same tissue type.
- gene products that are differentially expressed in cancerous cells relative to, for example, non-cancer cells of between cancer cells of differing malignant potential can also be assayed in addition to TTK for differential expression in a test cell.
- exemplary gene products include, but are not necessarily limited to MAPKAP kinase 2 (SEQ ID. No. 33 and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and 38).
- Staging is a process used by physicians to describe how advanced the cancerous state is in a patient. Staging assists the physician in determining a prognosis, planning treatment and evaluating the results of such treatment. Staging systems vary with the types of cancer, but generally involve the following “TNM” system: the type of tumor, indicated by T; whether the cancer has metastasized to nearby lymph nodes, indicated by N; and whether the cancer has metastasized to more distant parts of the body, indicated by M. Generally, if a cancer is only detectable in the area of the primary lesion without having spread to any lymph nodes it is called Stage I. If it has spread only to the closest lymph nodes, it is called Stage II. In Stage II, the cancer has generally spread to the lymph nodes in near proximity to the site of the primary lesion. Cancers that have spread to a distant part of the body, such as the liver, bone, brain or other site, are Stage IV, the most advanced stage.
- the differential expression level of TTK can facilitate fine-tuning of the staging process by identifying markers for the aggressiveness of a cancer, e.g. the metastatic potential, as well as the presence in different areas of the body.
- a Stage II cancer with a large differential level of expression of TTK can signify a cancer with a high metastatic potential and can be used to change a borderline Stage II tumor to a Stage III tumor, justifying more aggressive therapy.
- Grade is a term used to describe how closely a tumor resembles normal tissue of its same type.
- the microscopic appearance of a tumor is used to identify tumor grade based on parameters such as cell morphology, cellular organization, and other markers of differentiation.
- the grade of a tumor corresponds to its rate of growth or aggressiveness, with undifferentiated or high-grade tumors generally being more aggressive than well differentiated or low-grade tumors.
- the following guidelines are generally used for grading tumors: 1) GX Grade cannot be assessed; 2) G1 Well differentiated; G2 Moderately well differentiated; 3) G3 Poorly differentiated; 4) G4 Undifferentiated.
- TTK activity levels can be especially valuable in determining the grade of the tumor, as they not only can aid in determining the differentiation status of the cells of a tumor, they can also identify factors other than differentiation that are valuable in determining the aggressiveness of a tumor, such as metastatic potential.
- Colorectal cancer is one of the most common neoplasms in humans and perhaps the most frequent form of hereditary neoplasia. Prevention and early detection are key factors in controlling and curing colorectal cancer. Colorectal cancer begins as polyps, which are small, benign growths of cells that form on the inner lining of the colon. Over a period of several years, some of these polyps accumulate additional mutations and become cancerous.
- Familial adenomatous polyposis FAP
- Gardner's syndrome Hereditary nonpolyposis colon cancer
- HNPCC Hereditary nonpolyposis colon cancer
- Familial colorectal cancer in Ashkenazi Jews The expression of appropriate polypeptide andpolynucleotides can be used in the diagnosis, prognosis and management of colorectal cancer. Detection of colon cancer can be determined using expression levels of TTK alone or in combination with the levels of expression of other genes differentially expressed in colon cancer.
- Determination of the aggressive nature and/or the metastatic potential of a colon cancer can be determined by comparing levels of TTK with a level associated with a normal cell, and comparing total levels of another sequence known to be differentially expressed, or otherwise be a marker of, cancerous tissue, e.g., expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al., Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957; Bodmer W, et al., Nat Genet. (1994) 4(3):217; Fearon E R, Ann N Y Acad Sci.
- MAPKAP kinase 2 SEQ ID. No. 33 and 34
- MARCKS SEQ ID NO:35 and 36
- IGF2 SEQ ID NO:37 and 38
- development of colon cancer can be detected by examining the level of expression of a gene corresponding to a polynucleotides described herein to the levels of oncogenes (e.g. ras) or tumor suppressor genes (e.g. FAP or p53).
- oncogenes e.g. ras
- tumor suppressor genes e.g. FAP or p53
- specific marker polynucleotides can be used to discriminate between normal and cancerous colon tissue, to discriminate between colon cancers with different cells of origin, to discriminate between colon cancers with different potential metastatic rates, etc.
- markers of cancer see, e.g., Hanahan et al. (2000) Cell 100:57-70.
- adenocarcinomas subtypes which can be summarized as follows: 1) ductal carcinoma in situ (DCIS), including comedocarcinoma; 2) infiltrating (or invasive) ductal carcinoma (IDC); 3) lobular carcinoma in situ (LCIS); 4) infiltrating (or invasive) lobular carcinoma (ILC); 5) inflammatory breast cancer; 6) medullary carcinoma; 7) mucinous carcinoma; 8) Paget's disease of the nipple; 9) Phyllodes tumor; and 10) tubular carcinoma.
- DCIS ductal carcinoma in situ
- IDC infiltrating (or invasive) ductal carcinoma
- LCIS lobular carcinoma in situ
- ILC infiltrating (or invasive) lobular carcinoma
- the expression levels of TTK can be used in the diagnosis and management of breast cancer, as well as to distinguish between types of breast cancer. Detection of breast cancer can be determined using expression levels of TTK, either alone or in combination with expression of other gene known to be differentially expressed in breast cancer. Determination of the aggressive nature and/or the metastatic potential of a breast cancer can also be determined by comparing levels of TTK and comparing levels of another sequence known to vary in cancerous tissue, e.g. ER expression. In addition, development of breast cancer can be detected by examining the ratio of expression of TTK to the levels of steroid hormones (e.g., testosterone or estrogen) or to other hormones (e.g., growth hormone, insulin). Thus expression of specific marker polynucleotides and polypeptides can be used to discriminate between normal and cancerous breast tissue, to discriminate between breast cancers with different cells of origin, to discriminate between breast cancers with different potential metastatic rates, etc.
- steroid hormones e.g., testosterone or estrogen
- TTK gene product e.g., RNA or protein
- the purpose of such analysis may be used for diagnosis, to detect the presence of an existing cancer, to help identify the type of cancer, to assist a physician in determining the severity or likely course of the cancer, and/or to optimize treatment of it.
- the methods are useful for detecting cancer cells, facilitating diagnosis of cancer and the severity of a cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy (e.g., by providing a measure of therapeutic effect through, for example, assessing tumor burden during or following a chemotherapeutic regimen).
- the methods are useful for classification or stratification of cancer cells, e.g., for the purpose of selecting patients to be included in a clinical trial population, for selecting an appropriate therapy (e.g., selecting therapy according to an expression profile of the cancerous cells), and the like.
- the detection methods can be provided as part of a kit.
- the invention further provides kits for detecting the presence and/or a level of TTK activity e.g., by detection of a TTK-encoding mRNA and/or a polypeptide encoded thereby or by measuring TTK activity, in a biological sample. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals.
- the kits of the invention for detecting TTK polypeptide that is differentially expressed in cancer cells comprise a moiety that specifically binds the polypeptide, which may be a specific antibody.
- kits of the invention for detecting a TTK-encoding polynucleotide that is differentially expressed in cancer cells comprise a moiety that specifically hybridizes to such a polynucleotide such as a primer.
- the kits of the invention for detecting TTK activity comprise a recipient substrate capable of being phosphorylated by TTK, and a labeled donor substrate.
- the kits may optionally provide additional components that are useful in the procedure, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detection, control samples, standards, instructions, and interpretive information.
- Methods for detection of TTK activity include screening for the presence of TTK nucleic acid sequences representing an expressed TTK gene or alleles or variants thereof, and detecting the TTK polypeptide.
- the methods make use of biological samples from individuals that are suspected of contain the nucleic acid sequences or polypeptide. Examples of biological samples include blood, plasma, serum, tissue samples, tumor samples, saliva and urine.
- Exemplary approaches for detecting TTK nucleic acid or polypeptides include: (a) determining the presence of the polypeptide encoded by the TTK gene; (b) using a specific binding member capable of binding to a TTK nucleic acid sequence (e.g., a known complementary sequence), the specific binding member comprising a nucleic acid that hybridizes with the TTK sequence under stringent conditions (c) using a substance comprising an antibody domain with specificity for a TTK nucleic acid sequence or the polypeptide encoded by it, the specific binding member being labeled to allow detection of the specific binding member to its binding partner is detectable; (d) using PCR involving one or more primers to determine relative levels of TTK in a sample from a patient; and (e) using an assay for TTK activity, e.g., phosphorylation of a TTK substrate.
- a specific binding member capable of binding to a TTK nucleic acid sequence e.g., a known complementary sequence
- the specific binding member compris
- TTK levels can include both levels of normal TTK and/or variant forms of TTK.
- a variant form of the gene may contain one or more insertions, deletions, substitutions and/or additions of one or more nucleotides compared with the wild-type sequence which may or may not alter the gene function. Differences at the nucleic acid level are not necessarily reflected by a difference in the amino acid sequence of the encoded polypeptide due to the degeneracy of the genetic code.
- a mutation or other difference in a gene may result in a frame-shift or stop codon, which could seriously affect the nature of the polypeptide produced (if any), or a point mutation or gross mutational change to the encoded polypeptide, including insertion, deletion, substitution and/or addition of one or more amino acids or regions in the polypeptide.
- a mutation in a promoter sequence or other regulatory region may alter (e.g., reduce or enhance) expression from the gene or affect the processing or stability of the mRNA transcript.
- Tests may be carried out on preparations containing mRNA or cDNA generated from isolated mRNA in a manner that reflects the relative levels of mRNA transcripts in the sample.
- Levels of RNA can be determined specific amplification reaction such as PCR using one or more pairs of primers may be employed to amplify a region of the nucleic acid, and preferably a region with less homology to other genes.
- Nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.
- Nucleic acid may be screened using a TTK-specific probe.
- a TTK-specific probe corresponds in sequence to a region of the TTK gene, or its complement.
- specific hybridization of such a probe to test nucleic acid is indicative of the presence of the TTK nucleic acid in a sample.
- more than one probe may be used on the same test sample.
- the probe may contain as few as 15, 20, 50 or 100 nucleotides of the TTK gene of SEQ ID. No. 13 or may be as long as or 500, 1 kb or as much as 3.8 kb or longer in length.
- Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample.
- Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art.
- the PCR product may for instance be treated in a way that enables one to display the mutation or polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected. This can be done simultaneous to or sequentially to determining the level of a normal TTK sequence, e.g., to determine the combinatory levels of total TTK.
- the presence of absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA.
- the presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene or a variant or allele is digested with the same enzyme or enzymes.
- a test sample of nucleic acid may be provided for example by extracting nucleic acid from cells, e.g., cells from a tumor biopsy.
- TTK polypeptide there are various methods for determining the presence or absence in a test sample of a TTK polypeptide.
- a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies), specific for wild-type TTK and/or one or more particular variants (e.g., allelic variants) of the TTK polypeptide.
- the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding.
- a specific binding member such as an antibody under appropriate conditions for specific binding.
- different reporting labels may be employed for each antibody so that binding of each can be determined.
- TTK polypeptide can also be identified using TTK-specific activity assays.
- Binding agents can also be immobilized in small, discrete locations and/or as arrays on solid supports or on diagnostic chips. These approaches can be particularly valuable as they can provide great sensitivity, particularly through the use of fluorescently labeled reagents, require only very small amounts of biological sample from individuals being tested and allow a variety of separate assays can be carried out simultaneously. This latter advantage can be useful as it provides an assay for different proteins (e.g., an oncogene or tumor suppressor) in tandem with the assay for TTK.
- the present invention provides a support or diagnostic chip having immobilized thereon one or more binding agents capable of specifically binding TTK nucleic acid or polypeptides, optionally in combination with other reagents needed to carrying out an assay.
- the full-length or partial polypeptides encoded by TTK may be expressed in any expression system, including, for example, bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells for which are described in U.S. Pat. No. 5,654,173. Appropriate polynucleotide constructs are purified using standard recombinant DNA techniques as described in, for example, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), and under current regulations described in United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.
- yeast Expression systems in yeast include those described in Hinnen et al., Proc. Natl. Acad. Sci. ( USA ) (1978) 75:1929; Ito et al., J. Bacteriol. (1983) 153:163; Kurtz et al., Mol. Cell. Biol. (1986) 6:142; Kunze et al., J. Basic Microbiol. (1985) 25:141; Gleeson et al., J. Gen. Microbiol. (1986) 132:3459, Roggenkamp et al., Mol. Gen. Genet. (1986) 202:302) Das et al., J. Bacteriol.
- Insect Cells Expression of heterologous genes in insects is accomplished as described in U.S. Pat. No. 4,745,051, Friesen et al. (1986) “The Regulation of Baculovirus Gene Expression” in: The Molecular Biology Of Baculoviruses (W. Doerfler, ed.), EP 0 127,839, EP 0 155,476, and Vlak et al., J. Gen. Virol. (1988) 69:765-776, Miller et al., Ann. Rev. Microbiol.
- Mammalian Cells Mammalian expression is accomplished as described in Dijkema et al., EMBO J. (1985) 4:761, Gorman et al., Proc. Natl. Acad. Sci. ( USA ) (1982) 79:6777, Boshart et al., Cell (1985) 41:521 and U.S. Pat. No. 4,399,216. Other features of mammalian expression are facilitated as described in Ham and Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem. (1980) 102:255, U.S. Pat. Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.
- the invention also encompasses screening assays to identify agents that modulate TTK activity, specifically that decrease aberrant TTK activity in an affected cell, e.g., a cancerous or pre-cancerous cell in which TTK is differentially expressed. Such assays may be performed either in vitro or in vivo.
- agent as used herein describes any molecule with the capability of altering the expression or physiological function of a gene product of a differentially expressed gene. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
- Candidate agents encompass numerous chemical classes, including, but not limited to, organic molecules (e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons), peptides, monoclonal antibodies, antisense polynucleotides, and ribozymes, and the like.
- Candidate agents can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
- the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Candidate agents are also found among biomolecules including, but not limited to: polynucleotides, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
- Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs. Candidate agents can be assessed for modulation of TTK activity either singly or in pools.
- a wide variety of in vitro assays may be used to screen candidate agents for the desired biological activity, including, but not limited to, labeled in vitro protein-protein binding assays, protein-DNA binding assays (e.g., to identify agents that affect expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
- labeled in vitro protein-protein binding assays protein-DNA binding assays (e.g., to identify agents that affect expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
- protein-DNA binding assays e.g., to identify agents that affect expression
- electrophoretic mobility shift assays e.g., to identify agents that affect expression
- immunoassays for protein binding e.g., immunoassays for protein binding
- the purified polypeptide may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions, transcriptional regulation, etc.
- the screening assay can be a binding assay, wherein one or more of the molecules may be joined to a label, and the label directly or indirectly provide a detectable signal.
- Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g.,magnetic particles, and the like.
- Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
- the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
- a variety of other reagents may be included in the screening assays described herein. Where the assay is a binding assay, these include reagents like salts, neutral proteins, e.g.,albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
- reagents like salts, neutral proteins, e.g.,albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions.
- yeast has been shown to be a powerful tool for studying protein-protein interactions through the two hybrid system described in Chien et al. 1991 Proc. Natl. Acad. Sci. USA 88:9578-9582.
- Candidate agents can be screened in a non-human animal model of cancer (e.g., in animals into which have been injected cancerous cells; in animals that are transgenic for an alteration in expression of a differentially expressed gene as described herein, e.g., a transgenic “knock-out,” or a transgenic “knock-in,” a polynucleotide encoding all or a portion of a differentially expressed gene product and comprising an operably linked reporter gene, and the like).
- a non-human animal model of cancer e.g., in animals into which have been injected cancerous cells; in animals that are transgenic for an alteration in expression of a differentially expressed gene as described herein, e.g., a transgenic “knock-out,” or a transgenic “knock-in,” a polynucleotide encoding all or a portion of a differentially expressed gene product and comprising an operably linked reporter gene, and the like).
- the candidate agent is administered to the animal, and the effects of the candidate agent determined.
- the candidate agent can be administered in any manner desired and/or appropriate for delivery of the agent in order to effect a desired result.
- the candidate agent can be administered by injection (e.g., by injection intravenously, intramuscularly, subcutaneously, or directly into the tissue in which the desired affect is to be achieved), orally, or by any other desirable means.
- the in vivo screen will involve a number of animals receiving varying amounts and concentrations of the candidate agent (from no agent to an amount of agent hat approaches an upper limit of the amount that can be delivered successfully to the animal), and may include delivery of the agent in different formulation.
- the agents can be administered singly or can be combined in combinations of two or more, especially where administration of a combination of agents may result in a synergistic effect.
- the effect of agent administration upon the transgenic animal can be monitored by assessing expression of the gene product, growth of the injected tumor cells, and the like.
- Compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host for treatment of a condition that is amenable to treatment by modulation of expression of a differentially expressed gene product.
- the therapeutic agents may be administered in a variety of ways, orally, topically, parenterally e.g., subcutaneously, intraperitoneally, by viral infection, intravascularly, etc. Oral and inhaled treatments are of particular interest.
- the compounds may be formulated in a variety of ways.
- the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt. %.
- the therapeutic agents can be administered in a single dose, or as multiple doses over a course of treatment.
- compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
- Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds.
- Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
- a TTK polypeptide or TTK-encoding nucleic acid according to the present invention may be used in screening for molecules which affect or modulate TTK activity or function. Such molecules may be useful in a therapeutic and/or prophylactic context. Means for screening for substances potentially useful in treating or preventing cancer is provided by the present invention.
- the methods of the invention are to facilitate identification of modulators of TTK activity (e.g., by modulating activity of TTK polypeptide or other TTK gene product, or by affecting TTK activity by targeting activity of gene products that act either upstream or downstream of TTK in a cascade that leads to TTK activity), with agents that decrease TTK activity generally being of particular interest.
- Substances identified as modulators of the TTK activity represent an advance in the fight against cancer since they provide basis for design and investigation of pharmaceuticals for in vivo use.
- a method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide (e.g., the ability to phosphorylate its substrate) and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.
- Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide.
- Such libraries and their use are known in the art.
- the use of peptide libraries is preferred.
- Test substances may also be screened for ability to interact with the polypeptide, e.g., in a yeast two-hybrid system. This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide. Alternatively, the screen could be used to screen test substances for binding to a TTK specific binding partner.
- a substance identified using as a modulator of TTK polypeptide function may be peptide or non-peptide in nature.
- Non-peptide “small molecules” are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
- the activity of the TTK may be measured using any suitable kinase assay known in the art.
- any suitable kinase assay known in the art.
- the methods described in Hogg et al Oncogene 1994 9:98-96
- Mills et al J. Biol. Chem. 1992 267:16000-006
- Tomizawa et al 2001 FEBS Lett. 2001 492: 221-7
- Schmandt et al J. Immunol. 1994, 152:96-105
- serine, threonine and tyrosine kinase assays are described in Ausubel et al. (Short Protocols in Molecular Biology, 1999, unit 17.6).
- TTK assays generally use TTK polypeptide, a labeled donor substrate, and a receptor substrate that is either specific or non-specific for TTK. In such assays TTK transfers a labeled moiety from the donor substrate to the receptor substrate, and kinase activity is measured by the amount of labeled moiety transferred from the donor substrate to the receptor substrate.
- TTK polypeptide may be produced using various expression systems as detailed above, may be purified from cells, may be in the form of a cleaved or uncleaved recombinant fusion protein and may have non-TTK polypeptide sequences, for example a His tag or ⁇ -galactosidase at its N- or C-terminus. TTK activity may be assayed in cancerous cells lines if the cancerous cell lines are used as a source of the TTK to be assayed.
- Suitable donor substrates for TTK assays include any molecule that is susceptible to dephosphorylation by TTK include ⁇ -labeled ATP and ATP analogs, wherein the label is 33 P, 32 P, 35 S or any other radioactive isotope or a suitable fluorescent marker.
- Suitable recipient substrates for TTK assays include any polypeptide or other molecule that is susceptible to phosphorylation by TTK.
- Recipient substrates are usually derived from fragments of in vivo targets of TTK. Recipient substrates fragments may be 8 to 50 amino acids in length, usually 10 to 30 amino acids and preferably of about 10, 12, 15, 18, 20 and 25 amino acids in length Further recipient substrates can be determined empirically using a set of different polypeptides or other molecules.
- Targets of TTK suitable for TTK assays include tau and cdc25.
- Recipient substrates for TTK are typically capable of being purified from other components of the reaction once the reaction has been performed. This purification is usually done through a molecular interaction, where the recipient substrates is biotinylated and purified through its interaction with streptavidin, or a specific antibody is available that can specifically recognize the recipient substrates.
- the reaction can be performed in a variety of conditions, such as on a solid support, in a gel, in solution or in living cells.
- One exemplary recipient substrate for TTK phosphorylation is the human protein cdc25, SEQ ID NO:26, which is phosphorylated by TTK at the serine residues of amino acid position 214 and 216.
- Two fragments of cdc25 are used as substrates in the kinase assay described below. These fragments comprise peptides A (SEQ ID NO:27), corresponding to amino acids 209 to 225 of the cdc25 polypeptide sequence or peptide B (SEQ ID NO:28), corresponds to amino acids 210 to 223 of the cdc25 polypeptide.
- biotinylated polypeptides comprising either SEQ ID NO:27 (Biotin-SGSGSGLYRSPSMPENLNRPR-NH2) or SEQ ID NO:28 (Biotin-GGGGLYRSPSMPENLNRK-OH) are used.
- the choice of detection methods depends on type of label used for the donor molecule and may include, for example, measurement of incorporated radiation or fluorescence by autoradiography, scintillation, scanning or fluorography.
- the invention further provides methods for reducing growth of cancer cells, particular breast or colon cancer cells.
- the methods comprise contacting a cancer cell that expresses TTK at an aberrant level relative to normal cells with a substance that (1) modulates, generally decreases, expression of TTK (e.g., a antisense polynucleotide corresponding to TTK); or (2) otherwise modulates, generally decreases, TTK polypeptide levels and/or TTK activity in a cancerous cell having aberrant TTK activity.
- a substance that (1) modulates, generally decreases, expression of TTK e.g., a antisense polynucleotide corresponding to TTK
- TTK e.g., a antisense polynucleotide corresponding to TTK
- “Reducing growth of a cancer cell” includes, but is not limited to, reducing proliferation of cancer cells, and reducing the incidence of a normal cell from developing a cancerous phenotype or morphology. Whether a reduction in cancer cell growth has been achieved can be readily determined using any known assay, including, but not limited to, [ 3 H]-thymidine incorporation; counting cell number over a period of time; detecting, measuring a marker associated with colon cancer (e.g., CEA, CA19-9, and LASA), and/or methods well known in the art for assessing tumor burden.
- a marker associated with colon cancer e.g., CEA, CA19-9, and LASA
- the present invention provides methods for treating cancer (particularly breast and colon cancer or other cancer that is associated with aberrantly high TTK activity) which methods generally comprise administering to an individual an agent that reduces TTK activity in an amount sufficient to reduce cancer cell growth to treat the cancer.
- a substance, or a specific amount of the substance, is effective in treating cancer can be assessed using any of a variety of known diagnostic assays, e.g. in the case of colon cancer, sigmoidoscopy, proctoscopy, rectal examination, colonoscopy with biopsy, contrast radiographic studies, CAT scans, angiography, and detection of a tumor marker associated with colon cancer in the blood of the individual.
- the substance can be administered systemically or locally. Thus, in some embodiments, the substance is administered locally, and colon cancer growth is decreased at the site of administration. Local administration may be useful in treating, e.g., a solid tumor.
- the invention features polynucleotides that act as antisense polynucleotides and decrease TTK activity.
- Antisense TTK polynucleotides generally comprise a polynucleotide of at least about 20 to 3000 nucleotides, usually at least about 20 to 1000 nucleotides and more usually at least about 8 to 50 nucleotides, and preferably about 26, 20, 18, 17, 15, 10 and 8 nucleotides.
- Exemplary TTK polynucleotides are provided in the Examples and in SEQ ID NO:1-12, although any antisense fragment of SEQ ID NO:13 will suffice.
- the therapeutic regimen is selected according to the expression profile. For example, if a patient's tumor indicates that the tumor produces aberrantly high level of TTK relative to normal cells, then a drug having efficacy in the treatment of such TTK-expressing tumors is selected for therapy of that patient.
- compositions of the invention can comprise a therapeutically effective amount of a polypeptide, antibody, polynucleotide (including antisense nucleotides and ribozymes), or small molecule or other compound identified as modulating activity of TTK, preferably decreasing TTK activity.
- therapeutically effective amount refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels.
- Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature, and/or in the effect upon tumor load in the subject (e.g., decrease in tumor size or inhibition in tumor growth).
- an effective dose will generally be from about 0.01 mg/ kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA constructs in the individual to which it is administered.
- a pharmaceutical composition can also contain a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier refers to a carrier for administration of a therapeutic agent, such as antibodies or a polypeptide, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which can be administered without undue toxicity.
- Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Such carriers are well known to those of ordinary skill in the art.
- Pharmaceutically acceptable carriers in therapeutic compositions can include liquids such as water, saline, glycerol and ethanol.
- the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared.
- Liposomes are included within the definition of a pharmaceutically acceptable carrier.
- Pharmaceutically acceptable salts can also be present in the pharmaceutical composition, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
- compositions for oral administration may be in tablet, capsule, powder or liquid form.
- a tablet may include a solid carrier such as gelatin or an adjuvant.
- Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
- the active ingredient will be in the form of a parenterally acceptable aqueous solution which is has suitable pH, isotonicity and stability.
- Suitable solutions for example, optionally include but are not limited to isotonic vehicles such as sodium chloride, preservatives, stabilizers, buffers, antioxidants and/or other additives as required.
- Administration of the pharmaceutical is administered in a prophylactically effective amount or a therapeutically effective amount.
- the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Decisions on dosage etc, can be determined by one skilled in the art based upon the disclosed methods, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.
- targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands.
- Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.
- Targeting can be accomplished by, for example, administering a drug-antibody complex to a subject, wherein the antibody is specific for a cancer-associated antigen, and the drug is one that reduces cancer cell growth.
- Targeting can be accomplished by coupling (e.g., linking, directly or via a linker molecule, either covalently or non-covalently, so as to form a drug-antibody complex) a drug to an antibody specific for a cancer-associated antigen.
- Methods of coupling a drug to an antibody are well known in the art and need not be elaborated upon herein.
- Pharmaceutical agents can also be produced in the target cells by expression from an encoding gene introduced into the cells, e.g., in a viral or liposomal vector.
- the vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
- the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
- a composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
- compositions of the invention or identified using the methods of the invention can be administered directly to the subject (e.g., as polynucleotide or polypeptides).
- Direct delivery of the compositions will generally be accomplished by parenteral injection, e.g., subcutaneously, intraperitoneally, intravenously or intramuscularly, intratumoral or to the interstitial space of a tissue.
- Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications, needles, and gene guns or hyposprays.
- Dosage treatment can be a single dose schedule or a multiple dose schedule.
- the disorder can be amenable to treatment by administration of a therapeutic agent based on the provided polynucleotide, corresponding polypeptide or other corresponding molecule (e.g., antisense, ribozyme, etc.).
- the dose and the means of administration are determined based on the specific qualities of the therapeutic composition, the condition, age, and weight of the patient, the progression of the disease, and other relevant factors.
- administration of polynucleotide therapeutic compositions agents of the invention includes local or systemic administration, including injection, oral administration, particle gun or catheterized administration, and topical administration.
- the therapeutic polynucleotide composition contains an expression construct comprising a promoter operably linked to a polynucleotide of at least 12, 15, 17, 18, 22, 25, 30, or 35 contiguous-nucleotides of the polynucleotide disclosed herein.
- Various methods can be used to administer the therapeutic composition directly to a specific site in the body.
- a small metastatic lesion is located and the therapeutic composition injected several times in several different locations within the body of tumor.
- arteries which serve a tumor are identified, and the therapeutic composition injected into such an artery, in order to deliver the composition directly into the tumor.
- a tumor that has a necrotic center is aspirated and the composition injected directly into the now empty center of the tumor.
- the antisense composition is directly administered to the surface of the tumor, for example, by topical application of the composition.
- X-ray imaging is used to assist in certain of the above delivery methods.
- Receptor-mediated targeted delivery of therapeutic compositions containing an antisense polynucleotide, subgenomic polynucleotides, or antibodies to specific tissues can also be used.
- Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad.
- compositions containing a polynucleotide are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA can also be used during a gene therapy protocol.
- Factors such as method of action (e.g., for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations which will affect the dosage required for ultimate efficacy of the antisense subgenomic polynucleotides. Where greater expression is desired over a larger area of tissue, larger amounts of antisense subgenomic polynucleotides or the same amounts readministered in a successive protocol of administrations, or several administrations to different adjacent or close tissue portions of, for example, a tumor site, may be required to effect a positive therapeutic outcome. In all cases, routine experimentation in clinical trials will determine specific ranges for optimal therapeutic effect. For polynucleotide related genes encoding polypeptides or proteins with anti-inflammatory activity, suitable use, doses, and administration are described in U.S. Pat. No. 5,654,173.
- the therapeutic polynucleotides and polypeptides of the present invention can be delivered using gene delivery vehicles.
- the gene delivery vehicle can be of viral or non-viral origin (see generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995) 1:185; and Kaplitt, Nature Genetics (1994) 6:148).
- Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or regulated.
- Viral-based vectors for delivery of a desired polynucleotide and expression in a desired cell are well known in the art.
- Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5, 219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No.
- alphavirus-based vectors e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655).
- AAV adeno-associated virus
- Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone (see, e.g., Curiel, Hum. Gene Ther. (1992) 3:147); ligand-linked DNA(see, e.g., Wu, J. Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed.
- Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Pat. No. 5,580,859.
- Liposomes that can act as gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO 95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional approaches are described in Philip, Mol. Cell Biol. (1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.
- non-viral delivery suitable for use includes mechanical delivery systems such as the approach described in Woffendin et al., Proc. Natl. Acad. Sci. USA (1994) 91(24): 11581.
- the coding sequence and the product of expression of such can be delivered through deposition of photopolymerized hydrogel materials or use of ionizing radiation (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033).
- Other conventional methods for gene delivery that can be used for delivery of the coding sequence include, for example, use of hand-held gene transfer particle gun (see, e.g., U.S. Pat. No. 5,149,655); use of ionizing radiation for activating transferred gene (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033).
- nucleic acid As an alternative to the use of viral vectors other known methods of introducing nucleic acid into cells includes electroporation, calcium phosphate co-precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer. Gene transfer techniques which selectively target the TTK nucleic acid to the affected cell type are preferred. Examples of this included receptor-mediated gene transfer, in which the nucleic acid is linked to a protein ligand via polylysine, with the ligand being specific for a receptor present on the surface of the target cells.
- the present invention also provides the use of all or part of the nucleic acid sequence of the TTK promoter and/or enhancer regions in methods of screening for substances which modulate the activity of the promoter and increase or decrease the level of TTK expression.
- This assay can be performed to identify anti-cancer agents for therapeutic and/or prophylactic purposes.
- the level of promoter activity i.e., the ability to initiate transcription, is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter.
- the amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridize with the mRNA and which are labeled or may be used in a specific amplification reaction such as PCR.
- Use of a reporter gene facilitates determination of promoter activity by reference to protein production.
- a reporter gene under control of the TTK promoter and/or enhancers may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression.
- the reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product.
- a detectable signal preferably a visually detectable signal, such as a coloured product.
- Many examples are known, including ⁇ -galactosidase and luciferase. ⁇ -galactosidase activity may be assayed by production of blue color on substrate, the assay being by eye or by use of a spectrophotometer to measure absorbance.
- Fluorescence for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer. Radioactive assays may be used, for instance using choloramphenicol acetyltransferase, which may also be used in non-radioactive assays.
- the presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof.
- the binding molecule may be labeled directly or indirectly using any standard technique.
- the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug.
- TTK information determined according to the methods of the invention can be used in a system such as that described in U.S. Pat. No. 6,108,635 issued todorf, et al. on Aug. 22, 2000.
- Such a system can be for collecting the results of medical treatments given to patients in a plurality of locations. See, e.g., U.S. Pat. No. 5,713,350 issued to Yokota, et al. on Feb. 3, 1998.
- Table 1 (inserted following the last page of the Examples ) provides information about each patient from which the samples were isolated, including: the Patient ID and Path ReportID, numbers assigned to the patient and the pathology reports for identification purposes; the anatomical location of the tumor (AnatomicalLoc); The Primary Tumor Size; the Primary Tumor Grade; the Histopathologic Grade; a description of local sites to which the tumor had invaded (Local Invasion); the presence of lymph node metastases (Lymph Node Metastasis); incidence of lymph node metastases (provided as number of lymph nodes positive for metastasis over the number of lymph nodes examined) (Incidence Lymphnode Metastasis); the Regional Lymphnode Grade; the identification or detection of metastases to sites distant to the tumor and their location (Distant Met & Loc); a description of the distant metastases (Description Distant Met); the grade of distant metastasis (Distant Met Grade); and general comments about the patient or the tumor (Comments).
- Adenoma was not described in any of the patients; adenoma dysplasia (described as hyperplasia by the pathologist) was described in Patient ID No. 695. Extranodal extensions were described in two patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in seven patients, Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
- cDNA probes were prepared from total RNA isolated from the patient cells described in Example 1. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
- RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis.
- cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA.
- the second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA.
- the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA.
- Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red).
- Each array used had an identical spatial layout and control spot set.
- Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32 ⁇ 12 spots for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array. Spotting was accomplished using PCR amplified products from 0.5 kb to 2.0 kb and spotted using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations.
- the first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides.
- test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1 .
- concentrations from 2-600 pg/slide and ratios of 1:1 .
- two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about 4 duplicate measurements for each clone, two of one color and two of the other, for each sample.
- the differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient.
- the arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5 ⁇ SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol.
- the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5 ⁇ SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1 ⁇ SSC/0.2% SDS; 2) second wash in 0.1 ⁇ SSC/0.2% SDS; and 3) third wash in 0.1 ⁇ SSC.
- the experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction).
- the level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation.
- the data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential.
- the fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
- Quantitative PCR of a number of normal tissues and tumor cell lines, particularly colorectal carcinoma cell lines was used to analyze expression of TTK. Quantitative real-time PCR was performed by first isolating RNA from cells using a Roche RNA Isolation kit according to manufacturer's directions. One microgram of RNA was used to synthesize a first-strand cDNA using MMLV reverse transcriptase (Ambion) using the manufacturers buffer and recommended concentrations of oligo dT, nucleotides, and Rnasin. This first-strand cDNA served as a template for quantitative real-time PCR using the Roche light-cycler as recommended in the machine manual.
- TTK was amplified with the forward primer CGGAATCAAGTCTTCTAGCT (SEQ ID NO: 1) and reverse primer GGTTGCTCAAAAGTTGGTATG (SEQ ID NO:2) PCR product was quantified based on the cycle at which the amplification entered the linear phase of amplification in comparison to an internal standard and using the software supplied by the manufacturer. Small differences in amounts or total template in the first-strand cDNA reaction were eliminated by normalizing to amount of actin amplified in a separate quantitative PCR reaction using the forward primer 5′-CGGGAAATCGTGCGTGACATTAAG-3′ (SEQ ID NO:3) and the reverse primer: 5′-TGATCTCCTTCTGCATCCTGTCGG-3′ (SEQ ID NO:4).
- FIG. 1 The results for TTK mRNA levels in normal tissues are shown in FIG. 1; the results for TTK mRNA levels in tumor cell lines are shown in FIG. 2.
- FIG. 2 A brief description of the cell lines analyzed is provided in the table below.
- TTK was expressed in normal cells (FIG. 1), with thymus and testis identified as the normal tissues that most highly expressed the gene for TTK. Numerous cancer cells, however, displayed a significantly elevated level of TTK expression (FIG. 2) as compared to most wild-type tissues.
- IGF2 insulin-like growth factor 2
- TTK serotonine, tyrosine kinase implicated in the cell cycle
- MAPKAPK2 mitogen-activated protein (MAP) kinase-activated protein kinase
- MARCKS myristoylated alanine-rich C kinase substrate, which is a substrate of protein kinase C
- the data for these experiments is presented in graphical form in FIGS. 3 - 6 .
- the concurrent upregulation suggests that these genes are co-regulated and that patients with an elevated serum level of IGF2 may be candidates for treatment with inhibitors to TTK, MAPKAP kinase 2, MARCKS and/or IGF2.
- TTK expression in cancerous cells was further analyzed to confirm the role and function of the gene product in tumorgenesis, e.g., in promoting a metastatic phenotype.
- oligonucleotides complementary to TTK mRNA were designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of TTK.
- the ability of each designed antisense oligonucleotide to inhibit gene expression was tested through transfection into SW620 colon colorectal carcinoma cells.
- a carrier molecule preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 ⁇ m PVDF membrane.
- the antisense or control oligonucleotide was then prepared to a working concentration of 100 ⁇ M in sterile Millipore water.
- the oligonucleotide was further diluted in OptiMEMTM (Gibco/BRL), in a microfuge tube, to 2 ⁇ M, or approximately 20 ⁇ g oligo/ml of OptiMEMTM.
- OptiMEMTM Gabco/BRL
- lipitoid or cholesteroid typically in the amount of about 1.5-2 nmol lipitoid/pg antisense oligonucleotide
- the diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM.
- TTK target mRNA
- a buffer/enzyme mixture prepared by mixing (in the order listed) 2.5 ⁇ l H 2 O, 2.0 ⁇ l 10 ⁇ reaction buffer, 10 ⁇ l oligo dT (20 pmol), 1.0 ⁇ l dNTP mix (10 mM each), 0.5 ⁇ l RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 ⁇ l MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
- An amplification mixture was prepared by mixing in the following order: 1 ⁇ PCR buffer II, 3 mM MgCl 2 , 140 ⁇ M each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H 2 O to 20 ⁇ l.
- PCR buffer II is available in 10 ⁇ concentration from Perkin-Elmer, Norwalk, Conn.). In 1 ⁇ concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl.
- SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA.
- Oligo 79-5AS GGGACTCTTCCAAATGGGCATGACT (SEQ ID NO:5)
- Oligo 79-9AS TCCAGTAACTCTTGCGTTCCCATGG (SEQ ID NO:6)
- Oligo 79-5RC TCAGTACGGGTAAACCTTCTCAGGG (SEQ ID NO:7)
- Oligo 79-9RC GGTACCCTTGCGTTCTCAATGACCT (SEQ ID NO:8)
- the antisense oligonucleotides were introduced into a test cell and the effect upon TTK expression of the corresponding gene, as well as the effect induction of the cancerous phenotype, was examined as described below.
- TTK tumor necrosis factor
- MDA-MB-231 metastatic breast cancer cell lines
- SW620 colon colorectal carcinoma cells or 847 human immortal fibroblast cells.
- Transfection was carried out as described above in Example 4.
- oligonucleotide was diluted to 2 ⁇ M in OptiMEMTM and added to OptiMEMTM into which the delivery vehicle, lipitoid 116-6 in the case of SW620 cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231 cells, had been diluted.
- the oligo/ delivery vehicle mixture was then further diluted into medium with serum on the cells.
- the final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/ ⁇ g oligonucleotide.
- Cells were transfected overnight at 37° C. and the transfection mixture was replaced with fresh medium the next morning.
- TTK expression upon colony formation was tested in a soft agar assay.
- Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 ⁇ l aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for soft agar assay.
- 2000 cells are plated in 800 ⁇ l 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies are formed in 10 days to 3 weeks. Fields of colonies were counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
- antisense oligonucleotides to TTK led to decreased colony size and number compared to control reverse control oligonucleotides (79-9RC) or to control oligonucleotides (52-3AS: TAGGTCTTTGGCCGGTGATGGGTCG (SEQ ID NO:9) and 52-3RC: GCTGGGTAGTGGCCGGTTTCTGGAT (SEQ ID NO:10)).
- the 52-3 antisense oligonucleotide is directed to the hD53 mRNA, and serves as a negative control in the experiment.
- SW620 cells were transfected as described for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol was followed but cells were left in the presence of 2 ⁇ M drug. Each day, cytotoxicity was monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH was measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH).
- a positive control using antisense and reverse control oligonucleotides for BCL2 shows that loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
- Oligo Name AS or RC provides the name of the target gene or name of the oligo, and whether the oligo is antisense (AS) or a reverse control (RC).
- Oligo Name Antisense (AS) or Reverse Control (RC) Oligo Sequence SEQ ID NO: Chir39-5:AS ACTCATCTGGCTGGGCTATGGTGGT SEQ ID NO:11 Chir39-5:RC TGGTGGTATCGGGTCGGTCTACTCA SEQ ID NO:12 Chir79-9:AS TCCAGTAACTCTTGCGTTCCCATGG SEQ ID NO:6 Chir79-9:RC GGTACCCTTGCGTTCTCAATGACCT SEQ ID NO:8
- Chiron 79-9 (TTK) antisense does not sensitize the cells to treatment by cisplatin at a detectable level, but leads to increased death compared to control oligo at day 3.
- TTK was purified as a 6 ⁇ IIis tagged fusion protein using a baculovirus expression system. Essentially 20 ul of 20 nM TTK (100 k Da) in TTK kinase buffer comprising 50 mM Hepes pH 7.4, 2mM MgCl 2 , 10 mM MnCl 2 , 1 mM NaF, 50 mM NaCl, 1 mM DTT and 1 mg/ml BSA was added to 5 ul of a candidate agent diluted in 20% DMSO, 10 ul of a 2.8 uM solution of a biotinylated substrate peptide derived from cdc25, such as Biotin-SGSGSGLYRSPSMPENLNRPR-NH2 (SEQ ID NO:27) or Biotin-GGGGLYRSPSMPENLNRK-OH (SEQ ID NO:28) and 5 ul of 80 nM 33 P- ⁇ ATP
- Agents modulating TTK activity can be identified by comparing the activity of TTK in the presence of a candidate agent to the activity of TTK in the absence of a candidate agent.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Computational Biology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
- This application claims the benefit of U.S. provisional application serial No. 60/289,813, filed Feb. 21, 2001, which application is hereby incorporated by reference.
- The field of the present invention relates to disease diagnosis and treatment of cancer and identification of anti-cancer agents.
- Mitotic checkpoint genes have become widely studied for their roles in development as well as for their potential role in disease such as cancer. The mitotic checkpoint involves a number of different mechanisms to ensure proper cellular division. For example, the spindle assembly checkpoint modulates the timing of anaphase initiation in response to the improper alignment of chromosomes at the metaphase plate. If defects are detected, a signal is transduced to halt further progression of the cell cycle until correct bipolar attachment to the spindle is achieved. Initially identified in budding yeast, several mammalian spindle checkpoint-associated proteins have recently been identified and partially characterized. These proteins associate with all active human centromeres, including neocentromeres, in the early stages of mitosis prior to the commencement of anaphase. The proteins associated with the checkpoint protein complex (BUB1, BUBR1, BUB3, MAD2), the anaphase-promoting complex (Tsg24, p55CDC), and other proteins associated with mitotic checkpoint control (ERK1, 3F3/2 epitope, hZW10), were found to specifically associate with only the active centromere, suggesting that only active centromeres participate in the spindle checkpoint. Saffery R et al., Hum Genet. 107:376-84 (2000).
- Tyrosine threonine kinase (TTK), a protein kinase, phosphorylates serine, threonine, and tyrosine hydroxyamino acids (Mills et al,. Biol. Chem. 267:16000-6 (1992)). The kinases most closely related to TTK include SPK1 serine, threonine, and tyrosine kinase, the Pim1, PBS2, and CDC2 serine/threonine kinases, and the TIK kinase (Mills et al. J. Biol. Chem. 267:16000 -6 (1992)). The nucleotide and amino acid sequences of human TTK are provided at, for example, GenBank Accession No. M86699. Expression of TTK is markedly reduced or absent in resting cells and in tissues with a low proliferative index (Hogg et al. Oncogene 9:89-96 (1994)). TTK mRNA is expressed in human testis, thymus, bone marrow, and other tissues that contain a large number of proliferating cells and is not detected in tissues that contain few or no dividing cells. TTK expression was detected in several rapidly proliferating cells lines, including various cancer cell lines. TTK expression was also detected and in samples tissue samples from two patients with malignant ovarian cancer (Mills et al., ibid.; Schmandt et al. J. Immunol. 152:96-105 (1994)). TTK expression is correlated with cell proliferation, and plays a role in cell cycle control (Hogg et al., ibid.). Very low levels of TTK mRNA and protein are present in starved cells. When cells are induced to enter the cell cycle, levels of TTK mRNA, protein, and kinase activity increase at the G1/S phase of the cell cycle and peak in G2/M. TTK mRNA levels, as well as kinase activity, drop sharply in early G1, whereas protein levels are largely maintained. TTK is a human homologue of the S. cerevesiae kinase mps1 and the S. pombe protein mph1, both of which are involved in cell cycle spindle assembly checkpoint, thus indicating that TTK is a spindle checkpoint gene (see, e.g., Cahill et al. Genomics 58:181-7 (1999).
- Although mitotic checkpoint impairment has been detected in human cancers (e.g., such impairment is present in about 40% of human lung cancer cell lines) mutations in the MAD mitotic checkpoint genes and the BUB gene family are infrequent. Haruki N et al., Cancer Lett. 162:201-205 (2001); Mimori K et al., Oncol Rep. 8:39-42 (2001); Cahill et al., ibid.). There is thus a need for identification of mitotic checkpoint genes that have a role in human cancers, as they can serve as informative diagnostic and/or prognostic indicators, and therapeutic targets.
- The present invention provides methods for identification of cancerous cells by detection of expression levels of TTK, as well as diagnostic, prognostic and therapeutic methods that take advantage of the differential expression of these genes in mammalian cancer. Such methods can be useful in determining the ability of a subject to respond to a particular therapy, e.g., as the basis of rational therapy. In addition, the invention provides assays for identifying pharmaceuticals that modulate activity of these genes in cancers in which these genes are involved, as well as methods of inhibiting tumor growth by inhibiting activity of TTK.
- In a first embodiment, the present invention provides a method for identifying TTK levels in a sample of a subject suspected of having cancer (e.g., a lung, colon, prostrate or breast tissue biopsy) comprising quantifying the level of TTK in the sample. The identification of increased levels of TTK in the sample provides an indication of impairment of the cell cycle checkpoint in the sampled cells.
- In another embodiment, the invention provides a method for determining the characteristics of a malignant or pre-malignant growth comprising determining (either qualitatively or quantitatively) the level of TTK in the cells of the growth, and comparing levels with known levels in various stages of cancer and/or normal tissue. For example, to determine the characteristics of a particular subject's colon cancer, a sample of the cancer may be removed, the levels of TTK in the cancer determined, and the levels compared to normal tissue and/or levels in various stage colon cancers derived from the same cell type. The levels of TTK identified in the sample can thus be indicative of various characteristics of the malignant or pre-malignant growth, as determined by the characteristics of known tissue and cancers. The TTK levels can be compared directly to the levels in other single samples, or may be compared to a standard that is derived from the data of multiple samples.
- In another embodiment, the TTK levels of a sample can be used as one index for determining the appropriate therapeutic intervention for a subject with a malignant or pre-malignant growth. Highly increased levels of TTK, for example, can be indicative of the need for more aggressive therapy, as it is indicative of a later stage cancer. Alternatively, the level of TTK expression may be indicative of the responsiveness of a subject to a particular pharmaceutical, and in particular to a therapeutic intervention that affects the cancer via the mitotic checkpoint.
- In another embodiment, the invention features a method for identifying agents for inhibiting growth of a tumor, particular by a breast or colon tumor, by contacting a cell expressing TTK with a candidate agent, and assessing the effect of the agent upon TTK activity.
- Accordingly, in one aspect the invention features a method of diagnosing cancer in a subject, the method comprising detection of TTK polynucleotide or polypeptide in a test sample obtained from a subject so as to determine a level of expression of the gene product; and comparing the level of expression of the TTK in the test sample to a level of expression in a normal cell corresponding to the same tissue; wherein detection of an expression level of TTK in the test sample that is significantly increased from the level of expression in a normal cell indicates that the test cell is cancerous. In specific embodiments, the cancer is other than ovarian cancer, with colon cancer and breast cancer being of particular interest.
- In another aspect, the invention features a method for determining the prognosis of a cancerous disease in a subject, the method comprising detecting expression of TTK in a test cell from the subject; and comparing a level of expression of TTK in the test cell with a level of TTK expression in a control cell; wherein the level of expression of TTK in the test cell relative to the level of expression in the control cell is indicative of the prognosis of the cancerous disease. For example, where the control cell is a normal cell, an elevated level of TTK expression in the test cell relative to the normal cell is indicative of the continued presence of cancerous cells in the subject and thus a relatively poorer prognosis than where the level of TTK expression in the test cell is at a level comparable to that found in an normal (non-cancer) cell. In specific embodiments, progress of a cancer other than ovarian cancer is of particular interest, especially colon and breast cancer.
- In another aspect, the invention features a method for inhibiting growth of a cancerous cell comprising introducing into a cell an antisense polynucleotide for inhibition of TTK expression, wherein inhibition of TTK expression inhibits replication of the cancerous cell.
- In still another aspect, the invention features a method for assessing the tumor burden of a subject, the method comprising detecting a level of TTK expression in a test sample from a subject, the test sample suspected of comprising increased TTK expression; wherein detection of the level of TTK expression in the test sample is indicative of the tumor burden in the subject, with an increased level of TTK expression in the test sample relative to a control non-cancer cell indicates the presence of a tumor in the subject.
- In yet another aspect, the invention features a method of identifying an agent having anti-TTK activity, the method comprising contacting a cancerous cell displaying elevated expression of TTK with a candidate agent; and determining the effect of the candidate agent on TTK activity; wherein a decrease in TTK activity indicates that the agent has anti-TTK activity. In specific embodiments, TTK activity is detected by detecting TTK expression or by detecting a biological activity of TTK
- In yet another aspect, the invention features an assay for identifying a candidate agent that inhibits growth of a cancerous cell, comprising contacting a cell expressing TTK polypeptide with a candidate agent; and detecting activity of the TTK polypeptide, comparing the activity of the TTK polypeptide in the cell in the presence of the candidate agent to activity of a TTK polypeptide in a cell in the absence of the candidate agent; wherein reduction of TTK activity in the presence of the candidate agent relative to TTK activity in the absence of the candidate agent indicates that the candidate agent reduces TTK activity and inhibits growth of a cancerous cell.
- A primary object of the invention is to exploit TTK as a therapeutic target, e.g. by identifying candidate agents that modulate, usually that decrease, TTK activity in a target cell in order to, for example, inhibit cell growth.
- An object of the present invention is to inhibit tumor growth by inhibition of activity of a mitotic checkpoint gene product, particularly though inhibition of TTK activity in the target tumor cell.
- Another object of the invention is to facilitate rational cancer therapy. For example, where the cancer in the subject is associated with increased TTK activity levels, a therapeutic agent is selected accordingly so as to facilitate reduction of TTK activity levels.
- Another object of the present invention is to design clinical trials based on levels of TTK expression in a cancer, and more particularly to design clinical trials based on TTK expression in combination with other patient attributes.
- Yet another object of the invention is to identify the association of TTK expression and intervention attributes that yield efficacious changes in selected disease progression measures.
- An advantage of the invention is the ability to project disease progression based on expression of TTK in a malignant or pre-malignant growth.
- Another advantage of the present invention is that it allows a more systematic approach for intervention of a cancerous disease based upon objective indicia.
- These and other objects, advantages, and features of the invention will become apparent to those persons skilled in the art upon reading the details of the methods as more fully described below.
- FIG. 1 is a bar graph illustrating expression of TTK in various normal tissue types as detected by PCR.
- FIG. 2 is a bar graph illustrating expression of TTK in various tumor cell lines as detected by PCR.
- FIGS. 3-6 are graphs illustrating expression profiles for IGF2, MAPKAPK2, TTK, and MARCKS in patients with colorectal carcinoma.
- FIGS. 7 and 8 are graphs illustrating growth suppression of MDA-MB-231 cells following antisense suppression of TTK expression.
- FIG. 9 is a graph illustrating growth suppression of SW620 cells following antisense suppression of TTK expression.
- FIG. 10 is a graph illustrating suppression of colony formation of SW620 cells in soft agar following antisense suppression of TTK expression.
- FIG. 11 is a graph illustrating that antisense suppression of TTK has no detectable effect on normal immortal fibroblasts.
- FIG. 12 is a bar graph illustrating induction of cell death upon depletion of TTK from SW620 cells.
- Before the present invention is described, it is to be understood that this invention is not limited to particular methodologies described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
- Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
- Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.
- It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the agent” includes reference to one or more agents and equivalents thereof known to those skilled in the art, and so forth.
- The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
- The terms “polynucleotide” and “nucleic acid”, used interchangeably herein, refer to a polymeric forms of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, these terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa et al. (1999) Cell 99(7):691-702). The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucl. Acids Res. 24:2318-2323. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
- The terms “polypeptide” and “protein”, used interchangeably herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
- As used herein “TTK polynucleotide” and “TTK polypeptide” encompass polynucleotides and polypeptides having sequence similarity or sequence identity to the human TTK (having GenBank accession number M86699; SEQ ID NO:13 and 14), or the S. cerevesiae kinase mps1 gene and gene products (SEQ ID NO:29 and 30), the S. pombe protein mph1 gene and gene products (SEQ ID NO:31 and 32), and other genes and gene products related to TTK, such as SPK1 (SEQ ID NO:15 and 16), Pim1 (SEQ ID NO:17 and 18), PBS2 (SEQ ID NO:19 and 20), CDC2 (SEQ ID NO:21 and 22), and TIK (SEQ ID NO:23 and 24) of at least about 65%, preferably at least about 80%, more preferably at least about 85%, and can be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Sequence similarity and sequence identity are calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. In general, percent sequence identity is calculated by counting the number of residue matches (e.g., nucleotide residue or amino acid residue) between the query and test sequence and dividing total number of matches by the number of residues of the individual sequences found in the region of strongest alignment. Thus, where 10 residues of an 11 residue query sequence matches a test sequence, the percent identity above would be 10 divided by 11, or approximately, 90.9%. Algorithms for computer-based sequence analysis are known in the art, such as BLAST (see, e.g., Altschul et al., J. Mol. Biol., 215:403-10 (1990)), particularly the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). For the purposes of this invention, a preferred method of calculating percent identity is the Smith-Waterman algorithm, using the following. Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1. The human TTK cDNA is represented by the polynucleotide sequence of SEQ ID NO:13 and the human TTK polypeptide is represented by the sequence of SEQ ID NO:14.
- “Antisense polynucleotide” or “antisense oligonucleotide” are used interchangeably herein to mean an unmodified or modified nucleic acid having a nucleotide sequence complementary to a given polynucleotide sequence (e.g., a polynucleotide sequence encoding TTK) including polynucleotide sequences associated with the transcription or translation of the given polynucleotide sequence (e.g., a promoter of a polynucleotide encoding TTK), where the antisense polynucleotide is capable of hybridizing to a TTK-encoding polynucleotide sequence. Of particular interest are antisense polynucleotides capable of inhibiting transcription and/or translation of a TTK-encoding polynucleotide either in vitro or in vivo.
- The term “cDNA” as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons (e.g., sequences encoding open reading frames of the encoded polypeptide) and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns removed by nuclear RNA splicing to create a continuous open reading frame encoding TTK.
- A “variant” as used in the context of a “variant polypeptide” refers to an amino acid sequence that is altered by one or more amino acids relative to a reference amino acid sequence. The variant can have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have “nonconservative” changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software.
- A “deletion” is defined as a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent as compared to reference amino acid sequence or nucleotide sequence. Deletions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
- An “insertion” or “addition” is that change in an amino acid or nucleotide sequence which has resulted in the addition of one or more amino acid or nucleotide residues, respectively, as compared to a reference amino acid sequence or nucleotide sequence. Insertions or additions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
- A “substitution” results from the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively, as compared to a reference amino acid sequence or nucleotide sequence. Substitutions can be of any length, but are preferably approximately 50, 20, 15, 10, 5 or 3 amino acids or nucleotides in length.
- The terms “single nucleotide polymorphism” and “SNP” refer to polymorphisms of a single base change relative to a reference sequence.
- The term “biologically active” refers to gene product, usually a polypeptide, having structural, regulatory, or biochemical functions of a naturally occurring gene product, e.g., protein. “Immunologically active” defines the capability of the natural, recombinant, or synthetic polypeptide, or any oligopeptide thereof, to elicit a specific immune response in appropriate animals or cells and to bind with specific antibodies.
- The term “derivative” as used herein refers to the chemical modification of a nucleic acid or amino acid sequence relative to a reference nucleic acid or amino acid sequence. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group. A nucleic acid derivative generally encodes a polypeptide which retains essential biological characteristics of the polypeptide encoded by the reference nucleic acid (e.g., the “parent” molecule).
- As used herein the term “isolated” is meant to describe a compound of interest (e.g., either a polynucleotide or a polypeptide) that is in an environment different from that in which the compound naturally occurs. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
- As used herein, the term “substantially purified” refers to a compound (e.g., either a polynucleotide or a polypeptide) that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated.
- “Stringency” typically occurs in a range from about Tm −5° C. (5° C. below the Tm of the probe or antibody) to about 20° C. to 25° C. below Tm. As will be understood by those of skill in the art, a stringency hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences.
- The term “hybridization” as used herein shall include “any process by which a strand of nucleic acid joins with a complementary strand through base pairing” (Coombs, Dictionary of Biotechnology, Stockton Press, New York N.Y. (1994)). Amplification as carried out in the polymerase chain reaction technologies is described in Dieffenbach et al., PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. (1995).
- The term “transformation” as used herein refers to a permanent or transient genetic change, induced in a cell following incorporation of new DNA (i.e., DNA exogenous to the cell). Genetic change can be accomplished either by incorporation of the new DNA into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element. Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell.
- The term “construct” as used herein refers to a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences.
- As used herein, the term “differentially expressed” generally refers to a polynucleotide that is expressed at levels in a test cell that differ significantly from levels in a reference cell, e.g., mRNA is found at levels at least about 25%, at least about 50% to about 75%, at least about 90% increased or decreased, generally at least about 1.2-fold, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or at least about 50-fold or more increased or decreased in a cancerous cell when compared with a cell of the same type that is not cancerous. The comparison can be made between two tissues, for example, if one is using in situ hybridization or another assay method that allows some degree of discrimination among cell types in the tissue. The comparison may also be made between cells removed from their tissue source. “Differential expression” refers to both quantitative, as well as qualitative, differences in the genes' temporal and/or cellular expression patterns among, for example, normal and neoplastic tumor cells, and/or among tumor cells which have undergone different tumor progression events.
- The terms “correspond to” or “represents” as used in, for example, the phrase “polynucleotide corresponds to a differentially expressed gene” are used to refer to the relationship between a given polynucleotide and the gene from which the polynucleotide sequence is derived (e.g., a polynucleotide that is derived from a coding region of the gene, a splice variant of the gene, an exon, and the like) or to which the polynucleotide hybridizes to under stringer conditions.
- “Differentially expressed polynucleotide” as used herein refers to a nucleic acid molecule (RNA or DNA) comprising a sequence that represents or corresponds to a differentially expressed gene, e.g., the differentially expressed polynucleotide comprises a sequence (e.g., an open reading frame encoding a gene product; a non-coding sequence) that uniquely identifies a differentially expressed gene so that detection of the differentially expressed polynucleotide in a sample is correlated with the presence of a differentially expressed gene in a sample. “Differentially expressed polynucleotides” is also meant to encompass fragments of the disclosed polynucleotides, e.g., fragments retaining biological activity, as well as nucleic acids homologous, substantially similar, or substantially identical (e.g., having about 90% sequence identity) to the disclosed polynucleotides.
- “Diagnosis” as used herein generally includes determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy), and therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy).
- As used herein, the term “a polypeptide associated with cancer” (e.g., as in polypeptide associated with colon cancer) refers to a polypeptide that is present at relatively higher or lower levels in a cancer cell relative to a normal cell of the same type.
- The term “biological sample” encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.
- The terms “treatment”, “treating”, “treat” and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or relieving the disease symptom, i.e., causing regression of the disease or symptom. Thus “treatment of cancer” thus encompasses one or more of inhibition of cellular proliferation, inhibition of metastasis, and the like.
- The terms “individual,” “subject,” “host,” and “patient,” used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.
- The phrase “specific binding pair” as used herein comprises a specific binding member and a binding partner which have a particular specificity for each other and which bind to each other in preference to other molecules under stringent conditions. Examples of specific binding pairs are antigens and antibodies, molecules and receptors and complementary nucleotide sequences. Other examples of binding pairs will be apparent to one skilled in the art upon reading the present disclosure. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a larger molecule. In embodiments in which the specific binding pair are nucleic acid sequences, they are preferably between 10 to 200 nucleotides long, more preferably greater than 15 to 100 nucleotides long.
- By “antibody” is meant an immunoglobulin protein which is capable of binding an antigen. Antibody as used herein is meant to include the entire antibody as well as any antibody fragments (e.g., F(ab′) 2, Fab′, Fab, Fv) capable of binding the epitope, antigen, or antigenic fragment of interest.
- Antibodies of the invention are immunoreactive or immunospecific for and therefore specifically and selectively bind to a protein of interest, e.g., human TTK protein. Antibodies which are immunoreactive and immunospecific for human TTK are preferred. Antibodies for human TTK are preferably immunospecific—i.e., not substantially cross-reactive with related materials, although they may recognize TTK homologs across species. The term “antibody” encompasses all types of antibodies (e.g., monoclonal and polyclonal).
- By “binds specifically” is meant high avidity and/or high affinity binding of an antibody to a specific polypeptide, e.g., epitope of a TTK protein. Antibody binding to its epitope on this specific polypeptide is stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest. Antibodies which bind specifically to a polypeptide of interest may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to the compound or polypeptide of interest, e.g., by use of appropriate controls.
- The terms “cancer”, “neoplasm”, “tumor”, and the like are used interchangeably herein to refer to cells which exhibit relatively autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In general, cells of interest for detection or treatment in the present application include pre-malignant (e.g., benign hyperplasiac), malignant, metastatic, and non-metastatic cells.
- “TTK activity” as used herein refers to activity of the TTK polypeptide in phosphorylation of a recipient substrate.
- “Modulation of TTK activity” as used herein refers to an increase or decrease in TTK activity that can be a result of, for example, interaction of an agent with a TTK polypeptide (e.g., reversible or irreversible binding of an inhibitory agent so as to interfere with TTK polypeptide interaction with a donor molecule or a recipient (acceptor) molecule in the phosphorylation activity of TTK), inhibition of TTK transcription and/or translation (e.g., through antisense interaction with the TTK gene or TTK transcript, through modulation of transcription factors that facilitate TTK expression), and the like. Modulation of TTK activity that results in a decrease of TTK activity is of particular interest in the invention. In this context, TTK activity can be decreased by an inhibitory agent at least 10%, 25%, 50%, 75%, 85%, 90%, up to 100% relative to TTK activity in the absence of an agent. TTK activity can be assessed by assaying enzymatic activity, by assessing TTK polypeptide levels, or by assessing TTK transcription levels. Comparisons of TTK activity can also be accomplished by comparing TTK activity assessed (either qualitatively or quantitatively) in a test sample to a standard TTK activity (e.g., a level of TTK activity in the absence of an inhibitory agent or agonist, that is associated with a normal cell, a level of TTK activity of a cancerous cell of a selected tissue type, and the like).
- Overview
- Human TTK is a mitotic checkpoint gene which encodes an 857 amino acid protein that exhibits activity of a mixed specificity (tyr/thr) kinase. TTK is expressed in rapidly proliferating tissues such as testis and thymus. See, e.g., Mills G B et al., J Biol Chem. 267:16000-6 (1992). The present invention is based upon the finding that TTK is differentially expressed in colon tumor cells relative to normal colon cells as detected by microarray analysis. Differential expression was confirmed in cell lines derived from various forms of cancer, indicating that the involvement of TTK in cancer as a more general mechanism. In addition, disruption of TTK function using antisense oligonucleotides to “knock-out” TTK message decreased proliferation, inhibited anchorage independent growth, and induced apoptosis of cancer cell lines, including a metastatic breast cancer cell line (MDA-MB-213) and a colorectal carcinoma cell line (SW620). These data indicate that TTK can be a therapeutic target for chemotherapy in cancers in which TTK is overexpressed.
- The identification of the association of TTK with cancer, and the confirmation that inhibition of TTK activity (e.g., by reducing TTK expression) serves as the basis for the materials and methods of the invention, such as are disclosed and discussed herein, for use in, for example, diagnosing cancer of a patient, particularly a cancer that is susceptible to treatment by decreasing activity of TTK. The invention also provides for planning and selection of appropriate therapeutic and/or prophylactic treatment, permitting streamlining of treatment by targeting those most likely to benefit. The invention also provides for treatment of a cancer associated with aberrant TTK levels (e.g., associated with overexpression or overproduction of TTK), e.g. by inhibition of gene product production (e.g., decreasing levels of transcription and/or translation), by decreasing TTK activity (e.g., by decreasing TTK gene product production (e.g., at the level of transcription or translation) and/or by reducing one or more of TTK's kinase activities).
- Various aspects of the invention will now be described in more detail.
- Diagnostic Methods
- In one aspect the invention is based on the discovery that TTK activity is present at higher levels in cancerous cells (particularly in colon cancer and breast cancer) than in normal cells of the same cell type. This discovery serves as the basis for identification of cancerous cells, as well as identification of tumors that are susceptible to therapy by inhibiting activity of TTK, e.g., by inhibiting TTK expression at the level of transcription or translation or both, by inhibiting TTK activity, and the like.
- TTK gene products e.g. TTK encoding mRNA or TTK polypeptides are of particular interest as markers (e.g., in bodily fluids (such as blood) or in tissues) to detect the earliest changes along the carcinogenesis pathway (e.g., to differentiate cancerous tissue from non-cancerous tissue) and/or to monitor the efficacy of various therapies and preventive interventions. For example, a relatively increased level of expression of TTK compared to normal cells or tissues of the same type can be indicative of a poorer prognosis, and therefore warrant more aggressive therapy (e.g., chemo- or radio-therapy) for a patient or vice versa. The correlation of surrogate tumor specific features with response to treatment and outcome in patients can define prognostic indicators that allow the design of tailored therapy based on the molecular profile of the tumor. These therapies include antibody targeting, antagonists (e.g., small molecules), and gene therapy. Determining TTK expression and comparison of a patient's profile with known expression in normal tissue and variants of the disease allows a determination of the best possible treatment for a patient, both in terms of specificity of treatment and in terms of comfort level of the patient. Surrogate tumor markers, such as polynucleotide expression, can also be used to better classify, and thus diagnose and treat, different forms and disease states of cancer. Two classifications widely used in oncology that can benefit from identification of TTK expression levels are staging of the cancerous disorder, and grading the nature of the cancerous tissue.
- TTK polynucleotides, as well as their encoded gene products, can be useful to monitor patients having or susceptible to cancer to detect potentially malignant events at a molecular level before they are detectable at a gross morphological level. In addition, detection of TTK gene products can be useful as therametrics, e.g., to assess the effectiveness of therapy by using the polynucleotides or their encoded gene products, to assess, for example, tumor burden in the patient before, during, and after therapy.
- Furthermore, a polynucleotide identified as corresponding to a gene that is differentially expressed in, and thus is important for, one type of cancer can also have implications for development or risk of development of other types of cancer, e.g., where a polynucleotide represents a gene differentially expressed across various cancer types. Thus, for example, expression of a polynucleotide corresponding to a gene that has clinical implications for metastatic colon cancer can also have clinical implications for stomach cancer or endometrial cancer.
- In making a diagnosis, prognosis, risk assessment, or measurement of tumor burden based on the enzymatic activity of TTK or the expression levels of TTK polypeptide or TTK encoding polynucleotides, activity or expression levels may be compared to those of suitable cancerous or non-cancerous control samples. For example, a diagnosis of cancer can be made if TTK activity is increased at by 25%, 50%, 75%, 90%, up to 100%, or, alternatively by 5-fold, 10-fold, 50-fold, or more than 100-fold relative to a normal non-cancerous cell of the same tissue type.
- Other gene products that are differentially expressed in cancerous cells relative to, for example, non-cancer cells of between cancer cells of differing malignant potential (e.g., non-malignant tumor cells versus cells of high potential malignancy) can also be assayed in addition to TTK for differential expression in a test cell. Such exemplary gene products include, but are not necessarily limited to MAPKAP kinase 2 (SEQ ID. No. 33 and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and 38).
- Staging. Staging is a process used by physicians to describe how advanced the cancerous state is in a patient. Staging assists the physician in determining a prognosis, planning treatment and evaluating the results of such treatment. Staging systems vary with the types of cancer, but generally involve the following “TNM” system: the type of tumor, indicated by T; whether the cancer has metastasized to nearby lymph nodes, indicated by N; and whether the cancer has metastasized to more distant parts of the body, indicated by M. Generally, if a cancer is only detectable in the area of the primary lesion without having spread to any lymph nodes it is called Stage I. If it has spread only to the closest lymph nodes, it is called Stage II. In Stage II, the cancer has generally spread to the lymph nodes in near proximity to the site of the primary lesion. Cancers that have spread to a distant part of the body, such as the liver, bone, brain or other site, are Stage IV, the most advanced stage.
- The differential expression level of TTK can facilitate fine-tuning of the staging process by identifying markers for the aggressiveness of a cancer, e.g. the metastatic potential, as well as the presence in different areas of the body. Thus, a Stage II cancer with a large differential level of expression of TTK can signify a cancer with a high metastatic potential and can be used to change a borderline Stage II tumor to a Stage III tumor, justifying more aggressive therapy.
- Grading of cancers. Grade is a term used to describe how closely a tumor resembles normal tissue of its same type. The microscopic appearance of a tumor is used to identify tumor grade based on parameters such as cell morphology, cellular organization, and other markers of differentiation. As a general rule, the grade of a tumor corresponds to its rate of growth or aggressiveness, with undifferentiated or high-grade tumors generally being more aggressive than well differentiated or low-grade tumors. The following guidelines are generally used for grading tumors: 1) GX Grade cannot be assessed; 2) G1 Well differentiated; G2 Moderately well differentiated; 3) G3 Poorly differentiated; 4) G4 Undifferentiated. TTK activity levels (e.g., expression levels) can be especially valuable in determining the grade of the tumor, as they not only can aid in determining the differentiation status of the cells of a tumor, they can also identify factors other than differentiation that are valuable in determining the aggressiveness of a tumor, such as metastatic potential.
- Detection of colon cancer. Polynucleotides and polypeptides corresponding to TTK can be used to detect colon cancer in a subject. Colorectal cancer is one of the most common neoplasms in humans and perhaps the most frequent form of hereditary neoplasia. Prevention and early detection are key factors in controlling and curing colorectal cancer. Colorectal cancer begins as polyps, which are small, benign growths of cells that form on the inner lining of the colon. Over a period of several years, some of these polyps accumulate additional mutations and become cancerous. Multiple familial colorectal cancer disorders have been identified, which are summarized as follows: 1) Familial adenomatous polyposis (FAP); 2) Gardner's syndrome; 3) Hereditary nonpolyposis colon cancer (HNPCC); and 4) Familial colorectal cancer in Ashkenazi Jews. The expression of appropriate polypeptide andpolynucleotides can be used in the diagnosis, prognosis and management of colorectal cancer. Detection of colon cancer can be determined using expression levels of TTK alone or in combination with the levels of expression of other genes differentially expressed in colon cancer. Determination of the aggressive nature and/or the metastatic potential of a colon cancer can be determined by comparing levels of TTK with a level associated with a normal cell, and comparing total levels of another sequence known to be differentially expressed, or otherwise be a marker of, cancerous tissue, e.g., expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al., Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957; Bodmer W, et al., Nat Genet. (1994) 4(3):217; Fearon E R, Ann N Y Acad Sci. (1995) 768:101)or MAPKAP kinase 2 (SEQ ID. No. 33 and 34), MARCKS (SEQ ID NO:35 and 36) and/or IGF2 (SEQ ID NO:37 and 38). For example, development of colon cancer can be detected by examining the level of expression of a gene corresponding to a polynucleotides described herein to the levels of oncogenes (e.g. ras) or tumor suppressor genes (e.g. FAP or p53). Thus expression of specific marker polynucleotides can be used to discriminate between normal and cancerous colon tissue, to discriminate between colon cancers with different cells of origin, to discriminate between colon cancers with different potential metastatic rates, etc. For a review of markers of cancer, see, e.g., Hanahan et al. (2000) Cell 100:57-70.
- Detection of breast cancer. The majority of breast cancers are adenocarcinomas subtypes, which can be summarized as follows: 1) ductal carcinoma in situ (DCIS), including comedocarcinoma; 2) infiltrating (or invasive) ductal carcinoma (IDC); 3) lobular carcinoma in situ (LCIS); 4) infiltrating (or invasive) lobular carcinoma (ILC); 5) inflammatory breast cancer; 6) medullary carcinoma; 7) mucinous carcinoma; 8) Paget's disease of the nipple; 9) Phyllodes tumor; and 10) tubular carcinoma.
- The expression levels of TTK can be used in the diagnosis and management of breast cancer, as well as to distinguish between types of breast cancer. Detection of breast cancer can be determined using expression levels of TTK, either alone or in combination with expression of other gene known to be differentially expressed in breast cancer. Determination of the aggressive nature and/or the metastatic potential of a breast cancer can also be determined by comparing levels of TTK and comparing levels of another sequence known to vary in cancerous tissue, e.g. ER expression. In addition, development of breast cancer can be detected by examining the ratio of expression of TTK to the levels of steroid hormones (e.g., testosterone or estrogen) or to other hormones (e.g., growth hormone, insulin). Thus expression of specific marker polynucleotides and polypeptides can be used to discriminate between normal and cancerous breast tissue, to discriminate between breast cancers with different cells of origin, to discriminate between breast cancers with different potential metastatic rates, etc.
- Detection Methods
- A number of methods are known in the art for analyzing biological samples from individuals to determine whether the individual has increased expression of a TTK gene product (e.g., RNA or protein) by detecting the TTK gene product in a biological sample from that subject. As discussed above, the purpose of such analysis may be used for diagnosis, to detect the presence of an existing cancer, to help identify the type of cancer, to assist a physician in determining the severity or likely course of the cancer, and/or to optimize treatment of it. In specific non-limiting embodiments, the methods are useful for detecting cancer cells, facilitating diagnosis of cancer and the severity of a cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy (e.g., by providing a measure of therapeutic effect through, for example, assessing tumor burden during or following a chemotherapeutic regimen). In additional embodiments, the methods are useful for classification or stratification of cancer cells, e.g., for the purpose of selecting patients to be included in a clinical trial population, for selecting an appropriate therapy (e.g., selecting therapy according to an expression profile of the cancerous cells), and the like.
- Kits
- The detection methods can be provided as part of a kit. Thus, the invention further provides kits for detecting the presence and/or a level of TTK activity e.g., by detection of a TTK-encoding mRNA and/or a polypeptide encoded thereby or by measuring TTK activity, in a biological sample. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals. The kits of the invention for detecting TTK polypeptide that is differentially expressed in cancer cells comprise a moiety that specifically binds the polypeptide, which may be a specific antibody. The kits of the invention for detecting a TTK-encoding polynucleotide that is differentially expressed in cancer cells comprise a moiety that specifically hybridizes to such a polynucleotide such as a primer. The kits of the invention for detecting TTK activity comprise a recipient substrate capable of being phosphorylated by TTK, and a labeled donor substrate. The kits may optionally provide additional components that are useful in the procedure, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detection, control samples, standards, instructions, and interpretive information.
- Screening for TTK Nucleic Acid or Polypeptide
- Methods for detection of TTK activity include screening for the presence of TTK nucleic acid sequences representing an expressed TTK gene or alleles or variants thereof, and detecting the TTK polypeptide. The methods make use of biological samples from individuals that are suspected of contain the nucleic acid sequences or polypeptide. Examples of biological samples include blood, plasma, serum, tissue samples, tumor samples, saliva and urine.
- Exemplary approaches for detecting TTK nucleic acid or polypeptides include: (a) determining the presence of the polypeptide encoded by the TTK gene; (b) using a specific binding member capable of binding to a TTK nucleic acid sequence (e.g., a known complementary sequence), the specific binding member comprising a nucleic acid that hybridizes with the TTK sequence under stringent conditions (c) using a substance comprising an antibody domain with specificity for a TTK nucleic acid sequence or the polypeptide encoded by it, the specific binding member being labeled to allow detection of the specific binding member to its binding partner is detectable; (d) using PCR involving one or more primers to determine relative levels of TTK in a sample from a patient; and (e) using an assay for TTK activity, e.g., phosphorylation of a TTK substrate.
- The determination of TTK levels can include both levels of normal TTK and/or variant forms of TTK. A variant form of the gene may contain one or more insertions, deletions, substitutions and/or additions of one or more nucleotides compared with the wild-type sequence which may or may not alter the gene function. Differences at the nucleic acid level are not necessarily reflected by a difference in the amino acid sequence of the encoded polypeptide due to the degeneracy of the genetic code. However, a mutation or other difference in a gene may result in a frame-shift or stop codon, which could seriously affect the nature of the polypeptide produced (if any), or a point mutation or gross mutational change to the encoded polypeptide, including insertion, deletion, substitution and/or addition of one or more amino acids or regions in the polypeptide.
- A mutation in a promoter sequence or other regulatory region may alter (e.g., reduce or enhance) expression from the gene or affect the processing or stability of the mRNA transcript.
- There are various methods for detecting a particular nucleic acid sequence in a test sample. Tests may be carried out on preparations containing mRNA or cDNA generated from isolated mRNA in a manner that reflects the relative levels of mRNA transcripts in the sample. Levels of RNA can be determined specific amplification reaction such as PCR using one or more pairs of primers may be employed to amplify a region of the nucleic acid, and preferably a region with less homology to other genes. Nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.
- Nucleic acid may be screened using a TTK-specific probe. Such a probe corresponds in sequence to a region of the TTK gene, or its complement. Under stringent conditions, specific hybridization of such a probe to test nucleic acid is indicative of the presence of the TTK nucleic acid in a sample. For efficient screening purposes, more than one probe may be used on the same test sample. The probe may contain as few as 15, 20, 50 or 100 nucleotides of the TTK gene of SEQ ID. No. 13 or may be as long as or 500, 1 kb or as much as 3.8 kb or longer in length.
- Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample. Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art. The PCR product may for instance be treated in a way that enables one to display the mutation or polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected. This can be done simultaneous to or sequentially to determining the level of a normal TTK sequence, e.g., to determine the combinatory levels of total TTK.
- The presence of absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA. The presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene or a variant or allele is digested with the same enzyme or enzymes.
- A test sample of nucleic acid may be provided for example by extracting nucleic acid from cells, e.g., cells from a tumor biopsy.
- Detection of TTK Polypeptides
- There are various methods for determining the presence or absence in a test sample of a TTK polypeptide. A sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies), specific for wild-type TTK and/or one or more particular variants (e.g., allelic variants) of the TTK polypeptide. In such cases, the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding. Where a panel of antibodies is used, different reporting labels may be employed for each antibody so that binding of each can be determined. In addition to detection of TTK polypeptides using anti-TTK antibodies, TTK polypeptide can also be identified using TTK-specific activity assays.
- Arrays
- Binding agents (such as antibodies or nucleic acid sequences) can also be immobilized in small, discrete locations and/or as arrays on solid supports or on diagnostic chips. These approaches can be particularly valuable as they can provide great sensitivity, particularly through the use of fluorescently labeled reagents, require only very small amounts of biological sample from individuals being tested and allow a variety of separate assays can be carried out simultaneously. This latter advantage can be useful as it provides an assay for different proteins (e.g., an oncogene or tumor suppressor) in tandem with the assay for TTK. Thus, in a further aspect, the present invention provides a support or diagnostic chip having immobilized thereon one or more binding agents capable of specifically binding TTK nucleic acid or polypeptides, optionally in combination with other reagents needed to carrying out an assay.
- Methods for Expression of TTK Polypeptide
- The full-length or partial polypeptides encoded by TTK may be expressed in any expression system, including, for example, bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells for which are described in U.S. Pat. No. 5,654,173. Appropriate polynucleotide constructs are purified using standard recombinant DNA techniques as described in, for example, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), and under current regulations described in United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.
- Bacteria. Expression systems in bacteria include those described in Chang et al., Nature (1978) 275:615, Goeddel et al., Nature (1979) 281:544, Goeddel et al., Nucleic Acids Res. (1980) 8:4057;
EP 0 036,776, U.S. Pat. No. 4,551,433, DeBoer et al., Proc. Natl. Acad. Sci. (USA) (1983) 80:21-25, and Siebenlist et al., Cell (1980) 20:269. - Yeast. Expression systems in yeast include those described in Hinnen et al., Proc. Natl. Acad. Sci. (USA) (1978) 75:1929; Ito et al., J. Bacteriol. (1983) 153:163; Kurtz et al., Mol. Cell. Biol. (1986) 6:142; Kunze et al., J. Basic Microbiol. (1985) 25:141; Gleeson et al., J. Gen. Microbiol. (1986) 132:3459, Roggenkamp et al., Mol. Gen. Genet. (1986) 202:302) Das et al., J. Bacteriol. (1984) 158:1165; De Louvencourt et al., J. Bacteriol. (1983) 154:737, Van den Berg et al., Bio/Technology (1990) 8:135; Kunze et al., J. Basic Microbiol. (1985) 25:141; Cregg et al., Mol. Cell. Biol. (1985) 5:3376, U.S. Pat. Nos. 4,837,148 and 4,929,555; Beach and Nurse, Nature (1981) 300:706; Davidow et al., Curr. Genet. (1985) 10:380, Gaillardin et al., Curr. Genet. (1985) 10:49, Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112:284-289; Tilburn et al., Gene (1983) 26:205-221, Yelton et al., Proc. Natl. Acad. Sci. (USA) (1984) 81:1470-1474, Kelly and Hynes, EMBO J. (1985) 4:475479;
EP 0 244,234, and WO 91/00357. - Insect Cells. Expression of heterologous genes in insects is accomplished as described in U.S. Pat. No. 4,745,051, Friesen et al. (1986) “The Regulation of Baculovirus Gene Expression” in: The Molecular Biology Of Baculoviruses (W. Doerfler, ed.),
EP 0 127,839,EP 0 155,476, and Vlak et al., J. Gen. Virol. (1988) 69:765-776, Miller et al., Ann. Rev. Microbiol. (1988) 42:177, Carbonell et al., Gene (1988) 73:409, Maeda et al., Nature (1985) 315:592-594, Lebacq-Verheyden et al., Mol. Cell Biol. (1988) 8:3129; Smith et al., Proc. Natl. Acad. Sci. (USA) (1985) 82:8404, Miyajima et al., Gene (1987) 58:273; and Martin et al., DNA (1988) 7:99. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts are described in Luckow et al., Bio/Technology (1988) 6:47-55, Miller et al., Generic Engineering (Setlow, J. K. et al. eds.), Vol. 8 (Plenum Publishing, 1986), pp. 277-279, and Maeda et al., Nature, (1985) 315:592-594. - Mammalian Cells. Mammalian expression is accomplished as described in Dijkema et al., EMBO J. (1985) 4:761, Gorman et al., Proc. Natl. Acad. Sci. (USA) (1982) 79:6777, Boshart et al., Cell (1985) 41:521 and U.S. Pat. No. 4,399,216. Other features of mammalian expression are facilitated as described in Ham and Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem. (1980) 102:255, U.S. Pat. Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.
- Screening Assays to Identify Chemotherapeutic Agents
- The invention also encompasses screening assays to identify agents that modulate TTK activity, specifically that decrease aberrant TTK activity in an affected cell, e.g., a cancerous or pre-cancerous cell in which TTK is differentially expressed. Such assays may be performed either in vitro or in vivo.
- Candidate Agents
- The term “agent” as used herein describes any molecule with the capability of altering the expression or physiological function of a gene product of a differentially expressed gene. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
- Candidate agents encompass numerous chemical classes, including, but not limited to, organic molecules (e.g., small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons), peptides, monoclonal antibodies, antisense polynucleotides, and ribozymes, and the like. Candidate agents can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including, but not limited to: polynucleotides, peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
- Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs. Candidate agents can be assessed for modulation of TTK activity either singly or in pools.
- Screening of Candidate Agents In Vitro
- A wide variety of in vitro assays may be used to screen candidate agents for the desired biological activity, including, but not limited to, labeled in vitro protein-protein binding assays, protein-DNA binding assays (e.g., to identify agents that affect expression), electrophoretic mobility shift assays, immunoassays for protein binding, and the like. For example, by providing for the production of large amounts of a differentially expressed polypeptide, one can identify ligands or substrates that bind to, modulate or mimic the action of the polypeptide. Further methods for identifying these ligands and substrates are provided below. The purified polypeptide may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions, transcriptional regulation, etc.
- The screening assay can be a binding assay, wherein one or more of the molecules may be joined to a label, and the label directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g.,magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
- A variety of other reagents may be included in the screening assays described herein. Where the assay is a binding assay, these include reagents like salts, neutral proteins, e.g.,albumin, detergents, etc that are used to facilitate optimal protein-protein binding, protein-DNA binding, and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40° C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
- Many mammalian genes have homologs in yeast and lower animals. The study of such homologs physiological role and interactions with other proteins in vivo or in vitro can facilitate understanding of biological function. In addition to model systems based on genetic complementation, yeast has been shown to be a powerful tool for studying protein-protein interactions through the two hybrid system described in Chien et al. 1991 Proc. Natl. Acad. Sci. USA 88:9578-9582.
- Screening of Candidate Agents In Vivo
- Candidate agents can be screened in a non-human animal model of cancer (e.g., in animals into which have been injected cancerous cells; in animals that are transgenic for an alteration in expression of a differentially expressed gene as described herein, e.g., a transgenic “knock-out,” or a transgenic “knock-in,” a polynucleotide encoding all or a portion of a differentially expressed gene product and comprising an operably linked reporter gene, and the like).
- In general, the candidate agent is administered to the animal, and the effects of the candidate agent determined. The candidate agent can be administered in any manner desired and/or appropriate for delivery of the agent in order to effect a desired result. For example, the candidate agent can be administered by injection (e.g., by injection intravenously, intramuscularly, subcutaneously, or directly into the tissue in which the desired affect is to be achieved), orally, or by any other desirable means. Normally, the in vivo screen will involve a number of animals receiving varying amounts and concentrations of the candidate agent (from no agent to an amount of agent hat approaches an upper limit of the amount that can be delivered successfully to the animal), and may include delivery of the agent in different formulation. The agents can be administered singly or can be combined in combinations of two or more, especially where administration of a combination of agents may result in a synergistic effect.
- The effect of agent administration upon the transgenic animal can be monitored by assessing expression of the gene product, growth of the injected tumor cells, and the like.
- Identified Candidate Agents
- Compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host for treatment of a condition that is amenable to treatment by modulation of expression of a differentially expressed gene product. The therapeutic agents may be administered in a variety of ways, orally, topically, parenterally e.g., subcutaneously, intraperitoneally, by viral infection, intravascularly, etc. Oral and inhaled treatments are of particular interest. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways. The concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt. %. The therapeutic agents can be administered in a single dose, or as multiple doses over a course of treatment.
- The pharmaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like. Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds. Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
- Methods of Screening for Drugs that Modulate TTK Activity
- A TTK polypeptide or TTK-encoding nucleic acid according to the present invention may be used in screening for molecules which affect or modulate TTK activity or function. Such molecules may be useful in a therapeutic and/or prophylactic context. Means for screening for substances potentially useful in treating or preventing cancer is provided by the present invention. In general, the methods of the invention are to facilitate identification of modulators of TTK activity (e.g., by modulating activity of TTK polypeptide or other TTK gene product, or by affecting TTK activity by targeting activity of gene products that act either upstream or downstream of TTK in a cascade that leads to TTK activity), with agents that decrease TTK activity generally being of particular interest. Substances identified as modulators of the TTK activity represent an advance in the fight against cancer since they provide basis for design and investigation of pharmaceuticals for in vivo use.
- A method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide (e.g., the ability to phosphorylate its substrate) and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.
- Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide. Such libraries and their use are known in the art. The use of peptide libraries is preferred. Test substances may also be screened for ability to interact with the polypeptide, e.g., in a yeast two-hybrid system. This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide. Alternatively, the screen could be used to screen test substances for binding to a TTK specific binding partner.
- A substance identified using as a modulator of TTK polypeptide function may be peptide or non-peptide in nature. Non-peptide “small molecules” are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
- TTK activity assays
- The activity of the TTK may be measured using any suitable kinase assay known in the art. For example, and not by way of limitation, the methods described in Hogg et al (Oncogene 1994 9:98-96), Mills et al (J. Biol. Chem. 1992 267:16000-006) and Tomizawa et al 2001 (FEBS Lett. 2001 492: 221-7), Schmandt et al, (J. Immunol. 1994, 152:96-105) may be used. Further serine, threonine and tyrosine kinase assays are described in Ausubel et al. (Short Protocols in Molecular Biology, 1999, unit 17.6).
- TTK assays generally use TTK polypeptide, a labeled donor substrate, and a receptor substrate that is either specific or non-specific for TTK. In such assays TTK transfers a labeled moiety from the donor substrate to the receptor substrate, and kinase activity is measured by the amount of labeled moiety transferred from the donor substrate to the receptor substrate.
- TTK polypeptide may be produced using various expression systems as detailed above, may be purified from cells, may be in the form of a cleaved or uncleaved recombinant fusion protein and may have non-TTK polypeptide sequences, for example a His tag or β-galactosidase at its N- or C-terminus. TTK activity may be assayed in cancerous cells lines if the cancerous cell lines are used as a source of the TTK to be assayed. Suitable donor substrates for TTK assays include any molecule that is susceptible to dephosphorylation by TTK include γ-labeled ATP and ATP analogs, wherein the label is 33P, 32P, 35S or any other radioactive isotope or a suitable fluorescent marker. Suitable recipient substrates for TTK assays include any polypeptide or other molecule that is susceptible to phosphorylation by TTK. Recipient substrates are usually derived from fragments of in vivo targets of TTK. Recipient substrates fragments may be 8 to 50 amino acids in length, usually 10 to 30 amino acids and preferably of about 10, 12, 15, 18, 20 and 25 amino acids in length Further recipient substrates can be determined empirically using a set of different polypeptides or other molecules. Targets of TTK suitable for TTK assays include tau and cdc25. Recipient substrates for TTK are typically capable of being purified from other components of the reaction once the reaction has been performed. This purification is usually done through a molecular interaction, where the recipient substrates is biotinylated and purified through its interaction with streptavidin, or a specific antibody is available that can specifically recognize the recipient substrates. The reaction can be performed in a variety of conditions, such as on a solid support, in a gel, in solution or in living cells.
- One exemplary recipient substrate for TTK phosphorylation is the human protein cdc25, SEQ ID NO:26, which is phosphorylated by TTK at the serine residues of amino acid position 214 and 216. Two fragments of cdc25 are used as substrates in the kinase assay described below. These fragments comprise peptides A (SEQ ID NO:27), corresponding to amino acids 209 to 225 of the cdc25 polypeptide sequence or peptide B (SEQ ID NO:28), corresponds to amino acids 210 to 223 of the cdc25 polypeptide. In this assay, two biotinylated polypeptides of comprising either SEQ ID NO:27 (Biotin-SGSGSGLYRSPSMPENLNRPR-NH2) or SEQ ID NO:28 (Biotin-GGGGLYRSPSMPENLNRK-OH) are used.
- The choice of detection methods depends on type of label used for the donor molecule and may include, for example, measurement of incorporated radiation or fluorescence by autoradiography, scintillation, scanning or fluorography.
- Methods of Inhibiting Tumor Growth and Other Treatment Goals
- The invention further provides methods for reducing growth of cancer cells, particular breast or colon cancer cells. In general, the methods comprise contacting a cancer cell that expresses TTK at an aberrant level relative to normal cells with a substance that (1) modulates, generally decreases, expression of TTK (e.g., a antisense polynucleotide corresponding to TTK); or (2) otherwise modulates, generally decreases, TTK polypeptide levels and/or TTK activity in a cancerous cell having aberrant TTK activity.
- “Reducing growth of a cancer cell” includes, but is not limited to, reducing proliferation of cancer cells, and reducing the incidence of a normal cell from developing a cancerous phenotype or morphology. Whether a reduction in cancer cell growth has been achieved can be readily determined using any known assay, including, but not limited to, [ 3H]-thymidine incorporation; counting cell number over a period of time; detecting, measuring a marker associated with colon cancer (e.g., CEA, CA19-9, and LASA), and/or methods well known in the art for assessing tumor burden.
- The present invention provides methods for treating cancer (particularly breast and colon cancer or other cancer that is associated with aberrantly high TTK activity) which methods generally comprise administering to an individual an agent that reduces TTK activity in an amount sufficient to reduce cancer cell growth to treat the cancer. Whether a substance, or a specific amount of the substance, is effective in treating cancer can be assessed using any of a variety of known diagnostic assays, e.g. in the case of colon cancer, sigmoidoscopy, proctoscopy, rectal examination, colonoscopy with biopsy, contrast radiographic studies, CAT scans, angiography, and detection of a tumor marker associated with colon cancer in the blood of the individual. The substance can be administered systemically or locally. Thus, in some embodiments, the substance is administered locally, and colon cancer growth is decreased at the site of administration. Local administration may be useful in treating, e.g., a solid tumor.
- In one embodiment, the invention features polynucleotides that act as antisense polynucleotides and decrease TTK activity. Antisense TTK polynucleotides generally comprise a polynucleotide of at least about 20 to 3000 nucleotides, usually at least about 20 to 1000 nucleotides and more usually at least about 8 to 50 nucleotides, and preferably about 26, 20, 18, 17, 15, 10 and 8 nucleotides. Exemplary TTK polynucleotides are provided in the Examples and in SEQ ID NO:1-12, although any antisense fragment of SEQ ID NO:13 will suffice.
- The therapeutic regimen is selected according to the expression profile. For example, if a patient's tumor indicates that the tumor produces aberrantly high level of TTK relative to normal cells, then a drug having efficacy in the treatment of such TTK-expressing tumors is selected for therapy of that patient.
- Pharmaceutical Compositions
- Pharmaceutical compositions of the invention can comprise a therapeutically effective amount of a polypeptide, antibody, polynucleotide (including antisense nucleotides and ribozymes), or small molecule or other compound identified as modulating activity of TTK, preferably decreasing TTK activity. The term “therapeutically effective amount” as used herein refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels. Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature, and/or in the effect upon tumor load in the subject (e.g., decrease in tumor size or inhibition in tumor growth). The precise effective amount for a subject will depend upon the subject's size and health, the nature and extent of the condition, and the therapeutics or combination of therapeutics selected for administration. Thus, it is not useful to specify an exact effective amount in advance. However, the effective amount for a given situation is determined by routine experimentation and is within the judgment of the clinician. For purposes of the present invention, an effective dose will generally be from about 0.01 mg/ kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA constructs in the individual to which it is administered.
- A pharmaceutical composition can also contain a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent, such as antibodies or a polypeptide, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which can be administered without undue toxicity. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in therapeutic compositions can include liquids such as water, saline, glycerol and ethanol. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, can also be present in such vehicles. Typically, the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. Liposomes are included within the definition of a pharmaceutically acceptable carrier. Pharmaceutically acceptable salts can also be present in the pharmaceutical composition, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington 's Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991). The precise nature of the carrier or other material may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
- Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
- For intravenous, cutaneous or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is has suitable pH, isotonicity and stability. Suitable solutions, for example, optionally include but are not limited to isotonic vehicles such as sodium chloride, preservatives, stabilizers, buffers, antioxidants and/or other additives as required.
- Administration of the pharmaceutical is administered in a prophylactically effective amount or a therapeutically effective amount. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Decisions on dosage etc, can be determined by one skilled in the art based upon the disclosed methods, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.
- Alternatively, targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells. Targeting can be accomplished by, for example, administering a drug-antibody complex to a subject, wherein the antibody is specific for a cancer-associated antigen, and the drug is one that reduces cancer cell growth. Targeting can be accomplished by coupling (e.g., linking, directly or via a linker molecule, either covalently or non-covalently, so as to form a drug-antibody complex) a drug to an antibody specific for a cancer-associated antigen. Methods of coupling a drug to an antibody are well known in the art and need not be elaborated upon herein.
- Pharmaceutical agents can also be produced in the target cells by expression from an encoding gene introduced into the cells, e.g., in a viral or liposomal vector. The vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
- Alternatively, the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated. A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
- Delivery Methods for Therapy
- Once formulated, the compositions of the invention or identified using the methods of the invention can be administered directly to the subject (e.g., as polynucleotide or polypeptides). Direct delivery of the compositions will generally be accomplished by parenteral injection, e.g., subcutaneously, intraperitoneally, intravenously or intramuscularly, intratumoral or to the interstitial space of a tissue. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications, needles, and gene guns or hyposprays. Dosage treatment can be a single dose schedule or a multiple dose schedule.
- Once a gene corresponding to a polynucleotide of the invention has been found to correlate with a proliferative disorder, such as neoplasia, dysplasia, and hyperplasia, the disorder can be amenable to treatment by administration of a therapeutic agent based on the provided polynucleotide, corresponding polypeptide or other corresponding molecule (e.g., antisense, ribozyme, etc.).
- The dose and the means of administration are determined based on the specific qualities of the therapeutic composition, the condition, age, and weight of the patient, the progression of the disease, and other relevant factors. For example, administration of polynucleotide therapeutic compositions agents of the invention includes local or systemic administration, including injection, oral administration, particle gun or catheterized administration, and topical administration. Preferably, the therapeutic polynucleotide composition contains an expression construct comprising a promoter operably linked to a polynucleotide of at least 12, 15, 17, 18, 22, 25, 30, or 35 contiguous-nucleotides of the polynucleotide disclosed herein. Various methods can be used to administer the therapeutic composition directly to a specific site in the body. For example, a small metastatic lesion is located and the therapeutic composition injected several times in several different locations within the body of tumor. Alternatively, arteries which serve a tumor are identified, and the therapeutic composition injected into such an artery, in order to deliver the composition directly into the tumor. A tumor that has a necrotic center is aspirated and the composition injected directly into the now empty center of the tumor. The antisense composition is directly administered to the surface of the tumor, for example, by topical application of the composition. X-ray imaging is used to assist in certain of the above delivery methods.
- Receptor-mediated targeted delivery of therapeutic compositions containing an antisense polynucleotide, subgenomic polynucleotides, or antibodies to specific tissues can also be used. Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. (USA) (1990) 87:3655; Wu et al., J. Biol. Chem. (1991) 266:338. Therapeutic compositions containing a polynucleotide are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA can also be used during a gene therapy protocol. Factors such as method of action (e.g., for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations which will affect the dosage required for ultimate efficacy of the antisense subgenomic polynucleotides. Where greater expression is desired over a larger area of tissue, larger amounts of antisense subgenomic polynucleotides or the same amounts readministered in a successive protocol of administrations, or several administrations to different adjacent or close tissue portions of, for example, a tumor site, may be required to effect a positive therapeutic outcome. In all cases, routine experimentation in clinical trials will determine specific ranges for optimal therapeutic effect. For polynucleotide related genes encoding polypeptides or proteins with anti-inflammatory activity, suitable use, doses, and administration are described in U.S. Pat. No. 5,654,173.
- The therapeutic polynucleotides and polypeptides of the present invention can be delivered using gene delivery vehicles. The gene delivery vehicle can be of viral or non-viral origin (see generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995) 1:185; and Kaplitt, Nature Genetics (1994) 6:148). Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or regulated.
- Viral-based vectors for delivery of a desired polynucleotide and expression in a desired cell are well known in the art. Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5, 219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No. 2,200,651;
EP 0 345 242; and WO 91/02805), alphavirus-based vectors (e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655). Administration of DNA linked to killed adenovirus as described in Curiel, Hum. Gene Ther. (1992) 3:147 can also be employed. - Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone (see, e.g., Curiel, Hum. Gene Ther. (1992) 3:147); ligand-linked DNA(see, e.g., Wu, J. Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed. Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Pat. No. 5,580,859. Liposomes that can act as gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO 95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional approaches are described in Philip, Mol. Cell Biol. (1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.
- Further non-viral delivery suitable for use includes mechanical delivery systems such as the approach described in Woffendin et al., Proc. Natl. Acad. Sci. USA (1994) 91(24): 11581. Moreover, the coding sequence and the product of expression of such can be delivered through deposition of photopolymerized hydrogel materials or use of ionizing radiation (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033). Other conventional methods for gene delivery that can be used for delivery of the coding sequence include, for example, use of hand-held gene transfer particle gun (see, e.g., U.S. Pat. No. 5,149,655); use of ionizing radiation for activating transferred gene (see, e.g., U.S. Pat. No. 5,206,152 and WO 92/11033).
- As an alternative to the use of viral vectors other known methods of introducing nucleic acid into cells includes electroporation, calcium phosphate co-precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer. Gene transfer techniques which selectively target the TTK nucleic acid to the affected cell type are preferred. Examples of this included receptor-mediated gene transfer, in which the nucleic acid is linked to a protein ligand via polylysine, with the ligand being specific for a receptor present on the surface of the target cells.
- Screening for Substances Affecting TTK Expression
- The present invention also provides the use of all or part of the nucleic acid sequence of the TTK promoter and/or enhancer regions in methods of screening for substances which modulate the activity of the promoter and increase or decrease the level of TTK expression. This assay can be performed to identify anti-cancer agents for therapeutic and/or prophylactic purposes. The level of promoter activity, i.e., the ability to initiate transcription, is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter. The amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridize with the mRNA and which are labeled or may be used in a specific amplification reaction such as PCR. Use of a reporter gene facilitates determination of promoter activity by reference to protein production.
- Generally, a reporter gene under control of the TTK promoter and/or enhancers may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression. The reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product. Many examples are known, including β-galactosidase and luciferase. β-galactosidase activity may be assayed by production of blue color on substrate, the assay being by eye or by use of a spectrophotometer to measure absorbance. Fluorescence, for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer. Radioactive assays may be used, for instance using choloramphenicol acetyltransferase, which may also be used in non-radioactive assays. The presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof. The binding molecule may be labeled directly or indirectly using any standard technique.
- Those skilled in the art are well aware of a multitude of possible reporter genes and assay techniques which may be used to determine gene activity according to the presently disclosed methods. Any suitable reporter/assay may be used and the present invention is intended to encompass such systems.
- Following identification of a substance which modulates or affects promoter activity, the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug.
- Integrated Disease Information System
- The levels of TTK in a sample can be used in an integrated disease information system to aid in analysis such as proposed patient interventions, designing clinical trials, performing pharmacoeconomic analysis, and illustrating disease progression for various patients over time. For example, TTK information determined according to the methods of the invention can be used in a system such as that described in U.S. Pat. No. 6,108,635 issued to Herren, et al. on Aug. 22, 2000. Such a system can be for collecting the results of medical treatments given to patients in a plurality of locations. See, e.g., U.S. Pat. No. 5,713,350 issued to Yokota, et al. on Feb. 3, 1998.
- The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
- Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al (1998) Trends Genet 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:998-1001). Table 1 (inserted following the last page of the Examples ) provides information about each patient from which the samples were isolated, including: the Patient ID and Path ReportID, numbers assigned to the patient and the pathology reports for identification purposes; the anatomical location of the tumor (AnatomicalLoc); The Primary Tumor Size; the Primary Tumor Grade; the Histopathologic Grade; a description of local sites to which the tumor had invaded (Local Invasion); the presence of lymph node metastases (Lymph Node Metastasis); incidence of lymph node metastases (provided as number of lymph nodes positive for metastasis over the number of lymph nodes examined) (Incidence Lymphnode Metastasis); the Regional Lymphnode Grade; the identification or detection of metastases to sites distant to the tumor and their location (Distant Met & Loc);a description of the distant metastases (Description Distant Met); the grade of distant metastasis (Distant Met Grade); and general comments about the patient or the tumor (Comments). Adenoma was not described in any of the patients; adenoma dysplasia (described as hyperplasia by the pathologist) was described in Patient ID No. 695. Extranodal extensions were described in two patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in seven patients, Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.
- cDNA probes were prepared from total RNA isolated from the patient cells described in Example 1. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.
- Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling. Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red).
- Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array. Spotting was accomplished using PCR amplified products from 0.5 kb to 2.0 kb and spotted using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1 . For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about 4 duplicate measurements for each clone, two of one color and two of the other, for each sample.
- The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.
- The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.
- The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.
- A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10 −3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).
- The difference in the expression level of TTK in the colon tumor cells relative to the matched normal colon cells was greater than or equal to 2 fold (“>=2×”) in 39% of the patients, greater than or equal to 2.5 fold in 36% of the patients, and greater than or equal to 5 fold in 27% of the patients examined.
- Quantitative PCR of a number of normal tissues and tumor cell lines, particularly colorectal carcinoma cell lines was used to analyze expression of TTK. Quantitative real-time PCR was performed by first isolating RNA from cells using a Roche RNA Isolation kit according to manufacturer's directions. One microgram of RNA was used to synthesize a first-strand cDNA using MMLV reverse transcriptase (Ambion) using the manufacturers buffer and recommended concentrations of oligo dT, nucleotides, and Rnasin. This first-strand cDNA served as a template for quantitative real-time PCR using the Roche light-cycler as recommended in the machine manual. TTK was amplified with the forward primer CGGAATCAAGTCTTCTAGCT (SEQ ID NO: 1) and reverse primer GGTTGCTCAAAAGTTGGTATG (SEQ ID NO:2) PCR product was quantified based on the cycle at which the amplification entered the linear phase of amplification in comparison to an internal standard and using the software supplied by the manufacturer. Small differences in amounts or total template in the first-strand cDNA reaction were eliminated by normalizing to amount of actin amplified in a separate quantitative PCR reaction using the forward primer 5′-CGGGAAATCGTGCGTGACATTAAG-3′ (SEQ ID NO:3) and the reverse primer: 5′-TGATCTCCTTCTGCATCCTGTCGG-3′ (SEQ ID NO:4). The results for TTK mRNA levels in normal tissues are shown in FIG. 1; the results for TTK mRNA levels in tumor cell lines are shown in FIG. 2. A brief description of the cell lines analyzed is provided in the table below.
Cell Line Tissue Source Cell Line Tissue Source MDA-MB-231 Human breast; high Caco-2 Human colorectal metastatic potential adenocarcinoma (micromets in lung; adenocarcinoma; pleural effusion MDA-MB-435 Human breast, high SW620 Human colorectal metastatic potential adenocarcinoma; (macrometastases in from metastatic lung) site (lymph node) MCF-7 Human breast; non- LS174T High metastatic metastatic potential human colorectal adenocarcinoma MDA-MB-468 Human breast; LOVO Human colorectal adenocarcinoma adenocarcinoma; colon; from metastatic site (colon) Alab Human breast, HT29 Human colorectal metastatic adenocarcinoma; colon SKOV3 Human ovarian SW480 Human colorectal adenocarcinoma adenocarcinoma; colon OVCAR3 Human ovarian HCT116 Human colorectal adenocarcinoma carcinoma; colon KM12C Human colon; low Colo 320DN Human colorectal metastatic potential adenocarcinoma; colon KM12L4 Human colon; high T84 Human colorectal metastatic potential carcinoma; colon; (derived from from metastatic site Km12C) (lung) DU 145 Human prostate; HCT15 Human colorectal carcinoma; from adenocarcinoma; metastatic site: brain colon HT1080 Human sarcoma cell CCD112 Human colorectal line; adenocarcinoma, low metastatic potential HMVEC Primary human DLD1 Human colon; microvascular colorectal endothelial cells adenocarcinoma 184B5 normal breast 293 kidney epithelial epithelial cells; cells chemically trans- formed LNCAP prostate carcinoma; GRDP2 primary prostate metastasis to left epithelium supraclavicular lymph U373MG glioblastoma cell IMR90 primary lung fibroblast WOCA primary prostate PC3 prostate cancer; epithelium androgen receptor negative - TTK was expressed in normal cells (FIG. 1), with thymus and testis identified as the normal tissues that most highly expressed the gene for TTK. Numerous cancer cells, however, displayed a significantly elevated level of TTK expression (FIG. 2) as compared to most wild-type tissues.
- Differential expression patterns from Example 2 were analyzed by applying hierarchical clustering methods to the data sets (see Eisen et al. (1998) PNAS 95:14863-14868). In short, hierarchical clustering algorithms are based on the average-linkage method of Sokal and Michener (Sokal, R R & Michener, C D (1958) Univ. Kans. Sci. Bull. 38, 1409-1438), which was developed for clustering correlation matrixes. The object of this algorithm is to compute a dendrogram that assembles all elements into a single tree. For any set of n genes, an upper-diagonal similarity matrix is computed which contains similarity scores for all pairs of genes. The matrix is scanned to identify the highest value (representing a similar pair of genes). Using this technique, four groups of differential expression patterns were identified and assigned to clusters.
- Application of hierarchical clustering to the data from Example 2 revealed that IGF2 (insulin-like growth factor 2), TTK (serine, threonine, tyrosine kinase implicated in the cell cycle), MAPKAPK2 (mitogen-activated protein (MAP) kinase-activated protein kinase), and MARCKS (myristoylated alanine-rich C kinase substrate, which is a substrate of protein kinase C) are concurrently upregulated as detected in 9 out of the 33 colon cancer patient samples examined. The data for these experiments is presented in graphical form in FIGS. 3-6. The concurrent upregulation suggests that these genes are co-regulated and that patients with an elevated serum level of IGF2 may be candidates for treatment with inhibitors to TTK,
MAPKAP kinase 2, MARCKS and/or IGF2. - Additional functional information on TTK was generated using antisense knockout technology. TTK expression in cancerous cells was further analyzed to confirm the role and function of the gene product in tumorgenesis, e.g., in promoting a metastatic phenotype.
- A number of different oligonucleotides complementary to TTK mRNA were designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of TTK. The ability of each designed antisense oligonucleotide to inhibit gene expression was tested through transfection into SW620 colon colorectal carcinoma cells. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol lipitoid/pg antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM.
- The level of target mRNA (TTK) in the transfected cells was quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA were normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H 2O, 2.0 μl 10×reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.
- An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl 2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10×concentration from Perkin-Elmer, Norwalk, Conn.). In 1×concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.
- The following antisense oligonucleotides were shown to effectively deplete TTK RNA in the transfection assays:
- Oligo 79-5AS: GGGACTCTTCCAAATGGGCATGACT (SEQ ID NO:5)
- Oligo 79-9AS: TCCAGTAACTCTTGCGTTCCCATGG (SEQ ID NO:6)
- The reverse control of each of these antisense oligonucleotides were synthesized, as were oligonucleotides with the identical sequence of the antisense oligonucleotides in reverse orientation (Reverse Control):
- Oligo 79-5RC: TCAGTACGGGTAAACCTTCTCAGGG (SEQ ID NO:7)
- Oligo 79-9RC: GGTACCCTTGCGTTCTCAATGACCT (SEQ ID NO:8)
- The antisense oligonucleotides were introduced into a test cell and the effect upon TTK expression of the corresponding gene, as well as the effect induction of the cancerous phenotype, was examined as described below.
- The effect of TTK on proliferation was assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)), SW620 colon colorectal carcinoma cells, or 847 human immortal fibroblast cells. Transfection was carried out as described above in Example 4.
- Cells were plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide was diluted to 2 μM in OptiMEM™ and added to OptiMEM™ into which the delivery vehicle, lipitoid 116-6 in the case of SW620 cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231 cells, had been diluted. The oligo/ delivery vehicle mixture was then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/μg oligonucleotide. Cells were transfected overnight at 37° C. and the transfection mixture was replaced with fresh medium the next morning.
- Transfection of the antisense oligonucleotides into both SW620 colorectal carcinoma cells (FIG. 7) and 231 cells (FIG. 8) resulted in a decreased rate of proliferation compared to matched reverse control (RC) and oligonucleotides, but no inhibition of growth of 847 human immortal fibroblast cells (FIG. 11), suggesting possible tissue or transformation specificity in the functional role for the TTK protein.
- The effect of TTK expression upon colony formation was tested in a soft agar assay. Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies are formed in 10 days to 3 weeks. Fields of colonies were counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.
- As shown in FIG. 9, antisense oligonucleotides to TTK (79-9AS) led to decreased colony size and number compared to control reverse control oligonucleotides (79-9RC) or to control oligonucleotides (52-3AS: TAGGTCTTTGGCCGGTGATGGGTCG (SEQ ID NO:9) and 52-3RC: GCTGGGTAGTGGCCGGTTTCTGGAT (SEQ ID NO:10)). The 52-3 antisense oligonucleotide is directed to the hD53 mRNA, and serves as a negative control in the experiment.
- SW620 cells were transfected as described for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol was followed but cells were left in the presence of 2 μM drug. Each day, cytotoxicity was monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH was measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) shows that loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).
- The following antisense oligonucleotides were tested for the ability to deplete the message levels of the gene corresponding to the indicated cluster. Oligo Name: AS or RC provides the name of the target gene or name of the oligo, and whether the oligo is antisense (AS) or a reverse control (RC).
Oligo Name: Antisense (AS) or Reverse Control (RC) Oligo Sequence SEQ ID NO: Chir39-5:AS ACTCATCTGGCTGGGCTATGGTGGT SEQ ID NO:11 Chir39-5:RC TGGTGGTATCGGGTCGGTCTACTCA SEQ ID NO:12 Chir79-9:AS TCCAGTAACTCTTGCGTTCCCATGG SEQ ID NO:6 Chir79-9:RC GGTACCCTTGCGTTCTCAATGACCT SEQ ID NO:8 - As shown in FIG. 12, Chiron 79-9 (TTK) antisense does not sensitize the cells to treatment by cisplatin at a detectable level, but leads to increased death compared to control oligo at
day 3. - This assay may be performed in microtitre plates. TTK was purified as a 6×IIis tagged fusion protein using a baculovirus expression system. Essentially 20 ul of 20 nM TTK (100 k Da) in TTK kinase buffer comprising 50 mM Hepes pH 7.4, 2mM MgCl 2, 10 mM MnCl2, 1 mM NaF, 50 mM NaCl, 1 mM DTT and 1 mg/ml BSA was added to 5 ul of a candidate agent diluted in 20% DMSO, 10 ul of a 2.8 uM solution of a biotinylated substrate peptide derived from cdc25, such as Biotin-SGSGSGLYRSPSMPENLNRPR-NH2 (SEQ ID NO:27) or Biotin-GGGGLYRSPSMPENLNRK-OH (SEQ ID NO:28) and 5 ul of 80 nM 33P-γATP in a well of a microtitre plate. Samples were mixed, incubated for 2 hours and each reaction is terminated using 20 ul of 0.5 M EDTA pH 8.0. 50 ul of the sample is transferred to a 96 well flat bottom Streptavidin coated flash plate, and the sample is incubated with the plate for 1 hr at room temperature. The wells of the plate are washed four times with 250 ul of calcium and magnesium-free phosphate buffered saline, and scintillation fluid is added to the sample. Activity of TTK was measured by calculating the emission of 33P, transferred by TTK from 33P-γATP to a substrate peptide, by scintillation.
- Agents modulating TTK activity can be identified by comparing the activity of TTK in the presence of a candidate agent to the activity of TTK in the absence of a candidate agent.
- While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the invention.
-
0 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 38 <210> SEQ ID NO 1 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 1 cggaatcaag tcttctagct 20 <210> SEQ ID NO 2 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 2 ggttgctcaa aagttggtat g 21 <210> SEQ ID NO 3 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 3 cgggaaatcg tgcgtgacat taag 24 <210> SEQ ID NO 4 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 4 tgatctcctt ctgcatcctg tcgg 24 <210> SEQ ID NO 5 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 5 gggactcttc caaatgggca tgact 25 <210> SEQ ID NO 6 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 6 tccagtaact cttgcgttcc catgg 25 <210> SEQ ID NO 7 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 7 tcagtacggg taaaccttct caggg 25 <210> SEQ ID NO 8 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 8 ggtacccttg cgttctcaat gacct 25 <210> SEQ ID NO 9 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 9 taggtctttg gccggtgatg ggtcg 25 <210> SEQ ID NO 10 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 10 gctgggtagt ggccggtttc tggat 25 <210> SEQ ID NO 11 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 11 actcatctgg ctgggctatg gtggt 25 <210> SEQ ID NO 12 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthesized oligonucleotide <400> SEQUENCE: 12 tggtggtatc gggtcggtct actca 25 <210> SEQ ID NO 13 <211> LENGTH: 3866 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1026)...(3551) <221> NAME/KEY: misc_feature <222> LOCATION: (0)...(0) <223> OTHER INFORMATION: TTK <400> SEQUENCE: 13 ggaattcctt tttttttttt tttgagatgg agtttcactc ttgttggcca ggctggagtg 60 caatggcaca atctcagctt actgcaacct ccgcctcccg ggttcaagcg attctcctgc 120 ctcagcctct caagtagctg ggattacagg catgtgccac cacccctggc taactaattt 180 cttttctatt tagtagagat ggggtttcac catgttggtc aggctggtct tgaactcctg 240 acctcaggtg atccacttgc cttggcctcc caaagtgcta ggattacagc cgtgaaactg 300 tgcctggctg attctttttt tgttgttgga tttttgaaac agggtctccc ttggtcgccc 360 aggctggagt gcagtggtgc gatcttggct cactataacc tccacctcct ggtttcaagt 420 gatcctccca ctttagcctc ctgagtagct gtgattacag gcgtgcacca ccacacccgg 480 ctaatttttg tatttttatt agagacaggg tttcaccatg ttggccaggc tgttctcaaa 540 ctcctggact caagggatcc gcctgcctcc acttcccaaa gtcccgagat tacaggtgtg 600 agtcaccatg cctgacctta taattcttaa gtcatttttt ctggtccatt tcttccttag 660 ggtcctcaca acaaatctgc attaggcggt acaataatcc ttaacttcat gattcacaaa 720 aggaagatga agtgattcat gatttagaaa ggggaagtag taagcccact gcacactcct 780 ggatgatgat cctaaatcca gatacagtaa aaatggggta tgggaaggta gaatacaaaa 840 tttggtttaa attaattatc taaatatcta aaaacatttt tggatacatt gttgatgtga 900 atgtaagact gtacagactt cctagaaaac agtttgggtt ccatcttttc atttccccag 960 tgcagttttc tgtagaaatg gaatccgagg atttaagtgg cagagaattg acaattgatt 1020 ccata atg aac aaa gtg aga gac att aaa aat aag ttt aaa aat gaa gac 1070 Met Asn Lys Val Arg Asp Ile Lys Asn Lys Phe Lys Asn Glu Asp 1 5 10 15 ctt act gat gaa cta agc ttg aat aaa att tct gct gat act aca gat 1118 Leu Thr Asp Glu Leu Ser Leu Asn Lys Ile Ser Ala Asp Thr Thr Asp 20 25 30 aac tcg gga act gtt aac caa att atg atg atg gca aac aac cca gag 1166 Asn Ser Gly Thr Val Asn Gln Ile Met Met Met Ala Asn Asn Pro Glu 35 40 45 gac tgg ttg agt ttg ttg ctc aaa cta gag aaa aac agt gtt ccg cta 1214 Asp Trp Leu Ser Leu Leu Leu Lys Leu Glu Lys Asn Ser Val Pro Leu 50 55 60 agt gat gct ctt tta aat aaa ttg att ggt cgt tac agt caa gca att 1262 Ser Asp Ala Leu Leu Asn Lys Leu Ile Gly Arg Tyr Ser Gln Ala Ile 65 70 75 gaa gcg ctt ccc cca gat aaa tat ggc caa aat gag agt ttt gct aga 1310 Glu Ala Leu Pro Pro Asp Lys Tyr Gly Gln Asn Glu Ser Phe Ala Arg 80 85 90 95 att caa gtg aga ttt gct gaa tta aaa gct att caa gag cca gat gat 1358 Ile Gln Val Arg Phe Ala Glu Leu Lys Ala Ile Gln Glu Pro Asp Asp 100 105 110 gca cgt gac tac ttt caa atg gcc aga gca aac tgc aag aaa ttt gct 1406 Ala Arg Asp Tyr Phe Gln Met Ala Arg Ala Asn Cys Lys Lys Phe Ala 115 120 125 ttt gtt cat ata tct ttt gca caa ttt gaa ctg tca caa ggt aat gtc 1454 Phe Val His Ile Ser Phe Ala Gln Phe Glu Leu Ser Gln Gly Asn Val 130 135 140 aaa aaa agt aaa caa ctt ctt caa aaa gct gta gaa cgt gga gca gta 1502 Lys Lys Ser Lys Gln Leu Leu Gln Lys Ala Val Glu Arg Gly Ala Val 145 150 155 cca cta gaa atg ctg gaa att gcc ctg cgg aat tta aac ctc caa aaa 1550 Pro Leu Glu Met Leu Glu Ile Ala Leu Arg Asn Leu Asn Leu Gln Lys 160 165 170 175 aag cag ctg ctt tca gag gag gaa aag aag aat tta tca gca tct acg 1598 Lys Gln Leu Leu Ser Glu Glu Glu Lys Lys Asn Leu Ser Ala Ser Thr 180 185 190 gta tta act gcc caa gaa tca ttt tcc ggt tca ctt ggg cat tta cag 1646 Val Leu Thr Ala Gln Glu Ser Phe Ser Gly Ser Leu Gly His Leu Gln 195 200 205 aat agg aac aac agt tgt gat tcc aga gga cag act act aaa gcc agg 1694 Asn Arg Asn Asn Ser Cys Asp Ser Arg Gly Gln Thr Thr Lys Ala Arg 210 215 220 ttt tta tat gga gag aac atg cca cca caa gat gca gaa ata ggt tac 1742 Phe Leu Tyr Gly Glu Asn Met Pro Pro Gln Asp Ala Glu Ile Gly Tyr 225 230 235 cgg aat tca ttg aga caa act aac aaa act aaa cag tca tgc cca ttt 1790 Arg Asn Ser Leu Arg Gln Thr Asn Lys Thr Lys Gln Ser Cys Pro Phe 240 245 250 255 gga aga gtc cca gtt aac ctt cta aat agc cca gat tgt gat gtg aag 1838 Gly Arg Val Pro Val Asn Leu Leu Asn Ser Pro Asp Cys Asp Val Lys 260 265 270 aca gat gat tca gtt gta cct tgt ttt atg aaa aga caa acc tct aga 1886 Thr Asp Asp Ser Val Val Pro Cys Phe Met Lys Arg Gln Thr Ser Arg 275 280 285 tca gaa tgc cga gat ttg gtt gtg cct gga tct aaa cca agt gga aat 1934 Ser Glu Cys Arg Asp Leu Val Val Pro Gly Ser Lys Pro Ser Gly Asn 290 295 300 gat tcc tgt gaa tta aga aat tta aag tct gtt caa aat agt cat ttc 1982 Asp Ser Cys Glu Leu Arg Asn Leu Lys Ser Val Gln Asn Ser His Phe 305 310 315 aag gaa cct ctg gtg tca gat gaa aag agt tct gaa ctt att att act 2030 Lys Glu Pro Leu Val Ser Asp Glu Lys Ser Ser Glu Leu Ile Ile Thr 320 325 330 335 gat tca ata acc ctg aag aat aaa acg gaa tca agt ctt cta gct aaa 2078 Asp Ser Ile Thr Leu Lys Asn Lys Thr Glu Ser Ser Leu Leu Ala Lys 340 345 350 tta gaa gaa act aaa gag tat caa gaa cca gag gtt cca gag agt aac 2126 Leu Glu Glu Thr Lys Glu Tyr Gln Glu Pro Glu Val Pro Glu Ser Asn 355 360 365 cag aaa cag tgg caa gct aag aga aag tca gag tgt att aac cag aat 2174 Gln Lys Gln Trp Gln Ala Lys Arg Lys Ser Glu Cys Ile Asn Gln Asn 370 375 380 cct gct gca tct tca aat cac tgg cag att ccg gag tta gcc cga aaa 2222 Pro Ala Ala Ser Ser Asn His Trp Gln Ile Pro Glu Leu Ala Arg Lys 385 390 395 gtt aat aca gag cag aaa cat acc act ttt gag caa cct gtc ttt tca 2270 Val Asn Thr Glu Gln Lys His Thr Thr Phe Glu Gln Pro Val Phe Ser 400 405 410 415 gtt tca aaa cag tca cca cca ata tca aca tct aaa tgg ttt gac cca 2318 Val Ser Lys Gln Ser Pro Pro Ile Ser Thr Ser Lys Trp Phe Asp Pro 420 425 430 aaa tct att tgt aag aca cca agc agc aat acc ttg gat gat tac atg 2366 Lys Ser Ile Cys Lys Thr Pro Ser Ser Asn Thr Leu Asp Asp Tyr Met 435 440 445 agc tgt ttt aga act cca gtt gta aag aat gac ttt cca cct gct tgt 2414 Ser Cys Phe Arg Thr Pro Val Val Lys Asn Asp Phe Pro Pro Ala Cys 450 455 460 cag ttg tca aca cct tat ggc caa cct gcc tgt ttc cag cag caa cag 2462 Gln Leu Ser Thr Pro Tyr Gly Gln Pro Ala Cys Phe Gln Gln Gln Gln 465 470 475 cat caa ata ctt gcc act cca ctt caa aat tta cag gtt tta gca tct 2510 His Gln Ile Leu Ala Thr Pro Leu Gln Asn Leu Gln Val Leu Ala Ser 480 485 490 495 tct tca gca aat gaa tgc att tcg gtt aaa gga aga att tat tcc ata 2558 Ser Ser Ala Asn Glu Cys Ile Ser Val Lys Gly Arg Ile Tyr Ser Ile 500 505 510 tta aag cag ata gga agt gga ggt tca agc aag gta ttt cag gtg tta 2606 Leu Lys Gln Ile Gly Ser Gly Gly Ser Ser Lys Val Phe Gln Val Leu 515 520 525 aat gaa aag aaa cag ata tat gct ata aaa tat gtg aac tta gaa gaa 2654 Asn Glu Lys Lys Gln Ile Tyr Ala Ile Lys Tyr Val Asn Leu Glu Glu 530 535 540 gca gat aac caa act ctt gat agt tac cgg aac gaa ata gct tat ttg 2702 Ala Asp Asn Gln Thr Leu Asp Ser Tyr Arg Asn Glu Ile Ala Tyr Leu 545 550 555 aat aaa cta caa caa cac agt gat aag atc atc cga ctt tat gat tat 2750 Asn Lys Leu Gln Gln His Ser Asp Lys Ile Ile Arg Leu Tyr Asp Tyr 560 565 570 575 gaa atc acg gac cag tac atc tac atg gta atg gag tgt gga aat att 2798 Glu Ile Thr Asp Gln Tyr Ile Tyr Met Val Met Glu Cys Gly Asn Ile 580 585 590 gat ctt aat agt tgg ctt aaa aag aaa aaa tcc att gat cca tgg gaa 2846 Asp Leu Asn Ser Trp Leu Lys Lys Lys Lys Ser Ile Asp Pro Trp Glu 595 600 605 cgc aag agt tac tgg aaa aat atg tta gag gca gtt cac aca atc cat 2894 Arg Lys Ser Tyr Trp Lys Asn Met Leu Glu Ala Val His Thr Ile His 610 615 620 caa cat ggc att gtt cac agt gat ctt aaa cca gct aac ttt ctg ata 2942 Gln His Gly Ile Val His Ser Asp Leu Lys Pro Ala Asn Phe Leu Ile 625 630 635 gtt gat gga atg cta aag cta att gat ttt ggg att gca aac caa atg 2990 Val Asp Gly Met Leu Lys Leu Ile Asp Phe Gly Ile Ala Asn Gln Met 640 645 650 655 caa cca gat aca aca agt gtt gtt aaa gat tct cag gtt ggc aca gtt 3038 Gln Pro Asp Thr Thr Ser Val Val Lys Asp Ser Gln Val Gly Thr Val 660 665 670 aat tat atg cca cca gaa gca atc aaa gat atg tct tcc tcc aga gag 3086 Asn Tyr Met Pro Pro Glu Ala Ile Lys Asp Met Ser Ser Ser Arg Glu 675 680 685 aat ggg aaa tct aag tca aag ata agc ccc aaa agt gat gtt tgg tcc 3134 Asn Gly Lys Ser Lys Ser Lys Ile Ser Pro Lys Ser Asp Val Trp Ser 690 695 700 tta gga tgt att ttg tac tat atg act tac ggg aaa aca cca ttt cag 3182 Leu Gly Cys Ile Leu Tyr Tyr Met Thr Tyr Gly Lys Thr Pro Phe Gln 705 710 715 cag ata att aat cag att tct aaa tta cat gcc ata att gat cct aat 3230 Gln Ile Ile Asn Gln Ile Ser Lys Leu His Ala Ile Ile Asp Pro Asn 720 725 730 735 cat gaa att gaa ttt ccc gat att cca gag aaa gat ctt caa gat gtg 3278 His Glu Ile Glu Phe Pro Asp Ile Pro Glu Lys Asp Leu Gln Asp Val 740 745 750 tta aag tgt tgt tta aaa agg gac cca aaa cag agg ata tcc att cct 3326 Leu Lys Cys Cys Leu Lys Arg Asp Pro Lys Gln Arg Ile Ser Ile Pro 755 760 765 gag ctc ctg gct cat cca tat gtt caa att caa act cat cca gtt aac 3374 Glu Leu Leu Ala His Pro Tyr Val Gln Ile Gln Thr His Pro Val Asn 770 775 780 caa atg gcc aag gga acc act gaa gaa atg aaa tat gtt ctg ggc caa 3422 Gln Met Ala Lys Gly Thr Thr Glu Glu Met Lys Tyr Val Leu Gly Gln 785 790 795 ctt gtt ggt ctg aat tct cct aac tcc att ttg aaa gct gct aaa act 3470 Leu Val Gly Leu Asn Ser Pro Asn Ser Ile Leu Lys Ala Ala Lys Thr 800 805 810 815 tta tat gaa cac tat agt ggt ggt gaa agt cat aat tct tca tcc tcc 3518 Leu Tyr Glu His Tyr Ser Gly Gly Glu Ser His Asn Ser Ser Ser Ser 820 825 830 aag act ttt gaa aaa aaa agg gga aaa aaa tga tttgcagtta ttcgtaatgt 3571 Lys Thr Phe Glu Lys Lys Arg Gly Lys Lys * 835 840 cagataggag gtataaaata tattggactg ttatactctt gaatccctgt ggaaatctac 3631 atttgaagac aacatcactc tgaagtgtta tcagcaaaaa aaattcagtg agattatctt 3691 taaaagaaaa ctgtaaaaat agcaaccact tatggcactg tatatattgt agacttgttt 3751 tctctgtttt atgctcttgt gtaatctact tgacatcatt ttactcttgg aatagtgggt 3811 ggatagcaag tatattctaa aaaactttgt aaataaagtt ttgtggctaa aatga 3866 <210> SEQ ID NO 14 <211> LENGTH: 841 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 14 Met Asn Lys Val Arg Asp Ile Lys Asn Lys Phe Lys Asn Glu Asp Leu 1 5 10 15 Thr Asp Glu Leu Ser Leu Asn Lys Ile Ser Ala Asp Thr Thr Asp Asn 20 25 30 Ser Gly Thr Val Asn Gln Ile Met Met Met Ala Asn Asn Pro Glu Asp 35 40 45 Trp Leu Ser Leu Leu Leu Lys Leu Glu Lys Asn Ser Val Pro Leu Ser 50 55 60 Asp Ala Leu Leu Asn Lys Leu Ile Gly Arg Tyr Ser Gln Ala Ile Glu 65 70 75 80 Ala Leu Pro Pro Asp Lys Tyr Gly Gln Asn Glu Ser Phe Ala Arg Ile 85 90 95 Gln Val Arg Phe Ala Glu Leu Lys Ala Ile Gln Glu Pro Asp Asp Ala 100 105 110 Arg Asp Tyr Phe Gln Met Ala Arg Ala Asn Cys Lys Lys Phe Ala Phe 115 120 125 Val His Ile Ser Phe Ala Gln Phe Glu Leu Ser Gln Gly Asn Val Lys 130 135 140 Lys Ser Lys Gln Leu Leu Gln Lys Ala Val Glu Arg Gly Ala Val Pro 145 150 155 160 Leu Glu Met Leu Glu Ile Ala Leu Arg Asn Leu Asn Leu Gln Lys Lys 165 170 175 Gln Leu Leu Ser Glu Glu Glu Lys Lys Asn Leu Ser Ala Ser Thr Val 180 185 190 Leu Thr Ala Gln Glu Ser Phe Ser Gly Ser Leu Gly His Leu Gln Asn 195 200 205 Arg Asn Asn Ser Cys Asp Ser Arg Gly Gln Thr Thr Lys Ala Arg Phe 210 215 220 Leu Tyr Gly Glu Asn Met Pro Pro Gln Asp Ala Glu Ile Gly Tyr Arg 225 230 235 240 Asn Ser Leu Arg Gln Thr Asn Lys Thr Lys Gln Ser Cys Pro Phe Gly 245 250 255 Arg Val Pro Val Asn Leu Leu Asn Ser Pro Asp Cys Asp Val Lys Thr 260 265 270 Asp Asp Ser Val Val Pro Cys Phe Met Lys Arg Gln Thr Ser Arg Ser 275 280 285 Glu Cys Arg Asp Leu Val Val Pro Gly Ser Lys Pro Ser Gly Asn Asp 290 295 300 Ser Cys Glu Leu Arg Asn Leu Lys Ser Val Gln Asn Ser His Phe Lys 305 310 315 320 Glu Pro Leu Val Ser Asp Glu Lys Ser Ser Glu Leu Ile Ile Thr Asp 325 330 335 Ser Ile Thr Leu Lys Asn Lys Thr Glu Ser Ser Leu Leu Ala Lys Leu 340 345 350 Glu Glu Thr Lys Glu Tyr Gln Glu Pro Glu Val Pro Glu Ser Asn Gln 355 360 365 Lys Gln Trp Gln Ala Lys Arg Lys Ser Glu Cys Ile Asn Gln Asn Pro 370 375 380 Ala Ala Ser Ser Asn His Trp Gln Ile Pro Glu Leu Ala Arg Lys Val 385 390 395 400 Asn Thr Glu Gln Lys His Thr Thr Phe Glu Gln Pro Val Phe Ser Val 405 410 415 Ser Lys Gln Ser Pro Pro Ile Ser Thr Ser Lys Trp Phe Asp Pro Lys 420 425 430 Ser Ile Cys Lys Thr Pro Ser Ser Asn Thr Leu Asp Asp Tyr Met Ser 435 440 445 Cys Phe Arg Thr Pro Val Val Lys Asn Asp Phe Pro Pro Ala Cys Gln 450 455 460 Leu Ser Thr Pro Tyr Gly Gln Pro Ala Cys Phe Gln Gln Gln Gln His 465 470 475 480 Gln Ile Leu Ala Thr Pro Leu Gln Asn Leu Gln Val Leu Ala Ser Ser 485 490 495 Ser Ala Asn Glu Cys Ile Ser Val Lys Gly Arg Ile Tyr Ser Ile Leu 500 505 510 Lys Gln Ile Gly Ser Gly Gly Ser Ser Lys Val Phe Gln Val Leu Asn 515 520 525 Glu Lys Lys Gln Ile Tyr Ala Ile Lys Tyr Val Asn Leu Glu Glu Ala 530 535 540 Asp Asn Gln Thr Leu Asp Ser Tyr Arg Asn Glu Ile Ala Tyr Leu Asn 545 550 555 560 Lys Leu Gln Gln His Ser Asp Lys Ile Ile Arg Leu Tyr Asp Tyr Glu 565 570 575 Ile Thr Asp Gln Tyr Ile Tyr Met Val Met Glu Cys Gly Asn Ile Asp 580 585 590 Leu Asn Ser Trp Leu Lys Lys Lys Lys Ser Ile Asp Pro Trp Glu Arg 595 600 605 Lys Ser Tyr Trp Lys Asn Met Leu Glu Ala Val His Thr Ile His Gln 610 615 620 His Gly Ile Val His Ser Asp Leu Lys Pro Ala Asn Phe Leu Ile Val 625 630 635 640 Asp Gly Met Leu Lys Leu Ile Asp Phe Gly Ile Ala Asn Gln Met Gln 645 650 655 Pro Asp Thr Thr Ser Val Val Lys Asp Ser Gln Val Gly Thr Val Asn 660 665 670 Tyr Met Pro Pro Glu Ala Ile Lys Asp Met Ser Ser Ser Arg Glu Asn 675 680 685 Gly Lys Ser Lys Ser Lys Ile Ser Pro Lys Ser Asp Val Trp Ser Leu 690 695 700 Gly Cys Ile Leu Tyr Tyr Met Thr Tyr Gly Lys Thr Pro Phe Gln Gln 705 710 715 720 Ile Ile Asn Gln Ile Ser Lys Leu His Ala Ile Ile Asp Pro Asn His 725 730 735 Glu Ile Glu Phe Pro Asp Ile Pro Glu Lys Asp Leu Gln Asp Val Leu 740 745 750 Lys Cys Cys Leu Lys Arg Asp Pro Lys Gln Arg Ile Ser Ile Pro Glu 755 760 765 Leu Leu Ala His Pro Tyr Val Gln Ile Gln Thr His Pro Val Asn Gln 770 775 780 Met Ala Lys Gly Thr Thr Glu Glu Met Lys Tyr Val Leu Gly Gln Leu 785 790 795 800 Val Gly Leu Asn Ser Pro Asn Ser Ile Leu Lys Ala Ala Lys Thr Leu 805 810 815 Tyr Glu His Tyr Ser Gly Gly Glu Ser His Asn Ser Ser Ser Ser Lys 820 825 830 Thr Phe Glu Lys Lys Arg Gly Lys Lys 835 840 <210> SEQ ID NO 15 <211> LENGTH: 2735 <212> TYPE: DNA <213> ORGANISM: Saccharomyces cerevisiae <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (34)...(2499) <400> SEQUENCE: 15 agaaaagata gtgttacaca acatcaacta aaa atg gaa aat att aca caa ccc 54 Met Glu Asn Ile Thr Gln Pro 1 5 aca cag caa tcc acg cag gct act caa agg ttt ttg att gag aag ttt 102 Thr Gln Gln Ser Thr Gln Ala Thr Gln Arg Phe Leu Ile Glu Lys Phe 10 15 20 tct caa gaa cag atc ggc gaa aac att gtg tgc agg gtc att tgt acc 150 Ser Gln Glu Gln Ile Gly Glu Asn Ile Val Cys Arg Val Ile Cys Thr 25 30 35 acg ggt caa att ccc atc cga gat ttg tca gct gat att tca caa gtg 198 Thr Gly Gln Ile Pro Ile Arg Asp Leu Ser Ala Asp Ile Ser Gln Val 40 45 50 55 ctt aag gaa aaa cga tcc ata aag aaa gtt tgg aca ttt ggt aga aac 246 Leu Lys Glu Lys Arg Ser Ile Lys Lys Val Trp Thr Phe Gly Arg Asn 60 65 70 cca gcc tgt gac tat cat tta gga aac att tca aga ctg tca aat aag 294 Pro Ala Cys Asp Tyr His Leu Gly Asn Ile Ser Arg Leu Ser Asn Lys 75 80 85 cat ttc caa ata cta cta gga gaa gac ggt aac ctt tta ttg aat gac 342 His Phe Gln Ile Leu Leu Gly Glu Asp Gly Asn Leu Leu Leu Asn Asp 90 95 100 att tcc act aat ggg acc tgg tta aat ggg caa aaa gtc gag aag aac 390 Ile Ser Thr Asn Gly Thr Trp Leu Asn Gly Gln Lys Val Glu Lys Asn 105 110 115 agc aat cag tta ctg tct caa ggt gat gaa ata acc gtt ggt gta ggc 438 Ser Asn Gln Leu Leu Ser Gln Gly Asp Glu Ile Thr Val Gly Val Gly 120 125 130 135 gtg gaa tca gat att tta tct ctg gtc att ttc ata aac gac aaa ttt 486 Val Glu Ser Asp Ile Leu Ser Leu Val Ile Phe Ile Asn Asp Lys Phe 140 145 150 aag cag tgc ctc gag cag aac aaa gtt gat cgc ata aga tct aac ctg 534 Lys Gln Cys Leu Glu Gln Asn Lys Val Asp Arg Ile Arg Ser Asn Leu 155 160 165 aaa aat acc tct aaa ata gct tct cct ggt ctt aca tca tct act gca 582 Lys Asn Thr Ser Lys Ile Ala Ser Pro Gly Leu Thr Ser Ser Thr Ala 170 175 180 tca tca atg gtg gcc aac aag act ggt att ttt aag gat ttt tcg att 630 Ser Ser Met Val Ala Asn Lys Thr Gly Ile Phe Lys Asp Phe Ser Ile 185 190 195 att gac gaa gtg gtg ggc cag ggt gca ttt gcc aca gta aag aaa gcc 678 Ile Asp Glu Val Val Gly Gln Gly Ala Phe Ala Thr Val Lys Lys Ala 200 205 210 215 att gaa aga act act ggg aaa aca ttc gcg gtg aag att ata agt aaa 726 Ile Glu Arg Thr Thr Gly Lys Thr Phe Ala Val Lys Ile Ile Ser Lys 220 225 230 cgc aaa gta ata ggc aat atg gat ggt gtg aca aga gag tta gaa gta 774 Arg Lys Val Ile Gly Asn Met Asp Gly Val Thr Arg Glu Leu Glu Val 235 240 245 ttg caa aag ctc aat cat cca agg ata gta cga ttg aaa gga ttt tat 822 Leu Gln Lys Leu Asn His Pro Arg Ile Val Arg Leu Lys Gly Phe Tyr 250 255 260 gaa gat act gag agt tat tat atg gtg atg gag ttc gtt tct ggt ggt 870 Glu Asp Thr Glu Ser Tyr Tyr Met Val Met Glu Phe Val Ser Gly Gly 265 270 275 gac tta atg gat ttt gtt gct gct cat ggt gcg gtt gga gaa gat gct 918 Asp Leu Met Asp Phe Val Ala Ala His Gly Ala Val Gly Glu Asp Ala 280 285 290 295 ggg agg gag ata tcc agg cag ata ctc aca gca ata aaa tac att cac 966 Gly Arg Glu Ile Ser Arg Gln Ile Leu Thr Ala Ile Lys Tyr Ile His 300 305 310 tct atg ggc atc agc cat cgt gac cta aag ccc gat aat att ctt att 1014 Ser Met Gly Ile Ser His Arg Asp Leu Lys Pro Asp Asn Ile Leu Ile 315 320 325 gaa caa gac gat cct gta ttg gta aag ata acc gac ttt ggt ctg gca 1062 Glu Gln Asp Asp Pro Val Leu Val Lys Ile Thr Asp Phe Gly Leu Ala 330 335 340 aaa gta caa gga aat ggg tct ttt atg aaa acc ttc tgt ggc act ttg 1110 Lys Val Gln Gly Asn Gly Ser Phe Met Lys Thr Phe Cys Gly Thr Leu 345 350 355 gca tat gtg gca cct gaa gtc atc aga ggt aaa gat aca tcc gta tct 1158 Ala Tyr Val Ala Pro Glu Val Ile Arg Gly Lys Asp Thr Ser Val Ser 360 365 370 375 cct gat gaa tac gaa gaa agg aat gag tac tct tcg tta gtg gat atg 1206 Pro Asp Glu Tyr Glu Glu Arg Asn Glu Tyr Ser Ser Leu Val Asp Met 380 385 390 tgg tca atg gga tgt ctt gtg tat gtt atc cta acg ggc cac tta cct 1254 Trp Ser Met Gly Cys Leu Val Tyr Val Ile Leu Thr Gly His Leu Pro 395 400 405 ttt agt ggt agc aca cag gac caa tta tat aaa cag att gga aga ggc 1302 Phe Ser Gly Ser Thr Gln Asp Gln Leu Tyr Lys Gln Ile Gly Arg Gly 410 415 420 tca tat cat gaa ggg ccc ctc aaa gat ttc cgg ata tct gaa gaa gca 1350 Ser Tyr His Glu Gly Pro Leu Lys Asp Phe Arg Ile Ser Glu Glu Ala 425 430 435 aga gat ttc ata gat tca ttg tta cag gtg gat cca aat aat agg tcg 1398 Arg Asp Phe Ile Asp Ser Leu Leu Gln Val Asp Pro Asn Asn Arg Ser 440 445 450 455 aca gct gca aaa gcc ttg aat cat ccc tgg atc aag atg agt cca ttg 1446 Thr Ala Ala Lys Ala Leu Asn His Pro Trp Ile Lys Met Ser Pro Leu 460 465 470 ggc tca caa tca tat ggt gat ttt tca caa ata tcc tta tca caa tcg 1494 Gly Ser Gln Ser Tyr Gly Asp Phe Ser Gln Ile Ser Leu Ser Gln Ser 475 480 485 ttg tcg cag cag aaa tta tta gaa aat atg gac gat gct caa tac gaa 1542 Leu Ser Gln Gln Lys Leu Leu Glu Asn Met Asp Asp Ala Gln Tyr Glu 490 495 500 ttt gtc aaa gcg caa agg aaa tta caa atg gag caa caa ctt caa gaa 1590 Phe Val Lys Ala Gln Arg Lys Leu Gln Met Glu Gln Gln Leu Gln Glu 505 510 515 cag gat cag gaa gac caa gat gga aaa att caa gga ttt aaa ata ccc 1638 Gln Asp Gln Glu Asp Gln Asp Gly Lys Ile Gln Gly Phe Lys Ile Pro 520 525 530 535 gca cac gcc cct att cga tat aca cag ccc aaa agc att gaa gca gaa 1686 Ala His Ala Pro Ile Arg Tyr Thr Gln Pro Lys Ser Ile Glu Ala Glu 540 545 550 act aga gaa caa aaa ctt tta cat tcc aat aat act gag aat gtc aag 1734 Thr Arg Glu Gln Lys Leu Leu His Ser Asn Asn Thr Glu Asn Val Lys 555 560 565 agc tca aag aaa aag ggt aat ggt agg ttt tta act tta aaa cca ttg 1782 Ser Ser Lys Lys Lys Gly Asn Gly Arg Phe Leu Thr Leu Lys Pro Leu 570 575 580 cct gac agc att att caa gaa agc ctg gag att cag caa ggt gtg aat 1830 Pro Asp Ser Ile Ile Gln Glu Ser Leu Glu Ile Gln Gln Gly Val Asn 585 590 595 cca ttt ttc att ggt aga tcc gag gat tgc aat tgt aaa att gaa gac 1878 Pro Phe Phe Ile Gly Arg Ser Glu Asp Cys Asn Cys Lys Ile Glu Asp 600 605 610 615 aat agg ttg tct cga gtt cat tgc ttc att ttc aaa aag agg cat gct 1926 Asn Arg Leu Ser Arg Val His Cys Phe Ile Phe Lys Lys Arg His Ala 620 625 630 gta ggc aaa agc atg tat gaa tct ccg gca caa ggt tta gat gat att 1974 Val Gly Lys Ser Met Tyr Glu Ser Pro Ala Gln Gly Leu Asp Asp Ile 635 640 645 tgg tat tgc cac acc gga act aac gtg agc tat tta aat aat aac cgc 2022 Trp Tyr Cys His Thr Gly Thr Asn Val Ser Tyr Leu Asn Asn Asn Arg 650 655 660 atg ata cag ggt acg aaa ttc ctt tta caa gac gga gat gaa atc aag 2070 Met Ile Gln Gly Thr Lys Phe Leu Leu Gln Asp Gly Asp Glu Ile Lys 665 670 675 atc att tgg gat aaa aac aat aaa ttt gtc att ggc ttt aaa gtg gaa 2118 Ile Ile Trp Asp Lys Asn Asn Lys Phe Val Ile Gly Phe Lys Val Glu 680 685 690 695 att aac gat act aca ggt ctg ttt aac gag gga tta ggt atg tta caa 2166 Ile Asn Asp Thr Thr Gly Leu Phe Asn Glu Gly Leu Gly Met Leu Gln 700 705 710 gaa caa aga gta gta ctt aag caa aca gcc gaa gaa aaa gat ttg gtg 2214 Glu Gln Arg Val Val Leu Lys Gln Thr Ala Glu Glu Lys Asp Leu Val 715 720 725 aaa aag tta acc cag atg atg gca gct caa cgt gca aat caa ccc tcg 2262 Lys Lys Leu Thr Gln Met Met Ala Ala Gln Arg Ala Asn Gln Pro Ser 730 735 740 gct tct tct tca tca atg tcg gct aag aag ccg cca gtt agc gat aca 2310 Ala Ser Ser Ser Ser Met Ser Ala Lys Lys Pro Pro Val Ser Asp Thr 745 750 755 aat aat aac ggc aat aat tcg gta cta aac gac ttg gta gag tca ccg 2358 Asn Asn Asn Gly Asn Asn Ser Val Leu Asn Asp Leu Val Glu Ser Pro 760 765 770 775 att aat gcg aat acg ggg aac att ttg aag aga ata cat tcg gta agt 2406 Ile Asn Ala Asn Thr Gly Asn Ile Leu Lys Arg Ile His Ser Val Ser 780 785 790 tta tcg caa tca caa att gat cct agt aag aag gtt aaa agg gca aaa 2454 Leu Ser Gln Ser Gln Ile Asp Pro Ser Lys Lys Val Lys Arg Ala Lys 795 800 805 ttg gac caa acc tca aaa ggc ccc gag aat ttg caa ttt tcg taa 2499 Leu Asp Gln Thr Ser Lys Gly Pro Glu Asn Leu Gln Phe Ser * 810 815 820 ccaaggacaa atacccatag aaaatgctgc ccctttttaa gagagaagat ggtagatacc 2559 aatactcaga attcccagta caaagaacca atatcggagt caataaacag tatgatgaac 2619 ttgctttcgc aaataaaaga tatcactcag aagcacccag taataaagga tgcagatagc 2679 tcgagatttg gtaaggttga gtttagggac ttttatgacg aagtttcacg gaattc 2735 <210> SEQ ID NO 16 <211> LENGTH: 821 <212> TYPE: PRT <213> ORGANISM: Saccharomyces cerevisiae <400> SEQUENCE: 16 Met Glu Asn Ile Thr Gln Pro Thr Gln Gln Ser Thr Gln Ala Thr Gln 1 5 10 15 Arg Phe Leu Ile Glu Lys Phe Ser Gln Glu Gln Ile Gly Glu Asn Ile 20 25 30 Val Cys Arg Val Ile Cys Thr Thr Gly Gln Ile Pro Ile Arg Asp Leu 35 40 45 Ser Ala Asp Ile Ser Gln Val Leu Lys Glu Lys Arg Ser Ile Lys Lys 50 55 60 Val Trp Thr Phe Gly Arg Asn Pro Ala Cys Asp Tyr His Leu Gly Asn 65 70 75 80 Ile Ser Arg Leu Ser Asn Lys His Phe Gln Ile Leu Leu Gly Glu Asp 85 90 95 Gly Asn Leu Leu Leu Asn Asp Ile Ser Thr Asn Gly Thr Trp Leu Asn 100 105 110 Gly Gln Lys Val Glu Lys Asn Ser Asn Gln Leu Leu Ser Gln Gly Asp 115 120 125 Glu Ile Thr Val Gly Val Gly Val Glu Ser Asp Ile Leu Ser Leu Val 130 135 140 Ile Phe Ile Asn Asp Lys Phe Lys Gln Cys Leu Glu Gln Asn Lys Val 145 150 155 160 Asp Arg Ile Arg Ser Asn Leu Lys Asn Thr Ser Lys Ile Ala Ser Pro 165 170 175 Gly Leu Thr Ser Ser Thr Ala Ser Ser Met Val Ala Asn Lys Thr Gly 180 185 190 Ile Phe Lys Asp Phe Ser Ile Ile Asp Glu Val Val Gly Gln Gly Ala 195 200 205 Phe Ala Thr Val Lys Lys Ala Ile Glu Arg Thr Thr Gly Lys Thr Phe 210 215 220 Ala Val Lys Ile Ile Ser Lys Arg Lys Val Ile Gly Asn Met Asp Gly 225 230 235 240 Val Thr Arg Glu Leu Glu Val Leu Gln Lys Leu Asn His Pro Arg Ile 245 250 255 Val Arg Leu Lys Gly Phe Tyr Glu Asp Thr Glu Ser Tyr Tyr Met Val 260 265 270 Met Glu Phe Val Ser Gly Gly Asp Leu Met Asp Phe Val Ala Ala His 275 280 285 Gly Ala Val Gly Glu Asp Ala Gly Arg Glu Ile Ser Arg Gln Ile Leu 290 295 300 Thr Ala Ile Lys Tyr Ile His Ser Met Gly Ile Ser His Arg Asp Leu 305 310 315 320 Lys Pro Asp Asn Ile Leu Ile Glu Gln Asp Asp Pro Val Leu Val Lys 325 330 335 Ile Thr Asp Phe Gly Leu Ala Lys Val Gln Gly Asn Gly Ser Phe Met 340 345 350 Lys Thr Phe Cys Gly Thr Leu Ala Tyr Val Ala Pro Glu Val Ile Arg 355 360 365 Gly Lys Asp Thr Ser Val Ser Pro Asp Glu Tyr Glu Glu Arg Asn Glu 370 375 380 Tyr Ser Ser Leu Val Asp Met Trp Ser Met Gly Cys Leu Val Tyr Val 385 390 395 400 Ile Leu Thr Gly His Leu Pro Phe Ser Gly Ser Thr Gln Asp Gln Leu 405 410 415 Tyr Lys Gln Ile Gly Arg Gly Ser Tyr His Glu Gly Pro Leu Lys Asp 420 425 430 Phe Arg Ile Ser Glu Glu Ala Arg Asp Phe Ile Asp Ser Leu Leu Gln 435 440 445 Val Asp Pro Asn Asn Arg Ser Thr Ala Ala Lys Ala Leu Asn His Pro 450 455 460 Trp Ile Lys Met Ser Pro Leu Gly Ser Gln Ser Tyr Gly Asp Phe Ser 465 470 475 480 Gln Ile Ser Leu Ser Gln Ser Leu Ser Gln Gln Lys Leu Leu Glu Asn 485 490 495 Met Asp Asp Ala Gln Tyr Glu Phe Val Lys Ala Gln Arg Lys Leu Gln 500 505 510 Met Glu Gln Gln Leu Gln Glu Gln Asp Gln Glu Asp Gln Asp Gly Lys 515 520 525 Ile Gln Gly Phe Lys Ile Pro Ala His Ala Pro Ile Arg Tyr Thr Gln 530 535 540 Pro Lys Ser Ile Glu Ala Glu Thr Arg Glu Gln Lys Leu Leu His Ser 545 550 555 560 Asn Asn Thr Glu Asn Val Lys Ser Ser Lys Lys Lys Gly Asn Gly Arg 565 570 575 Phe Leu Thr Leu Lys Pro Leu Pro Asp Ser Ile Ile Gln Glu Ser Leu 580 585 590 Glu Ile Gln Gln Gly Val Asn Pro Phe Phe Ile Gly Arg Ser Glu Asp 595 600 605 Cys Asn Cys Lys Ile Glu Asp Asn Arg Leu Ser Arg Val His Cys Phe 610 615 620 Ile Phe Lys Lys Arg His Ala Val Gly Lys Ser Met Tyr Glu Ser Pro 625 630 635 640 Ala Gln Gly Leu Asp Asp Ile Trp Tyr Cys His Thr Gly Thr Asn Val 645 650 655 Ser Tyr Leu Asn Asn Asn Arg Met Ile Gln Gly Thr Lys Phe Leu Leu 660 665 670 Gln Asp Gly Asp Glu Ile Lys Ile Ile Trp Asp Lys Asn Asn Lys Phe 675 680 685 Val Ile Gly Phe Lys Val Glu Ile Asn Asp Thr Thr Gly Leu Phe Asn 690 695 700 Glu Gly Leu Gly Met Leu Gln Glu Gln Arg Val Val Leu Lys Gln Thr 705 710 715 720 Ala Glu Glu Lys Asp Leu Val Lys Lys Leu Thr Gln Met Met Ala Ala 725 730 735 Gln Arg Ala Asn Gln Pro Ser Ala Ser Ser Ser Ser Met Ser Ala Lys 740 745 750 Lys Pro Pro Val Ser Asp Thr Asn Asn Asn Gly Asn Asn Ser Val Leu 755 760 765 Asn Asp Leu Val Glu Ser Pro Ile Asn Ala Asn Thr Gly Asn Ile Leu 770 775 780 Lys Arg Ile His Ser Val Ser Leu Ser Gln Ser Gln Ile Asp Pro Ser 785 790 795 800 Lys Lys Val Lys Arg Ala Lys Leu Asp Gln Thr Ser Lys Gly Pro Glu 805 810 815 Asn Leu Gln Phe Ser 820 <210> SEQ ID NO 17 <211> LENGTH: 2525 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (289)...(1230) <400> SEQUENCE: 17 tcctgccccg cggcgctgcc gcacgagccc cacgagccgc tcaccccgcc gttctcagcg 60 ctgcccgacc ccgctggcgc gccctcccgc cgccagtccc ggcagcgccc tcagttgtcc 120 tccgactcgc cctcggcctt ccgcgccagc cgcagccaca gccgcaacgc cacccgcagc 180 cacagccaca gccacagccc caggcatagc cttcggcaca gccccggctc cggctcctgc 240 ggcagctcct ctgggcaccg tccctgcgcc gacatcctgg aggttggg atg ctc ttg 297 Met Leu Leu 1 tcc aaa atc aac tcg ctt gcc cac ctg cgc gcc gcg ccc tgc aac gac 345 Ser Lys Ile Asn Ser Leu Ala His Leu Arg Ala Ala Pro Cys Asn Asp 5 10 15 ctg cac gcc acc aag ctg gcg ccc ggc aag gag aag gag ccc ctg gag 393 Leu His Ala Thr Lys Leu Ala Pro Gly Lys Glu Lys Glu Pro Leu Glu 20 25 30 35 tcg cag tac cag gtg ggc ccg cta ctg ggc agc ggc ggc ttc ggc tcg 441 Ser Gln Tyr Gln Val Gly Pro Leu Leu Gly Ser Gly Gly Phe Gly Ser 40 45 50 gtc tac tca ggc atc cgc gtc tcc gac aac ttg ccg gtg gcc atc aaa 489 Val Tyr Ser Gly Ile Arg Val Ser Asp Asn Leu Pro Val Ala Ile Lys 55 60 65 cac gtg gag aag gac cgg att tcc gac tgg gga gag ctg cct aat ggc 537 His Val Glu Lys Asp Arg Ile Ser Asp Trp Gly Glu Leu Pro Asn Gly 70 75 80 act cga gtg ccc atg gaa gtg gtc ctg ctg aag aag gtg agc tcg ggt 585 Thr Arg Val Pro Met Glu Val Val Leu Leu Lys Lys Val Ser Ser Gly 85 90 95 ttc tcc ggc gtc att agg ctc ctg gac tgg ttc gag agg ccc gac agt 633 Phe Ser Gly Val Ile Arg Leu Leu Asp Trp Phe Glu Arg Pro Asp Ser 100 105 110 115 ttc gtc ctg atc ctg gag agg ccc gag ccg gtg caa gat ctc ttc gac 681 Phe Val Leu Ile Leu Glu Arg Pro Glu Pro Val Gln Asp Leu Phe Asp 120 125 130 ttc atc acg gaa agg gga gcc ctg caa gag gag ctc gcc cgc agc ttc 729 Phe Ile Thr Glu Arg Gly Ala Leu Gln Glu Glu Leu Ala Arg Ser Phe 135 140 145 ttc tgg cag gtg ctg gag gcc gtg cgg cac tgc cac aac tgc ggg gtg 777 Phe Trp Gln Val Leu Glu Ala Val Arg His Cys His Asn Cys Gly Val 150 155 160 ctc cac cgc gac atc aag gac gaa aac atc ctt atc gac ctc aat cgc 825 Leu His Arg Asp Ile Lys Asp Glu Asn Ile Leu Ile Asp Leu Asn Arg 165 170 175 ggc gag ctc aag ctc atc gac ttc ggg tcg ggg gcg ctg ctc aaa gac 873 Gly Glu Leu Lys Leu Ile Asp Phe Gly Ser Gly Ala Leu Leu Lys Asp 180 185 190 195 acc gtc tac acg gac ttc gat ggg acc cga gtg tat agc cct cca gag 921 Thr Val Tyr Thr Asp Phe Asp Gly Thr Arg Val Tyr Ser Pro Pro Glu 200 205 210 tgg atc cgc tac cat cgc tac cat ggc agg tcg gcg gca gtc tgg tcc 969 Trp Ile Arg Tyr His Arg Tyr His Gly Arg Ser Ala Ala Val Trp Ser 215 220 225 ctg ggg atc ctg ctg tat gat atg gtg tgt gga gat att cct ttc gag 1017 Leu Gly Ile Leu Leu Tyr Asp Met Val Cys Gly Asp Ile Pro Phe Glu 230 235 240 cat gac gaa gag atc atc agg ggc cag gtt ttc ttc agg cag agg gtc 1065 His Asp Glu Glu Ile Ile Arg Gly Gln Val Phe Phe Arg Gln Arg Val 245 250 255 tct tca gaa tgt cag cat ctc att aga tgg tgc ttg gcc ctg aga cca 1113 Ser Ser Glu Cys Gln His Leu Ile Arg Trp Cys Leu Ala Leu Arg Pro 260 265 270 275 tca gat agg cca acc ttc gaa gaa atc cag aac cat cca tgg atg caa 1161 Ser Asp Arg Pro Thr Phe Glu Glu Ile Gln Asn His Pro Trp Met Gln 280 285 290 gat gtt ctc ctg ccc cag gaa act gct gag atc cac ctc cac agc ctg 1209 Asp Val Leu Leu Pro Gln Glu Thr Ala Glu Ile His Leu His Ser Leu 295 300 305 tcg ccg ggg ccc agc aaa tag cagcctttct ggcaggtcct cccctctctt 1260 Ser Pro Gly Pro Ser Lys * 310 gtcagatgcc cgagggaggg gaagcttctg tctccagctt cccgagtacc agtgacacgt 1320 ctcgccaagc aggacagtgc ttgatacagg aacaacattt acaactcatt ccagatccca 1380 ggcccctgga ggctgcctcc caacagtgag gaagagtgac tctccagggg tcctaggcct 1440 caactcctcc catagatact ctcttcttct cataggtgtc cagcattgct ggactgctga 1500 aatatcccgg gggtgggggg tgggggtggg tcagaaccct gccatggaac tgtttccttc 1560 atcatgagtt ctgctgaatg ccgcgatggg tcaggtaggg gggaaacagg ttgggatggg 1620 ataggactag caccatttta agtccctgtc acctcttccg actctttctg agtgccttct 1680 gtggggactc cggctgtgct gggagaaata cttgaacttg cctcttttac ctgctgcttc 1740 tccaaaaatc tgcctgggtt ttgttcccta tttttctctc ctgtcctccc tcaccccctc 1800 cttcatatga aaggtgccat ggaagaggct acagggccaa acgctgagcc acctgccctt 1860 ttttctgcct cctttagtaa aactccgagt gaactggtct tcctttttgg tttttactta 1920 actgtttcaa agccaagacc tcacacacag aaaaaatgca caaacaatgc aatcaacaga 1980 aaagctgtaa atgtgtgtac agttggcatg gtagtataca aaaagattgt agtggatcta 2040 atttttcaga aattttgcct ttaagttatt ttacctgttt ttgtttcttg ttttgaaaga 2100 tgcgcattct aacctggagg tcaatgttat gtatttattt atttatttat ttggttccct 2160 tcctattcca agcttccata gctgctgccc tagttttctt tcctcctttc ctcctctgac 2220 ttggggacct tttgggggag ggctgcgacg cttgctctgt ttgtggggtg acgggactca 2280 ggcgggacag tgctgcagct ccctggcttc tgtggggccc ctcacctact tacccaggtg 2340 ggtcccggct ctgtgggtga tggggagggg cattgctgac tgtgtatata ggataattat 2400 gaaaagcagt tctggatggt gtgccttcca gatcctctct ggggctgtgt tttgagcagc 2460 aggtagcctg gctggtttta tctgagtgaa atactgtaca ggggaataaa agagatctta 2520 ttttt 2525 <210> SEQ ID NO 18 <211> LENGTH: 313 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 18 Met Leu Leu Ser Lys Ile Asn Ser Leu Ala His Leu Arg Ala Ala Pro 1 5 10 15 Cys Asn Asp Leu His Ala Thr Lys Leu Ala Pro Gly Lys Glu Lys Glu 20 25 30 Pro Leu Glu Ser Gln Tyr Gln Val Gly Pro Leu Leu Gly Ser Gly Gly 35 40 45 Phe Gly Ser Val Tyr Ser Gly Ile Arg Val Ser Asp Asn Leu Pro Val 50 55 60 Ala Ile Lys His Val Glu Lys Asp Arg Ile Ser Asp Trp Gly Glu Leu 65 70 75 80 Pro Asn Gly Thr Arg Val Pro Met Glu Val Val Leu Leu Lys Lys Val 85 90 95 Ser Ser Gly Phe Ser Gly Val Ile Arg Leu Leu Asp Trp Phe Glu Arg 100 105 110 Pro Asp Ser Phe Val Leu Ile Leu Glu Arg Pro Glu Pro Val Gln Asp 115 120 125 Leu Phe Asp Phe Ile Thr Glu Arg Gly Ala Leu Gln Glu Glu Leu Ala 130 135 140 Arg Ser Phe Phe Trp Gln Val Leu Glu Ala Val Arg His Cys His Asn 145 150 155 160 Cys Gly Val Leu His Arg Asp Ile Lys Asp Glu Asn Ile Leu Ile Asp 165 170 175 Leu Asn Arg Gly Glu Leu Lys Leu Ile Asp Phe Gly Ser Gly Ala Leu 180 185 190 Leu Lys Asp Thr Val Tyr Thr Asp Phe Asp Gly Thr Arg Val Tyr Ser 195 200 205 Pro Pro Glu Trp Ile Arg Tyr His Arg Tyr His Gly Arg Ser Ala Ala 210 215 220 Val Trp Ser Leu Gly Ile Leu Leu Tyr Asp Met Val Cys Gly Asp Ile 225 230 235 240 Pro Phe Glu His Asp Glu Glu Ile Ile Arg Gly Gln Val Phe Phe Arg 245 250 255 Gln Arg Val Ser Ser Glu Cys Gln His Leu Ile Arg Trp Cys Leu Ala 260 265 270 Leu Arg Pro Ser Asp Arg Pro Thr Phe Glu Glu Ile Gln Asn His Pro 275 280 285 Trp Met Gln Asp Val Leu Leu Pro Gln Glu Thr Ala Glu Ile His Leu 290 295 300 His Ser Leu Ser Pro Gly Pro Ser Lys 305 310 <210> SEQ ID NO 19 <211> LENGTH: 3401 <212> TYPE: DNA <213> ORGANISM: Saccharomyces cerevisiae <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (789)...(2795) <400> SEQUENCE: 19 atcgatacaa ctccccagaa atatcactgt tgagagttca tgtcaagacg tagtatagta 60 ttgcaacagg aaaaaaaaat cttattgcgt agcactctgt atctatttta tatatctgtt 120 tctatatttg attaatctct tgttatcttg gtgatgatcg cacaagtatg tactcctgta 180 tctgcaagaa tatctgtttt aaacttttca aagcaaggaa accccgtctt atataggtta 240 tccgcaaagg tcacattttc ttgcaaatag aagaaaaagc acccacaagc acactaacac 300 agtgccagag caaaactata tcctttgcat ccgatctcaa acgctgttct tatcgcatct 360 gtcttcgtcc tttcatctgc atttaccttt tctttttcat cctctatttg ccttttcatt 420 agtggcaatt tttccagttt tttccctctg cgtcccgttg cacctgaaag gatctttcta 480 acgtgtgttg tctactagtg agcgatttcg tgagccatac acgttctata gaaaattgaa 540 taaactttac ttcaaaggga tctggacaca gagataactg cttacctgct tgccggaaga 600 aaagaattac taaaaaagaa gacaagggta gctgctattg tgggtacacg tttcacagaa 660 ctactttttc cttgtccttc tccagacatc aacgtcatac aactaaaact gataaagtac 720 ccgtttttcc gtacatttct atagatacat tattatatta agcagatcga gacgttaatt 780 tctcaaag atg gaa gac aag ttt gct aac ctc agt ctc cat gag aaa act 830 Met Glu Asp Lys Phe Ala Asn Leu Ser Leu His Glu Lys Thr 1 5 10 ggt aag tca tct atc caa tta aac gag caa aca ggc tca gat aat ggc 878 Gly Lys Ser Ser Ile Gln Leu Asn Glu Gln Thr Gly Ser Asp Asn Gly 15 20 25 30 tct gct gtc aag aga aca tct tcg acg tcc tcg cac tac aat aac atc 926 Ser Ala Val Lys Arg Thr Ser Ser Thr Ser Ser His Tyr Asn Asn Ile 35 40 45 aac gct gac ctt cat gct cgt gta aaa gct ttt caa gaa caa cgt gca 974 Asn Ala Asp Leu His Ala Arg Val Lys Ala Phe Gln Glu Gln Arg Ala 50 55 60 ttg aaa agg tct gcc agc gtg ggc agt aat caa agc gag caa gac aaa 1022 Leu Lys Arg Ser Ala Ser Val Gly Ser Asn Gln Ser Glu Gln Asp Lys 65 70 75 ggc agt tca caa tca cct aaa cat att cag cag att gtt aat aag cca 1070 Gly Ser Ser Gln Ser Pro Lys His Ile Gln Gln Ile Val Asn Lys Pro 80 85 90 ttg ccg cct ctt ccc gta gca gga agt tct aag gtt tca caa aga atg 1118 Leu Pro Pro Leu Pro Val Ala Gly Ser Ser Lys Val Ser Gln Arg Met 95 100 105 110 agt agc caa gtc gtg caa gcg tcc tcc aag agc act ctt aag aac gtt 1166 Ser Ser Gln Val Val Gln Ala Ser Ser Lys Ser Thr Leu Lys Asn Val 115 120 125 ctg gac aat caa gaa aca caa aac att acc gac gta aat att aac atc 1214 Leu Asp Asn Gln Glu Thr Gln Asn Ile Thr Asp Val Asn Ile Asn Ile 130 135 140 gat aca acc aaa att acc gcc aca aca att ggt gta aat act ggc cta 1262 Asp Thr Thr Lys Ile Thr Ala Thr Thr Ile Gly Val Asn Thr Gly Leu 145 150 155 cct gct act gac att acg ccg tca gtt tct aat act gca tca gca aca 1310 Pro Ala Thr Asp Ile Thr Pro Ser Val Ser Asn Thr Ala Ser Ala Thr 160 165 170 cat aag gcg caa ttg ctg aat cct aac aga agg gca cca aga agg ccg 1358 His Lys Ala Gln Leu Leu Asn Pro Asn Arg Arg Ala Pro Arg Arg Pro 175 180 185 190 ctt tct acc cag cac cct aca aga cca aat gtt gcc ccg cat aag gcc 1406 Leu Ser Thr Gln His Pro Thr Arg Pro Asn Val Ala Pro His Lys Ala 195 200 205 cct gct ata atc aac aca cca aaa caa agt tta agt gcc cgt cga ggg 1454 Pro Ala Ile Ile Asn Thr Pro Lys Gln Ser Leu Ser Ala Arg Arg Gly 210 215 220 ctc aaa tta cca cca gga gga atg tca tta aaa atg ccc act aaa aca 1502 Leu Lys Leu Pro Pro Gly Gly Met Ser Leu Lys Met Pro Thr Lys Thr 225 230 235 gct caa cag ccg cag cag ttt gcc cca agc cct tca aac aaa aaa cat 1550 Ala Gln Gln Pro Gln Gln Phe Ala Pro Ser Pro Ser Asn Lys Lys His 240 245 250 ata gaa acc tta tca aac agc aaa gtt gtt gaa ggg aaa aga tcg aat 1598 Ile Glu Thr Leu Ser Asn Ser Lys Val Val Glu Gly Lys Arg Ser Asn 255 260 265 270 ccg ggt tct ttg ata aat ggt gtg caa agc aca tcc acc tca tca agt 1646 Pro Gly Ser Leu Ile Asn Gly Val Gln Ser Thr Ser Thr Ser Ser Ser 275 280 285 acc gaa ggc cca cat gac act gta ggc act aca ccc aga act gga aac 1694 Thr Glu Gly Pro His Asp Thr Val Gly Thr Thr Pro Arg Thr Gly Asn 290 295 300 agc aac aac tct tca aat tct ggt agt agt ggt ggt ggt ggt ctt ttc 1742 Ser Asn Asn Ser Ser Asn Ser Gly Ser Ser Gly Gly Gly Gly Leu Phe 305 310 315 gca aat ttc tcg aaa tac gtg gat atc aaa tcc ggc tct ttg aat ttt 1790 Ala Asn Phe Ser Lys Tyr Val Asp Ile Lys Ser Gly Ser Leu Asn Phe 320 325 330 gca ggc aaa cta tcg cta tcc tct aaa gga ata gat ttc agc aat ggt 1838 Ala Gly Lys Leu Ser Leu Ser Ser Lys Gly Ile Asp Phe Ser Asn Gly 335 340 345 350 tct agt tcg aga att aca ttg gac gaa cta gaa ttt ttg gat gaa ctg 1886 Ser Ser Ser Arg Ile Thr Leu Asp Glu Leu Glu Phe Leu Asp Glu Leu 355 360 365 ggt cat ggt aac tat ggt aac gtc tca aag gta ctg cat aag ccc aca 1934 Gly His Gly Asn Tyr Gly Asn Val Ser Lys Val Leu His Lys Pro Thr 370 375 380 aat gtt att atg gcg acg aag gaa gtc cgt ttg gag cta gat gag gct 1982 Asn Val Ile Met Ala Thr Lys Glu Val Arg Leu Glu Leu Asp Glu Ala 385 390 395 aaa ttt aga caa att tta atg gaa cta gaa gtt ttg cat aaa tgc aat 2030 Lys Phe Arg Gln Ile Leu Met Glu Leu Glu Val Leu His Lys Cys Asn 400 405 410 tct ccc tat att gtg gat ttt tat ggt gca ttc ttt att gag ggc gcc 2078 Ser Pro Tyr Ile Val Asp Phe Tyr Gly Ala Phe Phe Ile Glu Gly Ala 415 420 425 430 gtc tac atg tgt atg gaa tac atg gat ggt ggt tcc ttg gat aaa ata 2126 Val Tyr Met Cys Met Glu Tyr Met Asp Gly Gly Ser Leu Asp Lys Ile 435 440 445 tac gac gaa tca tct gaa atc ggc ggc att gat gaa cct cag cta gcg 2174 Tyr Asp Glu Ser Ser Glu Ile Gly Gly Ile Asp Glu Pro Gln Leu Ala 450 455 460 ttt att gcc aat gct gtc att cat gga cta aaa gaa ctc aaa gag cag 2222 Phe Ile Ala Asn Ala Val Ile His Gly Leu Lys Glu Leu Lys Glu Gln 465 470 475 cat aat atc ata cac aga gat gtc aaa cca aca aat att tta tgt tca 2270 His Asn Ile Ile His Arg Asp Val Lys Pro Thr Asn Ile Leu Cys Ser 480 485 490 gcc aac caa ggc acc gta aag ctg tgc gat ttc ggt gtt tct ggt aat 2318 Ala Asn Gln Gly Thr Val Lys Leu Cys Asp Phe Gly Val Ser Gly Asn 495 500 505 510 ttg gtg gca tct tta gcg aag act aat att ggt tgt cag tca tac atg 2366 Leu Val Ala Ser Leu Ala Lys Thr Asn Ile Gly Cys Gln Ser Tyr Met 515 520 525 gca cct gaa cga atc aaa tcg ttg aat cca gat aga gcc acc tat acc 2414 Ala Pro Glu Arg Ile Lys Ser Leu Asn Pro Asp Arg Ala Thr Tyr Thr 530 535 540 gta cag tca gac atc tgg tct tta ggt tta agc att ctg gaa atg gca 2462 Val Gln Ser Asp Ile Trp Ser Leu Gly Leu Ser Ile Leu Glu Met Ala 545 550 555 cta ggt aga tat ccg tat cca cca gaa aca tac gac aac att ttc tct 2510 Leu Gly Arg Tyr Pro Tyr Pro Pro Glu Thr Tyr Asp Asn Ile Phe Ser 560 565 570 caa ttg agc gct att gtt gat ggg ccg cca ccg aga tta cct tca gat 2558 Gln Leu Ser Ala Ile Val Asp Gly Pro Pro Pro Arg Leu Pro Ser Asp 575 580 585 590 aaa ttc agt tct gac gca caa gat ttt gtt tct tta tgt cta caa aag 2606 Lys Phe Ser Ser Asp Ala Gln Asp Phe Val Ser Leu Cys Leu Gln Lys 595 600 605 att ccg gaa aga aga cct aca tac gca gct tta aca gag cat cct tgg 2654 Ile Pro Glu Arg Arg Pro Thr Tyr Ala Ala Leu Thr Glu His Pro Trp 610 615 620 tta gta aaa tac aga aac cag gat gtc cac atg agt gag tat atc act 2702 Leu Val Lys Tyr Arg Asn Gln Asp Val His Met Ser Glu Tyr Ile Thr 625 630 635 gaa cga tta gaa agg cgc aac aaa atc tta cgg gaa cgt ggt gag aat 2750 Glu Arg Leu Glu Arg Arg Asn Lys Ile Leu Arg Glu Arg Gly Glu Asn 640 645 650 ggt tta tct aaa aat gta ccg gca tta cat atg ggt ggt tta tag 2795 Gly Leu Ser Lys Asn Val Pro Ala Leu His Met Gly Gly Leu * 655 660 665 cgttaatatc caaataaaag caaacaggca cgtgaatata acaacaaaaa aaaagcagac 2855 gaaaagctac tgtggaaatg atgcggcgaa tacaaaaaaa ccttacatat acatatgttt 2915 attgtaataa acttgcatta tactcgttat agacatatat atatatatat attcatatat 2975 atatatcgtc tgacttcctt ttgtcgaacc taaaaaaggg cacgaattat gacagagtat 3035 tgaggggatg ttatttcaag caccggcaag tgaagcgatg tggacgtcaa tatattgtgt 3095 tattcgatta ttgctacggc catcgactcc tcgaaattat ttacgttcgg ggctgacaac 3155 gcaagaaaga aaaaatgctc tggaattgtc tgatggtttt tccgctcttt acggctcaag 3215 gctaggaaag aaaaaaaagt ccaaaatcat cgagaaaata aaaggtgttt tgaaagttca 3275 aatccacgtt attgagagta gatgtggagt ctggaccagg aactatacct gtatcttacc 3335 ctaacttcta aattttgcta ctttcacgga aaacagtaaa taattaccta tcaagataaa 3395 gagctc 3401 <210> SEQ ID NO 20 <211> LENGTH: 668 <212> TYPE: PRT <213> ORGANISM: Saccharomyces cerevisiae <400> SEQUENCE: 20 Met Glu Asp Lys Phe Ala Asn Leu Ser Leu His Glu Lys Thr Gly Lys 1 5 10 15 Ser Ser Ile Gln Leu Asn Glu Gln Thr Gly Ser Asp Asn Gly Ser Ala 20 25 30 Val Lys Arg Thr Ser Ser Thr Ser Ser His Tyr Asn Asn Ile Asn Ala 35 40 45 Asp Leu His Ala Arg Val Lys Ala Phe Gln Glu Gln Arg Ala Leu Lys 50 55 60 Arg Ser Ala Ser Val Gly Ser Asn Gln Ser Glu Gln Asp Lys Gly Ser 65 70 75 80 Ser Gln Ser Pro Lys His Ile Gln Gln Ile Val Asn Lys Pro Leu Pro 85 90 95 Pro Leu Pro Val Ala Gly Ser Ser Lys Val Ser Gln Arg Met Ser Ser 100 105 110 Gln Val Val Gln Ala Ser Ser Lys Ser Thr Leu Lys Asn Val Leu Asp 115 120 125 Asn Gln Glu Thr Gln Asn Ile Thr Asp Val Asn Ile Asn Ile Asp Thr 130 135 140 Thr Lys Ile Thr Ala Thr Thr Ile Gly Val Asn Thr Gly Leu Pro Ala 145 150 155 160 Thr Asp Ile Thr Pro Ser Val Ser Asn Thr Ala Ser Ala Thr His Lys 165 170 175 Ala Gln Leu Leu Asn Pro Asn Arg Arg Ala Pro Arg Arg Pro Leu Ser 180 185 190 Thr Gln His Pro Thr Arg Pro Asn Val Ala Pro His Lys Ala Pro Ala 195 200 205 Ile Ile Asn Thr Pro Lys Gln Ser Leu Ser Ala Arg Arg Gly Leu Lys 210 215 220 Leu Pro Pro Gly Gly Met Ser Leu Lys Met Pro Thr Lys Thr Ala Gln 225 230 235 240 Gln Pro Gln Gln Phe Ala Pro Ser Pro Ser Asn Lys Lys His Ile Glu 245 250 255 Thr Leu Ser Asn Ser Lys Val Val Glu Gly Lys Arg Ser Asn Pro Gly 260 265 270 Ser Leu Ile Asn Gly Val Gln Ser Thr Ser Thr Ser Ser Ser Thr Glu 275 280 285 Gly Pro His Asp Thr Val Gly Thr Thr Pro Arg Thr Gly Asn Ser Asn 290 295 300 Asn Ser Ser Asn Ser Gly Ser Ser Gly Gly Gly Gly Leu Phe Ala Asn 305 310 315 320 Phe Ser Lys Tyr Val Asp Ile Lys Ser Gly Ser Leu Asn Phe Ala Gly 325 330 335 Lys Leu Ser Leu Ser Ser Lys Gly Ile Asp Phe Ser Asn Gly Ser Ser 340 345 350 Ser Arg Ile Thr Leu Asp Glu Leu Glu Phe Leu Asp Glu Leu Gly His 355 360 365 Gly Asn Tyr Gly Asn Val Ser Lys Val Leu His Lys Pro Thr Asn Val 370 375 380 Ile Met Ala Thr Lys Glu Val Arg Leu Glu Leu Asp Glu Ala Lys Phe 385 390 395 400 Arg Gln Ile Leu Met Glu Leu Glu Val Leu His Lys Cys Asn Ser Pro 405 410 415 Tyr Ile Val Asp Phe Tyr Gly Ala Phe Phe Ile Glu Gly Ala Val Tyr 420 425 430 Met Cys Met Glu Tyr Met Asp Gly Gly Ser Leu Asp Lys Ile Tyr Asp 435 440 445 Glu Ser Ser Glu Ile Gly Gly Ile Asp Glu Pro Gln Leu Ala Phe Ile 450 455 460 Ala Asn Ala Val Ile His Gly Leu Lys Glu Leu Lys Glu Gln His Asn 465 470 475 480 Ile Ile His Arg Asp Val Lys Pro Thr Asn Ile Leu Cys Ser Ala Asn 485 490 495 Gln Gly Thr Val Lys Leu Cys Asp Phe Gly Val Ser Gly Asn Leu Val 500 505 510 Ala Ser Leu Ala Lys Thr Asn Ile Gly Cys Gln Ser Tyr Met Ala Pro 515 520 525 Glu Arg Ile Lys Ser Leu Asn Pro Asp Arg Ala Thr Tyr Thr Val Gln 530 535 540 Ser Asp Ile Trp Ser Leu Gly Leu Ser Ile Leu Glu Met Ala Leu Gly 545 550 555 560 Arg Tyr Pro Tyr Pro Pro Glu Thr Tyr Asp Asn Ile Phe Ser Gln Leu 565 570 575 Ser Ala Ile Val Asp Gly Pro Pro Pro Arg Leu Pro Ser Asp Lys Phe 580 585 590 Ser Ser Asp Ala Gln Asp Phe Val Ser Leu Cys Leu Gln Lys Ile Pro 595 600 605 Glu Arg Arg Pro Thr Tyr Ala Ala Leu Thr Glu His Pro Trp Leu Val 610 615 620 Lys Tyr Arg Asn Gln Asp Val His Met Ser Glu Tyr Ile Thr Glu Arg 625 630 635 640 Leu Glu Arg Arg Asn Lys Ile Leu Arg Glu Arg Gly Glu Asn Gly Leu 645 650 655 Ser Lys Asn Val Pro Ala Leu His Met Gly Gly Leu 660 665 <210> SEQ ID NO 21 <211> LENGTH: 1883 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (121)...(1203) <400> SEQUENCE: 21 gtgagccacc gcccccagcc tggcctggca tttctttgag ttcaggaagt gtgacaagga 60 tttggacacc cagaaataag cgtgtcgaga agagcacaag cagaggatcc agcgctcggc 120 atg gcg gag cca gat ctg gag tgc gag cag atc cgt ctg aag tgt att 168 Met Ala Glu Pro Asp Leu Glu Cys Glu Gln Ile Arg Leu Lys Cys Ile 1 5 10 15 cgt aag gag ggc ttc ttc acg gtg cct ccg gaa cac agg ctg gga cga 216 Arg Lys Glu Gly Phe Phe Thr Val Pro Pro Glu His Arg Leu Gly Arg 20 25 30 tgc cgg agt gtg aag gag ttt gag aag ctg aac cgc att gga gag ggt 264 Cys Arg Ser Val Lys Glu Phe Glu Lys Leu Asn Arg Ile Gly Glu Gly 35 40 45 acc tac ggc att gtg tat cgg gcc cgg gac acc cag aca gat gag att 312 Thr Tyr Gly Ile Val Tyr Arg Ala Arg Asp Thr Gln Thr Asp Glu Ile 50 55 60 gtc gca ctg aag aag gtg cgg atg gac aag gag aag gat ggc atc ccc 360 Val Ala Leu Lys Lys Val Arg Met Asp Lys Glu Lys Asp Gly Ile Pro 65 70 75 80 atc agc agc ttg cgg gag atc acg ctg ctg ctc cgc ctg cgt cat ccg 408 Ile Ser Ser Leu Arg Glu Ile Thr Leu Leu Leu Arg Leu Arg His Pro 85 90 95 aac atc gtg gag ctg aag gag gtg gtt gtg ggg aac cac ctg gag agc 456 Asn Ile Val Glu Leu Lys Glu Val Val Val Gly Asn His Leu Glu Ser 100 105 110 atc ttc ctg gtg atg ggt tac tgt gag cag gac ctg gcc agc ctc ctg 504 Ile Phe Leu Val Met Gly Tyr Cys Glu Gln Asp Leu Ala Ser Leu Leu 115 120 125 gag aat atg cca aca ccc ttc tcg gag gct cag gtc aag tgc atc gtg 552 Glu Asn Met Pro Thr Pro Phe Ser Glu Ala Gln Val Lys Cys Ile Val 130 135 140 ctg cag gtg ctc cgg ggc ctc cag tat ctg cac agg aac ttc att atc 600 Leu Gln Val Leu Arg Gly Leu Gln Tyr Leu His Arg Asn Phe Ile Ile 145 150 155 160 cac agg gac ctg aag gtt tcc aac ttg ctc atg acc gac aag ggt tgt 648 His Arg Asp Leu Lys Val Ser Asn Leu Leu Met Thr Asp Lys Gly Cys 165 170 175 gtg aag aca gcg gat ttc ggc ctg gcc cgg gcc tat ggt gtc cca gta 696 Val Lys Thr Ala Asp Phe Gly Leu Ala Arg Ala Tyr Gly Val Pro Val 180 185 190 aag cca atg acc ccc aag gtg gtc act ctc tgg tac cga gcc cct gaa 744 Lys Pro Met Thr Pro Lys Val Val Thr Leu Trp Tyr Arg Ala Pro Glu 195 200 205 ctg ctg ttg gga acc acc acg cag acc acc agc atc gac atg tgg gct 792 Leu Leu Leu Gly Thr Thr Thr Gln Thr Thr Ser Ile Asp Met Trp Ala 210 215 220 gtg ggc tgc ata ctg gcc gag ctg ctg gcg cac agg cct ctt ctc ccc 840 Val Gly Cys Ile Leu Ala Glu Leu Leu Ala His Arg Pro Leu Leu Pro 225 230 235 240 ggc act tcc gag atc cac cag atc gac ttg atc gtg cag ctg ctg ggc 888 Gly Thr Ser Glu Ile His Gln Ile Asp Leu Ile Val Gln Leu Leu Gly 245 250 255 acg ccc agt gag aac atc tgg ccg ggc ttt tcc aag ctg cca ctg gtc 936 Thr Pro Ser Glu Asn Ile Trp Pro Gly Phe Ser Lys Leu Pro Leu Val 260 265 270 ggc cag tac agc ctc cgg aag cag ccc tac aac aac ctg aag cac aag 984 Gly Gln Tyr Ser Leu Arg Lys Gln Pro Tyr Asn Asn Leu Lys His Lys 275 280 285 ttc cca tgg ctg tcg gag gcc ggg ctg cgc ctg ctg cac ttc ctg ttc 1032 Phe Pro Trp Leu Ser Glu Ala Gly Leu Arg Leu Leu His Phe Leu Phe 290 295 300 atg tac gac cct aag aaa agg gcg acg gcc ggg gac tgc ctg gag agc 1080 Met Tyr Asp Pro Lys Lys Arg Ala Thr Ala Gly Asp Cys Leu Glu Ser 305 310 315 320 tcc tat ttc aag gag aag ccc cta ccc tgt gag ccg gag ctc atg ccg 1128 Ser Tyr Phe Lys Glu Lys Pro Leu Pro Cys Glu Pro Glu Leu Met Pro 325 330 335 acc ttt ccc cac cac cgc aac aag cgg gcc gcc cca gcc acc tcc gag 1176 Thr Phe Pro His His Arg Asn Lys Arg Ala Ala Pro Ala Thr Ser Glu 340 345 350 ggc cag agc aag cgc tgt aaa ccc tga cggtgggcct ggcacacgcc 1223 Gly Gln Ser Lys Arg Cys Lys Pro * 355 360 tgtattccca caccaggtct tccgatcagt ggtgtctgtg aagggtgccg cgagccaggc 1283 tgaccaggcg cccgggatcc agctcatccc cttggctggg aacatcctcc actgacttcc 1343 tcccactgtc tgccctgaac ccactgctgc ccccagaaaa aggccgggtg acaccggggg 1403 ctcccagccc gtgcaccctg gaagggcagg tctggcggct ccatccgtgg ctgcaggggt 1463 ctcatgtggt cctcctcgct atgttggaaa tgtgcaacca ctgcttcttg ggaggagtgg 1523 tgggtgcagt ccccccgctg tctttgagtt gtggtggacc gctggcctgg gatgagaggg 1583 cccagaagac cttcgtatcc cctctcagtc gcccggggct gtcccgtgca tgggttggct 1643 gtggggaccc caggtgggcc tggcaggact ccagatgagg acaagaggga caaggtatgg 1703 ggtgggagcc acaattgagg ataccccgag ctaccaggag agccctgggc tggaggctga 1763 gctggatccc tgctccccac acggaggacc caacaggagg ccgtggctct gatgctgagc 1823 gaagctatag gctcttgttg gataaaagct tttttaacag aaaaaaaaaa aaaaaaaaaa 1883 <210> SEQ ID NO 22 <211> LENGTH: 360 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 22 Met Ala Glu Pro Asp Leu Glu Cys Glu Gln Ile Arg Leu Lys Cys Ile 1 5 10 15 Arg Lys Glu Gly Phe Phe Thr Val Pro Pro Glu His Arg Leu Gly Arg 20 25 30 Cys Arg Ser Val Lys Glu Phe Glu Lys Leu Asn Arg Ile Gly Glu Gly 35 40 45 Thr Tyr Gly Ile Val Tyr Arg Ala Arg Asp Thr Gln Thr Asp Glu Ile 50 55 60 Val Ala Leu Lys Lys Val Arg Met Asp Lys Glu Lys Asp Gly Ile Pro 65 70 75 80 Ile Ser Ser Leu Arg Glu Ile Thr Leu Leu Leu Arg Leu Arg His Pro 85 90 95 Asn Ile Val Glu Leu Lys Glu Val Val Val Gly Asn His Leu Glu Ser 100 105 110 Ile Phe Leu Val Met Gly Tyr Cys Glu Gln Asp Leu Ala Ser Leu Leu 115 120 125 Glu Asn Met Pro Thr Pro Phe Ser Glu Ala Gln Val Lys Cys Ile Val 130 135 140 Leu Gln Val Leu Arg Gly Leu Gln Tyr Leu His Arg Asn Phe Ile Ile 145 150 155 160 His Arg Asp Leu Lys Val Ser Asn Leu Leu Met Thr Asp Lys Gly Cys 165 170 175 Val Lys Thr Ala Asp Phe Gly Leu Ala Arg Ala Tyr Gly Val Pro Val 180 185 190 Lys Pro Met Thr Pro Lys Val Val Thr Leu Trp Tyr Arg Ala Pro Glu 195 200 205 Leu Leu Leu Gly Thr Thr Thr Gln Thr Thr Ser Ile Asp Met Trp Ala 210 215 220 Val Gly Cys Ile Leu Ala Glu Leu Leu Ala His Arg Pro Leu Leu Pro 225 230 235 240 Gly Thr Ser Glu Ile His Gln Ile Asp Leu Ile Val Gln Leu Leu Gly 245 250 255 Thr Pro Ser Glu Asn Ile Trp Pro Gly Phe Ser Lys Leu Pro Leu Val 260 265 270 Gly Gln Tyr Ser Leu Arg Lys Gln Pro Tyr Asn Asn Leu Lys His Lys 275 280 285 Phe Pro Trp Leu Ser Glu Ala Gly Leu Arg Leu Leu His Phe Leu Phe 290 295 300 Met Tyr Asp Pro Lys Lys Arg Ala Thr Ala Gly Asp Cys Leu Glu Ser 305 310 315 320 Ser Tyr Phe Lys Glu Lys Pro Leu Pro Cys Glu Pro Glu Leu Met Pro 325 330 335 Thr Phe Pro His His Arg Asn Lys Arg Ala Ala Pro Ala Thr Ser Glu 340 345 350 Gly Gln Ser Lys Arg Cys Lys Pro 355 360 <210> SEQ ID NO 23 <211> LENGTH: 2299 <212> TYPE: DNA <213> ORGANISM: Mus musculus <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (142)...(1698) <400> SEQUENCE: 23 ccggacttcc atgggcagca gcagcggcag ggaacggagg gcgaatagat ttcagagcct 60 gcacctgaag tacaattcga atcctgctcc agggagcgag ccactgtccg gatccagaaa 120 ctttggccac tgggaggaaa a atg gcc agt gat acc cca ggt ttc tac atg 171 Met Ala Ser Asp Thr Pro Gly Phe Tyr Met 1 5 10 gac aaa ctt aat aaa tac cgc cag atg cac gga gta gcc att acg tat 219 Asp Lys Leu Asn Lys Tyr Arg Gln Met His Gly Val Ala Ile Thr Tyr 15 20 25 aaa gaa ctt agt act tcg gga cct cca cat gac aga agg ttt aca ttt 267 Lys Glu Leu Ser Thr Ser Gly Pro Pro His Asp Arg Arg Phe Thr Phe 30 35 40 caa gtt tta ata gat gag aag gaa ttt gga gaa gcc aaa ggt aga tca 315 Gln Val Leu Ile Asp Glu Lys Glu Phe Gly Glu Ala Lys Gly Arg Ser 45 50 55 aag acg gag gca aga aac gct gca gcc aaa tta gct gtt gat ata ctt 363 Lys Thr Glu Ala Arg Asn Ala Ala Ala Lys Leu Ala Val Asp Ile Leu 60 65 70 gat aac gaa aac aag gtg gat tgt cac acg agt gca tgt gag caa ggc 411 Asp Asn Glu Asn Lys Val Asp Cys His Thr Ser Ala Cys Glu Gln Gly 75 80 85 90 ttg ttc gtt ggt aac tac ata ggc ctt gtc aat agc ttt gcc cag aag 459 Leu Phe Val Gly Asn Tyr Ile Gly Leu Val Asn Ser Phe Ala Gln Lys 95 100 105 aaa aag ctg tct gta aat tat gaa cag tgt gag ccc aac tct gag ttg 507 Lys Lys Leu Ser Val Asn Tyr Glu Gln Cys Glu Pro Asn Ser Glu Leu 110 115 120 cct caa aga ttt att tgt aaa tgc aaa att ggg cag aca atg tat ggt 555 Pro Gln Arg Phe Ile Cys Lys Cys Lys Ile Gly Gln Thr Met Tyr Gly 125 130 135 act ggt tca ggt gtc acc aaa cag gag gca aag cag ttg gct gcg aaa 603 Thr Gly Ser Gly Val Thr Lys Gln Glu Ala Lys Gln Leu Ala Ala Lys 140 145 150 gaa gcc tat cag aag ctg tta aag agc ccg ccg aaa act gcc gga aca 651 Glu Ala Tyr Gln Lys Leu Leu Lys Ser Pro Pro Lys Thr Ala Gly Thr 155 160 165 170 tcc tct agc gtt gtc aca tct aca ttc agt ggc ttt tcc agc agc tcg 699 Ser Ser Ser Val Val Thr Ser Thr Phe Ser Gly Phe Ser Ser Ser Ser 175 180 185 tct atg aca agt aat ggt gtt tcc cag tca gca cct gga agt ttt tcc 747 Ser Met Thr Ser Asn Gly Val Ser Gln Ser Ala Pro Gly Ser Phe Ser 190 195 200 tca gag aac gtg ttt acg aac ggt ctc gga gaa aat aaa agg aaa tca 795 Ser Glu Asn Val Phe Thr Asn Gly Leu Gly Glu Asn Lys Arg Lys Ser 205 210 215 gga gta aaa gta tcc cct gat gat gtg caa aga aat aaa tat acc ttg 843 Gly Val Lys Val Ser Pro Asp Asp Val Gln Arg Asn Lys Tyr Thr Leu 220 225 230 gac gcc agg ttt aac agc gat ttt gaa gac ata gaa gaa att ggc tta 891 Asp Ala Arg Phe Asn Ser Asp Phe Glu Asp Ile Glu Glu Ile Gly Leu 235 240 245 250 ggt gga ttt ggt caa gtt ttc aaa gcg aaa cac aga att gat gga aag 939 Gly Gly Phe Gly Gln Val Phe Lys Ala Lys His Arg Ile Asp Gly Lys 255 260 265 aga tac gct att aag cgc gtt aaa tat aac acg gag aag gcg gag cac 987 Arg Tyr Ala Ile Lys Arg Val Lys Tyr Asn Thr Glu Lys Ala Glu His 270 275 280 gaa gta caa gcg ctg gca gaa ctc aat cac gtc aac att gtc caa tac 1035 Glu Val Gln Ala Leu Ala Glu Leu Asn His Val Asn Ile Val Gln Tyr 285 290 295 cat agt tgt tgg gag gga gtt gac tat gat cct gag cac agc atg agt 1083 His Ser Cys Trp Glu Gly Val Asp Tyr Asp Pro Glu His Ser Met Ser 300 305 310 gat aca agt cga tac aaa acc cgg tgc ctc ttt att caa atg gaa ttc 1131 Asp Thr Ser Arg Tyr Lys Thr Arg Cys Leu Phe Ile Gln Met Glu Phe 315 320 325 330 tgt gat aaa gga act ttg gag caa tgg atg aga aac aga aat cag agt 1179 Cys Asp Lys Gly Thr Leu Glu Gln Trp Met Arg Asn Arg Asn Gln Ser 335 340 345 aaa gtg gac aaa gct ttg att ttg gac tta tat gaa caa atc gtg acc 1227 Lys Val Asp Lys Ala Leu Ile Leu Asp Leu Tyr Glu Gln Ile Val Thr 350 355 360 gga gtg gag tat ata cac tcg aaa ggg tta att cac aga gat ctt aag 1275 Gly Val Glu Tyr Ile His Ser Lys Gly Leu Ile His Arg Asp Leu Lys 365 370 375 cca ggt aat ata ttt tta gta gat gaa aga cac att aag atc gga gac 1323 Pro Gly Asn Ile Phe Leu Val Asp Glu Arg His Ile Lys Ile Gly Asp 380 385 390 ttt ggc ctt gca aca gcc ctg gaa aat gat gga aaa tcc cga aca agg 1371 Phe Gly Leu Ala Thr Ala Leu Glu Asn Asp Gly Lys Ser Arg Thr Arg 395 400 405 410 aga aca gga act ctt caa tac atg agt cca gaa cag tta ttt tta aag 1419 Arg Thr Gly Thr Leu Gln Tyr Met Ser Pro Glu Gln Leu Phe Leu Lys 415 420 425 cac tat gga aaa gaa gtg gac atc ttt gct ttg ggc ctt att cta gct 1467 His Tyr Gly Lys Glu Val Asp Ile Phe Ala Leu Gly Leu Ile Leu Ala 430 435 440 gaa ctt ctt cac acg tgc ttc acg gag tca gag aaa ata aag ttt ttc 1515 Glu Leu Leu His Thr Cys Phe Thr Glu Ser Glu Lys Ile Lys Phe Phe 445 450 455 gaa agt cta aga aaa ggc gac ttc tct aat gat ata ttc gac aac aaa 1563 Glu Ser Leu Arg Lys Gly Asp Phe Ser Asn Asp Ile Phe Asp Asn Lys 460 465 470 gaa aaa agc ctt cta aaa aaa cta ctc tca gag aaa ccc aag gac cga 1611 Glu Lys Ser Leu Leu Lys Lys Leu Leu Ser Glu Lys Pro Lys Asp Arg 475 480 485 490 cct gag aca tct gaa atc ctg aag acc ttg gct gaa tgg agg aac atc 1659 Pro Glu Thr Ser Glu Ile Leu Lys Thr Leu Ala Glu Trp Arg Asn Ile 495 500 505 tca gag aaa gaa aag aaa cac atg tta ggg cct ttc tga gaaaacattc 1708 Ser Glu Lys Glu Lys Lys His Met Leu Gly Pro Phe * 510 515 cttctgccgt ggttttcctt taacgatctg cagtctgagg ggagtatcag tgaatattat 1768 ccttcttttc ttaataccac tctcccagac aggttttggt tagggtgacc cacagacatt 1828 gtatttatta ggctatgaaa aagtatgccc atttcctcaa ttgttaattg ctgggcctgt 1888 ggctggctag ctagccaaat atgtaaatgc ttgtttctcg tctgcccaaa gagaaaggca 1948 ggctcctgtg tgggaagtca cagagccccc aaagccaact ggatgaggaa ggactctggc 2008 ttttggcata aaaaagagct ggtagtcaga gctggggcag aaggtcctgc agacagacag 2068 acagacagac agacagagac acaaagacat ggactagaat ggaggaggga gggaggaagg 2128 gagggaggga gagagagaga gagaaagaaa gagagagaga ggacatggag acaaaatggc 2188 ttaagttagc tgggctacct gagagactgt cccagaaaac aggccaacaa ccttccttat 2248 gctatataga tgtctcagtg tctttatcat taaacaccaa gcaggagtgc t 2299 <210> SEQ ID NO 24 <211> LENGTH: 518 <212> TYPE: PRT <213> ORGANISM: Mus musculus <400> SEQUENCE: 24 Met Ala Ser Asp Thr Pro Gly Phe Tyr Met Asp Lys Leu Asn Lys Tyr 1 5 10 15 Arg Gln Met His Gly Val Ala Ile Thr Tyr Lys Glu Leu Ser Thr Ser 20 25 30 Gly Pro Pro His Asp Arg Arg Phe Thr Phe Gln Val Leu Ile Asp Glu 35 40 45 Lys Glu Phe Gly Glu Ala Lys Gly Arg Ser Lys Thr Glu Ala Arg Asn 50 55 60 Ala Ala Ala Lys Leu Ala Val Asp Ile Leu Asp Asn Glu Asn Lys Val 65 70 75 80 Asp Cys His Thr Ser Ala Cys Glu Gln Gly Leu Phe Val Gly Asn Tyr 85 90 95 Ile Gly Leu Val Asn Ser Phe Ala Gln Lys Lys Lys Leu Ser Val Asn 100 105 110 Tyr Glu Gln Cys Glu Pro Asn Ser Glu Leu Pro Gln Arg Phe Ile Cys 115 120 125 Lys Cys Lys Ile Gly Gln Thr Met Tyr Gly Thr Gly Ser Gly Val Thr 130 135 140 Lys Gln Glu Ala Lys Gln Leu Ala Ala Lys Glu Ala Tyr Gln Lys Leu 145 150 155 160 Leu Lys Ser Pro Pro Lys Thr Ala Gly Thr Ser Ser Ser Val Val Thr 165 170 175 Ser Thr Phe Ser Gly Phe Ser Ser Ser Ser Ser Met Thr Ser Asn Gly 180 185 190 Val Ser Gln Ser Ala Pro Gly Ser Phe Ser Ser Glu Asn Val Phe Thr 195 200 205 Asn Gly Leu Gly Glu Asn Lys Arg Lys Ser Gly Val Lys Val Ser Pro 210 215 220 Asp Asp Val Gln Arg Asn Lys Tyr Thr Leu Asp Ala Arg Phe Asn Ser 225 230 235 240 Asp Phe Glu Asp Ile Glu Glu Ile Gly Leu Gly Gly Phe Gly Gln Val 245 250 255 Phe Lys Ala Lys His Arg Ile Asp Gly Lys Arg Tyr Ala Ile Lys Arg 260 265 270 Val Lys Tyr Asn Thr Glu Lys Ala Glu His Glu Val Gln Ala Leu Ala 275 280 285 Glu Leu Asn His Val Asn Ile Val Gln Tyr His Ser Cys Trp Glu Gly 290 295 300 Val Asp Tyr Asp Pro Glu His Ser Met Ser Asp Thr Ser Arg Tyr Lys 305 310 315 320 Thr Arg Cys Leu Phe Ile Gln Met Glu Phe Cys Asp Lys Gly Thr Leu 325 330 335 Glu Gln Trp Met Arg Asn Arg Asn Gln Ser Lys Val Asp Lys Ala Leu 340 345 350 Ile Leu Asp Leu Tyr Glu Gln Ile Val Thr Gly Val Glu Tyr Ile His 355 360 365 Ser Lys Gly Leu Ile His Arg Asp Leu Lys Pro Gly Asn Ile Phe Leu 370 375 380 Val Asp Glu Arg His Ile Lys Ile Gly Asp Phe Gly Leu Ala Thr Ala 385 390 395 400 Leu Glu Asn Asp Gly Lys Ser Arg Thr Arg Arg Thr Gly Thr Leu Gln 405 410 415 Tyr Met Ser Pro Glu Gln Leu Phe Leu Lys His Tyr Gly Lys Glu Val 420 425 430 Asp Ile Phe Ala Leu Gly Leu Ile Leu Ala Glu Leu Leu His Thr Cys 435 440 445 Phe Thr Glu Ser Glu Lys Ile Lys Phe Phe Glu Ser Leu Arg Lys Gly 450 455 460 Asp Phe Ser Asn Asp Ile Phe Asp Asn Lys Glu Lys Ser Leu Leu Lys 465 470 475 480 Lys Leu Leu Ser Glu Lys Pro Lys Asp Arg Pro Glu Thr Ser Glu Ile 485 490 495 Leu Lys Thr Leu Ala Glu Trp Arg Asn Ile Ser Glu Lys Glu Lys Lys 500 505 510 His Met Leu Gly Pro Phe 515 <210> SEQ ID NO 25 <211> LENGTH: 2055 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (211)...(1632) <400> SEQUENCE: 25 caggaagact ctgagtccga cgttggccta cccagtcgga aggcagagct gcaatctagt 60 taactacctc ctttccccta gatttccttt cattctgctc aagtcttcgc ctgtgtccga 120 tccctatcta ctttctctcc tcttgtagca agcctcagac tccaggcttg agctaggttt 180 tgtttttctc ctggtgagaa ttcgaagacc atg tct acg gaa ctc ttc tca tcc 234 Met Ser Thr Glu Leu Phe Ser Ser 1 5 aca aga gag gaa gga agc tct ggc tca gga ccc agt ttt agg tct aat 282 Thr Arg Glu Glu Gly Ser Ser Gly Ser Gly Pro Ser Phe Arg Ser Asn 10 15 20 caa agg aaa atg tta aac ctg ctc ctg gag aga gac act tcc ttt acc 330 Gln Arg Lys Met Leu Asn Leu Leu Leu Glu Arg Asp Thr Ser Phe Thr 25 30 35 40 gtc tgt cca gat gtc cct aga act cca gtg ggc aaa ttt ctt ggt gat 378 Val Cys Pro Asp Val Pro Arg Thr Pro Val Gly Lys Phe Leu Gly Asp 45 50 55 tct gca aac cta agc att ttg tct gga gga acc cca aaa tgt tgc ctc 426 Ser Ala Asn Leu Ser Ile Leu Ser Gly Gly Thr Pro Lys Cys Cys Leu 60 65 70 gat ctt tcg aat ctt agc agt ggg gag ata act gcc act cag ctt acc 474 Asp Leu Ser Asn Leu Ser Ser Gly Glu Ile Thr Ala Thr Gln Leu Thr 75 80 85 act tct gca gac ctt gat gaa act ggt cac ctg gat tct tca gga ctt 522 Thr Ser Ala Asp Leu Asp Glu Thr Gly His Leu Asp Ser Ser Gly Leu 90 95 100 cag gaa gtg cat tta gct ggg atg aat cat gac cag cac cta atg aaa 570 Gln Glu Val His Leu Ala Gly Met Asn His Asp Gln His Leu Met Lys 105 110 115 120 tgt agc cca gca cag ctt ctt tgt agc act ccg aat ggt ttg gac cgt 618 Cys Ser Pro Ala Gln Leu Leu Cys Ser Thr Pro Asn Gly Leu Asp Arg 125 130 135 ggc cat aga aag aga gat gca atg tgt agt tca tct gca aat aaa gaa 666 Gly His Arg Lys Arg Asp Ala Met Cys Ser Ser Ser Ala Asn Lys Glu 140 145 150 aat gac aat gga aac ttg gtg gac agt gaa atg aaa tat ttg ggc agt 714 Asn Asp Asn Gly Asn Leu Val Asp Ser Glu Met Lys Tyr Leu Gly Ser 155 160 165 ccc att act act gtt cca aaa ttg gat aaa aat cca aac cta gga gaa 762 Pro Ile Thr Thr Val Pro Lys Leu Asp Lys Asn Pro Asn Leu Gly Glu 170 175 180 gac cag gca gaa gag att tca gat gaa tta atg gag ttt tcc ctg aaa 810 Asp Gln Ala Glu Glu Ile Ser Asp Glu Leu Met Glu Phe Ser Leu Lys 185 190 195 200 gat caa gaa gca aag gtg agc aga agt ggc cta tat cgc tcc ccg tcg 858 Asp Gln Glu Ala Lys Val Ser Arg Ser Gly Leu Tyr Arg Ser Pro Ser 205 210 215 atg cca gag aac ttg aac agg cca aga ctg aag cag gtg gaa aaa ttc 906 Met Pro Glu Asn Leu Asn Arg Pro Arg Leu Lys Gln Val Glu Lys Phe 220 225 230 aag gac aac aca ata cca gat aaa gtt aaa aaa aag tat ttt tct ggc 954 Lys Asp Asn Thr Ile Pro Asp Lys Val Lys Lys Lys Tyr Phe Ser Gly 235 240 245 caa gga aag ctc agg aag ggc tta tgt tta aag aag aca gtc tct ctg 1002 Gln Gly Lys Leu Arg Lys Gly Leu Cys Leu Lys Lys Thr Val Ser Leu 250 255 260 tgt gac att act atc act cag atg ctg gag gaa gat tct aac cag ggg 1050 Cys Asp Ile Thr Ile Thr Gln Met Leu Glu Glu Asp Ser Asn Gln Gly 265 270 275 280 cac ctg att ggt gat ttt tcc aag gta tgt gcg ctg cca acc gtg tca 1098 His Leu Ile Gly Asp Phe Ser Lys Val Cys Ala Leu Pro Thr Val Ser 285 290 295 ggg aaa cac caa gat ctg aag tat gtc aac cca gaa aca gtg gct gcc 1146 Gly Lys His Gln Asp Leu Lys Tyr Val Asn Pro Glu Thr Val Ala Ala 300 305 310 tta ctg tcg ggg aag ttc cag ggt ctg att gag aag ttt tat gtc att 1194 Leu Leu Ser Gly Lys Phe Gln Gly Leu Ile Glu Lys Phe Tyr Val Ile 315 320 325 gat tgt cgc tat cca tat gag tat ctg gga gga cac atc cag gga gcc 1242 Asp Cys Arg Tyr Pro Tyr Glu Tyr Leu Gly Gly His Ile Gln Gly Ala 330 335 340 tta aac tta tat agt cag gaa gaa ctg ttt aac ttc ttt ctg aag aag 1290 Leu Asn Leu Tyr Ser Gln Glu Glu Leu Phe Asn Phe Phe Leu Lys Lys 345 350 355 360 ccc atc gtc cct ttg gac acc cag aag aga ata atc atc gtg ttc cac 1338 Pro Ile Val Pro Leu Asp Thr Gln Lys Arg Ile Ile Ile Val Phe His 365 370 375 tgt gaa ttc tcc tca gag agg ggc ccc cga atg tgc cgc tgt ctg cgt 1386 Cys Glu Phe Ser Ser Glu Arg Gly Pro Arg Met Cys Arg Cys Leu Arg 380 385 390 gaa gag gac agg tct ctg aac cag tat cct gca ttg tac tac cca gag 1434 Glu Glu Asp Arg Ser Leu Asn Gln Tyr Pro Ala Leu Tyr Tyr Pro Glu 395 400 405 cta tat atc ctt aaa ggc ggc tac aga gac ttc ttt cca gaa tat atg 1482 Leu Tyr Ile Leu Lys Gly Gly Tyr Arg Asp Phe Phe Pro Glu Tyr Met 410 415 420 gaa ctg tgt gaa cca cag agc tac tgc cct atg cat cat cag gac cac 1530 Glu Leu Cys Glu Pro Gln Ser Tyr Cys Pro Met His His Gln Asp His 425 430 435 440 aag act gag ttg ctg agg tgt cga agc cag agc aaa gtg cag gaa ggg 1578 Lys Thr Glu Leu Leu Arg Cys Arg Ser Gln Ser Lys Val Gln Glu Gly 445 450 455 gag cgg cag ctg cgg gag cag att gcc ctt ctg gtg aag gac atg agc 1626 Glu Arg Gln Leu Arg Glu Gln Ile Ala Leu Leu Val Lys Asp Met Ser 460 465 470 cca tga taacattcca gccactggct gctaacaagt caccaaaaag acactgcaga 1682 Pro * aaccctgagc agaaagaggc cttctggatg gccaaaccca agattattaa aagatgtctc 1742 tgcaaaccaa caggctacca acttgtatcc aggcctggga atggattagg tttcagcaga 1802 gctgaaagct ggtggcagag tcctggagct ggctctataa ggcagccttg agttgcatag 1862 agatttgtat tggttcaggg aactctggca ttccttttcc caactcctca tgtcttctca 1922 caagccagcc aactctttct ctctgggctt cgggctatgc aagagcgttg tctaccttct 1982 ttctttgtat tttccttctt tgtttccccc tctttctttt ttaaaaatgg aaaaataaac 2042 actacagaat gag 2055 <210> SEQ ID NO 26 <211> LENGTH: 473 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 26 Met Ser Thr Glu Leu Phe Ser Ser Thr Arg Glu Glu Gly Ser Ser Gly 1 5 10 15 Ser Gly Pro Ser Phe Arg Ser Asn Gln Arg Lys Met Leu Asn Leu Leu 20 25 30 Leu Glu Arg Asp Thr Ser Phe Thr Val Cys Pro Asp Val Pro Arg Thr 35 40 45 Pro Val Gly Lys Phe Leu Gly Asp Ser Ala Asn Leu Ser Ile Leu Ser 50 55 60 Gly Gly Thr Pro Lys Cys Cys Leu Asp Leu Ser Asn Leu Ser Ser Gly 65 70 75 80 Glu Ile Thr Ala Thr Gln Leu Thr Thr Ser Ala Asp Leu Asp Glu Thr 85 90 95 Gly His Leu Asp Ser Ser Gly Leu Gln Glu Val His Leu Ala Gly Met 100 105 110 Asn His Asp Gln His Leu Met Lys Cys Ser Pro Ala Gln Leu Leu Cys 115 120 125 Ser Thr Pro Asn Gly Leu Asp Arg Gly His Arg Lys Arg Asp Ala Met 130 135 140 Cys Ser Ser Ser Ala Asn Lys Glu Asn Asp Asn Gly Asn Leu Val Asp 145 150 155 160 Ser Glu Met Lys Tyr Leu Gly Ser Pro Ile Thr Thr Val Pro Lys Leu 165 170 175 Asp Lys Asn Pro Asn Leu Gly Glu Asp Gln Ala Glu Glu Ile Ser Asp 180 185 190 Glu Leu Met Glu Phe Ser Leu Lys Asp Gln Glu Ala Lys Val Ser Arg 195 200 205 Ser Gly Leu Tyr Arg Ser Pro Ser Met Pro Glu Asn Leu Asn Arg Pro 210 215 220 Arg Leu Lys Gln Val Glu Lys Phe Lys Asp Asn Thr Ile Pro Asp Lys 225 230 235 240 Val Lys Lys Lys Tyr Phe Ser Gly Gln Gly Lys Leu Arg Lys Gly Leu 245 250 255 Cys Leu Lys Lys Thr Val Ser Leu Cys Asp Ile Thr Ile Thr Gln Met 260 265 270 Leu Glu Glu Asp Ser Asn Gln Gly His Leu Ile Gly Asp Phe Ser Lys 275 280 285 Val Cys Ala Leu Pro Thr Val Ser Gly Lys His Gln Asp Leu Lys Tyr 290 295 300 Val Asn Pro Glu Thr Val Ala Ala Leu Leu Ser Gly Lys Phe Gln Gly 305 310 315 320 Leu Ile Glu Lys Phe Tyr Val Ile Asp Cys Arg Tyr Pro Tyr Glu Tyr 325 330 335 Leu Gly Gly His Ile Gln Gly Ala Leu Asn Leu Tyr Ser Gln Glu Glu 340 345 350 Leu Phe Asn Phe Phe Leu Lys Lys Pro Ile Val Pro Leu Asp Thr Gln 355 360 365 Lys Arg Ile Ile Ile Val Phe His Cys Glu Phe Ser Ser Glu Arg Gly 370 375 380 Pro Arg Met Cys Arg Cys Leu Arg Glu Glu Asp Arg Ser Leu Asn Gln 385 390 395 400 Tyr Pro Ala Leu Tyr Tyr Pro Glu Leu Tyr Ile Leu Lys Gly Gly Tyr 405 410 415 Arg Asp Phe Phe Pro Glu Tyr Met Glu Leu Cys Glu Pro Gln Ser Tyr 420 425 430 Cys Pro Met His His Gln Asp His Lys Thr Glu Leu Leu Arg Cys Arg 435 440 445 Ser Gln Ser Lys Val Gln Glu Gly Glu Arg Gln Leu Arg Glu Gln Ile 450 455 460 Ala Leu Leu Val Lys Asp Met Ser Pro 465 470 <210> SEQ ID NO 27 <211> LENGTH: 17 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 27 Ser Gly Leu Tyr Arg Ser Pro Ser Met Pro Glu Asn Leu Asn Arg Pro 1 5 10 15 Arg <210> SEQ ID NO 28 <211> LENGTH: 14 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 28 Gly Leu Tyr Arg Ser Pro Ser Met Pro Glu Asn Leu Asn Arg 1 5 10 <210> SEQ ID NO 29 <211> LENGTH: 2295 <212> TYPE: DNA <213> ORGANISM: Saccharomyces cerevisiae <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2295) <400> SEQUENCE: 29 atg tca aca aac tca ttc cat gat tat gtg gat tta aaa tcg aga act 48 Met Ser Thr Asn Ser Phe His Asp Tyr Val Asp Leu Lys Ser Arg Thr 1 5 10 15 aat aca cga cag ttt tca gat gac gaa gag ttc act acg cct cca aaa 96 Asn Thr Arg Gln Phe Ser Asp Asp Glu Glu Phe Thr Thr Pro Pro Lys 20 25 30 cta agc aat ttc gga tca gct tta ctt tcc cac aca gaa aaa act tca 144 Leu Ser Asn Phe Gly Ser Ala Leu Leu Ser His Thr Glu Lys Thr Ser 35 40 45 gca tca gag ata tta tca agt cat aat aat gac aag atc gca aat cga 192 Ala Ser Glu Ile Leu Ser Ser His Asn Asn Asp Lys Ile Ala Asn Arg 50 55 60 tta gaa gaa atg gac agg agt tca tca agg agt cac ccc cca ccg tca 240 Leu Glu Glu Met Asp Arg Ser Ser Ser Arg Ser His Pro Pro Pro Ser 65 70 75 80 atg ggc aat ttg aca tcc ggt cat act agt acc tca tcg cat tca acc 288 Met Gly Asn Leu Thr Ser Gly His Thr Ser Thr Ser Ser His Ser Thr 85 90 95 ttg ttc gga cga tat ctg aga aat aat cac cag act agc atg acg acg 336 Leu Phe Gly Arg Tyr Leu Arg Asn Asn His Gln Thr Ser Met Thr Thr 100 105 110 atg aac act agt gac ata gag ata aat gtt gga aat agt ctt gat aag 384 Met Asn Thr Ser Asp Ile Glu Ile Asn Val Gly Asn Ser Leu Asp Lys 115 120 125 agt ttt gaa agg ata agg aat ttg cga caa aat atg aaa gaa gat att 432 Ser Phe Glu Arg Ile Arg Asn Leu Arg Gln Asn Met Lys Glu Asp Ile 130 135 140 acg gca aag tat gct gaa agg aga agt aag aga ttt tta ata tcc aat 480 Thr Ala Lys Tyr Ala Glu Arg Arg Ser Lys Arg Phe Leu Ile Ser Asn 145 150 155 160 agg aca acg aag ctg ggt cct gca aag aga gcg atg act ttg aca aat 528 Arg Thr Thr Lys Leu Gly Pro Ala Lys Arg Ala Met Thr Leu Thr Asn 165 170 175 atc ttt gat gag gat gtg cct aac tct cca aac cag cca ata aat gca 576 Ile Phe Asp Glu Asp Val Pro Asn Ser Pro Asn Gln Pro Ile Asn Ala 180 185 190 agg gag aca gtg gaa tta cca ctt gag gat tct cac caa aca aac ttt 624 Arg Glu Thr Val Glu Leu Pro Leu Glu Asp Ser His Gln Thr Asn Phe 195 200 205 aaa gaa cga aga gag aat acg gat tat gat tca att gat ttt gga gat 672 Lys Glu Arg Arg Glu Asn Thr Asp Tyr Asp Ser Ile Asp Phe Gly Asp 210 215 220 ttg aat cct atc cag tat att aaa aaa cat aat ctt ccc aca agt gac 720 Leu Asn Pro Ile Gln Tyr Ile Lys Lys His Asn Leu Pro Thr Ser Asp 225 230 235 240 ctt cca cta ata tct caa atc tac ttt gat aaa caa aga gaa gaa aat 768 Leu Pro Leu Ile Ser Gln Ile Tyr Phe Asp Lys Gln Arg Glu Glu Asn 245 250 255 aga caa gca gca ctc cga aaa cat agt tcc aga gaa ttg ctt tat aaa 816 Arg Gln Ala Ala Leu Arg Lys His Ser Ser Arg Glu Leu Leu Tyr Lys 260 265 270 agt agg tct tct tcc tct tca ctt tct agt aac aac tta ttg gca aac 864 Ser Arg Ser Ser Ser Ser Ser Leu Ser Ser Asn Asn Leu Leu Ala Asn 275 280 285 aag gac aat tct ata aca tcc aat aat ggt tct caa ccc agg cga aaa 912 Lys Asp Asn Ser Ile Thr Ser Asn Asn Gly Ser Gln Pro Arg Arg Lys 290 295 300 gtt tct act gga tca tct tca tct aag tca tcg atc gaa ata aga aga 960 Val Ser Thr Gly Ser Ser Ser Ser Lys Ser Ser Ile Glu Ile Arg Arg 305 310 315 320 gct ctc aag gag aat att gat act agc aat aac agc aat ttc aac agc 1008 Ala Leu Lys Glu Asn Ile Asp Thr Ser Asn Asn Ser Asn Phe Asn Ser 325 330 335 cca att cat aaa att tat aaa gga att tcc aga aat aaa gat tcc gac 1056 Pro Ile His Lys Ile Tyr Lys Gly Ile Ser Arg Asn Lys Asp Ser Asp 340 345 350 tcc gaa aaa aga gaa gta ctg cga aac ata agc ata aat gca aat cac 1104 Ser Glu Lys Arg Glu Val Leu Arg Asn Ile Ser Ile Asn Ala Asn His 355 360 365 gct gat aat ctc ctt caa caa gag aat aag aga cta aaa cga tca ttg 1152 Ala Asp Asn Leu Leu Gln Gln Glu Asn Lys Arg Leu Lys Arg Ser Leu 370 375 380 gat gat gca ata acg aat gag aat ata aac agt aaa aat cta gaa gta 1200 Asp Asp Ala Ile Thr Asn Glu Asn Ile Asn Ser Lys Asn Leu Glu Val 385 390 395 400 ttt tac cat cga cct gct ccc aaa cct cca gtc acc aag aaa gtt gaa 1248 Phe Tyr His Arg Pro Ala Pro Lys Pro Pro Val Thr Lys Lys Val Glu 405 410 415 att gtt gaa cct gca aag tcc gct tct tta tcg aat aat aga aat ata 1296 Ile Val Glu Pro Ala Lys Ser Ala Ser Leu Ser Asn Asn Arg Asn Ile 420 425 430 att aca gta aat gac tcc cag tac gaa aaa ata gaa ctt ttg ggt aga 1344 Ile Thr Val Asn Asp Ser Gln Tyr Glu Lys Ile Glu Leu Leu Gly Arg 435 440 445 ggt gga tcc tcc aga gtt tac aag gtg aaa gga tct ggc aat agg gta 1392 Gly Gly Ser Ser Arg Val Tyr Lys Val Lys Gly Ser Gly Asn Arg Val 450 455 460 tac gcg ctc aaa agg gtg tct ttt gac gct ttt gac gat tca agt att 1440 Tyr Ala Leu Lys Arg Val Ser Phe Asp Ala Phe Asp Asp Ser Ser Ile 465 470 475 480 gat gga ttc aaa gga gaa ata gaa ctt ctg gaa aaa ttg aaa gac caa 1488 Asp Gly Phe Lys Gly Glu Ile Glu Leu Leu Glu Lys Leu Lys Asp Gln 485 490 495 aag cgt gta atc caa cta cta gat tat gaa atg ggg gat ggt tta ttg 1536 Lys Arg Val Ile Gln Leu Leu Asp Tyr Glu Met Gly Asp Gly Leu Leu 500 505 510 tat ttg ata atg gaa tgt ggt gat cat gat ttg tca caa atc ctt aac 1584 Tyr Leu Ile Met Glu Cys Gly Asp His Asp Leu Ser Gln Ile Leu Asn 515 520 525 caa aga agc ggc atg cca ctg gat ttt aat ttt gtt aga ttc tat aca 1632 Gln Arg Ser Gly Met Pro Leu Asp Phe Asn Phe Val Arg Phe Tyr Thr 530 535 540 aag gaa atg ttg ctg tgc att aaa gta gtt cat gat gcg ggc ata gtt 1680 Lys Glu Met Leu Leu Cys Ile Lys Val Val His Asp Ala Gly Ile Val 545 550 555 560 cat tcg gat tta aaa cct gca aat ttt gtt tta gtg aaa ggt atc tta 1728 His Ser Asp Leu Lys Pro Ala Asn Phe Val Leu Val Lys Gly Ile Leu 565 570 575 aaa atc att gat ttt ggt ata gca aac gcg gta ccg gaa cat acg gtg 1776 Lys Ile Ile Asp Phe Gly Ile Ala Asn Ala Val Pro Glu His Thr Val 580 585 590 aat ata tat cgt gaa act caa att ggg act cca aat tat atg gca cca 1824 Asn Ile Tyr Arg Glu Thr Gln Ile Gly Thr Pro Asn Tyr Met Ala Pro 595 600 605 gaa gca cta gtt gct atg aat tac aca caa aat agt gag aac caa cat 1872 Glu Ala Leu Val Ala Met Asn Tyr Thr Gln Asn Ser Glu Asn Gln His 610 615 620 gag gga aac aag tgg aaa gtg ggg aga cca tct gat atg tgg tca tgc 1920 Glu Gly Asn Lys Trp Lys Val Gly Arg Pro Ser Asp Met Trp Ser Cys 625 630 635 640 ggt tgt att ata tat cag atg att tac ggg aaa ccc cca tat ggc agt 1968 Gly Cys Ile Ile Tyr Gln Met Ile Tyr Gly Lys Pro Pro Tyr Gly Ser 645 650 655 ttc caa ggc caa aat agg ctg ttg gct att atg aat cct gat gtg aaa 2016 Phe Gln Gly Gln Asn Arg Leu Leu Ala Ile Met Asn Pro Asp Val Lys 660 665 670 atc cca ttt cct gaa cat act agc aat aat gaa aag att cca aag tct 2064 Ile Pro Phe Pro Glu His Thr Ser Asn Asn Glu Lys Ile Pro Lys Ser 675 680 685 gcc att gaa tta atg aaa gca tgt ctg tac agg aac cca gac aaa aga 2112 Ala Ile Glu Leu Met Lys Ala Cys Leu Tyr Arg Asn Pro Asp Lys Arg 690 695 700 tgg act gtg gat aaa gtc ctg agt agc act ttc ctt caa cct ttt atg 2160 Trp Thr Val Asp Lys Val Leu Ser Ser Thr Phe Leu Gln Pro Phe Met 705 710 715 720 ata tcc gga tcg att atg gaa gac ctt att agg aat gcc gtt aga tat 2208 Ile Ser Gly Ser Ile Met Glu Asp Leu Ile Arg Asn Ala Val Arg Tyr 725 730 735 ggc tct gag aag cct cat ata tca caa gat gat ctc aat gat gtg gta 2256 Gly Ser Glu Lys Pro His Ile Ser Gln Asp Asp Leu Asn Asp Val Val 740 745 750 gac act gtt tta agg aaa ttt gca gat tac aaa att tag 2295 Asp Thr Val Leu Arg Lys Phe Ala Asp Tyr Lys Ile * 755 760 <210> SEQ ID NO 30 <211> LENGTH: 764 <212> TYPE: PRT <213> ORGANISM: Saccharomyces cerevisiae <400> SEQUENCE: 30 Met Ser Thr Asn Ser Phe His Asp Tyr Val Asp Leu Lys Ser Arg Thr 1 5 10 15 Asn Thr Arg Gln Phe Ser Asp Asp Glu Glu Phe Thr Thr Pro Pro Lys 20 25 30 Leu Ser Asn Phe Gly Ser Ala Leu Leu Ser His Thr Glu Lys Thr Ser 35 40 45 Ala Ser Glu Ile Leu Ser Ser His Asn Asn Asp Lys Ile Ala Asn Arg 50 55 60 Leu Glu Glu Met Asp Arg Ser Ser Ser Arg Ser His Pro Pro Pro Ser 65 70 75 80 Met Gly Asn Leu Thr Ser Gly His Thr Ser Thr Ser Ser His Ser Thr 85 90 95 Leu Phe Gly Arg Tyr Leu Arg Asn Asn His Gln Thr Ser Met Thr Thr 100 105 110 Met Asn Thr Ser Asp Ile Glu Ile Asn Val Gly Asn Ser Leu Asp Lys 115 120 125 Ser Phe Glu Arg Ile Arg Asn Leu Arg Gln Asn Met Lys Glu Asp Ile 130 135 140 Thr Ala Lys Tyr Ala Glu Arg Arg Ser Lys Arg Phe Leu Ile Ser Asn 145 150 155 160 Arg Thr Thr Lys Leu Gly Pro Ala Lys Arg Ala Met Thr Leu Thr Asn 165 170 175 Ile Phe Asp Glu Asp Val Pro Asn Ser Pro Asn Gln Pro Ile Asn Ala 180 185 190 Arg Glu Thr Val Glu Leu Pro Leu Glu Asp Ser His Gln Thr Asn Phe 195 200 205 Lys Glu Arg Arg Glu Asn Thr Asp Tyr Asp Ser Ile Asp Phe Gly Asp 210 215 220 Leu Asn Pro Ile Gln Tyr Ile Lys Lys His Asn Leu Pro Thr Ser Asp 225 230 235 240 Leu Pro Leu Ile Ser Gln Ile Tyr Phe Asp Lys Gln Arg Glu Glu Asn 245 250 255 Arg Gln Ala Ala Leu Arg Lys His Ser Ser Arg Glu Leu Leu Tyr Lys 260 265 270 Ser Arg Ser Ser Ser Ser Ser Leu Ser Ser Asn Asn Leu Leu Ala Asn 275 280 285 Lys Asp Asn Ser Ile Thr Ser Asn Asn Gly Ser Gln Pro Arg Arg Lys 290 295 300 Val Ser Thr Gly Ser Ser Ser Ser Lys Ser Ser Ile Glu Ile Arg Arg 305 310 315 320 Ala Leu Lys Glu Asn Ile Asp Thr Ser Asn Asn Ser Asn Phe Asn Ser 325 330 335 Pro Ile His Lys Ile Tyr Lys Gly Ile Ser Arg Asn Lys Asp Ser Asp 340 345 350 Ser Glu Lys Arg Glu Val Leu Arg Asn Ile Ser Ile Asn Ala Asn His 355 360 365 Ala Asp Asn Leu Leu Gln Gln Glu Asn Lys Arg Leu Lys Arg Ser Leu 370 375 380 Asp Asp Ala Ile Thr Asn Glu Asn Ile Asn Ser Lys Asn Leu Glu Val 385 390 395 400 Phe Tyr His Arg Pro Ala Pro Lys Pro Pro Val Thr Lys Lys Val Glu 405 410 415 Ile Val Glu Pro Ala Lys Ser Ala Ser Leu Ser Asn Asn Arg Asn Ile 420 425 430 Ile Thr Val Asn Asp Ser Gln Tyr Glu Lys Ile Glu Leu Leu Gly Arg 435 440 445 Gly Gly Ser Ser Arg Val Tyr Lys Val Lys Gly Ser Gly Asn Arg Val 450 455 460 Tyr Ala Leu Lys Arg Val Ser Phe Asp Ala Phe Asp Asp Ser Ser Ile 465 470 475 480 Asp Gly Phe Lys Gly Glu Ile Glu Leu Leu Glu Lys Leu Lys Asp Gln 485 490 495 Lys Arg Val Ile Gln Leu Leu Asp Tyr Glu Met Gly Asp Gly Leu Leu 500 505 510 Tyr Leu Ile Met Glu Cys Gly Asp His Asp Leu Ser Gln Ile Leu Asn 515 520 525 Gln Arg Ser Gly Met Pro Leu Asp Phe Asn Phe Val Arg Phe Tyr Thr 530 535 540 Lys Glu Met Leu Leu Cys Ile Lys Val Val His Asp Ala Gly Ile Val 545 550 555 560 His Ser Asp Leu Lys Pro Ala Asn Phe Val Leu Val Lys Gly Ile Leu 565 570 575 Lys Ile Ile Asp Phe Gly Ile Ala Asn Ala Val Pro Glu His Thr Val 580 585 590 Asn Ile Tyr Arg Glu Thr Gln Ile Gly Thr Pro Asn Tyr Met Ala Pro 595 600 605 Glu Ala Leu Val Ala Met Asn Tyr Thr Gln Asn Ser Glu Asn Gln His 610 615 620 Glu Gly Asn Lys Trp Lys Val Gly Arg Pro Ser Asp Met Trp Ser Cys 625 630 635 640 Gly Cys Ile Ile Tyr Gln Met Ile Tyr Gly Lys Pro Pro Tyr Gly Ser 645 650 655 Phe Gln Gly Gln Asn Arg Leu Leu Ala Ile Met Asn Pro Asp Val Lys 660 665 670 Ile Pro Phe Pro Glu His Thr Ser Asn Asn Glu Lys Ile Pro Lys Ser 675 680 685 Ala Ile Glu Leu Met Lys Ala Cys Leu Tyr Arg Asn Pro Asp Lys Arg 690 695 700 Trp Thr Val Asp Lys Val Leu Ser Ser Thr Phe Leu Gln Pro Phe Met 705 710 715 720 Ile Ser Gly Ser Ile Met Glu Asp Leu Ile Arg Asn Ala Val Arg Tyr 725 730 735 Gly Ser Glu Lys Pro His Ile Ser Gln Asp Asp Leu Asn Asp Val Val 740 745 750 Asp Thr Val Leu Arg Lys Phe Ala Asp Tyr Lys Ile 755 760 <210> SEQ ID NO 31 <211> LENGTH: 2079 <212> TYPE: DNA <213> ORGANISM: Schizosaccharomyces pombe <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (30)...(2066) <400> SEQUENCE: 31 ggaatgctcg ttttttagta actgtgttt atg tct aag cgc aat cct cct gtg 53 Met Ser Lys Arg Asn Pro Pro Val 1 5 act aat atc gcg gac ttg gtg tca gat tct tcc tta gat gaa gac tcg 101 Thr Asn Ile Ala Asp Leu Val Ser Asp Ser Ser Leu Asp Glu Asp Ser 10 15 20 ctt tct ttt ctc gaa gag ctt cag gat cca gaa tta tac ttc aaa aac 149 Leu Ser Phe Leu Glu Glu Leu Gln Asp Pro Glu Leu Tyr Phe Lys Asn 25 30 35 40 gac act ttc tct tcc aag agt agc cat tct gat ggc acc gtt act ggg 197 Asp Thr Phe Ser Ser Lys Ser Ser His Ser Asp Gly Thr Val Thr Gly 45 50 55 gat acg ttg cgt agg cag tca agc ggt gca act gct tta gag aga ttg 245 Asp Thr Leu Arg Arg Gln Ser Ser Gly Ala Thr Ala Leu Glu Arg Leu 60 65 70 gtc tca cat cct cgt act aaa aat ttt gat ttg caa gga aat gga gga 293 Val Ser His Pro Arg Thr Lys Asn Phe Asp Leu Gln Gly Asn Gly Gly 75 80 85 caa aat tct gct ttg aag gaa gtg aat act cca gca tat cag tca atg 341 Gln Asn Ser Ala Leu Lys Glu Val Asn Thr Pro Ala Tyr Gln Ser Met 90 95 100 cac cat ttc gag cat tta ata aca ccc ttg ccc tct act aat gcg tct 389 His His Phe Glu His Leu Ile Thr Pro Leu Pro Ser Thr Asn Ala Ser 105 110 115 120 cac agt gaa gtt tca ctc agt gca gga gtg aat gat ctc aat tct aat 437 His Ser Glu Val Ser Leu Ser Ala Gly Val Asn Asp Leu Asn Ser Asn 125 130 135 tcg gag cat gat ttg tta cct aaa agt gta aac aaa acc ccc ggt tct 485 Ser Glu His Asp Leu Leu Pro Lys Ser Val Asn Lys Thr Pro Gly Ser 140 145 150 tta tca att tca aga cga cga aga atc ggc aga att gga tta ggc cct 533 Leu Ser Ile Ser Arg Arg Arg Arg Ile Gly Arg Ile Gly Leu Gly Pro 155 160 165 cca aag cgt gct gag tac acg ttg acg gat ccc tcg aag act tcc gat 581 Pro Lys Arg Ala Glu Tyr Thr Leu Thr Asp Pro Ser Lys Thr Ser Asp 170 175 180 acc aaa aac tct aca gaa gca gat gag gat att gaa atg aaa tct cga 629 Thr Lys Asn Ser Thr Glu Ala Asp Glu Asp Ile Glu Met Lys Ser Arg 185 190 195 200 gaa gta tca cca gct tcc aac tct gtt gct gca aca act tta aaa cct 677 Glu Val Ser Pro Ala Ser Asn Ser Val Ala Ala Thr Thr Leu Lys Pro 205 210 215 ctg cag ctg cat aac act cct ttg caa aca tcc cag gag cat ccc aaa 725 Leu Gln Leu His Asn Thr Pro Leu Gln Thr Ser Gln Glu His Pro Lys 220 225 230 cct tct ttt cat cct tct cag ttt gag agc tct ttt tct cct agg gtg 773 Pro Ser Phe His Pro Ser Gln Phe Glu Ser Ser Phe Ser Pro Arg Val 235 240 245 cag ttt gat cac gat gtt gaa aga aga gct agt gaa ctt cat tct cgt 821 Gln Phe Asp His Asp Val Glu Arg Arg Ala Ser Glu Leu His Ser Arg 250 255 260 cca gtc acc gtt ttc caa gag cct cag cgt tct gct tct caa cca tat 869 Pro Val Thr Val Phe Gln Glu Pro Gln Arg Ser Ala Ser Gln Pro Tyr 265 270 275 280 gaa tct cat gct ctt tct cca aag gtg gct ccg tta ttt gat aac agt 917 Glu Ser His Ala Leu Ser Pro Lys Val Ala Pro Leu Phe Asp Asn Ser 285 290 295 caa gct act ccc ata ccc aag cgt cag cag gac gtt gtt act gtt gcc 965 Gln Ala Thr Pro Ile Pro Lys Arg Gln Gln Asp Val Val Thr Val Ala 300 305 310 aat cta caa ttt atc aaa tta gga gtt gtt gga aag ggt gga agt agt 1013 Asn Leu Gln Phe Ile Lys Leu Gly Val Val Gly Lys Gly Gly Ser Ser 315 320 325 atg gta tat cgc ata ttt tcc ccc gat aac agt cgt tta tac gct ttg 1061 Met Val Tyr Arg Ile Phe Ser Pro Asp Asn Ser Arg Leu Tyr Ala Leu 330 335 340 aaa gag gtg aac ttt att aat gca gac caa act act ata caa gga tac 1109 Lys Glu Val Asn Phe Ile Asn Ala Asp Gln Thr Thr Ile Gln Gly Tyr 345 350 355 360 aag aac gaa att gca tta tta aga aag ctt tca ggc aat gat cgc ata 1157 Lys Asn Glu Ile Ala Leu Leu Arg Lys Leu Ser Gly Asn Asp Arg Ile 365 370 375 att aaa tta tat gct gcc gaa gtt aat gat act tta ggg caa ctc aat 1205 Ile Lys Leu Tyr Ala Ala Glu Val Asn Asp Thr Leu Gly Gln Leu Asn 380 385 390 atg gtg atg gaa tgc gga gaa acg gat tta gca aac ctt tta atg aaa 1253 Met Val Met Glu Cys Gly Glu Thr Asp Leu Ala Asn Leu Leu Met Lys 395 400 405 aac atg aag aaa ccc att aat ctt aat ttc atc aga atg tat tgg gag 1301 Asn Met Lys Lys Pro Ile Asn Leu Asn Phe Ile Arg Met Tyr Trp Glu 410 415 420 caa atg cta gag gcg gtc cag gta gtt cat gat caa aat ata gtg cat 1349 Gln Met Leu Glu Ala Val Gln Val Val His Asp Gln Asn Ile Val His 425 430 435 440 tcg gat ttg aag ccg gcc aat ttc ctg ctt gta gaa ggg aat ttg aag 1397 Ser Asp Leu Lys Pro Ala Asn Phe Leu Leu Val Glu Gly Asn Leu Lys 445 450 455 ctg att gat ttt ggc att gcc aaa gca att ggt aat gac acc act aat 1445 Leu Ile Asp Phe Gly Ile Ala Lys Ala Ile Gly Asn Asp Thr Thr Asn 460 465 470 atc cat cgt gat tcc cac atc ggt act att aat tat atg gca cct gaa 1493 Ile His Arg Asp Ser His Ile Gly Thr Ile Asn Tyr Met Ala Pro Glu 475 480 485 gct ttg aca gac atg aat gct cac aca aac tct ggc gtg aaa ctc gta 1541 Ala Leu Thr Asp Met Asn Ala His Thr Asn Ser Gly Val Lys Leu Val 490 495 500 aag ttg ggc agg ccc agc gac gtg tgg agt ttg gga tgt ata tta tat 1589 Lys Leu Gly Arg Pro Ser Asp Val Trp Ser Leu Gly Cys Ile Leu Tyr 505 510 515 520 cag atg gtg tat ggg agg gcc ccg ttt gct cat cta aaa atg atc caa 1637 Gln Met Val Tyr Gly Arg Ala Pro Phe Ala His Leu Lys Met Ile Gln 525 530 535 gct ata gca gct atc cct aat gaa caa tat cac att cat ttc ccc gaa 1685 Ala Ile Ala Ala Ile Pro Asn Glu Gln Tyr His Ile His Phe Pro Glu 540 545 550 gtt gcc tta cct gct aat gct gtc cag gag aaa gag gga tcg ttg cca 1733 Val Ala Leu Pro Ala Asn Ala Val Gln Glu Lys Glu Gly Ser Leu Pro 555 560 565 ggt gta act gtc ggg cct gat cta atg gat gtt atg aaa aga tgc ctg 1781 Gly Val Thr Val Gly Pro Asp Leu Met Asp Val Met Lys Arg Cys Leu 570 575 580 gaa agg gat caa cgg aag aga ctt aca ata ccg gaa ttg ctg gtt cat 1829 Glu Arg Asp Gln Arg Lys Arg Leu Thr Ile Pro Glu Leu Leu Val His 585 590 595 600 ccc ttt tta aac cct ttg cca tcc tat ttg aca cct ttg gcc aaa aag 1877 Pro Phe Leu Asn Pro Leu Pro Ser Tyr Leu Thr Pro Leu Ala Lys Lys 605 610 615 ccg tta cct gtt tct ggg cac acc aat aat gct cat cca ctt aga ctc 1925 Pro Leu Pro Val Ser Gly His Thr Asn Asn Ala His Pro Leu Arg Leu 620 625 630 agc aca gaa atc tca gct tct caa tta tca atg att ata gaa agg tcg 1973 Ser Thr Glu Ile Ser Ala Ser Gln Leu Ser Met Ile Ile Glu Arg Ser 635 640 645 gtg gag ttg agt aag cac aag cga tta aat aag gaa ctt att gat agc 2021 Val Glu Leu Ser Lys His Lys Arg Leu Asn Lys Glu Leu Ile Asp Ser 650 655 660 atg gct tat gat tgc gtt agc aat tta cga aaa atg cca gaa tag 2066 Met Ala Tyr Asp Cys Val Ser Asn Leu Arg Lys Met Pro Glu * 665 670 675 aggcactaaa ttt 2079 <210> SEQ ID NO 32 <211> LENGTH: 678 <212> TYPE: PRT <213> ORGANISM: Schizosaccharomyces pombe <400> SEQUENCE: 32 Met Ser Lys Arg Asn Pro Pro Val Thr Asn Ile Ala Asp Leu Val Ser 1 5 10 15 Asp Ser Ser Leu Asp Glu Asp Ser Leu Ser Phe Leu Glu Glu Leu Gln 20 25 30 Asp Pro Glu Leu Tyr Phe Lys Asn Asp Thr Phe Ser Ser Lys Ser Ser 35 40 45 His Ser Asp Gly Thr Val Thr Gly Asp Thr Leu Arg Arg Gln Ser Ser 50 55 60 Gly Ala Thr Ala Leu Glu Arg Leu Val Ser His Pro Arg Thr Lys Asn 65 70 75 80 Phe Asp Leu Gln Gly Asn Gly Gly Gln Asn Ser Ala Leu Lys Glu Val 85 90 95 Asn Thr Pro Ala Tyr Gln Ser Met His His Phe Glu His Leu Ile Thr 100 105 110 Pro Leu Pro Ser Thr Asn Ala Ser His Ser Glu Val Ser Leu Ser Ala 115 120 125 Gly Val Asn Asp Leu Asn Ser Asn Ser Glu His Asp Leu Leu Pro Lys 130 135 140 Ser Val Asn Lys Thr Pro Gly Ser Leu Ser Ile Ser Arg Arg Arg Arg 145 150 155 160 Ile Gly Arg Ile Gly Leu Gly Pro Pro Lys Arg Ala Glu Tyr Thr Leu 165 170 175 Thr Asp Pro Ser Lys Thr Ser Asp Thr Lys Asn Ser Thr Glu Ala Asp 180 185 190 Glu Asp Ile Glu Met Lys Ser Arg Glu Val Ser Pro Ala Ser Asn Ser 195 200 205 Val Ala Ala Thr Thr Leu Lys Pro Leu Gln Leu His Asn Thr Pro Leu 210 215 220 Gln Thr Ser Gln Glu His Pro Lys Pro Ser Phe His Pro Ser Gln Phe 225 230 235 240 Glu Ser Ser Phe Ser Pro Arg Val Gln Phe Asp His Asp Val Glu Arg 245 250 255 Arg Ala Ser Glu Leu His Ser Arg Pro Val Thr Val Phe Gln Glu Pro 260 265 270 Gln Arg Ser Ala Ser Gln Pro Tyr Glu Ser His Ala Leu Ser Pro Lys 275 280 285 Val Ala Pro Leu Phe Asp Asn Ser Gln Ala Thr Pro Ile Pro Lys Arg 290 295 300 Gln Gln Asp Val Val Thr Val Ala Asn Leu Gln Phe Ile Lys Leu Gly 305 310 315 320 Val Val Gly Lys Gly Gly Ser Ser Met Val Tyr Arg Ile Phe Ser Pro 325 330 335 Asp Asn Ser Arg Leu Tyr Ala Leu Lys Glu Val Asn Phe Ile Asn Ala 340 345 350 Asp Gln Thr Thr Ile Gln Gly Tyr Lys Asn Glu Ile Ala Leu Leu Arg 355 360 365 Lys Leu Ser Gly Asn Asp Arg Ile Ile Lys Leu Tyr Ala Ala Glu Val 370 375 380 Asn Asp Thr Leu Gly Gln Leu Asn Met Val Met Glu Cys Gly Glu Thr 385 390 395 400 Asp Leu Ala Asn Leu Leu Met Lys Asn Met Lys Lys Pro Ile Asn Leu 405 410 415 Asn Phe Ile Arg Met Tyr Trp Glu Gln Met Leu Glu Ala Val Gln Val 420 425 430 Val His Asp Gln Asn Ile Val His Ser Asp Leu Lys Pro Ala Asn Phe 435 440 445 Leu Leu Val Glu Gly Asn Leu Lys Leu Ile Asp Phe Gly Ile Ala Lys 450 455 460 Ala Ile Gly Asn Asp Thr Thr Asn Ile His Arg Asp Ser His Ile Gly 465 470 475 480 Thr Ile Asn Tyr Met Ala Pro Glu Ala Leu Thr Asp Met Asn Ala His 485 490 495 Thr Asn Ser Gly Val Lys Leu Val Lys Leu Gly Arg Pro Ser Asp Val 500 505 510 Trp Ser Leu Gly Cys Ile Leu Tyr Gln Met Val Tyr Gly Arg Ala Pro 515 520 525 Phe Ala His Leu Lys Met Ile Gln Ala Ile Ala Ala Ile Pro Asn Glu 530 535 540 Gln Tyr His Ile His Phe Pro Glu Val Ala Leu Pro Ala Asn Ala Val 545 550 555 560 Gln Glu Lys Glu Gly Ser Leu Pro Gly Val Thr Val Gly Pro Asp Leu 565 570 575 Met Asp Val Met Lys Arg Cys Leu Glu Arg Asp Gln Arg Lys Arg Leu 580 585 590 Thr Ile Pro Glu Leu Leu Val His Pro Phe Leu Asn Pro Leu Pro Ser 595 600 605 Tyr Leu Thr Pro Leu Ala Lys Lys Pro Leu Pro Val Ser Gly His Thr 610 615 620 Asn Asn Ala His Pro Leu Arg Leu Ser Thr Glu Ile Ser Ala Ser Gln 625 630 635 640 Leu Ser Met Ile Ile Glu Arg Ser Val Glu Leu Ser Lys His Lys Arg 645 650 655 Leu Asn Lys Glu Leu Ile Asp Ser Met Ala Tyr Asp Cys Val Ser Asn 660 665 670 Leu Arg Lys Met Pro Glu 675 <210> SEQ ID NO 33 <211> LENGTH: 2263 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (379)...(1491) <400> SEQUENCE: 33 gatatcacag caacattgaa atgctaaaaa gtttttaaac actctcaatt tctaattcac 60 catgtcacag actggtgaaa aaaaaaaaaa aagcggccgc ttccccccgg ccgggccccc 120 gccgccccgc ggtccccaga gcgccaggcc cccgggggga gggagggagg gcgccgggcc 180 ggtgggagcc agcggcgcgc ggtgggaccc acggagcccc gcgacccgcc gagcctggag 240 ccgggccggc tcggggaagc cggctccagc ccggagcgaa cttcgcagcc cgtcgggggg 300 cggcggggag ggggcccgga gccggaggag ggggcggccg cgggcacccc cgcctgtgcc 360 ccggcgtccc cgggcacc atg ctg tcc aac tcc cag ggc cag agc ccg ccg 411 Met Leu Ser Asn Ser Gln Gly Gln Ser Pro Pro 1 5 10 gtg ccg ttc ccc gcc ccg gcc ccg ccg ccg cag ccc ccc acc cct gcc 459 Val Pro Phe Pro Ala Pro Ala Pro Pro Pro Gln Pro Pro Thr Pro Ala 15 20 25 ctg ccg cac ccc ccg gcg cag ccg ccg ccg ccg ccc ccg cag cag ttc 507 Leu Pro His Pro Pro Ala Gln Pro Pro Pro Pro Pro Pro Gln Gln Phe 30 35 40 ccg cag ttc cac gtc aag tcc ggc ctg cag atc aag aag aac gcc atc 555 Pro Gln Phe His Val Lys Ser Gly Leu Gln Ile Lys Lys Asn Ala Ile 45 50 55 atc gat gac tac aag gtc acc agc cag gtc ctg ggg ctg ggc atc aac 603 Ile Asp Asp Tyr Lys Val Thr Ser Gln Val Leu Gly Leu Gly Ile Asn 60 65 70 75 ggc aaa gtt ttg cag atc ttc aac aag agg acc cag gag aaa ttc gcc 651 Gly Lys Val Leu Gln Ile Phe Asn Lys Arg Thr Gln Glu Lys Phe Ala 80 85 90 ctc aaa atg ctt cag gac tgc ccc aag gcc cgc agg gag gtg gag ctg 699 Leu Lys Met Leu Gln Asp Cys Pro Lys Ala Arg Arg Glu Val Glu Leu 95 100 105 cac tgg cgg gcc tcc cag tgc ccg cac atc gta cgg atc gtg gat gtg 747 His Trp Arg Ala Ser Gln Cys Pro His Ile Val Arg Ile Val Asp Val 110 115 120 tac gag aat ctg tac gca ggg agg aag tgc ctg ctg att gtc atg gaa 795 Tyr Glu Asn Leu Tyr Ala Gly Arg Lys Cys Leu Leu Ile Val Met Glu 125 130 135 tgt ttg gac ggt gga gaa ctc ttt agc cga atc cag gat cga gga gac 843 Cys Leu Asp Gly Gly Glu Leu Phe Ser Arg Ile Gln Asp Arg Gly Asp 140 145 150 155 cag gca ttc aca gaa aga gaa gca tcc gaa atc atg aag agc atc ggt 891 Gln Ala Phe Thr Glu Arg Glu Ala Ser Glu Ile Met Lys Ser Ile Gly 160 165 170 gag gcc atc cag tat ctg cat tca atc aac att gcc cat cgg gat gtc 939 Glu Ala Ile Gln Tyr Leu His Ser Ile Asn Ile Ala His Arg Asp Val 175 180 185 aag cct gag aat ctc tta tac acc tcc aaa agg ccc aac gcc atc ctg 987 Lys Pro Glu Asn Leu Leu Tyr Thr Ser Lys Arg Pro Asn Ala Ile Leu 190 195 200 aaa ctc act gac ttt ggc ttt gcc aag gaa acc acc agc cac aac tct 1035 Lys Leu Thr Asp Phe Gly Phe Ala Lys Glu Thr Thr Ser His Asn Ser 205 210 215 ttg acc act cct tgt tat aca ccg tac tat gtg gct cca gaa gtg ctg 1083 Leu Thr Thr Pro Cys Tyr Thr Pro Tyr Tyr Val Ala Pro Glu Val Leu 220 225 230 235 ggt cca gag aag tat gac aag tcc tgt gac atg tgg tcc ctg ggt gtc 1131 Gly Pro Glu Lys Tyr Asp Lys Ser Cys Asp Met Trp Ser Leu Gly Val 240 245 250 atc atg tac atc ctg ctg tgt ggg tat ccc ccc ttc tac tcc aac cac 1179 Ile Met Tyr Ile Leu Leu Cys Gly Tyr Pro Pro Phe Tyr Ser Asn His 255 260 265 ggc ctt gcc atc tct ccg ggc atg aag act cgc atc cga atg ggc cag 1227 Gly Leu Ala Ile Ser Pro Gly Met Lys Thr Arg Ile Arg Met Gly Gln 270 275 280 tat gaa ttt ccc aac cca gaa tgg tca gaa gta tca gag gaa gtg aag 1275 Tyr Glu Phe Pro Asn Pro Glu Trp Ser Glu Val Ser Glu Glu Val Lys 285 290 295 atg ctc att cgg aat ctg ctg aaa aca gag ccc acc cag aga atg acc 1323 Met Leu Ile Arg Asn Leu Leu Lys Thr Glu Pro Thr Gln Arg Met Thr 300 305 310 315 atc acc gag ttt atg aac cac cct tgg atc atg caa tca aca aag gtc 1371 Ile Thr Glu Phe Met Asn His Pro Trp Ile Met Gln Ser Thr Lys Val 320 325 330 cct caa acc cca ctg cac acc agc cgg gtc ctg aag gag gac aag gag 1419 Pro Gln Thr Pro Leu His Thr Ser Arg Val Leu Lys Glu Asp Lys Glu 335 340 345 cgg tgg gag gat gtc aag ggg tgt ctt cat gac aag aac agc gac cag 1467 Arg Trp Glu Asp Val Lys Gly Cys Leu His Asp Lys Asn Ser Asp Gln 350 355 360 gcc act tgg ctg acc agg ttg tga gcagaggatt ctgtgttcct gtccaaactc 1521 Ala Thr Trp Leu Thr Arg Leu * 365 370 agtgctgttt cttagaatcc ttttattccc tgggtctcta atgggacctt aaagaccatc 1581 tggtatcatc ttctcatttt gcagaagaga aactgaggcc cagaggcgga gggcagtctg 1641 ctcaaggtca cgcagctggt gactggttgg ggcagaccgg acccaggttt cctgactcct 1701 ggcccaagtc tcttcctcct atcctgcggg atcactgggg ggctctcagg gaacagcagc 1761 agtgccatag ccaggctctc tgctgcccag cgctggggtg aggctgccgt tgtcagcgtg 1821 gaccactaac cagcccgtct tctctctctg ctcccacccc tgccgccctc accctgccct 1881 tgttgtctct gtctctcacg tctctcttct gctgtctctc ctacctgtct tctggctctc 1941 tctgtaccct tcctggtgct gccgtgcccc caggaggaga tgaccagtgc cttggccaca 2001 atgcgcgttg actacgagca gatcaagata aaaaagattg aagatgcatc caaccctctg 2061 ctgctgaaga ggcggaagaa agctcgggcc ctggaggctg cggctctggc ccactgagcc 2121 accgcgccct cctgcccacg ggaggacaag caataactct ctacaggaat atatttttta 2181 aacgaagaga cagaactgtc cacatctgcc tcctctcctc ctcagctgca tggagcctgg 2241 aactgcatca gtgactgaat tc 2263 <210> SEQ ID NO 34 <211> LENGTH: 370 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 34 Met Leu Ser Asn Ser Gln Gly Gln Ser Pro Pro Val Pro Phe Pro Ala 1 5 10 15 Pro Ala Pro Pro Pro Gln Pro Pro Thr Pro Ala Leu Pro His Pro Pro 20 25 30 Ala Gln Pro Pro Pro Pro Pro Pro Gln Gln Phe Pro Gln Phe His Val 35 40 45 Lys Ser Gly Leu Gln Ile Lys Lys Asn Ala Ile Ile Asp Asp Tyr Lys 50 55 60 Val Thr Ser Gln Val Leu Gly Leu Gly Ile Asn Gly Lys Val Leu Gln 65 70 75 80 Ile Phe Asn Lys Arg Thr Gln Glu Lys Phe Ala Leu Lys Met Leu Gln 85 90 95 Asp Cys Pro Lys Ala Arg Arg Glu Val Glu Leu His Trp Arg Ala Ser 100 105 110 Gln Cys Pro His Ile Val Arg Ile Val Asp Val Tyr Glu Asn Leu Tyr 115 120 125 Ala Gly Arg Lys Cys Leu Leu Ile Val Met Glu Cys Leu Asp Gly Gly 130 135 140 Glu Leu Phe Ser Arg Ile Gln Asp Arg Gly Asp Gln Ala Phe Thr Glu 145 150 155 160 Arg Glu Ala Ser Glu Ile Met Lys Ser Ile Gly Glu Ala Ile Gln Tyr 165 170 175 Leu His Ser Ile Asn Ile Ala His Arg Asp Val Lys Pro Glu Asn Leu 180 185 190 Leu Tyr Thr Ser Lys Arg Pro Asn Ala Ile Leu Lys Leu Thr Asp Phe 195 200 205 Gly Phe Ala Lys Glu Thr Thr Ser His Asn Ser Leu Thr Thr Pro Cys 210 215 220 Tyr Thr Pro Tyr Tyr Val Ala Pro Glu Val Leu Gly Pro Glu Lys Tyr 225 230 235 240 Asp Lys Ser Cys Asp Met Trp Ser Leu Gly Val Ile Met Tyr Ile Leu 245 250 255 Leu Cys Gly Tyr Pro Pro Phe Tyr Ser Asn His Gly Leu Ala Ile Ser 260 265 270 Pro Gly Met Lys Thr Arg Ile Arg Met Gly Gln Tyr Glu Phe Pro Asn 275 280 285 Pro Glu Trp Ser Glu Val Ser Glu Glu Val Lys Met Leu Ile Arg Asn 290 295 300 Leu Leu Lys Thr Glu Pro Thr Gln Arg Met Thr Ile Thr Glu Phe Met 305 310 315 320 Asn His Pro Trp Ile Met Gln Ser Thr Lys Val Pro Gln Thr Pro Leu 325 330 335 His Thr Ser Arg Val Leu Lys Glu Asp Lys Glu Arg Trp Glu Asp Val 340 345 350 Lys Gly Cys Leu His Asp Lys Asn Ser Asp Gln Ala Thr Trp Leu Thr 355 360 365 Arg Leu 370 <210> SEQ ID NO 35 <211> LENGTH: 1074 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (628)...(831) <400> SEQUENCE: 35 ttttactttt tttaagcaca aaattttgtt ttttttctcc cctccccaca gatcccatct 60 caaatcattc tgttaaccac cattccaaca ggtcgaggag agcttaaaca ccttcttcct 120 ctgccttgtt tctatttttt tatttttttg catcagtatt aatgtttttg catactctcc 180 atctttatcc aaaaatgtaa acttcctttg tcaatctatg gatatgccca tatatgaaag 240 agatgggtgg gtcaaaaagg gatatcaaat gaagtgatag gggtcacaat ggggaaatgg 300 aagtggtaca taacattgcc aaaataatgt gccactagaa atggtgtaaa ggctgtcttt 360ttttttaaga aaagttatta ccatgtattt tgtgaggcag gtttacaaca ctacaagtct 420 tgactaagaa ggaaagagga aaaaagaaaa aacaccaata cccatattta aaaaaaaaaa 480 aatgatcata gtcttaggag ttcatttaaa ccataggaac ttttcactta tctcatgtta 540 ggtgtaccag tcagtgatta agtagaacta caagttatat aggctgtatt gtttattgct 600 ggtttatgac cttaataaag tgtaatt atg tat tac cag cag ggt gtt ttt aac 654 Met Tyr Tyr Gln Gln Gly Val Phe Asn 1 5 tgt gac tat tgt ata aaa aca aat ctt gat atc cag aag cac atg aag 702 Cys Asp Tyr Cys Ile Lys Thr Asn Leu Asp Ile Gln Lys His Met Lys 10 15 20 25 ttt gcg act ttc cac cct gcc cat ttt tgt aaa act gca gtc atc ttg 750 Phe Ala Thr Phe His Pro Ala His Phe Cys Lys Thr Ala Val Ile Leu 30 35 40 gac ctt tta aac aca aat ttt aaa ctc aac caa gct gtg ata agc gga 798 Asp Leu Leu Asn Thr Asn Phe Lys Leu Asn Gln Ala Val Ile Ser Gly 45 50 55 atg gtt act gtt tat act gtg gta tgt ttt tga ttacagcaga taatgctttc 851 Met Val Thr Val Tyr Thr Val Val Cys Phe * 60 65 ttttccagtc atctttgaga ataaaggaaa aaaaaaatct tcagatgcaa tggttttgtg 911 tagcatcttg tctatcatgt tttgtaaatg ctggagaagc gtcgaccaat ttgacttaga 971 gatggaatgt aactttgctt acaaaaattg ctattaaact cctacttaag gtgttctaat 1031 tttctgtgag cacactaaaa acaaaaatat atgtgaataa aat 1074 <210> SEQ ID NO 36 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 36 Met Tyr Tyr Gln Gln Gly Val Phe Asn Cys Asp Tyr Cys Ile Lys Thr 1 5 10 15 Asn Leu Asp Ile Gln Lys His Met Lys Phe Ala Thr Phe His Pro Ala 20 25 30 His Phe Cys Lys Thr Ala Val Ile Leu Asp Leu Leu Asn Thr Asn Phe 35 40 45 Lys Leu Asn Gln Ala Val Ile Ser Gly Met Val Thr Val Tyr Thr Val 50 55 60 Val Cys Phe 65 <210> SEQ ID NO 37 <211> LENGTH: 1356 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (553)...(1095) <400> SEQUENCE: 37 ttctcccgca accttccctt cgctccctcc cgtccccccc agctcctagc ctccgactcc 60 ctccccccct cacgcccgcc ctctcgcctt cgccgaacca aagtggatta attacacgct 120 ttctgtttct ctccgtgctg ttctctcccg ctgtgcgcct gcccgcctct cgctgtcctc 180 tctccccctc gccctctctt cggccccccc ctttcacgtt cactctgtct ctcccactat 240 ctctgccccc ctctatcctt gatacaacag ctgacctcat ttcccgatac cttttccccc 300 ccgaaaagta caacatctgg cccgccccag cccgaagaca gcccgtcctc cctggacaat 360 cagacgaatt ctcccccccc ccccaaaaaa aaaagccatc cccccgctct gccccgtcgc 420 acattcggcc cccgcgactc ggccagagcg gcgctggcag aggagtgtcc ggcaggaggg 480 ccaacgcccg ctgttcggtt tgcgacacgc agcagggagg tgggcggcag cgtcgccggc 540 ttccagacac ca atg gga atc cca atg ggg aag tcg atg ctg gtg ctt ctc 591 Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu 1 5 10 acc ttc ttg gcc ttc gcc tcg tgc tgc att gct gct tac cgc ccc agt 639 Thr Phe Leu Ala Phe Ala Ser Cys Cys Ile Ala Ala Tyr Arg Pro Ser 15 20 25 gag acc ctg tgc ggc ggg gag ctg gtg gac acc ctc cag ttc gtc tgt 687 Glu Thr Leu Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys 30 35 40 45 ggg gac cgc ggc ttc tac ttc agc agg ccc gca agc cgt gtg agc cgt 735 Gly Asp Arg Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg 50 55 60 cgc agc cgt ggc atc gtt gag gag tgc tgt ttc cgc agc tgt gac ctg 783 Arg Ser Arg Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu 65 70 75 gcc ctc ctg gag acg tac tgt gct acc ccc gcc aag tcc gag agg gac 831 Ala Leu Leu Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Arg Asp 80 85 90 gtg tcg acc cct ccg acc gtg ctt ccg gac aac ttc ccc aga tac ccc 879 Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro 95 100 105 gtg ggc aag ttc ttc caa tat gac acc tgg aag cag tcc acc cag cgc 927 Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg 110 115 120 125 ctg cgc agg ggc ctg cct gcc ctc ctg cgt gcc cgc cgg ggt cac gtg 975 Leu Arg Arg Gly Leu Pro Ala Leu Leu Arg Ala Arg Arg Gly His Val 130 135 140 ctc gcc aag gag ctc gag gcg ttc agg gag gcc aaa cgt cac cgt ccc 1023 Leu Ala Lys Glu Leu Glu Ala Phe Arg Glu Ala Lys Arg His Arg Pro 145 150 155 ctg att gct cta ccc acc caa gac ccc gcc cac ggg ggc gcc ccc cca 1071 Leu Ile Ala Leu Pro Thr Gln Asp Pro Ala His Gly Gly Ala Pro Pro 160 165 170 gag atg gcc agc aat cgg aag tga gcaaaactgc cgcaagtctg cagcccggcg 1125 Glu Met Ala Ser Asn Arg Lys * 175 180 ccaccatcct gcagcctcct cctgaccacg gacgtttcca tcaggttcca tcccgaaaat 1185 ctctcggttc cacgtccccc tggggcttct cctgacccag tccccgtgcc ccgcctcccc 1245 gaaacaggct actctcctcg gccccctcca tcgggctgag gaagcacagc agcatcttca 1305 aacatgtaca aaatcgattg gctttaaaca cccttcacat accctccccc c 1356 <210> SEQ ID NO 38 <211> LENGTH: 180 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 38 Met Gly Ile Pro Met Gly Lys Ser Met Leu Val Leu Leu Thr Phe Leu 1 5 10 15 Ala Phe Ala Ser Cys Cys Ile Ala Ala Tyr Arg Pro Ser Glu Thr Leu 20 25 30 Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys Gly Asp Arg 35 40 45 Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg Arg Ser Arg 50 55 60 Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu 65 70 75 80 Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Arg Asp Val Ser Thr 85 90 95 Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys 100 105 110 Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu Arg Arg 115 120 125 Gly Leu Pro Ala Leu Leu Arg Ala Arg Arg Gly His Val Leu Ala Lys 130 135 140 Glu Leu Glu Ala Phe Arg Glu Ala Lys Arg His Arg Pro Leu Ile Ala 145 150 155 160 Leu Pro Thr Gln Asp Pro Ala His Gly Gly Ala Pro Pro Glu Met Ala 165 170 175 Ser Asn Arg Lys 180
Claims (34)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/081,119 US20030045491A1 (en) | 2001-02-23 | 2002-02-21 | TTK in diagnosis and as a therapeutic target in cancer |
| US10/951,477 US7501244B2 (en) | 2001-02-21 | 2004-09-27 | Determining prognosis of colon or breast cancer by measuring TTK expression |
| US10/951,406 US7501243B2 (en) | 2001-02-21 | 2004-09-27 | Detection of colon or breast cancer by measuring TTK polypeptide expression |
| US10/951,389 US7501242B2 (en) | 2001-02-21 | 2004-09-27 | Detection of colon or breast cancer by measuring TTK polynucleotide expression |
| US10/977,087 US7867731B2 (en) | 1998-11-04 | 2004-10-28 | HX2004-6 polypeptide expressed in cancerous cells |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US28981301P | 2001-02-23 | 2001-02-23 | |
| US10/081,119 US20030045491A1 (en) | 2001-02-23 | 2002-02-21 | TTK in diagnosis and as a therapeutic target in cancer |
Related Child Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/951,406 Division US7501243B2 (en) | 2001-02-21 | 2004-09-27 | Detection of colon or breast cancer by measuring TTK polypeptide expression |
| US10/951,477 Division US7501244B2 (en) | 2001-02-21 | 2004-09-27 | Determining prognosis of colon or breast cancer by measuring TTK expression |
| US10/951,389 Division US7501242B2 (en) | 2001-02-21 | 2004-09-27 | Detection of colon or breast cancer by measuring TTK polynucleotide expression |
| US10/977,087 Continuation-In-Part US7867731B2 (en) | 1998-11-04 | 2004-10-28 | HX2004-6 polypeptide expressed in cancerous cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20030045491A1 true US20030045491A1 (en) | 2003-03-06 |
Family
ID=26765220
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/081,119 Abandoned US20030045491A1 (en) | 1998-11-04 | 2002-02-21 | TTK in diagnosis and as a therapeutic target in cancer |
| US10/951,477 Expired - Fee Related US7501244B2 (en) | 2001-02-21 | 2004-09-27 | Determining prognosis of colon or breast cancer by measuring TTK expression |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/951,477 Expired - Fee Related US7501244B2 (en) | 2001-02-21 | 2004-09-27 | Determining prognosis of colon or breast cancer by measuring TTK expression |
Country Status (1)
| Country | Link |
|---|---|
| US (2) | US20030045491A1 (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040146942A1 (en) * | 2001-05-11 | 2004-07-29 | Gruenenthal Gmbh | Screening method using PIM1-kinase or PIM3-kinase |
| US20050130926A1 (en) * | 1998-11-04 | 2005-06-16 | Chiron Corporation | Gene products differentially expressed in cancerous cells and their methods of use V |
| US20060014171A1 (en) * | 2004-05-06 | 2006-01-19 | Roche Molecular Systems, Inc. | SENP1 as a marker for cancer |
| US20060024692A1 (en) * | 2002-09-30 | 2006-02-02 | Oncotherapy Science, Inc. | Method for diagnosing non-small cell lung cancers |
| US20060089321A1 (en) * | 2002-02-12 | 2006-04-27 | Walter Annette O | Cks1 inhibitors |
| US20090202576A1 (en) * | 2005-02-25 | 2009-08-13 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing ttk, urlc10 or koc1 polypeptides |
| US20100009920A1 (en) * | 2006-12-13 | 2010-01-14 | Yusuke Nakamura | Ttk as tumor marker and therapeutic target for lung cancer |
| WO2012168721A1 (en) | 2011-06-10 | 2012-12-13 | The Institute Of Cancer Research: Royal Cancer Hospital | Materials and methods for treating pten mutated or deficient cancer |
| US8530430B2 (en) | 2009-05-11 | 2013-09-10 | Oncotherapy Science, Inc. | TTK peptides and vaccines including the same |
| US8551980B2 (en) | 2009-11-30 | 2013-10-08 | Bayer Intellectual Property Gmbh | Substituted triazolopyridines |
Families Citing this family (41)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0307403D0 (en) | 2003-03-31 | 2003-05-07 | Medical Res Council | Selection by compartmentalised screening |
| GB0307428D0 (en) | 2003-03-31 | 2003-05-07 | Medical Res Council | Compartmentalised combinatorial chemistry |
| US20060078893A1 (en) | 2004-10-12 | 2006-04-13 | Medical Research Council | Compartmentalised combinatorial chemistry by microfluidic control |
| US20050221339A1 (en) | 2004-03-31 | 2005-10-06 | Medical Research Council Harvard University | Compartmentalised screening by microfluidic control |
| US7968287B2 (en) | 2004-10-08 | 2011-06-28 | Medical Research Council Harvard University | In vitro evolution in microfluidic systems |
| EP2363205A3 (en) | 2006-01-11 | 2014-06-04 | Raindance Technologies, Inc. | Microfluidic Devices And Methods Of Use In The Formation And Control Of Nanoreactors |
| EP2530168B1 (en) | 2006-05-11 | 2015-09-16 | Raindance Technologies, Inc. | Microfluidic Devices |
| US9562837B2 (en) | 2006-05-11 | 2017-02-07 | Raindance Technologies, Inc. | Systems for handling microfludic droplets |
| EP2077912B1 (en) | 2006-08-07 | 2019-03-27 | The President and Fellows of Harvard College | Fluorocarbon emulsion stabilizing surfactants |
| US8772046B2 (en) | 2007-02-06 | 2014-07-08 | Brandeis University | Manipulation of fluids and reactions in microfluidic systems |
| WO2008130623A1 (en) | 2007-04-19 | 2008-10-30 | Brandeis University | Manipulation of fluids, fluid components and reactions in microfluidic systems |
| WO2010009365A1 (en) | 2008-07-18 | 2010-01-21 | Raindance Technologies, Inc. | Droplet libraries |
| US12038438B2 (en) | 2008-07-18 | 2024-07-16 | Bio-Rad Laboratories, Inc. | Enzyme quantification |
| US8528589B2 (en) | 2009-03-23 | 2013-09-10 | Raindance Technologies, Inc. | Manipulation of microfluidic droplets |
| US8632534B2 (en) | 2009-04-03 | 2014-01-21 | Angiodynamics, Inc. | Irreversible electroporation (IRE) for congestive obstructive pulmonary disease (COPD) |
| US8903488B2 (en) | 2009-05-28 | 2014-12-02 | Angiodynamics, Inc. | System and method for synchronizing energy delivery to the cardiac rhythm |
| US10520500B2 (en) | 2009-10-09 | 2019-12-31 | Abdeslam El Harrak | Labelled silica-based nanomaterial with enhanced properties and uses thereof |
| EP2517025B1 (en) | 2009-12-23 | 2019-11-27 | Bio-Rad Laboratories, Inc. | Methods for reducing the exchange of molecules between droplets |
| JP5934657B2 (en) | 2010-02-12 | 2016-06-15 | レインダンス テクノロジーズ, インコーポレイテッド | Digital specimen analysis |
| US9399797B2 (en) | 2010-02-12 | 2016-07-26 | Raindance Technologies, Inc. | Digital analyte analysis |
| US9366632B2 (en) | 2010-02-12 | 2016-06-14 | Raindance Technologies, Inc. | Digital analyte analysis |
| US10351905B2 (en) | 2010-02-12 | 2019-07-16 | Bio-Rad Laboratories, Inc. | Digital analyte analysis |
| WO2012045012A2 (en) | 2010-09-30 | 2012-04-05 | Raindance Technologies, Inc. | Sandwich assays in droplets |
| US9700368B2 (en) | 2010-10-13 | 2017-07-11 | Angiodynamics, Inc. | System and method for electrically ablating tissue of a patient |
| EP3859011A1 (en) | 2011-02-11 | 2021-08-04 | Bio-Rad Laboratories, Inc. | Methods for forming mixed droplets |
| EP2675819B1 (en) | 2011-02-18 | 2020-04-08 | Bio-Rad Laboratories, Inc. | Compositions and methods for molecular labeling |
| DE202012013668U1 (en) | 2011-06-02 | 2019-04-18 | Raindance Technologies, Inc. | enzyme quantification |
| US8841071B2 (en) | 2011-06-02 | 2014-09-23 | Raindance Technologies, Inc. | Sample multiplexing |
| US8658430B2 (en) | 2011-07-20 | 2014-02-25 | Raindance Technologies, Inc. | Manipulating droplet size |
| US9078665B2 (en) | 2011-09-28 | 2015-07-14 | Angiodynamics, Inc. | Multiple treatment zone ablation probe |
| US9414881B2 (en) | 2012-02-08 | 2016-08-16 | Angiodynamics, Inc. | System and method for increasing a target zone for electrical ablation |
| WO2013120089A1 (en) | 2012-02-10 | 2013-08-15 | Raindance Technologies, Inc. | Molecular diagnostic screening assay |
| EP2844768B1 (en) | 2012-04-30 | 2019-03-13 | Raindance Technologies, Inc. | Digital analyte analysis |
| EP2986762B1 (en) | 2013-04-19 | 2019-11-06 | Bio-Rad Laboratories, Inc. | Digital analyte analysis |
| US11901041B2 (en) | 2013-10-04 | 2024-02-13 | Bio-Rad Laboratories, Inc. | Digital analysis of nucleic acid modification |
| US9944977B2 (en) | 2013-12-12 | 2018-04-17 | Raindance Technologies, Inc. | Distinguishing rare variations in a nucleic acid sequence from a sample |
| US11193176B2 (en) | 2013-12-31 | 2021-12-07 | Bio-Rad Laboratories, Inc. | Method for detecting and quantifying latent retroviral RNA species |
| US12114911B2 (en) | 2014-08-28 | 2024-10-15 | Angiodynamics, Inc. | System and method for ablating a tissue site by electroporation with real-time pulse monitoring |
| US10647981B1 (en) | 2015-09-08 | 2020-05-12 | Bio-Rad Laboratories, Inc. | Nucleic acid library generation methods and compositions |
| US10905492B2 (en) | 2016-11-17 | 2021-02-02 | Angiodynamics, Inc. | Techniques for irreversible electroporation using a single-pole tine-style internal device communicating with an external surface electrode |
| US10998178B2 (en) | 2017-08-28 | 2021-05-04 | Purdue Research Foundation | Systems and methods for sample analysis using swabs |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7625697B2 (en) | 1994-06-17 | 2009-12-01 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for constructing subarrays and subarrays made thereby |
| WO2000056756A2 (en) | 1999-03-23 | 2000-09-28 | Mount Sinai School Of Medicine Of New York University | Prolactin regulatory element binding protein and uses thereof |
| WO2001030964A2 (en) | 1999-10-22 | 2001-05-03 | Lifespan Biosciences, Inc. | Anti-cancer nucleic acid and protein targets |
-
2002
- 2002-02-21 US US10/081,119 patent/US20030045491A1/en not_active Abandoned
-
2004
- 2004-09-27 US US10/951,477 patent/US7501244B2/en not_active Expired - Fee Related
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050130926A1 (en) * | 1998-11-04 | 2005-06-16 | Chiron Corporation | Gene products differentially expressed in cancerous cells and their methods of use V |
| US7867731B2 (en) | 1998-11-04 | 2011-01-11 | Novartis Vaccines And Diagnostics, Inc. | HX2004-6 polypeptide expressed in cancerous cells |
| US20040146942A1 (en) * | 2001-05-11 | 2004-07-29 | Gruenenthal Gmbh | Screening method using PIM1-kinase or PIM3-kinase |
| US20060089321A1 (en) * | 2002-02-12 | 2006-04-27 | Walter Annette O | Cks1 inhibitors |
| US20060024692A1 (en) * | 2002-09-30 | 2006-02-02 | Oncotherapy Science, Inc. | Method for diagnosing non-small cell lung cancers |
| US7776539B2 (en) | 2004-05-06 | 2010-08-17 | Roche Molecular Systems, Inc. | SENP1 as a marker for cancer |
| US20090162846A1 (en) * | 2004-05-06 | 2009-06-25 | Roche Molecular Systems, Inc | SENP1 as a marker for cancer |
| US20060014171A1 (en) * | 2004-05-06 | 2006-01-19 | Roche Molecular Systems, Inc. | SENP1 as a marker for cancer |
| US7939251B2 (en) | 2004-05-06 | 2011-05-10 | Roche Molecular Systems, Inc. | SENP1 as a marker for cancer |
| US20090202576A1 (en) * | 2005-02-25 | 2009-08-13 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing ttk, urlc10 or koc1 polypeptides |
| US7847060B2 (en) | 2005-02-25 | 2010-12-07 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing TTK, URLC10 or KOC1 polypeptides |
| US20110027302A1 (en) * | 2005-02-25 | 2011-02-03 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing ttk, urlc10 or koc1 polypeptides |
| US8614176B2 (en) | 2005-02-25 | 2013-12-24 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing TTK, URLC10 or KOC1 polypeptides |
| US20100009920A1 (en) * | 2006-12-13 | 2010-01-14 | Yusuke Nakamura | Ttk as tumor marker and therapeutic target for lung cancer |
| US8530430B2 (en) | 2009-05-11 | 2013-09-10 | Oncotherapy Science, Inc. | TTK peptides and vaccines including the same |
| US8551980B2 (en) | 2009-11-30 | 2013-10-08 | Bayer Intellectual Property Gmbh | Substituted triazolopyridines |
| WO2012168721A1 (en) | 2011-06-10 | 2012-12-13 | The Institute Of Cancer Research: Royal Cancer Hospital | Materials and methods for treating pten mutated or deficient cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| US20050063974A1 (en) | 2005-03-24 |
| US7501244B2 (en) | 2009-03-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7501244B2 (en) | Determining prognosis of colon or breast cancer by measuring TTK expression | |
| JP4838835B2 (en) | TTK in diagnosis and TTK as a therapeutic target in cancer | |
| EP2094850B1 (en) | Cancer-related protein kinases | |
| DK2881402T3 (en) | Mutant ROS expression in human liver cancer | |
| US20050266409A1 (en) | Compositions and methods for diagnosing, preventing, and treating cancers | |
| JP6259320B2 (en) | Translocation and mutant ROS kinase in human non-small cell lung cancer | |
| KR102123963B1 (en) | Ros kinase in lung cancer | |
| JP2007289196A (en) | Nucleic acid sequences differentially expressed in cancer tissue | |
| AU2002244112A1 (en) | TTK in diagnosis and as a therapeutic target in cancer | |
| US7501242B2 (en) | Detection of colon or breast cancer by measuring TTK polynucleotide expression | |
| EP1953243A2 (en) | Polynucleotides related to colon cancer | |
| AU2007203399B2 (en) | TTK in diagnosis and as a therapeutic target in cancer | |
| ES2350089T3 (en) | A MEMBER OF THE FAMILY OF THE PROTEIN HUMAN KINASES AND USES OF THE SAME. | |
| RU2813996C2 (en) | Fusion protein of dctn1 protein with ret protein | |
| CA2569100A1 (en) | Methods for identifying risk of breast cancer and treatment thereof | |
| Class et al. | Patent application title: IDENTIFICATION OF A JAK2 MUTATION INVOLVED IN VAQUEZ POLYGLOBULIA Inventors: William Vainchenker (Paris, FR) Assistance Publique Hopitaux De Paris (Paris, FR) Igr&d Sa (Villejuif Cedex, FR) Valerie Ugo (Paris, FR) James Chloe (Montrouge, FR) Jean-Pierre Le Couedic (Champs Sur Marne, FR) Institut Gustave-Roussy (Villejuif, FR) Nicole Casadevall (Paris, FR) Universite De Versailles-St Quentin En Yvelines (Versailles, FR) Universite Paris-Sud (Orsay, FR) Assignees: Assistance Publique-Hopitaux De Paris IGR&D SA Universite Paris-Sud INSTITUT GUSTAVE ROUSSY UNIVERSITE DE VERSAILLES ST QUENTIN EN YVELINES INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM) | |
| US20030144188A1 (en) | Androgen regulated nucleic acid molecules and encoded proteins | |
| HK1192285B (en) | Translocation and mutant ros kinase in human non-small cell lung carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: CHIRON CORPORATION, CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:REINHARD, CHRISTOPH;JEFFERSON, ANNE B.;CHAN, VIVIEN W.;REEL/FRAME:016162/0319;SIGNING DATES FROM 20050527 TO 20050607 Owner name: CHIRON CORPORATION, CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:REINHARD, CHRISTOPH;JEFFERSON, ANNE B.;CHAN, VIVIEN W.;REEL/FRAME:016162/0375;SIGNING DATES FROM 20050527 TO 20050607 |
|
| AS | Assignment |
Owner name: CHIRON CORPORATION, CALIFORNIA Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE ASSIGNMENT DOCUMENTS PREVIOUSLY RECORDED ON REEL 016162 FRAME 0375;ASSIGNORS:REINHARD, CHRISTOPH;JEFFERSON, ANNE B.;CHAN, VIVIEN W.;REEL/FRAME:016424/0337;SIGNING DATES FROM 20050726 TO 20050802 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE |