US20030040099A1

US20030040099A1 - Highly infectious rubella virus clones and methods of production

Info

Publication number: US20030040099A1
Application number: US09/557,232
Authority: US
Inventors: Teryl Frey; Konstantin Pougatchev; Emily Abernathy
Original assignee: Individual
Current assignee: Individual
Priority date: 1991-06-28
Filing date: 2000-04-24
Publication date: 2003-02-27
Also published as: US6054573A

Abstract

Highly infectious rubella virus cDNA clones that are chimeric constructs of an infectious cDNA clone having a low specific infectivity and nucleic acid molecule fragments from a second rubella virus genome, wherein portions of the nucleotide sequence of the infectious cDNA clone having low specific infectivity have been replaced with the corresponding cDNA fragments derived from the second rubella virus genome.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This is a continuation-in-part of U.S. patent application Ser. No. 08/459,041 filed Jun. 2, 1995, which is a continuation-in-part of U.S. patent application Ser. No. 08/093,453, filed Jul. 19, 1993, now U.S. Pat. No. 5,663,065, which is a continuation of U.S. patent application Ser. No. 07/722,334, filed on Jun. 28, 1991, now abandoned.[0001]
[0002] The U.S. Government has rights in this invention arising out of National Institutes of Health (NIAID) grant number AI21389.

The present invention relates to the field of molecular virology and more particularly to construction of highly infectious rubella virus cDNA clones.

BACKGROUND OF THE INVENTION

Rubella virus is a major human pathogen. Infection with rubella virus can cause serious birth defects and chronic disease. There was a mini-epidemic of both rubella and congenital rubella syndrome in the United States between 1989 and 1991.

Rubella was first described in the eighteenth century in Germany. The symptoms of a rash and mild fever were similar to those of measles, so the disease was given the name German measles. The name “rubella” was coined in 1814 when physicians realized that the disease was unique and was not merely a variant of scarlatina (scarlet fever) or rubeola (measles).

Rubella is a relatively harmless disease in young children. However, during the first trimester of pregnancy, rubella virus infection can cause fetal death. If the fetus survives, it may be born deaf or have cataracts, cardiac abnormalities, microcephaly, motor deficits or other congenital anomalies. The infant may also be born with thrombocytopenic purpura, hepatosplenomegaly, icterus, anemia, and low birth weight. The presence of one or more of these defects has been termed “congenital rubella syndrome” or CRS.

The rubella virus was isolated in 1962 at the beginning of a worldwide rubella epidemic which lasted from 1962 to 1965. This epidemic peaked in the United States in 1964, resulting in the birth of approximately 20,000 infants exhibiting congenital rubella syndrome.

Scientists began development of an effective vaccine against the rubella virus during the rubella epidemic. Effective attenuated vaccines became available in the late 1960's and are still used today. These attenuated vaccines are live viruses that have been passaged to reduce their virulence. Attenuated vaccines produce immunity, but can cause disease. Protection is believed to persist for at least 15 years after inoculation with the attenuated rubella vaccine.

Various vaccination schedules have been set up in different parts of the world to eliminate rubella infection, especially of the human fetus. The rubella immunization program established in Great Britain requires vaccination of all girls between the ages of 10 and 14. The United States immunization program vaccinates infants at approximately 15 months and requires a certificate of vaccination prior to attending school. The United States program is designed to eradicate the disease among the population that is most responsible for transmission of rubella, whereas the program of Great Britain seeks to achieve complete protection for those at risk for pregnancy. One disadvantage to the United States program is that protection against rubella may dissipate at the very time when immunity is most needed, namely, during the child-bearing years.

Vaccination of women of child-bearing age having undetectable antibody titers is recommended in both the United States and Great Britain. However, there are several risks to this procedure. First, there is a risk that these women may be pregnant and not be aware of their pregnancy, or they may become pregnant within a few months following immunization. Vaccination against rubella is contraindicated in pregnant women because the live virus in the vaccine can cross the placenta and infect the fetus. Pregnant women who have not previously been infected with the rubella virus or who have not been vaccinated prior to becoming pregnant are advised to refrain from becoming vaccinated during their pregnancy. These women are therefore at risk for contracting rubella by coming in contact with infectious persons, including those recently vaccinated with the attenuated vaccine.

Vaccination of older women has been associated with chronic arthritis and neurological symptoms. Scientists believe that these symptoms may be due to the persistent nature of the attenuated rubella virus in the currently available vaccines. Rubella virus is the sole member of the rubivirus genus of the Togavirus family. Compared to other viruses, very little is known about the molecular biology of the rubella virus. The rubella virion consists of single-stranded RNA encapsidated in an icosahedral nucleocapsid surrounded by a lipid envelope. Multiple copies of a viral protein, designated the C protein (MW=32,000-38,000 daltons), make up the nucleocapsid. Two types of viral glycoprotein, designated E1 and E2 (MW=53,000-58,000 daltons and 42,000-48,000 daltons, respectively), are embedded in the envelope, as reported by Waxham, M. N. and Wolinsky, J. S., Virology 126:194-203 (1983). The E2 glycoprotein has been further subdivided into two subgroups, designated E2a and E2b, by their ability to migrate differently when resolved by polyacrylamide gel electrophoresis, as described by Oker-Blom, C., et al., J. Virol. 46:964-973 (1983). E1is the viral hemagglutinin. Neutralizing epitopes have been found on both E1 and E2 by Waxham, M. N. and Wolinsky, J. S., Virology 143:153-165 (1985) and Green, K. Y., and Dorsett, P. H., J. Virol., 57:893-898 (1986).

The rubella virus genomic RNA is of positive polarity and is capped and polyadenylated. In infected cells, a second positive polarity RNA strand is synthesized to serve as messenger RNA for translation of structural proteins. This second strand is the first 3327 nucleotides beginning from the 3′ end of the genomic RNA. The structural proteins are proteolytically processed from a polyprotein precursor during translation. The order of these proteins in the polyprotein is NH ₂—C-E2-E1-COOH, as reported by Oker-Blom, C., et al. (1983); Oker-Blom, C., J. Virol. 51:354-358 (1984).

Recombinant vaccines are based on live microorganisms which have been genetically manipulated so that they are not pathogenic, but result in immunity against the virulent organism. Recombinant vaccines can only cause disease if a rare genetic mutation or recombinant event occurs which allows the microorganism to revert to wild type. A recombinant vaccine is generally safer and more effective than an attenuated vaccine because the engineered mutations remove or inactivate only specific portions of the genome, whereas attenuated vaccines contain random mutations. In order to develop a recombinant vaccine, one must first have the nucleic acid sequence of the entire viral genome, including both the information required for infection and at least limited replication of the virus, and for antigenicity. Once the entire sequence has been determined, a cDNA clone can be produced that is infectious and can be modified to be non-virulent.

An infectious cDNA clone is a complete DNA copy of an RNA virus genome contained in a vector, such as a plasmid, from which RNA transcripts of the genome can be synthesized in vitro. In the case of positive-polarity RNA viruses such as rubella, such transcripts are infectious when transfected into cells. The development of an infectious clone is a landmark event in the molecular biology of any RNA virus. Although an infectious clone for rubella virus has been described (Wang, et al., J. Virol. 68:3550-3557 (1994)), this cDNA clone displayed low infectivity (approximately 5 plaques/10 μg of transcripts). Increasing the infectivity of this clone would increase the efficiency of a recombinant attenuated rubella vaccine derived from the clone and would provide an improved molecular biology tool for studying rubella virus replication.

However, successful generation of highly infectious cDNA clones has often been problematic due to the presence of mutations in the virus RNA template population caused by the inherent mutability of RNA viruses, the relatively low fidelity of the DNA polymerases used in cDNA synthesis, instability and toxicity of viral sequences in bacterial hosts, and the infidelity of the RNA polymerases used for in vitro transcriptions. Therefore, it is clear that there remains a strong need for an infectious cDNA clone of the rubella virus genome having a higher infectivity than currently available rubella virus clones. The isolation of a highly infectious cDNA clone will be useful for the development of a rubella vaccine that can be safely administered to pregnant and older women without risk of birth defects, auto immune disease, or neurologic symptoms.

SUMMARY OF THE INVENTION

Highly infectious cDNA clones of the rubella virus are provided herein. The clones are chimeric constructs containing portions of both a cDNA clone having a low specific infectivity and a second rubella virus genome. The infectious rubella virus clones are useful as molecular biology tools for studying rubella virus and can be useful for developing recombinant vaccines against rubella.

The highly infectious cDNA clones have a specific infectivity greater than 0.5 plaques/μg of transcript. In several preferred embodiments of the invention, the specific infectivities of viral transcripts were approximately 10 ⁴plaques/μg of transcript.

In the preferred embodiments, the cDNA clones are prepared by replacing one or more large fragments of a w-Therein-derived infectious cDNA clone with corresponding fragments from an f-Therein rubella virus strain.

It is therefore an object of the present invention to provide a highly infectious cDNA clone of the rubella virus genomic RNA.

It is a further object of the present invention to provide a molecular biology tool for studying rubella, particularly rubella virus replication.

It is a further object of the present invention to provide cDNA clones for the development of a recombinant rubella virus vaccine.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic diagram showing modifications to the construct Robo102 to produce highly infectious clones, Robo202, Robo302, Robo202/I and Robo202/II. [0022]
FIG. 2 is a graph comparing the infectivity of the Robo302 and Robo202 constructs with the f-Therien rubella virus strain, the w-Therien rubella virus strain, and a mock-infected control. [0023]
FIG. 3 is a graph comparing the growth curves of the two parent strains, w-Therien and f-Therien, with the four modified constructs, Robo202, Robo302, Robo202/I and Robo202/II, after infection of Vero cells at an m.o.i. of 2 pfu/cell. The graph shows average values of titers produced in two independent experiments.[0024]

DETAILED DESCRIPTION OF THE INVENTION

Highly infectious, isolated cDNA molecules or clones of rubella virus are described. The infectious rubella virus clones are useful as molecular biology tools for studying rubella virus and for developing recombinant vaccines against rubella. [0025]
The term “highly infectious cDNA clone” is defined herein as a cDNA clone having a specific infectivity of greater than 0.5 plaques/μg of transcript. The term “low infectivity” or “low specific infectivity” is defined herein as a specific infectivity of less than or equal to 0.5 plaques/μg of transcript. [0026]
The highly infectious, isolated cDNA molecules are inserted into a vector that enables replication of the nucleotide sequence of the molecules. A preferred vector is a bacterial plasmid such as pUC 19, pGEM, or PBR-322 (all available from Promega Biotec, Madison, Wis.) or pC11921 adjacent to a bacteriophage RNA polymerase promoter sequence such as the SP6 RNA polymerase (Promega Biotec) such that RNA copies of the rubella virus DNA can be synthesized in vitro. The vector is chemically introduced into susceptible culture cells, for example, [0027] E. coli, for amplification and production of large amounts of the cDNA clone. For use, the purified infectious clone is restricted with a restriction endonuclease such as Nsi 1 (New England Biolabs, Beverly, Mass.) for linearization at the termination of the rubella virus cDNA sequences. The linearized plasmid is then transcribed with an RNA polymerase such as SP6 RNA polymerase, which results in production of RNA transcripts templated from the rubella virus cDNA sequence in the non-pathogenic infectious clone.
In preferred embodiments of the present invention, the rubella virus clones have specific infectivities of approximately 10[0028] ⁴plaques/μg of transcript. In these preferred embodiments, the rubella virus cDNA clones are chimeric constructs, which contain portions of both an infectious cDNA clone, having a low specific infectivity of approximately 0.5 plaques/ug of transcript or less, and portions, or fragments, of cDNA from a second rubella virus genome, in which the cDNA has a minimal number of deleterious mutations that adversely affect infectivity. The highly infectious constructs are prepared by replacing one or more portions of the cDNA clone having low infectivity with corresponding DNA fragments from the second rubella virus strain. The specific infectivities achieved by these cDNA clones exhibit an increase of at least 10⁴fold over infectivity achieved using a cDNA clone derived solely from a w-Therien rubella virus strain.
In the most preferred embodiments of the present invention, the cDNA clone having a low specific infectivity is derived from the f-Therien rubella virus strain and the cDNA fragments used to replace portions of the cDNA clone are derived from the w-Therien rubella virus strain. Most preferably, the chimeric constructs contain one or more portions of the infectious cDNA clone Robo102, derived from the w-Therien rubella virus strain, as described in U.S. patent application Ser. No. 08/459,041, now U.S. Pat. No. 5,663,065, which is incorporated by reference herein, and one or more fragments of cloned cDNA derived from the f-Therien rubella virus strains. [0029]
Preferably, the cDNA fragments are created using the technique known by those skilled in the art as reverse transcriptase-long polymerase chain reaction (RT-long PCR) or high-fidelity long PCR, which allows for the amplification of long nucleic acid sequences. This use of this technique results in a reduction of the number of deleterious mutations in the genomic cDNA. High-fidelity long PCR amplification of rubella virus cDNA fragments is achieved with first strand cDNA synthesis, using currently available nucleic acid synthesis kits such as the RiboClone cDNA Synthesis System kit (Promega Corporation, Madison, Wis.) according to the protocol of the manufacturer, followed by PCR amplification. Exemplary oligonucleotide primers for the generation of nucleic acid fragments, with which to replace the portions of the cDNA clone having low infectivity, are set forth in the Examples below. [0030]
As shown in FIG. 1, in a first preferred embodiment of the present invention, the 5′ end portion of the cDNA clone having low specific infectivity (the w-Therien derived Robo102 construct) is replaced with the corresponding cDNA fragment (fragment III) from a second rubella virus genome (the f-Therien strain of the rubella virus genome), to create a highly infectious construct (Robo202). Fragment III contains the entire structural protein open reading frame region (SP-ORF) of the genome. The structural protein open reading frame encodes at least three structural proteins, C, E1 and E2. Fragment III also contains a portion of the 5′-end of the non-structural protein open reading frame (NSP-ORF). Fragment III is also described as a nucleic acid molecule between restriction endonuclease cleavage sites NheI and BglII. More specifically, the Robo202 chimeric construct includes [0031] nucleotides 1 to approximately 5352 of SEQ ID NO. 1 and replaces nucleotides 5353 to 9734 of SEQ ID NO. 1 with the corresponding sequence from the f-Therien rubella virus genome.
In a second preferred embodiment of the present invention, two fragments from a second rubella virus genome (the f-Therien rubella virus genome), are used to replace the corresponding fragments of the infectious rubella virus cDNA clone having low specific infectivity (Robo102) to create a chimeric construct having high specific infectivity (Robo302). As shown in FIG. 1, the first fragment (fragment I) contains the 3′ end of the non-structural open reading frame. Fragment I is also described as the nucleic acid molecule between restriction endonuclease cleavage sites HindIII and KpnI. The nucleic acid sequence of fragment I is set forth in the sequence listing as SEQ ID NO. 2. The second fragment (fragment II) contains the 5′ end of the non-structural open reading frame and the entire structural protein open reading frame. Fragment II is also described as the nucleic acid molecule between restriction endonuclease cleavage sites NheI and BglII. The nucleic acid sequence of fragment II is set forth in the sequence listing as SEQ ID NO. 3. In particular, fragment I replaces [0032] nucleotides 1 to 1723 of Robo102, and fragment II replaces nucleotides 2800 to 5352 of Robo102. The resulting construct, Robo302, contains roughly 90% of the f-Therien rubella virus genome and 10% of the w-Therien strain of the rubella virus genome.
In a third preferred embodiment of the present invention, fragments I and III, as described above, replace the corresponding portions of the infectious cDNA clone having low infectivity (Robo102) to produce a highly infectious cDNA clone (Robo202/I). As shown in FIG. 1, the resulting cDNA construct contains both the 5′ and 3′ ends of the f-Therien strain of the rubella virus genome corresponding to [0033] nucleotides 1 to 1723 and 5352 to 9734, respectively. The central portion of the Robo202/I cDNA is derived from nucleotides 1723 to 5352 of the w-Therien strain.
In a fourth preferred embodiment of the present invention, fragments II and III, as described above, replace the corresponding portions of the infectious cDNA clone having low infectivity (Robo102) to produce a highly infectious cDNA clone (Robo202/II). As shown in FIG. 1, the resulting cDNA construct contains the 5′ end of the w-Therien rubella virus genome up to [0034] nucleotide 2800 with the remaining section consisting of the f-Therien rubella virus genome.
The highly infectious rubella virus cDNA clones described above will be further understood with reference to the following non-limiting examples. [0035]

EXAMPLE 1

Preparation of f-Therien Virion RNA and RT-long PCR

Vero cells (ATCC, Rockville, Md.) were infected with f-Therien rubella virus (multiplicity of infection (m.o.i.)=0.5). Four days post infection, culture medium was harvested and PEG-precipitated virion RNA was isolated using either TRI-Reagent LS (Molecular Research Center, Cincinnati, Ohio), according to the protocol provided by the manufacturer, or by using the method described by Wang, C. Y. et al., [0036] J. Virol. 68:3550-3557 (1994). The extracted RNA was further purified by oligo-(dT)-cellulose chromatography, redissolved in 50 μl of water, and stored at −70° C.
First strand cDNA synthesis was performed with AMV reverse transcriptase (RiboClone™ cDNA Synthesis Kit; Promega, Madison, Wis.), according to the protocol provided by the manufacturer, in the presence of sodium pyrophosphate with one of the following three primers: [0037]
SEQ ID NO. 4: [0038]
5′-GGGAAGCTT[0039] GCACGACACGGACAAAAGCC
(underlined sequence is complementary to nucleotides 1897-1916 of the rubella virus genome) [0040]
SEQ ID NO. 5: [0041]
5′-TAGTCTTCGGCGCAAGG [0042]
(complementary to nucleotides 5744-5760 of the rubella virus genome) [0043]
SEQ ID NO. 6: [0044]
5′-CGC[0045] GAATTC(T)₂₀ CTATACAGCAACAGGTGC
(contains an EcoRI site (double underlined), a (dT)[0046] ₂₀-stretch, and a sequence complementary to nucleotides 9740-9757 of the rubella virus genome (single underlined))
Three large CDNA clones were then generated using the PCR techniques described by Barnes, W. M., et al., [0047] Proc. Natl. Acad. Sci. USA 91:2216-2220 (1994) and Cheng, S., et al., Proc. Natl. Acad. Sci. USA 91:5695-5699 (1994), the teachings of which are incorporated by reference herein. The single-stranded products, Fragments I, II, and III, were phenol-chloroform extracted and precipitated twice with ethanol, first in the presence of 2M ammonium acetate and second in the presence of 0.3 M sodium acetate. The precipitates were redissolved in 10 μg of water and 2 to 5 μl were used in 50 μl PCR reactions that contained 2.5 units of ExTaq temperature stable DNA polymerase (TaKaRa LA PCR kit, Pan Vera Corp., Madison, Wis.), and the following three primers:
SEQ ID NO. 7: [0048]
5′-TCG[0049] AAGCTTATTTAGGTGACACTATAGCAATG GAAGCTATCGGACCTCGCTTAGG
(contains a HindIII site (double underlined), the SP6 RNA polymerase promoter (dot underlined), and nucleotides 1-28 of the rubella virus genome (single underlined)) [0050]
SEQ ID NO.8: [0051]
5′-TTTGCCAACGCCACGGC [0052]
(containing nucleotides 2600-2616 of the rubella virus genome) SEQ ID NO. 9: [0053]
5′-AGCTCACCGACCGCTAC [0054]
(containing nucleotides 5319-5335 of the rubella virus genome) [0055]
The following primers and amplification protocols were utilized: for fragment I, the primer set forth in SEQ ID NO. 7 served as a primer for 30 cycles of 20 seconds at 98° C., one second at 55° C. and three minutes at 70° C.; for fragment II, the primer set forth in SEQ ID NO. 8 served as a primer for 30 cycles of 20 seconds at 98° C., one second at 50° C., and five minutes at 70° C.; and for fragment III, the primer set forth in SEQ ID NO. 9 served as a primer for 30 cycles of 20 seconds at 98° C., one second at 52° C., and seven minutes at 68° C. These techniques were slightly modified by the addition of 10% DMSO to the PCR amplifications due to the high G+C content of the rubella genome. Roughly ten percent of the rubella virus genome between fragments I and II could not be amplified from the virion RNA, presumably due to peculiarities of secondary and or tertiary structure in this region. [0056]
Using standard recombinant DNA techniques, fragments I, II, and III were digested with the restriction enzymes HindIII and KpnI, NheI and BglII, or BglII and EcoRI, respectively, as described below, and individually ligated with Robo102 from which the corresponding fragment had been removed. Phenol-chloroform extracted and linearized constructs were transcribed in vitro as described in Pugachev, K. V., P. W. Mason, and T. K. Frey [0057] Virology 209:155-166 (1995), using SP6 RNA polymerase (Epicentre Technologies, Madison, Wis.) in the presence of a cap structure analog, and transfected into Vero cells using lipofectin-mediated techniques described by Rice et al., New Biol. 1:285-296 (1989).
Freshly linearized Robo plasmids in the presence of the m7G(5′)ppp(5′)G cap structure analog (New England Biolabs, Beverly, Mass.) were used in the transcription reactions in accordance with the method of Rice et al., [0058] New Biol. 1:285-296 (1989), with the modification that Opti-MEMI-reduced serum medium replaced phosphate buffered saline (PBS) during transfection. Transfected cells were incubated and tested for rubella induced cytopathic effects.

As shown in FIG. 1, the construct containing fragment III was designated Robo202, the construct containing fragments I, II and III was designated Robo302, the construct containing fragments I and III was designated Robo202/I, and the construct containing fragments II and III was designated Robo202/II.

TABLE I


Average Titers Produced by Therien
Viruses and Robo Constructs

	Virus	Titer (pfu/ml)

	f-Therien	2.6 × 10⁷
	w-Therien	2.5 × 10⁷
	f-Therien	1.4 × 10⁷
	f-Therien	1 × 10⁷
	f-Therien	1.36 × 10⁶
	f-Therien	1.2 × 10⁷

EXAMPLE 2

Construction and Specific Infectivity of Robo202

The specific infectivity of the rubella virus cDNA clone designated Robo202, as described above in Example 1, was determined as follows. After PCR amplification of fragment III, as described above, the fragment was digested with restriction enzymes BglII and EcoRI and ligated with a similarly digested Robo102 clone, as shown in FIG. 1. In vitro transcription of the newly constructed clone, Robo202, and subsequent transfection into Vero cells resulted a 10[0060] ⁴-fold increase in infectivity as shown below in Table I. While the slightly infectious Robo102 clone did not induce cytopathic effects within eight days after transfection into Vero cells, insertion of fragment III into the Robo102 clone resulted in cytopathic effects within five days of transfection into Vero cells. However, insertion of either fragment I or II, individually, did not increase the infectivity of subsequently produced viral transcripts, and therefore the deleterious mutation that caused low infectivity of Robo102 is believed to be located in the region replaced by fragment III.

EXAMPLE 3

Construction and Specific Infectivity of Robo302

Following PCR amplification of fragments I and II, the fragments were digested with restriction enzymes HindIII and KpnI, and NheI and BglII, respectively. The fragments were simultaneously inserted into a Robo202 clone wherein the corresponding fragments had been removed, resulting in the Robo302 construct, as shown in FIG. 1. The addition of fragments I and II to the Robo202 construct, produced viral transcripts with an increased specific infectivity. [0061]
Vero cells grown in 24-well plates were infected with the indicated viruses at an m.o.i. of 2 pfu/cell. At indicated times post infection, cells were trypsinized, washed with PBS and stained with trypan blue. Three aliquots of each trypsinized cell suspension were counted. As shown in FIG. 2, viral transcripts derived from the Robo302 clone induced approximately 80% cell death over the control, whereas viral transcripts derived from the Robo202 clone resulted in approximately 40% cell death. These results also paralleled the results of plaque assays wherein the Robo302 clone displayed a clear plaque phenotype, and the Robo202 clone displayed an opaque plaque phenotype. [0062]

EXAMPLE 4

Construction and Specific Infectivity of Robo202/I and Robo202/II

Fragments I and II were excised from the Robo302 construct with the appropriate restriction enzymes, and introduced individually to produce the Robo202/I and Robo202/II constructs, respectively. Introduction of either fragment resulted in decreased plaque opacity, with Robo202/II producing the most clear plaques, slightly smaller than the plaques produced by Robo302. [0063]

EXAMPLE 5

Growth Kinetics of Robo Constructs

To elucidate the basis of the difference in plaque phenotype between the Robo constructs, growth curves of the resulting viruses and their ability to kill infected cells were investigated. Because of the limited titer to which one of the viruses, Robo202/I, replicated, an m.o.i. of 2 pfu/cell was used in these experiments. As shown in FIG. 3, the growth kinetics of all of the viruses were similar with a lag phase of roughly 0-12 hours post infection, an exponential phase between 12 and 24 hours post infection, and a slower exponential phase through 55 hours post infection. While f-Therien produced the highest titers, w-Therien, Robo302, Robo202, and Robo202/II produced similar intermediate titers. Robo202/I virus grew to noticeably lower titers than the other viruses. Over a more prolonged course of infection (4 days), w-Therien titers caught up with f-Therien titers, Robo202, Robo302 and Robo202/II titers were approximately two fold lower than f- and w-Therien titers, whereas Robo202/I titers were 8-18 fold lower than any of the other viruses. [0064]
To analyze molecular differences between these viruses that could account for the difference in plaque morphology/cell killing, virus macromolecular synthesis was characterized. Production of the rubella virus-specific RNAs (of both positive and negative polarity) was examined by northern hybridization of total intracellular RNAs extracted from infected cells with the result that all of these viruses produced equivalent amounts of all the virus RNA species (data not shown). Non-structural and structural protein synthesis was analyzed by immunoprecipitation of the proteins from lysates of infected cells radiolabeled for 1.5 hours. As shown in FIG. 3, structural protein synthesis was similar for all of the viruses. However production of the non-structural proteins was higher in cells infected with the more cytopathic viruses (f-Therien and Robo302) than the less cytopathic viruses (w-Therien and Robo202). Robo 202/I also produced more non-structural proteins in comparison with Robo202/II. These differences were not due to differences in the number of infected cells in the culture since at 40 hours post infection, a similar percentage of cells (roughly 60%) was infected with f-Therien, w-Therien, Robo302, Robo202 and Robo202/II viruses as determined by indirect immunofluorescence. However, in Robo202/I infected cells, only 35% of cells were infected, probably due to the slower replication rate of this virus. [0065]
Modifications and variations of the DNA encoding an infectious rubella virus, method of making a less virulent rubella virus, an improved rubella virus vaccine and methods of use thereof will be obvious to those skilled in the art from the foregoing detailed description of the invention. Such modifications and variations are intended to come within the scope of the appended claims. [0066]
1 9 1 9759 DNA synthetic construct - rubella 1 caatggaagc tatcggacct cgcttaggac tcccattccc atggagaaac tcctagatga 60 ggttcttgcc cccggtgggc cttataactt aaccgtcggc agttgggtaa gagaccacgt 120 ccgatcaatt gtcgagggcg cgtgggaagt gcgcgatgtt gttaccgctg cccaaaagcg 180 ggccatcgta gccgtgatac ccagacctgt gttcacgcag atgcaggtca gtgatcaccc 240 agcactccac gcaatttcgc ggtatacccg ccgccattgg atcgagtggg gccctaaaga 300 agccctacac gtcctcatcg acccaagccc gggcctgctc cgcgaggtcg ctcgcgttga 360 gcgccgctgg gtcgcactgt gcctccacag gacggcacgc aaactcgcca ccgccctggc 420 cgagacggcc agcgaggcgt ggcacgctga ctacgtgtgc gcgctgcgtg gcgcaccgag 480 cggccccttc tacgtccacc ctgaggacgt cccgcacggc ggtcgcgccg tggcggacag 540 atgcttgctc tactacacac ccatgcagat gtgcgagctg atgcgtacca ttgacgccac 600 cctgctcgtg gcggttgact tgtggccggt cgcccttgcg gcccacgtcg gcgacgactg 660 ggacgacctg ggcattgcct ggcatctcga ccatgacggc ggttgccccg ccgattgccg 720 cggagccggc gctgggccca cgcccggcta cacccgcccc tgcaccacac gcatctacca 780 agtcctgccg gacaccgccc accccgggcg cctctaccgg tgcgggcccc gcctgtggac 840 gcgcgattgc gccgtggccg aactctcatg ggaggttgcc caacactgcg ggcaccaggc 900 gcgcgtgcgc gccgtgcgat gcaccctccc tatccgccac gtgcgcagcc tccaacccag 960 cgcgcgggtc cgactcccgg acctcgtcca tctcgccgag gtgggccggt ggcggtggtt 1020 cagcctcccc cgccccgtgt tccagcgcat gctgtcctac tgcaagaccc tgagccccga 1080 cgcgtactac agcgagcgcg tgttcaagtt caagaacgcc ctgtgccaca gcatcacgct 1140 cgcgggcaat gtgctgcaag aggggtggaa gggcacgtgc gccgaggaag acgcgctgtg 1200 cgcatacgta gccttccgcg cgtggcagtc taacgccagg ttggcgggga ttatgaaagg 1260 cgcgaagcgc tgcgccgccg actctttgag cgtggccggc tggctggaca ccatttggga 1320 cgccattaag cggttcctcg gtagcgtgcc cctcgccgag cgcatggagg agtgggaaca 1380 ggacgccgcg gtcgccgcct tcgaccgcgg ccccctcgag gacggcgggc gccacttgga 1440 caccgtgcaa cccccaaaat cgccgccccg ccctgagatc gccgcgacct ggatcgtcca 1500 cgcagccagc gaagaccgcc attgcgcgtg cgctccccgc tgcgacgtcc cgcgcgaacg 1560 tccttccgcg cccgccggcc agccggatga cgaggcgctc atcccgccgt ggctgttcgc 1620 cgagcgccgt gccctccgct gccgcgagtg ggatttcgag gctctccgcg cgcgcgccga 1680 tacggcggcc gcgcccgccc cgccggctcc acgccccgcg cggtacccca ccgtgctcta 1740 ccgccacccc gcccaccacg gcccgtggct cacccttgac gagccgggcg aggctgacgc 1800 ggccctggtc ttatgcgacc cacttggcca gccgctccgg ggccctgaac gccacttcgc 1860 cgccggcgcg catatgtgcg cgcaggcgcg ggggctccag gcttttgtcc gtgtcgtgcc 1920 tccacccgag cgcccctggg ccgacggggg cgccagagcg tgggcgaagt tcttccgcgg 1980 ctgcgcctgg gcgcagcgct tgctcggcga gccagcagtt atgcacctcc catacaccga 2040 tggcgacgtg ccacagctga tcgcactggc tttgcgcacg ctggcccaac agggggccgc 2100 cttggcactc tcggtgcgtg acctgcccgg gggtgcagcg ttcgacgcaa acgcggtcac 2160 cgccgccgtg cgcgctggcc cccgccagtc cgcggccgcg tcaccgccac ccggcgaccc 2220 cccgccgccg cgccgcgcac ggcgatcgca acggcactcg gacgctcgcg gcactccgcc 2280 ccccgcgcct gcgcgcgacc cgccgccgcc cgcccccagc ccgcccgcgc caccccgcgc 2340 tggtgacccg gtccctccca ttcccgcggg gccggcggat cgcgcgcgtg acgccgagct 2400 ggaggtcgcc tgcgagccga gcggcccccc cacgtcaacc agggcagacc cagacagcga 2460 catcgttgaa agttacgccc gcgccgccgg acccgtgcac ctccgagtcc gcgacatcat 2520 ggacccaccg cccggctgca aggtcgtggt caacgccgcc aacgaggggc tactggccgg 2580 ctctggcgtg tgcggtgcca tctttgccaa cgccacggcg gccctcgctg caaactgccg 2640 gcgcctcgcc ccatgcccca ccggcgaggc agtggcgaca cccggccacg gctgcgggta 2700 cacccacatc atccacgccg tcgcgccgcg gcgtcctcgg gaccccgccg ccctcgagga 2760 gggcgaagcg ctgctcgagc gcgcctaccg cagcatcgtc gcgctagccg ccgcgcgtcg 2820 gtgggcgtgt gtcgcgtgcc ccctcctcgg cgctggcgtc tacggctggt ctgctgcgga 2880 gtccctccga gccgcgctcg cggctacgcg caccgagccc gtcgagcgcg tgagcctgca 2940 catctgccac cccgaccgcg ccacgctgac gcacgcctcc gtgctcgtcg gcgcggggct 3000 cgctgccagg cgcgtcagtc ctcctccgac cgagcccctc gcatcttgcc ccgccggtga 3060 cccgggccga ccggctcagc gcagcgcgtc gcccccagcg accccccttg gggatgccac 3120 cgcgcccgag ccccgcggat gccaggggtg cgaactctgc cggtacacgc gcgtcaccaa 3180 tgaccgcgcc tatgtcaacc tgtggctcga gcgcgaccgc ggcgccacca gctgggccat 3240 gcgcattccc gaggtggttg tctacgggcc ggagcacctc gccacgcatt ttccattaaa 3300 ccactacagt gtgctcaagc ccgcggaggt caggcccccg cgaggcatgt gcgggagtga 3360 catgtggcgc tgccgcggct ggcatggcat gccgcaggtg cggtgcaccc cctccaacgc 3420 tcacgccgcc ctgtgccgca caggcgtgcc ccctcgggcg agcacgcgag gcggcgagct 3480 agacccaaac acctgctggc tccgcgccgc cgccaacgtt gcgcaggctg cgcgcgcctg 3540 cggcgcctac acgagtgccg ggtgccccaa gtgcgcctac ggccgcgccc tgagcgaagc 3600 ccgcactcat gaggacttcg ccgcgctgag ccagcggtgg agcgcgagcc acgccgatgc 3660 ctcccctgac ggcaccggag atcccctcga ccccctgatg gagaccgtgg gatgcgcctg 3720 ttcgcgcgtg tgggtcggct ccgagcatga ggccccgccc gaccacctcc tggtgtccct 3780 tcaccgtgcc ccaaatggtc cgtggggcgt agtgctcgag gtgcgtgcgc gccccgaggg 3840 gggcaacccc accggccact tcgtctgcgc ggtcggcggc ggcccacgcc gcgtctcgga 3900 ccgcccccac ctctggcttg cggtccccct gtctcggggc ggtggcacct gtgccgcgac 3960 cgacgagggg ctggcccagg cgtactacga cgacctcgag gtgcgccgcc tcggggatga 4020 cgccatggcc cgggcggccc tcgcatcagt ccaacgccct cgcaaaggcc cttacaatat 4080 cagggtatgg aacatggccg caggcgctgg caagactacc cgcatcctcg ctgccttcac 4140 gcgcgaagac ctttacgtct gccccaccaa tgcgctcctg cacgagatcc aggccaaact 4200 ccgcgcgcgc gatatcgaca tcaagaacgc cgccacctac gagcgccggc tgacgaaacc 4260 gctcgccgcc taccgccgca tctacatcga tgaggcgttc actctcggcg gcgagtactg 4320 cgcgttcgtt gccagccaaa ccaccgcgga ggtgatctgc gtcggtgatc gggaccagtg 4380 cggcccacac tacgccaata actgccgcac ccccgtccct gaccgctggc ctaccgagcg 4440 ctcgcgccac acttggcgct tccccgactg ctgggcggcc cgcctgcgcg cggggctcga 4500 ttatgacatc gagggcgagc gcaccggcac cttcgcctgc aacctttggg acggccgcca 4560 ggtcgacctt cacctcgcct tctcgcgcga aaccgtgcgc cgccttcacg aggctggcat 4620 acgcgcatac accgtgcgcg aggcccaggg tatgagcgtc ggcaccgcct gcatccatgt 4680 aggcagagac ggcacggacg ttgccctggc gctgacacgc gacctcgcca tcgtcagcct 4740 gacccgggcc tccgacgcac tctacctcca cgagctcgag gacggctcac tgcgcgctgc 4800 ggggctcagc gcgttcctcg acgccggggc actggcggag ctcaaggagg ttcccgctgg 4860 cattgaccgc gttgtcgccg tcgagcaggc accaccaccg ttgccgcccg ccgacggcat 4920 ccccgaggcc caagacgtgc cgcccttctg cccccgcact ctggaggagc tcgtcttcgg 4980 ccgtgccggc cacccccatt acgcggacct caaccgcgtg actgagggcg aacgagaagt 5040 gcggtacatg cgcatctcgc gtcacctgct caacaagaat cacaccgaga tgcccggaac 5100 ggaacgcgtt ctcagtgccg tttcgccgtg cggctaccgc gcgggcgagg atgggtcgac 5160 cctccgcact gctgtggccc gccagcaccc gcgccctttt cgccagatcc cacccccgcg 5220 cgtcactgct ggggtcgccc aggagtggcg catgacgtac ttgcgggaac ggatcgacct 5280 cactgatgtc tacacgcaga tgggcgtggc cgcgcgggag ctcaccgacc gctacgcgcg 5340 ccgctatcct gagatcttcg ccggcatgtg taccgcccag agcctgagcg tccccgcctt 5400 cctcaaagcc accttgaagt gcgtagacgc cgccctcggc cccagggaca ccgaggactg 5460 ccacgccgct caggggaaag ccggccttga gatccgggcg tgggccaagg agtgggttca 5520 ggttatgtcc ccgcatttcc gcgcgatcca gaagatcatc atgcgcgcct tgcgcccgca 5580 attccttgtg gccgctggcc atacggagcc cgaggtcgat gcgtggtggc aggcccatta 5640 caccaccaac gccatcgagg tcgacttcac tgagttcgac atgaaccaga ccctcgctac 5700 tcgggacgtc gagctcgaga ttagcgccgc tctcttgggc ctcccttgcg ccgaagacta 5760 ccgcgcgctc cgcgccggca gctactgcac cctgcgcgaa ctgggctcca ctgagaccgg 5820 ctgcgagcgc acaagcggcg agcccgccac gctgctgcac aacaccaccg tggccatgtg 5880 catggccatg cgcatggtcc ccaaaggcgt gcgctgggcc gggattttcc agggtgacga 5940 tatggtcatc ttcctccccg agggcgcgcg cagcgcggca ctcaagtgga cccccgccga 6000 ggtgggcttg tttggcttcc acatcccggt gaagcacgtg agcaccccta cccccagctt 6060 ctgcgggcac gtcggcaccg cggccggcct cttccatgat gtcatgcacc aggcgatcaa 6120 ggtgctttgc cgccgtttcg acccagacgt gcttgaagaa cagcaggtgg ccctcctcga 6180 ccgcctccgg ggggtctacg cggctctgcc tgacaccgtt gccgccaatg ctgcgtacta 6240 cgactacagc gcggagcgcg tcctcgctat cgtgcgcgaa cttaccgcgt acgcgcgggg 6300 gcgcggcctc gaccacccgg ccaccatcgg cgcgctcgag gagattcaga ccccctacgc 6360 gcgcgccaat ctccacgacg ccgactaacg cccctgtacg tggggccttt aatcttacct 6420 actctaacca ggtcatcacc caccgttgtt tcgccgcatc tggtgggtac ccaacttttg 6480 ccattcggga gagccccagg gtgcccgaat ggcttctact acccccatca ccatggagga 6540 cctccagaag gccctcgagg cacaatcccg cgccctgcgc gcggaactcg ccgccggcgc 6600 ctcgcagtcg cgccggccgc ggccgccgcg acagcgcgac tccagcacct ccggagatga 6660 ctccggccgt gactccggag ggccccgccg ccgccgcggc aaccggggcc gtggccagcg 6720 cagggactgg tccagggccc cgcccccccc ggaggagcgg caagaaactc gctcccagac 6780 tccggccccg aagccatcgc gggcgccgcc acaacagcct caacccccgc gcatgcaaac 6840 cgggcgtggg ggctctgccc cgcgccccga gctggggcca ccgaccaacc cgttccaagc 6900 agccgtggcg cgtggcctgc gcccgcctct ccacgaccct gacaccgagg cacccaccga 6960 ggcctgcgtg acctcgtggc tttggagcga gggcgaaggc gcggtctttt accgcgtcga 7020 cctgcatttc accaacctgg gcaccccccc actcgacgag gacggccgct gggaccctgc 7080 gctcatgtac aacccttgcg ggcccgagcc gcccgctcac gtcgtccgcg cgtacaatca 7140 acctgccggc gacgtcaggg gcgtttgggg taaaggcgag cgcacctacg ccgagcagga 7200 cttccgcgtc ggcggcacgc gctggcaccg actgctgcgc atgccagtgc gcggcctcga 7260 cggcgacagc gccccgcttc ccccccacac caccgagcgc attgagaccc gctcggcgcg 7320 ccatccttgg cgcatccgct tcggtgcccc ccaggccttc cttgccgggc tcttgctcgc 7380 cacggtcgcc gttggcaccg cgcgcgccgg gctccagccc cgcgctgata tggcggcacc 7440 tcctacgctg ccgcagcccc cctgtgcgca cgggcagcat tacggccacc accaccatca 7500 gctgccgttc ctcgggcacg acggccatca tggcggcacc ttgcgcgtcg gccagcatta 7560 ccgaaacgcc agcgacgtgc tgcccggcca ctggctccaa ggcggctggg gttgctacaa 7620 cctgagcgac tggcaccagg gcactcatgt ctgtcatacc aagcacatgg acttctggtg 7680 tgtggagcac gaccgaccgc cgcccgcgac cccgacgcct ctcaccaccg cggcgaactc 7740 cacgaccgcc gccacccccg ccactgcgcc ggccccctgc cacgccggcc tcaatgacag 7800 ctgcggcggc ttcttgtctg ggtgcgggcc gatgcgcctg cgccacggcg ctgacacccg 7860 gtgcggtcgg ttgatctgcg ggctgtccac caccgcccag tacccgccta cccggtttgg 7920 ctgcgctatg cggtggggcc ttcccccctg ggaactggtc gtccttaccg cccgccccga 7980 agacggctgg acttgccgcg gcgtgcccgc ccatccaggc gcccgctgcc ccgaactggt 8040 gagccccatg ggacgcgcga cttgctcccc agcctcggcc ctctggctcg ccacagcgaa 8100 cgcgctgtct cttgatcacg ccctcgcggc cttcgtcctg ctggtcccgt gggtcctgat 8160 atttatggtg tgccgccgcg cctgtcgccg ccgcggcgcc gccgccgccc tcaccgcggt 8220 cgtcctgcag gggtacaacc cccccgccta tggcgaggag gctttcacct acctctgcac 8280 tgcaccgggg tgcgccactc aagcacctgt ccccgtgcgc ctcgctggcg tccgttttga 8340 gtccaagatt gtggacggcg gctgctttgc cccatgggac ctcgaggcca ctggagcctg 8400 catttgcgag atccccactg atgtctcgtg cgagggcttg ggggcctggg tacccgcagc 8460 cccttgcgcg cgcatctgga atggcacaca gcgcgcgtgc accttctggg ctgtcaacgc 8520 ctactcctct ggcgggtacg cgcagctggc ctcttacttc aaccctggcg gcagctacta 8580 caagcagtac caccctaccg cgtgcgaggt tgaacctgcc ttcggacaca gcgacgcggc 8640 ctgctggggc ttccccaccg acaccgtgat gagcgtgttc gcccttgcta gctacgtcca 8700 gcaccctcac aagaccgtcc gggtcaagtt ccatacagag accaggaccg tctggcaact 8760 ctccgttgcc ggcgtgtcgt gcaacgtcac cactgaacac ccgttctgca acacgccgca 8820 cggacaactc gaggtccagg tcccgcccga ccccggggac ctggttgagt acattatgaa 8880 ttacaccggc aatcagcagt cccggtgggg cctcgggagc ccgaattgcc acggccccga 8940 ttgggcctcc ccggtttgcc aacgccattc ccctgactgc tcgcggcttg tgggggccac 9000 gccagagcgc ccccggctgc gcctggtcga cgccgacgac cccctgctgc gcactgcccc 9060 tggacccggc gaggtgtggg tcacgcctgt cataggctct caggcgcgca agtgcggact 9120 ccacatacgc gctggaccgt acggccatgc taccgtcgaa atgcccgagt ggatccacgc 9180 ccacaccacc agcgacccct ggcatccacc gggccccttg gggctgaagt tcaagacagt 9240 tcgcccggtg gccctgccac gcacgttagc gccaccccgc aatgtgcgtg tgaccgggtg 9300 ctaccagtgc ggtacccccg cgctggtgga aggccttgcc cccgggggag gcaattgcca 9360 tctcaccgtc aatggcgagg acctcggcgc cgtcccccct gggaagttcg tcaccgccgc 9420 cctcctcaac acccccccgc cctaccaagt cagctgcggg ggcgagagcg atcgcgcgac 9480 cgcgcgggtc atcgaccccg ccgcgcaatc gtttaccggc gtggtgtatg gcacacacac 9540 cactgctgtg tcggagaccc ggcagacctg ggcggagtgg gctgctgccc attggtggca 9600 gctcactctg ggcgccattt gcgccctccc actcgctggc ttactcgctt gctgtgccaa 9660 atgcttgtac tacttgcgcg gcgctatagc gcctcgctag tgggcccccg cgcgaaaccc 9720 gcactaggcc actagatccc cgcacctgtt gctgtatag 9759 2 1727 DNA Rubella virus 2 caatggaagc tatcggacct cgcttaggac tcccattccc atggagaagc tcctagatga 60 ggttcttgcc cccggtgggc cttataactt aaccgtcggc agttgggtaa gagaccacgt 120 ccgatcaatt gtcgagggcg cgtgggaagt gcgcgatgtt gttaccgctg cccaaaagcg 180 ggccatcgta gccgtgatac ccagacctgt gttcacgcag atgcaggtca gtgatcaccc 240 agcactccac gcaatttcgc ggtatacccg ccgccattgg atcgagtggg gccctaaaga 300 agccctacac gtcctcatcg acccaagccc gggcctgctc cgcgaggtcg ctcgcgttga 360 gcgccgctgg gtcgcactgt gcctccacag gacggcacgc aaactcgcca ccgccctggc 420 cgagacggcc ggcgaggcgt ggcacgctga ctacgtgtgc gcgctgcgtg gcgcaccgag 480 cggccccttc tacgtccacc ctgaggacgt cccgcacggc ggtcgcgccg tggcggacag 540 atgcttgctc tactacacac ccatgcagat gtgcgagctg atgcgtacca ttgacgccac 600 cctgctcgtg gcggttgact tgtggccggt cgcccttgcg gcccacgtcg gcgacgactg 660 ggacgacctg ggcattgcct ggcatctcga ccatgacggc ggttgccccg ccgattgccg 720 cggagccggc gctgggccca cgcccggcta cacccgcccc tgcaccacac gcatttacca 780 agtcctgccg gacaccgccc accccgggcg cctctaccgg tgcgggcccc gcctgtggac 840 gcgcgattgc gccgtggccg aactctcatg ggaggttgcc caacactgcg ggcaccaggc 900 gcgcgtgcgc gccgtgcgat gcaccctccc tatccgccac gtgcgcagcc tccaacccag 960 cgcgcgggtc cgactcccgg acctcgtcca tctcgccgag gtgggccggt ggcggtggtt 1020 cagcctcccc cgccccgtgt tccagcgcat gctgtcctac tgcaagaccc tgagccccga 1080 cgcgtactac agcgagcgcg tgttcaagtt caagaacgcc ctgagccaca gcatcacgct 1140 cgcgggcaat gtgctgcaag aggggtggaa gggcacgtgc gccgaggaag acgcgctgtg 1200 cgcatacgta gccttccgcg cgtggcagtc taacgccagg ttggcgggga ttatgaaagg 1260 cgcgaagcgc tgcgccgccg actctttgag cgtggccggc tggctggaca ccatttggga 1320 cgccattaag cggttcttcg gtagcgtgcc cctcgccgag cgcatggagg agtgggaaca 1380 ggacgccgcg gtcgccgcct tcgaccgcgg ccccctcgag gacggcgggc gccacttgga 1440 caccgtgcaa cccccaaaat cgccgccccg ccctgagatc gccgcgacct ggatcgtcca 1500 cgcagccagc gcagaccgcc attgcgcgtg cgctccccgc tgcgacgtcc cgcgcgaacg 1560 tccttccgcg cccgccggcc cgccggatga cgaggcgctc atcccgccgt ggctgttcgc 1620 cgagcgccgt gccctccgct gccgcgagtg ggatttcgag gctctccgcg cgcgcgccga 1680 tacggcggcc gcgtccgccc cgctggctcc ccgccccgcg cggtacc 1727 3 2558 DNA Rubella virus 3 gctagccgcc gcgcgtcggt gggcgtgtgt cgcgtgcccc ctcctcggcg ctggcgtcta 60 cggctggtct gctgcggagt ccctccgagc cgcgctcgcg gctacgcgca ccgagcccgt 120 cgagcgcgtg agcctgcaca tctgccaccc cgaccgcgcc acgctgacgc acgcctccgt 180 gctcgtcggc gcggggctcg ctgccaggcg cgtcagtcct cctccgaccg agcccctcgc 240 atcttgcccc gccggtgacc cgggccgacc ggctcagcgc agcgcgtcgc ccccagcgac 300 cccccttggg gatgccaccg cgcccgagcc ccgcggatgc caggggtgcg aactctgccg 360 gtgcacgcgc gtcaccaatg accgcgccta tgtcaacctg tggctcgagc gcgaccgcgg 420 cgccaccagc tgggccatgc gcattcccga ggtggttgtc tacgggccgg agcacctcgc 480 cacgcatttt ccattaaacc actacagtgt gctcaagccc gcggaggtca ggcccccgcg 540 aggcatgtgc gggagtgaca tgtggcgctg ccgcggctgg catggcatgc cgcaggtgcg 600 gtgcaccccc tccaacgctc acgccgccct gtgccgcaca ggcgtgcccc ctcgggcgag 660 cacgcgaggc ggcgagctag acccaaacac ctgctggctc cgcgccgccg ccaacgttgc 720 gcaggctgcg cgcgcctgcg gcgcctacac gagtgccggg tgccccaagt gcgcctacgg 780 ccgcgccctg agcgaagccc gcactcatga ggacttcgcc gcgctgagcc agcggtggag 840 cgcgagccac gccgatgcct cccctgacgg caccggagat cccctcgacc ccctgatgga 900 gaccgtggga tgcacctgtt cgcgcgtgtg ggtcggctcc gagcatgagg ccccgcccga 960 ccaactcctg gtgtcccttc accgtgcccc aaatggtccg tggggcgtag tgctcgaggt 1020 gcgtgcgcgc cccgaggggg gcaaccccac cggccacttc gtctgcgcgg tcggcggcgg 1080 cccacgccgc gtctcggacc gcccccacct ctggcttgcg gtccccctgt ctcggggcgg 1140 tggcacctgt gccgcgaccg acgaggggct ggcccaggcg tactacgacg acctcgaggt 1200 gcgccgcctc ggggatgacg ccatggcccg ggcggccctc gcatcagtcc aacgccctcg 1260 caaaggccct tacaatatca gggtatggaa catggccgca ggcgctggca agactacccg 1320 catcctcgct gccttcacgc gcgaagacct ttacgtctgc cccaccaatg cgctcctgca 1380 cgagatccag gccaaactcc gcgcgcgcga tatcgacttc aagaacgccg ccacctacga 1440 gcgccggctg acgaaaccgc tcgccgccta ccgccgcatc tacatcgatg aggcgttcac 1500 tctcggcggc gagtactgcg cgttcgttgc cagccaaacc accgcggagg tgatctgcgt 1560 cggtgatcgg gaccagtgcg gcccacacta cgccaataac tgccgcaccc ccgtccctga 1620 ccgctggcct accgagagct cacgccacac ttggcgcttc cccgactgct gggcggcccg 1680 cctgcgcgcg gggctcgatt atgacatcga gggcgagcgc accggcacct tcgcctgcaa 1740 cctttgggac ggccgccagg tcgaccttca cctcgccttc tcgcgcgaaa ccgtgcgccg 1800 ccttcacgag gctggcatac gcgcatacac cgtgcgcgag gcccagggta tgagcgtcgg 1860 caccgcctgc atccatgtag gcagagacgg cacggacgtt gccctggcgc tgacacgcga 1920 cctcgccatc gtcagcctga cccgggcctc cgacgcactc tacctccacg agctcgagga 1980 cggctcactg cgcgctgcgg ggctcagcgc gttcctcgac gccggggcac tggcggagct 2040 caaggaggtt cccgctggca ttgaccgcgt tgtcgccgtc gagcaggcac caccaccgtt 2100 gccgcccgcc gacggcatcc ccgaggccca agacgtgccg cccttctgcc cccgcactct 2160 ggaggagctc gtcttcggcc gtgccggcca cccccattac gcggacctca accgcgtgac 2220 tgagggcgaa cgagaagtgc ggtacatgcg catctcgcgt cacctgctca acaagaatca 2280 caccgagatg cccggaacgg aacgcgttct cagtgccgtt tgcgccgtgc ggcgctaccg 2340 cgcgggcgag gatgggtcga ccctccgcac tgctgtggcc cgccagcacc cgcgcccttt 2400 tcgccagatc ccacccccgc gcgtcactgc tggggtcgcc caggagtggc gcatgacgta 2460 cttgcgggaa cggatcgacc tcactgatgt ctacacgcag atgggcgtgg ccgcgcggga 2520 gctcaccgac cgctacgcgc gccgctatcc tgagatct 2558 4 29 DNA Synthetic Primer 4 gggaagcttg cacgacacgg acaaaagcc 29 5 17 DNA Synthetic Primer 5 tagtcttcgg cgcaagg 17 6 47 DNA Synthetic Primer 6 cgcgaattct tttttttttt tttttttttc tatacagcaa caggtgc 47 7 55 DNA Synthetic Primer 7 tcgaagctta tttaggtgac actatagcaa tggaagctat cggacctcgc ttagg 55 8 17 DNA Synthetic Primer 8 tttgccaacg ccacggc 17 9 17 DNA Synthetic Primer 9 agctcaccga ccgctac 17

Claims

We claim:

1. An isolated DNA molecule comprising a chimeric construct that encodes a highly infectious rubella virus.

2. The isolated DNA molecule of claim 1, wherein the rubella virus has a specific infectivity of greater than 0.5 plaques/μg of transcript.

3. The isolated DNA molecule of claim 1, wherein the rubella virus has a specific infectivity of approximately 10⁴plaques/μg of transcript.

4. The isolated DNA molecule of claim 1, wherein the chimeric construct comprises a DNA molecule encoding an infectious rubella virus having low infectivity in which portions of the DNA molecule have been replaced with one or more corresponding DNA fragments of a second rubella virus genome.

5. The isolated DNA molecule of claim 4, wherein the second rubella virus genome has a minimal number mutations that adversely affect infectivity.

6. The isolated DNA molecule of claim 4, wherein the molecule comprises a structural protein open reading frame portion and a non-structural protein open reading frame portion and wherein the DNA fragments replace all or a portion of the structural protein open reading frame region of the DNA molecule encoding the infectious rubella virus having low infectivity.

7. The isolated DNA molecule of claim 4, wherein the molecule comprises a structural protein open reading frame portion and a non-structural protein open reading frame portion and wherein the DNA fragments replace all or a portion of the non-structural protein open reading frame region of the DNA molecule encoding the infectious rubella virus having low infectivity.

8. The isolated DNA molecule of claim 4, wherein the DNA fragments replace portions of the DNA molecule encoding the infectious rubella virus having low infectivity selected from the group consisting of fragment I, fragment II, and fragment III.

9. The isolated DNA molecule of claim 8, wherein fragment I is a nucleic acid molecule between restriction endonuclease cleavage sites HindIII and KpnI, fragment II is a nucleic acid molecule between restriction endonuclease cleavage sites NheI and BglII, and fragment III is a nucleic acid molecule between restriction endonuclease cleavage sites NheI and BglII.

10. The isolated DNA molecule of claim 8, wherein the DNA molecule encoding the infectious rubella virus having low infectivity has the sequence set forth in SEQ ID NO. 1 and fragment I replaces nucleotides 1 to 1723 of SEQ ID NO. 1, fragment II replaces nucleotides 2800 to 5352 of SEQ ID NO. 1, and fragment III replaces nucleotides 5353 to 9734 of SEQ ID NO. 1.

11. The isolated DNA molecule of claim 1 further comprising a vector, wherein the vector enables replication of the nucleotide sequence.

12. The isolated DNA molecule of claim 11, wherein the vector is a bacterial plasmid.

13. The isolated DNA molecule of claim 12, further comprising a vector, wherein the vector enables replication of the DNA molecule.

14. The isolated DNA molecule of claim 13, wherein the vector is a bacterial plasmid.

15. A method of producing a highly infectious rubella virus comprising the steps of:

a. inserting a chimeric DNA molecule into a plasmid, wherein the chimeric construct comprises a DNA molecule encoding an infectious rubella virus having low infectivity in which portions of the DNA molecule have been replaced with one or more corresponding DNA fragments of a second rubella virus genome;

b. transcribing the DNA into linear RNA;

c. transfecting cells with the nucleic acid transcript; and

d. recovering highly infectious rubella virus from the transfected cells.

16. The method of claim 15, wherein the molecule comprises a structural protein open reading frame portion and a non-structural protein open reading frame portion and wherein the DNA fragments replace all or a portion of the structural protein open reading frame region of the DNA molecule encoding the infectious rubella virus having low infectivity.

17. The method of claim 15, wherein the molecule comprises a structural protein open reading frame portion and a non-structural protein open reading frame portion and wherein the DNA fragments replace all or a portion of the non-structural protein open reading frame region of the DNA molecule encoding the infectious rubella virus having low infectivity.

18. The method of claim 15, wherein the DNA fragments replace portions of the DNA molecule encoding the infectious rubella virus having low infectivity selected from the group consisting of fragment I, fragment II, and fragment III.

19. The method of claim 18, wherein fragment I is a nucleic acid molecule between restriction endonuclease cleavage sites HindIII and KpnI, fragment II is a nucleic acid molecule between restriction endonuclease cleavage sites NheI and BglII, and fragment III is a nucleic acid molecule between restriction endonuclease cleavage sites NheI and BglII.

20. The method of claim 18, wherein the DNA molecule encoding the infectious rubella virus having low infectivity has the sequence set forth in SEQ ID NO. 1 and fragment I replaces nucleotides 1 to 1723 of SEQ ID NO. 1, fragment II replaces nucleotides 2800 to 5352 of SEQ ID NO. 1, and fragment III replaces nucleotides 5353 to 9734 of SEQ ID NO. 1.