US20020037525A1 - Method for generating transcriptionally active DNA fragments - Google Patents

Method for generating transcriptionally active DNA fragments Download PDF

Info

Publication number
US20020037525A1
US20020037525A1 US09/919,758 US91975801A US2002037525A1 US 20020037525 A1 US20020037525 A1 US 20020037525A1 US 91975801 A US91975801 A US 91975801A US 2002037525 A1 US2002037525 A1 US 2002037525A1
Authority
US
United States
Prior art keywords
dna
promoter
pcr
region
dna fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/919,758
Inventor
Xiaowu Liang
Philip Felgner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US09/919,758 priority Critical patent/US20020037525A1/en
Publication of US20020037525A1 publication Critical patent/US20020037525A1/en
Priority to US11/475,794 priority patent/US20060240469A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Definitions

  • the present invention relates to a method for generating transcriptionally active DNA fragments. More specifically, the method relates to synthesis of a DNA fragment by polymerase chain reaction (PCR) using nested primers, promoter sequences and terminator sequences.
  • PCR polymerase chain reaction
  • the present invention provides a simple, rapid method for the generation of transcriptionally active DNA fragments.
  • One embodiment of the present invention is a method for generating a transcriptionally active DNA molecule, comprising polymerase chain reaction (PCR) amplification of said DNA molecule in the presence of a first DNA fragment (F1), second DNA fragment (F2), first primer (P1), a second primer (P2), a third primer (P3) and a fourth primer (P4)
  • F1 comprises a promoter sequence
  • F2 comprises a terminator sequence
  • P1 is complementary to the 5′ end of F1
  • P2 is complementary to the 3′ end of F2
  • P3 comprises a first region complementary to the 3′ end of F1 and a second region complementary to the 5′ end of said DNA molecule
  • P4 comprises a first region complementary to the 5′ end of F2 and a second region complementary to the 3′ end of said DNA molecule, whereby a transcriptionally active DNA molecule is produced by said PCR amplification.
  • F1 is the cytomegalovirus IE promoter.
  • the transcriptionally active DNA molecule encodes a therapeutic gene.
  • the method may further comprise the step of adding a PNA tail to the 5′-end of P1 and P2 prior to the PCR amplification.
  • a thymidine base immediately precedes the region of complementarity between the third primer P3 and the first DNA fragment F1.
  • a thymidine base immediately precedes the region of complementarity between the fourth primer P3 and the second DNA fragment F2.
  • the method may also further comprise the step of adding a PNA clamp to said transcriptionally active DNA molecule after said PCR amplification.
  • the method further comprises the step of adding a PNA molecule via a linker (PNA clamp tail) to primers P1 and P2 prior to the PCR amplification.
  • FIG. 1 is a schematic diagram of the gene amplification method of the present invention.
  • Oligonucleotide primers P1 and P2 are complementary to the 5′ end of a promoter sequence (F1) and the 3′ end of a terminator sequence (F2), respectively.
  • P3 and P4 are oligonucleotide primers which contain regions complementary to opposite ends of Gene X.
  • P3 and P4 contain regions which are complementary to the 3′ region of F1 and the 5′ region of F2.
  • primers P1 and P2 are combined with Gene X, or with a mixture of DNA containing Gene X, and with F1, F2, P3 and P4, or with a mixture of DNA containing F1, F2 and Gene X which has been PCR amplified using P3 and P4, and subjected to PCR to produce a transcriptionally active linear DNA fragment containing F1, F2 and gene X.
  • FIG. 2 is a schematic diagram showing DNA fragment F1 which contains a thymidine base immediately preceding the region of complementarity with the PCR intermediate (primer P3).
  • FIG. 3 is a schematic diagram showing the use of peptide nucleic acid (PNA) sequences and PNA clamps to protect the ends of linear expression DNA fragments.
  • Primers P1 and P2 contain a PNA tail which is resistant to proteolytic and exonuclease degradation.
  • the resulting linear expression DNA fragment contains a PNA tail at each of the 5′-ends.
  • the 3′ ends are protected by addition of a PNA “clamp” which is also resistant to proteolytic and exonuclease degradation.
  • FIG. 4 is a schematic diagram showing the use of a PNA “clamp” tail to protect the 5′ ends of the linear expression DNA fragment, followed by formation of a clamp during PCR to protect the 3′ ends.
  • the present invention provides a simple, efficient method for generating transcriptionally active DNA fragments which can be readily transfected into animal cells or tissues by conventional nucleic acid transfection techniques, without the need for subcloning into expression vectors and purification of plasmid DNA from bacteria.
  • the transcriptionally active DNA fragments are synthesized by polymerase chain reaction (PCR) amplification of any gene of interest using nested oligonucleotide primers and two DNA fragments, one of which comprises an active transcription promoter sequence and one of which comprises a basic transcription terminator element.
  • a first primer is complementary to the DNA fragment comprising the promoter; a second primer is complementary to the DNA fragment comprising the terminator; a third primer is complementary to both the promoter sequence and one end of the gene of interest; and a fourth primer is complementary to both the terminator sequence and the other end of the gene of interest.
  • These promoters, genes and terminators are linked in an expression cassette as shown in FIG. 1.
  • the ends of linear DNA containing the expression cassette can be protected from exonuclease digestion during and after transfection by incorporating peptide nucleic acid (PNA) sequences and PNA clamps as shown in FIGS. 3 and 4.
  • PNA peptide nucleic acid
  • promoter is a DNA sequence which extends upstream from the transcription initiation site and is involved in binding of RNA polymerase.
  • the promoter may contain several short ( ⁇ 10 base pair) sequence elements that bind transcription factors, generally dispersed over >200 base pairs.
  • a promoter that contains only elements recognized by general and upstream factors is usually transcribed in any cell type.
  • Such promoters may be responsible for expression of cellular genes that are constitutively expressed (sometimes called housekeeping genes).
  • tissue-specific promoters limited to particular cell types, such as the human metallothionein (MT) promoter which is upregulated by heavy metal ions and glucocorticoids.
  • MT human metallothionein
  • terminal is a DNA sequence represented at the end of the transcript that causes RNA polymerase to terminate transcription. This occurs at a discrete site downstream of the mature 3′ end which is generated by cleavage and polyadenylation.
  • the present method can be used to quickly generate nuclease-resistant and transcriptionally active linear DNA molecules which express any desired gene with any known sequence.
  • the linear DNA can then be delivered into animal cells or tissues for functional analysis, vaccination and other pharmaceutical applications.
  • This method also avoids problems associated with bacterial growth such as toxicity and stability.
  • This method can also be completely automated for use in high-throughput screening methods.
  • oligonucleotide primers P1 and P2 are complementary to the 5′ region of DNA fragments F1 and F2, respectively.
  • Fragment F1 comprises a transcription promoter (darkened region) and fragment F2 comprises a transcription terminator (darkened region).
  • Primers P3 and P4 are complementary to the 3′ ends of F1 and F2, respectively, and to different ends of the DNA fragment containing Gene X.
  • FIG. 1 shows the putative intermediates and the final product which are formed in the present PCR-based method when P1, P2, P3, P4 , F1 and F2 are added to a DNA template comprising Gene X.
  • primers P1 and P2 present in the reaction mixture are preferably at least about 100 fold greater than the amounts of P3, P4, F1 and F2, to minimized the amounts of intermediate products generated during the reaction.
  • primer P3 and P4 are used which amplify from the promoter and terminator sequences of F1 and F2 across Gene X, resulting in an intermediate having the promoter and terminator sequences on the ends and Gene X in between these sequences.
  • the second intermediate is formed by hybridization of the first intermediate with fragments F1 and F2 via their complementary promoter and terminator sequences (darkened regions), followed by PCR amplification from primers P3 and P4, resulting in a DNA segment comprising the entire F1, F2 and Gene X.
  • the method of the invention may be performed by adding all of the components in a single reaction mixture. Alternatively, two separate PCR reactions can be performed. In the first reaction, the template gene, P3 and P4 are used first. The product of this reaction is then used as a template for a second PCR reaction involving fragments F1 and F2, plus primers P1 and P2.
  • the overlap between the PCR intermediate (P3 primer) and F1, and P4/F2 is designed such that a thymidine base (T) immediately precedes the overlap region in fragments F1 and F2 (FIG. 2, only F1 shown).
  • T thymidine base
  • PNA Peptide nucleic acids
  • PNA clamps molecules called PNA “clamps” which have two identical PNA sequences joined by a flexible hairpin linker containing three 8-amino-3,6-dioxaoctanoic acid units.
  • a PNA clamp is mixed with a complementary homopurine or homopyrimidine DNA target sequence, a PNA-DNA-PNA triplex hybrid can form which is extremely stable (Bentin et al., Biochemistry 35:8863-8869, 1996; Egholm et al., Nucleic Acids Res. 23:217-222, 1995; Griffith et al., J. Am. Chem. Soc. 117:831-832, 1995).
  • FIGS. 3 and 4 A representative PNA clamp is shown in FIGS. 3 and 4.
  • This PNA clamp, or a PNA clamp having any desired DNA sequence is synthesized as described by Egholm et al. (supra.) or is available from PerSeptive Biosystems (Framingham, Mass.).
  • the representative PNA clamp shown in FIGS. 2 and 3 has the sequence 5′-TCTCTCTC-O-O-O-TJTJTJTJTJTJ (SEQ ID NO: 1), where J (pseudoisocytosine) is an analog of C, and the “O” residues are 8-amino-3,6-dioxaoctanoic acid linkers which separate the two regions of the PNA.
  • FIG. 2 The use of PNA tails, PNA clamps and PNA “clamp tails” to protect the ends of the transcriptionally active PCR fragments which are described above is illustrated in FIG. 2.
  • the ends of the PCR fragments generated as shown in FIG. 1 are prone to digestion by exonucleases after transfection into a cell or tissue.
  • Two strategies for inhibiting this degradation are shown in FIGS. 3 and 4.
  • a PNA tail and a short DNA sequence (5′-GATC-O-TCTCTCTC-3′; SEQ ID NO: 2) is added to the 5′ end of primers P1 and P2 which bind to the target sequence 5′-GAGAGAGA-3′ (SEQ ID NO: 3).
  • PNA binding site at the 3′ end of the opposite strand during PCR.
  • Primers containing PNA tails can be synthesized using methods well known in the art or are available from PerSeptive Biosystems. These PNA tails do not hybridize to a target sequence, but protect the 5′-ends from exonuclease digestion. In order to protect the 5′ ends of the PCR fragment, a PNA molecule is added to the 3′-PNA tail-protected PCR fragment. This PNA contains a DNA sequence which is complementary to the 3′-end of the PCR fragment and binds thereto as shown in FIG. 3.
  • FIG. 4 An alternate PNA protection approach is shown in FIG. 4.
  • a PNA clamp is linked to primers P1 and P2 via one or more 8-amino-3,6-dioxaoctanoic acid linkers to form a PNA “clamp” tail by well known methods.
  • the “clamp tail” binds to the 3′ ends of the PCR fragment, and is linked to the 5′ ends via the one or more 8-amino-3,6-dioxaoctanoic acid linkers to protect both the 3′ and 5′ ends of the PCR fragment.
  • Suitable promoters for use in the present invention include, for example, SV40, rous sarcoma virus (RSV), retroviral long terminal repeats (LTR), muscle creatine kinase promoter, actin promoter, elongation factor promoter, synthetic promoters, tissue-specific promoters, and the like.
  • Suitable terminator sequences include SV40 transcription terminator, bovine growth hormone (BGH) terminator, synthetic terminators, and the like. These promoter and terminator sequences can be obtained by restriction enzyme digestion of commercially available plasmids and cDNA molecules, or can be synthesized using an automated DNA synthesizer using methods well known in the art.
  • any desired gene may be amplified and coupled to active promoter and terminator sequences using the method of the present invention.
  • the gene encodes a gene product which is absent or present at reduced levels in an organism.
  • Nonlimiting examples of these gene products are the cystic fibrosis transmembrane regulator (CFTR), insulin, dystrophin, interleukin-2, interleukin-12, erythropoietin, gamma interferon, and granulocyte macrophage colony stimulating factor (GM-CSF).
  • CFTR cystic fibrosis transmembrane regulator
  • GM-CSF granulocyte macrophage colony stimulating factor
  • any transfection method well known in the art may be used to transfect the transcriptionally active PCR fragments of the invention into cells or tissues including calcium phosphate precipitation, electroporation and DEAE-dextran, cationic lipid-mediated transfection is preferred.
  • Gene delivery systems are described by Felgner et al. ( Hum. Gene Ther. 8:511-512, 1997) and include cationic lipid-based delivery systems (lipoplex), polycation-based delivery systems (polyplex) and a combination thereof (lipopolyplex).
  • Cationic lipids are described in U.S. Pat. Nos. 4,897,355 and 5,459,127, the entire contents of which are hereby incorporated by reference.
  • DNA fragment F1 (4 ng) which comprises a region of high transcriptional potency ( ⁇ 240 to +60) from the human cytomegalovirus (CMV) immediate early gene (IE) promoter/enhancer
  • DNA fragment F2 (4 ng)
  • a 55 base pair oligonucleotide encoding an artificial mammalian transcription terminator element (5′-CACAAAAAACCAACACACAGATCTCTAGAGCTCTGATCTTTTATTAGCCA GAAGT-3′; SEQ ID NO: 4
  • 400 ng primer P1 (5′-TCTCTCTACGTATTAGTCATCG-3′; SEQ ID NO: 5
  • 400 ng primer P2 (5′-TCACAAAAAACCAACACACAG-3′; SEQ ID NO: 6
  • the P1 and P2 primer sequences correspond to the 5′ end of fragment F1 and the 5′ end of fragment F2, respectively (FIG. 1).
  • Primers P3 and P4 are designed based on the gene sequence of interest. The 3′ potion of these primers (about 10-20 base pairs) is determined by the actual sequence of the gene to be amplified, whereas the 5′ region of P3 comprises the following sequence: 5′-CTCCGCGGATCCAGA-3′ (SEQ ID NO: 7) to overlap with the 3′ region of F1, and P4 comprises the sequence 5′-TTATTAGCCAGAAGT-3′ (SEQ ID NO: 8) to overlap with the 3′ region of F2.
  • PCR is performed as follows: denaturation for 30 seconds at 94° C., annealing for 45 seconds at 55° C. and extension for three minutes at 72° C. for 25-30 cycles. The size of the final produce is verified by 1% agarose gel electrophoresis. The amplified PCR fragment is cleaned and purified using a commercial PCR cleaning kit (e.g., Qiagen), and can be used for in vitro or in vivo transfection of cells or tissues.
  • a commercial PCR cleaning kit e.g., Qiagen
  • the green fluorescent protein (GFP, 700 bp) was used as a target gene.
  • the F1 fragment was a 600 bp fragment of the CMV immediate early gene promoter (from ⁇ 550 to +50).
  • a 50 bp oligonucleotide containing a modified rabbit beta-globin gene transcription terminator was used as primer 2.
  • Two different versions of these primers were designed so that the overlap between F1 and the intermediate GFP PCR fragment was either preceded with or without a thymidine base. After the PCR reaction was carried out according to the conditions described in Example 1, the products were analyzed by electrophoresis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A method for producing transcriptionally active DNA molecules, comprising (PCR) amplification of said DNA molecule in the presence of a first DNA fragment (F1), second DNA fragment (F2), first primer (P1), a second primer (P2), a third primer (P3), and a fourth primer (P4) wherein: F1 comprises a promoter sequence; F2 comprises a terminator sequence; P1 is complementary to the 5′ end of F1; P2 is complementary to the 5′ end of F2; P3 comprises a first region complementary to the 3′ end of F1 and a second region complementary to the 5′ end of said DNA molecule; P4 comprises a first region complementary to the 3′ end of F2 and a second region complementary to the 3′ end of said DNA molecule.

Description

    RELATED APPLICATIONS
  • The present application is a continuation of U.S. patent application Ser. No. 09/535,262, filed Mar. 23, 2000, and claims priority to U.S. Provisional Application Serial No. 60/125,953, filed Mar. 24, 1999, both of which are hereby expressly incorporated by reference in their entireties.[0001]
  • BACKGROUND OF THE INVENTION
  • 1. Field of the Invention [0002]
  • The present invention relates to a method for generating transcriptionally active DNA fragments. More specifically, the method relates to synthesis of a DNA fragment by polymerase chain reaction (PCR) using nested primers, promoter sequences and terminator sequences. [0003]
  • 2. Description of the Related Art [0004]
  • In addition to the tremendous progress made in the past few years in sequencing the human genome, efforts have also been made to sequence other organisms that are of biomedical importance. For example, complete genomic sequences have been obtained for [0005] Borrelia burgdorferi (cause of Lyme disease), Chlamydia, Heliobacter pylori and Mycobacterium tuberculosis. The fast-growing sequence information provides immense opportunities to reveal the basic biology of related organisms at the gene/molecular level and to develop novel therapeutics or vaccines against various pathogens.
  • However, this vast sequence information also mandates a much more efficient and streamlined way to screen and identify genes of interest from tens of thousands of candidate genes. The conventional approach to gene screening and identification involves generation of a cDNA library, subcloning the DNA inserts into plasmid vectors (expression vectors), purifying plasmid DNA from bacteria for each individual cDNA clone and transfecting animal cells or tissues for functional analysis of the encoded gene product. This method, even in conjunction with the use of polymerase chain reaction (PCR) to generate cDNA fragments to allow directional and in-frame cloning, is still time consuming, costly and difficult to automate. [0006]
  • The present invention provides a simple, rapid method for the generation of transcriptionally active DNA fragments. [0007]
  • SUMMARY OF THE INVENTION
  • One embodiment of the present invention is a method for generating a transcriptionally active DNA molecule, comprising polymerase chain reaction (PCR) amplification of said DNA molecule in the presence of a first DNA fragment (F1), second DNA fragment (F2), first primer (P1), a second primer (P2), a third primer (P3) and a fourth primer (P4) wherein: F1 comprises a promoter sequence; F2 comprises a terminator sequence; P1 is complementary to the 5′ end of F1; P2 is complementary to the 3′ end of F2; P3 comprises a first region complementary to the 3′ end of F1 and a second region complementary to the 5′ end of said DNA molecule; P4 comprises a first region complementary to the 5′ end of F2 and a second region complementary to the 3′ end of said DNA molecule, whereby a transcriptionally active DNA molecule is produced by said PCR amplification. Preferably, F1 is the cytomegalovirus IE promoter. In one aspect of this preferred embodiment, the transcriptionally active DNA molecule encodes a therapeutic gene. The method may further comprise the step of adding a PNA tail to the 5′-end of P1 and P2 prior to the PCR amplification. Preferably, a thymidine base immediately precedes the region of complementarity between the third primer P3 and the first DNA fragment F1. In another aspect of this preferred embodiment, a thymidine base immediately precedes the region of complementarity between the fourth primer P3 and the second DNA fragment F2. The method may also further comprise the step of adding a PNA clamp to said transcriptionally active DNA molecule after said PCR amplification. Preferably, the method further comprises the step of adding a PNA molecule via a linker (PNA clamp tail) to primers P1 and P2 prior to the PCR amplification.[0008]
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 is a schematic diagram of the gene amplification method of the present invention. Oligonucleotide primers P1 and P2 are complementary to the 5′ end of a promoter sequence (F1) and the 3′ end of a terminator sequence (F2), respectively. P3 and P4 are oligonucleotide primers which contain regions complementary to opposite ends of Gene X. In addition, P3 and P4 contain regions which are complementary to the 3′ region of F1 and the 5′ region of F2. An excess amount of primers P1 and P2 are combined with Gene X, or with a mixture of DNA containing Gene X, and with F1, F2, P3 and P4, or with a mixture of DNA containing F1, F2 and Gene X which has been PCR amplified using P3 and P4, and subjected to PCR to produce a transcriptionally active linear DNA fragment containing F1, F2 and gene X. [0009]
  • FIG. 2 is a schematic diagram showing DNA fragment F1 which contains a thymidine base immediately preceding the region of complementarity with the PCR intermediate (primer P3). [0010]
  • FIG. 3 is a schematic diagram showing the use of peptide nucleic acid (PNA) sequences and PNA clamps to protect the ends of linear expression DNA fragments. Primers P1 and P2 contain a PNA tail which is resistant to proteolytic and exonuclease degradation. The resulting linear expression DNA fragment contains a PNA tail at each of the 5′-ends. The 3′ ends are protected by addition of a PNA “clamp” which is also resistant to proteolytic and exonuclease degradation. [0011]
  • FIG. 4 is a schematic diagram showing the use of a PNA “clamp” tail to protect the 5′ ends of the linear expression DNA fragment, followed by formation of a clamp during PCR to protect the 3′ ends.[0012]
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • The present invention provides a simple, efficient method for generating transcriptionally active DNA fragments which can be readily transfected into animal cells or tissues by conventional nucleic acid transfection techniques, without the need for subcloning into expression vectors and purification of plasmid DNA from bacteria. The transcriptionally active DNA fragments are synthesized by polymerase chain reaction (PCR) amplification of any gene of interest using nested oligonucleotide primers and two DNA fragments, one of which comprises an active transcription promoter sequence and one of which comprises a basic transcription terminator element. A first primer is complementary to the DNA fragment comprising the promoter; a second primer is complementary to the DNA fragment comprising the terminator; a third primer is complementary to both the promoter sequence and one end of the gene of interest; and a fourth primer is complementary to both the terminator sequence and the other end of the gene of interest. These promoters, genes and terminators are linked in an expression cassette as shown in FIG. 1. In addition, the ends of linear DNA containing the expression cassette can be protected from exonuclease digestion during and after transfection by incorporating peptide nucleic acid (PNA) sequences and PNA clamps as shown in FIGS. 3 and 4. [0013]
  • As used herein, the term “promoter” is a DNA sequence which extends upstream from the transcription initiation site and is involved in binding of RNA polymerase. The promoter may contain several short (<10 base pair) sequence elements that bind transcription factors, generally dispersed over >200 base pairs. A promoter that contains only elements recognized by general and upstream factors is usually transcribed in any cell type. Such promoters may be responsible for expression of cellular genes that are constitutively expressed (sometimes called housekeeping genes). There are also tissue-specific promoters limited to particular cell types, such as the human metallothionein (MT) promoter which is upregulated by heavy metal ions and glucocorticoids. [0014]
  • As used herein, the term “terminator” is a DNA sequence represented at the end of the transcript that causes RNA polymerase to terminate transcription. This occurs at a discrete site downstream of the mature 3′ end which is generated by cleavage and polyadenylation. [0015]
  • The present method can be used to quickly generate nuclease-resistant and transcriptionally active linear DNA molecules which express any desired gene with any known sequence. The linear DNA can then be delivered into animal cells or tissues for functional analysis, vaccination and other pharmaceutical applications. This method also avoids problems associated with bacterial growth such as toxicity and stability. This method can also be completely automated for use in high-throughput screening methods. [0016]
  • Referring now to FIG. 1, oligonucleotide primers P1 and P2 are complementary to the 5′ region of DNA fragments F1 and F2, respectively. Fragment F1 comprises a transcription promoter (darkened region) and fragment F2 comprises a transcription terminator (darkened region). Primers P3 and P4 are complementary to the 3′ ends of F1 and F2, respectively, and to different ends of the DNA fragment containing Gene X. FIG. 1 shows the putative intermediates and the final product which are formed in the present PCR-based method when P1, P2, P3, P4 , F1 and F2 are added to a DNA template comprising Gene X. It should be noted that amount of primers P1 and P2 present in the reaction mixture are preferably at least about 100 fold greater than the amounts of P3, P4, F1 and F2, to minimized the amounts of intermediate products generated during the reaction. To generate the first intermediate, primer P3 and P4 are used which amplify from the promoter and terminator sequences of F1 and F2 across Gene X, resulting in an intermediate having the promoter and terminator sequences on the ends and Gene X in between these sequences. [0017]
  • The second intermediate is formed by hybridization of the first intermediate with fragments F1 and F2 via their complementary promoter and terminator sequences (darkened regions), followed by PCR amplification from primers P3 and P4, resulting in a DNA segment comprising the entire F1, F2 and Gene X. [0018]
  • In the last step of the reaction, PCR amplification of the second intermediate using primers P1 and P2 results in amplified amounts of the complete transcriptionally active DNA fragment. [0019]
  • The method of the invention may be performed by adding all of the components in a single reaction mixture. Alternatively, two separate PCR reactions can be performed. In the first reaction, the template gene, P3 and P4 are used first. The product of this reaction is then used as a template for a second PCR reaction involving fragments F1 and F2, plus primers P1 and P2. [0020]
  • The generation of final products using the nested PCR method describe above is dependent on the sequences of the F1 or F2 fragments at the junction between the region overlapping P3 and P4, respectively. This is due, at least in part, to the addition of an extra adenosine base (A) at the 3′ end of the PCR fragment by Taq DNA polymerase which is commonly used in PCR protocols. This could produce a mismatch between the PCR intermediate generated by P3/P4 and fragments F1 and F2. [0021]
  • Thus, in a preferred embodiment, the overlap between the PCR intermediate (P3 primer) and F1, and P4/F2, is designed such that a thymidine base (T) immediately precedes the overlap region in fragments F1 and F2 (FIG. 2, only F1 shown). In this case, even with the addition of an “A” base to the 3′ end to the intermediate during PCR amplification, the overlap between F1/F2 and the respective PCR intermediates is still perfectly maintained. [0022]
  • Peptide nucleic acids (PNA) are nucleic acid analogs in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically completely different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units. Unlike DNA, which is highly negatively charged, the PNA backbone is neutral. Therefore, there is much less repulsive energy between complementary strands in a PNA-DNA hybrid than the comparable DNA-DNA hybrid, and consequently they are much more stable. [0023]
  • In addition, molecules called PNA “clamps” have been synthesized which have two identical PNA sequences joined by a flexible hairpin linker containing three 8-amino-3,6-dioxaoctanoic acid units. When a PNA clamp is mixed with a complementary homopurine or homopyrimidine DNA target sequence, a PNA-DNA-PNA triplex hybrid can form which is extremely stable (Bentin et al., [0024] Biochemistry 35:8863-8869, 1996; Egholm et al., Nucleic Acids Res. 23:217-222, 1995; Griffith et al., J. Am. Chem. Soc. 117:831-832, 1995). The sequence-specific and high affinity duplex and triplex binding of PNA have been extensively described (Nielsen et al., Science 254:1497-1500, 1991; Egholm et al., J. Am. Chem. Soc. 114:9677-9678, 1992; Egholm et al., Nature 365:566-568, 1993; Almarsson et al., Proc. Natl. Acad. Sci. U. S. A. 90:9542-9546, 1993; Demidov et al., Proc. Natl. Acad. Sci. U. S A. 92:2637-2641, 1995). They have also been shown to be resistant to nuclease and protease digestion (Demidov et al., Biochem. Pharm. 48:1010-1013, 1994).
  • A representative PNA clamp is shown in FIGS. 3 and 4. This PNA clamp, or a PNA clamp having any desired DNA sequence, is synthesized as described by Egholm et al. (supra.) or is available from PerSeptive Biosystems (Framingham, Mass.). The representative PNA clamp shown in FIGS. 2 and 3 has the [0025] sequence 5′-TCTCTCTC-O-O-O-TJTJTJTJ (SEQ ID NO: 1), where J (pseudoisocytosine) is an analog of C, and the “O” residues are 8-amino-3,6-dioxaoctanoic acid linkers which separate the two regions of the PNA.
  • The use of PNA tails, PNA clamps and PNA “clamp tails” to protect the ends of the transcriptionally active PCR fragments which are described above is illustrated in FIG. 2. The ends of the PCR fragments generated as shown in FIG. 1 are prone to digestion by exonucleases after transfection into a cell or tissue. Two strategies for inhibiting this degradation are shown in FIGS. 3 and 4. In FIG. 1, a PNA tail and a short DNA sequence (5′-GATC-O-TCTCTCTC-3′; SEQ ID NO: 2) is added to the 5′ end of primers P1 and P2 which bind to the [0026] target sequence 5′-GAGAGAGA-3′ (SEQ ID NO: 3). This generates a PNA binding site at the 3′ end of the opposite strand during PCR. Primers containing PNA tails can be synthesized using methods well known in the art or are available from PerSeptive Biosystems. These PNA tails do not hybridize to a target sequence, but protect the 5′-ends from exonuclease digestion. In order to protect the 5′ ends of the PCR fragment, a PNA molecule is added to the 3′-PNA tail-protected PCR fragment. This PNA contains a DNA sequence which is complementary to the 3′-end of the PCR fragment and binds thereto as shown in FIG. 3.
  • An alternate PNA protection approach is shown in FIG. 4. In this method, a PNA clamp is linked to primers P1 and P2 via one or more 8-amino-3,6-dioxaoctanoic acid linkers to form a PNA “clamp” tail by well known methods. After PCR amplification, the “clamp tail” binds to the 3′ ends of the PCR fragment, and is linked to the 5′ ends via the one or more 8-amino-3,6-dioxaoctanoic acid linkers to protect both the 3′ and 5′ ends of the PCR fragment. [0027]
  • Although the use of the CMV IE promoter and an artificial mammalian transcriptional terminator elements are exemplified herein, the use of any eukaryotic promoter and terminator is within the scope of the present invention. Suitable promoters for use in the present invention include, for example, SV40, rous sarcoma virus (RSV), retroviral long terminal repeats (LTR), muscle creatine kinase promoter, actin promoter, elongation factor promoter, synthetic promoters, tissue-specific promoters, and the like. Suitable terminator sequences include SV40 transcription terminator, bovine growth hormone (BGH) terminator, synthetic terminators, and the like. These promoter and terminator sequences can be obtained by restriction enzyme digestion of commercially available plasmids and cDNA molecules, or can be synthesized using an automated DNA synthesizer using methods well known in the art. [0028]
  • Any desired gene may be amplified and coupled to active promoter and terminator sequences using the method of the present invention. In a preferred embodiment, the gene encodes a gene product which is absent or present at reduced levels in an organism. Nonlimiting examples of these gene products are the cystic fibrosis transmembrane regulator (CFTR), insulin, dystrophin, interleukin-2, interleukin-12, erythropoietin, gamma interferon, and granulocyte macrophage colony stimulating factor (GM-CSF). [0029]
  • Although any transfection method well known in the art may be used to transfect the transcriptionally active PCR fragments of the invention into cells or tissues including calcium phosphate precipitation, electroporation and DEAE-dextran, cationic lipid-mediated transfection is preferred. Gene delivery systems are described by Felgner et al. ([0030] Hum. Gene Ther. 8:511-512, 1997) and include cationic lipid-based delivery systems (lipoplex), polycation-based delivery systems (polyplex) and a combination thereof (lipopolyplex). Cationic lipids are described in U.S. Pat. Nos. 4,897,355 and 5,459,127, the entire contents of which are hereby incorporated by reference.
  • EXAMPLE 1 Production of Transcriptionally Active PCR Fragments
  • The following components are combined in a 100 μl reaction volume: DNA fragment F1 (4 ng) which comprises a region of high transcriptional potency (−240 to +60) from the human cytomegalovirus (CMV) immediate early gene (IE) promoter/enhancer, DNA fragment F2 (4 ng), a 55 base pair oligonucleotide encoding an artificial mammalian transcription terminator element (5′-CACAAAAAACCAACACACAGATCTCTAGAGCTCTGATCTTTTATTAGCCA GAAGT-3′; SEQ ID NO: 4), 400 ng primer P1 (5′-TCTCTCTACGTATTAGTCATCG-3′; SEQ ID NO: 5), 400 ng primer P2 (5′-TCACAAAAAACCAACACACAG-3′; SEQ ID NO: 6), 4 ng primer P3 and 4 ng primer P4. The P1 and P2 primer sequences correspond to the 5′ end of fragment F1 and the 5′ end of fragment F2, respectively (FIG. 1). Primers P3 and P4 are designed based on the gene sequence of interest. The 3′ potion of these primers (about 10-20 base pairs) is determined by the actual sequence of the gene to be amplified, whereas the 5′ region of P3 comprises the following sequence: 5′-CTCCGCGGATCCAGA-3′ (SEQ ID NO: 7) to overlap with the 3′ region of F1, and P4 comprises the [0031] sequence 5′-TTATTAGCCAGAAGT-3′ (SEQ ID NO: 8) to overlap with the 3′ region of F2.
  • PCR is performed as follows: denaturation for 30 seconds at 94° C., annealing for 45 seconds at 55° C. and extension for three minutes at 72° C. for 25-30 cycles. The size of the final produce is verified by 1% agarose gel electrophoresis. The amplified PCR fragment is cleaned and purified using a commercial PCR cleaning kit (e.g., Qiagen), and can be used for in vitro or in vivo transfection of cells or tissues. [0032]
  • EXAMPLE 2
  • The green fluorescent protein (GFP, 700 bp) was used as a target gene. The F1 fragment was a 600 bp fragment of the CMV immediate early gene promoter (from −550 to +50). A 50 bp oligonucleotide containing a modified rabbit beta-globin gene transcription terminator was used as primer 2. Two different versions of these primers were designed so that the overlap between F1 and the intermediate GFP PCR fragment was either preceded with or without a thymidine base. After the PCR reaction was carried out according to the conditions described in Example 1, the products were analyzed by electrophoresis. When a thymidine base preceded the overlap region in F1, a clean major PCR fragment of about 1.4 kb was produced, representing the GFP coding region flanked by CMV promoter (F1) and the transcription terminator, whereas if a base other than thymidine preceded the overlapping region, no product was generated. The fragment generated by nested PCR was then transfected into Cos-7 cells and the expression of GFP was monitored by fluorescence microscopy. The results showed that the intensity and frequency of GFP-expressing cells was almost the same between cells transfected with the PCR fragment and a supercoiled plasmid DNA in which the same CMV promoter was driving expression of the GFP gene. Thus, the present method produces DNA fragments which are transcriptionally active. [0033]
  • While particular embodiments of the invention have been described in detail, it will be apparent to those skilled in the art that these embodiments are exemplary rather than limiting, and the true scope of the invention is that defined in the following claims. [0034]
  • 1 8 1 16 DNA Artificial Sequence Synthetic oligonucleotide primer 1 tctctctctn tntntn 16 2 12 DNA Artificial Sequence Synthetic oligonucleotide primer 2 gatctctctc tc 12 3 8 DNA Artificial Sequence Synthetic oligonucleotide primer 3 gagagaga 8 4 55 DNA Artificial Sequence Synthetic oligonucleotide primer 4 cacaaaaaac caacacacag atctctagag ctctgatctt ttattagcca gaagt 55 5 22 DNA Artificial Sequence Synthetic oligonucleotide primer 5 tctctctacg tattagtcat cg 22 6 21 DNA Artificial Sequence Synthetic oligonucleotide primer 6 tcacaaaaaa ccaacacaca g 21 7 15 DNA Artificial Sequence Synthetic oligonucleotide primer 7 ctccgcggat ccaga 15 8 15 DNA Artificial Sequence Synthetic oligonucleotide primer 8 ttattagcca gaagt 15

Claims (4)

What is claimed is:
1. A method for amplifying a transcriptionally-active polynucleotide, comprising:
PCR-amplifying a first fragment of DNA with a first primer pair, wherein the first primer pair, upon such amplification, adds to first and second ends of the first fragment predetermined first and second regions of complementarity, to form a second DNA fragment having said first region of complementarity at a first end and a second region of complementarity at a second end of said second DNA fragment;
providing a promoter-containing sequence and a terminator-containing sequence, said promoter-containing sequence further including a region complementary to said first region of complementarity, and said terminator-containing sequence further including a region complementary to said second region of complementarity, wherein both said promoter-containing sequence and said terminator-containing sequence include an internal nucleotide capable of forming an A-T base pair immediately adjacent to said region of complementarity;
joining said promoter-containing sequence to said first end of said second DNA fragment and said terminator-containing sequence to said second end of said second DNA fragment to form said third DNA fragment; and
PCR-amplifying said third DNA fragment.
2. The method of claim 1, wherein said joining comprises joining in the presence of polymerase said promoter-containing sequence to said first end of said second DNA fragment and said terminator-containing sequence to said second end of said second DNA fragment to form said third DNA fragment.
3. The method of claim 1, wherein said promoter-containing sequence and said terminator-containing sequence further comprise a non-DNA, binding moiety capable of interacting with said second DNA fragment.
4. The method of claim 3, wherein said non-DNA, binding moiety comprises a PNA molecule.
US09/919,758 1999-03-24 2001-07-31 Method for generating transcriptionally active DNA fragments Abandoned US20020037525A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US09/919,758 US20020037525A1 (en) 1999-03-24 2001-07-31 Method for generating transcriptionally active DNA fragments
US11/475,794 US20060240469A1 (en) 1999-03-24 2006-06-26 Method for generating transcriptionally active DNA fragments

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US12595399P 1999-03-24 1999-03-24
US09/535,262 US6280977B1 (en) 1999-03-24 2000-03-23 Method for generating transcriptionally active DNA fragments
US09/919,758 US20020037525A1 (en) 1999-03-24 2001-07-31 Method for generating transcriptionally active DNA fragments

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/535,262 Continuation US6280977B1 (en) 1999-03-24 2000-03-23 Method for generating transcriptionally active DNA fragments

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/475,794 Continuation US20060240469A1 (en) 1999-03-24 2006-06-26 Method for generating transcriptionally active DNA fragments

Publications (1)

Publication Number Publication Date
US20020037525A1 true US20020037525A1 (en) 2002-03-28

Family

ID=22422215

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/535,262 Expired - Fee Related US6280977B1 (en) 1999-03-24 2000-03-23 Method for generating transcriptionally active DNA fragments
US09/919,758 Abandoned US20020037525A1 (en) 1999-03-24 2001-07-31 Method for generating transcriptionally active DNA fragments
US11/475,794 Abandoned US20060240469A1 (en) 1999-03-24 2006-06-26 Method for generating transcriptionally active DNA fragments

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/535,262 Expired - Fee Related US6280977B1 (en) 1999-03-24 2000-03-23 Method for generating transcriptionally active DNA fragments

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/475,794 Abandoned US20060240469A1 (en) 1999-03-24 2006-06-26 Method for generating transcriptionally active DNA fragments

Country Status (5)

Country Link
US (3) US6280977B1 (en)
EP (1) EP1163359A4 (en)
JP (1) JP2002539800A (en)
AU (1) AU4032300A (en)
WO (1) WO2000056914A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004094654A3 (en) * 2003-04-22 2005-06-09 Nucleonics Inc Transfection kinetics and structural promoters
US20100129399A1 (en) * 2007-06-27 2010-05-27 Avir Green Hills Biotechnology Research Development Trade Ag Linear expression constructs for production of influenza virus particles
US9796973B2 (en) 2011-04-28 2017-10-24 Yamaguchi University Terminator sequence-containing reverse primer for overexpression and linear DNA

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5766891A (en) * 1994-12-19 1998-06-16 Sloan-Kettering Institute For Cancer Research Method for molecular cloning and polynucleotide synthesis using vaccinia DNA topoisomerase
EP0920526B1 (en) * 1997-06-12 2004-11-24 Sloan-Kettering Institute For Cancer Research Covalent joining of dna strands to rna strands catalyzed by vaccinia topoisomerase
EP1165813A2 (en) * 1999-03-24 2002-01-02 The Board Of Regents, The University Of Texas System Linear and circular expression elements
WO2001062943A1 (en) 2000-02-25 2001-08-30 Invitrogen Corporation Topoisomerase linker-mediated amplification methods
US7191239B2 (en) * 2000-08-02 2007-03-13 Ipass Inc. Method and system to customize and update a network connection application for distribution to multiple end-users
AU2001288356B2 (en) 2000-08-21 2007-03-22 Life Technologies Corporation Methods and reagents for molecular cloning
US7198924B2 (en) 2000-12-11 2007-04-03 Invitrogen Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
US20060008817A1 (en) * 2000-12-08 2006-01-12 Invitrogen Corporation Methods and compositions for generating recombinant nucleic acid molecules
NZ526194A (en) * 2000-12-08 2004-10-29 Invitrogen Corp Methods of covalently linking, in one or both strands, two or more double stranded nucleotide sequences using one or more topoisomerases
US20020165175A1 (en) * 2001-04-17 2002-11-07 Xiaowu Liang Fast and enzymeless cloning of nucleic acid fragments
DE10119005A1 (en) * 2001-04-18 2002-10-24 Roche Diagnostics Gmbh Process for protein expression starting from stabilized linear short DNA in cell-free in vitro transcription / translation systems with exonuclease-containing lysates or in a cellular system containing exonucleases
JP2005515754A (en) * 2001-05-30 2005-06-02 ジーン セラピー システムズ インコーポレーテッド Protein arrays and methods and systems for producing them
JP4768155B2 (en) * 2001-07-02 2011-09-07 独立行政法人理化学研究所 Method for producing template DNA and method for producing protein by cell-free protein synthesis system using the same
DE10158904A1 (en) * 2001-11-30 2003-06-12 Roche Diagnostics Gmbh Process for the preparation of linear DNA fragments for the in vitro expression of proteins
JP2005512578A (en) * 2001-12-19 2005-05-12 ロシュ ダイアグノスティックス コーポレーション PCR-based highly efficient polypeptide screening
JP4441170B2 (en) 2002-11-28 2010-03-31 独立行政法人理化学研究所 Escherichia coli cell extract having mutation in S12 ribosomal protein and cell-free protein production method using the same
US20050277127A1 (en) * 2003-11-26 2005-12-15 Epitomics, Inc. High-throughput method of DNA immunogen preparation and immunization
US20050287118A1 (en) * 2003-11-26 2005-12-29 Epitomics, Inc. Bacterial plasmid with immunological adjuvant function and uses thereof
ATE469984T1 (en) 2003-12-01 2010-06-15 Life Technologies Corp NUCLEIC ACID MOLECULES CONTAINING RECOMBINATION SITE AND METHOD FOR USE THEREOF
JP4868731B2 (en) 2004-11-17 2012-02-01 独立行政法人理化学研究所 Cell-free protein synthesis system derived from cultured mammalian cells
JP4787488B2 (en) 2004-11-19 2011-10-05 独立行政法人理化学研究所 Cell-free protein synthesis method using linear template DNA and cell extract therefor
WO2006060484A2 (en) * 2004-12-01 2006-06-08 Gene Therapy Systems, Inc. Tuberculosis nucleic acids, polypeptides and immunogenic compositions
JP5704677B2 (en) 2007-11-05 2015-04-22 独立行政法人理化学研究所 Method for producing membrane protein
EP2233568A1 (en) 2009-03-19 2010-09-29 Avir Green Hills Biotechnology Research Development Trade AG Novel method for generation of RNA virus
GB0903207D0 (en) 2009-02-25 2009-04-08 Ucb Pharma Sa Method for expressing multimeric proteins
WO2010097435A1 (en) 2009-02-25 2010-09-02 Ucb Pharma, S.A. Method for producing antibodies
EA201201620A1 (en) 2010-06-02 2013-07-30 Авир Грин Хилз Байотекнолоджи Рисерч Дивелопмент Трейд Аг METHOD OF OBTAINING RNA VIRUS
CA3032514C (en) 2015-07-31 2021-05-04 Takehiro SHINODA Method of producing membrane protein and utilization thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5096825A (en) * 1983-01-12 1992-03-17 Chiron Corporation Gene for human epidermal growth factor and synthesis and expression thereof
KR850004274A (en) * 1983-12-13 1985-07-11 원본미기재 Method for preparing erythropoietin
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
EP1396540B1 (en) * 1990-09-27 2007-02-07 Invitrogen Corporation Direct cloning of PCR amplified nucleic acids
AU665365B2 (en) * 1991-08-10 1996-01-04 Medical Research Council Treatment of cell populations
US5561053A (en) 1994-08-05 1996-10-01 Genentech, Inc. Method for selecting high-expressing host cells
DE19637339A1 (en) * 1996-09-13 1998-03-19 Hoechst Ag Methods for amplifying nucleic acids
WO1999013719A1 (en) * 1997-09-18 1999-03-25 Gene Therapy Systems, Inc. Chemical modification of dna using peptide nucleic acid conjugates

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004094654A3 (en) * 2003-04-22 2005-06-09 Nucleonics Inc Transfection kinetics and structural promoters
US20100129399A1 (en) * 2007-06-27 2010-05-27 Avir Green Hills Biotechnology Research Development Trade Ag Linear expression constructs for production of influenza virus particles
US9796973B2 (en) 2011-04-28 2017-10-24 Yamaguchi University Terminator sequence-containing reverse primer for overexpression and linear DNA

Also Published As

Publication number Publication date
EP1163359A4 (en) 2005-01-26
US6280977B1 (en) 2001-08-28
AU4032300A (en) 2000-10-09
WO2000056914A1 (en) 2000-09-28
JP2002539800A (en) 2002-11-26
US20060240469A1 (en) 2006-10-26
EP1163359A1 (en) 2001-12-19

Similar Documents

Publication Publication Date Title
US6280977B1 (en) Method for generating transcriptionally active DNA fragments
US20230265431A1 (en) Oligonucleotides, manufacturing method for same, and target rna site-specific editing method
EP3353298A2 (en) Allele selective gene editing and uses thereof
Mandecki et al. FokI method of gene synthesis
Steinmetz et al. Nucleotide sequences of five maize chloroplast transfer RNA genes and their flanking regions.
Xiang et al. Targeted gene conversion in a mammalian CD34+-enriched cell population using a chimeric RNA/DNA oligonucleotide
AU2006317222B2 (en) DNA constructs for specific inhibition of gene expression by RNA interference
US5405775A (en) Retrons coding for hybrid DNA/RNA molecules
WO2013003489A2 (en) Method for genome complexity reduction and polymorphism detection
US11643658B2 (en) Oligonucleotides, manufacturing method for same, and target RNA site-specific editing method
Chant et al. Archaebacteria: transcription and processing of ribosomal RNA sequences in Halobacterium cutirubrum
KR20000022488A (en) Method for producing therapeutic dna
AU777910B2 (en) Amplification and sequencing primer pairs and use thereof
US6921816B2 (en) Chimerical peptide-nucleic acid fragment, process for producing the same and its for appropriately introducing nucleic acids into cell organelles and cells
Nielsen Gene targeting using peptide nucleic acid
JP4465741B2 (en) Ligation at the end of a double-stranded DNA fragment
JP2706568B2 (en) Identification of new drugs and reagents
CN116583606A (en) Nucleic acid delivery methods and systems
KR20180128864A (en) Gene editing composition comprising sgRNAs with matched 5&#39; nucleotide and gene editing method using the same
US20070167388A1 (en) Nucleotide sequences promoting the trans-membrane transport of nucleic acids
CN114990093A (en) Protein sequence MINI RFX-CAS13D with small amino acid sequence
USRE37411E1 (en) Expression cassette for antisense expression of ribozyme
EP3845645A1 (en) Method for modifying target nucleic acid in genome of cell
Berlin DNA splicing by directed ligation (SDL)
CA2421391A1 (en) Compositions and methods for enhanced sensitivity and specificity of nucleic acid synthesis

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION