US12371709B2 - Multifunctional nucleic acid reporter constructs - Google Patents
Multifunctional nucleic acid reporter constructsInfo
- Publication number
- US12371709B2 US12371709B2 US17/047,615 US201917047615A US12371709B2 US 12371709 B2 US12371709 B2 US 12371709B2 US 201917047615 A US201917047615 A US 201917047615A US 12371709 B2 US12371709 B2 US 12371709B2
- Authority
- US
- United States
- Prior art keywords
- sequence
- nucleic acid
- dse
- repair
- reading frame
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active, expires
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/36—Vector systems having a special element relevant for transcription being a transcription termination element
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
Definitions
- Tumor cells may emerge when their precursors lose the ability to maintain the integrity of their genomic DNA sequence in response to DNA damage.
- DNA damage that are the most deleterious are double-stranded breaks (DSBs).
- DSBs double-stranded breaks
- Chronic failure to repair DSBs efficiently and perfectly may lead to a state of chronic genomic instability, a hallmark of human cancer.
- DSB repair pathways either error-free or error-prone
- factors such as transcriptional activity at or near the affected locus, chromatin state, etc.
- varying cellular and molecular scenarios such as cell cycle status, differentiation status, cell/tissue type and genetics can each influence the choice of which DSB repair pathway will be called upon to repair a given DSB. It is currently not fully known how cells select a single repair pathway to eliminate a given DSB. Since the known DSB repair pathways can be either error-free or error-prone depending on a number of variables, the choice of pathway to mend a given DSB has deep ramifications for the maintenance of genomic stability and integrity.
- a complete open reading frame of RP1 consists of from 5′ to 3′: 5′RP1, the first MHD or the second MHD, and 3′RP1.
- the nucleic acid further comprises a promoter sequence operably linked to the first cassette.
- the third cassette does not comprise a start codon in the RP3 reading frame.
- one or more of RP1, RP2, RP3, and RP4 are a fluorescent protein.
- each of RP1, RP2, RP3, and RP4 is a fluorescent protein.
- RP1 encodes EGFP-Y64H, optionally wherein the EGFP-Y64H comprises the amino acid sequence of SEQ ID NO: 4.
- RP3 encodes EGFP, optionally wherein the EGFP comprises the amino acid sequence of SEQ ID NO: 5.
- RP2 encodes tdTomato, optionally wherein the tdTomato comprises the amino acid sequence of SEQ ID NO: 6.
- RP4 encodes iRFP670, optionally wherein the iRFP670 comprises the amino acid sequence of SEQ ID NO: 7.
- one or more of RP1, RP2, RP3, and RP4 are an enzyme that catalyzes a reaction with a substrate to produce an observable change in that substrate.
- the first DSE is a rare-cutting endonuclease.
- the second DSE is a rare-cutting endonuclease.
- each of the first and the second DSEs is a rare-cutting endonuclease.
- the rare-cutting endonuclease is selected from the group consisting of I-SceI and AsiSI.
- the first DSE is a transcription activator-like nuclease (TALEN) or a zinc finger nuclease.
- the second DSE is a transcription activator-like nuclease (TALEN) or a zinc finger nuclease.
- the first DSE is a transcription activator-like nuclease (TALEN) or a zinc finger nuclease
- the second DSE is a transcription activator-like nuclease (TALEN) or a zinc finger nuclease.
- FIG. 1 B is a schematic diagram of the homologous recombination (HR) repair pathway following a double-stranded DNA break.
- FIG. 1 C is a schematic diagram of the single strand annealing (SSA) repair pathway following a double-stranded DNA break.
- SSA single strand annealing
- FIG. 1 D is a schematic diagram of the microhomology-mediated end joining (MMEJ) repair pathway following a double-stranded DNA break.
- MMEJ microhomology-mediated end joining
- FIG. 3 A is a schematic diagram of a nucleic acid reporter construct using fluorescent reporter proteins.
- FIG. 3 B is a schematic diagram of the nucleic acid reporter construct of FIG. 3 A before and after contact with a rare-cutting endonuclease or an RNA-guided DNA endonuclease.
- FIG. 3 C is a schematic diagram of the cleaved nucleic acid reporter construct of FIG. 3 B before and after repair by the NHEJ repair pathway.
- FIG. 3 D is a schematic diagram of the cleaved nucleic acid reporter construct of FIG. 3 B before and after repair by the HR repair pathway.
- FIG. 4 is a set of histograms depicting detection of four different fluorescent reporter proteins in 293T cells transiently transfected with a nucleic acid reporter construct.
- the reporter construct was either cut in vitro with the endonuclease I-SceI and then transfected into the 293T cells, or the cells were co-transfected with Cas9+sgRNA dual expression vectors specific for the I-SceI cutting recognition sequence.
- FIG. 5 D is a histogram of the percentage of iRFP-positive cells detected in five different 293T cell clones stably transfected with a nucleic acid reporter construct, following transient transfection with the rare-cutting endonuclease I-SceI.
- FIGS. 6 A-B are a histogram showing the percentage of GFP ( FIG. 6 A ) or BFP-positive ( FIG. 6 B ) cells detected in 293T cell clones stably transfected with a nucleic acid reporter construct, following transient transfection with either an endonuclease I-SceI encoding vector or a CRISPR vector encoding both Cas9 and the relevant sgRNA (single guide RNA).
- FIG. 7 B depicts the fluorescent signal from tdTomato and iRFP in 293T cell clone P22 with and without repair triggered by I-SceI cleavage. The comparison illustrates the fluorescent signal background in the absence of DNA repair.
- FIG. 8 A is a schematic diagram of the nucleic acid reporter construct of FIG. 2 with polyadenylation signals included as transcriptional stop elements.
- FIG. 8 B is a schematic diagram of the nucleic acid reporter construct of FIG. 2 and a model of run-through transcription occurring in the absence of endonuclease induced DNA repair.
- FIG. 10 B is a schematic diagram of the nucleic acid reporter construct of FIG. 10 A under na ⁇ ve conditions when there is no I-SceI activity and no DNA repair.
- FIG. 10 G is a schematic diagram of the nucleic acid reporter construct of FIG. 10 C before and after repair by the SSA repair pathway.
- FIGS. 11 A-D are a set of histograms depicting detection of four different fluorescent reporter proteins in 293T cells transiently transfected with the nucleic acid reporter construct of FIG. 10 A .
- the 293T cells were either uninfected or infected with an empty virus or an I-SceI encoding virus. Data is shown for 293T cell clones A2, A7, B10, and B12.
- FIG. 11 A shows fluorescent reporter signal detected corresponding to HR.
- FIG. 11 B shows fluorescent reporter signal detected corresponding to MMEJ.
- FIG. 11 C shows fluorescent reporter signal detected corresponding to NHEJ.
- FIG. 11 D shows fluorescent reporter signal detected corresponding to SSA.
- FIGS. 12 A-B depict verification that the repair pathway indicated by the emission of a particular fluorescent reporter protein matches the repair pathway indicated based on DNA analysis of the cell.
- the 293T cells were infected with an I-SceI encoding virus. As shown in FIG. 12 A , the cells were FACs sorted based on the fluorescent signal they displayed. Genomic DNA was extracted from the color sorted cells in order to analyze the repair products formed. As shown in FIG. 12 B , restriction enzyme digestion or PCR amplification was used to distinguish between products of the respective repair pathways. Data is shown for 293T cell clones A2, A7, B10, and B12.
- FIGS. 13 A-D are a set of histograms depicting detection of four different fluorescent reporter proteins in 293T cell clones A2 ( FIG. 13 A ), A7 ( FIG. 13 B ), B10 ( FIG. 13 C ), and B12 ( FIG. 13 C ) when DNA repair proteins are selectively depleted.
- the 293T cells were infected with the ISceI-encoding virus and then transfected with siRNAs targeted at depleting either BRCA1, BRCA2, Rad51, Rad52 or 53BP1, or the siRNA control (siGL2).
- FIGS. 15 A-D are a set of pie charts depicting the percent detection of four different fluorescent reporter proteins (corresponding to NHEJ, HR, SSA, and MMEJ repair mechanisms, respectively) in subclones of cell clones A2 ( FIG. 15 A ), A7 ( FIG. 15 B ), B10 ( FIG. 15 C ), and B12 ( FIG. 15 D ).
- FIGS. 16 A-C are a set of histograms depicting the percentage of mouse ES cells ( FIG. 16 A ), 293T cells ( FIG. 16 B ), or T98G cells ( FIG. 16 C ) or that undergo DNA repair when infected with an I-SceI encoding virus or an AsiSI encoding virus.
- a reporter protein may be an enzyme that catalyzes a reaction with a substrate to produce an observable change in that substrate, such as luciferase which acts on luciferin to emit photons, or ⁇ -galactosidase which can hydrolyze X-gal (5-bromo-4-chloro-3-indolyl- ⁇ -D-galactopyranoside) to form a blue precipitate that can visualized.
- a reporter protein is detectable by an antibody binding interaction.
- fluorescent protein refers to a protein that emits light at some wavelength after excitation by light at another wavelength.
- Exemplary fluorescent proteins that emit in the green spectrum range include, but are not limited to: green fluorescent protein (GFP); enhanced GFP (EGFP); superfolder GFP; AcGFP1; and ZsGreen1.
- Exemplary fluorescent proteins that emit light in the blue spectrum range include, but are not limited to: enhanced blue fluorescent protein (EBFP), EBFP2, Azurite, and mKalama1.
- Exemplary fluorescent proteins that emit light in the cyan spectrum range include, but are not limited to: cyan fluorescent protein (CFP); enhanced CFP (ECFP); Cerulean; mHoneydew; and CyPet.
- a chimeric fluorescent protein may include a photoactivatable GFP that can then quench photoemission by CFP.
- FRET proteins are discussed in Hildebrandt et al., Sensors (Basel). 2016 September; 16 (9): 1488, incorporated herein by reference.
- double-stranded endonuclease recognition sequence refers to a nucleotide sequence that is recognized by an double-stranded endonuclease, optionally wherein the endonuclease is a rare-cutting endonuclease, an RNA-guided DNA endonuclease, a zinc-finger nuclease, or a TALEN, which cleaves both strands of DNA in or to the proximity of the double-stranded endonuclease recognition sequence.
- the double-stranded endonuclease recognition sequence does not occur in the cellular genome at a high frequency.
- guide RNA refers to a single-stranded RNA that includes an RNA sequence used as template by RNA-guided DNA endonucleases (such as spCas9) to specifically detect a complementary sequence in double-stranded DNA.
- This template RNA is called crRNA.
- the guide RNA may also include a transactivating crRNA (tracrRNA) with a certain sequence is required for some Cas9 endonucleases to function (such as spCas9 and saCas9).
- ZFN zic-finger nuclease
- a ZFN module can comprise two zinc fingers and recognizes a unique 6 bp sequence.
- a ZFN may be engineered to recognize a double-stranded cutting recognition sequence that occurs at a low frequency in a genome.
- TALEN transcription activator-like nucleases
- TALEN transcription activator-like nucleases
- a ZFN may be engineered to recognize a double-stranded cutting recognition sequence that occurs at a low frequency in a genome.
- Exemplary eukaryotic transcriptional terminators include, but are not limited to, human actin beta (hACTB) terminator sequence, phosphoglucokinase (PGK) terminator sequence, simian virus 40 (SV40) terminator sequence, human growth hormone (hGH) terminator sequence, bovine growth hormone (bGH) terminator sequence, and rabbit beta-globin (rbGlob) terminator sequence.
- hACTB human actin beta
- PGK phosphoglucokinase
- SV40 simian virus 40
- hGH human growth hormone
- bGH bovine growth hormone
- rbGlob rabbit beta-globin
- linker nucleotide sequence refers to a nucleotide sequence that is located between two other nucleotide sequences.
- a linker nucleotide sequence may encode an IRES, a cleavage site of a protease, or a ribosomal skipping peptide, if the linker nucleotide sequence links two coding sequences in the same reading frame.
- nucleotide sequence encoding peptide 2A may be used, which causes ribosomal skipping at the end of the 2A sequence. This leaves no peptide bond between the 2A peptide and any peptide translated after the 2A peptide, and allows multiple separate proteins to be translated from a single transcript.
- the technology is a composite of synthetic DNA sequences that function as a reporter construct that allows an investigator to assess the precise nature of the dominant DNA repair pathway that is applied to a DSB, for example in a defined region of the genome.
- effector molecules useful in the methods as disclosed herein include, but are not limited to ⁇ -glucosidase; hypoxanthine-guianine phosphoribosyltransferase; ⁇ -lactamase; carboxylesterase HCE1; peroxidase enzyme and variants or fragments thereof.
- a secondary agent may be an antiviral drug, such as oseltamivir; allopurinol.
- the instant disclosure provides a vector comprising the reporter sequence disclosed herein, further comprising a first homology arm 5′ to the reporter sequence and a second homology arm 3′ to the reporter sequence, wherein the first and second homology arms are substantially identical to two nucleotide sequences at a genomic locus.
- the two nucleotide sequences are adjacent at the genomic locus.
- the two nucleotide sequences are no more than 10, 20, 50, 100, 200, 500, 1,000, 2,000, or 5,000 nucleotides apart at the genomic locus.
- the vector further comprises a negative selection cassette (e.g., a inducible or constitutive promoter region operably linked to a sequence encoding a toxic or suicide protein) 5′ to the first homology arm or 3′ to the second homology arm.
- a negative selection cassette e.g., a inducible or constitutive promoter region operably linked to a sequence encoding a toxic or suicide protein
- the vector further comprises a nucleotide sequence encoding a split toxic gene.
- the DSB reporter construct incorporates a mechanism using a ribonuclease to destroy mRNA transcripts that result from run-through transcription in the absence of DNA repair.
- the ribonuclease is a CRISPR-associated protein.
- the ribonuclease is Csy4 (as known as Cas6).
- the DNA encoding the ribonuclease is contained within the DSB reporter construct.
- the ribonuclease is encoded by an expression cassette contained within the DSB reporter construct. In some embodiments the expression cassette is spaced 3′ to the second reporter gene and 5′ to the third reporter gene.
- sequence within the DSB reporter construct encoding an RNA hairpin structure or structures is located between the 5′ portion of the first reporter gene and the 3′ portion of the first reporter gene. In some embodiments sequence encoding three hairpin sequences in the transcript of the DSB reporter construct is located between the 5′ portion of the first reporter gene and the 3′ portion of the first reporter gene. In some embodiments the sequence within the DSB reporter construct encoding an RNA hairpin structure or structures is located between the third reporter gene and the fourth reporter gene. In some embodiments sequence encoding three hairpin sequences in the transcript of the DSB reporter construct is located between the third reporter gene and the fourth reporter gene.
- NHEJ Non-Homologous End Joining
- the double stranded break is repaired using blunt end ligation of the DSB by DNA ligase IV and XRCC4, in combination with several co-factors (see FIG. 1 A ).
- the blunt ends are generated either by the DSB itself or by DNA polymerase- and/or exonuclease-mediated polishing of the non-homologous cohesive DNA ends resulting from the DSB.
- NHEJ can have both a fast process, and a slow process. The fast process uses the co-factors Ku70/80 and DNA-PKcs. In the slow process, the ends of the double-stranded break are processed by an additional protein Artemis is used in the joining process.
- NHEJ repair pathway is potentially error-prone and homology-independent and is believed to be active throughout the cell cycle. Despite its error-prone nature, NHEJ is thought to be the major pathway that is most frequently used to repair DSBs in mammalian cells.
- the ends of the double stranded break are first resected via CtIP and MRN complexes, creating single-stranded 3′ tails on each side of the DSB.
- the 3′tails are used with a sister or homologous chromatid which serves as the homology template for repairing the DSB (see FIG. 1 B ).
- the recombinase RAD51 mediates strand invasion of the sister chromatid by the 3′tails, along with co-factors RPA, and BRCA2 to result in a repaired DSB. Due to the requirement of a sister chomatid template, this repair pathway is mainly active during late S and G2 phases of the cell cycle. If properly controlled, HR can be the most conservative pathway to repair DSBs and can be, in most settings, considered an error-free repair pathway. This pathway is known to be upregulated in cells that are NHEJ-deficient (by genetic or pharmacological disruption).
- MMEJ Microhomology-Mediated End Joining
- the ends of the double stranded break are first resected via CtIP and MRN complex, creating single-stranded 3′ tails on each side of the DSB (see FIG. 1 D ).
- Microhomology regions (1-20 bp) from each of the 3′ tails on the same chromatid are combined in a PARP1- and POLQ-dependent manner and ligated together via DNA ligase III to repair the DSB.
- the multifunctional DSB reporter construct described herein uses multiple reporter genes and portions of genes, along with a double-stranded cutting recognition domain. Once inserted into the genome of a cell, a double-stranded cutting endonuclease may be administered to or expressed by the cell to create a double-stranded break at the double-stranded cutting recognition domain.
- the configuration of the reporter genes, reporter gene portions, and double-stranded recognition domain allows repair of the double-stranded break in the construct by any one of the four major DSB repair pathways. Irreversible expression of one of four reporter gene or reporter gene combinations allows a user to distinguishably detect which of the four DSB repair pathways was utilized in that particular cell. Likewise, analyzing the preferred repair pathway in whole populations of cells under a certain biological setting, will reveal how the relevant setting influences the most likely choice of DSB repair.
- the multifunctional DSB reporter construct described herein may be introduced into a cell using transient transfection techniques (e.g., using a plasmid introduced by lipids), or it may be stably integrated into a cellular genome, such as by viral delivery (e.g., using a lentivirus or baculovirus vector).
- the multifunctional DBS reporter constructs may also be integrated into a specific genomic region of interest, using site-directed recombinase technology (e.g., Cre-Lox or FLP-FRT) or transposon-based technology (e.g., Sleeping Beauty transposon/SB100X). Electroporation is another of such methods that can be used.
- FIG. 2 is a schematic diagram of a multifunctional DSB reporter construct, from 5′ on the left hand side to 3′ on the right hand side.
- the text “Prom” denotes a promoter region, and the arrow shows the direction of transcription/translation.
- the promoter region may be a strong constitutive promoter, including but not limited to, a CAG promoter or a GDS promoter (also called TDH3 or GAPDH).
- the promoter region drives expression of a 5′ portion of an open reading frame for a first reporter gene (5′RP1).
- the 5′RP1 is a 5′ portion of the first reporter gene. If the 5′RP1 is expressed as a truncated protein, the truncated protein is not capable of producing the intended signal of the full-length RP1.
- DSE-RS double-stranded endonuclease recognition sequences
- FIG. 2 black triangles
- Each black triangle is a single DSE-RS.
- both of the DSE-RSs are recognized by a double-stranded cutting endonuclease, the double stranded nucleic acid between the two DSE-RSs is removed.
- each of the DSE-RSs may be a different nucleic acid sequence and is cut by a different double-stranded endonuclease.
- the nucleic acids in between each of the first and second DSE-RSs may include one or more stop codons in-frame with the open reading frame of 5′RP1 (a termination cassette).
- each of the two DSE-RSs is the same nucleic acid sequence, and is cut by the same double-stranded cutting endonuclease.
- more than one pair of DSE-RSs may be included in the construct. For example a pair of DSC-RSs for I-SceI and a pair of DSE-RSs for AsiSI may each flank the intervening sequence.
- a fragile DNA sequence that is prone to spontaneous breakage during DNA replication might be added/substituted for.
- a specific sequence that would allow docking of a protein that would promote stalling of the replication fork could be added/substituted for (Tus/Ter system, for instance).
- the construct also contains a terminator cassette (two rows of letters on black background) that prevents any reporter genes from being expressed before a double-stranded break is created in the construct.
- the terminator cassette may include multiple transcriptional terminators that ensure termination of transcription before any full-length open reading frames can be transcribed as mRNA (such as tdTomato or iRFP670).
- Exemplary transcriptional terminators may include, but are not limited to, human actin beta (hACTB) terminator sequence, phosphoglucokinase (PGK) terminator sequence, simian virus 40 (SV40) terminator sequence, human growth hormone (hGH) terminator sequence, bovine growth hormone (bGH) terminator sequence, and rabbit beta-globin (rbGlob) terminator sequence.
- a 3′ portion of an open reading frame for an allele of the first reporter gene (labeled 3′RP1 in FIG. 2 ) is located 3′ to the second MHD (see, e.g., discussion of FIG. 3 A below). If the 5′RP1 is in the same reading frame as the 3′RP1 following a DSB repair event (such as the MMEJ repair pathway), the resulting translated protein will have the signaling properties of the 3′RP1 allele (see FIG. 3 E for example).
- the translated protein of the 5′RP1/MHD/3′RP1 is capable of producing a first signal, such as a fluorescence emission at a given wavelength or an enzymatic by-product if the translated 5′RP1/MHD/3′RP1 is an enzyme.
- IRES internal ribosome entry site
- a second 5′ portion of an open reading frame for a third reporter gene (RP3) is located 3′to the RP2.
- the RP3 has homology with portions of both the 5′RP1 and the 3′RP1, and is an allele of RP1.
- Cells that utilize the HR repair pathway to repair the double-stranded break in the construct homologously recombine the RP3 in a sister chromatid with the 5′RP1 and the 3′RP1, replacing the allelic portion of the 3′RP1.
- the 5′RP1, the RP3, and the 3′RP1 form a functional RP3 protein.
- This functional RP3 protein is capable of producing a third signal that is distinguishable from both the first and second signals (see, e.g., FIG. 3 D ).
- the construct shown in FIG. 2 also includes an open reading frame for a fourth reporter gene (labeled RP4 in FIG. 2 ).
- the RP4 encodes a full-length protein that produces a fourth signal when translated after an SSA repair event (see FIG. 3 F ).
- the fourth signal is distinguishable from each of the first, second, and third signals, such as a different wavelength of fluorescent emission, or a different catalytic by-product if the RP4 is an enzyme.
- RP4 and RP3 may be separated by a linker nucleotide sequence that allows multicistronic expression of RP4 and RP3, if RP3 interferes with the reporting signal of RP4.
- the linker sequence may include, but is not limited to, an IRES, a cleavage site of a protease (e.g., 3C or “PreScission”; enterokinase (EKT); Factor Xa (Fxa); Tobacco etch virus (TEV); or thrombin), or a ribosomal skipping peptide (such as T2A, P2A, E2A, or F2A).
- a protease e.g., 3C or “PreScission”
- enterokinase EKT
- Factor Xa Factor Xa
- TEV Tobacco etch virus
- thrombin thrombin
- the DSB reporter may further comprise reporter genes such as, but not limited to RP5, RP5 and RP6, or RP5, RP6, and RP7.
- additional or distinct repair homologous templates are added to the reporter construct along with additional reporter genes, thereby allowing expansion of the repertoire of DSB repair pathway choices that can be assayed with this system.
- RP5, RP6, and RP7 correspond to repair products of pathways other than HR, NHEJ, MMEJ, and SSA. These repair pathways can be any repair pathways known in the art or later discovered.
- This exemplary cellular DSB repair choice detection system includes: a strong mammalian promoter to drive expression of the fluorescent reporter genes (a CAG promoter); two tandem repeats of partial EGFP/BFP coding sequences that act as repair templates for the HR, MMEJ and SSA repair pathways; an intact coding sequence for tdTomato as a fluorescent reporter for NHEJ; and the coding sequence for iRFP670, which acts as a reporter for SSA repair.
- the construct also contains a terminator cassette that prevents any reporter genes from being expressed before a double-stranded break is created in the construct.
- the terminator cassette may include one or more stop codons and/or one or more transcriptional polyadenylation sequences (four SV40-poly A sequences) that ensure termination of transcription before any full-length open reading frames can be transcribed (such as tdTomato or iRFP670).
- the reporter construct also includes microhomology regions adjacent to the DSE-RSs for rare-cutting restriction enzymes (AsiSI, I-SceI). Forced expression of either AsiSI or I-SceI enzyme in cells harboring this reporter construct will create a nucleic acid DSB in the reporter.
- one of the recombination-based repair pathways can drive the repair of the broken ends of the DSB.
- one of the three repair different templates provided by the DSB reporter construct will be utilized depending on the pathway that is chosen. If the cell uses HR to repair the DSB, then the homologous recombination of the partial EGFP sequence results in expression of a functional EGFP protein and tdTomato, which have distinguishable fluorescent emissions (see discussion of FIG. 3 D below).
- a first microhomology domain is 3′ from the 5′EGFP-A (see FIG. 3 A , region marked by “ ⁇ ” that is 3′ of the 5′EGFP-A).
- the first MHD sequence is part of the 5′EGFP-A.
- the sequence of the 5′EGFP-A includes the first MHD and ends at the termination cassette (discussed below).
- a second MHD is 3′ of the first MHD (see FIG. 3 A , region marked with “u” that is 3′ of the first MHD), and has homology with the first MHD.
- more than two DSE-RSs may be included on each side of the termination cassette (e.g., AsiSI domain, I-SceI domain, and a unique sequence that can be recognized by an RNA-guided endonuclease with a guide RNA).
- the termination cassette e.g., AsiSI domain, I-SceI domain, and a unique sequence that can be recognized by an RNA-guided endonuclease with a guide RNA.
- An internal ribosome entry site (labeled IRES in FIG. 3 A ) is located 3′ to the 3′EGFP-Y64H.
- the IRES allows cap-independent translation of an open reading frame for a tdTomato gene sequence located 3′ from the IRES.
- the tdTomato sequence is operably linked to the IRES, and when expressed produces an orange fluorescent signal.
- the tdTomato gene is expressed in response to an NHEJ, HR, or MMEJ repair event following creation of the double-stranded break by forced expression of AsiSI and/or I-SceI and removal of the termination cassette (see discussion of FIGS. 3 C- 3 E below).
- iRFP670 An open reading frame for the gene sequence of iRFP670 (labeled iRFP670 in FIG. 3 A ).
- the iRFP670 encodes a full-length protein that fluoresces maroon when translated after an SSA repair event (see discussion of FIG. 3 F ).
- a linker nucleotide sequence is located between the 5′EGFP-B sequence and the iRFP670 sequence.
- the linker sequence comprises nucleotide sequence encoding peptide P2A, which causes ribosomal skipping during translation of the 5′EGFP-B and the iRFP670 from the same mRNA following an SSA event.
- linker nucleotide sequences may be used, such as another 2A peptide encoding sequence, an encoded protease cleavage site, or an IRES.
- FIG. 3 B is a schematic diagram of the fluorescent DSB construct before (top construct) and after exposure to AsiSI or I-SceI (bottom construct). A double stranded break is created, removing the termination cassette. The cell harboring the construct can now utilize its preferred DSB repair pathway to mend these broken DNA ends.
- FIG. 3 C is a schematic diagram of the NHEJ repair pathway being used to repair the fluorescent DSB construct.
- the ends of the double-stranded break are ligated together directly (see arrows on ends of the microhomology domains on the top construct).
- the transcribed RNA is no long terminated before transcription of the IRES, and tdTomato protein is expressed. None of the other reporters are expressed at full-length and/or in-frame, and therefore cannot be detected by fluorescence.
- FIG. 3 D is a schematic diagram of the HR repair pathway being used to repair the fluorescent DSB construct.
- the 5′EGFP-B portion of the construct from a sister chromatid is used to repair the break.
- the 5′EGFP-B has homology to both the 5′EGFP-A and the 3′EGFP-Y64H (see gray arrows indicating homologous regions).
- the repaired sequence is that of a full-length EGFP. Both full-length EGFP (green fluorescence) and tdTomato (orange fluorescence) are expressed.
- FIG. 3 E is a schematic diagram of the MMEJ repair pathway being used to repair the fluorescent DSB construct.
- the microhomology domains (labeled “u”) on each end of the broken chromatid recombine (see gray arrow between the MHD on each end of the break) and the ends of the break are ligated together, leaving a single microhomology domain.
- the full-length EGFP-Y64H fluoresces blue, and the tdTomato fluoresces orange.
- FIG. 3 F is a schematic diagram of the SSA repair pathway being used to repair the fluorescent DSB construct.
- the 5′EGFP-A is annealed with homologous sequence of 5′EGFP-B on the same chromatid.
- the promoter associated with the 5′EGFP-A drives expression of the iRFP670 protein, which fluoresces maroon.
- the section of chromatid containing the 3′EGFP-Y64H, the IRES, and the tdTomato is deleted; thus no other fluorescent proteins are retained in the repaired construct.
- FIG. 3 G is a schematic diagram that summarizes which fluorescent proteins are expressed by the fluorescent DSB construct after each repair pathway.
- Uncut fluorescent DSB construct does not express any fluorescent proteins and thus no fluorescent colors.
- Cut fluorescent DSB construct that has been repaired via the NHEJ pathway expresses only tdTomato protein, and thus fluoresces orange when excited at around 554 nm.
- Cut fluorescent DSB construct that has been repaired via the HR pathway expresses both EGFP (fluorescing green when excited at around the maximal excitation wavelength of 488 nm) and tdTomato (fluorescing orange when excited at around the maximal excitation wavelength of 554 nm).
- Cut fluorescent DSB construct that has been repaired via the MMEJ pathway expresses BFP (EGFP-Y64H; fluorescing blue when excited at around the maximal excitation wavelength of 383 nm) and tdTomato (fluorescing orange when excited at around the maximal excitation wavelength of 554 nm).
- Cut fluorescent DSB construct that has been repaired via the SSA pathway expresses only iRFP670, which fluoresces maroon when excited at around the maximal excitation wavelength of 670 nm.
- Equal amounts of the fluorescent DSB reporter construct (FluoMulti) described in Example 1 were transfected as uncut, in vitro-cut, or co-transfected with Cas9+sgRNA dual expression vectors and their respective non-target controls.
- Na ⁇ ve 293T cells were transfected using LIPOFECTAMINE 2000 (Thermo Fisher Scientific) following the manufacturer's instructions. Briefly, for each transfection, one subconfluent (70-80%) P100 plate of asynchronous cultures of 293T cells was trypsinized and transfected in suspension with a total 25 ⁇ g of plasmid DNA and using 60 ⁇ L of Lipofectamine 2000 reagent.
- the DNA being transfected consisted of a mixture of 5 ⁇ g of the FluoMulti plasmid (digested in vitro with I-SceI or undigested, depending on the condition tested) and 20 ⁇ g of either non-similar plasmid (pUC18, Addgene #50004), I-SceI-encoding plasmid (pCBASCe, Addgene #26477), or Cas9+sgRNA expression vectors (LentiCrisprV2, Addgene #52961) in which the sgRNA expressed directs Cas9 to cleave within the I-SceI sites of FluoMulti.
- Hygromycin B Selection with 250 ⁇ g/mL of Hygromycin B was started around 48 h post electroporation. When cell colonies became visible (15-20 days), cells were isolated using cloning discs and transferred to multi-well tissue culture plates and the antibiotic selection was switched to blasticidin at 10 g/mL. The antibiotic-resistant, clonal populations that resulted after blasticidin selection were used for generation of cells stocks and further analyses. The serial selection with these two antibiotics favored the selection of clonal cell lines in which the intact reporter was stably integrated in the cells' genome.
- the cell clones isolated as above were initially screened for their ability to generate fluorescent repair products following in cellulo cleavage of the reporter following forced overexpression of I-SceI.
- cells were infected with an inducible lentiviral vector that drives overexpression of I-SceI in response to doxycycline along with puromycin resistance, or its corresponding empty vector.
- puromycin After selection of the stably infected cells with puromycin at 4 ⁇ g/mL for 48 h, cells were split 1:2 in multi-well plates, so that for each condition there are cells treated with either 1 ⁇ M doxycycline or with the same volume of phosphate buffered saline (PBS) as a vehicle control.
- PBS phosphate buffered saline
- FIGS. 5 A- 5 D show bar graphs for the percentage of fluorescent marker detected by FACS for each clone transfected with either I-SceI expression vector or its corresponding empty vector control. These independent clones have one or more copies of the FluoMulti reporter randomly integrated in their genome. While all five clones noticeably report performance of HR and NHEJ, only clones P19, P20, and P22 report performance of MMEJ in response to IsceI-mediated cleavage, and only clones P15 and P20 report performance of SSA.
- FIGS. 6 A-B show bar graphs representing the percentage of fluorescent marker detected by FACS of 293T cells transfected with a CRISPR encoding vector or a I-SceI encoding vector.
- a transient transfection of the FluoMulti reporter into na ⁇ ve cells was completed. 293T cells were plated at 80% confluency in 6-well plates and the transfection was performed with the cells still in suspension using Lipofectamine 2000 (ThermoFisher). 5 ⁇ g of naked plasmid DNA was used per transfection (well/condition). For Cas9/sgRNA conditions, 4 ⁇ g of the relevant CRISPR vector encoding both Cas9 and the relevant sgRNA were transfected along with 1 ⁇ g of the reporter plasmid.
- FIG. 6 A shows the percentage of GFP-positive cells.
- FIG. 6 B shows the percentage of BFP-positive cells.
- reporter protein fluorescent signal was detectable in the absence of the initiation of DNA repair.
- the fluorescent signal of each of the reporter proteins was analyzed in control samples of cells untreated with I-SceI endonuclease. Fluorescent signal in the absence of I-SceI endonuclease to initiate DNA repair is representative of background signal that occurs in the absence of DNA repair mechanisms altering the structure of the DSB reporter.
- FIGS. 7 A and 7 B show detection of tdTomato (representative of NHEJ repair) and iRFP (representative of SSA repair) fluorescent signal in 293T cells that are either treated with I-SceI endonuclease (initiating DNA repair) or untreated control cells.
- FIG. 7 A presents results from 293T cell clone P19
- FIG. 7 B presents results from 293T cell clone P22.
- one copy of the FluoMulti reporter was integrated at a random location within the genome of the cell.
- FIGS. 7 A and 7 B 293T untreated control cells in which the FluoMulti reporter was uncut and unrepaired displayed significant background signal of tdTomato and iRFP.
- the DSB reporter construct incorporates a ribonuclease mechanism to destroy mRNA transcripts that result from run-through transcription in the absence of DNA repair.
- This new reporter is called the FluoMultiCsy4 reporter and shown in FIG. 10 A .
- the ribonuclease used was CRISPR-associated protein Csy4.
- Csy4 is continually expressed from an expression cassette contained within the FluoMultiCsy4 reporter.
- FIG. 10 B is a is a schematic diagram that represents the FluoMultiCsy4 reporter in na ⁇ ve conditions wherein DNA repair has not been initiated by I-SceI.
- Cys4 is being continually expressed and will target and destroy spurious run-through transcripts. Since both the polycistronic tdTomato transcript and the polycistronic iRFP transcript mRNA harbor the specific Csy4-targeting hairpin sequence, both transcript mRNAs will be destroyed. The transcripts will not be translated, eliminating tdTomato and iRFP reporter protein fluorescent signal that occurs as background signal.
- FIG. 10 C is a schematic diagram that delineates the I-SceI (or alternatively AsiSI or Cas9) enzyme cutting of the FluoMultiCsy4 reporter. This enzyme-cutting event removes the section of the reporter containing both the polyadenylation transcriptional stop elements and the sequence for the Cys4 associated RNA hairpins.
- NHEJ repair allows for translation and expression of only the full tdTomato reporter protein.
- the ends of the double-stranded break are ligated together directly (see arrows on ends of the microhomology domains on the top construct).
- the transcribed RNA is no longer terminated before transcription of the IRES, and tdTomato protein is expressed. None of the other reporters are expressed at full-length and/or in-frame. Since the Cys4 associated RNA hairpin encoding sequence 5′ to tdTomato was removed by the I-SceI cutting enzyme, the tdTomato transcript is not targeted for destruction by Cys4.
- Cys4-associated RNA hairpin-encoding sequence remains present 5′ to the iRFP670 reporter protein. Ongoing expression of Csy4 causes the destruction of iRFP670 transcript. Therefore, only tdTomato fluorescence signal is present when NHEJ repair occurs.
- HR repair allows for translation and expression of GFP and tdTomato.
- the 5′EGFP-B portion of the construct from a sister chromatid is used to repair the break.
- the 5′EGFP-B has homology to both the 5′EGFP-A and the 3′EGFP-Y64H (see gray arrows indicating homologous regions).
- the repaired sequence is that of a full-length EGFP. Both full-length EGFP (green fluorescence) and tdTomato (orange fluorescence) are expressed. Since the Cys4 associated RNA hairpin encoding sequence 5′ to tdTomato was removed by the I-SceI cutting enzyme, the EGFP/tdTOMATO bicistronic transcript is not targeted for destruction by Cys4.
- Cys4 associated RNA hairpin-encoding sequence remains 5′ to the iRFP670 reporter protein. Ongoing expression of Csy4 causes the destruction of iRFP670 transcript. Therefore, tdTomato and GFP fluorescence signal are present when HR repair occurs.
- MMEJ repair allows for translation and expression of BFP and tdTomato.
- the microhomology domains (labeled “u”) on each end of the broken chromatid recombine (see gray arrow between the MHD on each end of the break) and the ends of the break are ligated together, leaving a single microhomology domain.
- the full-length EGFP-Y64H has the signaling properties of blue fluorescent protein (BFP).
- Cys4-associated RNA hairpin-encoding sequence remains 5′ to the iRFP670 reporter protein. Ongoing expression of Csy4 causes the destruction of iRFP670 transcript. Therefore, tdTomato and BFP fluorescence signal are present when MMEJ repair occurs.
- SSA repair allows for translation and expression of iRFP.
- the 5′EGFP-A is annealed with homologous sequence of 5′EGFP-B on the same chromatid.
- the promoter associated with the 5′EGFP-A drives expression of the iRFP670 protein, which fluoresces maroon.
- the section of chromatid containing the 3′EGFP-Y64H, the IRES, and the tdTomato is deleted; thus no other fluorescent proteins are retained in the repaired construct.
- the expression cassette for Csy4 has also been removed in the final repair product. Therefore, iRFP is expressed despite having the Csy4 associated RNA hairpin, because Csy4 is no longer being expressed.
- iRFP fluorescence signal is present when SSA repair occurs.
- the efficacy of the FluoMultiCsy4 reporter was tested to compare the fluorescent signal observed in cells with forced expression of I-SceI versus control cells without an endonuclease. Plasmids containing the FluoMultiCsy4 reporter were transfected into 293T cells. Clones which integrated a single copy of the FluoMultiCsy4 reporter at a random location in their genome were selected (A2, A7, B10, and B12). These clones were infected with either an empty virus or an ISceI-encoding virus. The fluorescent signal of the cells was then determined by FACs (counting 100,000 cells).
- FIGS. 11 A-D are a set of histograms that display the percentage of cells counted with a fluorescent signal indicative of HR ( FIG. 11 A ), MMEJ ( FIG. 11 B ), NHEJ ( FIG. 11 C ), or SSA ( FIG. 11 D ).
- Data is presented for cells infected with ISceI-encoding virus, as well as, uninfected and empty virus controls.
- the vast majority of the cells that displayed DNA repair used the NHEJ repair mechanism, confirming that NHEJ is the pathway of (double-strand break repair) DSBR most frequently utilized by mammalian cells.
- FIGS. 12 A-B show the results of experiments performed to determine whether the expected repair products for each different pathway would match the colors that the cells emit.
- 293T cell clones A2, A7, B10, and B12 which have one copy of the FluoMultiCsy4 reporter integrated into their genome, were infected with an ISceI-encoding virus.
- the cells were FACS-sorted according to the different colors that they displayed. Genomic DNA was extracted from these color-sorted cells with the purpose of analyzing the repair products formed.
- the DSB reporter construct was designed with silent mutagenesis to create unique restriction sites in the repair products of each distinct pathway. Repair products from the genomic DNA of the color-sorted cells were PCR-amplified and digested with the appropriate restriction enzymes. For example, in the case of SSA, the PCR product is only amplified when repair by SSA occurs.
- each expected repair product or digested repair product is only detected significantly in the cells that were sorted by color for that specific type of repair.
- the SSA repair product only amplifies in the gDNA of cells that are sorted for the maroon color, the expected color for SSA, whereas the same PCR product is not detectable in clone B10, which is consistent with almost no cells utilizing SSA for DSB repair.
- the A2 ( FIG. 13 A ), A7 ( FIG. 13 B ), B10 ( FIG. 13 C ), and B12 ( FIG. 13 D ) clones were infected with ISceI-encoding virus.
- the cells were transfected with siRNAs targeted at depleting either BRCA1, BRCA2, Rad51, Rad52 or 53BP1.
- Cells were also transfected with an siRNA control, siGL2, that targets a gene irrelevant to the DNA repair pathways.
- FIGS. 15 A-D As shown in FIGS. 15 A-D , once the subclones were isolated, the DNA repair process was initiated using I-SceI in the subclones, as well as, the original clone.
- the clones, and respective subclones, of A2 ( FIG. 15 A ), A7 ( FIG. 15 B ), B10 ( FIG. 15 C ), and B12 ( FIG. 15 D ) were analyzed using FACs (counting 100,000 cells).
- the results from the original parental clone are shown as boxed.
- the repair choice profiles of the subclones are largely comparable to their respective parental clone, underscoring the robustness and reproducibility of this method.
- FIGS. 16 A-C show the efficiency of endonucleases I-SceI and AsiSI to induce DNA repair in mouse ES cells ( FIG. 16 A ), 293T cells ( FIG. 16 B ), or T98G cells ( FIG. 16 C ).
- Clones which integrated a single FluoMultiCsy4 reporter were isolated from 293 Ts, T98Gs and mouse ES cells. These cells were infected with either 3 ⁇ SV40nls.ISceI-, 3 ⁇ SV40nls.AsiSI- or 3 ⁇ MYCnls.AsiSI-encoding viruses, alongside an appropriate empty vector control (not shown). Cells were selected with Puromycin.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
-
- (a) a first cassette comprising:
- (i) a 5′ portion of an open reading frame of a first reporter gene (5′RP1);
- (ii) a first microhomology domain (MHD);
- (iii) a sequence comprising from 5′ to 3′: a first double-stranded endonuclease recognition sequence (DSE-RS) recognized by a first double-stranded endonuclease (DSE), one or more sequences that lead to termination of transcription, and a second DSE-RS recognized by a second DSE;
- (iv) a second MHD that has sequence homology to the first MHD; and
- (v) a 3′ portion of an open reading frame for an allele of the first reporter gene (3′RP1),
- wherein a complete open reading frame of the first reporter gene (RP1) comprises from 5′ to 3′: 5′RP1, the first MHD or the second MHD, and 3′RP1, wherein removal of the sequence between the cleavage site in the first DSE-RS and the cleavage site in the second DSE-RS from the first cassette results in a reading frame shift of 3′RP1 relative to its native reading frame;
- (b) a second cassette comprising:
- (vi) an internal ribosome entry site sequence (IRES);
- (vii) an open reading frame of a second reporter gene (RP2) that is operably linked to the IRES;
- (c) a third cassette comprising a portion of an open reading frame of a third reporter gene (RP3), wherein the portion of RP3 comprises from 5′ to 3′:
- (viii) a first portion that has sequence homology to the 5′RP1; and
- (ix) a second portion that has sequence homology to the 3′RP1, wherein homologous recombination between the first and third cassettes results in a complete open reading frame of the third reporter gene comprising from 5′ to 3′: a 5′ portion of the 5′RP1, the portion of RP3, and a 3′ portion of the 3′RP1; and
- (d) a fourth cassette comprising an open reading frame of a fourth reporter gene (RP4) lacking a start codon,
wherein the first and second cassettes are operably linked, and wherein the third and fourth cassettes are fused in the same reading frame.
- (a) a first cassette comprising:
-
- (a) the RP1 gene product is capable of producing a first signal;
- (b) the RP2 gene product is capable of producing a second signal;
- (c) the RP3 gene product is capable of producing a third signal; and
- (d) the RP4 gene product is capable of producing a fourth signal.
-
- (a) integrating a nucleic acid sequence into the genome of a cell, wherein the nucleic acid sequence comprises at least four reporter genes that generate a different signal;
- (b) inducing a double-stranded break into the nucleic acid sequence;
- (c) detecting at least one signal generated by at least one reporter gene, that signal being indicative of the type of double-stranded break repair mechanism.
-
- (a) obtaining a cell comprising a vector comprising a nucleic acid disclosed herein;
- (b) expressing in the cell the first DSE and the second DSE, thereby generating a double-stranded break; and
- (c) detecting one or more of the first, second, third, and/or fourth signals in response to the double-stranded break, wherein detection of a first, second, third, and/or fourth signal is indicative of a type of double-stranded break repair mechanism. In some embodiments, detecting only the second signal indicates that the cell used non-homologous end joining (NHEJ) to repair the double-stranded break. In some embodiments, detecting only the second signal and the third signal indicates that the cell used homologous recombination (HR) to repair the double-stranded break. In some embodiments, detecting only the first signal and the second signal indicates that the cell used microhomology-mediated end joining (MMEJ) to repair the double-stranded break. In some embodiments, detecting only the fourth signal indicates that the cell used single-strand annealing (SSA) to repair the double-stranded break.
| (SEQ ID NO: 8; CrPD) | |
| GTAGGGATAACAGGGTAATATGG, | |
| (SEQ ID NO: 9; Cr1A) | |
| TAACGAATAAAAGTTACGCTAGG, | |
| (SEQ ID NO: 10; Cr1B) | |
| AACGAATAAAAGTTACGCTAGGG, | |
| (SEQ ID NO: 11; Cr1C) | |
| AAGTTACGCTAGGGATAACAGGG, | |
| and | |
| (SEQ ID NO: 12; Cr1D) | |
| AAAGTTACGCTAGGGATAACAGG. |
Claims (20)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/047,615 US12371709B2 (en) | 2018-04-20 | 2019-04-19 | Multifunctional nucleic acid reporter constructs |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862660539P | 2018-04-20 | 2018-04-20 | |
| PCT/US2019/028378 WO2019204767A1 (en) | 2018-04-20 | 2019-04-19 | Multifunctional nucleic acid reporter constructs |
| US17/047,615 US12371709B2 (en) | 2018-04-20 | 2019-04-19 | Multifunctional nucleic acid reporter constructs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20210123072A1 US20210123072A1 (en) | 2021-04-29 |
| US12371709B2 true US12371709B2 (en) | 2025-07-29 |
Family
ID=68239022
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/047,615 Active 2042-11-27 US12371709B2 (en) | 2018-04-20 | 2019-04-19 | Multifunctional nucleic acid reporter constructs |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US12371709B2 (en) |
| WO (1) | WO2019204767A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG11201912236YA (en) | 2017-07-31 | 2020-01-30 | Regeneron Pharma | Crispr reporter non-human animals and uses thereof |
| WO2025151662A1 (en) * | 2024-01-09 | 2025-07-17 | Massachusetts Institute Of Technology | Multi-pathway reporter system that interrogates repair of dna double-strand breaks with applications for diagnosis and therapeutic treatment |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040171154A1 (en) | 2001-07-27 | 2004-09-02 | Francesca Storici | Systems for in vivo site-directed mutagenesis using oligonucleotides |
| US20170166912A1 (en) | 2014-02-27 | 2017-06-15 | Monsanto Technology Llc | Compositions and methods for site directed genomic modification |
| WO2017147056A1 (en) | 2016-02-22 | 2017-08-31 | Caribou Biosciences, Inc. | Methods for modulating dna repair outcomes |
| WO2018014005A1 (en) * | 2016-07-15 | 2018-01-18 | University Of Southern Calfifornia | Multiple-reporter systems for indirectly screening differentiated cells by cell type and/or cell function |
-
2019
- 2019-04-19 WO PCT/US2019/028378 patent/WO2019204767A1/en not_active Ceased
- 2019-04-19 US US17/047,615 patent/US12371709B2/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040171154A1 (en) | 2001-07-27 | 2004-09-02 | Francesca Storici | Systems for in vivo site-directed mutagenesis using oligonucleotides |
| US20170166912A1 (en) | 2014-02-27 | 2017-06-15 | Monsanto Technology Llc | Compositions and methods for site directed genomic modification |
| WO2017147056A1 (en) | 2016-02-22 | 2017-08-31 | Caribou Biosciences, Inc. | Methods for modulating dna repair outcomes |
| WO2018014005A1 (en) * | 2016-07-15 | 2018-01-18 | University Of Southern Calfifornia | Multiple-reporter systems for indirectly screening differentiated cells by cell type and/or cell function |
Non-Patent Citations (14)
| Title |
|---|
| Ayora et al., "Double-strand break repair in bacteria: a view from Bacillus subtilis", FEMS Microbiol. Rev. vol. 35, 2011, pp. 1055-1081. (Year: 2011). * |
| Bindra et al., "Development of an assay to measure mutagenic non-homologous end-joining repair activity in mammalian cells", Nucleic Acids Res, vol. 41, Published Apr. 12, 2013, pp. 1-15. (Year: 2013). * |
| Decottignies, "Microhomology-Mediated End Joining in Fission Yeast Is Repressed by Pku70 and Relies on Genes Involved in Homologous Recobination", Genetics 176 Jul. 2007, pp. 1403-1415. (Year: 2007). * |
| Gomez-Cabello et al., "New Tools to Study DNA Double-Strand Break Repair Pathway Choice," PLOS ONE, vol. 8, Published Oct. 2013, pp. 1-9. (Year: 2013). * |
| Gunn et al., "I-Scel-Based Assays to Examine Distinct Repair Outcomes of Mammalian Chromosomal Double Strand Breaks", DNA Repair Protocols, Methods in Molecular Biology, vol. 920, Chapter 27, 2012, pp. 379-390. (Year: 2012). * |
| Kostyrko et al. "Assays for DNA double-strand break repair by microhomoloy-based end-joining repair mechanisms," Nucleic Acids Res, Dec. 10, 2015, vol. 44, e56, pp. 1-9, entire document. |
| Mao et al. "Sirtuin 6 (SIRT6) rescues the decline of homologous recombination repair during replicative senescence," Proc Natl Acad Sci USA, Jul. 2, 2012, vol. 109, pp. 11800-11805, entire document. |
| Nagel et al., "Multiplexed DNA Repair assays for multiple lesions and multiple doses via transcription inhibition and transcriptional mutagenesis", PNAS, Published Apr. 22, 2014, pp. E1823-E1832) (Year: 2014). * |
| PCT Application No. PCT/US19/28378 International Preliminary Report on Patentability, dated Oct. 20, 2020, 9 pages. |
| PCT Application No. PCT/US19/28378 International Search Report and Written Opinion, dated Jul. 12, 2019, 13 pages. |
| Sfeir at al., "Microhomology-mediated end joining: a back-up survival mechanism or dedicated pathway?", Trends Biochem Sci., Nov. 2015, pp. 704-714. (Year: 2015). * |
| Weinstock et al., "Assaying Double-Strand Break Repair Pathway Choice in Mammalian Cells Using a Targeted Endonuclease or the RAG Recombinase", Methods in Enzymology, vol. 409, 2006, pp. 524-538. (Year: 2006). * |
| Xue et al. "A targeted neuroglial reporter line generated by homologous recombination in human embryonic stem cells," Stem Cells, Aug. 1, 2009, vol. 27, pp. 1836-1846, entire document. |
| Yang et al. "One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering," Cell, Aug. 29, 2013, vol. 154, pp. 1370-1379, entire document. |
Also Published As
| Publication number | Publication date |
|---|---|
| US20210123072A1 (en) | 2021-04-29 |
| WO2019204767A1 (en) | 2019-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11802277B2 (en) | Thermostable Cas9 nucleases | |
| Bukhari et al. | Endogenous fluorescence tagging by CRISPR | |
| KR102758434B1 (en) | Method for inducing exon skipping by genome editing | |
| US20210395710A1 (en) | Cas9-cas9 fusion proteins | |
| US9567608B2 (en) | Methods of nuclease-based genetic engineering | |
| RU2764757C2 (en) | Genomic engineering | |
| US10428327B2 (en) | Compositions and methods for enhancing homologous recombination | |
| US20170260547A1 (en) | Methods and compositions for gene editing | |
| CN109415729B (en) | Gene editing reagents with reduced toxicity | |
| WO2017136629A1 (en) | Vectors and system for modulating gene expression | |
| US20220098619A1 (en) | Anti-crispr-mediated control of genome editing and synthetic circuits in eukaryotic cells | |
| Xiao et al. | An expandable FLP-ON:: TIR1 system for precise spatiotemporal protein degradation in Caenorhabditis elegans | |
| US12371709B2 (en) | Multifunctional nucleic acid reporter constructs | |
| US20220025405A1 (en) | Production method for genome-edited cells | |
| Hamaker et al. | High‐efficiency and multilocus targeted integration in CHO cells using CRISPR‐mediated donor nicking and DNA repair inhibitors | |
| US20250002943A1 (en) | Methods for gene editing | |
| WO2020033456A1 (en) | Homologous recombination reporter construct and uses thereof | |
| WO2020117992A9 (en) | Improved vector systems for cas protein and sgrna delivery, and uses therefor | |
| Guirouilh-Barbat et al. | RAD51 promotes non-homologous genetic rearrangements that are prevented by 53BP1 | |
| Fladerer | Investigating nucleolar dynamics in karyotypically normal human cells by fluorescent protein tagging of genes encoding key nucleolar proteins | |
| WO2025106834A1 (en) | A single-plasmid system for enhanced crispr-cas9 mediated homologous recombination | |
| Xiao et al. | An expandable FLP-ON:: TIR1 system for precise spatiotemporal protein degradation in C. elegans | |
| Murray et al. | Interrogating the Mechanisms of Cas9-mediated Allele Conversion | |
| Kang et al. | Optimization of a Cas12a-Driven Synthetic Gene Regulatory Network System | |
| HK40058696A (en) | Compositions and methods for enhancing homologous recombination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| AS | Assignment |
Owner name: DANA-FARBER CANCER INSTITUTE, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BOWMAN-COLIN, CHRISTIAN;LIVINGSTON, DAVID M.;WONG, LAURA C.;AND OTHERS;REEL/FRAME:054641/0198 Effective date: 20180511 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: FINAL REJECTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: ADVISORY ACTION MAILED |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |