US11787797B2 - 4,5-annulated 1,2,4-triazolones - Google Patents

4,5-annulated 1,2,4-triazolones Download PDF

Info

Publication number
US11787797B2
US11787797B2 US17/161,615 US202117161615A US11787797B2 US 11787797 B2 US11787797 B2 US 11787797B2 US 202117161615 A US202117161615 A US 202117161615A US 11787797 B2 US11787797 B2 US 11787797B2
Authority
US
United States
Prior art keywords
group
alkyl
aryl
optionally substituted
alkenyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US17/161,615
Other versions
US20210188846A1 (en
Inventor
Stefan Nikolaus GRADL
Duy Nguyen
Knut Eis
Judith Günther
Timo Stellfeld
Andreas Janzer
Sven Christian
Thomas Mueller
Sherif El Sheikh
Han Jie ZHOU
Changjia ZHAO
David B. Sykes
Steven James Ferrara
Kery LIU
Simon Anthony HERBERT
Claudia MERZ
Michael Niehues
Carl Friedrich Nising
Martina Schäfer
Katja Zimmermann
Jörg KNÄBLEIN
Kai Thede
Thomas FAUPEL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer AG
Bayer Pharma AG
Harvard College
General Hospital Corp
Broad Institute Inc
Original Assignee
Bayer AG
Bayer Pharma AG
Harvard College
General Hospital Corp
Broad Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer AG, Bayer Pharma AG, Harvard College, General Hospital Corp, Broad Institute Inc filed Critical Bayer AG
Priority to US17/161,615 priority Critical patent/US11787797B2/en
Publication of US20210188846A1 publication Critical patent/US20210188846A1/en
Assigned to PRESIDENT AND FELLOWS OF HARVARD COLLEGE, THE GENERAL HOSPITAL CORPORATION reassignment PRESIDENT AND FELLOWS OF HARVARD COLLEGE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SYKES, DAVID B.
Assigned to THE BROAD INSTITUTE, INC. reassignment THE BROAD INSTITUTE, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FERRARA, STEVEN JAMES
Assigned to BAYER PHARMA AKTIENGESELLSCHAFT, BAYER AKTIENGESELLSCHAFT reassignment BAYER PHARMA AKTIENGESELLSCHAFT ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ZHOU, HAN JIE, LIU, Kery, ZHAO, Changjia, MERZ, Claudia, SHEIKH, SHERIF EL, HERBERT, SIMON ANTHONY, CHRISTIAN, SVEN, EIS, KNUT, GRADL, STEFAN NIKOLAUS, JANZER, ANDREAS, KNÄBLEIN, Jörg, MUELLER, THOMAS, NGUYEN, DUY, NIEHUES, MICHAEL, SCHÄFER, Martina, STELLFELD, TIMO, ZIMMERMANN, KATJA, FAUPEL, Thomas, NISING, CARL FRIEDRICH, THEDE, KAI, GÜNTHER, Judith
Application granted granted Critical
Publication of US11787797B2 publication Critical patent/US11787797B2/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4196—1,2,4-Triazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D498/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D498/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D498/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D519/00—Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups C07D453/00 or C07D455/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C12N9/0038—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
    • C12N9/0042—NADPH-cytochrome P450 reductase (1.6.2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10—Nitrogen as only ring hetero atom
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/182—Heterocyclic compounds containing nitrogen atoms as the only ring heteroatoms in the condensed system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/188—Heterocyclic compound containing in the condensed system at least one hetero ring having nitrogen atoms and oxygen atoms as the only ring heteroatoms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
    • C12Y106/02—Oxidoreductases acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
    • C12Y106/02004—NADPH-hemoprotein reductase (1.6.2.4), i.e. NADP-cytochrome P450-reductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/14—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (1.14.14)
    • C12Y114/14001—Unspecific monooxygenase (1.14.14.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention provides 4,5-a-annulated 1,2,4-triazolone compounds of general formula (I) as described and defined herein, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases, in particular of hyperproliferative and/or inflammatory disorders, as a sole agent or in combination with other active ingredients.
  • the present invention provides 4,5-annulated 1,2,4-triazolone compounds of general formula (I) which inhibit Dihydroorotate Dehydrogenase (DHODH).
  • DHODH Dihydroorotate Dehydrogenase
  • AML Acute myeloid leukemia
  • AML is the most common acute leukemia in humans with a 5 year survival of only about 30%.
  • AML is a malignancy of the myeloid line of blood cells.
  • the incidence rates and chances of cure are highly age dependent.
  • the chemotherapy standard of care for AML has not changed significantly over the last decades highlighting the need for novel therapies.
  • a major hallmark of AML is differentiation arrest of the leukemic cells at early stages of cellular differentiation.
  • the potential of leukemic differentiation therapy can be seen with the success of ATRA or arsenic trioxide inducing differentiation in acute promyelocytic leukemia (APL).
  • AML Around 10% of AML belong to the APL subtype where leukemic cells are harbouring a chromosomal translocation resulting in fusions of oncoproteins involving the retinoic acid receptor. While treatment with ATRA or arsenic trioxide leads to a dramatic increase of patient survival, with overall survival rates of over 70%, unfortunately a comparable differentiation therapy for the non-APL AMLs is lacking (Management of acute promyelocytic leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet, Sanz M. A. et al, Blood 2009, 113(9), 1875-1891). Therefore new therapies inducing differentiation of AML cells are of high interest and medical need.
  • DHODH is located in the mitochondria and the enzyme responsible for the 4 th and rate limiting step in de novo pyrimidine synthesis converting dihydroorotate to orotate (Dihydroorotat-ubiquinone oxidoreductase links mitochondria in the biosynthesis of pyrimidine nucleotides, Löffler M. et al, Molecular and Cellular Biochemistry 1997, 174, 125-129).
  • DHODH is highly important for cellular proliferation.
  • the enzyme is considered an attractive drug target for cancer, immunological, parasitic and viral diseases and DHODH small molecule inhibitors like Leflunomide/Teriflunomide and Brequinar have been approved for clinical use in Rheumatoid Arthritis and Multiple Sclerosis. Additionally, preclinical studies indicate that DHODH inhibitors may be useful for the treatment of haematological cancer indications, for the treatment of solid tumors (e.g., neuroblastoma, melanoma, colon, breast and lung tumors), for the treatment of parasitic diseases (e.g., malaria), and for viral disease therapy.
  • solid tumors e.g., neuroblastoma, melanoma, colon, breast and lung tumors
  • parasitic diseases e.g., malaria
  • U.S. Pat. No. 6,444,613 B1 relates to the field of defoliants, in particular thidiazuron-comprising mixtures, and their use in crops of cotton. These mixtures comprise among others 2,4,5-trisubstituted 1,2,4-triazolone compounds as herbicides, which inhibit the enzyme protoporphyrinogen-(IX) oxidase (PPO inhibitors).
  • PPO inhibitors 2,4,5-trisubstituted 1,2,4-triazolone compounds as herbicides, which inhibit the enzyme protoporphyrinogen-(IX) oxidase
  • WO199802422 describes substituted aromatic carbonyl compounds, among others 2,4,5-trisubstituted 1,2,4-triazolone compounds, as herbicides.
  • WO 2013/186692 A1 describes triazolone compounds as mPGES-1 inhibitors, useful in the treatment of pain and/or inflammation from a variety of diseases or conditions, such as asthma, osteoarthritis, rheumatoid arthritis, acute or chronic pain and neurodegenerative diseases.
  • WO2010/077686 A1 describes sirtuin-modulating compounds, e.g. isoindolinone and related compounds, and methods of use thereof.
  • the sirtuin-modulating compounds may be used for increasing the lifespan of a cell, and treating and/or preventing a wide variety of diseases and disorders including, for example, diseases or disorders related to aging or stress, diabetes, obesity, neurodegenerative diseases, cardiovascular disease, blood clotting disorders, inflammation, cancer, and/or flushing as well as diseases or disorders that would benefit from increased mitochondrial activity.
  • the compounds of the present invention have surprisingly been found to effectively inhibit DHODH and may therefore be used for the treatment or prophylaxis of disease including hyperproliferative and/or inflammatory disorders, such as cancer, for example.
  • the present invention provides compounds of general formula (I):
  • substituted means that one or more hydrogen atoms on the designated atom or group are replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded. Combinations of substituents and/or variables are permissible.
  • optionally substituted means that the number of substituents can be equal to or different from zero. Unless otherwise indicated, it is possible that optionally substituted groups are substituted with as many optional substituents as can be accommodated by replacing a hydrogen atom with a non-hydrogen substituent on any available carbon or nitrogen atom. Commonly, it is possible for the number of optional substituents, when present, to be 1, 2, 3, 4 or 5, in particular 1, 2 or 3.
  • the term “one or more”, e.g. in the definition of the substituents of the compounds of general formula (I) of the present invention, means “1, 2, 3, 4 or 5, particularly 1, 2, 3 or 4, more particularly 1, 2 or 3, even more particularly 1 or 2”.
  • an oxo substituent represents an oxygen atom, which is bound to a carbon atom or to a sulfur atom via a double bond.
  • ring substituent means a substituent attached to an aromatic or nonaromatic ring which replaces an available hydrogen atom on the ring.
  • a composite substituent be composed of more than one parts, e.g. (C 1 -C 3 -alkoxy)-(C 1 -C 6 -alkyl)-, it is possible for the position of a given part to be at any suitable position of said composite substituent, i.e. the C 1 -C 3 -alkoxy part can be attached to any carbon atom of the C 1 -C 6 -alkyl part of said (C 1 -C 3 -alkoxy)-(C 1 -C 6 alkyl)- group.
  • a hyphen at the beginning or at the end of such a composite substituent indicates the point of attachment of said composite substituent to the rest of the molecule.
  • a ring comprising carbon atoms and optionally one or more heteroatoms, such as nitrogen, oxygen or sulfur atoms for example, be substituted with a substituent
  • substituent it is possible for said substituent to be bound at any suitable position of said ring, be it bound to a suitable carbon atom and/or to a suitable heteroatom.
  • halogen atom means a fluorine, chlorine, bromine or iodine atom, particularly a fluorine, chlorine or bromine atom.
  • C 1 -C 8 -alkyl means a linear or branched, saturated, monovalent hydrocarbon group having 1, 2, 3, 4, 5 or 6 carbon atoms, e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, 2-methylbutyl, 1-methylbutyl, 1-ethylpropyl, 1,2-dimethylpropyl, neo-pentyl, 1,1-dimethylpropyl, hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2,3-dimethylbutyl, 1,2-dimethylbutyl,
  • said group has 1, 2, 3, 4, 5 or 6 carbon atoms (“C 1 -C 6 -alkyl”), e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, 2-methylbutyl, 1-methylbutyl, 1-ethylpropyl, 1,2-dimethylpropyl, neo-pentyl, 1,1-dimethylpropyl, hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2,3-dimethylbutyl, 1,2-dimethylbutyl or 1,3-dimethylbutyl group.
  • said group has 1, 2, 3 or 4 carbon atoms (“C 1 -C 4 -alkyl”), e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl isobutyl, or tert-butyl group, more particularly 1, 2 or 3 carbon atoms (“C 1 -C 3 -alkyl”), e.g. a methyl, ethyl, n-propyl or isopropyl group.
  • C 1 -C 4 -alkyl e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl isobutyl, or tert-butyl group, more particularly 1, 2 or 3 carbon atoms (“C 1 -C 3 -alkyl”), e.g. a methyl, ethyl, n-propyl or isopropyl group.
  • C 1 -C 6 -hydroxyalkyl means a linear or branched, saturated, monovalent hydrocarbon group in which the term “C 1 -C 6 -alkyl” is defined supra, and in which 1 or 2 hydrogen atoms are replaced with a hydroxy group, e.g.
  • said group has 1, 2 or 3 carbon atoms (“C 1 -C 3 -hydroxyalkyl”), e.g.
  • C 1 -C 6 -alkylsulfanyl means a linear or branched, saturated, monovalent group of formula (C 1 -C 6 -alkyl)-S—, in which the term “C 1 -C 6 -alkyl” is as defined supra, e.g.
  • C 2 -C 8 -haloalkyl means a linear or branched, saturated, monovalent hydrocarbon group in which the term “C 2 -C 8 -alkyl” is as defined supra, and in which one or more of the hydrogen atoms are replaced, identically or differently, with a halogen atom. Particularly, said halogen atom is a fluorine atom.
  • Said C 2 -C 8 -haloalkyl group is, for example, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, 3,3,3-trifluoropropyl or 1,3-difluoropropan-2-yl.
  • said group has 2, 3, 4 5 or 6 carbon atoms (“C 2 -C 6 -haloalkyl”).
  • C 1 -C 6 -haloalkyl means a linear or branched, saturated, monovalent hydrocarbon group in which the term “C 1 -C 6 -alkyl” is as defined supra, and in which one or more of the hydrogen atoms are replaced, identically or differently, with a halogen atom. Particularly, said halogen atom is a fluorine atom.
  • Said C 1 -C 6 -haloalkyl group is, for example, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, 3,3,3-trifluoropropyl or 1,3-difluoropropan-2-yl.
  • said group has 1, 2, 3 or 4 carbon atoms (“C 1 -C 4 -haloalkyl”), more particularly 1, 2 or 3 carbon atoms (“C 1 -C 3 -haloalkyl”), e.g.
  • fluoromethyl difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, 3,3,3-trifluoropropyl or 1,3-difluoropropan-2-yl.
  • C 1 -C 6 -alkoxy means a linear or branched, saturated, monovalent group of formula (C 1 -C 6 -alkyl)-O—, in which the term “C 1 -C 6 -alkyl” is as defined supra, e.g. a methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, isobutoxy, tert-butoxy, pentyloxy, isopentyloxy or n-hexyloxy group, or an isomer thereof. Particularly, said group has 1, 2 or 3 carbon atoms (“C 1 -C 3 -alkoxy”), e.g. a methoxy, ethoxy, n-propoxy or isopropoxy group.
  • C 1 -C 6 -haloalkoxy means a linear or branched, saturated, monovalent C 1 -C 6 -alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, identically or differently, with a halogen atom.
  • said halogen atom is a fluorine atom.
  • Said C 1 -C 6 -haloalkoxy group is, for example, fluoromethoxy, difluoromethoxy, trifluoromethoxy, 2,2,2-trifluoroethoxy or pentafluoroethoxy.
  • said group has 1, 2 or 3 carbon atoms (“C 1 -C 3 -haloalkoxy”), e.g. a fluoromethoxy, difluoromethoxy, trifluoromethoxy, 2,2,2-trifluoroethoxy or pentafluoroethoxy group.
  • C 2 -C 6 -alkenyl means a linear or branched, monovalent hydrocarbon group, which contains one double bond, and which has 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (“C 2 -C 3 -alkenyl”), it being understood that in the case in which said alkenyl group contains more than one double bond, then it is possible for said double bonds to be isolated from, or conjugated with, each other.
  • Said alkenyl group is, for example, an ethenyl (or “vinyl”), prop-2-en-1-yl (or “allyl”), prop-1-en-1-yl, but-3-enyl, but-2-enyl, but-1-enyl, pent-4-enyl, pent-3-enyl, pent-2-enyl, pent-1-enyl, hex-5-enyl, hex-4-enyl, hex-3-enyl, hex-2-enyl, hex-1-enyl, prop-1-en-2-yl (or “isopropenyl”), 2-methylprop-2-enyl, 1-methylprop-2-enyl, 2-methylprop-1-enyl, 1-methylprop-1-enyl, 3-methylbut-3-enyl, 2-methylbut-3-enyl, 1-methylbut-3-enyl, 3-methylbut-2-enyl, 2-methylbut-2-enyl, 2-methylbut-2-
  • C 2 -C 6 -alkynyl means a linear or branched, monovalent hydrocarbon group which contains one triple bond, and which contains 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (“C 2 -C 3 -alkynyl”).
  • Said C 2 -C 6 -alkynyl group is, for example, ethynyl, prop-1-ynyl, prop-2-ynyl (or “propargyl”), but-1-ynyl, but-2-ynyl, but-3-ynyl, pent-1-ynyl, pent-2-ynyl, pent-3-ynyl, pent-4-ynyl, hex-1-ynyl, hex-2-ynyl, hex-3-ynyl, hex-4-ynyl, hex-5-ynyl, 1-methylprop-2-ynyl, 2-methylbut-3-ynyl, 1-methylbut-3-ynyl, 1-methylbut-2-ynyl, 3-methylbut-1-ynyl, 1-ethylprop-2-ynyl, 3-methylpent-4-ynyl, 2-methylpent-4-ynyl, 1-methyl-pent-4
  • C 3 -C 8 -cycloalkyl means a saturated, monovalent, mono- or bicyclic hydrocarbon ring which contains 3, 4, 5, 6, 7 or 8 carbon atoms (“C 1 -C 3 -cycloalkyl”).
  • Said C 3 -C 8 -cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl group, or a bicyclic hydrocarbon ring, e.g. a bicyclo[4.2.0]octyl or octahydropentalenyl.
  • said group contains 3, 4, 5 or 6 carbon atoms (“C 3 -C 6 -cycloalkyl”), e.g. a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl group.
  • said group contains 4, 5, 6, 7 or 8 carbon atoms (“C 4 -C 8 -cycloalkyl”), e.g. a cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl group.
  • C 4 -C 8 -cycloalkenyl means a monovalent, mono- or bicyclic hydrocarbon ring which contains 4, 5, 6, 7 or 8 carbon atoms and one double bond. Particularly, said ring contains 4, 5 or 6 carbon atoms (“C 4 -C 6 -cycloalkenyl”).
  • Said C 4 -C 8 -cycloalkenyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl or cyclooctenyl group, or a bicyclic hydrocarbon ring, e.g. a bicyclo[2.2.1]hept-2-enyl or bicyclo[2.2.2]oct-2-enyl.
  • C 3 -C 8 -cycloalkoxy means a saturated, monovalent, mono- or bicyclic group of formula (C 3 -C 8 -cycloalkyl)-O—, which contains 3, 4, 5, 6, 7 or 8 carbon atoms, in which the term “C 3 -C 8 -cycloalkyl” is defined supra, e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, cycloheptyloxy or cyclooctyloxy group. Particularly, said group has 3, 4, 5 or 6 carbon atoms (“C 3 -C 8 -cycloalkoxy”), e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy group.
  • 4- to 7-membered heterocycloalkyl and “4- to 6-membered heterocycloalkyl” mean a monocyclic, saturated heterocycle with 4, 5, 6 or 7 or, respectively, 4, 5 or 6 ring atoms in total, which contains one or two identical or different ring heteroatoms from the series N, O and S.
  • Said heterocycloalkyl group can be a 4-membered ring, such as azetidinyl, oxetanyl or thietanyl, for example; or a 5-membered ring, such as tetrahydrofuranyl, 1,3-dioxolanyl, thiolanyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, 1,1-dioxidothiolanyl, dioxidotetrahydrothiopyranyl, 1,2-oxazolidinyl, 1,3-oxazolidinyl or 1,3-thiazolidinyl, for example; or a 6-membered ring, such as tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, 1,3-dioxany
  • heterocycloalkyl and “4- to 6-membered nitrogen containing heterocycloalkyl” mean a monocyclic, saturated heterocycle with 4, 5, 6 or 7 or, respectively, 4, 5 or 6 ring atoms in total, containing one ring nitrogen atom and optionally one further ring heteroatom from the series: N, O, S. atom.
  • Said nitrogen containing heterocycloalkyl group can be a 4-membered ring, such as azetidinyl for example; or a 5-membered ring, such as pyrrolidinyl, imidazolidinyl, pyrazolidinyl, 1,2-oxazolidinyl, 1,3-oxazolidinyl or 1,3-thiazolidinyl, for example; or a 6-membered ring, such as piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl or 1,2-oxazinanyl, for example, or a 7-membered ring, such as azepanyl, 1,4-diazepanyl or 1,4-oxazepanyl, for example.
  • a 4-membered ring such as azetidinyl for example
  • a 5-membered ring such as pyrrolidinyl, imidazolidinyl, pyrazo
  • heterocycloalkenyl means a monocyclic, unsaturated, non-aromatic heterocycle with 5, 6 or 7 ring atoms in total, which contains one or two double bonds and one or two identical or different ring heteroatoms from the series: N, O, S.
  • Said heterocycloalkenyl group is, for example, 4H-pyranyl, 2H-pyranyl, 2,5-dihydro-1H-pyrrolyl, [1,3]dioxolyl, 4H-[1,3,4]thiadiazinyl, 2,5-dihydrofuranyl, 2,3-dihydrofuranyl, 2,5-dihydrothiophenyl, 2,3-dihydrothiophenyl, 4,5-dihydrooxazolyl or 4H-[1,4]thiazinyl.
  • 4-7-membered, optionally unsaturated, heterocyclic group includes the terms “4- to 7-membered heterocycloalkyl” and “5- to 7-membered heterocycloalkenyl”.
  • aryl includes aromatic ring systems being mono- or bicyclic, especially phenyl and naphthyl.
  • phenyl groups of which two vicinal substituents may form together a 5- or 6-membered, optionally aromatic or non-aromatic ring, and optionally containing a C( ⁇ O) group and specifically includes naphthalinyl, indanyl and tetralinyl.
  • heteroaryl means a monovalent, monocyclic or bicyclic aromatic ring having 5, 6, 8, 9 or 10 ring atoms (a “5- to 10-membered heteroaryl” group), particularly 5, 6, 9 or 10 ring atoms, which contains at least one ring heteroatom and optionally one, two or three further ring heteroatoms from the series: N, O and/or S, and which is bound via a ring carbon atom or optionally via a ring nitrogen atom (if allowed by valency).
  • Said heteroaryl group can be a 5-membered heteroaryl group, such as, for example, thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl or tetrazolyl; or a 6-membered heteroaryl group, such as, for example, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl or triazinyl; or a 9-membered heteroaryl group, such as, for example, benzofuranyl, benzothienyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, benzothiazolyl, benzotriazolyl, indazolyl, indolyl, isoindolyl, ind
  • heteroaryl or heteroarylene groups include all possible isomeric forms thereof, e.g.: tautomers and positional isomers with respect to the point of linkage to the rest of the molecule.
  • pyridinyl includes pyridin-2-yl, pyridin-3-yl and pyridin-4-yl; or the term thienyl includes thien-2-yl and thien-3-yl.
  • C 1 -C 6 as used in the present text, e.g. in the context of the definition of “C 1 -C 6 -alkyl”, “C 1 -C 6 -haloalkyl”, “C 1 -C 6 -hydroxyalkyl”, “C 1 -C 6 -alkoxy” or “C 1 -C 6 -haloalkoxy” means an alkyl group having a finite number of carbon atoms of 1 to 6, i.e. 1, 2, 3, 4, 5 or 6 carbon atoms.
  • C 3 -C 8 as used in the present text, e.g.
  • C 3 -C 8 -cycloalkyl in the context of the definition of “C 3 -C 8 -cycloalkyl”, means a cycloalkyl group having a finite number of carbon atoms of 3 to 8, i.e. 3, 4, 5, 6, 7 or 8 carbon atoms.
  • C 1 -C 8 encompasses C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 1 -C 8 , C 1 -C 7 , C 1 -C 6 , C 1 -C 5 , C 1 - C 4 , C 1 -C 3 , C 1 -C 2 , C 2 -C 8 , C 2 -C 7 , C 2 -C 6 , C 2 -C 5 , C 2 -C 4 , C 2 -C 3 , C 3 -C 8 , C 3 -C 7 , C 3 -C 6 , C 3 -C 5 , C 3 -C 4 , C 4 -C 8 , C 4 -C 7 , C 4 -C 6 , C 4 -C 5 , C 5 -C 8 , C 5 -C 7 , C 5 -C 6 , C 6 -C 8 , C 6 -C
  • C 1 -C 6 encompasses C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 1 -C 6 , C 1 -C 5 , C 1 -C 4 , C 1 -C 3 , C 1 -C 2 , C 2 - C 6 , C 2 -C 6 , C 2 -C 4 , C 2 -C 3 , C 3 -C 6 , C 3 -C 5 , C 3 -C 4 , C 4 -C 6 , C 4 -C 5 , and C 5 -C 6 ;
  • C 1 -C 4 encompasses C 1 , C 2 , C 3 , C 4 , C 1 -C 4 , C 1 -C 3 , C 1 -C 2 , C 2 -C 4 , C 2 -C 3 and C 3 -C 4 ;
  • C 1 -C 3 encompasses C 1 , C 2 , C 3 , C 1 -C 3 , C 1 -C 2 and C 2 -C 3 ;
  • C 2 -C 6 encompasses C 2 , C 3 , C 4 , C 5 , C 6 , C 2 -C 6 , C 2 -C 5 , C 2 -C 4 , C 2 -C 3 , C 3 -C 6 , C 3 -C 5 , C 3 -C 4 , C 4 -C 6 , C 4 -C 5 , and C 5 -C 6 ;
  • C 3 -C 8 encompasses C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 3 -C 8 , C 3 -C 7 , C 3 -C 6 , C 3 -C 5 , C 3 -C 4 , C 4 - C 8 , C 4 -C 7 , C 4 -C 6 , C 4 -C 5 , C 5 -C 8 , C 5 -C 7 , C 5 -C 6 , C 6 -C 8 , C 6 -C 7 and C 7 -C 8 ;
  • C 3 -C 6 encompasses C 3 , C 4 , C 5 , C 6 , C 3 -C 5 , C 3 -C 4 , C 3 -C 4 , C 4 -C 6 , C 4 -C 5 , and C 5 -C 6 ;
  • C 4 -C 8 encompasses C 4 , C 5 , C 6 , C 7 , C 8 , C 4 -C 8 , C 4 -C 7 , C 4 -C 6 , C 4 -C 5 , C 5 -C 8 , C 5 -C 7 , C 5 -C 6 , C 6 -C 8 , C 6 -C 7 and C 7 -C 8 ;
  • C 4 -C 7 encompasses C 4 , C 5 , C 6 , C 7 , C 4 -C 7 , C 4 -C 6 , C 4 -C 5 , C 5 -C 7 , C 5 -C 6 and C 6 -C 7 ;
  • C 4 -C 6 encompasses C 4 , C 5 , C 6 , C 4 -C 6 , C 4 -C 5 and C 5 -C 6 ;
  • C 5 -C 10 encompasses C 5 , C 6 , C 7 , C 8 , C 9 , C 10 , C 5 -C 10 , C 5 -C 9 , C 5 -C 8 , C 5 -C 7 , C 5 -C 6 , C 6 - C 10 , C 6 -C 9 , C 6 -C 8 , C 6 -C 7 , C 7 -C 10 , C 7 -C 9 , C 7 -C 8 , C 8 -C 10 , C 8 -C 9 and C 9 -C 10 ;
  • C 6 -C 10 encompasses C 6 , C 7 , C 8 , C 9 , C 10 , C 6 -C 10 , C 6 -C 9 , C 6 -C 8 , C 6 -C 7 , C 7 -C 10 , C 7 -C 9 , C 7 -C 8 , C 8 -C 10 , C 8 -C 9 and C 9 -C 10 .
  • the term “leaving group” means an atom or a group of atoms that is displaced in a chemical reaction as stable species taking with it the bonding electrons.
  • a leaving group is selected from the group comprising: halide, in particular fluoride, chloride, bromide or iodide, (methylsulfonyl)oxy, [(trifluoromethyl)sulfonyl]oxy, [(nonafluorobutyl)-sulfonyl]oxy, (phenylsulfonyl)oxy, [(4-methylphenyl)sulfonyl]oxy, [(4-bromophenyl)sulfonyl]oxy, [(4-nitrophenyl)sulfonyl]oxy, [(2-nitrophenyl)sulfonyl]oxy, [(4-isopropylphenyl)sulfonyl]oxy, [(2,4,6-triisopropyl
  • substituted refers to a group “substituted” on, e.g. an alkyl, haloalkyl, cycloalkyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any atom of that group, replacing one or more hydrogen atoms therein.
  • the substituent(s) on a group are independently any one single, or any combination of two or more of the permissible atoms or groups of atoms delineated for that substituent.
  • a substituent may itself be substituted with any one of the above substituents.
  • optionalally substituted means unsubstituted (e.g., substituted with an H) or substituted.
  • subject is meant a mammal, including, but not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, rodent, or feline
  • the invention therefore includes one or more isotopic variant(s) of the compounds of general formula (I), particularly deuterium-containing compounds of general formula (I).
  • isotopic variant of a compound or a reagent is defined as a compound exhibiting an unnatural proportion of one or more of the isotopes that constitute such a compound.
  • unnatural proportion in relation to an isotope means a proportion of such isotope which is higher than its natural abundance.
  • the natural abundances of isotopes to be applied in this context are described in “Isotopic Compositions of the Elements 1997”, Pure Appl. Chem., 70(1), 217-235, 1998.
  • isotopes examples include stable and radioactive isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine, bromine and iodine, such as 2 H (deuterium), 3 H (tritium), 11 C, 13 C, 14 C 15 N, 18 O, 32 P, 33 P, 33 S, 34 S 35 S, 36 S, 18 F, 36 Cl, 82 Br, 123 I, 124 I, 125 I, 129 I and 131 I, respectively.
  • stable and radioactive isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine, bromine and iodine such as 2 H (deuterium), 3 H (tritium), 11 C, 13 C, 14 C 15 N, 18 O, 32 P, 33 P, 33 S, 34 S 35 S, 36 S, 18 F, 36 Cl, 82 Br, 123 I, 124 I, 125 I, 129 I and 131 I, respectively.
  • the isotopic variant(s) of the compounds of general formula (I) preferably contain deuterium (“deuterium-containing compounds of general formula (I)”).
  • deuterium-containing compounds of general formula (I) Isotopic variants of the compounds of general formula (I) in which one or more radioactive isotopes, such as 3 H or 14 C, are incorporated are useful e.g. in drug and/or substrate tissue distribution studies. These isotopes are particularly preferred for the ease of their incorporation and detectability.
  • Positron emitting isotopes such as 18 F or 11 C may be incorporated into a compound of general formula (I).
  • These isotopic variants of the compounds of general formula (I) are useful for in vivo imaging applications.
  • Deuterium-containing and 13 C-containing compounds of general formula (I) can be used in mass spectrometry analyses in the context of preclinical or clinical studies.
  • Isotopic variants of the compounds of general formula (I) can generally be prepared by methods known to a person skilled in the art, such as those described in the schemes and/or examples herein, by substituting a reagent for an isotopic variant of said reagent, preferably for a deuterium-containing reagent.
  • a reagent for an isotopic variant of said reagent preferably for a deuterium-containing reagent.
  • deuterium from D 2 O can be incorporated either directly into the compounds or into reagents that are useful for synthesizing such compounds.
  • Deuterium gas is also a useful reagent for incorporating deuterium into molecules. Catalytic deuteration of olefinic bonds and acetylenic bonds is a rapid route for incorporation of deuterium.
  • Metal catalysts i.e.
  • deuterated reagents and synthetic building blocks are commercially available from companies such as for example C/D/N Isotopes, Quebec, Canada; Cambridge Isotope Laboratories Inc., Andover, Mass., USA; and CombiPhos Catalysts, Inc., Princeton, N.J., USA.
  • deuterium-containing compound of general formula (I) is defined as a compound of general formula (I), in which one or more hydrogen atom(s) is/are replaced by one or more deuterium atom(s) and in which the abundance of deuterium at each deuterated position of the compound of general formula (I) is higher than the natural abundance of deuterium, which is about 0.015%.
  • the abundance of deuterium at each deuterated position of the compound of general formula (I) is higher than 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80%, preferably higher than 90%, 95%, 96% or 97%, even more preferably higher than 98% or 99% at said position(s). It is understood that the abundance of deuterium at each deuterated position is independent of the abundance of deuterium at other deuterated position(s).
  • the selective incorporation of one or more deuterium atom(s) into a compound of general formula (I) may alter the physicochemical properties (such as for example acidity [C. L. Perrin, et al., J. Am. Chem. Soc., 2007, 129, 4490], basicity [C. L. Perrin et al., J. Am. Chem. Soc., 2005, 127, 9641], lipophilicity [B. Testa et al., Int. J. Pharm., 1984, 19(3), 271]) and/or the metabolic profile of the molecule and may result in changes in the ratio of parent compound to metabolites or in the amounts of metabolites formed.
  • physicochemical properties such as for example acidity [C. L. Perrin, et al., J. Am. Chem. Soc., 2007, 129, 4490], basicity [C. L. Perrin et al., J. Am. Chem. Soc., 2005
  • Kassahun et al., WO2012/112363 are examples for this deuterium effect. Still other cases have been reported in which reduced rates of metabolism result in an increase in exposure of the drug without changing the rate of systemic clearance (e.g. Rofecoxib: F. Schneider et al., Arzneim. Forsch./Drug. Res., 2006, 56, 295; Telaprevir: F. Maltais et al., J. Med. Chem., 2009, 52, 7993). Deuterated drugs showing this effect may have reduced dosing requirements (e.g. lower number of doses or lower dosage to achieve the desired effect) and/or may produce lower metabolite loads.
  • a compound of general formula (I) may have multiple potential sites of attack for metabolism.
  • deuterium-containing compounds of general formula (I) having a certain pattern of one or more deuterium-hydrogen exchange(s) can be selected.
  • the deuterium atom(s) of deuterium-containing compound(s) of general formula (I) is/are attached to a carbon atom and/or is/are located at those positions of the compound of general formula (I), which are sites of attack for metabolizing enzymes such as e.g. cytochrome P 450 .
  • the present invention concerns a deuterium-containing compound of general formula (I) having 1, 2, 3 or 4 deuterium atoms, particularly with 1, 2 or 3 deuterium atoms.
  • stable compound or “stable structure” is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
  • the compounds of the present invention optionally contain one or more asymmetric centres, depending upon the location and nature of the various substituents desired. It is possible that one or more asymmetric carbon atoms are present in the (R) or (S) configuration, which can result in racemic mixtures in the case of a single asymmetric centre, and in diastereomeric mixtures in the case of multiple asymmetric centres. In certain instances, it is possible that asymmetry also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds.
  • Preferred isomers are those which produce the more desirable biological activity.
  • These separated, pure or partially purified isomers or racemic mixtures of the compounds of this invention are also included within the scope of the present invention.
  • the purification and the separation of such materials can be accomplished by standard techniques known in the art.
  • the optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers.
  • appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid.
  • Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation.
  • the optically active bases or acids are then liberated from the separated diastereomeric salts.
  • a different process for separation of optical isomers involves the use of chiral chromatography (e.g., HPLC columns using a chiral phase), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers.
  • Suitable HPLC columns using a chiral phase are commercially available, such as those manufactured by Daicel, e.g., Chiracel OD and Chiracel OJ, for example, among many others, which are all routinely selectable.
  • Enzymatic separations, with or without derivatisation are also useful.
  • the optically active compounds of the present invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.
  • Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention is achieved by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
  • any compound of the present invention which contains an imidazopyridine moiety as a heteroaryl group for example can exist as a 1H tautomer, or a 3H tautomer, or even a mixture in any amount of the two tautomers, namely:
  • the present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio.
  • the compounds of the present invention can exist as N-oxides, which are defined in that at least one nitrogen of the compounds of the present invention is oxidised.
  • the present invention includes all such possible N-oxides.
  • the present invention also provides useful forms of the compounds of the present invention, such as metabolites, hydrates, solvates, prodrugs, salts, in particular pharmaceutically acceptable salts, and/or co-precipitates.
  • the compounds of the present invention can exist as a hydrate, or as a solvate, wherein the compounds of the present invention contain polar solvents, in particular water, methanol or ethanol for example, as structural element of the crystal lattice of the compounds. It is possible for the amount of polar solvents, in particular water, to exist in a stoichiometric or non-stoichiometric ratio.
  • polar solvents in particular water
  • stoichiometric solvates e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-, tri-, tetra-, penta- etc. solvates or hydrates, respectively, are possible.
  • the present invention includes all such hydrates or solvates.
  • the compounds of the present invention may exist in free form, e.g. as a free base, or as a free acid, or as a zwitterion, or to exist in the form of a salt.
  • Said salt may be any salt, either an organic or inorganic addition salt, particularly any pharmaceutically acceptable organic or inorganic addition salt, which is customarily used in pharmacy, or which is used, for example, for isolating or purifying the compounds of the present invention.
  • pharmaceutically acceptable salt refers to an inorganic or organic acid addition salt of a compound of the present invention.
  • pharmaceutically acceptable salt refers to an inorganic or organic acid addition salt of a compound of the present invention.
  • S. M. Berge, et al. “Pharmaceutical Salts,” J. Pharm. Sci. 1977, 66, 1-19.
  • a suitable pharmaceutically acceptable salt of the compounds of the present invention may be, for example, an acid-addition salt of a compound of the present invention bearing a nitrogen atom, in a chain or in a ring, for example, which is sufficiently basic, such as an acid-addition salt with an inorganic acid, or “mineral acid”, such as hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfamic, bisulfuric, phosphoric, or nitric acid, for example, or with an organic acid, such as formic, acetic, acetoacetic, pyruvic, trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric, benzoic, salicylic, 2-(4-hydroxybenzoyl)-benzoic, camphoric, cinnamic, cyclopentanepropionic, digluconic, 3-hydroxy-2-naphthoic, nico
  • an alkali metal salt for example a sodium or potassium salt
  • an alkaline earth metal salt for example a calcium, magnesium or strontium salt, or an aluminium or a zinc salt
  • acid addition salts of the claimed compounds to be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods.
  • alkali and alkaline earth metal salts of acidic compounds of the present invention are prepared by reacting the compounds of the present invention with the appropriate base via a variety of known methods.
  • the present invention includes all possible salts of the compounds of the present invention as single salts, or as any mixture of said salts, in any ratio.
  • the present invention includes diastereomers, racemates, tautomers, N-oxides, hydrates, solvates, and salts of the compounds of the present invention, and mixtures of same.
  • suffixes to chemical names or structural formulae relating to salts such as “hydrochloride”, “trifluoroacetate”, “sodium salt”, or “x HCl”, “x CF 3 COOH”, “x Na + ”, for example, mean a salt form, the stoichiometry of which salt form not being specified.
  • the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorph, or as a mixture of more than one polymorph, in any ratio.
  • the present invention also includes prodrugs of the compounds according to the invention.
  • prodrugs here designates compounds which themselves can be biologically active or inactive, but are converted (for example metabolically or hydrolytically) into compounds according to the invention during their residence time in the body.
  • the present invention provides compounds of general formula (I),
  • the present invention provides compounds of general formula (I),
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which: R 1 represents a group selected from
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), supra, in which:
  • the present invention provides the compounds of general formula (I), supra, which are exemplified in the experimental section.
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of general formula (I), in which
  • the present invention provides compounds of general formula (I), in which
  • the present invention provides compounds of general formula (I), in which
  • the present invention provides compounds of general formula (I), in which
  • the present invention provides compounds of general formula (I), in which R 1 represents a indanyl group, a tetralinyl group and a monocyclic- or bicyclic heteroaryl group
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which R 4 and R 5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
  • partial formula (i) includes but is not limited thereto e.g.
  • X 1 , X 2 , X 3 , X 4 and X 5 represents a group independently selected from —N(R 7 )—, —O—, —S—, —S( ⁇ O)—, —S( ⁇ O)( ⁇ NR 14 )— and —S( ⁇ O) 2 — and
  • the present invention provides compounds of formula (I), supra, in which R 4 and R 5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
  • partial formula (i) includes but is not limited thereto e.g.
  • X 1 , X 2 , X 3 , X 4 and X 5 represents a group independently selected from —N(R 7 )—, —O—, —S—, —S( ⁇ O)— and —S( ⁇ O) 2 — and
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • R 4 and R 5 are linked to one another in such a way that they jointly form a group selected from
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • R 4 and R 5 are linked to one another in such a way that they jointly form a group selected from
  • R 4 and R 5 are linked to one another in such a way that they jointly form a group selected from
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of general formula (I),
  • the present invention provides compounds of general formula (I),
  • the present invention provides compounds of general formula (I),
  • the present invention provides compounds of general formula (I),
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, in which:
  • the present invention provides compounds of formula (I), supra, which are selected from the group consisting of:
  • the present invention provides compounds of formula (I), supra, which are selected from the group consisting of:
  • the present invention provides any sub-combination within any embodiment or aspect of the present invention of compounds of general formula (I), supra.
  • the present invention provides any sub-combination within any embodiment or aspect of the present invention of intermediate compounds of general formulae (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX), (X) and (XXI).
  • the present invention provides the compounds of general formula (I) which are disclosed in the Example Section of this text, infra.
  • the compounds according to the invention of general formula (I) can be prepared according to the following schemes 1, 2, 3, 4 and 5.
  • the schemes and procedures described below illustrate synthetic routes to the compounds of general formula (I) of the invention and are not intended to be limiting. It is clear to the person skilled in the art that the order of transformations as exemplified in schemes 1, 2, 3, 4 and 5 can be modified in various ways. The order of transformations exemplified in these schemes is therefore not intended to be limiting. In addition, interconversion of any of the substituents, R 1 , R 2 , R 3 , R 4 or R 5 can be achieved before and/or after the exemplified transformations.
  • tert-Butyl benzoates of general formula (III) can be prepared from benzoic acid derivatives of general formula (II) according to procedures available from the public domain, as understandable to the person skilled in the art.
  • tert-butyl benzoates of general formula (III) can be prepared from benzoic acid derivatives of general formula (II) by in situ formation of the corresponding acid chlorides and subsequent reaction with tert-butanol.
  • In situ formation of acid chlorides from benzoic acids of general formula (II) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide.
  • tert-butyl benzoates of general formula (V) can be accomplished by the reaction of triazolinones of general formula (IV) with tert-butyl benzoates of general formula (III) in the presence of a base.
  • a base in connection with the method of the invention, the use of 1,8-diazabicyclo[5.4.0]undec-7-ene as organic base in acetonitrile at 80° C. was preferable.
  • benzoic acids of general formula (VIII) can be accomplished by reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) in the presence of a base, and subsequent saponification of the resulting ester of general formula (VII).
  • Bases that can be employed for the reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example sodium hydride, sodium tert-butanolate, potassium tert-butanolate, or cesium carbonate.
  • potassium hexamethyldisilazide solution in tetrahydrofuran was preferrably used as organic base.
  • Solvents that can be used for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example tetrahydrofuran, dimethyl sulfoxide and N,N-dimethylformamide.
  • tertahydrofuran was preferrably used as solvent.
  • Reaction temperatures for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example ranging from room temperature to 130° C. Cooling of the reaction mixture is optionally necessary on adding the reactants or bases. In connection with the method of the invention, cooling the reaction to ⁇ 10° C. prior addition of potassium hexamethyldisilazide solution in tetrahydrofuran and subsequent running the reaction at room temperature was preferable.
  • Suitable reaction times for the reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are ranging from 1h several days.
  • tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) can also result in transesterification, such as the tert-butoxide moiety of the tert-butyl benzoates of general formula (V) can be replaced by the alkoxide R 3 CH(CH 3 )O moiety of the alcohols of general formula (VI).
  • subsequent ester hydrolysis is required.
  • Ester hydrolysis can be achieved by various methods which are well known to the person skilled in the art, for example by treatment of the esters with lithium hydroxide, sodium hydroxide or potassium hydroxide, in solvents, such as, for example water, 1,4-dioxane, ethanol or tetrahydrofuran or mixtures thereof.
  • solvents such as, for example water, 1,4-dioxane, ethanol or tetrahydrofuran or mixtures thereof.
  • the reactions can be carried out at temperatures ranging from room temperature to the boiling point of the respective solvent or solvent mixture.
  • the compounds of general formula (I) can be prepared by the reaction of the benzoic acids of general formula (VIII) with amines of general formula (X) either by
  • In situ formation of acid chlorides of general formula (IX) from benzoic acids of general formular (VIII) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide.
  • oxalyl chloride is preferably used in the presence of N,N-dimethylformamide.
  • Suitable solvents for the in situ formation of acid chlorides of general formula (IX) from benzoic acids of general formula (VIII) include aprotic nonpolar solvents such as for example dichloromethane or toluene. In connection with the method according to the invention, dichloromethane is preferably used as solvent.
  • Suitable reaction temperatures for the in situ formation of acid chlorides of general formula (IX) from benzoic acids of general formula (VIII) mostly reflect the boiling point of the solvents used in the reaction.
  • adding of oxalyl chloride was carried out at 0° C. and the reaction mixture was subsequently allowed to warm up to room temperature.
  • organic bases are for example triethylamine, pyridine or N-ethyl-N,N-diisopropylamine.
  • triethylamine was preferably used as organic base.
  • Suitable solvents for the reaction of acid chlorides of general formula (IX) with amines of general formula (X) include aprotic polar solvents such as for example acetonitrile, N,N-dimethylformamide or aprotic nonpolar solvents such as dichloromethane. In connection with the method according to the invention dichoromethane was used as solvent.
  • Suitable coupling reagents for the reaction of benzoic acids of general formula (VIII) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
  • HATU O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate
  • dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide
  • Suitable organic bases for the amide coupling of benzoic acids of general formula (VIII) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine or triethylamine.
  • Suitable solvents for the for the amide coupling of benzoic acids of general formula (VIII) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
  • Nitriles of general formula (XII) can be prepared from nitriles of general formula (XI) and with alcohols of general formula (VI) according to procedures available from the public domain, as understandable to the person skilled in the art.
  • benzoates of general formula (XIII) can be accomplished by hydrolysis of nitriles of general formula XII using strong acids or bases.
  • the compounds of general formula (XV) can be prepared by the reaction of the benzoic acids of general formula (XIII) with amines of general formula (X) either by
  • In situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formular (XIII) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide.
  • oxalyl chloride is preferably used in the presence of N,N-dimethylformamide.
  • Suitable solvents for the in situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formula (XIII) include aprotic nonpolar solvents such as for example dichloromethane or toluene. In connection with the method according to the invention, dichloromethane is preferably used as solvent.
  • Suitable reaction temperatures for the in situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formula (XIII) mostly reflect the boiling point of the solvents used in the reaction.
  • adding of oxalyl chloride was carried out at 0° C. and the reaction mixture was subsequently allowed to warm up to room temperature.
  • organic bases are for example triethylamine, pyridine or N-ethyl-N,N-diisopropylamine.
  • triethylamine was preferably used as organic base.
  • Suitable solvents for the reaction of acid chlorides of general formula (XIV) with amines of general formula (X) include aprotic polar solvents such as for example acetonitrile, N,N-dimethylformamide or aprotic nonpolar solvents such as dichloromethane. In connection with the method according to the invention dichoromethane was used as solvent.
  • Suitable coupling reagents for the reaction of benzoic acids of general formula (XIII) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
  • HATU O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate
  • dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide
  • Suitable organic bases for the amide coupling of benzoic acids of general formula (XIII) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine or triethylamine.
  • Suitable solvents for the for the amide coupling of benzoic acids of general formula (XIII) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
  • allylpalladium chloride dimer dichlorobis(benzonitrile)palladium (II), palladium (II) acetate, palladium (II) chloride, tetrakis(triphenylphosphine)palladium (O), tris(dibenzylideneacetone)dipalladium (O), chloro(2′-amino-1,1′-biphenyl-2-yl)palladium(II) dimer, (2′-amino-1,1′-bipheny-2-yl)methanesulfonatopalladium(II) dimer, trans-di(p-acetato)bis[o-(di-o-tolylphosphino)benzyl]dipalladium(II) [cataCXium® C], allylchloro[1,3-bis(2,4,6-trimethylphenyl)imidazol-2-ylidene]palladium(II),
  • Nitriles of general formula (XVII) can be prepared from nitriles of general formula (XVI) and triazolinones of general formula (IV) in the presence of a base.
  • the use of potassium carbonate as base in acetonitrile at 80° C. was preferable.
  • benzoates of general formula (XVIII) can be accomplished by hydrolysis of nitriles of general formula XVII using strong acids or bases.
  • the use of sodium hydroxide in ethanol at 85° C. was preferable.
  • the compounds of general formula (XIX) can be prepared by the reaction of the benzoic acids of general formula (XVIII) with amines of general formula (X) by amide coupling.
  • Suitable coupling reagents for the reaction of benzoic acids of general formula (XVIII) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
  • HATU O-(7-aza-1H-benzotriazol-1-yl)-N,N,N′-tetramethyluronium hexafluorophosphate
  • dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochlor
  • Suitable organic bases for the amide coupling of benzoic acids of general formula (XVIII) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine, N-methylpyrollidine, or triethylamine.
  • Suitable solvents for the for the amide coupling of benzoic acids of general formula (XVIII) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
  • the formation of compounds of general formula (I) can be accomplished by reaction of amides of general formula (XIX) and alcohols of general formula (VI) in the presence of a base.
  • Bases that can be employed for the reaction of amides of general formula (XIX) with alcohols of general formula (VI) are for example sodium hydride, sodium tert-butanolate, potassium tert-butanolate, or cesium carbonate.
  • sodium hydride was preferrably used as organic base.
  • Solvents that can be used for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example tetrahydrofuran, dimethyl sulfoxide and N,N-dimethylformamide. In connection with the method according to the invention N,N-dimethylformamide was preferrably used as solvent.
  • Reaction temperatures for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example ranging from room temperature to 80° C.
  • the reaction of alcohols of general formula (VI) with sodium hydride was preferably performed at room temperature for 1h before addition of amides of formula (XIX) and subsequent heating of the reaction mixture to 80° C.
  • Suitable reaction times for the reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are ranging from 3h to several days.
  • Amides of general formula (XX) can be prepared by the reaction of the benzoic acids of general formula (II) with amines of general formula (X) by amide coupling.
  • Suitable coupling reagents for the reaction of benzoic acids of general formula (II) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
  • HATU O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate
  • dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide
  • Suitable organic bases for the amide coupling of benzoic acids of general formula (II) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine, N-methylpyrollidine, or triethylamine.
  • Suitable solvents for the for the amide coupling of benzoic acids of general formula (II) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
  • amides of general formula (XX) can be prepared from benzoic acid derivatives of general formula (II) by in situ formation of the corresponding acid chlorides and subsequent reaction with amines of general formula (X).
  • In situ formation of acid chlorides from benzoic acids of general formula (II) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide.
  • the formation of compounds of general formula (I) can be accomplished by reaction of amides of general formula (XIX) and alcohols of general formula (VI) in the presence of a base.
  • Bases that can be employed for the reaction of amides of general formula (XIX) with alcohols of general formula (VI) are for example sodium hydride, sodium tert-butanolate, potassium tert-butanolate, or cesium carbonate.
  • sodium hydride was preferrably used as organic base.
  • Solvents that can be used for the reactions of amides of general formula (XIX) with alcohols of general formula (VI) are for example tetrahydrofuran, dimethyl sulfoxide and N,N-dimethylformamide. In connection with the method according to the invention N,N-dimethylformamide was preferrably used as solvent.
  • Reaction temperatures for the reactions of amides of general formula (XIX) with alcohols of general formula (VI) are for example ranging from room temperature to 140° C.
  • the reaction of alcohols of general formula (VI) with sodium hydride was preferably performed at room temperature for 1h before addition of amides of formula (XIX) and subsequent heating of the reaction mixture to 80° C.
  • Suitable reaction times for the reaction of amides of general formula (XIX) with alcohols of general formula (VI) are ranging from 3h to several days.
  • benzoates of general formula (VIII) can be accomplished by hydrolysis of nitriles of general formula XXI using strong acids or bases.
  • the use of sulphuric acid, acetic acid and water at 120° C. was preferable.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (VIII):
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (IX):
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (VII)
  • the present invention provides the intermediate compound of general formula (VIII)
  • the present invention provides the use of the intermediate compound (VII) in which R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) as defined supra for the production of a compound of general formula (I).
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XV):
  • R 1 , R 2 and R 3 are as defined for the compound of general formula (I) as defined supra, and A represents a chlorine, bromine or iodine atom, to react with a compound of general formula (IV):
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XVIII)
  • R 1 , R 2 , R 4 and R 5 are as defined supra.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XX)
  • R 1 , R 2 , R 4 and R 5 are as defined for the compound of general formula (I) as defined supra.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XIX)
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra,
  • said methods comprise the step of allowing an intermediate compound of general formula (VIII)
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra, then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (IX)
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra, then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XV)
  • R 1 , R 2 and R 3 are as defined for the compound of general formula (I) as defined supra, and A represents a chlorine, bromine or iodine atom, to react with a compound of general formula (IV):
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra, then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
  • the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XIX)
  • R 1 , R 2 , R 3 , R 4 and R 5 are as defined supra, then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
  • the present invention provides methods of preparing compounds of the present invention of general formula (I), said methods comprising the steps as described in the Experimental Section herein.
  • the present invention provides intermediate compounds which are useful for the preparation of the compounds of general formula (I), supra.
  • R 3 is as defined for the compound of general formula (I) supra.
  • R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) supra.
  • R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) supra.
  • R 1 , R 2 and R 3 are as defined for the compound of general formula (I) supra, and A represents a chlorine, bromine or iodine atom.
  • R 1 , R 2 , R 4 and R 5 are as defined for the compound of general formula (I) supra.
  • R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) supra.
  • the present invention provides the use of said intermediate compounds for the preparation of a compound of general formula (I) as defined supra.
  • R 3 is as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
  • R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
  • R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
  • the invention provides the use of intermediate compounds of general formula (X): R 1 —NH 2 (X), in which R 1 is as defined for the compound of general formula (I) as defined supra, for the preparation of a compound of general formula (I) as defined supra.
  • R 1 , R 2 and R 3 are as defined for the compound of general formula (I) supra, and A represents a chlorine, bromine or iodine atom, for the preparation of a compound of general formula (I) as defined supra.
  • R 2 , R 4 and R 5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
  • R 1 , R 2 , R 4 and R 5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
  • R 1 and R 2 are as defined for the compound of general formula (I) as defined supra, for the preparation of a compound of general formula (I) as defined supra.
  • R 2 , R 3 , R 4 and R 5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
  • the present invention provides methods of preparing compounds of the present invention of general formula (I),
  • the present invention provides methods of preparing compounds of the present invention of general formula (I),
  • the present invention provides methods of preparing compounds of the present invention of general formula (I),
  • the present invention provides methods of preparing compounds of the present invention of general formula (I), as defined in any previous aspect, said methods comprising the step of reacting a compound of general formula (Ia)
  • R 1 , R 2 and R 3 are as defined in any embodiment or aspect supra and R 4 and R 5 are linked to one another in such a way that they jointly form a group selected from
  • a compound of formula (la-2) with a microorganism such as a e.g. a modified E. coli hosting a suitable plasmid, such as a nucleic acid sequence of Seq. ID. No.1 or Seq. ID. No.2, or a fungus and subsequently harvesting the culture and isolating the reaction product after a suitable reaction time to obtain a compound of formula (Ib) wherein R 1 , R 2 and R 3 are as defined in any embodiment or aspect supra and R 4 and R 5 are linked to one another in such a way that they jointly form a group selected from a microorganism such as a e.g. a modified E. coli hosting a suitable plasmid, such as a nucleic acid sequence of Seq. ID. No.1 or Seq. ID. No.2, or a fungus and subsequently harvesting the culture and isolating the reaction product after a suitable reaction time to obtain a compound of formula (Ib) wherein R 1 , R
  • the present invention provides methods of preparing compounds of the present invention of general formula (I), as defined in any previous aspect, said methods comprising the step of reacting a compound of general formula (Ia)
  • R 1 , R 2 and R 3 are as defined in any aspect or embodiment defined supra and R 4 and R 5 are linked to one another in such a way that they jointly form a group selected from
  • the process as described above further comprises subsequently harvesting the culture and isolating the reaction product after a suitable reaction time.
  • the present invention provides methods of preparing a compound of formula (I), wherein the suitable medium is a suitable nutrition solution comprising a buffer and an aqueous sugar solution.
  • the present invention provides methods of preparing a compound of formula (I), wherein the suitable medium is a suitable nutrition solution comprising a buffer such as an aqueous phosphatebuffer solution e.g. a potassiumdihydrogenphosphate/potassiumhydrogenphosphate buffer, a sodiumdihydrogenphosphate/sodiumhydrogenphosphate buffer, particularly a potassiumdihydrogenphosphate/potassiumhydrogenphosphate buffer and an aqueous sugar solution such as e.g. an aqueous glucose solution optionally further comprising an aqueous solution of a complexing agent such as e.g. ethylendiamintetraacetate.
  • a buffer such as an aqueous phosphatebuffer solution e.g. a potassiumdihydrogenphosphate/potassiumhydrogenphosphate buffer, a sodiumdihydrogenphosphate/sodiumhydrogenphosphate buffer, particularly a potassiumdihydrogenphosphate/potassiumhydrogenphosphate buffer and an aqueous sugar solution
  • the present invention provides methods of preparing a compound of formula (I), as disclosed supra and optionally further comprising aeration of the culture thus providing aerobic reaction conditions.
  • the present invention provides methods of preparing a compound of formula (I), as disclosed supra and further comprising the steps of harvesting the culture after a suitable reaction time such as e.g. 3-6h, particularly 3-4h and isolating the product.
  • the present invention provides methods of preparing a compound of formula (I), which are example compounds 293-296
  • glucose solution at a temperature range of 20-30° C., particularly 25°-30° C., the ranges including the lower and upper limit temperature, more particularly 27° C. under aerobic conditions and subsequently harvesting the culture and isolating the reaction product after a suitable reaction time, such as 3-6 h, particularly 3-4 h.
  • the present invention provides methods of preparing a compound of formula (I), which are example compounds 293-296 under the conditions as described in example 293.
  • a further embodiment of the invention is the compound of formula (I) obtained by the method disclosed supra.
  • a further aspect of the invention is the nucleic acid sequence of Seq. ID. No.1., plasmid 1 of example 293.
  • Yet another aspect of the invention is the nucleic acid sequence of Seq ID. No.2, plasmid 2 of example 293.
  • a further aspect is the use of a plasmid of Seq. ID. No. 1 and/or Seq. ID. No.2 for the production of a mircoorganism suitable for a hydroxylation reaction, preferably the hydroxylation of a compound of formula (I), more preferably a compound of formula (Ia), even more preferably a compound of formula (la-2).
  • a further aspect is the use of nucleic acid sequence Seq. ID No. 1 or nucleic acid sequence Seq. ID No. 2
  • a further aspect is the use of a plasmid of Seq. ID. No. 1 and/or Seq.D.no. 2 for the production of a mircoorganism suitable for the production of a compound of formula (I).
  • a further aspect is the use of a plasmid of Seq. ID. No. 1 and/or Seq. ID.no. 2 for the production of a mircoorganism suitable for the production of a compound of formula (I), more particularly a hydroxylated compound of formula (I), even more particularly a hydroxylated compound of formula (I) in which
  • Another aspect of the invention is a compound of formula (I), particularly a compound of formula (Ib) more particularly the compounds of examples 293-296 obtained by a method as described herein.
  • the present invention provides the use of the intermediate compounds of general formula (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX) and (XXI) which are disclosed in the Example Section of this text, infra.
  • the present invention provides the intermediate compounds which are disclosed in the Example Section of this text, infra.
  • the present invention provides the intermediate compounds of general formula (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX) and (XXI) which are disclosed in the Example Section of this text, infra.
  • the present invention provides any sub-combination within any embodiment or aspect of the present invention of intermediate compounds of general formula (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX) and (XXI), supra.
  • the compounds of general formula (I) of the present invention can be converted to any salt, preferably pharmaceutically acceptable salts, as described herein, by any method which is known to the person skilled in the art.
  • any salt of a compound of general formula (I) of the present invention can be converted into the free compound, by any method which is known to the person skilled in the art.
  • Compounds of general formula (I) of the present invention demonstrate a valuable pharmacological spectrum of action, which could not have been predicted.
  • Compounds of the present invention have surprisingly been found to effectively inhibit DHODH and it is possible therefore that said compounds be used for the treatment or prophylaxis of diseases, preferably hyperproliferative and/or inflammatory disorders in humans and animals.
  • Compounds of the present invention can be utilized to inhibit the activity of DHODH.
  • This method comprises administering to a mammal in need thereof, including a human, an effective amount of a compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, for the treatment of hyperproliferative and/or inflammatory disorders.
  • Another aspect of the invention is a method of inhibiting proliferation of a cell, comprising contacting the cell with a compound of formula (I).
  • Hyperproliferative disorders include, but are not limited to, for example: psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH), solid tumours, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases.
  • BPH benign prostate hyperplasia
  • solid tumours such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases.
  • Those disorders also include sarcomas, and haematological malignancies including but not limiting to leukemias, lymphomas, multiple myeolomas.
  • breast cancers include, but are not limited to, invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.
  • cancers of the respiratory tract include, but are not limited to, small-cell and non-small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.
  • brain cancers include, but are not limited to, brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumour.
  • Tumours of the male reproductive organs include, but are not limited to, prostate and testicular cancer.
  • Tumours of the female reproductive organs include, but are not limited to, endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.
  • Tumours of the digestive tract include, but are not limited to, anal, colon, colorectal, oesophageal, gallbladder, gastric, pancreatic, rectal, small-intestine, and salivary gland cancers.
  • Tumours of the urinary tract include, but are not limited to, bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.
  • Eye cancers include, but are not limited to, intraocular melanoma and retinoblastoma.
  • liver cancers include, but are not limited to, hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.
  • Skin cancers include, but are not limited to, squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.
  • Head-and-neck cancers include, but are not limited to, laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell.
  • Lymphomas include, but are not limited to, AIDS-related lymphoma, chronic lymphocytic lymphoma (CLL), non-Hodgkin's lymphoma (NHL), T-non-Hodgkin lymphoma (T-NHL), subtypes of NHL such as Diffuse Large Cell Lymphoma (DLBCL), activated B-cell DLBCL, germinal center B-cell lymphoma DLBCL, double-hit lymphoma and double-expressor lymphoma; anaplastic large cell lymphoma, B-cell lymphoma, cutaneous T-cell lymphoma, Burkitt's lymphoma, follicular lymphoma, hairy cell lymphoma, Hodgkin's disease, mantle cell lymphoma (MCL), lymphoma of the central nervous system, small lymphocytic lymphoma and chronic lymphocytic lymphoma and Sezary syndrome.
  • CLL chronic lymphocytic
  • Sarcomas include, but are not limited to, sarcoma of the soft tissue, gliosarcoma, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma.
  • Leukemias include, but are not limited to acute lymphoblastic leukemia, acute myeloid leukemia, (acute) T-cell leukemia, acute lymphoblastic leukemia, acute lymphocytic leukemia (ALL), acute monocytic leukemia (AML), acute promyelocytic leukemia, bisphenotypic B myelomonocytic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia (CMML), large granular lymphocytic leukemia, plasma cell leukemia, and also myelodysplastic syndrome (MDS), which can develop into an acute myeloid leukemia.
  • ALL acute lymphoblastic leukemia
  • ALL acute lymphocytic leukemia
  • AML acute monocytic leukemia
  • AML acute promyelocytic leukemia
  • Inhibition of DHODH can also lead to differentiation of tumor initiating cells in hematological and solid cancers, especially leukemias.
  • the present invention also provides methods of treating angiogenic disorders including diseases associated with excessive and/or abnormal angiogenesis.
  • Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism.
  • a number of pathological conditions are associated with the growth of extraneous blood vessels. These include, for example, diabetic retinopathy, ischemic retinal-vein occlusion, and retinopathy of prematurity [Aiello et al., New Engl. J. Med., 1994, 331, 1480; Peer et al., Lab. Invest., 1995, 72, 638], age-related macular degeneration (AMD) [Lopez et al., Invest. Opththalmol. Vis.
  • AMD age-related macular degeneration
  • neovascular glaucoma neovascular glaucoma
  • psoriasis retrolental fibroplasias
  • angiofibroma inflammation
  • RA rheumatoid arthritis
  • restenosis in-stent restenosis
  • vascular graft restenosis etc.
  • the increased blood supply associated with cancerous and neoplastic tissue encourages growth, leading to rapid tumour enlargement and metastasis.
  • the growth of new blood and lymph vessels in a tumour provides an escape route for renegade cells, encouraging metastasis and the consequence spread of the cancer.
  • compounds of general formula (I) of the present invention can be utilized to treat and/or prevent any of the aforementioned angiogenesis disorders, for example by inhibiting and/or reducing blood vessel formation; by inhibiting, blocking, reducing, decreasing, etc. endothelial cell proliferation, or other types involved in angiogenesis, as well as causing cell death or apoptosis of such cell types.
  • Another aspect of the invention is a method for controlling cancer in humans and animals by administering an effective amount of at least one compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, or of a medicament, comprising at least one compound of general formula (I) of the present invention.
  • Another aspect of the invention is a method for controlling cancer (e.g., through treatment prophylaxis, etc.) in a subject (e.g., human, rat, etc.) by administering an effective amount of at least one compound of general formula (I), or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof to the subject.
  • the subject may be administered a medicament, comprising at least one compound of general formula (I) and one or more pharmaceutically acceptable carriers, excipients, and/or diluents.
  • the method of treatment and/or prophylaxis of a hyperproliferative disorder in a subject may comprise administering to the subject an effective amount of a compound of general formula (I).
  • the hyperproliferative disorder may be, for example, cancer (e.g. but not limited to lung cancer, acute myeloid leukemia, lymphoma, glioblastoma, prostate cancer, etc.).
  • a method of inhibiting dihydroorotate dehydrogenase activity in a cancer cell comprises contacting a cancer cell with a compound of general formula (I).
  • the cancer cell may be in vitro or in vivo.
  • Another aspect of the invention is a method of treating lymphoma in a subject, the method comprising administering to the subject an effective amount of a compound of general formula (I).
  • a yet other aspect of the invention is a method of treating leukemia in a subject, the method comprising administering to the subject an effective amount of a compound of general formula (I).
  • the present invention provides the use of a compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, for the preparation of a medicament for the treatment or prophylaxis of a disease.
  • the present invention provides methods of treating cancer, which cancer is selected from a solid tumor such as e.g. lung cancer, glioblastoma, and prostate cancer, leukemia such as e.g. acute myeloid leukemia and lymphoma.
  • a solid tumor such as e.g. lung cancer, glioblastoma, and prostate cancer
  • leukemia such as e.g. acute myeloid leukemia and lymphoma.
  • the present invention provides methods of treating cancer, which cancer is selected from lung cancer, leukemia, lymphoma, glioblastoma, and prostate cancer.
  • the present invention provides methods of treating cancer, which cancer is selected from lung cancer, acute myeloid leukemia, lymphoma, glioblastoma, and prostate cancer.
  • the present invention provides the use of a compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, for the treatment of cancer, which cancer is selected from lung cancer, acute myeloid leukemia, lymphoma, glioblastoma, and prostate cancer.
  • the present invention provides methods of treating or preventing a disease or condition associated with inflammation, a metabolic disorder, infection or an immune disease or condition by administering to a subject having such a condition or disease, a therapeutically effective amount of a compound or composition of the invention.
  • diseases or conditions including chronic diseases, of humans or other species can be treated or prevented by inhibition of DHODH.
  • diseases or conditions include (1) inflammatory or allergic diseases such as systemic anaphylaxis and hypersensitivity responses, drug allergies, insect sting allergies and food allergies, (2) inflammatory bowel diseases, such as Crohn's disease, ulcerative colitis, ileitis and enteritis, (3) vaginitis, (4) psoriasis and inflammatory dermatoses such as dermatitis, eczema, atopic dermatitis, allergic contact dermatitis and urticaria, (5) vasculitis, (6) spondyloarthropathies, (7) scleroderma, (8) asthma and respiratory allergic diseases such as allergic asthma, allergic rhinitis, allergic conjunctivitis, hypersensitivity lung diseases and the like, and (9) autoimmune diseases, such as arthritis (including rheumatoid and psoriatic), systemic lupus erythemato
  • the present invention provides methods of treating or preventing viral infections.
  • the present invention provides methods of treating or preventing Malaria.
  • treating or “treatment” as stated throughout this document is used conventionally, for example the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of a disease or disorder, such as a carcinoma.
  • the compounds of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.
  • chemotherapeutic agents and/or anti-cancer agents in combination with a compound or pharmaceutical composition of the present invention will serve to:
  • the compounds of general formula (I) of the present invention can also be used in combination with radiotherapy and/or surgical intervention.
  • the compounds of general formula (I) of the present invention may be used to sensitize a cell to radiation, i.e. treatment of a cell with a compound of the present invention prior to radiation treatment of the cell renders the cell more susceptible to DNA damage and cell death than the cell would be in the absence of any treatment with a compound of the present invention.
  • the cell is treated with at least one compound of general formula (I) of the present invention.
  • the present invention also provides a method of killing a cell, wherein a cell is administered one or more compounds of the present invention in combination with conventional radiation therapy.
  • the present invention also provides a method of rendering a cell more susceptible to cell death, wherein the cell is treated with one or more compounds of general formula (I) of the present invention prior to the treatment of the cell to cause or induce cell death.
  • the cell is treated with at least one compound, or at least one method, or a combination thereof, in order to cause DNA damage for the purpose of inhibiting the function of the normal cell or killing the cell.
  • a cell is killed by treating the cell with at least one DNA damaging agent, i.e. after treating a cell with one or more compounds of general formula (I) of the present invention to sensitize the cell to cell death, the cell is treated with at least one DNA damaging agent to kill the cell.
  • DNA damaging agents useful in the present invention include, but are not limited to, chemotherapeutic agents (e.g. cis platin), ionizing radiation (X-rays, ultraviolet radiation), carcinogenic agents, and mutagenic agents.
  • a cell is killed by treating the cell with at least one method to cause or induce DNA damage.
  • methods include, but are not limited to, activation of a cell signalling pathway that results in DNA damage when the pathway is activated, inhibiting of a cell signalling pathway that results in DNA damage when the pathway is inhibited, and inducing a biochemical change in a cell, wherein the change results in DNA damage.
  • a DNA repair pathway in a cell can be inhibited, thereby preventing the repair of DNA damage and resulting in an abnormal accumulation of DNA damage in a cell.
  • a compound of general formula (I) of the present invention is administered to a cell prior to the radiation or other induction of DNA damage in the cell.
  • a compound of general formula (I) of the present invention is administered to a cell concomitantly with the radiation or other induction of DNA damage in the cell.
  • a compound of general formula (I) of the present invention is administered to a cell immediately after radiation or other induction of DNA damage in the cell has begun.
  • the cell is in vitro. In another embodiment, the cell is in vivo.
  • the present invention provides compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, for use in the treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders.
  • the present invention provides compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, for use in the treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
  • the pharmaceutical activity of the compounds according to the invention can be explained by their activity as DHODH inhibitors.
  • the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, for the treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders.
  • the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, for the treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
  • the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, in a method of treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders, particularly cancer.
  • the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, in a method of treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
  • the present invention provides the use of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the preparation of a medicament, for the prophylaxis or treatment of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
  • diseases in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
  • the present invention provides use of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the preparation of a pharmaceutical composition, for the prophylaxis or treatment of diseases, in particular hyperproliferative and/or inflammatory disorders.
  • the present invention provides use of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the preparation of a pharmaceutical composition, preferably a medicament, for the prophylaxis or treatment of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
  • a pharmaceutical composition preferably a medicament
  • the present invention provides a method of treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders, comprising administering an effective amount of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same.
  • a compound of general formula (I) as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same.
  • the present invention provides a method of treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer, comprising administering an effective amount of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same.
  • a compound of general formula (I) as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same.
  • the present invention provides pharmaceutical compositions, in particular a medicament, comprising a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt, or a mixture of same, and one or more excipients), in particular one or more pharmaceutically acceptable excipient(s).
  • a medicament comprising a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt, or a mixture of same, and one or more excipients), in particular one or more pharmaceutically acceptable excipient(s).
  • Conventional procedures for preparing such pharmaceutical compositions in appropriate dosage forms can be utilized.
  • the present invention furthermore provides pharmaceutical compositions, in particular medicaments, which comprise at least one compound according to the invention, conventionally together with one or more pharmaceutically suitable excipients, and to their use for the above mentioned purposes.
  • the compounds according to the invention prefferably have systemic and/or local activity.
  • they can be administered in a suitable manner, such as, for example, via the oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, vaginal, dermal, transdermal, conjunctival, otic route or as an implant or stent.
  • the compounds according to the invention for oral administration, it is possible to formulate the compounds according to the invention to dosage forms known in the art that deliver the compounds of the invention rapidly and/or in a modified manner, such as, for example, tablets (uncoated or coated tablets, for example with enteric or controlled release coatings that dissolve with a delay or are insoluble), orally-disintegrating tablets, films/wafers, films/lyophylisates, capsules (for example hard or soft gelatine capsules), sugar-coated tablets, granules, pellets, powders, emulsions, suspensions, aerosols or solutions. It is possible to incorporate the compounds according to the invention in crystalline and/or amorphised and/or dissolved form into said dosage forms.
  • Parenteral administration can be effected with avoidance of an absorption step (for example intravenous, intraarterial, intracardial, intraspinal or intralumbal) or with inclusion of absorption (for example intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal).
  • absorption step for example intravenous, intraarterial, intracardial, intraspinal or intralumbal
  • absorption for example intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal.
  • Administration forms which are suitable for parenteral administration are, inter alia, preparations for injection and infusion in the form of solutions, suspensions, emulsions, lyophylisates or sterile powders.
  • Examples which are suitable for other administration routes are pharmaceutical forms for inhalation [inter alia powder inhalers, nebulizers], nasal drops, nasal solutions, nasal sprays; tablets/films/wafers/capsules for lingual, sublingual or buccal administration; suppositories; eye drops, eye ointments, eye baths, ocular inserts, ear drops, ear sprays, ear powders, ear-rinses, ear tampons; vaginal capsules, aqueous suspensions (lotions, mixturae agitandae), lipophilic suspensions, emulsions, ointments, creams, transdermal therapeutic systems (such as, for example, patches), milk, pastes, foams, dusting powders, implants or stents.
  • inhalation inter alia powder inhalers, nebulizers
  • nasal drops nasal solutions, nasal sprays
  • tablets/films/wafers/capsules for lingual, sublingual or buccal
  • the compounds according to the invention can be incorporated into the stated administration forms. This can be effected in a manner known per se by mixing with pharmaceutically suitable excipients.
  • Pharmaceutically suitable excipients include, inter alia,
  • the present invention furthermore relates to a pharmaceutical composition which comprise at least one compound according to the invention, conventionally together with one or more pharmaceutically suitable excipient(s), and to their use according to the present invention.
  • the present invention provides pharmaceutical combinations, in particular medicaments, comprising at least one compound of general formula (I) of the present invention and at least one or more further active ingredients, in particular for the treatment and/or prophylaxis of a hyperproliferative disorder, particularly cancer.
  • the present invention provides a pharmaceutical combination, which comprises:
  • a “fixed combination” in the present invention is used as known to persons skilled in the art and is defined as a combination wherein, for example, a first active ingredient, such as one or more compounds of general formula (I) of the present invention, and a further active ingredient are present together in one unit dosage or in one single entity.
  • a “fixed combination” is a pharmaceutical composition wherein a first active ingredient and a further active ingredient are present in admixture for simultaneous administration, such as in a formulation.
  • Another example of a “fixed combination” is a pharmaceutical combination wherein a first active ingredient and a further active ingredient are present in one unit without being in admixture.
  • a non-fixed combination or “kit-of-parts” in the present invention is used as known to persons skilled in the art and is defined as a combination wherein a first active ingredient and a further active ingredient are present in more than one unit.
  • a non-fixed combination or kit-of-parts is a combination wherein the first active ingredient and the further active ingredient are present separately. It is possible for the components of the non-fixed combination or kit-of-parts to be administered separately, sequentially, simultaneously, concurrently or chronologically staggered.
  • the compounds of the present invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutically active ingredients where the combination causes no unacceptable adverse effects.
  • the present invention also provides such pharmaceutical combinations.
  • the compounds of the present invention can be combined with known anti-cancer agents.
  • anti-cancer agents examples include:
  • 131I-chTNT abarelix, abiraterone, aclarubicin, adalimumab, ado-trastuzumab emtansine, afatinib, aflibercept, aldesleukin, alectinib, alemtuzumab, alendronic acid, alitretinoin, altretamine, amifostine, aminoglutethimide, hexyl aminolevulinate, amrubicin, amsacrine, anastrozole, ancestim, anethole dithiolethione, anetumab ravtansine, angiotensin II, antithrombin III, aprepitant, arcitumomab, arglabin, arsenic trioxide, asparaginase, atezolizumab, axitinib, azacitidine, basiliximab, belotecan, bendamustine,
  • the effective dosage of the compounds of the present invention can readily be determined for treatment of each desired indication.
  • the amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
  • the total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day.
  • Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing.
  • drug holidays in which a patient is not dosed with a drug for a certain period of time, to be beneficial to the overall balance between pharmacological effect and tolerability. It is possible for a unit dosage to contain from about 0.5 mg to about 1500 mg (e.g.
  • the average daily dosage for administration by injection will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily.
  • the transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg.
  • the average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
  • the total amount of the active ingredient to be administered will generally range from 0.001 mg/kg to 200 mg/kg body weight per day, and preferably from 0.01 mg/kg to 20 mg/kg body weight per day.
  • Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing.
  • drug holidays in which a patient is not dosed with a drug for a certain period of time, to be beneficial to the overall balance between pharmacological effect and tolerability. It is possible for a unit dosage to contain from 0.5 mg to 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day.
  • the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like.
  • the desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
  • NMR peak forms are stated as they appear in the spectra, possible higher order effects have not been considered.
  • the 1 H-NMR data of selected examples are listed in the form of 1 H-NMR peaklists.
  • the ⁇ value in ppm is given, followed by the signal intensity, reported in round brackets.
  • the ⁇ value-signal intensity pairs from different peaks are separated by commas. Therefore, a peaklist is described by the general form: ⁇ 1 (intensity 1 ), ⁇ 2 (intensity 2 ), . . . , ⁇ i (intensity i ), . . . , ⁇ n (intensity n ).
  • a 1 H-NMR peaklist is similar to a classical 1 H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical 1 H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of target compounds (also the subject of the invention), and/or peaks of impurities.
  • the peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compounds (e.g., with a purity of >90%).
  • Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify the reproduction of our manufacturing process on the basis of “by-product fingerprints”.
  • An expert who calculates the peaks of the target compounds by known methods can isolate the peaks of target compounds as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical H-NMR interpretation.
  • Chemical names were generated using the ACD/Name software from ACD/Labs. In some cases generally accepted names of commercially available reagents were used in place of ACD/Name generated names.
  • the compounds and intermediates produced according to the methods of the invention may require purification. Purification of organic compounds is well known to the person skilled in the art and there may be several ways of purifying the same compound. In some cases, no purification may be necessary. In some cases, the compounds may be purified by crystallization.
  • impurities may be stirred out using a suitable solvent.
  • the compounds may be purified by chromatography, particularly flash column chromatography, using for example prepacked silica gel cartridges, e.g. Biotage SNAP cartidges KP-Sil® or KP-NH® in combination with a Biotage autopurifier system (SP4® or Isolera Four®) and eluents such as gradients of hexane/ethyl acetate or DCM/methanol.
  • the compounds may be purified by preparative HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
  • a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
  • purification methods as described above can provide those compounds of the present invention which possess a sufficiently basic or acidic functionality in the form of a salt, such as, in the case of a compound of the present invention which is sufficiently basic, a trifluoroacetate or formate salt for example, or, in the case of a compound of the present invention which is sufficiently acidic, an ammonium salt for example.
  • a salt of this type can either be transformed into its free base or free acid form, respectively, by various methods known to the person skilled in the art, or be used as salts in subsequent biological assays. It is to be understood that the specific form (e.g. salt, free base etc.) of a compound of the present invention as isolated and as described herein is not necessarily the only form in which said compound can be applied to a biological assay in order to quantify the specific biological activity.
  • aqueous solution was then adjusted to pH 5 with 1 M aqueous hydrochloric acid and concentrated under reduced pressure.
  • the residue was purified by reversed phase column chromatography (Biotage® SNAP ULTRA C18, water, acetonitrile 0-40%) to yield the product as a beige solid (1.9 g, 86%).
  • the mixture was poured onto ice water and extracted with diethyl ether (3 ⁇ 50 ml), after which the combined organic extracts were washed with 2.0 M aqueous sodium hydroxide (4 ⁇ 25 ml).
  • the resulting aq. layer was acidified to pH 2.5 with concentrated aqueous hydrochloric acid and extracted with diethyl ether (3 ⁇ 50 ml).
  • the combined organic extracts were dried over sodium sulfate, filtered and concentrated under reduced pressure to give the acid as an off white solid (1.07 g, 98% purity, 89%).
  • the mixture was poured onto ice water and extracted with diethyl ether (3 ⁇ 100 ml), after which the combined organic extracts were washed with 2.0 M aqueous sodium hydroxide (4 ⁇ 50 ml).
  • the resulting aqueous layer was acidified to pH 2.5 with concentrated hydrochloric acid and extracted with diethyl ether (3 ⁇ 100 ml).
  • the combined organic extracts were dried over sodium sulfate, filtered and concentrated under reduced pressure to give the acid as a beige solid (2.1 g, 85% purity, 65%). The material was used in the next step without further purification.
  • the organic phase was discarded, and the aqueous phase was then adjusted to an acidic pH using 1 N aqueous hydrochloric acid and extracted with ethyl acetate.
  • the organic phases were dried over sodium sulfate and concentrated under reduced pressure to yield the crude product (0.73 g, 80%-UV), which was used without further purification.
  • Examples 2-23 were prepared as described for example 1 from 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (intermediate 16) and the respective amines, as indicated. Products were purified by flash column chromatography or, if explicitly mentioned, by preparative HPLC.
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous ammonia, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous ammonia, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous ammonia, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous formic acid, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous formic acid, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous ammonia, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous ammonia, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous formic acid, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous formic acid, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous ammonia, acetonitrile).
  • the product was purified by preparative HPLC (X-Bridge Prep C18 5 ⁇ m OBD, 0.1% aqueous formic acid, acetonitrile).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Pain & Pain Management (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Rheumatology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides triazolone compounds of general formula (I):in which R1, R2, R3, R4 and R5 are as defined herein, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases, in particular of hyperproliferative disorders, as a sole agent or in combination with other active ingredients.

Description

CROSS REFERENCE TO RELATED APPLICATIONS
This application is a Divisional Application of U.S. application Ser. No. 16/345,178, filed Apr. 25, 2019, which is a U.S. national phase application, pursuant to 35 U.S.C. § 371, of PCT International Application Ser. No.: PCT/EP2017/077301, filed Oct. 25, 2017, designating the United States and published in English, which claims the benefit of and priority to PCT International Application Ser. No.: PCT/CN2016/103642, filed Oct. 27, 2016, the entire contents of each of which are incorporated herein by reference.
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jan. 28, 2021, is named 167741-016011USDIV-20210128-SequenceListing.txt and is 18,348 bytes in size.
FIELD OF INVENTION
The present invention provides 4,5-a-annulated 1,2,4-triazolone compounds of general formula (I) as described and defined herein, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases, in particular of hyperproliferative and/or inflammatory disorders, as a sole agent or in combination with other active ingredients.
BACKGROUND
The present invention provides 4,5-annulated 1,2,4-triazolone compounds of general formula (I) which inhibit Dihydroorotate Dehydrogenase (DHODH).
Acute myeloid leukemia (AML) is the most common acute leukemia in humans with a 5 year survival of only about 30%. AML is a malignancy of the myeloid line of blood cells. The incidence rates and chances of cure are highly age dependent. The chemotherapy standard of care for AML has not changed significantly over the last decades highlighting the need for novel therapies. A major hallmark of AML is differentiation arrest of the leukemic cells at early stages of cellular differentiation. The potential of leukemic differentiation therapy can be seen with the success of ATRA or arsenic trioxide inducing differentiation in acute promyelocytic leukemia (APL). Around 10% of AML belong to the APL subtype where leukemic cells are harbouring a chromosomal translocation resulting in fusions of oncoproteins involving the retinoic acid receptor. While treatment with ATRA or arsenic trioxide leads to a dramatic increase of patient survival, with overall survival rates of over 70%, unfortunately a comparable differentiation therapy for the non-APL AMLs is lacking (Management of acute promyelocytic leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet, Sanz M. A. et al, Blood 2009, 113(9), 1875-1891). Therefore new therapies inducing differentiation of AML cells are of high interest and medical need.
Dihydroorotate Dehydroqenase (DHODH)
DHODH is located in the mitochondria and the enzyme responsible for the 4th and rate limiting step in de novo pyrimidine synthesis converting dihydroorotate to orotate (Dihydroorotat-ubiquinone oxidoreductase links mitochondria in the biosynthesis of pyrimidine nucleotides, Löffler M. et al, Molecular and Cellular Biochemistry 1997, 174, 125-129).
As pyrimdine production is essential for DNA and RNA synthesis DHODH is highly important for cellular proliferation. The enzyme is considered an attractive drug target for cancer, immunological, parasitic and viral diseases and DHODH small molecule inhibitors like Leflunomide/Teriflunomide and Brequinar have been approved for clinical use in Rheumatoid Arthritis and Multiple Sclerosis. Additionally, preclinical studies indicate that DHODH inhibitors may be useful for the treatment of haematological cancer indications, for the treatment of solid tumors (e.g., neuroblastoma, melanoma, colon, breast and lung tumors), for the treatment of parasitic diseases (e.g., malaria), and for viral disease therapy.
U.S. Pat. No. 6,444,613 B1 relates to the field of defoliants, in particular thidiazuron-comprising mixtures, and their use in crops of cotton. These mixtures comprise among others 2,4,5-trisubstituted 1,2,4-triazolone compounds as herbicides, which inhibit the enzyme protoporphyrinogen-(IX) oxidase (PPO inhibitors).
WO199802422 describes substituted aromatic carbonyl compounds, among others 2,4,5-trisubstituted 1,2,4-triazolone compounds, as herbicides.
From CN106543139 some triazolone compounds are known as agrochemicals.
US 2016/0251341 A1 describes triazole compounds as serine protease inhibitors useful for the inhibition of thrombin and/or kallikrein.
WO 2013/186692 A1 describes triazolone compounds as mPGES-1 inhibitors, useful in the treatment of pain and/or inflammation from a variety of diseases or conditions, such as asthma, osteoarthritis, rheumatoid arthritis, acute or chronic pain and neurodegenerative diseases.
WO2010/077686 A1 describes sirtuin-modulating compounds, e.g. isoindolinone and related compounds, and methods of use thereof. The sirtuin-modulating compounds may be used for increasing the lifespan of a cell, and treating and/or preventing a wide variety of diseases and disorders including, for example, diseases or disorders related to aging or stress, diabetes, obesity, neurodegenerative diseases, cardiovascular disease, blood clotting disorders, inflammation, cancer, and/or flushing as well as diseases or disorders that would benefit from increased mitochondrial activity.
DESCRIPTION OF THE INVENTION
It has now been found, and this partially constitutes the basis of the present invention, that the compounds of the present invention (e.g., 4,5-annulated 1,2,4-triazolone compounds of general formula (I)) have surprising and advantageous properties.
In particular, the compounds of the present invention have surprisingly been found to effectively inhibit DHODH and may therefore be used for the treatment or prophylaxis of disease including hyperproliferative and/or inflammatory disorders, such as cancer, for example.
In accordance with one aspect, the present invention provides compounds of general formula (I):
Figure US11787797-20231017-C00002
in which
  • R1 represents a group selected from
    • a C1-C8-alkyl group, which is optionally substituted with a group selected from C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
      • wherein said phenyl substituent is optionally substituted, one, two or three times with one or more substituents independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C8-haloalkyl group,
    • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group,
    • a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
      • or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8) and
    • a monocyclic or bicyclic heteroaryl group which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
  • R2 represents a hydrogen atom or a halogen atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group,
    • a C3-C8-cycloalkyl group,
    • a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group,
    • a C2-C6-alkenyl group,
    • a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group,
    • a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)R6 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group, wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group and, wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
    • and
    • a phenyl group,
      • which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
  • R4 and R5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
Figure US11787797-20231017-C00003
    • whereby ring A in addition to the two mandatory atoms, the nitrogen atom and the carbon atom bridging the two rings, bears additional 3 to 6 members selected from —O—, —S—, —S(═O)—, —S(═O)2—, —S(═O)(═NR14)—, —N═, —N(R7)—, —C(═O)—, —CH═, —CR11═, —C(R12)2—, —C(H)(R13)—,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C6-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-alkenyl group, a C2-C6-hydroxyalkyl group, a haloalkyl group, a aryl group, a (C1-C6-alkyl)-aryl group, and a —(C2-C6-alkyl)-N(R9)(R10) group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from
    • C1-C6-alkyl, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C3-alkyl), —S(═O)2—(C2-C6-alkenyl), and —C(═O)OR6—,
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a C1-C3-alkyl group,
  • R13 represents a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
  • R15 represents a group selected from
    • a C1-C6-alkyl group and a benzyl group,
      or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound.
Definitions
The term “substituted” means that one or more hydrogen atoms on the designated atom or group are replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded. Combinations of substituents and/or variables are permissible.
The term “optionally substituted” means that the number of substituents can be equal to or different from zero. Unless otherwise indicated, it is possible that optionally substituted groups are substituted with as many optional substituents as can be accommodated by replacing a hydrogen atom with a non-hydrogen substituent on any available carbon or nitrogen atom. Commonly, it is possible for the number of optional substituents, when present, to be 1, 2, 3, 4 or 5, in particular 1, 2 or 3.
As used herein, the term “one or more”, e.g. in the definition of the substituents of the compounds of general formula (I) of the present invention, means “1, 2, 3, 4 or 5, particularly 1, 2, 3 or 4, more particularly 1, 2 or 3, even more particularly 1 or 2”.
As used herein, an oxo substituent represents an oxygen atom, which is bound to a carbon atom or to a sulfur atom via a double bond.
The term “ring substituent” means a substituent attached to an aromatic or nonaromatic ring which replaces an available hydrogen atom on the ring.
Should a composite substituent be composed of more than one parts, e.g. (C1-C3-alkoxy)-(C1-C6-alkyl)-, it is possible for the position of a given part to be at any suitable position of said composite substituent, i.e. the C1-C3-alkoxy part can be attached to any carbon atom of the C1-C6-alkyl part of said (C1-C3-alkoxy)-(C1-C6alkyl)- group. A hyphen at the beginning or at the end of such a composite substituent indicates the point of attachment of said composite substituent to the rest of the molecule. Should a ring, comprising carbon atoms and optionally one or more heteroatoms, such as nitrogen, oxygen or sulfur atoms for example, be substituted with a substituent, it is possible for said substituent to be bound at any suitable position of said ring, be it bound to a suitable carbon atom and/or to a suitable heteroatom.
The term “comprising” when used in the specification includes “consisting of”.
If within the present text any item is referred to as “as mentioned herein”, it means that it may be mentioned anywhere in the present text.
The terms as mentioned in the present text have the following meanings: The term “halogen atom” means a fluorine, chlorine, bromine or iodine atom, particularly a fluorine, chlorine or bromine atom.
The term “C1-C8-alkyl” means a linear or branched, saturated, monovalent hydrocarbon group having 1, 2, 3, 4, 5 or 6 carbon atoms, e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, 2-methylbutyl, 1-methylbutyl, 1-ethylpropyl, 1,2-dimethylpropyl, neo-pentyl, 1,1-dimethylpropyl, hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, heptyl or octyl group, or an isomer thereof. Particularly, said group has 1, 2, 3, 4, 5 or 6 carbon atoms (“C1-C6-alkyl”), e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, 2-methylbutyl, 1-methylbutyl, 1-ethylpropyl, 1,2-dimethylpropyl, neo-pentyl, 1,1-dimethylpropyl, hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2,3-dimethylbutyl, 1,2-dimethylbutyl or 1,3-dimethylbutyl group. Particularly, said group has 1, 2, 3 or 4 carbon atoms (“C1-C4-alkyl”), e.g. a methyl, ethyl, propyl, isopropyl, butyl, sec-butyl isobutyl, or tert-butyl group, more particularly 1, 2 or 3 carbon atoms (“C1-C3-alkyl”), e.g. a methyl, ethyl, n-propyl or isopropyl group.
The term “C1-C6-hydroxyalkyl” means a linear or branched, saturated, monovalent hydrocarbon group in which the term “C1-C6-alkyl” is defined supra, and in which 1 or 2 hydrogen atoms are replaced with a hydroxy group, e.g. a hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2-dihydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 1-hydroxypropyl, 1-hydroxypropan-2-yl, 2-hydroxypropan-2-yl, 2,3-dihydroxypropyl, 1,3-dihydroxypropan-2-yl, 3-hydroxy-2-methylpropyl, 2-hydroxy-2-methyl-propyl, 1-hydroxy-2-methyl-propyl group. Particularly, said group has 1, 2 or 3 carbon atoms (“C1-C3-hydroxyalkyl”), e.g. a hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2-dihydroxyethyl, 3-hydroxypropyl, 2-hydroxypropyl, 1-hydroxypropyl, 1-hydroxypropan-2-yl, 2-hydroxypropan-2-yl, 2,3-dihydroxypropyl or 1,3-dihydroxypropan-2-yl group.
The term “C1-C6-alkylsulfanyl” means a linear or branched, saturated, monovalent group of formula (C1-C6-alkyl)-S—, in which the term “C1-C6-alkyl” is as defined supra, e.g. a methylsulfanyl, ethylsulfanyl, propylsulfanyl, isopropylsulfanyl, butylsulfanyl, sec-butylsulfanyl, isobutylsulfanyl, tert-butylsulfanyl, pentylsulfanyl, isopentylsulfanyl, hexylsulfanyl group.
The term “C2-C8-haloalkyl” means a linear or branched, saturated, monovalent hydrocarbon group in which the term “C2-C8-alkyl” is as defined supra, and in which one or more of the hydrogen atoms are replaced, identically or differently, with a halogen atom. Particularly, said halogen atom is a fluorine atom. Said C2-C8-haloalkyl group is, for example, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, 3,3,3-trifluoropropyl or 1,3-difluoropropan-2-yl. Particularly, said group has 2, 3, 4 5 or 6 carbon atoms (“C2-C6-haloalkyl”).
The term “C1-C6-haloalkyl” means a linear or branched, saturated, monovalent hydrocarbon group in which the term “C1-C6-alkyl” is as defined supra, and in which one or more of the hydrogen atoms are replaced, identically or differently, with a halogen atom. Particularly, said halogen atom is a fluorine atom. Said C1-C6-haloalkyl group is, for example, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, 3,3,3-trifluoropropyl or 1,3-difluoropropan-2-yl. Particularly, said group has 1, 2, 3 or 4 carbon atoms (“C1-C4-haloalkyl”), more particularly 1, 2 or 3 carbon atoms (“C1-C3-haloalkyl”), e.g. fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, 3,3,3-trifluoropropyl or 1,3-difluoropropan-2-yl.
The term “C1-C6-alkoxy” means a linear or branched, saturated, monovalent group of formula (C1-C6-alkyl)-O—, in which the term “C1-C6-alkyl” is as defined supra, e.g. a methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, isobutoxy, tert-butoxy, pentyloxy, isopentyloxy or n-hexyloxy group, or an isomer thereof. Particularly, said group has 1, 2 or 3 carbon atoms (“C1-C3-alkoxy”), e.g. a methoxy, ethoxy, n-propoxy or isopropoxy group.
The term “C1-C6-haloalkoxy” means a linear or branched, saturated, monovalent C1-C6-alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, identically or differently, with a halogen atom. Particularly, said halogen atom is a fluorine atom. Said C1-C6-haloalkoxy group is, for example, fluoromethoxy, difluoromethoxy, trifluoromethoxy, 2,2,2-trifluoroethoxy or pentafluoroethoxy. Particularly, said group has 1, 2 or 3 carbon atoms (“C1-C3-haloalkoxy”), e.g. a fluoromethoxy, difluoromethoxy, trifluoromethoxy, 2,2,2-trifluoroethoxy or pentafluoroethoxy group.
The term “C2-C6-alkenyl” means a linear or branched, monovalent hydrocarbon group, which contains one double bond, and which has 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (“C2-C3-alkenyl”), it being understood that in the case in which said alkenyl group contains more than one double bond, then it is possible for said double bonds to be isolated from, or conjugated with, each other. Said alkenyl group is, for example, an ethenyl (or “vinyl”), prop-2-en-1-yl (or “allyl”), prop-1-en-1-yl, but-3-enyl, but-2-enyl, but-1-enyl, pent-4-enyl, pent-3-enyl, pent-2-enyl, pent-1-enyl, hex-5-enyl, hex-4-enyl, hex-3-enyl, hex-2-enyl, hex-1-enyl, prop-1-en-2-yl (or “isopropenyl”), 2-methylprop-2-enyl, 1-methylprop-2-enyl, 2-methylprop-1-enyl, 1-methylprop-1-enyl, 3-methylbut-3-enyl, 2-methylbut-3-enyl, 1-methylbut-3-enyl, 3-methylbut-2-enyl, 2-methylbut-2-enyl, 1-methylbut-2-enyl, 3-methylbut-1-enyl, 2-methylbut-1-enyl, 1-methylbut-1-enyl, 1,1-dimethylprop-2-enyl, 1-ethylprop-1-enyl, 1-propylvinyl, 1-isopropylvinyl, 4-methylpent-4-enyl, 3-methylpent-4-enyl, 2-methylpent-4-enyl, 1-methylpent-4-enyl, 4-methylpent-3-enyl, 3-methylpent-3-enyl, 2-methylpent-3-enyl, 1-methylpent-3-enyl, 4-methylpent-2-enyl, 3-methylpent-2-enyl, 2-methylpent-2-enyl, 1-methylpent-2-enyl, 4-methylpent-1-enyl, 3-methylpent-1-enyl, 2-methylpent-1-enyl, 1-methylpent-1-enyl, 3-ethylbut-3-enyl, 2-ethylbut-3-enyl, 1-ethylbut-3-enyl, 3-ethylbut-2-enyl, 2-ethylbut-2-enyl, 1-ethylbut-2-enyl, 3-ethylbut-1-enyl, 2-ethylbut-1-enyl, 1-ethylbut-1-enyl, 2-propylprop-2-enyl, 1-propylprop-2-enyl, 2-isopropylprop-2-enyl, 1-isopropylprop-2-enyl, 2-propylprop-1-enyl, 1-propylprop-1-enyl, 2-isopropylprop-1-enyl, 1-isopropylprop-1-enyl, 3,3-dimethylprop-1-enyl, or 1-(1,1-dimethylethyl)ethenyl group. Particularly, said group is allyl.
The term “C2-C6-alkynyl” means a linear or branched, monovalent hydrocarbon group which contains one triple bond, and which contains 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (“C2-C3-alkynyl”). Said C2-C6-alkynyl group is, for example, ethynyl, prop-1-ynyl, prop-2-ynyl (or “propargyl”), but-1-ynyl, but-2-ynyl, but-3-ynyl, pent-1-ynyl, pent-2-ynyl, pent-3-ynyl, pent-4-ynyl, hex-1-ynyl, hex-2-ynyl, hex-3-ynyl, hex-4-ynyl, hex-5-ynyl, 1-methylprop-2-ynyl, 2-methylbut-3-ynyl, 1-methylbut-3-ynyl, 1-methylbut-2-ynyl, 3-methylbut-1-ynyl, 1-ethylprop-2-ynyl, 3-methylpent-4-ynyl, 2-methylpent-4-ynyl, 1-methyl-pent-4-ynyl, 2-methylpent-3-ynyl, 1-methylpent-3-ynyl, 4-methylpent-2-ynyl, 1-methyl-pent-2-ynyl, 4-methylpent-1-ynyl, 3-methylpent-1-ynyl, 2-ethylbut-3-ynyl, 1-ethylbut-3-ynyl, 1-ethylbut-2-ynyl, 1-propylprop-2-ynyl, 1-isopropylprop-2-ynyl, 2,2-dimethylbut-3-ynyl, 1,1-dimethylbut-3-ynyl, 1,1-dimethylbut-2-ynyl or 3,3-dimethylbut-1-ynyl group.
The term “C3-C8-cycloalkyl” means a saturated, monovalent, mono- or bicyclic hydrocarbon ring which contains 3, 4, 5, 6, 7 or 8 carbon atoms (“C1-C3-cycloalkyl”). Said C3-C8-cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl group, or a bicyclic hydrocarbon ring, e.g. a bicyclo[4.2.0]octyl or octahydropentalenyl. Particularly, said group contains 3, 4, 5 or 6 carbon atoms (“C3-C6-cycloalkyl”), e.g. a cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl group. Particularly, said group contains 4, 5, 6, 7 or 8 carbon atoms (“C4-C8-cycloalkyl”), e.g. a cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl group.
The term “C4-C8-cycloalkenyl” means a monovalent, mono- or bicyclic hydrocarbon ring which contains 4, 5, 6, 7 or 8 carbon atoms and one double bond. Particularly, said ring contains 4, 5 or 6 carbon atoms (“C4-C6-cycloalkenyl”). Said C4-C8-cycloalkenyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl or cyclooctenyl group, or a bicyclic hydrocarbon ring, e.g. a bicyclo[2.2.1]hept-2-enyl or bicyclo[2.2.2]oct-2-enyl.
The term “C3-C8-cycloalkoxy” means a saturated, monovalent, mono- or bicyclic group of formula (C3-C8-cycloalkyl)-O—, which contains 3, 4, 5, 6, 7 or 8 carbon atoms, in which the term “C3-C8-cycloalkyl” is defined supra, e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, cycloheptyloxy or cyclooctyloxy group. Particularly, said group has 3, 4, 5 or 6 carbon atoms (“C3-C8-cycloalkoxy”), e.g. a cyclopropyloxy, cyclobutyloxy, cyclopentyloxy or cyclohexyloxy group.
The terms “4- to 7-membered heterocycloalkyl” and “4- to 6-membered heterocycloalkyl” mean a monocyclic, saturated heterocycle with 4, 5, 6 or 7 or, respectively, 4, 5 or 6 ring atoms in total, which contains one or two identical or different ring heteroatoms from the series N, O and S.
Said heterocycloalkyl group, without being limited thereto, can be a 4-membered ring, such as azetidinyl, oxetanyl or thietanyl, for example; or a 5-membered ring, such as tetrahydrofuranyl, 1,3-dioxolanyl, thiolanyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, 1,1-dioxidothiolanyl, dioxidotetrahydrothiopyranyl, 1,2-oxazolidinyl, 1,3-oxazolidinyl or 1,3-thiazolidinyl, for example; or a 6-membered ring, such as tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, 1,3-dioxanyl, 1,4-dioxanyl or 1,2-oxazinanyl, for example, or a 7-membered ring, such as azepanyl, 1,4-diazepanyl or 1,4-oxazepanyl, for example.
The terms “4- to 7-membered nitrogen containing heterocycloalkyl” and “4- to 6-membered nitrogen containing heterocycloalkyl” mean a monocyclic, saturated heterocycle with 4, 5, 6 or 7 or, respectively, 4, 5 or 6 ring atoms in total, containing one ring nitrogen atom and optionally one further ring heteroatom from the series: N, O, S. atom.
Said nitrogen containing heterocycloalkyl group, without being limited thereto, can be a 4-membered ring, such as azetidinyl for example; or a 5-membered ring, such as pyrrolidinyl, imidazolidinyl, pyrazolidinyl, 1,2-oxazolidinyl, 1,3-oxazolidinyl or 1,3-thiazolidinyl, for example; or a 6-membered ring, such as piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl or 1,2-oxazinanyl, for example, or a 7-membered ring, such as azepanyl, 1,4-diazepanyl or 1,4-oxazepanyl, for example.
The term “5- to 7-membered heterocycloalkenyl” means a monocyclic, unsaturated, non-aromatic heterocycle with 5, 6 or 7 ring atoms in total, which contains one or two double bonds and one or two identical or different ring heteroatoms from the series: N, O, S.
Said heterocycloalkenyl group is, for example, 4H-pyranyl, 2H-pyranyl, 2,5-dihydro-1H-pyrrolyl, [1,3]dioxolyl, 4H-[1,3,4]thiadiazinyl, 2,5-dihydrofuranyl, 2,3-dihydrofuranyl, 2,5-dihydrothiophenyl, 2,3-dihydrothiophenyl, 4,5-dihydrooxazolyl or 4H-[1,4]thiazinyl.
The term “4-7-membered, optionally unsaturated, heterocyclic group” includes the terms “4- to 7-membered heterocycloalkyl” and “5- to 7-membered heterocycloalkenyl”.
The term “aryl” includes aromatic ring systems being mono- or bicyclic, especially phenyl and naphthyl.
The term “phenyl groups of which two vicinal substituents may form together a 5- or 6-membered, optionally aromatic or non-aromatic ring, and optionally containing a C(═O) group” and specifically includes naphthalinyl, indanyl and tetralinyl.
The term “heteroaryl” means a monovalent, monocyclic or bicyclic aromatic ring having 5, 6, 8, 9 or 10 ring atoms (a “5- to 10-membered heteroaryl” group), particularly 5, 6, 9 or 10 ring atoms, which contains at least one ring heteroatom and optionally one, two or three further ring heteroatoms from the series: N, O and/or S, and which is bound via a ring carbon atom or optionally via a ring nitrogen atom (if allowed by valency).
Said heteroaryl group can be a 5-membered heteroaryl group, such as, for example, thienyl, furanyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl or tetrazolyl; or a 6-membered heteroaryl group, such as, for example, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl or triazinyl; or a 9-membered heteroaryl group, such as, for example, benzofuranyl, benzothienyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, benzothiazolyl, benzotriazolyl, indazolyl, indolyl, isoindolyl, indolizinyl or purinyl; or a 10-membered heteroaryl group, such as, for example, quinolinyl, quinazolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinoxalinyl or pteridinyl.
In general, and unless otherwise mentioned, the heteroaryl or heteroarylene groups include all possible isomeric forms thereof, e.g.: tautomers and positional isomers with respect to the point of linkage to the rest of the molecule. Thus, for some illustrative non-restricting examples, the term pyridinyl includes pyridin-2-yl, pyridin-3-yl and pyridin-4-yl; or the term thienyl includes thien-2-yl and thien-3-yl.
The term “C1-C6”, as used in the present text, e.g. in the context of the definition of “C1-C6-alkyl”, “C1-C6-haloalkyl”, “C1-C6-hydroxyalkyl”, “C1-C6-alkoxy” or “C1-C6-haloalkoxy” means an alkyl group having a finite number of carbon atoms of 1 to 6, i.e. 1, 2, 3, 4, 5 or 6 carbon atoms. Further, as used herein, the term “C3-C8”, as used in the present text, e.g. in the context of the definition of “C3-C8-cycloalkyl”, means a cycloalkyl group having a finite number of carbon atoms of 3 to 8, i.e. 3, 4, 5, 6, 7 or 8 carbon atoms.
When a range of values is given, said range encompasses each value and sub-range within said range.
For example:
“C1-C8” encompasses C1, C2, C3, C4, C5, C6, C7, C8, C1-C8, C1-C7, C1-C6, C1-C5, C1- C4, C1-C3, C1-C2, C2-C8, C2-C7, C2-C6, C2-C5, C2-C4, C2-C3, C3-C8, C3-C7, C3-C6, C3-C5, C3-C4, C4-C8, C4-C7, C4-C6, C4-C5, C5-C8, C5-C7, C5-C6, C6-C8, C6-C7 and C7-C8;
“C1-C6” encompasses C1, C2, C3, C4, C5, C6, C1-C6, C1-C5, C1-C4, C1-C3, C1-C2, C2- C6, C2-C6, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6;
“C1-C4” encompasses C1, C2, C3, C4, C1-C4, C1-C3, C1-C2, C2-C4, C2-C3 and C3-C4;
“C1-C3” encompasses C1, C2, C3, C1-C3, C1-C2 and C2-C3;
“C2-C6” encompasses C2, C3, C4, C5, C6, C2-C6, C2-C5, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6;
“C3-C8” encompasses C3, C4, C5, C6, C7, C8, C3-C8, C3-C7, C3-C6, C3-C5, C3-C4, C4- C8, C4-C7, C4-C6, C4-C5, C5-C8, C5-C7, C5-C6, C6-C8, C6-C7 and C7-C8;
“C3-C6” encompasses C3, C4, C5, C6, C3-C5, C3-C4, C3-C4, C4-C6, C4-C5, and C5-C6;
“C4-C8” encompasses C4, C5, C6, C7, C8, C4-C8, C4-C7, C4-C6, C4-C5, C5-C8, C5-C7, C5-C6, C6-C8, C6-C7 and C7-C8;
“C4-C7” encompasses C4, C5, C6, C7, C4-C7, C4-C6, C4-C5, C5-C7, C5-C6 and C6-C7;
“C4-C6” encompasses C4, C5, C6, C4-C6, C4-C5 and C5-C6;
“C5-C10” encompasses C5, C6, C7, C8, C9, C10, C5-C10, C5-C9, C5-C8, C5-C7, C5-C6, C6- C10, C6-C9, C6-C8, C6-C7, C7-C10, C7-C9, C7-C8, C8-C10, C8-C9 and C9-C10;
“C6-C10” encompasses C6, C7, C8, C9, C10, C6-C10, C6-C9, C6-C8, C6-C7, C7-C10, C7-C9, C7-C8, C8-C10, C8-C9 and C9-C10.
As used herein, the term “leaving group” means an atom or a group of atoms that is displaced in a chemical reaction as stable species taking with it the bonding electrons. In particular, such a leaving group is selected from the group comprising: halide, in particular fluoride, chloride, bromide or iodide, (methylsulfonyl)oxy, [(trifluoromethyl)sulfonyl]oxy, [(nonafluorobutyl)-sulfonyl]oxy, (phenylsulfonyl)oxy, [(4-methylphenyl)sulfonyl]oxy, [(4-bromophenyl)sulfonyl]oxy, [(4-nitrophenyl)sulfonyl]oxy, [(2-nitrophenyl)sulfonyl]oxy, [(4-isopropylphenyl)sulfonyl]oxy, [(2,4,6-triisopropylphenyl)sulfonyl]oxy, [(2,4,6-trimethylphenyl)sulfonyl]oxy, [(4-tert-butyl-phenyl)sulfonyl]oxy and [(4-methoxyphenyl)sulfonyl]oxy.
The term “substituent” refers to a group “substituted” on, e.g. an alkyl, haloalkyl, cycloalkyl, heterocyclyl, heterocycloalkenyl, cycloalkenyl, aryl, or heteroaryl group at any atom of that group, replacing one or more hydrogen atoms therein. In one aspect, the substituent(s) on a group are independently any one single, or any combination of two or more of the permissible atoms or groups of atoms delineated for that substituent. In another aspect, a substituent may itself be substituted with any one of the above substituents. Further, as used herein, the phrase “optionally substituted” means unsubstituted (e.g., substituted with an H) or substituted.
It will be understood that the description of compounds herein is limited by principles of chemical bonding known to those skilled in the art. Accordingly, where a group may be substituted by one or more of a number of substituents, such substitutions are selected so as to comply with principles of chemical bonding with regard to valencies, etc., and to give compounds which are not inherently unstable. For example, any carbon atom will be bonded to two, three, or four other atoms, consistent with the four valence electrons of carbon.
By “subject” is meant a mammal, including, but not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, rodent, or feline
It is possible for the compounds of general formula (I) to exist as isotopic variants. The invention therefore includes one or more isotopic variant(s) of the compounds of general formula (I), particularly deuterium-containing compounds of general formula (I).
The term “isotopic variant” of a compound or a reagent is defined as a compound exhibiting an unnatural proportion of one or more of the isotopes that constitute such a compound.
The expression “unnatural proportion” in relation to an isotope means a proportion of such isotope which is higher than its natural abundance. The natural abundances of isotopes to be applied in this context are described in “Isotopic Compositions of the Elements 1997”, Pure Appl. Chem., 70(1), 217-235, 1998.
Examples of such isotopes include stable and radioactive isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine, bromine and iodine, such as 2H (deuterium), 3H (tritium), 11C, 13C, 14C 15N, 18O, 32P, 33P, 33S, 34S 35S, 36S, 18F, 36Cl, 82Br, 123I, 124I, 125I, 129I and 131I, respectively.
With respect to the treatment and/or prophylaxis of the disorders specified herein the isotopic variant(s) of the compounds of general formula (I) preferably contain deuterium (“deuterium-containing compounds of general formula (I)”). Isotopic variants of the compounds of general formula (I) in which one or more radioactive isotopes, such as 3H or 14C, are incorporated are useful e.g. in drug and/or substrate tissue distribution studies. These isotopes are particularly preferred for the ease of their incorporation and detectability. Positron emitting isotopes such as 18F or 11C may be incorporated into a compound of general formula (I). These isotopic variants of the compounds of general formula (I) are useful for in vivo imaging applications. Deuterium-containing and 13C-containing compounds of general formula (I) can be used in mass spectrometry analyses in the context of preclinical or clinical studies.
Isotopic variants of the compounds of general formula (I) can generally be prepared by methods known to a person skilled in the art, such as those described in the schemes and/or examples herein, by substituting a reagent for an isotopic variant of said reagent, preferably for a deuterium-containing reagent. Depending on the desired sites of deuteration, in some cases deuterium from D2O can be incorporated either directly into the compounds or into reagents that are useful for synthesizing such compounds. Deuterium gas is also a useful reagent for incorporating deuterium into molecules. Catalytic deuteration of olefinic bonds and acetylenic bonds is a rapid route for incorporation of deuterium. Metal catalysts (i.e. Pd, Pt, and Rh) in the presence of deuterium gas can be used to directly exchange deuterium for hydrogen in functional groups containing hydrocarbons. A variety of deuterated reagents and synthetic building blocks are commercially available from companies such as for example C/D/N Isotopes, Quebec, Canada; Cambridge Isotope Laboratories Inc., Andover, Mass., USA; and CombiPhos Catalysts, Inc., Princeton, N.J., USA.
The term “deuterium-containing compound of general formula (I)” is defined as a compound of general formula (I), in which one or more hydrogen atom(s) is/are replaced by one or more deuterium atom(s) and in which the abundance of deuterium at each deuterated position of the compound of general formula (I) is higher than the natural abundance of deuterium, which is about 0.015%. Particularly, in a deuterium-containing compound of general formula (I) the abundance of deuterium at each deuterated position of the compound of general formula (I) is higher than 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80%, preferably higher than 90%, 95%, 96% or 97%, even more preferably higher than 98% or 99% at said position(s). It is understood that the abundance of deuterium at each deuterated position is independent of the abundance of deuterium at other deuterated position(s).
The selective incorporation of one or more deuterium atom(s) into a compound of general formula (I) may alter the physicochemical properties (such as for example acidity [C. L. Perrin, et al., J. Am. Chem. Soc., 2007, 129, 4490], basicity [C. L. Perrin et al., J. Am. Chem. Soc., 2005, 127, 9641], lipophilicity [B. Testa et al., Int. J. Pharm., 1984, 19(3), 271]) and/or the metabolic profile of the molecule and may result in changes in the ratio of parent compound to metabolites or in the amounts of metabolites formed. Such changes may result in certain therapeutic advantages and hence may be preferred in some circumstances. Reduced rates of metabolism and metabolic switching, where the ratio of metabolites is changed, have been reported (A. E. Mutlib et al., Toxicol. Appl. Pharmacol., 2000, 169, 102). These changes in the exposure to parent drug and metabolites can have important consequences with respect to the pharmacodynamics, tolerability and efficacy of a deuterium-containing compound of general formula (I). In some cases deuterium substitution reduces or eliminates the formation of an undesired or toxic metabolite and enhances the formation of a desired metabolite (e.g. Nevirapine: A. M. Sharma et al., Chem. Res. Toxicol., 2013, 26, 410; Efavirenz: A. E. Mutlib et al., Toxicol. Appl. Pharmacol., 2000, 169, 102). In other cases the major effect of deuteration is to reduce the rate of systemic clearance. As a result, the biological half-life of the compound is increased. The potential clinical benefits would include the ability to maintain similar systemic exposure with decreased peak levels and increased trough levels. This could result in lower side effects and enhanced efficacy, depending on the particular compound's pharmacokinetic/pharmacodynamic relationship. ML-337 (C. J. Wenthur et al., J. Med. Chem., 2013, 56, 5208) and Odanacatib (K. Kassahun et al., WO2012/112363) are examples for this deuterium effect. Still other cases have been reported in which reduced rates of metabolism result in an increase in exposure of the drug without changing the rate of systemic clearance (e.g. Rofecoxib: F. Schneider et al., Arzneim. Forsch./Drug. Res., 2006, 56, 295; Telaprevir: F. Maltais et al., J. Med. Chem., 2009, 52, 7993). Deuterated drugs showing this effect may have reduced dosing requirements (e.g. lower number of doses or lower dosage to achieve the desired effect) and/or may produce lower metabolite loads.
A compound of general formula (I) may have multiple potential sites of attack for metabolism. To optimize the above-described effects on physicochemical properties and metabolic profile, deuterium-containing compounds of general formula (I) having a certain pattern of one or more deuterium-hydrogen exchange(s) can be selected. Particularly, the deuterium atom(s) of deuterium-containing compound(s) of general formula (I) is/are attached to a carbon atom and/or is/are located at those positions of the compound of general formula (I), which are sites of attack for metabolizing enzymes such as e.g. cytochrome P450.
In another embodiment the present invention concerns a deuterium-containing compound of general formula (I) having 1, 2, 3 or 4 deuterium atoms, particularly with 1, 2 or 3 deuterium atoms.
Where the plural form of the word compounds, salts, polymorphs, hydrates, solvates and the like, is used herein, this is taken to mean also a single compound, salt, polymorph, isomer, hydrate, solvate or the like. The terms “a” or “an,” as used in herein means one or more.
By “stable compound’ or “stable structure” is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
The compounds of the present invention optionally contain one or more asymmetric centres, depending upon the location and nature of the various substituents desired. It is possible that one or more asymmetric carbon atoms are present in the (R) or (S) configuration, which can result in racemic mixtures in the case of a single asymmetric centre, and in diastereomeric mixtures in the case of multiple asymmetric centres. In certain instances, it is possible that asymmetry also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds.
Preferred isomers are those which produce the more desirable biological activity. These separated, pure or partially purified isomers or racemic mixtures of the compounds of this invention are also included within the scope of the present invention. The purification and the separation of such materials can be accomplished by standard techniques known in the art.
The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers. Examples of appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid. Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation. The optically active bases or acids are then liberated from the separated diastereomeric salts. A different process for separation of optical isomers involves the use of chiral chromatography (e.g., HPLC columns using a chiral phase), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers. Suitable HPLC columns using a chiral phase are commercially available, such as those manufactured by Daicel, e.g., Chiracel OD and Chiracel OJ, for example, among many others, which are all routinely selectable. Enzymatic separations, with or without derivatisation, are also useful. The optically active compounds of the present invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.
In order to distinguish different types of isomers from each other reference is made to IUPAC Rules Section E (Pure Appl Chem 45, 11-30, 1976).
Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention is achieved by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
Further, it is possible for the compounds of the present invention to exist as tautomers. For example, any compound of the present invention which contains an imidazopyridine moiety as a heteroaryl group for example can exist as a 1H tautomer, or a 3H tautomer, or even a mixture in any amount of the two tautomers, namely:
Figure US11787797-20231017-C00004
The present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio.
Further, the compounds of the present invention can exist as N-oxides, which are defined in that at least one nitrogen of the compounds of the present invention is oxidised. The present invention includes all such possible N-oxides.
The present invention also provides useful forms of the compounds of the present invention, such as metabolites, hydrates, solvates, prodrugs, salts, in particular pharmaceutically acceptable salts, and/or co-precipitates.
The compounds of the present invention can exist as a hydrate, or as a solvate, wherein the compounds of the present invention contain polar solvents, in particular water, methanol or ethanol for example, as structural element of the crystal lattice of the compounds. It is possible for the amount of polar solvents, in particular water, to exist in a stoichiometric or non-stoichiometric ratio. In the case of stoichiometric solvates, e.g. a hydrate, hemi-, (semi-), mono-, sesqui-, di-, tri-, tetra-, penta- etc. solvates or hydrates, respectively, are possible. The present invention includes all such hydrates or solvates.
Further, it is possible for the compounds of the present invention to exist in free form, e.g. as a free base, or as a free acid, or as a zwitterion, or to exist in the form of a salt. Said salt may be any salt, either an organic or inorganic addition salt, particularly any pharmaceutically acceptable organic or inorganic addition salt, which is customarily used in pharmacy, or which is used, for example, for isolating or purifying the compounds of the present invention.
The term “pharmaceutically acceptable salt” refers to an inorganic or organic acid addition salt of a compound of the present invention. For example, see S. M. Berge, et al. “Pharmaceutical Salts,” J. Pharm. Sci. 1977, 66, 1-19.
A suitable pharmaceutically acceptable salt of the compounds of the present invention may be, for example, an acid-addition salt of a compound of the present invention bearing a nitrogen atom, in a chain or in a ring, for example, which is sufficiently basic, such as an acid-addition salt with an inorganic acid, or “mineral acid”, such as hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfamic, bisulfuric, phosphoric, or nitric acid, for example, or with an organic acid, such as formic, acetic, acetoacetic, pyruvic, trifluoroacetic, propionic, butyric, hexanoic, heptanoic, undecanoic, lauric, benzoic, salicylic, 2-(4-hydroxybenzoyl)-benzoic, camphoric, cinnamic, cyclopentanepropionic, digluconic, 3-hydroxy-2-naphthoic, nicotinic, pamoic, pectinic, 3-phenylpropionic, pivalic, 2-hydroxyethanesulfonic, itaconic, trifluoromethanesulfonic, dodecylsulfuric, ethanesulfonic, benzenesulfonic, para-toluenesulfonic, methanesulfonic, 2-naphthalenesulfonic, naphthalinedisulfonic, camphorsulfonic acid, citric, tartaric, stearic, lactic, oxalic, malonic, succinic, malic, adipic, alginic, maleic, fumaric, D-gluconic, mandelic, ascorbic, glucoheptanoic, glycerophosphoric, aspartic, sulfosalicylic, or thiocyanic acid, for example.
Further, another suitably pharmaceutically acceptable salt of a compound of the present invention which is sufficiently acidic, is an alkali metal salt, for example a sodium or potassium salt, an alkaline earth metal salt, for example a calcium, magnesium or strontium salt, or an aluminium or a zinc salt, or an ammonium salt derived from ammonia or from an organic primary, secondary or tertiary amine having 1 to 20 carbon atoms, such as ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylaminoethanol, diethylaminoethanol, tris(hydroxymethyl)aminomethane, procaine, dibenzylamine, N-methylmorpholine, arginine, lysine, 1,2-ethylenediamine,N-methylpiperidine,N-methyl-glucamine,N,N-dimethyl-glucamine, N-ethyl-glucamine, 1,6-hexanediamine, glucosamine, sarcosine, serinol, 2-amino-1,3-propanediol, 3-amino-1,2-propanediol, 4-amino-1,2,3-butanetriol, or a salt with a quarternary ammonium ion having 1 to 20 carbon atoms, such as tetramethylammonium, tetraethylammonium, tetra(n-propyl)ammonium, tetra(n-butyl)ammonium, N-benzyl-N,N,N-trimethylammonium, choline or benzalkonium.
Those skilled in the art will further recognise that it is possible for acid addition salts of the claimed compounds to be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods. Alternatively, alkali and alkaline earth metal salts of acidic compounds of the present invention are prepared by reacting the compounds of the present invention with the appropriate base via a variety of known methods.
The present invention includes all possible salts of the compounds of the present invention as single salts, or as any mixture of said salts, in any ratio.
The present invention includes diastereomers, racemates, tautomers, N-oxides, hydrates, solvates, and salts of the compounds of the present invention, and mixtures of same.
In the present text, in particular in the Experimental Section, for the synthesis of intermediates and of examples of the present invention, when a compound is mentioned as a salt form with the corresponding base or acid, the exact stoichiometric composition of said salt form, as obtained by the respective preparation and/or purification process, is, in most cases, unknown.
Unless specified otherwise, suffixes to chemical names or structural formulae relating to salts, such as “hydrochloride”, “trifluoroacetate”, “sodium salt”, or “x HCl”, “x CF3COOH”, “x Na+”, for example, mean a salt form, the stoichiometry of which salt form not being specified.
This applies analogously to cases in which synthesis intermediates or example compounds or salts thereof have been obtained, by the preparation and/or purification processes described, as solvates, such as hydrates, with (if defined) unknown stoichiometric composition.
Furthermore, the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorph, or as a mixture of more than one polymorph, in any ratio.
Moreover, the present invention also includes prodrugs of the compounds according to the invention. The term “prodrugs” here designates compounds which themselves can be biologically active or inactive, but are converted (for example metabolically or hydrolytically) into compounds according to the invention during their residence time in the body.
In accordance with certain embodiments, the present invention provides compounds of general formula (I),
Figure US11787797-20231017-C00005
in which
  • R1 represents a group selected from
    • a C1-C3-alkyl group, which is optionally substituted with a group selected from
      • C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl, wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a C2-C8-haloalkyl group,
      • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group,
    • a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a group selected from
      • C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
      • or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8)
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
  • R2 represents a hydrogen atom or a halogen atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group,
    • a C3-C8-cycloalkyl group,
    • a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group,
    • a C2-C6-alkenyl group,
    • a C2-C6-alkinyl group
    • a C4-C8-cycloalkenyl group,
    • a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group, wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group and in which said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
    • and
    • a phenyl group,
      • which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
  • R4 and R5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
Figure US11787797-20231017-C00006
    • whereby ring A in addition to the two mandatory atoms, the nitrogen atom and the carbon atom bridging the two rings, bears additional 3 to 6 members selected from —O—, —S—, —S(═O)—, —S(═O)2—, —N═, —N(R7)—, —C(═O)—, —CH═, —CR11═, —C(R12)2—, —CHR13—,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C6-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-alkenyl group, a C2-C6-hydroxyalkyl group, a haloalkyl group, a aryl group, a (C1-C6-alkyl)-aryl group, and a —(C2-C6-alkyl)-N(R9)(R10) group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from
    • C1-C6-alkyl, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C3-alkyl), —S(═O)2—(C2-C6-alkenyl), and —C(═O)OR6—,
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      and tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides of said compounds.
In accordance with certain embodiments, the present invention provides compounds of general formula (I),
Figure US11787797-20231017-C00007
in which
  • R1 represents a group selected from
    • a C1-C3-alkyl group, a C2-C8-haloalkyl group, a C3-C8-cycloalkyl group, a C2-C6-cyanoalkyl group, a C2-C6-hydroxyalkyl group, a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group, a —(C2-C6-alkyl)-N(R7)(R8) group, a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group, a 4- to 7-membered, optionally unsaturated, heterocyclic group, a phenyl group, and a monocyclic or bicyclic heteroaryl group,
      • wherein said C1-C3-alkyl group is optionally substituted with a group selected from
      • C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl, wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy, and
      • wherein said C3-C8-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said 4-7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a group selected from
      • C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
      • or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3—C-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8) and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8),
  • R2 represents a hydrogen atom or a halogen atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C8-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group and
    • a phenyl group,
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8),
  • R4 and R5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
Figure US11787797-20231017-C00008
    • whereby ring A in addition to the two mandatory atoms, the nitrogen atom and the carbon atom bridging the two rings, bears additional 3 to 6 members selected from —O—, —S—, —S(═O)—, —S(═O)2—, —N═, —N(R7)—, —C(═O)—, —CH═, —CR11═, —C(R12)2—, —CHR13—,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C6-alkyl group and a benzyl group,
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-alkenyl group, a C2-C6-hydroxyalkyl group, a haloalkyl group, a aryl group, a (C1-C6-alkyl)-aryl group, and a —(C2-C6-alkyl)-N(R9)(R10) group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from
    • C1-C6-alkyl, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C3-alkyl), —S(═O)2—(C2-C6-alkenyl), and —C(═O)OR6—,
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a C1-C3-alkyl group,
  • R13 represents a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      and tautomers, N-oxides, or salts thereof, and salts of tautomers or N-oxides of said compound.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, which is optionally substituted with a group selected from C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a C2-C8-haloalkyl group,
    • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group,
    • a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 7-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 7-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a 5- to 7-membered heterocycloalkenyl group, which is connected to the rest of the molecule via a carbon atom of said 5- to 7-membered heterocycloalkenyl group and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R)(R8), —N(R)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
    • an indanyl group, a tetralinyl group wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom, a C1-C6-alkyl group, a C1-C6-haloalkyl group, a C3-C8-cycloalkyl group, a C1-C6-alkoxy group, a C1-C6-haloalkoxy group, a C3-C8-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
    • and
    • a monocyclic or bicyclic heteroaryl group, which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C6-alkyl group, a C1-C6-haloalkyl group, a C3-C8-cycloalkyl group, a C1-C6-alkoxy group, a C1-C6-haloalkoxy group, a C3-C8-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group,
    • a C3-C8-cycloalkyl group,
    • a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group,
    • a C2-C6-alkenyl group,
    • a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group,
    • a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)R6 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group, and
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
    • and
    • a phenyl group, which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and
      • one of X1, X2, X3, X4 and X5 represents a group selected from C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group, or
      • one of X1, X2, X3, X4 and X5 represents a group selected from —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C6-alkyl group and a benzyl group,
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-hydroxyalkyl group and a —(C2-C6-alkyl)-N(R9)(R10) group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R) group,
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
  • R15 represents a group selected from
    • a C1-C6-alkyl group and a benzyl group,
      or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, a C2-C8-haloalkyl group, a C3-C8-cycloalkyl group, a C2-C6-cyanoalkyl group, a C2-C6-hydroxyalkyl group, a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group, a —(C2-C6-alkyl)-N(R7)(R8) group, a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group, a 4- to 7-membered heterocycloalkyl group, a 5- to 7-membered heterocycloalkenyl group, a phenyl group, an indanyl group, a tetralinyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C1-C3-alkyl group is optionally substituted with a group selected from
      • C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl, wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy, and
      • wherein said C3-C8-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy, and
      • wherein said 4- to 7-membered heterocycloalkyl group and 5- to 7-membered heterocycloalkenyl group, which are connected to the rest of the molecule via a carbon atom of said 4- to 7-membered heterocycloalkyl group and
      • of said 5- to 7-membered heterocycloalkenyl group, and which are optionally substituted one or two times, each substituent independently selected from a group selected from
      • C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
      • wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C3-C8-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C3-C8-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
  • R2 represents a hydrogen atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C8-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group and a phenyl group,
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C6-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-hydroxyalkyl group and a —(C2-C6-alkyl)-N(R9)(R10) group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from
    • C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or a tautomer, an N-oxide, or a salt thereof, and a salt of a tautomer or an N-oxide.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C6-alkyl group, which is optionally substituted with a group selected from C3-C6-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C6-haloalkyl group,
      • a C3-C6-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group, a (C2-C8-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a 5- to 6-membered heterocycloalkenyl group, which is connected to the rest of the molecule via a carbon atom of said 5- to 6-membered heterocycloalkenyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and oxo (═O) group, and
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C3-C6-cycloalkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —(C1-C3-alkyl)-C(═O)OR6, —(C1-C3-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
    • an indanyl group, a tetralinyl group which are optionally substituted one or two times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C3-C6-cycloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group, a C3-C6-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C3-C6-cycloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group, a C3-C6-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl, a C2-C6-alkinyl group,
    • a C4-C6-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)R6 group, a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
    • a —(C1-C6-alkyl)-(4- to 6-membered nitrogen containing heterocycloalkyl) group and
    • a phenyl group,
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C3-alkyl group, a C2-C8-hydroxyalkyl group and a —(C2-C8-alkyl)-N(R9)(R10), or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
  • R15 represents a group selected from
    • a C1-C4-alkyl group and a benzyl group,
      or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C6-alkyl group, a C2-C6-haloalkyl group, a C3-C6-cycloalkyl group, a C2-C6-cyanoalkyl group, a C2-C6-hydroxyalkyl group, a (C2-C8-hydroxyalkyl)-O—(C2-C6-alky)- group, a —(C2-C6-alkyl)-N(R7)(R8) group, a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group, a 4- to 6-membered heterocycloalkyl group, a 5-6-membered heterocycloalkenyl group, a phenyl group, an indanyl group, a tetralinyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C1-C6-alkyl group is optionally substituted with a group selected from
      • C3-C6-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy, and
      • wherein said 4- to 6-membered heterocycloalkyl group and said 5- to 6-membered heterocyclocalkenyl group, which are connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group and said heterocycloalkenyl group, are optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C3-C6-cycloalkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —(C1-C3-alkyl)-C(═O)OR6, —(C1-C3-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—, and
      • wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C3-C6-cycloalkyl, C1-C3-alkoxy,
      • C1-C3-haloalkoxy, C3-C6-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C3-C6-cycloalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
  • R2 represents a hydrogen atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl, a C2-C6-alkinyl group,
    • a C4-C6-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 6-membered nitrogen containing heterocycloalkyl) group and a phenyl group,
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C3-alkyl group, a C2-C8-hydroxyalkyl group and a —(C2-C8-alkyl)-N(R9)(R10), or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    • or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
  • R11 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R) group,
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which: R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and -a N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and a oxo (═O) group,
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-hydroxyalkyl group, a C1-C3-alkoxy group, a cyano group, a hydroxy group, a —C(═O)OR6 group, a —C(═O)N(R7)(R8)group, a —N(R7)(R8) group, a —(C1-C3-alkyl)-N(R7)(R8) group, a —S(═O)2N(R7)(R8) group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-alkoxy group, a hydroxy group and a —N(R7)(R8) group,
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)OR15 group and a phenyl group,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O—, —S— and —S(═O)(═NR14)—,
      • X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or
    • a C1-C3-alkyl group,
    • or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
  • R11 represents a hydrogen atom,
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)CF3 group,
  • R15 represents a C1-C4-alkyl group,
    or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group, a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
  • R2 represents a hydrogen atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, (C1-C6-alkyl)-N(R7)R8 and
    • a phenyl group,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O— and —S—,
      • X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or
    • a C1-C3-alkyl group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
  • R11 represent a hydrogen atom,
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is selected from cyclopropyl and cyclohexyl, and which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is selected from azetidinyl, oxetanyl, tetrahydro-2H-pyranyl, tetrahydro-2H-thiopyranyl and piperidinyl, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alky group,
      • a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group,
      • a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and a oxo (═O) group,
      • a phenyl group, which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-hydroxyalkyl group, a C1-C3-alkoxy group, a hydroxy group, a cyano group, a —C(═O)OR6 group, a —C(═O)N(R7)(R8) group, a —N(R7)(R8) group, a —(C1-C3-alkyl)-N(R7)(R8) group, a —S(═O)2N(R7)(R8) group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is selected from imidazolyl, 1,2-oxazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrazinyl, pyrimidinyl, indazolyl, 1,3-benzothiazolyl, pyrrolo[2,3-d]pyrimidinyl and quinolinyl, and
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)OR15 and a phenyl group,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O—, —S— and —S(═O)(═NH)—,
      • and one of X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or
    • a C1-C3-alkyl group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
  • R11 represents a hydrogen atom,
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
  • R15 represents a C1-C4-alkyl group,
    or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and
    • a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is selected from cyclopropyl and cyclohexyl,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is selected from
      • azetidinyl, oxetanyl, tetrahydro-2H-pyranyl, tetrahydro-2H-thiopyranyl and piperidinyl,
      • which 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from imidazolyl, 1,2-oxazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrazinyl, pyrimidinyl, indazolyl, 1,3-benzothiazolyl, pyrrolo[2,3-d]pyrimidinyl and quinolinyl, which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
  • R2 represents a hydrogen atom or a fluorine atom,
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a (C1-C6-alkyl)-N(R7)R8 group and
    • a phenyl group,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O— and —S—,
      • and one of X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or
    • a C1-C3-alkyl group,
    • or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
  • R11 represent a hydrogen atom,
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is selected from a cyclopropyl group and a cyclohexyl group,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a fluorine atom, a phenyl group and a dimethylamino group,
        • wherein said phenyl substituent is optionally substituted with a fluorine atom
    • a 2-hydroxy-2-methylpropyl group,
    • a 2-(dimethylamino)ethyl group,
      • a 4- to 6-membered heterocycloalkyl group, which is selected from azetidin-3-yl, oxetan-3-yl, tetrahydro-2H-pyran-4-yl, tetrahydro-2H-thiopyran-4-yl and piperidin-4-yl, and
      • which is optionally substituted one or two times, each substituent independently selected from a group selected from a methyl group, an ethyl group, a pyrazinyl group, a tert-butoxycarbonyl group, a acetyl group, a 1-cyclopropanecarbonyl group, a methylsulfonyl group and a oxo (═O) group,
      • a phenyl group, which, is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom, a methyl group, an ethyl group, a difluoromethyl group, a trifluoromethyl group, a hydroxymethyl group, a methoxy group, a hydroxy group, a cyano group, a —C(═O)OH group, a —C(═O)OCH3 group, a —C(═O)OC(CH3), group, a —C(═O)NH2 group, a —C(═O)N(CH3)2 group, an amino group, a methylamino group, an aminomethyl group, a —S(═O)2NH2 group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH—CH2—NH—CH2— and —O—CH2—C(═O)—NH—,
    • a 2-hydroxyindan-1-yl group and
    • a monocyclic or bicyclic heteroaryl group,
      • which is selected from
      • imidazol-4-yl, 1,2-oxazol-4-yl, 1,2-oxazol-5-yl, pyrazol-3-yl, pyrazol-4-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrazinyl, pyrimidin-4-yl, pyrimidin-5-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, 1,3-benzothiazol-6-yl, pyrrolo[2,3-d]pyrimidin-4-yl, quinolin-5-yl, quinolin-6-yl, quinolin-7-yl and quinolin-8-yl, and
      • which is optionally substituted one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom, a methyl group, a methoxy group, a hydroxy group and a morpholin-4-yl group,
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, 1-hydroxyethyl, allyl, aminomethyl, (dimethylamino)methyl, (tert-butoxycarbonylamino)methyl, 2-(dimethylamino)ethyl, pyrrolidin-1-yl-methyl and phenyl,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—CH(OH)—(CH2)3—#,
    • *—CH2—CH(OH)—(CH2)2—#,
    • *—(CH2)2—CH(OH)—CH2—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH═CH—CH(OH)—CH2—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#,
    • *—(CH2)3—S(═O)(═NH)—,#
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—CH═CH—CH═CH—#,
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound.
In accordance with certain embodiments, the present invention provides compounds of general formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a 2-hydroxy-2-methylpropyl group,
    • a 2-(dimethylamino)ethyl group, a 4- to 6-membered heterocycloalkyl group,
    • a phenyl group, a 2-hydroxyindan-1-yl group and
    • a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is selected from cyclopropyl and cyclohexyl,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a fluorine atom or a group selected from
      • phenyl and dimethylamino,
        • wherein said phenyl substituent is optionally substituted with a fluorine atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group is selected from azetidin-3-yl, oxetan-3-yl, tetrahydro-2H-pyran-4-yl, tetrahydro-2H-thiopyran-4-yl and piperidin-4-yl,
      • which 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from methyl, ethyl, pyrazinyl, tert-butoxycarbonyl, acetyl, 1-cyclopropanecarbonyl, methylsulfonyl and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, hydroxymethyl, methoxy, cyano, —C(═O)OH, —C(═O)OCH3, —C(═O)OC(CH3)3, —C(═O)NH2, —C(═O)N(CH3)2, amino, methylamino, aminomethyl, —S(═O)2NH2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH—CH2—NH—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from imidazol-4-yl, 1,2-oxazol-4-yl, 1,2-oxazol-5-yl, pyrazol-3-yl, pyrazol-4-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrazinyl, pyrimidin-4-yl, pyrimidin-5-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, 1,3-benzothiazol-6-yl, pyrrolo[2,3-d]pyrimidin-4-yl, quinolin-5-yl, quinolin-6-yl, quinolin-7-yl and quinolin-8-yl,
      • which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, methoxy, hydroxy and morpholin-4-yl,
  • R2 represents a hydrogen atom or a fluorine atom,
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, 1-hydroxyethyl, allyl, (dimethylamino)methyl, 2-(dimethylamino)ethyl, pyrrolidin-1-yl-methyl and phenyl,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—CH═CH—CH═CH—#,
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with further embodiments, the present invention provides the compounds of general formula (I), supra, which are exemplified in the experimental section.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, which is optionally substituted with a group selected from C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
      • wherein said phenyl substituent is optionally substituted, one, two or three times with one or more substituents independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C8-haloalkyl group,
    • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group, a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
      • or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C3-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8) and
    • a monocyclic or bicyclic heteroaryl group which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, which is optionally substituted with a group selected from a C3-C8-cycloalkyl group, a phenyl group and a monocyclic- or bicyclic heteroaryl group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a C2-C8-haloalkyl group,
    • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from a hydroxy group, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group,
    • a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
      • or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8)
    • and
    • a monocyclic or bicyclic heteroaryl group, which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides of said compound.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, a C2-C8-haloalkyl group, a C3-C8-cycloalkyl group, a C2-C6-cyanoalkyl group, a C2-C6-hydroxyalkyl group, a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group, a —(C2-C6-alkyl)-N(R7)(R8) group, a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group, a 4- to 7-membered, optionally unsaturated, heterocyclic group, a phenyl group, and a monocyclic or bicyclic heteroaryl group,
      • wherein said C1-C3-alkyl group is optionally substituted with a group selected from said
      • C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said C3-C8-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said 4-7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a group selected from
      • C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
      • or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8) and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with further embodiments, the present invention provides compounds of general formula (I), in which
  • R1 represents a phenyl group which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR11)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
    • or in which two substituents of said phenyl groups, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • *—CH2—N(R7)—CH2—, —CH2—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
In accordance with further embodiments, the present invention provides compounds of general formula (I), in which
  • R1 represents a phenyl group, which is optionally substituted, one or two times, each substituent independently selected from a fluorine atom, a chlorine atom and a methyl group.
In accordance with further embodiments, the present invention provides compounds of general formula (I), in which
  • R1 represents a C4-C8-cycloalkyl group or a —(C3-C8-cycloalkyl)-N(R7)(R8) group which are optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from hydroxy, phenyl and —N(R7)(R8),
    • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy.
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with further embodiments, the present invention provides compounds of general formula (I), in which
  • R1 represents a 4- to 7-membered heterocycloalkyl group or a 5- to 7-membered heterocycloalkenyl group, wherein said 4- to 7-membered heterocycloalkyl group and 5- to 7-membered heterocycloalkenyl group are optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl,
    —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
    and wherein said 4- to 7-membered heterocycloalkyl group and 5- to 7-membered heterocycloalkenyl group are connected to the rest of the molecule via a carbon atom of the said heterocycloalkyl- or heterocyclalkenyl group and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with further embodiments, the present invention provides compounds of general formula (I), in which R1 represents a indanyl group, a tetralinyl group and a monocyclic- or bicyclic heteroaryl group
    • wherein said indanyl or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C3-C3-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
    • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C3-C3-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8).
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, which is optionally substituted with a group selected from C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a C2-C8-haloalkyl group,
    • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a C2-C6-cyanoalkyl group,
    • a C2-C6-hydroxyalkyl group,
    • a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
    • a 4- to 7-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 7-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a 5- to 7-membered heterocycloalkenyl group, which is connected to the rest of the molecule via a carbon atom of said 5- to 7-membered heterocycloalkenyl group and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
    • an indanyl group, a tetralinyl group wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom, a C1-C6-alkyl group, a C1-C6-haloalkyl group, a C3-C8-cycloalkyl group, a C1-C6-alkoxy group, a C1-C6-haloalkoxy group, a C3-C8-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
    • and
    • a monocyclic or bicyclic heteroaryl group, which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C6-alkyl group, a C1-C6-haloalkyl group, a C3-C8-cycloalkyl group, a C1-C6-alkoxy group, a C1-C6-haloalkoxy group, a C3-C8-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C3-alkyl group, a C2-C8-haloalkyl group, a C3-C8-cycloalkyl group, a C2-C6-cyanoalkyl group, a C2-C6-hydroxyalkyl group, a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group, a —(C2-C6-alkyl)-N(R7)(R8) group, a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group, a 4- to 7-membered heterocycloalkyl group, a 5- to 7-membered heterocycloalkenyl group, a phenyl group, an indanyl group, a tetralinyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C1-C3-alkyl group is optionally substituted with a group selected from
      • C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said C3-C8-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said 4- to 7-membered heterocycloalkyl group and said 5- to 7-membered heterocycloalkenyl group, which are connected to the rest of the molecule via a carbon atom of said 4- to 7-membered heterocycloalkyl group
      • and
      • said 5- to 7-membered heterocycloalkenyl group, are optionally substituted one or two times, each substituent independently selected from a group selected from
      • C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R)(R8), —N(R)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R)—CH2—, —CH2—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
      • and
      • wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C3-C8-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C3-C8-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
    • a 4- to 7-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 7-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a 5- to 7-membered heterocycloalkenyl group, which is connected to the rest of the molecule via a carbon atom of said 5- to 7-membered heterocycloalkenyl group and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
      • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
    • a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R)(R8), —N(R)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
    • an indanyl group, a tetralinyl group wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom, a C1-C6-alkyl group, a C1-C6-haloalkyl group, a C3-C8-cycloalkyl group, a C1-C6-alkoxy group, a C1-C6-haloalkoxy group, a C3-C8-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
    • and
    • a monocyclic or bicyclic heteroaryl group, which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C6-alkyl group, a C1-C6-haloalkyl group, a C3-C8-cycloalkyl group, a C1-C6-alkoxy group, a C1-C6-haloalkoxy group, a C3-C8-cycloalkoxy group, a cyano group, a hydroxy group and a —N(R7)(R8) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C8-cycloalkyl group, a 4- to 7-membered heterocycloalkyl group,
    • a 5- to 7-membered heterocycloalkenyl group, a phenyl group, an indanyl group, a tetralinyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C8-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said 4- to 7-membered heterocycloalkyl group and said 5- to 7-membered heterocycloalkenyl group, which are connected to the rest of the molecule via a carbon atom of said 4- to 7-membered heterocycloalkyl group
      • and
      • 5- to 7-membered heterocycloalkenyl group, are optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C6-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C6-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R)(R8), —N(R)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R)—CH2—, —CH2—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—, and
      • wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C3-C8-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C3-C8-cycloalkyl, C1-C6-alkoxy, C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C1-C6-alkyl group, a C2-C6-haloalkyl group, a C3-C6-cycloalkyl group, a C2-C6-cyanoalkyl group, a C2-C6-hydroxyalkyl group, a (C2-C8-hydroxyalkyl)-O—(C2-C6-alky)- group, a —(C2-C6-alkyl)-N(R7)(R8) group, a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group, a 4- to 6-membered heterocycloalkyl group, a 5 to 6-membered heterocycloalkenyl group, a phenyl group, an indanyl group, a tetralinyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C1-C6-alkyl group is optionally substituted with a group selected from
      • C3-C6-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group and said heterocycloalkenyl group, which are connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group and said heterocycloalkenyl group, are optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C3-C6-cycloalkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R)(R3), —N(R)(R3), —(C1-C3-alkyl)-N(R7)(R8), —(C1-C3-alkyl)-C(═O)OR6, —(C1-C3-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R)—CH2—, —CH2—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
      • and
      • wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C3-C6-cycloalkyl, C1-C3-alkoxy,
      • C1-C3-haloalkoxy, C3-C6-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C3-C6-cycloalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a 4- to 6-membered heterocycloalkyl group, a heterocycloalkenyl group, a phenyl group, an indanyl group, a tetralinyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • hydroxy, phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
        • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group and said heterocycloalkenyl group, which are connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group and of said heterocycloalkenyl group, are optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
        • wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
      • and
      • wherein said phenyl group is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C3-C6-cycloalkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R)(R3), —N(R)(R3), —(C1-C3-alkyl)-N(R7)(R8), —(C1-C3-alkyl)-C(═O)OR6, —(C1-C3-alkyl)-C(═O)N(R7)(R8), —S(═O)2N(R7)(R8), —S(═O)2(C1-C3-alkyl), —S(═O)(═NR14)(C1-C3-alkyl), —P(═O)(C1-C3-alkyl)2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R)—CH2—, —CH2—O—CH2—, —O—CH2—C(═O)—NH— and —NH—C(═O)—NH—,
      • and
      • wherein said indanyl- or tetralinyl group is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C3-C6-cycloalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy, C3-C6-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C3-C6-cycloalkyl, C1-C3-alkoxy, C1-C3-haloalkoxy,
      • C3-C6-cycloalkoxy, cyano, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and -a N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and a oxo (═O) group,
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-hydroxyalkyl group, a C1-C3-alkoxy group, a cyano group, a hydroxy group, a —C(═O)OR6 group, a —C(═O)N(R7)(R8)group, a —N(R7)(R8) group, a —(C1-C3-alkyl)-N(R7)(R8) group, a —S(═O)2N(R7)(R8) group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • an indanyl group which is optionally substituted with a hydroxy group
      • and
      • a monocyclic or bicyclic heteroaryl group,
        • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-alkoxy group, a hydroxy group and a —N(R7)(R8) group,
          or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group, a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and -a N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and a oxo (═O) group,
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-hydroxyalkyl group, a C1-C3-alkoxy group, a cyano group, a hydroxy group, a —C(═O)OR6 group, a —C(═O)N(R7)(R8)group, a —N(R7)(R8) group, a —(C1-C3-alkyl)-N(R7)(R8) group, a —S(═O)2N(R7)(R8) group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-alkoxy group, a hydroxy group and a —N(R7)(R8) group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is selected from cyclopropyl and cyclohexyl, and which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is selected from azetidinyl, oxetanyl, tetrahydro-2H-pyranyl, tetrahydro-2H-thiopyranyl and piperidinyl, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group,
      • a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group,
      • a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and a oxo (═O) group,
      • a phenyl group, which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-hydroxyalkyl group, a C1-C3-alkoxy group, a hydroxy group, a cyano group, a —C(═O)OR6 group, a —C(═O)N(R7)(R8) group, a —N(R7)(R8) group, a —(C1-C3-alkyl)-N(R7)(R8) group, a —S(═O)2N(R7)(R8) group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is selected from imidazolyl, 1,2-oxazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrazinyl, pyrimidinyl, indazolyl, 1,3-benzothiazolyl, pyrrolo[2,3-d]pyrimidinyl and quinolinyl, and
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group, a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is selected from cyclopropyl and cyclohexyl,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is selected from azetidinyl, oxetanyl, tetrahydro-2H-pyranyl, tetrahydro-2H-thiopyranyl and piperidinyl,
      • which 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from imidazolyl, 1,2-oxazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrazinyl, pyrimidinyl, indazolyl, 1,3-benzothiazolyl, pyrrolo[2,3-d]pyrimidinyl and quinolinyl, which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is selected from cyclopropyl and cyclohexyl, and which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and a —N(R7)(R8) group, wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and which is selected from azetidinyl, oxetanyl, tetrahydro-2H-pyranyl, tetrahydro-2H-thiopyranyl and piperidinyl, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group,
      • a 5- to 6-membered heteroaryl group, a —C(═O)O(C1-C4-alkyl) group,
      • a —C(═O)(C1-C3-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C3-alkyl) group and a oxo (═O) group,
      • a phenyl group, which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-hydroxyalkyl group, a C1-C3-alkoxy group, a hydroxy group, a cyano group, a —C(═O)OR6 group, a —C(═O)N(R7)(R8) group, a —N(R7)(R8) group, a —(C1-C3-alkyl)-N(R7)(R8) group, a —S(═O)2N(R7)(R8) group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is selected from imidazolyl, 1,2-oxazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrazinyl, pyrimidinyl, indazolyl, 1,3-benzothiazolyl, pyrrolo[2,3-d]pyrimidinyl and quinolinyl, and
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is selected from cyclopropyl and cyclohexyl,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is selected from
      • azetidinyl, oxetanyl, tetrahydro-2H-pyranyl, tetrahydro-2H-thiopyranyl and piperidinyl,
      • which 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl),
      • —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from imidazolyl, 1,2-oxazolyl, pyrazolyl, pyridinyl, pyridazinyl, pyrazinyl, pyrimidinyl, indazolyl, 1,3-benzothiazolyl, pyrrolo[2,3-d]pyrimidinyl and quinolinyl, which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is selected from a cyclopropyl group and a cyclohexyl group,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a fluorine atom, a phenyl group and a dimethylamino group,
        • wherein said phenyl substituent is optionally substituted with a fluorine atom
    • a 2-hydroxy-2-methylpropyl group,
    • a 2-(dimethylamino)ethyl group,
      • a 4- to 6-membered heterocycloalkyl group, which is selected from azetidin-3-yl, oxetan-3-yl, tetrahydro-2H-pyran-4-yl, tetrahydro-2H-thiopyran-4-yl and piperidin-4-yl, and
      • which is optionally substituted one or two times, each substituent independently selected from a group selected from a methyl group, an ethyl group, a pyrazinyl group, a tert-butoxycarbonyl group, a acetyl group, a 1-cyclopropanecarbonyl group, amethylsulfonyl group and a oxo (═O) group,
      • a phenyl group, which, is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom, a methyl group, an ethyl group, a difluoromethyl group, a trifluoromethyl group, a hydroxymethyl group, a methoxy group, a hydroxy group, a cyano group, a —C(═O)OH group, a —C(═O)OCH3 group, a —C(═O)OC(CH3), group, a —C(═O)NH2 group, a —C(═O)N(CH3)2 group, an amino group, a methylamino group, an aminomethyl group, a —S(═O)2NH2 group and a SF5 group,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH—CH2—NH—CH2— and —O—CH2—C(═O)—NH—,
    • a 2-hydroxyindan-1-yl group and
    • a monocyclic or bicyclic heteroaryl group,
      • which is selected from
      • imidazol-4-yl, 1,2-oxazol-4-yl, 1,2-oxazol-5-yl, pyrazol-3-yl, pyrazol-4-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrazinyl, pyrimidin-4-yl, pyrimidin-5-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, 1,3-benzothiazol-6-yl, pyrrolo[2,3-d]pyrimidin-4-yl, quinolin-5-yl, quinolin-6-yl, quinolin-7-yl and quinolin-8-yl, and
      • which is optionally substituted one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom, a methyl group, a methoxy group, a hydroxy group and a morpholin-4-yl group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a 2-hydroxy-2-methylpropyl group,
    • a 2-(dimethylamino)ethyl group, a 4- to 6-membered heterocycloalkyl group,
    • a phenyl group, a 2-hydroxyindan-1-yl group and
    • a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is selected from cyclopropyl and cyclohexyl,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a fluorine atom or a group selected from
      • phenyl and dimethylamino,
        • wherein said phenyl substituent is optionally substituted with a fluorine atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group is selected from azetidin-3-yl, oxetan-3-yl, tetrahydro-2H-pyran-4-yl, tetrahydro-2H-thiopyran-4-yl and piperidin-4-yl,
      • which 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from methyl, ethyl, pyrazinyl, tert-butoxycarbonyl, acetyl, 1-cyclopropanecarbonyl, methylsulfonyl and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, hydroxymethyl, methoxy, cyano, —C(═O)OH, —C(═O)OCH3, —C(═O)OC(CH3)3, —C(═O)NH2, —C(═O)N(CH3)2, amino, methylamino, aminomethyl, —S(═O)2NH2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH—CH2—NH—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from imidazol-4-yl, 1,2-oxazol-4-yl, 1,2-oxazol-5-yl, pyrazol-3-yl, pyrazol-4-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrazinyl, pyrimidin-4-yl, pyrimidin-5-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, 1,3-benzothiazol-6-yl, pyrrolo[2,3-d]pyrimidin-4-yl, quinolin-5-yl, quinolin-6-yl, quinolin-7-yl and quinolin-8-yl,
      • which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, methoxy, hydroxy and morpholin-4-yl,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is selected from a cyclopropyl group and a cyclohexyl group,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a fluorine atom, a phenyl group and a dimethylamino group,
        • wherein said phenyl substituent is optionally substituted with a fluorine atom
    • a 4- to 6-membered heterocycloalkyl group, which is selected from azetidin-3-yl, oxetan-3-yl, tetrahydro-2H-pyran-4-yl, tetrahydro-2H-thiopyran-4-yl and piperidin-4-yl, and which is optionally substituted one or two times, each substituent independently selected from a group selected from a methyl group, an ethyl group, a pyrazinyl group, a tert-butoxycarbonyl group, a acetyl group, a 1-cyclopropanecarbonyl group, a methylsulfonyl group and a oxo (═O) group,
    • a phenyl group, which, is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom, a methyl group, an ethyl group, a difluoromethyl group, a trifluoromethyl group, a hydroxymethyl group, a methoxy group, a hydroxy group, a cyano group, a —C(═O)OH group, a —C(═O)OCH3 group, a —C(═O)OC(CH3), group, a —C(═O)NH2 group, a —C(═O)N(CH3)2 group, an amino group, a methylamino group, an aminomethyl group, a —S(═O)2NH2 group and a SF5 group, or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH—CH2—NH—CH2— and —O—CH2—C(═O)—NH—,
    • a 2-hydroxyindan-1-yl group and
    • a monocyclic or bicyclic heteroaryl group,
      • which is selected from
      • imidazol-4-yl, 1,2-oxazol-4-yl, 1,2-oxazol-5-yl, pyrazol-3-yl, pyrazol-4-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrazinyl, pyrimidin-4-yl, pyrimidin-5-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, 1,3-benzothiazol-6-yl, pyrrolo[2,3-d]pyrimidin-4-yl, quinolin-5-yl, quinolin-6-yl, quinolin-7-yl and quinolin-8-yl, and
      • which is optionally substituted one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom, a methyl group, a methoxy group, a hydroxy group and a morpholin-4-yl group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a 4- to 6-membered heterocycloalkyl group, a phenyl group,
    • a 2-hydroxyindan-1-yl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is selected from cyclopropyl and cyclohexyl,
      • which C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a fluorine atom or a group selected from
      • phenyl and dimethylamino,
        • wherein said phenyl substituent is optionally substituted with a fluorine atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group is selected from azetidin-3-yl, oxetan-3-yl, tetrahydro-2H-pyran-4-yl, tetrahydro-2H-thiopyran-4-yl and piperidin-4-yl,
      • which 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from methyl, ethyl, pyrazinyl, tert-butoxycarbonyl, acetyl, 1-cyclopropanecarbonyl, methylsulfonyl and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, hydroxymethyl, methoxy, cyano, —C(═O)OH, —C(═O)OCH3, —C(═O)OC(CH3)3, —C(═O)NH2, —C(═O)N(CH3)2, amino, methylamino, aminomethyl, —S(═O)2NH2 and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH—CH2—NH—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from imidazol-4-yl, 1,2-oxazol-4-yl, 1,2-oxazol-5-yl, pyrazol-3-yl, pyrazol-4-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrazinyl, pyrimidin-4-yl, pyrimidin-5-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, 1,3-benzothiazol-6-yl, pyrrolo[2,3-d]pyrimidin-4-yl, quinolin-5-yl, quinolin-6-yl, quinolin-7-yl and quinolin-8-yl,
      • which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, methoxy, hydroxy and morpholin-4-yl,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents a hydrogen atom or a halogen atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compound.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents a hydrogen atom or a fluorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents a fluorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents chlorine atom or a fluorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents chlorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R2 represents a hydrogen atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group,
    • a C3-C8-cycloalkyl group,
    • a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group,
    • a C2-C6-alkenyl group,
    • a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group,
    • a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)R6 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group, which is connected to the alkyl group via a carbon atom of the heterocycloalkyl group and which is optionally substituted with a C1-C3-alkyl group,
    • and
    • a phenyl group,
      • which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3—C-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group,
    • a C3-C8-cycloalkyl group,
    • a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group,
    • a C2-C6-alkenyl group,
    • a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group,
    • a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group and wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group, and
    • a phenyl group,
      • which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C8-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group and a phenyl group,
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3—C-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8),
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C8-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)R6 group, a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group and a phenyl group,
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C8-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, a C2-C6-alkinyl group,
    • a C4-C8-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group and a phenyl group,
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl, a C2-C6-alkinyl group,
    • a C4-C6-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)R6 group, a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
    • a —(C1-C6-alkyl)-(4- to 6-membered nitrogen containing heterocycloalkyl) group
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
    • and
    • a phenyl group, which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl, a C2-C6-alkinyl group,
    • a C4-C6-cycloalkenyl group, a (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-(4- to 6-membered nitrogen containing heterocycloalkyl) group and a phenyl group,
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
      • and
      • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group,
      • and
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-alkoxy and hydroxy,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, (C1-C6-alkyl)-N(R7)R8 group,
    • a —(C1-C6-alkyl)-N(H)C(═O)OR15 group and a phenyl group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • a C1-C6-alkyl group, a C3-C6-cycloalkyl group, a C1-C6-haloalkyl group,
    • a C1-C6-hydroxyalkyl group, a C2-C6-alkenyl group, (C1-C6-alkyl)-N(R7)R8 and a phenyl group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, 1-hydroxyethyl, allyl, (dimethylamino)methyl, 2-(dimethylamino)ethyl, pyrrolidin-1-yl-methyl and phenyl,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, 1-hydroxyethyl, allyl, aminomethyl, (dimethylamino)methyl, (tert-butoxycarbonylamino)methyl, 2-(dimethylamino)ethyl, pyrrolidin-1-yl-methyl and phenyl,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which R4 and R5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
Figure US11787797-20231017-C00009
In which partial formula (i) includes but is not limited thereto e.g.
Figure US11787797-20231017-C00010
Figure US11787797-20231017-C00011
in which X1, X2, X3, X4 and X5 represents a group independently selected from —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2— and
    • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C3-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
    • more specifically a group selected from
      • a hydrogen atom, a halogen atom or a group selected from a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group, more specifically in which groups (ii) to (x)
    • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
    • one of X1, X2, X3, X4 and X5 represents a group selected from —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
    • and one of X1, X2, X3, X4 and X5 represents a group selected from C(R12)2 and CH(R13),
    • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group, and
    • R11 represents independently from each occurrence a hydrogen atom, a halogen atom or a group selected from a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      even more specifically those ring systems as disclosed in the examples
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which R4 and R5 jointly form a 5- to 6-membered, optionally unsaturated, heterocyclic ring A of partial formula (i)
Figure US11787797-20231017-C00012
In which partial formula (i) includes but is not limited thereto e.g.
Figure US11787797-20231017-C00013
Figure US11787797-20231017-C00014
in which X1, X2, X3, X4 and X5 represents a group independently selected from —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2— and
    • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
      • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
    • more specifically a group selected from
      • a hydrogen atom, a halogen atom or a group selected from a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
        more specifically in which groups (ii) to (x)
    • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
    • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
    • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
    • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group, and
    • R11 represents independently from each occurrence a hydrogen atom, a halogen atom or a group selected from a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      even more specifically those ring systems as disclosed in the examples
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
      • —CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
      • —CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
      • —CH═C(R11)—C(R11)═N—#, in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O—, —S— and —S(═O)(═NR14)—,
      • X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3-+,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O—, —S— and —S(═O)(═NR14)—,
      • X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O— and —S—,
      • and one of X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O— and —S—,
      • and one of X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—CH(OH)—(CH2)3—#,
    • *—CH2—CH(OH)—(CH2)2—#,
    • *—(CH2)2—CH(OH)—CH2—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH═CH—CH(OH)—CH2—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#,
    • *—(CH2)3—S(═O)(═NH)—,#
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—CH═CH—CH═CH—#,
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—CH═CH—CH═CH—#,
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—,
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—CH(OH)—(CH2)3—#,
    • *—CH2—CH(OH)—(CH2)2—#,
    • *—(CH2)2—CH(OH)—CH2—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH═CH—CH(OH)—CH2—#,
    • *—(CH2)5—#,
    • and
    • *—CH═CH—CH═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • and
    • *—CH(R3)—X1—X2—X3—#,
      • in which groups represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and
    • *—CH2—X1—X2—X3—X4—X5—#,
      • in which groups represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH═CH—CH(R13)—X3—
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • X3 represents a group selected from
      • C(R12)2 and CH(R13),
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a
    • *—CH═C(R11)—C(R11)═C(R11)—#group,
      • in which group represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • and
    • *—CH(R3)—X1—X2—X3—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and
    • *—CH2—X1—X2—X3—X4—X5—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH═CH—CH(R13)—X3—
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • X3 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—(CH2)5—#,
    • and
    • *—CH═CH—CH═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R3)—X1—X2—X3—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—(CH2)3—C(H)(OH)—#,
    • and
    • *—(CH2)5—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#,
    • *—(CH2)3—S(═O)(═NH)—,#
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#,
    • *—(CH2)3—S(═O)(═NH)—,#
    • *—(CH2)3O—CH2—#,
    • and
    • *—(CH2)2—N(H)—(CH2)2—#
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#
    • *—(CH2)3O—CH2—#,
    • and
    • *—(CH2)2—N(H)—(CH2)2—#
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C3-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
      • or
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C3-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6—, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O—, —S— and —S(═O)(═NR14)—,
      • X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)CF3 group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R13)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O—, —S— and —S(═O)(═NR14)—,
      • X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represent, identically or differently, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)CF3 group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
      • or
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O— and —S—,
      • and one of X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH═C(R11)—C(R11)═C(R11)—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • and
    • *—CH═C(R11)—N═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • —N(R7)—, —O— and —S—,
      • and one of X1, X2, X3 and X4 represents a C(R12)2 group,
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—CH═CH—CH═CH—#,
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—, and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3 and X4 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3 and X4 each represent a CH2 group,
        and
  • R11 represents a hydrogen atom,
    and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • and
    • *—CH(R13)—X1—X2—X3—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and
    • *—CH2—X1—X2—X3—X4—X5—#,
      • in which groups represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH═CH—CH(R13)—X3—#,
    • and
    • *—CH═C(R11)—C(R11)═C(R11)—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • X3 represents a group selected from
      • C(R12)2 and CH(R13),
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a
    • *—CH═C(R11)—C(R11)═C(R11)—#group,
      • in which group represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and Rare linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2 #,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—CH(R3)—X1—X2—X3—#,
    • *—CH═CH—CH(R13)—X3—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • *—CH2—X1—X2—X3—X4—X5—#,
    • and
    • *—CH(R13)—X1—X2—X3—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and
    • *—CH2—X1—X2—X3—X4—X5—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • one of X1, X2, X3, X4 and X5 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)— and —S(═O)2—,
      • and one of X1, X2, X3, X4 and X5 represents a group selected from
      • C(R12)2 and CH(R13),
      • and the remaining of X1, X2, X3, X4 and X5 each represent a CH2 group,
        and
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH═CH—CH(R13)—X3—#,
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
      • X3 represents a group selected from
      • —N(R7)—, —O—, —S—, —S(═O)—, —S(═O)(═NR14)— and —S(═O)2—,
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)2—S—#,
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#,
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S—#,
    • *—(CH2)3—S(═O)(═NH)—,#
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—CH2—C(H)(C(═O)OH)—(CH2)2—#,
    • *—CH2—CF2—(CH2)2—#,
    • *—(CH2)3—C(H)(C(═O)OH)—#,
    • *—CH(OH)—(CH2)3—#,
    • *—CH2—CH(OH)—(CH2)2—#,
    • *—(CH2)2—CH(OH)—CH2—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—CH═CH—CH(OH)—CH2—#,
    • *—(CH2)5—#, and
    • *—CH═CH—CH═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—C(CH3)2—CH2—O—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)3—O—#, and
    • *—(CH2)3O—CH2—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)3—N(CH3)—#,
    • *—(CH2)3—S(═O)(═NH)—,#
    • *—(CH2)2—N(H)—(CH2)2—#
    • *—N═CH—CH═CH—#,
    • and
    • *—CH═CH—N═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—N═C(R11)—C(R11)═C(R11)—#,
    • *—CH═N—C(R11)═C(R11)—#,
    • *—CH═C(R11)—N═C(R11)—#,
    • and
    • *—CH═C(R11)—C(R11)═N—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
      • and in which groups
        and
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C6-alkyl group and a benzyl group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R6 represents a hydrogen atom or a group selected from
    • a C1-C4-alkyl group and a benzyl group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-hydroxyalkyl group and a —(C2-C6-alkyl)-N(R9)(R10) group, or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C6-alkyl group, a C2-C6-hydroxyalkyl group and a —(C2-C6-alkyl)-N(R9)(R10) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    • wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C3-alkyl group, a C2—C-hydroxyalkyl group and a —(C2-C8-alkyl)-N(R9)(R10), or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or a group selected from
    • a C1-C3-alkyl group, a C2-C3-hydroxyalkyl group and a —(C2-C3-alkyl)-N(R9)(R10),
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    • wherein said 4- to 6-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from C1-C3-alkyl, —S(═O)2(C1-C3-alkyl) and —C(═O)O(C1-C4-alkyl),
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R3 represent, independently from each occurrence, a hydrogen atom or
    • a C1-C3-alkyl group,
      or
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R8 represent, independently from each occurrence, a hydrogen atom or
    • a C1-C3-alkyl group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R7 and R8 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 7-membered heterocycloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
    or
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R9 and R10 together with the nitrogen to which they are attached represent a nitrogen containing 4- to 6-membered heterocycloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
    • a C1-C3-alkyl group, a C1-C3-haloalkyl group, a C1-C3-alkoxy group, a C1-C3-haloalkoxy group and a cyano group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R11 represents a hydrogen atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or
    • a C1-C3-alkyl group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R13 represents a group selected from
    • a hydroxy group, a —C(═O)OR6 group and a —C(═O)N(R7)(R8) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R13 represents a group selected from
    • a hydroxy group and a —C(═O)OR6 group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R14 represents a hydrogen atom or a group selected from
    • a cyano group and a —C(═O)CF3 group,
      or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R14 represents a hydrogen atom,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R14 represents a group selected from a cyano group and a —C(═O)CF3 group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R15 represents a group selected from a C1-C6-alkyl group and a benzyl group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R15 represents a group selected from a C1-C4-alkyl group and a benzyl group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R15 represents a C1-C4-alkyl group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, wherein said 4- to 6-membered heterocycloalkyl group is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, and said 4- to 6-membered heterocycloalkyl group is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
        and
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
        and
  • R2 represents a hydrogen atom or a fluorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from
      • C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
        and
  • R2 represents a chlorine atom or a fluorine atom,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group, a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
  • R2 represents a hydrogen atom or a fluorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C3-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • a phenyl group which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
        and
  • R2 represents a fluorine atom,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
  • R2 represents a fluorine atom,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from a phenyl group and a —N(R7)(R8) group,
      • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
    • a C2-C6-hydroxyalkyl group,
    • a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl),
      • —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • an indanyl group which is optionally substituted with a hydroxy group
    • and
    • a monocyclic or bicyclic heteroaryl group,
      • which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
        and
  • R3 represents a C1-C6-haloalkyl group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a C3-C6-cycloalkyl group, a C2-C6-hydroxyalkyl group, a —(C2-C6-alkyl)-N(R7)(R8) group,
    • a 4- to 6-membered heterocycloalkyl group, a phenyl group, an indanyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said C3-C6-cycloalkyl group is optionally substituted, one or two times, each substituent independently selected from a halogen atom or a group selected from
      • phenyl and —N(R7)(R8),
        • wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom,
      • and
      • wherein said 4- to 6-membered heterocycloalkyl group, which is connected to the rest of the molecule via a carbon atom of said 4- to 6-membered heterocycloalkyl group, is optionally substituted one or two times, each substituent independently selected from a group selected from C1-C3-alkyl, 5- to 6-membered heteroaryl, —C(═O)O(C1-C4-alkyl), —C(═O)(C1-C3-alkyl), —C(═O)(C3-C6-cycloalkyl), —S(═O)2(C1-C3-alkyl) and oxo (═O),
      • and
      • wherein said phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
      • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
      • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
      • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
      • and
      • wherein said indanyl group is optionally substituted with a hydroxy group,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-alkoxy, hydroxy and —N(R7)(R8), and
  • R3 represents a C1-C6-haloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
    • C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, hydroxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
    • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a C1-C6-haloalkyl group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group,
    • which is phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8), or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a C1-C6-haloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group,
    • which is phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(O)2, —N(O)2, and —N(R7)(R8),
    • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a C1-C6-haloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
    • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
    • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a C1-C6-haloalkyl group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group,
    • which is phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
    • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a C1-C6-haloalkyl group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group, which is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from
    • C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, hydroxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
    • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a CF3 group,
    or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group,
    • which is phenyl group is optionally substituted, one, two, three or four times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C3-haloalkyl, C1-C3-hydroxyalkyl, C1-C3-alkoxy, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C3-alkyl)-N(R7)(R8), —S(═O)2N(R7)(R8) and SF5,
    • or in which two substituents of said phenyl group, when they are attached to adjacent ring atoms, are optionally linked to one another in such a way that they jointly form a group selected from
    • —CH2—N(R7)—CH2— and —O—CH2—C(═O)—NH—,
    • and
  • R3 represents a CF3 group,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with further embodiments, the present invention provides compounds of general formula (I),
Figure US11787797-20231017-C00015
in which
  • R1 represents a group selected from
    • a 4,4-difluorocyclohexyl group, a 1-(methylsulfonyl)piperidin-4-yl group, a phenyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy, hydroxy, cyano, —C(═O)OC(CH3)3, amino and —S(═O)2NH2,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from 1,2-oxazol-4-yl, pyrazol-3-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrimidin-4-yl, pyrimidin-5-yl and indazol-5-yl,
      • and which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a chlorine atom, a methyl group and a methoxy group,
  • R2 represents a hydrogen atom or a chlorine atom or a fluorine atom,
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, (dimethylamino)methyl and phenyl,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—(CH2)3—C(H)(OH)—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • and
    • *—CH═CH—CH═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In accordance with further embodiments, the present invention provides compounds of general formula (I),
Figure US11787797-20231017-C00016
in which
  • R1 represents a group selected from
    • a 4,4-difluorocyclohexyl group, a 1-(methylsulfonyl)piperidin-4-yl group, a phenyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy, cyano, —C(═O)OC(CH3)3, amino and —S(═O)2NH2,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from 1,2-oxazol-4-yl, pyrazol-3-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrimidin-4-yl, pyrimidin-5-yl and indazol-5-yl,
      • which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a chlorine atom or a group selected from
      • methyl and methoxy,
  • R2 represents a hydrogen atom or a fluorine atom,
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, (dimethylamino)methyl and phenyl,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#
    • *—(CH2)3—C(H)(OH)—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • and
    • *—CH═CH—CH═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In accordance with further embodiments, the present invention provides compounds of general formula (I),
Figure US11787797-20231017-C00017
in which
  • R1 represents a group selected from
    • a phenyl group and a monocyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom, a chlorine atom a methyl group, an ethyl group, a difluoromethyl group, a trifluoromethyl group, a methoxy group, a hydroxy group and an amino group,
      • and
      • wherein said monocyclic heteroaryl group is selected from
      • pyridin-2-yl, pyridin-3-yl and pyridazin-3-yl,
      • which monocyclic heteroaryl group is optionally substituted one or two times, each substituent independently selected from a chlorine atom or a group selected from a methyl group and a methoxy group,
  • R2 represents a fluorine atom,
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl and phenyl,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)5—#, and
    • *—(CH2)3O—CH2—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In accordance with further embodiments, the present invention provides compounds of general formula (I),
Figure US11787797-20231017-C00018
in which
  • R1 represents a group selected from
    • a phenyl group and a monocyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy and amino,
      • and
      • wherein said monocyclic heteroaryl group is selected from
      • pyridin-2-yl, pyridin-3-yl and pyridazin-3-yl,
      • which monocyclic heteroaryl group is optionally substituted one or two times, each substituent independently selected from a chlorine atom or a group selected from
      • methyl and methoxy,
  • R2 represents a fluorine atom,
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl and phenyl,
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)5—#,
    • and
    • *—(CH2)3O—CH2—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a 4,4-difluorocyclohexyl group, a 1-(methylsulfonyl)piperidin-4-yl group, a phenyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy, hydroxy, cyano, —C(═O)OC(CH3)3, amino and —S(═O)2NH2,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from 1,2-oxazol-4-yl, pyrazol-3-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrimidin-4-yl, pyrimidin-5-yl and indazol-5-yl,
      • and which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a chlorine atom, a methyl group and a methoxy group,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a 4,4-difluorocyclohexyl group, a 1-(methylsulfonyl)piperidin-4-yl group, a phenyl group and a monocyclic or bicyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy, cyano, —C(═O)OC(CH3)3, amino and —S(═O)2NH2,
      • and
      • wherein said monocyclic or bicyclic heteroaryl group is selected from 1,2-oxazol-4-yl, pyrazol-3-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyridazin-3-yl, pyrimidin-4-yl, pyrimidin-5-yl and indazol-5-yl,
      • which monocyclic or bicyclic heteroaryl group is optionally substituted one, two or three times, each substituent independently selected from a chlorine atom or a group selected from
      • methyl and methoxy,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl, (dimethylamino)methyl and phenyl,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#
    • *—(CH2)3—C(H)(OH)—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)5—#,
    • *—(CH2)3O—CH2—#,
    • and
    • *—CH═CH—CH═CH—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group and a monocyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy, hydroxy and amino,
      • and
      • wherein said monocyclic heteroaryl group is selected from
      • pyridin-2-yl, pyridin-3-yl and pyridazin-3-yl,
      • which monocyclic heteroaryl group is optionally substituted one or two times,
      • each substituent independently selected from a chlorine atom or a group
      • selected from
      • methyl and methoxy,
        or tautomers, N-oxides, or salts thereof, or salts of tautomers or N-oxides of said compounds.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R1 represents a group selected from
    • a phenyl group and a monocyclic heteroaryl group,
      • wherein said phenyl group is optionally substituted, one, two or three times, each substituent independently selected from a fluorine atom or a chlorine atom or a group selected from
      • methyl, ethyl, difluoromethyl, trifluoromethyl, methoxy and amino,
      • and
      • wherein said monocyclic heteroaryl group is selected from
      • pyridin-2-yl, pyridin-3-yl and pyridazin-3-yl,
      • which monocyclic heteroaryl group is optionally substituted one or two times, each substituent independently selected from a chlorine atom or a group selected from
      • methyl and methoxy,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R3 represents a group selected from
    • propyl, cyclohexyl, trifluoromethyl and phenyl,
      and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, in which:
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—(CH2)4—#,
    • *—(CH2)2—O—CH2—#,
    • *—(CH2)5—#,
    • and
    • *—(CH2)3O—CH2—#,
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, which are selected from the group consisting of:
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yl-oxy]-N-[3-(trifluoromethyl)phenyl]benzamide,
  • N-(1-acetylpiperidin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(3-chloropyridin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(3,5-dimethylpyrazin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(5-methylpyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(5-chloropyrimidin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(3-chloropyridin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]-N-[1-(pyrazin-2-yl)piperidin-4-yl]benzamide,
  • N-[1-(cyclopropylcarbonyl)piperidin-4-yl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo-[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-[1-(methylsulfonyl)piperidin-4-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(1-methyl-2-oxopiperidin-(4R,S)-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide, mixture of diastereomers,
  • 5-fluoro-N-(1-methylpiperidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(2-aminophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-[2-(methylamino)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(2-amino-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(4-amino-2-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[3-(trifluoromethyl)-phenyl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-[2-chloro-4-(pentafluoro-lambda6-sulfanyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(oxetan-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-N-(1,3,5-trimethyl-1H-pyrazol-4-yl)benzamide,
  • N-(2-chloro-3-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-4-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-3,5-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(3,5-dimethyl-1,2-oxazol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-methyl-1,2-oxazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-methyl-1H-imidazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(3-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-[2-(dimethylamino)ethyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(1-methylpiperidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[4-(trifluoromethyl)-phenyl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-cyclopropyl-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-cyano-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-cyano-5-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • tert-butyl 3-{[5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl]amino}azetidine-1-carboxylate,
  • N-(azetidin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(6-methoxy-2-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[1-(methylsulfonyl)piperidin-4-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(4,4-difluorocyclohexyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(1-ethylazetidin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-[4-(dimethylamino)cyclohexyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-ethylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-fluoro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-fluoro-2,6-dimethylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,4-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-N-(2,4,6-trimethylpyridin-3-yl)benzamide,
  • N-(6-chloro-2,3-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methoxy-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-phenyl-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(2,4,6-trifluoro-phenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[2-(trifluoromethyl)-phenyl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(3-methylpyridin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chlorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-cyano-3-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(1-methyl-1H-pyrazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(tetrahydro-2H-pyran-4-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-5-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-5-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(3-methylpyridin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(1,3-dimethyl-1H-pyrazol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(1,4-dimethyl-1H-pyrazol-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-hydroxy-2-methylpropyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-(hydroxymethyl)-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[3-(hydroxymethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-8-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-6-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 3-{[5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl]amino}-4-methylbenzoic acid,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-5-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methylquinolin-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-7-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(3-sulfamoyl-phenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methylquinolin-6-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methyl-1,3-benzothiazol-6-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(6-methyl-1H-indazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(3-oxo-3,4-dihydro-2H-1,4-benzoxazin-7-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,3-dimethoxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(1H-indazol-7-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[1-(4-fluorophenyl)cyclopropyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-fluoro-3-hydroxy-1H-indazol-6-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[(1S,2S)-2-hydroxy-2,3-dihydro-1H-inden-1-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(3-carbamoyl-2-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(4,4-difluorocyclohexyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methoxy-5-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxy-2-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-[3-(dimethylcarbamoyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[1-(methylsulfonyl)piperidin-4-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[6-(morpholin-4-yl)pyridazin-3-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methoxypyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-methoxypyrimidin-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(4,6-dimethoxypyrimidin-5-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(3,5-dimethylpyrazin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxypyrazin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methoxypyrazin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxypyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(5,6-dimethylpyrimidin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-methylpyrimidin-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(2,4-dimethylpyrimidin-5-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methylpyrazin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methylpyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-methylpyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-fluoropyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[3-(morpholin-4-yl)pyrazin-2-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(4,6-dimethylpyrimidin-5-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-(3-amino-2-methylphenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-[4-amino-2-(trifluoromethyl)phenyl]-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-methyl-4-sulfamoylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-[2-(aminomethyl)-6-methylphenyl]-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • methyl 2-({2-[(1R)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoyl}amino)-3-methylbenzoate,
  • 2-[(1R)-1-cyclohexylethoxy]-N-(2,3-dihydro-1H-isoindol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-(5-amino-3-methylpyridin-2-yl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-({2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)benzoyl}amino)-3-methylbenzoic acid,
  • tert-butyl 4-({2-[(1S)-1-cyclohexylethoxy]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)benzoyl}amino)-3-methylbenzoate,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[3-(trifluoromethyl)phenyl]benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(2,4,6-trifluorophenyl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[2-(trifluoromethyl)phenyl]benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methylpyridin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(2,4-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-[2-(dimethylamino)ethyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-fluoro-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(1-methyl-1H-pyrazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide,
  • N-(2-cyano-4-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-(2-chloro-5-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methyl-5-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methylpyridin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
  • N-(2-chloro-6-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methyl-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methyl-4-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-(2-chloro-3-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(1,3-dimethyl-1H-pyrazol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(1-methylpiperidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-N-(1,4-dimethyl-1H-pyrazol-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-hydroxy-2-methylpropyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-(hydroxymethyl)-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methyl-1,2-oxazol-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-(2-chloro-4-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
  • 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-fluoro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-3,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(3-fluoro-2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-N-(2,4,6-trifluoro-phenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-dichloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(4,5-difluoro-2-methylphenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-4-(trifluoromethyl)phenyl]-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-5-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-fluoro-2,6-dimethylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-cyano-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
  • N-(4-chloro-2-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4,6-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,4-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methoxy-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(6-chloro-2,3-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]-N-[3-(trifluoro-methyl)phenyl]benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]-N-[3-(trifluoromethyl)phenyl]benzamide,
  • 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-fluoro-6-methylphenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-6-methylphenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-dichloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(4-fluoro-2,6-dimethylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(4-chloro-2-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2-chloro-4,6-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,4-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-methoxy-6-methylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(6-chloro-2,3-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]-oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamid,e
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(8-methyl-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyrimidin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro[1,3]thiazolo[2,3-c][1,2,4]triazol-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7,8,9-tetrahydro-3H-[1,2,4]triazolo[4,3-a]azepin-2(5H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyrazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]thiazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-4-(6,6-dimethyl-3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-2(3H)-yl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 4-(6,6-difluoro-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(2,6-difluoro-phenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-b]pyridazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 2-(4-[(2,6-difluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}phenyl)-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-8-(R,S)-carboxylic acid, mixture of diastereomers,
  • 2-(4-[(2-chloro-6-fluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-phenyl)-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-8-(R,S)-carboxylic acid,
  • mixture of diastereomers,
  • 2-(4-[(2-chloro-6-fluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-phenyl)-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-6-(R,S)-carboxylic acid,
  • mixture of diastereomers,
  • N-(2,6-difluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-2-{[(2R,3R)-3-hydroxybutan-2-yl]oxy}-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2R)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1-(pyrrolidin-1-yl)propan-2-yl]oxy}benzamide,
  • N-[2-(difluoromethyl)phenyl]-2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-N-(3,5-dimethylpyrazin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(4-methylpyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide,
  • rac-2-{[4-(dimethylamino)butan-2-yl]oxy}-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzamide,
  • rac-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]-oxazin-2(8H)-yl)-2-{[1-(pyrrolidin-1-yl)propan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7,8,9-tetrahydro-3H-[1,2,4]triazolo[4,3-d][1,4]-diazepin-2(5H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide, and
  • N-(2,6-difluorophenyl)-5-fluoro-4-[(8R,S)-8-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo-[4,3-a]pyridin-2(3H)-yl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide, mixture of diastereomers,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
In further embodiments, the present invention provides compounds of formula (I), supra, which are selected from the group consisting of:
  • 5-chloro-N-(2,6-difluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-(2-chloro-6-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-[1-(4-fluorophenyl)cyclopropyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-[2-(difluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-(4-methylpyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • 5-chloro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
  • 5-chloro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluoro-4-hydroxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluoro-3-hydroxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(8-imino-3,8-dioxo-5,6,7,8-tetrahydro-8λ6-[1,2,4]triazolo-[3,4-b][1,3]thiazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(7-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(6-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(6-hydroxy-3-oxo-5,6-dihydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • N-(2,6-difluorophenyl)-5-fluoro-4-(8-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide,
  • rac-tert-butyl [2-{2-[(2-chloro-6-fluorophenyl)carbamoyl]-4-fluoro-5-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)phenoxy}propyl]carbamate, and
  • rac-2-{[1-aminopropan-2-yl]oxy}-N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide, salt with hydrochloric acid,
    and tautomers, N-oxides, and salts thereof, and salts of tautomers or N-oxides.
The present invention provides any sub-combination within any embodiment or aspect of the present invention of compounds of general formula (I), supra.
The present invention provides any sub-combination within any embodiment or aspect of the present invention of intermediate compounds of general formulae (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX), (X) and (XXI).
The present invention provides the compounds of general formula (I) which are disclosed in the Example Section of this text, infra.
The compounds according to the invention of general formula (I) can be prepared according to the following schemes 1, 2, 3, 4 and 5. The schemes and procedures described below illustrate synthetic routes to the compounds of general formula (I) of the invention and are not intended to be limiting. It is clear to the person skilled in the art that the order of transformations as exemplified in schemes 1, 2, 3, 4 and 5 can be modified in various ways. The order of transformations exemplified in these schemes is therefore not intended to be limiting. In addition, interconversion of any of the substituents, R1, R2, R3, R4 or R5 can be achieved before and/or after the exemplified transformations. These modifications can be such as the introduction of protecting groups, cleavage of protecting groups, reduction or oxidation of functional groups, halogenation, metallation, substitution or other reactions known to the person skilled in the art. These transformations include those which introduce a functionality which allows for further interconversion of substituents. Appropriate protecting groups and their introduction and cleavage are well-known to the person skilled in the art (see for example T. W. Greene and P. G. M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999). Specific examples are described in the subsequent paragraphs.
Synthetic Routes
Five routes for the preparation of compounds of general formula (I) are described in schemes 1, 2, 3, 4 and 5.
Synthetic Route 1
Figure US11787797-20231017-C00019
Compounds of general formulae (II), (IV), (VI) and (X) are either commercially available or can be prepared according to procedures available from the public domain, as understandable to the person skilled in the art. Specific examples are described in the Experimental Section.
(II)→(III):
tert-Butyl benzoates of general formula (III) can be prepared from benzoic acid derivatives of general formula (II) according to procedures available from the public domain, as understandable to the person skilled in the art.
In connection with the method of the invention, the use of di-tert-butyl-dicarbonate in tert-butanol was preferable.
Alternatively, the tert-butyl benzoates of general formula (III) can be prepared from benzoic acid derivatives of general formula (II) by in situ formation of the corresponding acid chlorides and subsequent reaction with tert-butanol.
In situ formation of acid chlorides from benzoic acids of general formular (II) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide.
(III)+(IV)→(V):
The formation of tert-butyl benzoates of general formula (V) can be accomplished by the reaction of triazolinones of general formula (IV) with tert-butyl benzoates of general formula (III) in the presence of a base. In connection with the method of the invention, the use of 1,8-diazabicyclo[5.4.0]undec-7-ene as organic base in acetonitrile at 80° C. was preferable.
(V)+(VI)→(VII)→(VIII):
The formation of benzoic acids of general formula (VIII) can be accomplished by reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) in the presence of a base, and subsequent saponification of the resulting ester of general formula (VII).
Bases that can be employed for the reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example sodium hydride, sodium tert-butanolate, potassium tert-butanolate, or cesium carbonate. In connection with the method of the invention, potassium hexamethyldisilazide solution in tetrahydrofuran was preferrably used as organic base.
Solvents that can be used for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example tetrahydrofuran, dimethyl sulfoxide and N,N-dimethylformamide. In connection with the method according to the invention tertahydrofuran was preferrably used as solvent.
Reaction temperatures for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example ranging from room temperature to 130° C. Cooling of the reaction mixture is optionally necessary on adding the reactants or bases. In connection with the method of the invention, cooling the reaction to −10° C. prior addition of potassium hexamethyldisilazide solution in tetrahydrofuran and subsequent running the reaction at room temperature was preferable.
Suitable reaction times for the reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are ranging from 1h several days.
The reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) can also result in transesterification, such as the tert-butoxide moiety of the tert-butyl benzoates of general formula (V) can be replaced by the alkoxide R3CH(CH3)O moiety of the alcohols of general formula (VI). In order to obtain the benzoic acids of general formula (VIII), subsequent ester hydrolysis is required.
Ester hydrolysis can be achieved by various methods which are well known to the person skilled in the art, for example by treatment of the esters with lithium hydroxide, sodium hydroxide or potassium hydroxide, in solvents, such as, for example water, 1,4-dioxane, ethanol or tetrahydrofuran or mixtures thereof. The reactions can be carried out at temperatures ranging from room temperature to the boiling point of the respective solvent or solvent mixture.
In connection with the method of the invention, use of lithium hydroxide in water/dioxane was preferable.
(VIII)→(IX), (VIII)/((IX)+(X)→(I):
The compounds of general formula (I) can be prepared by the reaction of the benzoic acids of general formula (VIII) with amines of general formula (X) either by
    • in situ formation of the corresponding acid chlorides of general formula (IX) and subsequent reaction with amines of general formula (X),
      or by
    • amide coupling of the benzoic acids of general formula (VIII) with amines of general formula (X).
In situ formation of acid chlorides of general formula (IX) from benzoic acids of general formular (VIII) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide. In connection with the method according to the invention, oxalyl chloride is preferably used in the presence of N,N-dimethylformamide.
Suitable solvents for the in situ formation of acid chlorides of general formula (IX) from benzoic acids of general formula (VIII) include aprotic nonpolar solvents such as for example dichloromethane or toluene. In connection with the method according to the invention, dichloromethane is preferably used as solvent.
Suitable reaction temperatures for the in situ formation of acid chlorides of general formula (IX) from benzoic acids of general formula (VIII) mostly reflect the boiling point of the solvents used in the reaction. In connection with the method according to the invention, adding of oxalyl chloride was carried out at 0° C. and the reaction mixture was subsequently allowed to warm up to room temperature.
Subsequent reactions of the in situ formed acid chlorides of general formula (IX) with amines of general formula (X) can be carried out in the presence of an organic base. Suitable organic bases are for example triethylamine, pyridine or N-ethyl-N,N-diisopropylamine. In connection with the method according to the invention, triethylamine was preferably used as organic base.
Suitable solvents for the reaction of acid chlorides of general formula (IX) with amines of general formula (X) include aprotic polar solvents such as for example acetonitrile, N,N-dimethylformamide or aprotic nonpolar solvents such as dichloromethane. In connection with the method according to the invention dichoromethane was used as solvent.
Suitable coupling reagents for the reaction of benzoic acids of general formula (VIII) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
Suitable organic bases for the amide coupling of benzoic acids of general formula (VIII) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine or triethylamine.
Suitable solvents for the for the amide coupling of benzoic acids of general formula (VIII) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
For coupling of the amide bond, other methods which are well known to the person skilled in the art are also suitable, such as a condensation between amine and acid using propanephosphonic acid anhydride (T3P) as coupling reagent.
In connection with the invention, formation of the compounds according to the invention of general formula (I) were preferrably accomplished by in situ formation of acid chlorides of general formula (IX) from benzoic acids of general formula (VIII) and subsequent reaction with amines of general formula (X).
Synthetic Route 2
Figure US11787797-20231017-C00020
Compounds of general formulae (XI), (IV), (VI) and (X) are either commercially available or can be prepared according to procedures available from the public domain, as understandable to the person skilled in the art. Specific examples are described in the Experimental Section.
(XI)+(VI)→(XII):
Nitriles of general formula (XII) can be prepared from nitriles of general formula (XI) and with alcohols of general formula (VI) according to procedures available from the public domain, as understandable to the person skilled in the art.
In connection with the method of the invention, the use of sodium hydride in DMF was preferable.
Alternatively, for alcohols of sufficiently high acidity the use of potassium carbonate was preferable.
(XII)→(XIII):
The formation of benzoates of general formula (XIII) can be accomplished by hydrolysis of nitriles of general formula XII using strong acids or bases.
In connection with the method of the invention, the use of sodium hydroxide in ethanol at 90° C. was preferable.
(XIII)→(XIV)+(X)→(XV):
The compounds of general formula (XV) can be prepared by the reaction of the benzoic acids of general formula (XIII) with amines of general formula (X) either by
    • in situ formation of the corresponding acid chlorides of general formula (XIV) and subsequent reaction with amines of general formula (X),
      or by
    • amide coupling of the benzoic acids of general formula (XV) with amines of general formula (X).
In situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formular (XIII) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide. In connection with the method according to the invention, oxalyl chloride is preferably used in the presence of N,N-dimethylformamide.
Suitable solvents for the in situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formula (XIII) include aprotic nonpolar solvents such as for example dichloromethane or toluene. In connection with the method according to the invention, dichloromethane is preferably used as solvent.
Suitable reaction temperatures for the in situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formula (XIII) mostly reflect the boiling point of the solvents used in the reaction. In connection with the method according to the invention, adding of oxalyl chloride was carried out at 0° C. and the reaction mixture was subsequently allowed to warm up to room temperature.
Subsequent reactions of the in situ formed acid chlorides of general formula (XIV) with amines of general formula (X) can be carried out in the presence of an organic base. Suitable organic bases are for example triethylamine, pyridine or N-ethyl-N,N-diisopropylamine. In connection with the method according to the invention, triethylamine was preferably used as organic base.
Suitable solvents for the reaction of acid chlorides of general formula (XIV) with amines of general formula (X) include aprotic polar solvents such as for example acetonitrile, N,N-dimethylformamide or aprotic nonpolar solvents such as dichloromethane. In connection with the method according to the invention dichoromethane was used as solvent.
Suitable coupling reagents for the reaction of benzoic acids of general formula (XIII) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
Suitable organic bases for the amide coupling of benzoic acids of general formula (XIII) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine or triethylamine.
Suitable solvents for the for the amide coupling of benzoic acids of general formula (XIII) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
For coupling of the amide bond, other methods which are well known to the person skilled in the art are also suitable, such as a condensation between amine and acid using propanephosphonic acid anhydride (T3P) as coupling reagent.
In connection with the invention, formation of the compounds according to the invention of general formula (XV) were preferrably accomplished by in situ formation of acid chlorides of general formula (XIV) from benzoic acids of general formula (XIII) and subsequent reaction with amines of general formula (X).
(XV)+(IV)→(I):
Compounds according to the invention of general formula (I) can be prepared from halides of general formula (XV) and from triazolones of general formula (IV) using transition metals as catalysts.
Intermediates of general formula (XV) can be reacted with a suitable triazolone of general formula (IV), such as, for example 3-ethyl-4-methyl-1H-1,2,4-triazol-5(4H)-one, in the presence of a suitable base, such as, for example cesium carbonate, and a suitable palladium catalyst, such as for example (1E,4E)-1,5-diphenylpenta-1,4-dien-3-one-palladium, in the presence of a suitable ligand, such as for example (9,9-dimethyl-9H-xanthene-4,5-diyl)bis(diphenylphosphine), in a suitable solvent system, such as, for example, dioxane, in a temperature range from room temperature to the boiling point of the respective solvent, preferably the reaction is carried out at 100° C. to furnish compounds of general formula (I). Alternatively the following palladium catalysts can be used:
allylpalladium chloride dimer, dichlorobis(benzonitrile)palladium (II), palladium (II) acetate, palladium (II) chloride, tetrakis(triphenylphosphine)palladium (O), tris(dibenzylideneacetone)dipalladium (O), chloro(2′-amino-1,1′-biphenyl-2-yl)palladium(II) dimer, (2′-amino-1,1′-bipheny-2-yl)methanesulfonatopalladium(II) dimer, trans-di(p-acetato)bis[o-(di-o-tolylphosphino)benzyl]dipalladium(II) [cataCXium® C], allylchloro[1,3-bis(2,4,6-trimethylphenyl)imidazol-2-ylidene]palladium(II), allylchloro[1,3-bis(2,6-diisopropylphenyl)imidazol-2-ylidene]palladium(II), chloro[(1,3-dimesitylimidazol-[1,3-bis(2,4,6-trimethylphenyl)-1,3-dihydro-2H-imidazol-2-ylidene](chloro){2-[(dimethylamino)methyl]phenyl}palladium, chloro[(1,2,3-N)-3-phenyl-2-propenyl][1,3-bis(2,6-di-iso-propylphenyl)imidazol-2-ylidene]palladium(II), [2-(acetylamino)phenyl]{1,3-bis[2,6-di(propan-2-yl)phenyl]-1,3-dihydro-2H-imidazol-2-ylidene}chloropalladium, {1,3-bis[2,6-di(propan-2-yl)phenyl]-1,3-dihydro-2H-imidazol-2-ylidene}(chloro){2-[(dimethylamino)methyl]phenyl} palladium, {1,3-bis[2,6-di(propan-2-yl)phenyl]-2,3-dihydro-1H-imidazol-2-yl}(dichloro)(3-chloropyridine-kappaN)palladium, [1,3-bis(2,6-diisopropylphenyl) imidazol-2-ylidene](3-chloropyridyl)palladium(II) dichloride, [2-(acetylamino)-4-methoxyphenyl]{1,3-bis[2,6-di(propan-2-yl)phenyl]-1,3-dihydro-2H-imidazol-2-ylidene}chloropalladium, {1,3-bis[2,6-di(propan-2-yl)phenyl]-1,3-dihydro-2H-imidazol-2-ylidene}(chloro){2-[(dimethylamino)methyl]-3,5-dimethoxyphenyl}palladium, dichloro[1,3-bis(2,6-di-3-pentylphenyl)imidazol-2-ylidene](3-chloropyridyl) palladium(II), dichloro(di-p-chloro)bis[1,3-bis(2,6-di-iso-propylphenyl) imidazol-2-ylidene]dipalladium(II), 2-(2′-di-tert-butylphosphine)biphenylpalladium(II) acetate, chloro[dicyclohexyl(2′,6′-dimethoxybiphenyl-2-yl)-lambda5-phosphanyl][2-(phenyl-kappaC2)ethanaminato-kappaN]palladium, [2-(2-aminoethyl)phenyl](chloro)palladium-di-tert-butyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane, {dicyclohexyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane}{2-[2-(methylazanidyl-kappaN)ethyl]phenyl-kappaC1}palladium, chloro(2-dicyclohexylphosphino-2′,6′-dimethoxy-1,1′-biphenyl)(2′-amino-1,1′-biphenyl-2-yl) palladium(II), [2′,6′-bis(propan-2-yloxy)biphenyl-2-yl](dicyclohexyl)phosphane-[2-(2-aminoethyl) phenyl](chloro) palladium, [2-(2-aminoethyl)phenyl](chloro){dicyclohexyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]-lambda5-phosphanylidene}palladium, 2′-(dicyclohexylphosphanyl)-N,N,N′,N′-tetramethylbiphenyl-2,6-diamine-(2′-aminobiphenyl-2-yl)(chloro)palladium, chloro(2-dicyclohexylphosphino-2′,6′-di-iso-propoxy-1,1′-biphenyl)(2-amino-1,1′-biphenyl-2-yl)palladium(II), [2′-(azanidyl-kappaN)biphenyl-2-yl-kappaC2](chloro){dicyclohexyl [2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]-lambda5-phosphanyl}palladium, (2′-aminobi-phenyl-2-yl)(methanesulfonato-kappaO)palladium-di-tert-butyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane, (2′-aminobiphenyl-2-yl)palladium(1+) methanesulfonate-di-tert-butyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane, dicyclohexyl[3,6-dimethoxy-2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane-[2-(2-aminoethyl) phenyl](chloro)palladium, (2′-aminobiphenyl-2-yl)palladium(1+) methanesulfonate-2′-(dicyclohexylphosphanyl)-N,N,N′,N′-tetramethylbiphenyl-2,6-diamine, sodium 2′-(dicyclohexylphosphanyl)-2,6-dimethoxybiphenyl-3-sulfonate-(2′-aminobiphenyl-2-yl)(chloro)palladium, chloro(2-dicyclohexylphosphino-2′,4′,6′-tri-iso-propyl-1,1′-biphenyl)[2-(2-aminoethyl)phenyl]palladium(II), (2′-aminobiphenyl-2-yl)(methane-sulfonato-kappaO)palladium-[2′,6′-bis(propan-2-yloxy)biphenyl-2-yl](dicyclohexyl) phosphane, (2′-aminobiphenyl-2-yl)(methanesulfonato-kappaO)palladium-dicyclohexyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane, (2′-aminobiphenyl-2-yl)palladium(1+) methanesulfonate-dicyclohexyl[2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane, dicyclohexyl[3,6-dimethoxy-2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane-(2′-aminobiphenyl-2-yl)(chloro)palladium, (2′-aminobiphenyl-2-yl)(methanesulfonato-kappaO)palladium-di-tert-butyl[3,6-dimethoxy-2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane, (2′-aminobiphenyl-2-yl)(methanesulfonato-kappaO)palladium-dicyclohexyl[3,6-dimethoxy-2′,4′,6′-tri(propan-2-yl)biphenyl-2-yl]phosphane or the following ligands:
    • racemic-2,2′-bis(diphenylphosphino)-1,1′-binaphthyl, rac-BINAP, 1,1′-bis(diphenyl-phosphino)ferrocene, bis(2-diphenylphosphinophenyl)ether, di-tert-butylmethylphosphonium tetrafluoroborate, 2-(di-tert-butylphosphino)biphenyl, tri-tert-butylphosphonium tetrafluoroborate, tri-2-furylphosphine, tris(2,4-di-tert-butylphenyl)phosphite, tri-o-tolylphosphine, (9,9-dimethyl-9H-xanthene-4,5-diyl)bis(diphenylphosphine), dicyclohexyl(2′,4′,6′-triisopropyl-3,6-dimethoxybiphenyl-2-yl)phosphine, di-tert-butyl (2′,4′,6′-triisopropyl-3,6-dimethoxybiphenyl-2-yl)phosphine, di-tert-butyl(2′,4′,6′-triiso propylbiphenyl-2-yl)phosphine, dicyclohexyl(2′,4′,6′-triisopropylbiphenyl-2-yl) phosphine, di-tert-butyl(2′,4′,6′-triisopropyl-3-methoxy-6-methylbiphenyl-2-yl)phos-phine, di-tert-butyl(2′,4′,6′-triisopropyl-3,4,5,6-tetramethylbiphenyl-2-yl) phosphine, adamantan-1-yl(adamantan-2-yl)(2′,4′,6′-triisopropyl-3,6-dimethoxybiphenyl-2-yl) phosphine, dicyclohexyl(2′,6′-dimethoxybiphenyl-2-yl)phosphine, dicyclohexyl(2′,6′-diisopropoxybiphenyl-2-yl)phosphine, 2′-(dicyclohexylphosphino)-N,N-dimethyl-biphenyl-2-amine, 2′-(di-tert-butylphosphino)-N,N-dimethylbiphenyl-2-amine, 2′-(di-phenylphosphino)-N,N,N′,N′-tetramethylbiphenyl-2,6-diamine, di-tert-butyl(2′,4′,6′-tricyclohexyl-3,6-dimethoxybiphenyl-2-yl)phosphine, bis[3,5-bis(trifluoromethyl)phe-nyl] (2′,4′,6′-triisopropyl-3,6-dimethoxybiphenyl-2-yl)phosphine, biphenyl-2-yl(di-tert-butyl)phosphine, dicyclohexyl(2′-methylbiphenyl-2-yl)phosphine, biphenyl-2-yl (dicyclohexyl)phosphine, 2′-(dicyclohexylphosphino)-N,N-dimethylbiphenyl-2-amine, 2′-(dicyclohexylphosphino)-N,N,N′,N′-tetramethylbiphenyl-2,6-diamine, sodium 2′-(dicyclohexylphosphino)-2,6-diisopropylbiphenyl-4-sulfonate, sodium 2′-(dicyclohexylphosphino)-2,6-dimethoxybiphenyl-3-sulfonate, 1,1′-binaphthalen-2-yl(di-tert-butyl)phosphine, 1,3-bis(2,4,6-trimethylphenyl)-1,3-dihydro-2H-imidazol-2-ylidene, 1,3-bis[2,6-di(propan-2-yl)phenyl]-1,3-dihydro-2H-imidazol-2-ylidene.
      Synthetic Route 3
Figure US11787797-20231017-C00021
Compounds of general formulae (XVI), (IV), (VI) and (X) are either commercially available or can be prepared according to procedures available from the public domain, as understandable to the person skilled in the art. Specific examples are described in the Experimental Section.
Nitriles of general formula (XVII) can be prepared from nitriles of general formula (XVI) and triazolinones of general formula (IV) in the presence of a base. In connection with the method of the invention, the use of potassium carbonate as base in acetonitrile at 80° C. was preferable.
The formation of benzoates of general formula (XVIII) can be accomplished by hydrolysis of nitriles of general formula XVII using strong acids or bases. In connection with the method of the invention, the use of sodium hydroxide in ethanol at 85° C. was preferable.
The compounds of general formula (XIX) can be prepared by the reaction of the benzoic acids of general formula (XVIII) with amines of general formula (X) by amide coupling.
Suitable coupling reagents for the reaction of benzoic acids of general formula (XVIII) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
Suitable organic bases for the amide coupling of benzoic acids of general formula (XVIII) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine, N-methylpyrollidine, or triethylamine.
Suitable solvents for the for the amide coupling of benzoic acids of general formula (XVIII) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
For coupling of the amide bond, other methods which are well known to the person skilled in the art are also suitable, such as a condensation between amine and acid using propanephosphonic acid anhydride (T3P) as coupling reagent, or transformation of benzoic acids of general formula (XVIII) into their respective acid chlorides and subsequent reaction with amines of general formula (X) as described above.
In connection with the invention, formation of the compounds of general formula (XIX) were preferrably accomplished by HATU mediated amide coupling of benzoic acids of general formula (XVIII) and amines of general formula (X).
The formation of compounds of general formula (I) can be accomplished by reaction of amides of general formula (XIX) and alcohols of general formula (VI) in the presence of a base. Bases that can be employed for the reaction of amides of general formula (XIX) with alcohols of general formula (VI) are for example sodium hydride, sodium tert-butanolate, potassium tert-butanolate, or cesium carbonate. In connection with the method of the invention, sodium hydride was preferrably used as organic base.
Solvents that can be used for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example tetrahydrofuran, dimethyl sulfoxide and N,N-dimethylformamide. In connection with the method according to the invention N,N-dimethylformamide was preferrably used as solvent.
Reaction temperatures for the reactions of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are for example ranging from room temperature to 80° C. In connection with the method of the invention, the reaction of alcohols of general formula (VI) with sodium hydride was preferably performed at room temperature for 1h before addition of amides of formula (XIX) and subsequent heating of the reaction mixture to 80° C.
Suitable reaction times for the reaction of tert-butyl benzoates of general formula (V) with alcohols of general formula (VI) are ranging from 3h to several days.
Synthetic Route 4
Figure US11787797-20231017-C00022
Compounds of general formulae (II), (IV), (VI) and (X) are either commercially available or can be prepared according to procedures available from the public domain, as understandable to the person skilled in the art. Specific examples are described in the Experimental Section.
Amides of general formula (XX) can be prepared by the reaction of the benzoic acids of general formula (II) with amines of general formula (X) by amide coupling.
Suitable coupling reagents for the reaction of benzoic acids of general formula (II) with amines of general formula (X) are for example O-(7-aza-1H-benzotriazol-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU), dicyclohexylcarbodiimide or a combination of 1H-benzotria-1-ol and 1-ethyl-3-[3-(diemthylaminopropyl]carbodiimide hydrochloride.
Suitable organic bases for the amide coupling of benzoic acids of general formula (II) with amines of general formula (X) are for example 4-(dimethylamino)pyridine, N-ethyl-N,N-diisopropylamine, N-methylpyrollidine, or triethylamine.
Suitable solvents for the for the amide coupling of benzoic acids of general formula (II) with amines of general formula (X) are for example N,N-dimethylformamide, dichoromethane or tetrahydrofuran.
For coupling of the amide bond, other methods which are well known to the person skilled in the art are also suitable, such as a condensation between amine and acid using propanephosphonic acid anhydride (T3P) as coupling reagent, or transformation of benzoic acids of general formula (II) into their respective acid chlorides and subsequent reaction with amines of general formula (X) as described above.
In connection with the invention, formation of the compounds of general formula (XX) were preferrably accomplished by HATU mediated amide coupling of benzoic acids of general formula (II) and amines of general formula (X).
Alternatively, amides of general formula (XX) can be prepared from benzoic acid derivatives of general formula (II) by in situ formation of the corresponding acid chlorides and subsequent reaction with amines of general formula (X).
In situ formation of acid chlorides from benzoic acids of general formular (II) can be accomplished, for example by using oxalyl chloride or thionyl chloride, both reagents used in the presence of catalytic amount of N,N-dimethylformamide.
(XX)+(IV)→(XIX):
The formation of compounds of general formula (XIX) can be accomplished by the reaction of triazolinones of general formula (IV) with amides of general formula (XX) in the presence of a base, such as potassium carbonate. In connection with the method of the invention, the use of 1,8-diazabicyclo[5.4.0]undec-7-ene as organic base in acetonitrile at 80° C. was preferable.
The formation of compounds of general formula (I) can be accomplished by reaction of amides of general formula (XIX) and alcohols of general formula (VI) in the presence of a base. Bases that can be employed for the reaction of amides of general formula (XIX) with alcohols of general formula (VI) are for example sodium hydride, sodium tert-butanolate, potassium tert-butanolate, or cesium carbonate. In connection with the method of the invention, sodium hydride was preferrably used as organic base.
Solvents that can be used for the reactions of amides of general formula (XIX) with alcohols of general formula (VI) are for example tetrahydrofuran, dimethyl sulfoxide and N,N-dimethylformamide. In connection with the method according to the invention N,N-dimethylformamide was preferrably used as solvent.
Reaction temperatures for the reactions of amides of general formula (XIX) with alcohols of general formula (VI) are for example ranging from room temperature to 140° C. In connection with the method of the invention, the reaction of alcohols of general formula (VI) with sodium hydride was preferably performed at room temperature for 1h before addition of amides of formula (XIX) and subsequent heating of the reaction mixture to 80° C.
Suitable reaction times for the reaction of amides of general formula (XIX) with alcohols of general formula (VI) are ranging from 3h to several days.
Synthetic Route 5
Figure US11787797-20231017-C00023
An alternative synthesis of compounds of formula (VIII) is described in scheme 5.
Compounds of general formula (XXI) can be prepared from halides of general formula (XII) and from triazolones of general formula (IV) using transition metals as catalysts.
The formation of benzoates of general formula (VIII) can be accomplished by hydrolysis of nitriles of general formula XXI using strong acids or bases. In connection with the method of the invention, the use of sulphuric acid, acetic acid and water at 120° C. was preferable.
The synthesis of compounds of general formula (XII) and the synthesis of compounds of general formula (I) from compounds of general formula (VIII) is described above.
The order of transformations exemplified in these schemes is therefore not intended to be limiting. In addition, interconversion of any of the substituents, R1, R2, R3, R4 or R5 can be achieved before and/or after the exemplified transformations. These modifications can be such as the introduction of protecting groups, cleavage of protecting groups, reduction or oxidation of functional groups, halogenation, metallation, substitution or other reactions known to the person skilled in the art. These transformations include those which introduce a functionality which allows for further interconversion of substituents. Appropriate protecting groups and their introduction and cleavage are well-known to the person skilled in the art (see for example T. W. Greene and P. G. M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999). Specific examples are described in the subsequent paragraphs.
The resulting compounds of general formula (I) are optionally converted with corresponding (i) solvents and/or (ii) bases or acids to their solvates, salts and/or solvates of the salts, in which R1, R2, R3, R4 and R5 have the meaning as given for general formula (I), supra.
In accordance with another aspect, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (VIII):
Figure US11787797-20231017-C00024
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to react with a compound of general formula (X)
R1—NH2   (X),
in which R1 is as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00025
in which R1, R2, R3, R4 and R5 are as defined supra.
In accordance with certain embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (IX):
Figure US11787797-20231017-C00026
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to react with a compound of general formula (X):
R1—NH2   (X),
in which R1 is as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00027
in which R1, R2, R3, R4 and R5 are as defined supra.
In accordance with certain embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (VII)
Figure US11787797-20231017-C00028
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to be saponified resulting in a compound of general formula (VIII)
Figure US11787797-20231017-C00029
In accordance with certain embodiments, the present invention provides the intermediate compound of general formula (VIII)
Figure US11787797-20231017-C00030
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
In accordance with certain embodiments, the present invention provides the use of the intermediate compound (VII) in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra for the production of a compound of general formula (I).
In accordance with further embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XV):
Figure US11787797-20231017-C00031
in which R1, R2 and R3 are as defined for the compound of general formula (I) as defined supra, and A represents a chlorine, bromine or iodine atom,
to react with a compound of general formula (IV):
Figure US11787797-20231017-C00032
in which R4 and R5 are as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00033
in which R1, R2, R3, R4 and R5 are as defined supra.
In accordance with other embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XVIII)
Figure US11787797-20231017-C00034
in which R2, R4 and R5 are as defined for the compound of general formula (I) as defined supra, to react with a compound of general formula (X):
R1—NH2   (X),
in which R1 is as defined for the compound of general formula (I) as defined supra,
thereby giving a compound of general formula (XIX)
Figure US11787797-20231017-C00035
in which R1, R2, R4 and R5 are as defined supra.
In accordance with other embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XX)
Figure US11787797-20231017-C00036
in which R1 and R2 are as defined for the compound of general formula (I) as defined supra, to react with a compound of general formula (IV):
Figure US11787797-20231017-C00037
in which R4 and R5 are as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (XIX):
Figure US11787797-20231017-C00038
in which R1, R2, R4 and R5 are as defined for the compound of general formula (I) as defined supra.
In accordance with further embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XIX)
Figure US11787797-20231017-C00039
in which R1, R2, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to react with a compound of general formula (VI)
Figure US11787797-20231017-C00040
in which R3 is as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00041
in which R1, R2, R3, R4 and R5 are as defined supra.
In accordance with another aspect, the present invention provides methods of preparing compounds of general formula (I) as defined supra,
said methods comprise the step of allowing an intermediate compound of general formula (VIII)
Figure US11787797-20231017-C00042
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to react with a compound of general formula (X)
R1—NH2   (X),
in which R1 is as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00043
in which R1, R2, R3, R4 and R5 are as defined supra,
then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
In accordance with certain embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (IX)
Figure US11787797-20231017-C00044
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to react with a compound of general formula (X)
R1—NH2   (X),
in which R1 is as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00045
in which R1, R2, R3, R4 and R5 are as defined supra,
then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
In accordance with further embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XV)
Figure US11787797-20231017-C00046
in which R1, R2 and R3 are as defined for the compound of general formula (I) as defined supra, and A represents a chlorine, bromine or iodine atom,
to react with a compound of general formula (IV):
Figure US11787797-20231017-C00047
in which R4 and R5 are as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00048
in which R1, R2, R3, R4 and R5 are as defined supra,
then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
In accordance with other embodiments, the present invention provides methods of preparing compounds of general formula (I) as defined supra, said methods comprising the step of allowing an intermediate compound of general formula (XIX)
Figure US11787797-20231017-C00049
in which R1, R2, R4 and R5 are as defined for the compound of general formula (I) as defined supra,
to react with a compound of general formula (VI):
Figure US11787797-20231017-C00050
in which R3 is as defined for the compound of general formula (I) as defined supra, thereby giving a compound of general formula (I):
Figure US11787797-20231017-C00051
in which R1, R2, R3, R4 and R5 are as defined supra,
then optionally converting said compound into solvates, salts and/or solvates of such salts using the corresponding (i) solvents and/or (ii) bases or acids.
The present invention provides methods of preparing compounds of the present invention of general formula (I), said methods comprising the steps as described in the Experimental Section herein.
In accordance with a further aspect, the present invention provides intermediate compounds which are useful for the preparation of the compounds of general formula (I), supra.
Particularly, the invention provides the intermediate compounds of general formula (IV):
    • (IV),
      in which R4 and R5 are as defined for the compound of general formula (I) supra.
Furthermore, the invention provides the intermediate compounds of general formula (VI):
Figure US11787797-20231017-C00052
in which R3 is as defined for the compound of general formula (I) supra.
Particularly, the invention provides the intermediate compounds of general formula (VIII):
Figure US11787797-20231017-C00053
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) supra.
Particularly, the inventions provides the intermediate compounds of general formula (IX):
Figure US11787797-20231017-C00054
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) supra.
Particularly, the inventions provides the intermediate compounds of general formula (XV):
Figure US11787797-20231017-C00055
in which R1, R2 and R3 are as defined for the compound of general formula (I) supra, and A represents a chlorine, bromine or iodine atom.
Particularly, the inventions provides the intermediate compounds of general formula (XVIII):
Figure US11787797-20231017-C00056
in which R2, R4 and R5 are as defined for the compound of general formula (I) supra.
Particularly, the invention provides the intermediate compounds of general formula (XIX):
Figure US11787797-20231017-C00057
in which R1, R2, R4 and R5 are as defined for the compound of general formula (I) supra.
Particularly, the invention provides the intermediate compounds of general formula (XXI):
Figure US11787797-20231017-C00058
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) supra.
In accordance with another aspect, the present invention provides the use of said intermediate compounds for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (IV):
Figure US11787797-20231017-C00059
in which R4 and R5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (VI):
Figure US11787797-20231017-C00060
in which R3 is as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (VIII):
Figure US11787797-20231017-C00061
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (IX):
Figure US11787797-20231017-C00062
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (X):
R1—NH2   (X),
in which R1 is as defined for the compound of general formula (I) as defined supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (XV):
Figure US11787797-20231017-C00063
in which R1, R2 and R3 are as defined for the compound of general formula (I) supra, and A represents a chlorine, bromine or iodine atom, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (XVIII):
Figure US11787797-20231017-C00064
in which R2, R4 and R5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (XIX):
Figure US11787797-20231017-C00065
in which R1, R2, R4 and R5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (XX):
Figure US11787797-20231017-C00066
in which R1 and R2 are as defined for the compound of general formula (I) as defined supra, for the preparation of a compound of general formula (I) as defined supra.
Particularly, the invention provides the use of intermediate compounds of general formula (XXI):
Figure US11787797-20231017-C00067
in which R2, R3, R4 and R5 are as defined for the compound of general formula (I) supra, for the preparation of a compound of general formula (I) as defined supra.
In one embodiment the present invention provides methods of preparing compounds of the present invention of general formula (I),
Figure US11787797-20231017-C00068
    • in which
    • R1, R2, R3 are as defined in any previous aspect and
    • R4 and R5 are linked to one another in such a way that they jointly form together with the nitrogen atom and the carbon atom to which they are attached a 5 to 7 membered saturated or partially unsaturated heterocyclic ring that is substituted once with a hydroxy group,
      said methods comprising the step of reacting a compound of general formula (Ia)
Figure US11787797-20231017-C00069
    • in which
    • R1, R2, R3 are as defined in any previous aspect and
    • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
      • *—CH2—X1—X2—#,
      • *—CH2—X1—X2—X3—#,
      • *—CH2—X1—X2—X3—X4—#,
      • and X1, X2, X3 and X4 are —CH2—
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
    • with a suitable microorganism, under suitable conditions and in a suitable medium.
In one embodiment the present invention provides methods of preparing compounds of the present invention of general formula (I),
Figure US11787797-20231017-C00070
    • in which
  • R1, R2, R3 are as defined in any previous aspect and
  • R4 and R5 are linked to one another in such a way that they jointly form a group
    • *—CH(OH)—X1—X2—#,
    • *—CH2—CH(OH)—X2 #,
    • *—CH(OH)—X1—X2—X3—#,
    • *—CH2—CH(OH)—X2—X3—#,
    • *—CH2—X1—CH(OH)—X3—#,
    • *—CH═CH—CH(OH)—X3—#,
    • *—CH(OH)—X1—X2—X3—X4—#,
    • *—CH2—CH(OH)—X2—X3—X4—#,
    • *—CH2—X1—CH(OH)—X3—X4—#,
    • *—CH2—X1—X2—CH(OH)—X4—#,
    • and X1, X2, X3 and X4 are —CH2—.
    • in which groups “*” represents the point of attachment of R4 to the rest of the molecule and “#” represents the point of attachment of R5 to the rest of the molecule.
      said methods comprising the step of reacting a compound of general formula (Ia)
Figure US11787797-20231017-C00071
    • in which
    • R1, R2, R3 are as defined in any previous aspect and
    • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
      • *—CH2—X1—X2—#,
      • *—CH2—X1—X2—X3—#,
      • *—CH2—X1—X2—X3—X4—#,
      • and X1, X2, X3 and X4 are —CH2— in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
        with a suitable microorganism, under suitable conditions and in a suitable medium.
In one embodiment the present invention provides methods of preparing compounds of the present invention of general formula (I),
Figure US11787797-20231017-C00072
    • in which
    • R1, R2, R3 are as defined in any previous aspect and
    • R4 and R5 are linked to one another in such a way that they jointly form a group
    • *—CH(OH)—X1—X2—#,
    • *—CH2—CH(OH)—X2 #,
    • *—CH(OH)—X1—X2—X3—#,
    • *—CH2—CH(OH)—X2—X3—#,
    • *—CH2—X1—CH(OH)—X3—#,
    • *—CH═CH—CH(OH)—X3—#,
    • *—CH(OH)—X1—X2—X3—X4—#,
    • *—CH2—CH(OH)—X2—X3—X4—#,
    • *—CH2—X1—CH(OH)—X3—X4—#,
    • *—CH2—X1—X2—CH(OH)—X4—#,
    • and X1, X2, X3 and X4 are —CH2—.
    • in which groups “*” represents the point of attachment of R4 to the rest of the molecule and “#” represents the point of attachment of R5 to the rest of the molecule.
      said methods comprising the step of reacting a compound of general formula (Ia)
Figure US11787797-20231017-C00073
    • in which
    • R1, R2, R3 are as defined in any previous aspect and
    • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
      • *—CH2—X1—X2—#,
      • *—CH2—X1—X2—X3—#,
      • *—CH2—X1—X2—X3—X4—#,
      • and X1, X2, X3 and X4 are —CH2—
      • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule,
    • with a modified E. coli or a fungus under suitable conditions and in a suitable medium.
In one embodiment the present invention provides methods of preparing compounds of the present invention of general formula (I), as defined in any previous aspect, said methods comprising the step of reacting a compound of general formula (Ia)
Figure US11787797-20231017-C00074
wherein
R1, R2 and R3 are as defined in any embodiment or aspect supra and
R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and X1, X2, X3 and X4 are —CH2—
    • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule, resulting in the following subgroups of compounds of general formula (Ia):
Figure US11787797-20231017-C00075
preferably a compound of formula (la-2),
with a microorganism such as a e.g. a modified E. coli hosting a suitable plasmid, such as a nucleic acid sequence of Seq. ID. No.1 or Seq. ID. No.2, or a fungus
and subsequently harvesting the culture and isolating the reaction product after a suitable reaction time
to obtain a compound of formula (Ib)
wherein
R1, R2 and R3 are as defined in any embodiment or aspect supra and
R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH(OH)—X1—X2—#,
    • *—CH2—CH(OH)—X2 #,
    • *—CH(OH)—X1—X2—X3—#,
    • *—CH2—CH(OH)—X2—X3—#,
    • *—CH2—X1—CH(OH)—X3—#,
    • *—CH═CH—CH(OH)—X3—#,
    • *—CH(OH)—X1—X2—X3—X4—#,
    • *—CH2—CH(OH)—X2—X3—X4—#,
    • *—CH2—X1—CH(OH)—X3—X4—#,
    • *—CH2—X1—X2—CH(OH)—X4—#,
    • and X1, X2, X3 and X4 are —CH2—.
    • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule.
In one embodiment the present invention provides methods of preparing compounds of the present invention of general formula (I), as defined in any previous aspect, said methods comprising the step of reacting a compound of general formula (Ia)
Figure US11787797-20231017-C00076
wherein
R1, R2 and R3 are as defined in any aspect or embodiment defined supra and
R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH2—X1—X2—#,
    • *—CH2—X1—X2—X3—#,
    • *—CH2—X1—X2—X3—X4—#,
    • and X1, X2, X3 and X4 are —CH2—
      in a suitable medium with a microorganism, such as a modified E. coli e.g. hosting certain modified plasmids, particularly those having the Seq ID No. 1 or Seq. ID No. 2, or a fungus such as e.g. Nigrospora sphaerica (ATCC 12772, CBS 98469) and
      subsequently harvesting the culture and isolating the reaction product after a suitable reaction time to produce a compound of formula (Ib) wherein
      R1, R2 and R3 are as defined in any aspect or embodiment supra and
      R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH(OH)—X1—X2—X3—#,
    • *—CH2—CH(OH)—X2—X3—#,
    • *—CH2—X1—CH(OH)—X3—#,
    • *—CH═CH—CH(OH)—X3—#.
In one embodiment the process as described above further comprises subsequently harvesting the culture and isolating the reaction product after a suitable reaction time.
In another embodiment the present invention provides methods of preparing a compound of formula (I), wherein the suitable medium is a suitable nutrition solution comprising a buffer and an aqueous sugar solution.
In another embodiment the present invention provides methods of preparing a compound of formula (I), wherein the suitable medium is a suitable nutrition solution comprising a buffer such as an aqueous phosphatebuffer solution e.g. a potassiumdihydrogenphosphate/potassiumhydrogenphosphate buffer, a sodiumdihydrogenphosphate/sodiumhydrogenphosphate buffer, particularly a potassiumdihydrogenphosphate/potassiumhydrogenphosphate buffer and an aqueous sugar solution such as e.g. an aqueous glucose solution optionally further comprising an aqueous solution of a complexing agent such as e.g. ethylendiamintetraacetate.
In another embodiment the present invention provides methods of preparing a compound of formula (I), as disclosed supra and optionally further comprising aeration of the culture thus providing aerobic reaction conditions.
In another embodiment the present invention provides methods of preparing a compound of formula (I), as disclosed supra and further comprising the steps of harvesting the culture after a suitable reaction time such as e.g. 3-6h, particularly 3-4h and isolating the product.
In another embodiment the present invention provides methods of preparing a compound of formula (I), which are example compounds 293-296
Figure US11787797-20231017-C00077
reacting a compound of formula (Ic)
Figure US11787797-20231017-C00078
named N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
with E. coli DH5a LPSd pACYC_pel_POR_pETDuet_Δ3_CYP2C19 in a medium comprising a suitable buffer such as e.g. potassiumdihydrogenphosphate/potassiumhydrogenphosphate and an aqueous sugar solution such as e.g. glucose solution at a temperature range of 20-30° C., particularly 25°-30° C., the ranges including the lower and upper limit temperature, more particularly 27° C. under aerobic conditions and subsequently harvesting the culture and isolating the reaction product after a suitable reaction time, such as 3-6 h, particularly 3-4 h.
In a further embodiment the present invention provides methods of preparing a compound of formula (I), which are example compounds 293-296 under the conditions as described in example 293.
A further embodiment of the invention is the compound of formula (I) obtained by the method disclosed supra.
A further aspect of the invention is the nucleic acid sequence of Seq. ID. No.1., plasmid 1 of example 293.
Yet another aspect of the invention is the nucleic acid sequence of Seq ID. No.2, plasmid 2 of example 293.
A further aspect is the use of a plasmid of Seq. ID. No. 1 and/or Seq. ID. No.2 for the production of a mircoorganism suitable for a hydroxylation reaction, preferably the hydroxylation of a compound of formula (I), more preferably a compound of formula (Ia), even more preferably a compound of formula (la-2).
A further aspect is the use of nucleic acid sequence Seq. ID No. 1 or nucleic acid sequence Seq. ID No. 2
    • for the preparation of a microorganism suitable for the production of a compound of formula (I)
      in which
    • R1, R2, R3 are as defined in any previous aspect and
    • R4 and R5 are linked to one another in such a way that they jointly form together with the nitrogen atom and the carbon atom to which they are attached a 5 to 7 membered saturated or partially unsaturated heterocyclic ring that is substituted once with a hydroxy group,
      more particularly, for the production of a compound of formula (I) in which
  • R1, R2, R3 are as defined in any previous aspect and
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH(OH)—X1—X2—#,
    • *—CH2—CH(OH)—X2 #,
    • *—CH(OH)—X1—X2—X3—#,
    • *—CH2—CH(OH)—X2—X3—#,
    • *—CH2—X1—CH(OH)—X3—#,
    • *—CH═CH—CH(OH)—X3—#,
    • *—CH(OH)—X1—X2—X3—X4—#,
    • *—CH2—CH(OH)—X2—X3—X4—#,
    • *—CH2—X1—CH(OH)—X3—X4—#,
    • *—CH2—X1—X2—CH(OH)—X4—#,
    • and X1, X2, X3 and X4 are —CH2—
    • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule.
A further aspect is the use of a plasmid of Seq. ID. No. 1 and/or Seq.D.no. 2 for the production of a mircoorganism suitable for the production of a compound of formula (I).
A further aspect is the use of a plasmid of Seq. ID. No. 1 and/or Seq. ID.no. 2 for the production of a mircoorganism suitable for the production of a compound of formula (I), more particularly a hydroxylated compound of formula (I), even more particularly a hydroxylated compound of formula (I) in which
  • R4 and R5 are linked to one another in such a way that they jointly form a group selected from
    • *—CH(OH)—X1—X2—#,
    • *—CH2—CH(OH)—X2 #,
    • *—CH(OH)—X1—X2—X3—#,
    • *—CH2—CH(OH)—X2—X3—#,
    • *—CH2—X1—CH(OH)—X3—#,
    • *—CH═CH—CH(OH)—X3—#,
    • *—CH(OH)—X1—X2—X3—X4—#,
    • *—CH2—CH(OH)—X2—X3—X4—#,
    • *—CH2—X1—CH(OH)—X3—X4—#,
    • *—CH2—X1—X2—CH(OH)—X4—#,
    • and X1, X2, X3 and X4 are —CH2—
    • in which groups “*” represents the point of attachment of R4 to the rest of the molecule, and “#” represents the point of attachment of R5 to the rest of the molecule.
Another aspect of the invention is a compound of formula (I), particularly a compound of formula (Ib) more particularly the compounds of examples 293-296 obtained by a method as described herein.
The present invention provides the use of the intermediate compounds of general formula (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX) and (XXI) which are disclosed in the Example Section of this text, infra.
The present invention provides the intermediate compounds which are disclosed in the Example Section of this text, infra.
The present invention provides the intermediate compounds of general formula (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX) and (XXI) which are disclosed in the Example Section of this text, infra.
The present invention provides any sub-combination within any embodiment or aspect of the present invention of intermediate compounds of general formula (IV), (VI), (VIII), (IX), (X), (XV), (XVIII), (XIX) and (XXI), supra.
The compounds of general formula (I) of the present invention can be converted to any salt, preferably pharmaceutically acceptable salts, as described herein, by any method which is known to the person skilled in the art. Similarly, any salt of a compound of general formula (I) of the present invention can be converted into the free compound, by any method which is known to the person skilled in the art.
Compounds of general formula (I) of the present invention demonstrate a valuable pharmacological spectrum of action, which could not have been predicted. Compounds of the present invention have surprisingly been found to effectively inhibit DHODH and it is possible therefore that said compounds be used for the treatment or prophylaxis of diseases, preferably hyperproliferative and/or inflammatory disorders in humans and animals.
Compounds of the present invention can be utilized to inhibit the activity of DHODH. This method comprises administering to a mammal in need thereof, including a human, an effective amount of a compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, for the treatment of hyperproliferative and/or inflammatory disorders.
Another aspect of the invention is a method of inhibiting proliferation of a cell, comprising contacting the cell with a compound of formula (I).
Hyperproliferative disorders include, but are not limited to, for example: psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH), solid tumours, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases. Those disorders also include sarcomas, and haematological malignancies including but not limiting to leukemias, lymphomas, multiple myeolomas.
Examples of breast cancers include, but are not limited to, invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.
Examples of cancers of the respiratory tract include, but are not limited to, small-cell and non-small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.
Examples of brain cancers include, but are not limited to, brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumour.
Tumours of the male reproductive organs include, but are not limited to, prostate and testicular cancer.
Tumours of the female reproductive organs include, but are not limited to, endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.
Tumours of the digestive tract include, but are not limited to, anal, colon, colorectal, oesophageal, gallbladder, gastric, pancreatic, rectal, small-intestine, and salivary gland cancers.
Tumours of the urinary tract include, but are not limited to, bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.
Eye cancers include, but are not limited to, intraocular melanoma and retinoblastoma.
Examples of liver cancers include, but are not limited to, hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.
Skin cancers include, but are not limited to, squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.
Head-and-neck cancers include, but are not limited to, laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell.
Lymphomas include, but are not limited to, AIDS-related lymphoma, chronic lymphocytic lymphoma (CLL), non-Hodgkin's lymphoma (NHL), T-non-Hodgkin lymphoma (T-NHL), subtypes of NHL such as Diffuse Large Cell Lymphoma (DLBCL), activated B-cell DLBCL, germinal center B-cell lymphoma DLBCL, double-hit lymphoma and double-expressor lymphoma; anaplastic large cell lymphoma, B-cell lymphoma, cutaneous T-cell lymphoma, Burkitt's lymphoma, follicular lymphoma, hairy cell lymphoma, Hodgkin's disease, mantle cell lymphoma (MCL), lymphoma of the central nervous system, small lymphocytic lymphoma and chronic lymphocytic lymphoma and Sezary syndrome.
Sarcomas include, but are not limited to, sarcoma of the soft tissue, gliosarcoma, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma.
Leukemias include, but are not limited to acute lymphoblastic leukemia, acute myeloid leukemia, (acute) T-cell leukemia, acute lymphoblastic leukemia, acute lymphocytic leukemia (ALL), acute monocytic leukemia (AML), acute promyelocytic leukemia, bisphenotypic B myelomonocytic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia (CMML), large granular lymphocytic leukemia, plasma cell leukemia, and also myelodysplastic syndrome (MDS), which can develop into an acute myeloid leukemia.
Inhibition of DHODH can also lead to differentiation of tumor initiating cells in hematological and solid cancers, especially leukemias.
The present invention also provides methods of treating angiogenic disorders including diseases associated with excessive and/or abnormal angiogenesis.
Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism. A number of pathological conditions are associated with the growth of extraneous blood vessels. These include, for example, diabetic retinopathy, ischemic retinal-vein occlusion, and retinopathy of prematurity [Aiello et al., New Engl. J. Med., 1994, 331, 1480; Peer et al., Lab. Invest., 1995, 72, 638], age-related macular degeneration (AMD) [Lopez et al., Invest. Opththalmol. Vis. Sci., 1996, 37, 855], neovascular glaucoma, psoriasis, retrolental fibroplasias, angiofibroma, inflammation, rheumatoid arthritis (RA), restenosis, in-stent restenosis, vascular graft restenosis, etc. In addition, the increased blood supply associated with cancerous and neoplastic tissue, encourages growth, leading to rapid tumour enlargement and metastasis. Moreover, the growth of new blood and lymph vessels in a tumour provides an escape route for renegade cells, encouraging metastasis and the consequence spread of the cancer. Thus, compounds of general formula (I) of the present invention can be utilized to treat and/or prevent any of the aforementioned angiogenesis disorders, for example by inhibiting and/or reducing blood vessel formation; by inhibiting, blocking, reducing, decreasing, etc. endothelial cell proliferation, or other types involved in angiogenesis, as well as causing cell death or apoptosis of such cell types.
Another aspect of the invention is a method for controlling cancer in humans and animals by administering an effective amount of at least one compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, or of a medicament, comprising at least one compound of general formula (I) of the present invention.
Another aspect of the invention is a method for controlling cancer (e.g., through treatment prophylaxis, etc.) in a subject (e.g., human, rat, etc.) by administering an effective amount of at least one compound of general formula (I), or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof to the subject. In some embodiments, the subject may be administered a medicament, comprising at least one compound of general formula (I) and one or more pharmaceutically acceptable carriers, excipients, and/or diluents. In some embodiments, the method of treatment and/or prophylaxis of a hyperproliferative disorder in a subject may comprise administering to the subject an effective amount of a compound of general formula (I). The hyperproliferative disorder may be, for example, cancer (e.g. but not limited to lung cancer, acute myeloid leukemia, lymphoma, glioblastoma, prostate cancer, etc.).
A method of inhibiting dihydroorotate dehydrogenase activity in a cancer cell is also provided, wherein the method comprises contacting a cancer cell with a compound of general formula (I). The cancer cell may be in vitro or in vivo.
Another aspect of the invention is a method of treating lymphoma in a subject, the method comprising administering to the subject an effective amount of a compound of general formula (I).
A yet other aspect of the invention is a method of treating leukemia in a subject, the method comprising administering to the subject an effective amount of a compound of general formula (I).
In another aspect, the present invention provides the use of a compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, for the preparation of a medicament for the treatment or prophylaxis of a disease.
In another aspect, the present invention provides methods of treating cancer, which cancer is selected from a solid tumor such as e.g. lung cancer, glioblastoma, and prostate cancer, leukemia such as e.g. acute myeloid leukemia and lymphoma.
In another aspect, the present invention provides methods of treating cancer, which cancer is selected from lung cancer, leukemia, lymphoma, glioblastoma, and prostate cancer.
In another aspect, the present invention provides methods of treating cancer, which cancer is selected from lung cancer, acute myeloid leukemia, lymphoma, glioblastoma, and prostate cancer.
In another aspect, the present invention provides the use of a compound of general formula (I) of the present invention, or a pharmaceutically acceptable salt, polymorph, metabolite, hydrate, solvate or ester thereof, for the treatment of cancer, which cancer is selected from lung cancer, acute myeloid leukemia, lymphoma, glioblastoma, and prostate cancer.
In another aspect, the present invention provides methods of treating or preventing a disease or condition associated with inflammation, a metabolic disorder, infection or an immune disease or condition by administering to a subject having such a condition or disease, a therapeutically effective amount of a compound or composition of the invention.
In further embodiments, diseases or conditions, including chronic diseases, of humans or other species can be treated or prevented by inhibition of DHODH. These diseases or conditions include (1) inflammatory or allergic diseases such as systemic anaphylaxis and hypersensitivity responses, drug allergies, insect sting allergies and food allergies, (2) inflammatory bowel diseases, such as Crohn's disease, ulcerative colitis, ileitis and enteritis, (3) vaginitis, (4) psoriasis and inflammatory dermatoses such as dermatitis, eczema, atopic dermatitis, allergic contact dermatitis and urticaria, (5) vasculitis, (6) spondyloarthropathies, (7) scleroderma, (8) asthma and respiratory allergic diseases such as allergic asthma, allergic rhinitis, allergic conjunctivitis, hypersensitivity lung diseases and the like, and (9) autoimmune diseases, such as arthritis (including rheumatoid and psoriatic), systemic lupus erythematosus, type I diabetes, glomerulonephritis and the like, (10) graft rejection (including allograft rejection and graft-v-host disease), (11) other diseases in which undesired inflammatory responses are to be inhibited, e.g., atherosclerosis, myositis, neurological disorders such as stroke, ischemic reperfusion injury, traumatic brain injury and closed-head injuries, neurodegenerative diseases (e.g., Parkinson's disease), multiple sclerosis, Alzheimer's disease, encephalitis, meningitis, osteoporosis, gout, hepatitis, nephritis, gall bladder disease, sepsis, sarcoidosis, conjunctivitis, otitis, chronic obstructive pulmonary disease, sinusitis and Behcet's syndrome, and (12) immune diseases or conditions.
In another aspect, the present invention provides methods of treating or preventing viral infections.
In yet another aspect, the present invention provides methods of treating or preventing Malaria.
These disorders have been well characterized in humans, but also exist with a similar etiology in other mammals, and can be treated by administering pharmaceutical compositions of the present invention.
If it is stated “preventing or treating” “treatment or prophylaxis” treating/treatment is preferred.
The term “treating” or “treatment” as stated throughout this document is used conventionally, for example the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of a disease or disorder, such as a carcinoma.
The compounds of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.
Generally, the use of chemotherapeutic agents and/or anti-cancer agents in combination with a compound or pharmaceutical composition of the present invention will serve to:
    • 1. yield better efficacy in reducing the growth of a tumour or even eliminate the tumour as compared to administration of either agent alone,
    • 2. provide for the administration of lesser amounts of the administered chemotherapeutic agents,
    • 3. provide for a chemotherapeutic treatment that is well tolerated in the patient with fewer deleterious pharmacological complications than observed with single agent chemotherapies and certain other combined therapies,
    • 4. provide for treating a broader spectrum of different cancer types in mammals, especially humans,
    • 5. provide for a higher response rate among treated patients,
    • 6. provide for a longer survival time among treated patients compared to standard chemotherapy treatments,
    • 7. provide a longer time for tumour progression, and/or
    • 8. yield efficacy and tolerability results at least as good as those of the agents used alone, compared to known instances where other cancer agent combinations produce antagonistic effects.
In addition, the compounds of general formula (I) of the present invention can also be used in combination with radiotherapy and/or surgical intervention.
In a further embodiment of the present invention, the compounds of general formula (I) of the present invention may be used to sensitize a cell to radiation, i.e. treatment of a cell with a compound of the present invention prior to radiation treatment of the cell renders the cell more susceptible to DNA damage and cell death than the cell would be in the absence of any treatment with a compound of the present invention. In one aspect, the cell is treated with at least one compound of general formula (I) of the present invention.
Thus, the present invention also provides a method of killing a cell, wherein a cell is administered one or more compounds of the present invention in combination with conventional radiation therapy.
The present invention also provides a method of rendering a cell more susceptible to cell death, wherein the cell is treated with one or more compounds of general formula (I) of the present invention prior to the treatment of the cell to cause or induce cell death. In one aspect, after the cell is treated with one or more compounds of general formula (I) of the present invention, the cell is treated with at least one compound, or at least one method, or a combination thereof, in order to cause DNA damage for the purpose of inhibiting the function of the normal cell or killing the cell.
In other embodiments of the present invention, a cell is killed by treating the cell with at least one DNA damaging agent, i.e. after treating a cell with one or more compounds of general formula (I) of the present invention to sensitize the cell to cell death, the cell is treated with at least one DNA damaging agent to kill the cell. DNA damaging agents useful in the present invention include, but are not limited to, chemotherapeutic agents (e.g. cis platin), ionizing radiation (X-rays, ultraviolet radiation), carcinogenic agents, and mutagenic agents.
In other embodiments, a cell is killed by treating the cell with at least one method to cause or induce DNA damage. Such methods include, but are not limited to, activation of a cell signalling pathway that results in DNA damage when the pathway is activated, inhibiting of a cell signalling pathway that results in DNA damage when the pathway is inhibited, and inducing a biochemical change in a cell, wherein the change results in DNA damage. By way of a non-limiting example, a DNA repair pathway in a cell can be inhibited, thereby preventing the repair of DNA damage and resulting in an abnormal accumulation of DNA damage in a cell.
In one aspect of the invention, a compound of general formula (I) of the present invention is administered to a cell prior to the radiation or other induction of DNA damage in the cell. In another aspect of the invention, a compound of general formula (I) of the present invention is administered to a cell concomitantly with the radiation or other induction of DNA damage in the cell. In yet another aspect of the invention, a compound of general formula (I) of the present invention is administered to a cell immediately after radiation or other induction of DNA damage in the cell has begun.
In another aspect, the cell is in vitro. In another embodiment, the cell is in vivo.
In accordance with a further aspect, the present invention provides compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, for use in the treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders.
In accordance with a further aspect, the present invention provides compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, for use in the treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
The pharmaceutical activity of the compounds according to the invention can be explained by their activity as DHODH inhibitors.
In accordance with a further aspect, the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, for the treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders.
In accordance with a further aspect, the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, for the treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
In accordance with a further aspect, the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, in a method of treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders, particularly cancer.
In accordance with a further aspect, the present invention provides the use of compounds of general formula (I), as described supra, or tautomers, N-oxides, and salts thereof, or salts of tautomers or N-oxides, particularly pharmaceutically acceptable salts thereof, or mixtures of same, in a method of treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
In accordance with a further aspect, the present invention provides the use of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the preparation of a medicament, for the prophylaxis or treatment of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
In accordance with a further aspect, the present invention provides use of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the preparation of a pharmaceutical composition, for the prophylaxis or treatment of diseases, in particular hyperproliferative and/or inflammatory disorders.
In accordance with a further aspect, the present invention provides use of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same, for the preparation of a pharmaceutical composition, preferably a medicament, for the prophylaxis or treatment of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer.
In accordance with a further aspect, the present invention provides a method of treatment or prophylaxis of diseases, in particular hyperproliferative and/or inflammatory disorders, comprising administering an effective amount of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same.
In accordance with a further aspect, the present invention provides a method of treatment or prophylaxis of diseases, in particular hyperproliferative disorders, particularly benign hyperproliferative disorders, more particularly cancer, comprising administering an effective amount of a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt thereof, or a mixture of same.
In accordance with a further aspect, the present invention provides pharmaceutical compositions, in particular a medicament, comprising a compound of general formula (I), as described supra, or a tautomer, an N-oxide, and a salt thereof, or a salt of a tautomer or an N-oxide, particularly a pharmaceutically acceptable salt, or a mixture of same, and one or more excipients), in particular one or more pharmaceutically acceptable excipient(s). Conventional procedures for preparing such pharmaceutical compositions in appropriate dosage forms can be utilized.
The present invention furthermore provides pharmaceutical compositions, in particular medicaments, which comprise at least one compound according to the invention, conventionally together with one or more pharmaceutically suitable excipients, and to their use for the above mentioned purposes.
It is possible for the compounds according to the invention to have systemic and/or local activity.
For this purpose, they can be administered in a suitable manner, such as, for example, via the oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, vaginal, dermal, transdermal, conjunctival, otic route or as an implant or stent.
For these administration routes, it is possible for the compounds according to the invention to be administered in suitable administration forms.
For oral administration, it is possible to formulate the compounds according to the invention to dosage forms known in the art that deliver the compounds of the invention rapidly and/or in a modified manner, such as, for example, tablets (uncoated or coated tablets, for example with enteric or controlled release coatings that dissolve with a delay or are insoluble), orally-disintegrating tablets, films/wafers, films/lyophylisates, capsules (for example hard or soft gelatine capsules), sugar-coated tablets, granules, pellets, powders, emulsions, suspensions, aerosols or solutions. It is possible to incorporate the compounds according to the invention in crystalline and/or amorphised and/or dissolved form into said dosage forms.
Parenteral administration can be effected with avoidance of an absorption step (for example intravenous, intraarterial, intracardial, intraspinal or intralumbal) or with inclusion of absorption (for example intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal). Administration forms which are suitable for parenteral administration are, inter alia, preparations for injection and infusion in the form of solutions, suspensions, emulsions, lyophylisates or sterile powders.
Examples which are suitable for other administration routes are pharmaceutical forms for inhalation [inter alia powder inhalers, nebulizers], nasal drops, nasal solutions, nasal sprays; tablets/films/wafers/capsules for lingual, sublingual or buccal administration; suppositories; eye drops, eye ointments, eye baths, ocular inserts, ear drops, ear sprays, ear powders, ear-rinses, ear tampons; vaginal capsules, aqueous suspensions (lotions, mixturae agitandae), lipophilic suspensions, emulsions, ointments, creams, transdermal therapeutic systems (such as, for example, patches), milk, pastes, foams, dusting powders, implants or stents.
The compounds according to the invention can be incorporated into the stated administration forms. This can be effected in a manner known per se by mixing with pharmaceutically suitable excipients. Pharmaceutically suitable excipients include, inter alia,
    • fillers and carriers (for example cellulose, microcrystalline cellulose (such as, for example, Avicel®), lactose, mannitol, starch, calcium phosphate (such as, for example, Di-Cafos®)),
    • ointment bases (for example petroleum jelly, paraffins, triglycerides, waxes, wool wax, wool wax alcohols, lanolin, hydrophilic ointment, polyethylene glycols),
    • bases for suppositories (for example polyethylene glycols, cacao butter, hard fat),
    • solvents (for example water, ethanol, isopropanol, glycerol, propylene glycol, medium chain-length triglycerides fatty oils, liquid polyethylene glycols, paraffins),
    • surfactants, emulsifiers, dispersants or wetters (for example sodium dodecyl sulfate), lecithin, phospholipids, fatty alcohols (such as, for example, Lanette®), sorbitan fatty acid esters (such as, for example, Span®), polyoxyethylene sorbitan fatty acid esters (such as, for example, Tween®), polyoxyethylene fatty acid glycerides (such as, for example, Cremophor®), polyoxethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, glycerol fatty acid esters, poloxamers (such as, for example, Pluronic®),
    • buffers, acids and bases (for example phosphates, carbonates, citric acid, acetic acid, hydrochloric acid, sodium hydroxide solution, ammonium carbonate, trometamol, triethanolamine),
    • isotonicity agents (for example glucose, sodium chloride),
    • adsorbents (for example highly-disperse silicas),
    • viscosity-increasing agents, gel formers, thickeners and/or binders (for example polyvinylpyrrolidone, methylcellulose, hydroxypropylmethylcellulose, hydroxypropylcellulose, carboxymethylcellulose-sodium, starch, carbomers, polyacrylic acids (such as, for example, Carbopol®); alginates, gelatine),
    • disintegrants (for example modified starch, carboxymethylcellulose-sodium, sodium starch glycolate (such as, for example, Explotab®), cross-linked polyvinylpyrrolidone, croscarmellose-sodium (such as, for example, AcDiSol®)),
    • flow regulators, lubricants, glidants and mould release agents (for example magnesium stearate, stearic acid, talc, highly-disperse silicas (such as, for example, Aerosil®)),
    • coating materials (for example sugar, shellac) and film formers for films or diffusion membranes which dissolve rapidly or in a modified manner (for example polyvinylpyrrolidones (such as, for example, Kollidon®), polyvinyl alcohol, hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, hydroxypropylmethylcellulose phthalate, cellulose acetate, cellulose acetate phthalate, polyacrylates, polymethacrylates such as, for example, Eudragit®)),
    • capsule materials (for example gelatine, hydroxypropylmethylcellulose),
    • synthetic polymers (for example polylactides, polyglycolides, polyacrylates, polymethacrylates (such as, for example, Eudragit®), polyvinylpyrrolidones (such as, for example, Kollidon®), polyvinyl alcohols, polyvinyl acetates, polyethylene oxides, polyethylene glycols and their copolymers and blockcopolymers),
    • plasticizers (for example polyethylene glycols, propylene glycol, glycerol, triacetine, triacetyl citrate, dibutyl phthalate),
    • penetration enhancers,
    • stabilisers (for example antioxidants such as, for example, ascorbic acid, ascorbyl palmitate, sodium ascorbate, butylhydroxyanisole, butylhydroxytoluene, propyl gallate),
    • preservatives (for example parabens, sorbic acid, thiomersal, benzalkonium chloride, chlorhexidine acetate, sodium benzoate),
    • colourants (for example inorganic pigments such as, for example, iron oxides, titanium dioxide),
    • flavourings, sweeteners, flavour- and/or odour-masking agents.
The present invention furthermore relates to a pharmaceutical composition which comprise at least one compound according to the invention, conventionally together with one or more pharmaceutically suitable excipient(s), and to their use according to the present invention.
In accordance with another aspect, the present invention provides pharmaceutical combinations, in particular medicaments, comprising at least one compound of general formula (I) of the present invention and at least one or more further active ingredients, in particular for the treatment and/or prophylaxis of a hyperproliferative disorder, particularly cancer.
Particularly, the present invention provides a pharmaceutical combination, which comprises:
    • one or more first active ingredients, in particular compounds of general formula (I) as defined supra, and
    • one or more further active ingredients, in particular anti-cancer agents.
The term “combination” in the present invention is used as known to persons skilled in the art, it being possible for said combination to be a fixed combination, a non-fixed combination or a kit-of-parts.
A “fixed combination” in the present invention is used as known to persons skilled in the art and is defined as a combination wherein, for example, a first active ingredient, such as one or more compounds of general formula (I) of the present invention, and a further active ingredient are present together in one unit dosage or in one single entity. One example of a “fixed combination” is a pharmaceutical composition wherein a first active ingredient and a further active ingredient are present in admixture for simultaneous administration, such as in a formulation. Another example of a “fixed combination” is a pharmaceutical combination wherein a first active ingredient and a further active ingredient are present in one unit without being in admixture.
A non-fixed combination or “kit-of-parts” in the present invention is used as known to persons skilled in the art and is defined as a combination wherein a first active ingredient and a further active ingredient are present in more than one unit. One example of a non-fixed combination or kit-of-parts is a combination wherein the first active ingredient and the further active ingredient are present separately. It is possible for the components of the non-fixed combination or kit-of-parts to be administered separately, sequentially, simultaneously, concurrently or chronologically staggered.
The compounds of the present invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutically active ingredients where the combination causes no unacceptable adverse effects. The present invention also provides such pharmaceutical combinations. For example, the compounds of the present invention can be combined with known anti-cancer agents.
Examples of anti-cancer agents include:
131I-chTNT, abarelix, abiraterone, aclarubicin, adalimumab, ado-trastuzumab emtansine, afatinib, aflibercept, aldesleukin, alectinib, alemtuzumab, alendronic acid, alitretinoin, altretamine, amifostine, aminoglutethimide, hexyl aminolevulinate, amrubicin, amsacrine, anastrozole, ancestim, anethole dithiolethione, anetumab ravtansine, angiotensin II, antithrombin III, aprepitant, arcitumomab, arglabin, arsenic trioxide, asparaginase, atezolizumab, axitinib, azacitidine, basiliximab, belotecan, bendamustine, besilesomab, belinostat, bevacizumab, bexarotene, bicalutamide, bisantrene, bleomycin, blinatumomab, bortezomib, buserelin, bosutinib, brentuximab vedotin, busulfan, cabazitaxel, cabozantinib, calcitonine, calcium folinate, calcium levofolinate, capecitabine, capromab, carbamazepine carboplatin, carboquone, carfilzomib, carmofur, carmustine, catumaxomab, celecoxib, celmoleukin, ceritinib, cetuximab, chlorambucil, chlormadinone, chlormethine, cidofovir, cinacalcet, cisplatin, cladribine, clodronic acid, clofarabine, cobimetinib, copanlisib, crisantaspase, crizotinib, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, daratumumab, darbepoetin alfa, dabrafenib, dasatinib, daunorubicin, decitabine, degarelix, denileukin diftitox, denosumab, depreotide, deslorelin, dianhydrogalactitol, dexrazoxane, dibrospidium chloride, dianhydrogalactitol, diclofenac, dinutuximab, docetaxel, dolasetron, doxifluridine, doxorubicin, doxorubicin+estrone, dronabinol, eculizumab, edrecolomab, elliptinium acetate, elotuzumab, eltrombopag, endostatin, enocitabine, enzalutamide, epirubicin, epitiostanol, epoetin alfa, epoetin beta, epoetin zeta, eptaplatin, eribulin, erlotinib, esomeprazole, estradiol, estramustine, ethinylestradiol, etoposide, everolimus, exemestane, fadrozole, fentanyl, filgrastim, fluoxymesterone, floxuridine, fludarabine, fluorouracil, flutamide, folinic acid, formestane, fosaprepitant, fotemustine, fulvestrant, gadobutrol, gadoteridol, gadoteric acid meglumine, gadoversetamide, gadoxetic acid, gallium nitrate, ganirelix, gefitinib, gemcitabine, gemtuzumab, Glucarpidase, glutoxim, GM-CSF, goserelin, granisetron, granulocyte colony stimulating factor, histamine dihydrochloride, histrelin, hydroxycarbamide, I-125 seeds, lansoprazole, ibandronic acid, ibritumomab tiuxetan, ibrutinib, idarubicin, ifosfamide, imatinib, imiquimod, improsulfan, indisetron, incadronic acid, ingenol mebutate, interferon alfa, interferon beta, interferon gamma, iobitridol, iobenguane (123I), iomeprol, ipilimumab, irinotecan, Itraconazole, ixabepilone, ixazomib, lanreotide, lansoprazole, lapatinib, lasocholine, lenalidomide, lenvatinib, lenograstim, lentinan, letrozole, leuprorelin, levamisole, levonorgestrel, levothyroxine sodium, lisuride, lobaplatin, lomustine, lonidamine, masoprocol, medroxyprogesterone, megestrol, melarsoprol, melphalan, mepitiostane, mercaptopurine, mesna, methadone, methotrexate, methoxsalen, methylaminolevulinate, methylprednisolone, methyltestosterone, metirosine, mifamurtide, miltefosine, miriplatin, mitobronitol, mitoguazone, mitolactol, mitomycin, mitotane, mitoxantrone, mogamulizumab, molgramostim, mopidamol, morphine hydrochloride, morphine sulfate, nabilone, nabiximols, nafarelin, naloxone+pentazocine, naltrexone, nartograstim, necitumumab, nedaplatin, nelarabine, neridronic acid, netupitant/palonosetron, nivolumab, pentetreotide, nilotinib, nilutamide, nimorazole, nimotuzumab, nimustine, nintedanib, nitracrine, nivolumab, obinutuzumab, octreotide, ofatumumab, olaparib, olaratumab, omacetaxine mepesuccinate, omeprazole, ondansetron, oprelvekin, orgotein, orilotimod, osimertinib, oxaliplatin, oxycodone, oxymetholone, ozogamicine, p53 gene therapy, paclitaxel, palbociclib, palifermin, palladium-103 seed, palonosetron, pamidronic acid, panitumumab, panobinostat, pantoprazole, pazopanib, pegaspargase, PEG-epoetin beta (methoxy PEG-epoetin beta), pembrolizumab, pegfilgrastim, peginterferon alfa-2b, pembrolizumab, pemetrexed, pentazocine, pentostatin, peplomycin, Perflubutane, perfosfamide, Pertuzumab, picibanil, pilocarpine, pirarubicin, pixantrone, plerixafor, plicamycin, poliglusam, polyestradiol phosphate, polyvinylpyrrolidone+sodium hyaluronate, polysaccharide-K, pomalidomide, ponatinib, porfimer sodium, pralatrexate, prednimustine, prednisone, procarbazine, procodazole, propranolol, quinagolide, rabeprazole, racotumomab, radium-223 chloride, radotinib, raloxifene, raltitrexed, ramosetron, ramucirumab, ranimustine, rasburicase, razoxane, refametinib, regorafenib, risedronic acid, rhenium-186 etidronate, rituximab, rolapitant, romidepsin, romiplostim, romurtide, rucaparib, samarium (153Sm) lexidronam, sargramostim, satumomab, secretin, siltuximab, sipuleucel-T, sizofiran, sobuzoxane, sodium glycididazole, sonidegib, sorafenib, stanozolol, streptozocin, sunitinib, talaporfin, talimogene laherparepvec, tamibarotene, tamoxifen, tapentadol, tasonermin, teceleukin, technetium (99mTc) nofetumomab merpentan, 99mTc-HYNIC-[Tyr3]-octreotide, tegafur, tegafur+gimeracil+oteracil, temoporfin, temozolomide, temsirolimus, teniposide, testosterone, tetrofosmin, thalidomide, thiotepa, thymalfasin, thyrotropin alfa, tioguanine, tocilizumab, topotecan, toremifene, tositumomab, trabectedin, trametinib, tramadol, trastuzumab, trastuzumab emtansine, treosulfan, tretinoin, trifluridine+tipiracil, trilostane, triptorelin, trametinib, trofosfamide, thrombopoietin, tryptophan, ubenimex, valatinib, valrubicin, vandetanib, vapreotide, vemurafenib, vinblastine, vincristine, vindesine, vinflunine, vinorelbine, vismodegib, vorinostat, vorozole, yttrium-90 glass microspheres, zinostatin, zinostatin stimalamer, zoledronic acid, zorubicin.
Based upon standard laboratory techniques known to evaluate compounds useful for the treatment of hyperproliferative and/or inflammatory disorders, by standard toxicity tests and by standard pharmacological assays for the determination of treatment of the conditions identified above in mammals, and by comparison of these results with the results of known active ingredients or medicaments that are used to treat these conditions, the effective dosage of the compounds of the present invention can readily be determined for treatment of each desired indication. The amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
The total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day. Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing. In addition, it is possible for “drug holidays”, in which a patient is not dosed with a drug for a certain period of time, to be beneficial to the overall balance between pharmacological effect and tolerability. It is possible for a unit dosage to contain from about 0.5 mg to about 1500 mg (e.g. about 0.5 mg to about 5 mg, about 5 mg to about 50 mg, about 50 mg to about 500 mg, about 500 mg to about 1500 mg, etc.) of active ingredient, and can be administered one or more times per day or less than once a day. The average daily dosage for administration by injection, including intravenous, intramuscular, subcutaneous and parenteral injections, and use of infusion techniques will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily. The transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg. The average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
In other embodiments of the invention the total amount of the active ingredient to be administered will generally range from 0.001 mg/kg to 200 mg/kg body weight per day, and preferably from 0.01 mg/kg to 20 mg/kg body weight per day. Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing. In addition, it is possible for “drug holidays”, in which a patient is not dosed with a drug for a certain period of time, to be beneficial to the overall balance between pharmacological effect and tolerability. It is possible for a unit dosage to contain from 0.5 mg to 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day.
Of course the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like. The desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
EXPERIMENTAL SECTION
NMR peak forms are stated as they appear in the spectra, possible higher order effects have not been considered.
The 1H-NMR data of selected examples are listed in the form of 1H-NMR peaklists. For each signal peak the δ value in ppm is given, followed by the signal intensity, reported in round brackets. The δ value-signal intensity pairs from different peaks are separated by commas. Therefore, a peaklist is described by the general form: δ1 (intensity1), δ2 (intensity2), . . . , δi (intensityi), . . . , δn (intensityn).
The intensity of a sharp signal correlates with the height (in cm) of the signal in a printed NMR spectrum. When compared with other signals, this data can be correlated to the real ratios of the signal intensities. In the case of broad signals, more than one peak, or the center of the signal along with their relative intensity, compared to the most intense signal displayed in the spectrum, are shown. A 1H-NMR peaklist is similar to a classical 1H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical 1H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of target compounds (also the subject of the invention), and/or peaks of impurities. The peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compounds (e.g., with a purity of >90%). Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify the reproduction of our manufacturing process on the basis of “by-product fingerprints”. An expert who calculates the peaks of the target compounds by known methods (MestReC, ACD simulation, or by use of empirically evaluated expectation values), can isolate the peaks of target compounds as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical H-NMR interpretation. A detailed description of the reporting of NMR data in the form of peaklists can be found in the publication “Citation of NMR Peaklist Data within Patent Applications” (cf. Research Disclosure Database Number 605005, 2014, 1 Aug. 2014, or http://www.researchdisclosure.com/searching-disclosures). In the peak picking routine, as described in the Research Disclosure Database Number 605005, the parameter “MinimumHeight” can be adjusted between 1% and 4%. Depending on the chemical structure and/or depending on the concentration of the measured compound it may be reasonable to set the parameter “MinimumHeight”<1%.
Chemical names were generated using the ACD/Name software from ACD/Labs. In some cases generally accepted names of commercially available reagents were used in place of ACD/Name generated names.
The following table 1 lists the abbreviations used in this paragraph and in the Examples section as far as they are not explained within the text body. Other abbreviations have their meanings customary per se to the skilled person.
TABLE 1
Abbreviations
Abbreviation Meaning
aq. aqueous
br broad (1H-NMR signal)
cat. catalytic
CDCl3 deuterated chloroform
Cl chemical ionisation
d doublet
DAD diode array detector
DCM dichloromethane
d doublet
dd double-doublet
ddd double-doublet-doublet
DMF N,N-dimethylformamide
DMSO dimethylsulfoxide
ELSD Evaporative Light Scattering Detector
eq. equivalent
ESI electrospray (ES) ionisation
h hour(s)
HATU 1-[bis(dimethylamino)methylene]-1H-1,2,3-
triazolo[4,5-b]pyridinium 3-oxid
hexafluorophosphate
HPLC high performance liquid chromatography
LC-MS liquid chromatography mass spectrometry
m multiplet
min minute(s)
MS mass spectrometry
NMR nuclear magnetic resonance spectroscopy: chemical
shifts (δ) are given in ppm. The chemical shifts were
corrected by setting the DMSO signal to 2.50 ppm
unless otherwise stated.
p pentet
a quartet
r.t. or rt or RT room temperature
rac racemic
Rt retention time (as measured either with HPLC or
UPLC) in minutes
s singlet
t triplet
td triple-doublet
UPLC ultra performance liquid chromatography
Other abbreviations have their meanings customary per se to the skilled person.
The various aspects and embodiments of the invention described in this application are illustrated by the following examples which are not meant to limit the invention in any way.
The example testing experiments described herein serve to illustrate the present invention and the invention is not limited to the examples given.
EXPERIMENTAL SECTION—GENERAL PART
All reagents, for which the synthesis is not described in the experimental part, are either commercially available, or are known compounds or may be formed from known compounds by known methods by a person skilled in the art.
The compounds and intermediates produced according to the methods of the invention may require purification. Purification of organic compounds is well known to the person skilled in the art and there may be several ways of purifying the same compound. In some cases, no purification may be necessary. In some cases, the compounds may be purified by crystallization.
In some cases, impurities may be stirred out using a suitable solvent. In some cases, the compounds may be purified by chromatography, particularly flash column chromatography, using for example prepacked silica gel cartridges, e.g. Biotage SNAP cartidges KP-Sil® or KP-NH® in combination with a Biotage autopurifier system (SP4® or Isolera Four®) and eluents such as gradients of hexane/ethyl acetate or DCM/methanol. In some cases, the compounds may be purified by preparative HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
In some cases, purification methods as described above can provide those compounds of the present invention which possess a sufficiently basic or acidic functionality in the form of a salt, such as, in the case of a compound of the present invention which is sufficiently basic, a trifluoroacetate or formate salt for example, or, in the case of a compound of the present invention which is sufficiently acidic, an ammonium salt for example. A salt of this type can either be transformed into its free base or free acid form, respectively, by various methods known to the person skilled in the art, or be used as salts in subsequent biological assays. It is to be understood that the specific form (e.g. salt, free base etc.) of a compound of the present invention as isolated and as described herein is not necessarily the only form in which said compound can be applied to a biological assay in order to quantify the specific biological activity.
UPLC-MS Standard Procedures
Analytical UPLC-MS was performed as described below. The masses (m/z) are reported from the positive mode electrospray ionisation unless the negative mode is indicated (ESI−). In most of the cases method 1 is used. If not, it is indicated.
Method A (HPLC-MS):
Instrument: Waters Acquity UPLCMS SingleQuad; Column: Acquity UPLC BEH C18 1.7 μm, 50×2.1 mm; eluent A: water+0.1 vol % formic acid (99%), eluent B: acetonitrile; gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; flow 0.8 ml/min; temperature: 60° C.; DAD scan: 210-400 nm.
Method B (HPLC-MS):
Instrument: Waters Acquity UPLCMS SingleQuad; Column: Acquity UPLC BEH C18 1.7 μm, 50×2.1 mm; eluent A: water+0.2 vol % aqueous ammonia (32%), eluent B: acetonitrile; gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; flow 0.8 ml/min; temperature: 60° C.; DAD scan: 210-400 nm.
Method C (HPLC-MS):
Instrument: Waters Acquity; MS: Waters ZQ; Column: Acquity BEH C18 1.7 μm, 50×2.1 mm; eluent A: water+0.1 vol % formic acid (99%), eluent B: acetonitrile; gradient:0-1.6 min 1-99% B, 1.8-2.0 min 99% B; temperature: 60° C.; flow: 0.8 ml/min; DAD scan: 210-400 nm
EXPERIMENTAL SECTION—INTERMEDIATES
Intermediate 1
tert-butyl 2,4,5-trifluorobenzoate
Figure US11787797-20231017-C00079
Under argon, to a solution of 2,4,5-trifluorobenzoic acid (101 g, 574 mmol) in 2-methylpropan-2-01 (200 ml) was added N,N-dimethylpyridin-4-amine (35 g, 287 mmol). Subsequently, di-tert-butyl dicarbonate (200 ml, 860 mmol) was added in portions. The resulting mixture was stirred at ambient temperature for two days to yield a clear colorless solution. The reaction mixture was poured into an aqueous sodium carbonate solution (1 N, 1.5 I), and the resulting mixture was extracted with tert-butyl methyl ether (3×300 ml). The organic phases were concentrated and the observed crude product was purified by silica gel chromatography to yield tert-butyl 2,4,5-trifluorobenzoate (113 g, 85%) as white crystals.
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.53 (s, 9H), 7.68 (m, 1H), 7.87 (m, 1H).
Intermediate 2
tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate
Figure US11787797-20231017-C00080
Under argon, to a solution of tert-butyl 2,4,5-trifluorobenzoate (intermediate 1) (50.0 g, 215 mmol) in acetonitrile (500 ml, 9.5 mol) was added 5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one [CAS 118801-67-5] (33.0 g, 237 mmol), and potassium carbonate (59.5 g, 431 mmol). The reaction mixture was stirred under reflux for three days. The mixture was then cooled to room temperature, poured into water (2 l) and the mixture was extracted with tert-butyl methyl ether (3×500 ml). The organic phases were concentrated and the residue was purified twice by chromatography over silica gel to yield tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate 47.2 g (62%).
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=352.0 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.54 (s, 9H), 1.73-1.92 (m, 4H), 2.70 (m, 2H), 3.56 (m, 2H), 7.61 (m, 1H), 7.78 (m, 1H).
Intermediate 3
tert-butyl 2,5-difluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoate
Figure US11787797-20231017-C00081
To a room temperature stirred solution of tert-butyl 2,4,5-trifluorobenzoate (intermediate 1) (1.16 g, 5.00 mmol) in anhydrous acetonitrile (12.5 ml) was added 2,5,6,8-tetrahydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-3-one [CAS 133365-36-3] (741 mg, 5.25 mmol) followed by dropwise addition of 1,8-diazabicyclo[5.4.0]undec-7-ene (1.52 ml, 10.0 mmol). Following complete addition, the resulting mixture was heated at 85° C. for 16 hours, cooled to room temperature and concentrated under reduced pressure to give a dark brown oil (3.52 g). The residue was purified by flash column chromatography to give a waxy white solid (1.35 g, 98% purity, 75%).
LC-MS (method A): Rt=1.15 min; MS (ESIpos): m/z=354.2 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.60 (s, 9H), 3.80 (dd, 2H), 4.08 (dd, 2H), 4.74 (s, 2H), 7.45 (dd, 1H), 7.73 (dd, 1H).
Intermediate 4
tert-butyl 2,5-difluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate
Figure US11787797-20231017-C00082
Tert-butyl 2,5-difluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate was prepared as described for tert-butyl 2,5-difluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoate (Intermediate 3) using tert-butyl 2,4,5-trifluorobenzoate (intermediate 1) and [1,2,4]triazolo[4,3-a]pyridin-3(2H)-one [CAS 6969-71-7] to yield the title compound (70%).
MS (ESIpos): m/z=348 [M+H]+
1H NMR (400 MHz, CDCl3) δ [ppm] 1.60 (s, 9H), 6.55 (ddd, 1H), 7.13-7.21 (m, 2H), 7.53 (dd, 1H), 7.76 (d, 1H), 7.81 (td, 1H).
Intermediate 5
4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile
Figure US11787797-20231017-C00083
To a stirred suspension of 4-bromo-2,5-difluorobenzonitrile (5.0 g, 22.9 mmol) and potassium carbonate (9.5 g, 68.8 mmol) in N,N-dimethylformamide (45.9 ml) was added (S)-1,1,1-trifluoropropanol [CAS 3539-97-7] dropwise (2.88 g, 25.2 mmol). The resulting mixture was heated at 55° C. for 15 hours and cooled to room temperature. Water (100 ml) was added to the mixture and extracted with diethyl ether (3×50 ml). The combined organic extracts were sequentially washed with water (2×100 ml), brine (100 ml), dried over magnesium sulfate, filtered and concentrated under reduced pressure to give an off white solid (6.93 g). The residue was purified by flash column chromatography to give the ether as a white crystalline solid (5.90 g, 97% purity, 80%).
LC-MS (method A): Rt=1.29 min; MS (ESIpos): m/z=312.0 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.511 (4.41), 1.531 (15.64), 1.533 (16.00), 1.548 (15.84), 1.550 (15.83), 4.566 (1.08), 4.581 (2.68), 4.597 (3.18), 4.612 (2.62), 4.626 (1.01), 7.194 (5.27), 7.207 (7.60), 7.220 (7.57).
Intermediate 6
4-bromo-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile
Figure US11787797-20231017-C00084
To a stirred suspension of 4-bromo-2-fluorobenzonitrile (5.00 g, 25.0 mmol) and potassium carbonate (10.4 g, 75.0 mmol) in N,N-dimethylformamide (50.0 ml) was added (S)-1,1,1-trifluoropropanol dropwise (3.14 g, 27.5 mmol). The resulting mixture was heated at 55° C. for two days and cooled to room temperature. Water (100 ml) was added to the mixture and extracted with diethyl ether (3×50 ml). The combined organic extracts were sequentially washed with water (2×100 ml), brine (100 ml), dried over magnesium sulfate, filtered and concentrated under reduced pressure to give a white solid 7.03 g (98% purity, 94%). The product was used directly in the next step without further purification.
LC-MS (method A): Rt=1.27 min; MS (ESIpos): m/z=294 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.368 (3.65), 1.415 (15.76), 1.427 (16.00), 1.428 (15.81), 1.984 (0.94), 4.525 (1.13), 4.538 (2.65), 4.550 (3.35), 4.562 (2.58), 4.574 (1.03), 7.019 (7.92), 7.022 (8.28), 7.073 (9.59), 7.089 (5.49), 7.092 (5.57), 7.105 (7.20), 7.108 (6.95).
Intermediate 7
2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile
Figure US11787797-20231017-C00085
To a solution of 2,4,5-trifluorobenzonitrile (1.08 g, 6.9 mmol) and potassium carbonate (1.9 g, 13.8 mmol) in acetonitrile (25 ml) was added 5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one [CAS 118801-67-5] (1.05 g, 7.6 mmol), and the mixture was heated under reflux overnight. The mixture was then cooled to room temperature, poured into water (150 ml), and extracted with dichloromethane (3×300 ml). The organic phases were dried over sodium sulfate, and concentrated under reduced pressure, and the residue was purified by flash chromatography to yield the title compound as an off-white solid (1.06 g, 56%).
LC-MS (method A): Rt=0.91 min; MS (ESIpos): m/z=277 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.194 (16.00), 1.896 (1.10), 1.898 (1.22), 1.905 (1.49), 1.914 (3.31), 1.920 (3.80), 1.926 (4.48), 1.936 (4.46), 1.941 (5.07), 1.944 (3.41), 1.953 (2.17), 1.957 (2.32), 1.978 (2.44), 1.982 (2.02), 1.992 (4.35), 1.997 (4.41), 2.008 (4.81), 2.013 (3.80), 2.019 (2.76), 2.022 (3.01), 2.028 (1.50), 2.035 (1.36), 2.050 (0.42), 2.776 (7.63), 2.793 (13.88), 2.808 (8.54), 3.218 (5.28), 3.691 (9.78), 3.707 (15.57), 3.722 (6.87), 7.448 (5.53), 7.462 (5.56), 7.472 (5.65), 7.486 (5.47), 7.644 (5.43), 7.658 (5.52), 7.667 (5.42), 7.682 (5.28).
Intermediate 8
2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid
Figure US11787797-20231017-C00086
To a solution of 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile (intermediate 7) (4.3 g, 15.67 mmol) in ethanol (30 ml) was added aqueous sodium hydroxide (1 N, 300 ml) and the resulting suspension was heated to 85° C. for one hour. The resulting clear red solution was cooled to room temperature, adjusted to pH 1 with aqueous 1 N hydrochloric acid, and extracted with ethyl acetate. The organic phases were dried over sodium sulfate and concentrated under reduced pressure to yield a beige-brown solid (3.93 g, 85%), which was used for the next step.
LC-MS (method A): Rt=0.73 min; MS (ESIpos): m/z=296 [M+H]+
Intermediate 9
5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile
Figure US11787797-20231017-C00087
A mixture of 4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 5) (2.43 g, 7.79 mmol), 2,5,6,8-tetrahydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-3-one (1.0 g, 7.09 mmol), tris(dibenzylideneacetone)dipalladium(O) (195 mg, 0.21 mmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (369 mg, 0.64 mmol) and cesium carbonate (3.46 g, 10.6 mmol) were placed under an argon atmosphere. To this mixture was then added argon sparged 1,4-dioxane (14.2 ml) after which the resulting mixture was heated at 105° C. for two days and then cooled to room temperature. The mixture was diluted with ethyl acetate, filtered through a Celite plug and concentrated under reduced pressure to give foamy dark orange solid (3.54 g). The residue was purified by flash column chromatography to give the title compound as a yellow solid (2.53 g, 98% purity, 94%).
LC-MS (method B): Rt=1.04 min; MS (ESIpos): m/z=373 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.526 (6.26), 1.542 (8.45), 1.544 (7.59), 3.713 (2.80), 3.726 (3.96), 3.729 (2.71), 3.740 (3.60), 3.999 (3.80), 4.009 (2.74), 4.012 (3.99), 4.025 (3.13), 4.607 (0.44), 4.623 (1.07), 4.638 (1.33), 4.653 (1.08), 4.673 (16.00), 7.338 (3.00), 7.353 (3.00), 7.381 (3.98), 7.405 (4.00).
Intermediate 10
5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile
Figure US11787797-20231017-C00088
A mixture of 4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 5) (8.24 g, 26.4 mmol), 2,6,7,9-tetrahydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-3-one (intermediate 37) (3.72 g, 24.0 mmol), tris(dibenzylideneacetone)dipalladium(O) (659 mg, 720 μmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (1.25 g, 2.16 mmol) and cesium carbonate (11.7 g, 36.0 mmol) were placed under an argon atmosphere. To this mixture was then added argon sparged 1,4-dioxane (48 ml) after which the resulting mixture was heated at 105° C. for two days and then cooled to room temperature. The mixture was diluted with ethyl acetate, filtered through a Celite plug and concentrated under reduced pressure to give a dark foam (3.54 g). The residue was purified by flash column chromatography to give the title compound as a off-white solid (8.56 g, 90%).
LC-MS (method A): Rt=1.07 min; MS (ESIpos): m/z=387.2 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.584 (3.78), 1.587 (1.48), 1.603 (6.18), 1.618 (6.41), 1.620 (6.42), 2.011 (0.70), 2.017 (0.65), 2.024 (1.24), 2.038 (1.84), 2.050 (1.28), 2.063 (0.74), 3.989 (2.42), 3.996 (1.08), 4.001 (1.79), 4.004 (1.76), 4.017 (2.33), 4.057 (2.76), 4.069 (2.30), 4.081 (2.72), 4.595 (16.00), 4.684 (0.45), 4.699 (1.08), 4.714 (1.33), 4.729 (1.04), 4.744 (0.41), 7.390 (3.04), 7.404 (3.01), 7.454 (4.08), 7.477 (4.04).
Intermediate 11
2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo-[4,3-a]pyridin-2(3H)-yl)benzonitrile
Figure US11787797-20231017-C00089
To a solution of (S)-(+)-1-dimethylamino-2-propanol (2.26 g, 25 mmol) in N,N-dimethylformamide (30 ml) was added sodium hydride (1.0 g, 60% purity, 25.1 mmol) and the suspension was stirred at room temperature for one hour. A solution of 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile (intermediate 7) (3.46 g, 12.5 mmol) in N,N-dimethylformamide (30 ml) was then added dropwise, and the reaction mixture was stirred for three hours, then poured into water, and extracted with ethyl acetate. The organic phases were washed with brine, dried over sodium sulfate and concentrated under reduced pressure. The residue was purified by flash chromatography to yield the title compound as a brown, foamy oil (2.1 g, 47%).
LC-MS (method A): Rt=0.52 min; MS (ESIpos): m/z=360.2 [M+H]+
Intermediate 12
4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00090
To a solution of 4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 5) (27.4 g, 87.9 mmol) in ethanol (90 ml) was added aqueous sodium hydroxide (2 N, 140 ml) and the resulting mixture was heated to 90° C. for 20 hours. The resulting solution was cooled to room temperature, diluted with water, and extracted with dichloromethane. The aqueous phase was acidified with 2 N aqueous hydrochloric acid (pH 2) upon which a white solid precipitated. The suspension was stirred for further 15 minutes, the solid was filtered off, washed with water and dried in vacuo. to yield an off-white solid (25.97 g, 89%), which was used for the next step without further purification.
LC-MS (method A): Rt=1.16 min; MS (ESIpos): m/z=331 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.396 (15.96), 1.411 (16.00), 1.469 (0.69), 1.484 (0.45), 2.518 (3.48), 2.523 (2.36), 5.288 (1.19), 5.304 (2.89), 5.320 (3.73), 5.336 (2.70), 5.352 (1.05), 7.612 (11.35), 7.634 (11.12), 7.743 (7.88), 7.757 (7.91).
Intermediate 13
4-bromo-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid
Figure US11787797-20231017-C00091
To a solution of 4-bromo-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 6) (5.00 g, 17.0 mmol) in ethanol (18 ml) was added aqueous sodium hydroxide (2 N, 28 ml) and the resulting mixture was heated to 90° C. for 21 hours. The resulting solution was cooled to room temperature, diluted with water, and extracted with dichloromethane. The aqueous phase was acidified with 2 N aqueous hydrochloric acid (pH 2) upon which a white solid precipitated. The suspension was stirred for further 15 minutes, the solid was filtered off, washed with water and dried in vacuo. to yield white solid 4.76 g (89%), which was used for the next step without further purification.
LC-MS (method A): Rt=1.15 min; MS (ESIneg): m/z=311 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.403 (15.87), 1.419 (16.00), 2.518 (2.74), 2.523 (1.80), 5.352 (1.13), 5.368 (2.86), 5.383 (3.71), 5.400 (2.72), 5.416 (1.03), 7.299 (6.49), 7.304 (6.51), 7.320 (6.97), 7.324 (7.05), 7.584 (13.85), 7.596 (8.97), 7.600 (8.84), 7.605 (12.52).
Intermediate 14
4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl chloride
Figure US11787797-20231017-C00092
To a solution of 4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 12) (15.0 g, 45.3 mmol) in dichloromethane (230 ml) was added N,N-dimethylformamide (350 μl), followed by dropwise addition of ethanedioyl dichloride (4.7 ml, 54 mmol). The reaction mixture was stirred at room temperature for one hour, and concentrated under reduced pressure. The title compound was obtained as brown oil (15.84 g, quantitative), which was used for the next step without purification. For analytic, a small amount of the product was treated with methanol, to yield the corresponding methyl ester, which was detected by LC-MS.
LC-MS (method A) [methyl ester]: Rt=1.36 min; MS (ESIpos): m/z=345 [M+H]+
Intermediate 15
4-bromo-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl chloride
Figure US11787797-20231017-C00093
To a solution of 4-bromo-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 13) (2.6 g, 8.3 mmol) in dichloromethane (42 ml) was added N,N-dimethylformamide (870 μl), followed by dropwise addition of ethanedioyl dichloride (870 μl, 10 mmol). The reaction mixture was stirred at room temperature for one hour, and concentrated under reduced pressure. The title compound was obtained as brown oil (15.84 g, quantitative), which was used for the next step without purification. For analytic, a small amount of the product was treated with methanol, to yield the corresponding methyl ester, which was detected by LC-MS.
LC-MS (method A) [methyl ester]: Rt=1.33 min; MS (ESIpos): m/z=327 [M+H]+
Intermediate 16
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic Acid
Figure US11787797-20231017-C00094
To a −10° C. stirred solution of (S)-(+)-2-pentanol (1.16 g, 13.2 mmol) in anhydrous tetrahydrofuran (13.2 ml) was added a 1.0 M solution of potassium 1,1,1,3,3,3-hexamethyldisilazan-2-ide in tetrahydrofuran dropwise (7.20 ml, 7.20 mmol). The resulting mixture was then stirred at −10° C. for 1 hour, after which the resulting alkoxide solution was added dropwise to a stirred solution of tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 2) (2.11 g, 6.00 mmol) in anhydrous tetrahydrofuran (6.00 ml). The resulting orange solution was stirred at −10° C. for 2 hours and then concentrated under reduced pressure to give a orange solid. The residue was purified by flash column chromatography to give a mixture of esters as a colourless oil. The residue was suspended in a 4:1 ration of 1,4-dioxane/water (30.0 ml) after which lithium hydroxide (2.16 g, 90.0 mmol) was added in one portion. The resulting mixture was heated at 70° C. for 16 hours and cooled to room temperature. Water (20 ml) was added to the mixture followed by washing with diethyl ether (20 ml). The aqueous layer was acidified to pH 2.0 with concentrated hydrochloric acid and then extracted with diethyl ether (3×20 ml). The combined organic extracts were washed with brine (20 ml), dried over magnesium sulfate, filtered and concentrated under reduced pressure to give a cream solid. The residue was purified by flash column chromatography to give 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid as a cream solid (1.06 g, 48%).
LC-MS (method A): Rt=1.05 min; MS (ESIpos): m/z=364 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.958 (6.44), 0.976 (15.81), 0.983 (0.74), 0.995 (7.41), 1.002 (0.81), 1.400 (0.49), 1.418 (0.89), 1.426 (0.78), 1.435 (16.00), 1.444 (1.77), 1.450 (15.70), 1.459 (1.02), 1.462 (1.04), 1.471 (0.41), 1.478 (1.05), 1.484 (0.68), 1.490 (0.68), 1.497 (0.84), 1.504 (0.84), 1.509 (0.68), 1.516 (0.45), 1.523 (0.87), 1.542 (0.50), 1.675 (0.56), 1.689 (0.98), 1.700 (0.47), 1.704 (0.57), 1.710 (0.90), 1.714 (0.89), 1.724 (1.46), 1.728 (0.53), 1.734 (0.83), 1.739 (0.76), 1.749 (1.27), 1.763 (0.57), 1.811 (0.71), 1.825 (0.85), 1.827 (0.85), 1.837 (0.71), 1.841 (0.83), 1.846 (0.58), 1.851 (0.76), 1.853 (0.79), 1.860 (0.58), 1.862 (0.60), 1.867 (0.68), 1.872 (0.50), 1.876 (0.48), 1.888 (0.49), 1.902 (0.78), 1.910 (0.62), 1.919 (1.38), 1.926 (1.59), 1.931 (1.81), 1.942 (1.81), 1.946 (2.01), 1.959 (0.85), 1.962 (0.92), 1.984 (0.96), 1.990 (0.88), 1.999 (1.79), 2.003 (1.85), 2.014 (1.99), 2.019 (1.58), 2.028 (1.19), 2.042 (0.52), 2.793 (3.08), 2.808 (5.61), 2.825 (3.35), 3.701 (3.92), 3.712 (9.14), 3.717 (6.28), 3.732 (2.69), 4.674 (0.99), 4.689 (1.93), 4.704 (1.90), 4.720 (0.95), 5.308 (1.24), 7.464 (3.89), 7.478 (3.90), 8.012 (4.97), 8.040 (4.91), 11.113 (0.43).
Intermediate 17
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid
Figure US11787797-20231017-C00095
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (S)-1,1,1-trifluoropropanol [CAS 3539-97-7] (5.01 g, 44.0 mmol) and tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 2) (7.03 g, 20.0 mmol) to yield the title compound, 7.15 g (98% purity, 90%).
LC-MS (method A): Rt=0.93 min; MS (ESIpos): m/z=390 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.578 (0.49), 1.607 (15.92), 1.623 (16.00), 1.908 (1.01), 1.923 (2.89), 1.935 (4.07), 1.950 (4.27), 1.966 (2.10), 1.988 (2.08), 2.007 (4.12), 2.018 (4.38), 2.032 (2.70), 2.046 (1.12), 2.054 (0.61), 2.798 (5.21), 2.814 (10.12), 2.830 (5.64), 3.709 (6.22), 3.725 (10.71), 3.739 (4.89), 4.821 (1.08), 4.836 (2.54), 4.851 (3.26), 4.866 (2.46), 4.882 (1.00), 7.504 (6.48), 7.519 (6.42), 7.954 (6.94), 7.981 (6.82).
Intermediate 18
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00096
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (R)-1,1,1-trifluoropropanol [CAS 17628-73-8] (714 mg, 6.26 mmol) and tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 2) (1.0 g, 2.85 mmol) to yield the title compound, 800 mg (72%).
LC-MS (method A): Rt=0.92 min; MS (ESIpos): m/z=390 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.400 (15.93), 1.416 (16.00), 1.512 (1.30), 1.769 (0.97), 1.784 (2.84), 1.796 (4.11), 1.810 (4.29), 1.823 (2.12), 1.864 (2.02), 1.878 (4.18), 1.889 (4.40), 1.903 (2.82), 1.917 (1.14), 2.083 (9.11), 2.326 (0.48), 2.683 (4.64), 2.699 (9.32), 2.715 (5.05), 3.549 (5.37), 3.564 (9.81), 3.579 (4.60), 5.184 (1.05), 5.200 (2.59), 5.216 (3.40), 5.232 (2.48), 5.248 (1.00), 7.481 (6.42), 7.497 (6.44), 7.645 (7.67), 7.671 (7.48), 13.231 (1.18).
Intermediate 19
2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic Acid
Figure US11787797-20231017-C00097
2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (1S)-1-cyclohexylethanol (14.96 g, 116.7 mmol), tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 2) (20 g, 56.9 mmol) and to yield the title compound, and potassium 2-methylpropan-2-olate instead of potassium 1,1,1,3,3,3-hexamethyldisilazan-2-ide as base. The title compound was obtained as white solid, 13.03 g (57%).
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=404 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: −0.008 (0.83), 0.008 (0.90), 1.025 (0.44), 1.056 (1.55), 1.086 (2.87), 1.106 (2.47), 1.118 (3.29), 1.148 (3.68), 1.166 (15.87), 1.182 (16.00), 1.535 (1.26), 1.616 (1.40), 1.645 (1.48), 1.692 (4.71), 1.721 (4.07), 1.766 (0.90), 1.781 (2.33), 1.793 (3.31), 1.808 (3.63), 1.824 (2.93), 1.857 (2.93), 1.875 (3.52), 1.886 (3.49), 1.899 (2.18), 1.914 (0.86), 2.675 (3.71), 2.691 (7.09), 2.707 (3.89), 3.542 (4.20), 3.557 (7.48), 3.572 (3.50), 4.203 (0.54), 4.218 (1.95), 4.233 (2.74), 4.247 (1.91), 4.262 (0.51), 5.758 (0.53), 7.227 (4.58), 7.243 (4.56), 7.542 (5.25), 7.568 (5.18), 12.923 (4.84).
Intermediate 20
2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic Acid
Figure US11787797-20231017-C00098
To a solution of 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile (intermediate 11) (2.1 g, 5.84 mmol) in ethanol (12 ml) was added aqueous sodium hydroxide solution (120 ml, 1.0 M, 120 mmol), and the mixture was heated to 85° C. for seven hours. The mixture was then cooled to room temperature and extracted with ethyl acetate. The aqueous solution was then adjusted to pH 5 with 1 M aqueous hydrochloric acid and concentrated under reduced pressure. The residue was purified by reversed phase column chromatography (Biotage® SNAP ULTRA C18, water, acetonitrile 0-40%) to yield the product as a beige solid (1.9 g, 86%).
LC-MS (method B): Rt=0.51 min; MS (ESIneg): m/z=377 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.497 (4.39), 1.513 (4.38), 1.909 (0.76), 1.921 (1.07), 1.936 (1.12), 1.993 (1.11), 2.003 (1.14), 2.595 (16.00), 2.766 (0.86), 2.772 (0.98), 2.781 (1.40), 2.797 (3.05), 2.812 (1.46), 3.115 (0.65), 3.143 (0.81), 3.174 (0.57), 3.689 (1.55), 3.704 (2.60), 3.718 (1.30), 4.599 (0.48), 7.289 (1.65), 7.304 (1.61), 7.724 (1.76), 7.751 (1.72).
Intermediate 21
5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic Acid
Figure US11787797-20231017-C00099
5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (S)-pentan-2-ol (440 μl, 4.0 mmol) and tert-butyl 2,5-difluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoate (intermediate 3) (650 mg, 1.84 mmol) to yield the title compound, 200 mg (30%).
LC-MS (method A): Rt=0.97 min; MS (ESIpos): m/z=366.2 [M+H]+
Intermediate 22
rac-2-{[(2S)-4-(dimethylamino)butan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoic Acid
Figure US11787797-20231017-C00100
Rac-2-{[(2S)-4-(dimethylamino)butan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using rac-4-(dimethylamino)butan-2-ol (136 mg, 1.16 mmol) and tert-butyl 2,5-difluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoate (intermediate 3) (200 mg, 0.566 mmol) to yield the title compound, 64 mg (52%).
LC-MS (method B): Rt=0.49 min; MS (ESIpos): m/z=395 [M+H]+
Intermediate 23
rac-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[1-(pyrrolidin-1-yl)propan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00101
5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[1-(pyrrolidin-1-yl)propan-2-yl]oxy}benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using rac-1-(pyrrolidin-1-yl)propan-2-ol (187 mg, 1.45 mmol) and tert-butyl 2,5-difluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoate (intermediate 3) (250 mg, 0.707 mmol) to yield the title compound, 117 mg (41%).
LC-MS (method B): Rt=0.52 min; MS (ESIpos): m/z=407 [M+H]+
Intermediate 24
5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00102
Method 1:
5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (S)-1,1,1-trifluoropropanol [CAS 3539-97-7] (461 mg, 4.0 mmol) and tert-butyl 2,5-difluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzoate (intermediate 3) (650 mg, 1.8 mmol) to yield the title compound, 356 mg (49%).
Method 2:
To a stirred suspension of 5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 9) (1.12 g, 3.0 mmol) in water (3.00 ml) was added concentrated sulfuric acid (8.40 ml, 158 mmol) and acetic acid (8.40 ml, 147 mmol). The resulting mixture was heated at 120° C. for 2 days and then cooled to room temperature. The mixture was poured onto ice water and extracted with diethyl ether (3×50 ml), after which the combined organic extracts were washed with 2.0 M aqueous sodium hydroxide (4×25 ml). The resulting aq. layer was acidified to pH 2.5 with concentrated aqueous hydrochloric acid and extracted with diethyl ether (3×50 ml). The combined organic extracts were dried over sodium sulfate, filtered and concentrated under reduced pressure to give the acid as an off white solid (1.07 g, 98% purity, 89%).
LC-MS (method A): Rt=0.84 min; MS (ESIpos): m/z=392 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.400 (8.86), 1.416 (8.88), 1.513 (1.37), 2.083 (3.03), 2.326 (0.67), 2.331 (0.48), 2.518 (3.05), 2.522 (2.02), 2.668 (0.70), 2.673 (0.49), 3.653 (3.00), 3.666 (4.91), 3.680 (3.47), 4.016 (3.69), 4.030 (5.03), 4.043 (3.10), 4.736 (16.00), 5.177 (0.60), 5.193 (1.49), 5.209 (1.93), 5.225 (1.38), 5.241 (0.55), 7.484 (2.92), 7.499 (2.85), 7.640 (3.36), 7.666 (3.30).
Intermediate 25
5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00103
5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (S)-1,1,1-trifluoropropanol [CAS 3539-97-7] and tert-butyl 2,5-difluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 4).
Intermediate 26
5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic Acid
Figure US11787797-20231017-C00104
5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (S)-pentan-2-ol and tert-butyl 2,5-difluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 4).
MS (ESIneg): m/z=358 [M−H]−
1H NMR (400 MHz, CDCl3) δ [ppm] 0.98 (t, 3H), 1.39-1.57 (m, 2H), 1.46 (d, 3H), 1.68-1.79 (m, 1H), 1.82-1.92 (m, 1H), 4.67-4.76 (m, 1H), 6.57 (ddd, 1H), 7.15-7.23 (m, 2H), 7.48 (d, 1H), 7.82 (td, 1H), 8.09 (d, 1H), 11.04 (br, 1H).
Intermediate 27
5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzoic Acid
Figure US11787797-20231017-C00105
5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (1S)-1-phenylethanol and tert-butyl 2,5-difluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 4).
MS (ESIneg): m/z=392 [M−H]−
1H NMR (400 MHz, CDCl3) δ [ppm] 1.83 (d, 3H), 5.63 (q, 1H), 6.55 (ddd, 1H), 7.11-7.22 (m, 2H), 7.29-7.41 (m, 5H), 7.44 (d, 1H), 7.79 (td, 1H), 8.05 (d, 1H), 11.04 (br, 1H).
Intermediate 28
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzoic Acid
Figure US11787797-20231017-C00106
5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzoic acid was prepared as described for 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (Intermediate 16), using (1S)-1-phenylethanol and tert-butyl 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoate (intermediate 2).
MS (ESIpos): m/z=398 [M+H]+
1H NMR (400 MHz, CDCl3) δ [ppm] 1.80 (d, 3H), 1.86-1.94 (m, 2H), 1.94-2.02 (m, 2H), 2.76 (t, 2H), 3.65-3.71 (m, 2H), 5.61 (q, 1H), 7.30-7.40 (m, 5H), 7.45 (d, 1H), 7.98 (d, 1H).
Intermediate 29
5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00107
To a stirred suspension of 5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 10) (2.61 g, 6.76 mmol) in water (6.76 ml) was added concentrated. sulfuric acid (18.9 ml) and acetic acid (18.9 ml). The resulting mixture was heated at 120° C. for two days and then cooled to room temperature. The mixture was poured onto ice water and extracted with diethyl ether (3×100 ml), after which the combined organic extracts were washed with 2.0 M aqueous sodium hydroxide (4×50 ml). The resulting aqueous layer was acidified to pH 2.5 with concentrated hydrochloric acid and extracted with diethyl ether (3×100 ml). The combined organic extracts were dried over sodium sulfate, filtered and concentrated under reduced pressure to give the acid as a beige solid (2.1 g, 85% purity, 65%). The material was used in the next step without further purification.
LC-MS (method A): Rt=0.89 min; MS (ESIpos): m/z=406 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.817 (0.46), 0.837 (0.88), 0.842 (0.90), 0.849 (0.81), 0.858 (0.73), 0.887 (0.43), 1.262 (1.08), 1.293 (0.99), 1.379 (0.51), 1.624 (9.21), 1.640 (9.17), 2.019 (3.78), 2.032 (1.73), 2.045 (2.48), 2.057 (1.91), 2.065 (1.03), 2.070 (1.21), 3.709 (0.48), 3.723 (0.65), 3.737 (0.45), 4.001 (2.93), 4.016 (2.36), 4.028 (3.00), 4.041 (0.80), 4.062 (3.28), 4.075 (3.04), 4.087 (3.03), 4.609 (16.00), 4.694 (2.34), 4.821 (0.61), 4.837 (1.44), 4.852 (1.82), 4.868 (1.38), 4.883 (0.56), 7.445 (3.54), 7.459 (3.54), 7.473 (0.55), 7.488 (0.51), 7.971 (0.86), 7.977 (4.10), 7.998 (0.88), 8.003 (4.03).
Intermediate 30
4-bromo-N-(2,6-difluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00108
Under argon, a solution of 4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl chloride (intermediate 14) (17.0 g, 48.6 mmol) in dichloromethane (200 ml) were added at room temperature to a solution of 2,6-difluoroaniline (5.8 ml, 54 mmol) and triethylamine (7.5 ml, 54 mmol) in dichloromethane (350 ml), and the mixture was stirred at room temperature for one hour. The reaction mixture was then concentrated under reduced pressure. The residue was dissolved in 150 ml of methanol and triturated with water (300 ml). The resulting solid was filtered, washed with water, and dried in vacuo to yield the title compound (20.6 g, 96%) as off-white solid.
LC-MS (method A): Rt=1.40 min; MS (ESIneg): m/z=440 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.147 (1.01), 1.165 (1.91), 1.184 (1.01), 1.339 (0.56), 1.356 (0.62), 1.394 (0.97), 1.411 (1.35), 1.430 (16.00), 1.446 (15.69), 1.486 (0.42), 2.331 (0.97), 2.518 (4.44), 2.522 (3.02), 2.673 (0.97), 5.366 (1.11), 5.383 (2.64), 5.399 (3.30), 5.415 (2.46), 5.430 (1.04), 7.183 (4.93), 7.203 (10.41), 7.224 (6.52), 7.367 (1.18), 7.382 (2.50), 7.403 (3.68), 7.419 (1.98), 7.424 (1.91), 7.440 (0.83), 7.555 (7.05), 7.576 (6.98), 7.808 (6.25), 7.822 (6.18), 9.886 (0.42), 9.918 (10.17).
Intermediate 31
4-bromo-N-(2-chloro-6-fluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00109
4-bromo-N-(2-chloro-6-fluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide was prepared as described for 4-bromo-N-(2,6-difluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (Intermediate 30), using 4-bromo-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl chloride (intermediate 14) (10.6 g, 30.3 mmol) and 2-chloro-6-fluoroaniline (4.86 g, 33.4 mmol) to yield the title compound, 12.5 g (90%).
LC-MS (method A): Rt=1.44 min; MS (ESIpos): m/z=458 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.343 (1.25), 1.356 (1.38), 1.387 (1.01), 1.404 (1.10), 1.437 (16.00), 1.453 (15.85), 2.327 (0.96), 2.669 (0.99), 5.401 (1.31), 5.417 (2.76), 5.432 (3.40), 5.449 (2.53), 5.465 (1.17), 7.328 (1.83), 7.347 (4.04), 7.363 (2.55), 7.371 (2.93), 7.383 (2.30), 7.403 (4.05), 7.416 (5.56), 7.425 (9.27), 7.431 (9.39), 7.445 (2.51), 7.482 (0.62), 7.528 (5.87), 7.549 (5.79), 7.679 (0.57), 7.820 (5.53), 7.834 (5.48), 9.977 (10.39).
Intermediate 32
4-bromo-N-(2,6-difluorophenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00110
4-bromo-N-(2,6-difluorophenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamidewasprepared as described for 4-bromo-N-(2,6-difluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (Intermediate 30), using 4-bromo-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl chloride (intermediate 15) (2.65 g, 7.99 mmol) and 2,6-difluoroaniline (950 μl, 8.8 mmol) to yield the title compound, 3.11 g (92%).
LC-MS (method A): Rt=1.36 min; MS (ESIpos): m/z=424 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.054 (0.42), 1.350 (0.40), 1.365 (0.42), 1.445 (16.00), 1.461 (15.92), 2.518 (4.30), 2.523 (2.73), 5.433 (1.17), 5.449 (2.71), 5.465 (3.50), 5.481 (2.57), 5.497 (1.09), 7.176 (4.91), 7.197 (10.19), 7.217 (6.29), 7.362 (4.96), 7.365 (4.80), 7.382 (7.32), 7.385 (6.93), 7.395 (4.03), 7.411 (2.04), 7.433 (0.82), 7.493 (7.91), 7.514 (5.84), 7.667 (8.70), 9.794 (12.87).
Intermediate 33
2,5-difluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00111
To a solution of 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 8) (195 mg, 660 μmol) in N,N-dimethylformamide (5 ml) was added 1-[bis(dimethylamino)methylene]-1H-[1,2,3]triazolo[4,5-b]pyridin-1-ium 3-oxide hexafluorophosphate (HATU) (502 mg, 1.32 mmol), and the mixture was stirred at room temperature for 15 minutes. Then, 2-fluoroaniline (80.7 mg, 727 μmol) and N-ethyl-N-isopropylpropan-2-amine (350 μl, 2.0 mmol) were added subsequently, and the reaction mixture was stirred at room temperature for four hours. The reaction solution was directly subjected to reversed phase column chromatography (Biotage® SNAP ULTRA C18, water, acetonitrile 10-90%) to yield the product as a beige solid (110 mg, 43%).
LC-MS (method A): Rt=1.08 min; MS (ESIpos): m/z=389.8 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.844 (0.47), 1.108 (8.91), 1.145 (0.50), 1.198 (0.42), 1.232 (0.92), 1.775 (1.68), 1.790 (4.64), 1.802 (6.53), 1.817 (6.65), 1.829 (3.29), 1.870 (3.21), 1.884 (6.59), 1.895 (7.01), 1.909 (4.27), 1.923 (1.68), 2.074 (7.34), 2.323 (1.28), 2.327 (1.68), 2.331 (1.23), 2.523 (4.80), 2.669 (1.90), 2.674 (1.59), 2.689 (7.65), 2.705 (15.02), 2.721 (8.15), 3.559 (9.08), 3.575 (16.00), 3.589 (7.23), 4.190 (0.84), 7.216 (1.90), 7.229 (5.00), 7.234 (5.72), 7.247 (6.51), 7.253 (7.20), 7.263 (4.94), 7.270 (4.22), 7.275 (5.36), 7.281 (2.23), 7.291 (5.31), 7.310 (2.29), 7.317 (4.75), 7.338 (2.32), 7.342 (1.95), 7.600 (3.24), 7.614 (3.60), 7.626 (3.55), 7.640 (3.24), 7.742 (3.55), 7.757 (3.80), 7.768 (3.80), 7.783 (3.49), 7.823 (2.18), 7.840 (3.85), 7.856 (2.12), 10.315 (8.04).
Intermediate 34
N-(2,6-difluorophenyl)-2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00112
To a solution of 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 8) (195 mg, 660 μmol) in N,N-dimethylformamide (5 ml) was added 1-[bis(dimethylamino)methylene]-1H-[1,2,3]triazolo[4,5-b]pyridin-1-ium 3-oxide hexafluorophosphate (HATU) (502 mg, 1.32 mmol), and the mixture was stirred at room temperature for 15 minutes. Then, 2,6-difluoroaniline (93.8 mg, 727 μmol) and N-ethyl-N-isopropylpropan-2-amine (350 μl, 2.0 mmol) were added subsequently, and the reaction mixture was stirred at room temperature for four hours. The reaction solution was directly subjected to reversed phase column chromatography (Biotage® SNAP ULTRA C18, water, acetonitrile 10-90%) to yield the product as a beige solid (292 mg, 40% purity, 44% yield).
LC-MS (method A): Rt=0.99 min; MS (ESIpos): m/z=407.8 [M+H]+
Intermediate 35
2,5-difluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00113
To a solution of 2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 8) (1.4 g, 4.74 mmol) in N,N-dimethylformamide (110 ml) was added 1-[bis(dimethylamino)methylene]-1H-[1,2,3]triazolo[4,5-b]pyridin-1-ium 3-oxide hexafluorophosphate (HATU) (10.1 g, 26.6 mmol), and the mixture was stirred at room temperature for 15 minutes. Then, 2-fluoro-6-methylaniline (1.83 g, 14.6 mmol) and N-ethyl-N-isopropylpropan-2-amine (7.0 ml, 40 mmol) were added subsequently, and the reaction mixture was stirred at room temperature for four hours. The reaction solution was directly subjected to reversed phase column chromatography (Biotage® SNAP ULTRA C18, 0.1% aqueous ammonia, acetonitrile 1-100%) to yield the product as a beige solid (1.1 g, 57%).
LC-MS (method A): Rt=1.03 min; MS (ESIneg): m/z=403.3 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.273 (0.85), 1.290 (0.98), 1.316 (0.46), 1.579 (0.83), 1.907 (0.43), 1.914 (0.55), 1.923 (1.11), 1.930 (1.33), 1.934 (1.51), 1.946 (1.48), 1.950 (1.61), 1.962 (0.70), 1.966 (0.76), 1.986 (0.85), 1.990 (0.77), 2.000 (1.48), 2.005 (1.53), 2.016 (1.58), 2.021 (1.29), 2.030 (0.97), 2.044 (0.43), 2.203 (2.58), 2.336 (16.00), 2.796 (2.27), 2.813 (4.24), 2.829 (2.49), 3.710 (3.20), 3.725 (4.84), 3.740 (2.05), 7.001 (0.69), 7.023 (1.39), 7.046 (0.86), 7.072 (1.29), 7.091 (1.72), 7.190 (0.87), 7.204 (0.96), 7.210 (1.30), 7.224 (1.29), 7.230 (0.65), 7.243 (0.59), 7.625 (1.26), 7.639 (1.27), 7.655 (1.27), 7.670 (1.24), 7.974 (0.80), 8.012 (0.86), 8.020 (1.51), 8.036 (1.31), 8.047 (1.29), 8.064 (1.25).
Intermediate 36
tert-butyl 2-(4-[(2,6-difluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-phenyl)-3-oxo-2,3,5,6,8,9-hexahydro-7H-[1,2,4]triazolo[4,3-d][1,4]diazepine-7-carboxylate
Figure US11787797-20231017-C00114
4-bromo-N-(2,6-difluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (intermediate 30) (100 mg, 226 μmol), tert-butyl 3-oxo-2,3,5,6,8,9-hexahydro-7H-[1,2,4]triazolo[4,3-d][1,4]diazepine-7-carboxylate [CAS 1424939-96-7] (86.3 mg, 339 μmol), tris(dibenzylideneacetone)dipalladium(O) (20.7 mg, 22.6 μmol), 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene (39.3 mg, 67.8 μmol), and cesium carbonate (147 mg, 452 μmol) were placed in a microwave vial under argon. Degassed dioxane (2.0 ml) was added, the vial was capped and the mixture was heated to 110° C. for 40 hours. The resulting suspension was filtered over celite, the filter cake was washed with ethyl acetate, and the filtrate was reduced under reduced pressure. The residue was purified by preparative HPLC to yield the title compound as beige crystalline solid (67.2 mg, 90% purity, 43%).
LC-MS (method A): Rt=1.32 min; MS (ESIpos): m/z=616.2 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.430 (1.97), 1.449 (16.00), 2.518 (1.77), 2.522 (1.16), 2.907 (0.55), 3.634 (0.66), 3.833 (0.70), 7.190 (0.52), 7.204 (0.70), 7.211 (1.04), 7.231 (0.64), 7.386 (0.40), 7.408 (0.40), 7.554 (0.62), 7.570 (1.11), 7.596 (0.67), 9.996 (1.53).
Intermediates 37-41 were prepared by methods described in the literature (the syntheses of similar triazolone derivatives are for example described in Chemische Berichte (1957), 90, 909-21; Journal of Medicinal Chemistry (1992), 35(1), 189-94; DE 19901846 A1).
Intermediate 37
2,6,7,9-tetrahydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-3-one
Figure US11787797-20231017-C00115
Intermediate 38
5,6-dihydro[1,3]thiazolo[2,3-c][1,2,4]triazol-3(2H)-one
Figure US11787797-20231017-C00116
Intermediate 39
6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]thiazin-3(2H)-one
Figure US11787797-20231017-C00117
Intermediate 40
6,6-dimethyl-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-3(2H)-one
Figure US11787797-20231017-C00118
Intermediate 41
6,6-difluoro-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one
Figure US11787797-20231017-C00119
Intermediate 42
5-chloro-2-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile
Figure US11787797-20231017-C00120
A mixture of 5-chloro-2,4-difluorobenzonitrile [CAS 146780-26-9] (540 mg, 3.11 mmol), 5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one [CAS 118801-67-5] (476 mg, 3.42 mmol), and potassium carbonate (860 mg, 6.22 mmol) in acetonitrile (5.1 ml) was heated in an oil bath at 95° C. bath temperature for 3.5 hours. After cooling to room temperature, the mixture was poured into water, and the resulting mixture was extracted with dichloromethane. The organic fractions were dried over sodium sulfate and concentrated under reduced pressure to yield the crude product as yellow oil (1 g, 38%-UV), which was used in the next step without purification.
For analytical purpose, the reaction was repeated with 50.0 mg (288 μmol) of 5-chloro-2,4-difluorobenzonitrile, 5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one (44.1 mg, 317 μmol), and potassium carbonate (79.6 mg, 576 μmol) in 0.4 ml acetonitrile under the same conditions. The crude material was purified by preparative HPLC (XBridge Prep C18 5μ OBD; solvents: water (+0.1% ammonia), acetonitrile; gradient 5%-95% acetonitrile in 10 min; flow: 30 ml/min) to afford 5-chloro-2-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile (16 mg, 19% yield, 100%-UV).
LC-MS (Method A): Rt=0.93 min; MS (ESIpos): m/z=293 [M+H]+
1H-NMR (500 MHz, DMSO-d6) δ[ppm]: −0.006 (0.53), 0.000 (13.44), 0.007 (0.47), 1.242 (0.55), 1.780 (1.49), 1.786 (1.73), 1.793 (4.36), 1.799 (4.35), 1.803 (5.95), 1.812 (4.83), 1.815 (6.38), 1.824 (2.21), 1.827 (2.42), 1.873 (2.41), 1.878 (2.20), 1.885 (5.83), 1.889 (5.08), 1.897 (6.55), 1.902 (4.54), 1.908 (4.03), 1.920 (1.58), 2.077 (1.08), 2.519 (1.18), 2.523 (0.96), 2.527 (0.73), 2.687 (8.10), 2.700 (15.19), 2.713 (7.92), 3.216 (0.91), 3.557 (8.68), 3.569 (16.00), 3.581 (7.93), 7.765 (10.96), 7.784 (11.13), 8.374 (10.26), 8.387 (10.04).
Intermediate 43
5-chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-tri-fluoropropan-2-yl]oxy}benzonitrile
Figure US11787797-20231017-C00121
To a solution of (2S)-1,1,1-trifluoropropan-2-ol (468 mg, 4.10 mmol) in tetrahydrofuran (5 ml) was added in portions sodium hydride (164 mg, 60% in mineral oil, 4.10 mmol) at 0° C. After stirring for 30 min, a solution of 5-chloro-2-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzonitrile (intermediate 42, crude product from previous step, 1.00 g, 38%-UV) and the mixture was stirred for 1.5 h at 0° C. The mixture was then poured into saturated aqueous sodium chloride (5 ml), and extracted with ethyl acetate. The organic fractions were dried over sodium sulfate and concentrated under reduced pressure. The crude product (1.16 g, 50%-UV) was used without purification.
LC-MS (Method A): Rt=1.12 min; MS (ESIpos): m/z=387 [M+H]+
Intermediate 44
5-chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-tri-fluoropropan-2-yl]oxy}benzoic Acid
Figure US11787797-20231017-C00122
To a solution of 5-chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzonitrile (intermediate 43, crude product from previous step, 1.16 g, 50%-UV) in ethanol (90 ml) was added aqueous sodium hydroxide (62 ml, 1.0 M, 62 mmol) and the mixture was stirred at 80° C. for 2 d. After cooling to room temperature, the reaction mixture was extracted twice with ethyl acetate. The organic phase was discarded, and the aqueous phase was then adjusted to an acidic pH using 1 N aqueous hydrochloric acid and extracted with ethyl acetate. The organic phases were dried over sodium sulfate and concentrated under reduced pressure to yield the crude product (0.73 g, 80%-UV), which was used without further purification.
LC-MS (Method A): Rt=0.93 min; MS (ESIneg): m/z=404 [M−H]−
Intermediate 45
rac-tert-butyl N-[2-(5-bromo-2-cyano-4-fluoro-phenoxy)propyl]carbamate
Figure US11787797-20231017-C00123
To a suspension of sodium hydride (4.04 g, 100 mmol, 60% purity) in THF (25 mL) was added tert-butyl N-(2-hydroxypropyl)carbamate (8.84 g, 50.5 mmol) at 0° C. The resulting mixture was stirred at 0° C. for 0.5 h, then a solution of 4-bromo-2,5-difluorobenzonitrile (10 g, 45.9 mmol) in THF (25 mL) was added. The mixture was stirred at 0° C. for 0.5 h. The reaction mixture was diluted with water and extracted with ethyl acetate. The combined organic layers were washed with brine, dried over sodium sulfate, filtered and concentrated under reduced pressure to give a residue, which was purified by column chromatography (silica gel, petroleum ether/ethyl acetate=50/1 to 10/1) to give the desired product (13 g, 34.8 mmol, 76% yield) as a white solid.
MS (M+H+): 397.1
1H NMR (400 MHz, CDCl3) [ppm]: 7.33-7.30 (t, J=6 Hz, 1H), 7.27-7.24 (t, J=6 Hz, 1H), 4.99 (s, 1H), 4.57 (s, 1H), 3.53-3.48 (m, 1H), 3.33-3.28 (m, 1H), 1.62-1.45 (q, 9H), 1.36-1.26 (m, 3H).
Intermediate 46
rac-4-bromo-2-[2-(tert-butoxycarbonylamino)-1-methyl-ethoxy]-5-fluoro-benzoic Acid
Figure US11787797-20231017-C00124
To a solution of tert-butyl N-[2-(5-bromo-2-cyano-4-fluoro-phenoxy)propyl]carbamate (13 g, 34.8 mmol) in ethanol (60 mL) was added sodium hydroxide (5 M in water, 69.7 mL) at 25° C., the resulting mixture was stirred at 90° C. for 12 hrs. The reaction mixture was evaporated under vacuum, the residue was diluted with water (60 mL), acidified to pH=4-5 with aq. hydrochloric acid (1 N), extracted with ethyl acetate three times. The combined organic layers were washed with brine, dried over sodium sulfate, filtered, and concentrated under reduced pressure to give the desired product (11 g, crude) as a yellow oil, which was used in next step without further purification.
MS (M+H+): 336.2
1H NMR (400 MHz, CDCl3) δ [ppm]: 7.84-7.82 (d, J=8 Hz, 1H), 7.31-7.29 (d, J=8 Hz, 1H), 5.16 (s, 1H), 4.70 (s, 1H), 3.53-3.50 (m, 1H), 3.40-3.34 (m, 1H), 1.44-1.39 (t, J=10 Hz, 9H), 1.32-1.25 (m, 3H).
Intermediate 47
rac-tert-butyl (2-{5-bromo-2-[(2-chloro-6-fluorophenyl)carbamoyl]-4-fluorophenoxy}propyl) carbamate
Figure US11787797-20231017-C00125
Crude intermediate 46 (10 g, 25.5 mmol) and 2-chloro-6-fluoroaniline (3.71 g, 25.5 mmol) were suspended in pyridine (50 mL) was added phosphoryl chloride (15.6 g, 102 mmol, 9.5 mL) in one portion at 0° C. under nitrogen. The resulting mixture was stirred at 25° C. for 10 min. The reaction mixture was quenched by addition of water (300 mL) and extracted with ethyl acetate (300 mL×2). The combined organic layers were washed with brine (150 mL×2), dried over sodium sulfate, filtered and concentrated under reduced pressure. Column chromatography (silica gel, petroleum ether/ethyl acetate=50/1 to 5/1) afforded the desire product (8.22 g, 15.2 mmol, 59% yield, 96% purity).
MS (M+H+): 421.1
1H NMR (400 MHz, CDCl3) δ [ppm]: 9.46 (s, 1H), 8.06-8.03 (d, J=12 Hz, 1H), 7.31-7.28 (q, 2H), 7.26 (s, 1H), 7.25-7.13 (t, J=24 Hz, 1H), 4.92 (s, 1H), 4.78-4.73 (q, 1H), 3.50-3.47 (m, 2H), 1.58-1.42 (q, 3H), 1.38 (s, 9H).
EXPERIMENTAL SECTION—EXAMPLES Example 1 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00126
To a 0° C. stirred solution of 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (intermediate 16) (100 mg, 275 μmol) and catalytic N,N-dimethylformamide in anhydrous dichloromethane (1.5 ml) was added oxalyl chloride (28 μl, 330 μmol). The resulting mixture was warmed to room temperature, stirred for 90 minutes and concentrated under reduced pressure. A solution of the residue in anhydrous dichloromethane (1.0 ml) was added dropwise to a 0° C. stirred solution of 2,6-difluoroaniline (39 mg, 303 μmol) and triethylamine (42 μl, 300 μmol) in anhydrous DCM (2.0 ml). Following complete addition, the mixture was warmed to room temperature and stirred for 1 hour. Aqueous 1.0 M hydrochloric acid was added to the mixture and extracted with dichloromethane. The combined organic extracts were washed with brine, dried (magnesium sulfate) and concentrated under reduced pressure. The residue was purified by flash column chromatography (hexanes/ethyl acetate) to give the desired product (111 mg, 85%).
MS (ESIpos): m/z=475 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 0.95 (t, 3H), 1.43 (d, 3H), 1.45-1.56 (m, 2H), 1.61-1.78 (m, 1H), 1.78-2.06 (m, 5H), 2.81 (t, 2H), 3.72 (t, 2H), 4.59-4.71 (m, 1H), 6.95-7.04 (m, 2H), 7.16-7.27 (m, 1H), 7.41 (d, 1H), 8.14 (d, 1H), 9.68 (s, 1H).
Examples 2-23 were prepared as described for example 1 from 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (intermediate 16) and the respective amines, as indicated. Products were purified by flash column chromatography or, if explicitly mentioned, by preparative HPLC.
Example 2 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00127
From intermediate 16 and 2-fluoroaniline.
LC-MS (method A): Rt=1.46 min; MS (ESIpos): m/z=457 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.875 (6.76), 0.894 (16.00), 0.912 (7.62), 1.346 (11.35), 1.361 (11.28), 1.389 (1.11), 1.397 (1.00), 1.408 (1.06), 1.427 (0.96), 1.446 (0.91), 1.452 (0.92), 1.470 (0.90), 1.670 (1.13), 1.695 (0.88), 1.790 (2.28), 1.798 (2.94), 1.803 (3.29), 1.814 (3.07), 1.818 (3.31), 1.829 (1.73), 1.833 (1.63), 1.866 (1.21), 1.871 (1.23), 1.881 (2.35), 1.885 (2.56), 1.897 (2.70), 1.902 (2.20), 1.911 (1.61), 2.518 (1.69), 2.523 (1.18), 2.692 (3.05), 2.708 (6.06), 2.725 (3.28), 3.559 (3.63), 3.575 (6.53), 3.590 (2.88), 4.725 (0.82), 4.740 (1.56), 4.755 (1.53), 7.173 (1.45), 7.178 (1.33), 7.186 (1.38), 7.192 (1.85), 7.197 (1.30), 7.205 (1.32), 7.210 (1.26), 7.221 (1.64), 7.225 (1.93), 7.241 (2.22), 7.245 (2.44), 7.260 (0.98), 7.264 (0.94), 7.333 (1.53), 7.337 (1.50), 7.353 (1.33), 7.357 (1.44), 7.362 (1.62), 7.366 (1.53), 7.382 (1.18), 7.386 (1.16), 7.486 (3.45), 7.501 (3.41), 7.883 (4.33), 7.911 (4.28), 8.358 (1.21), 8.362 (1.26), 8.378 (2.31), 8.382 (2.25), 8.398 (1.19), 8.402 (1.12), 10.342 (3.06), 10.348 (2.99).
Example 3 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]-N-[3-(trifluoromethyl)phenyl]benzamide
Figure US11787797-20231017-C00128
From intermediate 16 and 3-(trifluoromethyl)aniline.
MS (ESIpos): m/z=507 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.00 (t, 3H), 1.47 (d, 3H), 1.49-1.57 (m, 2H), 1.64-2.05 (m, 6H), 2.81 (t, 2H), 3.72 (t, 2H), 4.60-4.73 (m, 1H), 7.35-7.42 (m, 2H), 7.49 (t, 1H), 7.86 (d, 1H), 7.93 (s, 1H), 8.15 (d, 1H), 10.4 (s, 1H).
Example 4 N-(1-acetylpiperidin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00129
From intermediate 16 and 1-(4-aminopiperidin-1-yl)ethanone.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=0.99 min; MS (ESIpos): m/z=488 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.935 (1.11), 0.946 (1.23), 0.953 (2.59), 0.964 (2.55), 0.972 (1.38), 0.982 (1.24), 1.361 (2.55), 1.375 (4.76), 1.390 (3.06), 1.404 (0.96), 1.423 (0.84), 1.432 (0.82), 1.448 (0.64), 1.461 (0.52), 1.626 (0.45), 1.646 (0.60), 1.652 (0.68), 1.660 (0.70), 1.676 (0.56), 1.684 (0.44), 1.908 (0.72), 1.916 (0.86), 1.920 (0.96), 1.932 (0.99), 1.936 (1.05), 1.948 (0.47), 1.952 (0.50), 1.972 (0.55), 1.988 (0.95), 1.993 (1.00), 2.003 (1.08), 2.009 (0.94), 2.016 (0.88), 2.031 (0.54), 2.133 (16.00), 2.783 (1.51), 2.800 (2.90), 2.815 (1.68), 2.874 (0.54), 3.253 (0.64), 3.259 (0.42), 3.694 (1.93), 3.709 (3.09), 3.724 (1.36), 3.791 (0.45), 4.516 (0.43), 4.541 (0.72), 4.556 (1.22), 4.572 (0.94), 4.587 (0.47), 7.292 (1.89), 7.307 (1.87), 8.044 (1.37), 8.073 (1.35), 8.163 (0.53), 8.177 (0.52).
Example 5 N-(3-chloropyridin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00130
From intermediate 16 and 3-chloropyridin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.28 min; MS (ESIpos): m/z=474 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.929 (6.69), 0.947 (16.00), 0.965 (7.53), 1.259 (0.42), 1.282 (2.30), 1.391 (0.52), 1.409 (0.86), 1.416 (0.65), 1.424 (0.75), 1.427 (0.77), 1.435 (1.09), 1.442 (0.78), 1.452 (1.27), 1.462 (15.62), 1.471 (1.85), 1.477 (15.87), 1.489 (1.00), 1.496 (0.90), 1.501 (0.72), 1.509 (0.50), 1.515 (0.87), 1.529 (0.41), 1.534 (0.49), 1.665 (0.61), 1.679 (1.13), 1.689 (0.57), 1.694 (0.66), 1.699 (0.88), 1.704 (0.95), 1.714 (1.39), 1.719 (0.58), 1.724 (0.79), 1.728 (0.73), 1.739 (1.16), 1.753 (0.57), 1.914 (1.01), 1.926 (1.90), 1.931 (2.19), 1.939 (2.40), 1.944 (1.98), 1.948 (2.56), 1.952 (2.80), 1.956 (2.11), 1.961 (1.37), 1.965 (1.56), 1.969 (1.62), 1.979 (0.80), 1.990 (1.48), 2.004 (2.30), 2.009 (1.99), 2.019 (2.08), 2.024 (1.70), 2.034 (1.28), 2.047 (0.58), 2.803 (3.02), 2.819 (5.65), 2.836 (3.35), 3.713 (3.80), 3.729 (6.23), 3.744 (2.68), 4.655 (0.91), 4.671 (1.72), 4.687 (1.72), 4.703 (0.89), 7.467 (3.74), 7.481 (3.72), 8.101 (5.26), 8.130 (5.22), 8.463 (1.02), 8.476 (1.14), 8.589 (1.77), 8.626 (1.79), 8.640 (1.55), 10.429 (2.68).
Example 6 N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00131
From intermediate 16 and 2-chloro-6-fluoroaniline.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.35 min; MS (ESIpos): m/z=491 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.937 (6.73), 0.955 (16.00), 0.974 (7.56), 1.414 (0.59), 1.432 (1.21), 1.444 (15.10), 1.459 (15.32), 1.473 (0.81), 1.476 (0.89), 1.486 (0.68), 1.491 (0.81), 1.500 (0.77), 1.505 (0.72), 1.511 (0.80), 1.518 (0.84), 1.525 (0.90), 1.530 (0.75), 1.538 (0.54), 1.544 (0.93), 1.558 (0.50), 1.563 (0.58), 1.577 (0.46), 1.629 (1.09), 1.670 (0.75), 1.685 (1.13), 1.696 (0.58), 1.700 (0.71), 1.705 (0.93), 1.710 (0.91), 1.719 (1.45), 1.724 (0.61), 1.730 (0.84), 1.734 (0.80), 1.744 (1.16), 1.759 (0.54), 1.846 (0.69), 1.860 (0.87), 1.872 (0.75), 1.876 (0.88), 1.881 (0.68), 1.888 (0.87), 1.897 (0.77), 1.902 (1.02), 1.907 (1.03), 1.911 (1.08), 1.920 (2.00), 1.933 (2.11), 1.945 (2.04), 1.948 (2.17), 1.960 (0.98), 1.964 (1.01), 1.985 (1.07), 2.000 (1.96), 2.004 (2.05), 2.015 (2.16), 2.020 (1.77), 2.029 (1.29), 2.043 (0.53), 2.801 (3.05), 2.818 (5.83), 2.834 (3.34), 3.711 (3.77), 3.727 (6.13), 3.741 (2.72), 4.663 (1.01), 4.679 (1.98), 4.694 (1.95), 4.709 (0.96), 7.107 (1.11), 7.110 (1.15), 7.128 (1.92), 7.131 (2.59), 7.151 (1.69), 7.155 (1.72), 7.195 (1.24), 7.209 (1.23), 7.215 (2.50), 7.229 (2.53), 7.236 (1.58), 7.249 (1.61), 7.280 (2.67), 7.294 (1.25), 7.297 (1.90), 7.300 (1.30), 7.418 (3.77), 7.433 (3.71), 8.152 (5.03), 8.181 (4.88), 9.727 (3.12).
Example 7 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00132
From intermediate 16 and o-toluidine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.36 min; MS (ESIpos): m/z=453 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.929 (5.14), 0.947 (12.73), 0.965 (5.84), 1.419 (0.88), 1.426 (11.38), 1.442 (11.90), 1.452 (0.70), 1.459 (0.98), 1.473 (0.65), 1.478 (0.95), 1.484 (0.58), 1.492 (0.65), 1.497 (0.73), 1.503 (0.55), 1.516 (0.67), 1.582 (1.77), 1.640 (0.44), 1.655 (0.80), 1.670 (0.49), 1.674 (0.66), 1.679 (0.66), 1.689 (1.08), 1.695 (0.41), 1.699 (0.59), 1.704 (0.55), 1.714 (0.85), 1.728 (0.42), 1.819 (0.51), 1.833 (0.61), 1.836 (0.59), 1.845 (0.52), 1.849 (0.63), 1.853 (0.48), 1.858 (0.58), 1.861 (0.59), 1.867 (0.51), 1.874 (0.51), 1.879 (0.40), 1.895 (0.41), 1.908 (0.51), 1.913 (0.50), 1.922 (1.05), 1.929 (1.24), 1.934 (1.40), 1.945 (1.46), 1.949 (1.57), 1.961 (0.69), 1.965 (0.72), 1.986 (0.74), 1.992 (0.66), 2.001 (1.37), 2.006 (1.44), 2.016 (1.52), 2.021 (1.25), 2.031 (0.93), 2.044 (0.41), 2.355 (16.00), 2.801 (2.27), 2.817 (4.37), 2.833 (2.54), 3.712 (2.98), 3.727 (4.80), 3.743 (2.08), 4.637 (0.73), 4.652 (1.45), 4.668 (1.46), 4.683 (0.71), 7.098 (0.76), 7.102 (0.78), 7.117 (1.86), 7.120 (1.91), 7.135 (1.30), 7.138 (1.28), 7.232 (1.83), 7.252 (2.22), 7.290 (0.74), 7.404 (2.81), 7.419 (2.84), 8.010 (1.88), 8.028 (1.72), 8.030 (1.70), 8.167 (3.90), 8.196 (3.88), 9.656 (1.79).
Example 8 5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00133
From intermediate 16 and 4-fluoro-2-methylaniline.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.36 min; MS (ESIpos): m/z=471 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.931 (4.92), 0.950 (12.09), 0.968 (5.64), 1.419 (0.81), 1.427 (11.60), 1.442 (11.68), 1.452 (0.73), 1.459 (0.90), 1.463 (0.75), 1.472 (0.67), 1.477 (0.95), 1.483 (0.60), 1.490 (0.62), 1.496 (0.78), 1.501 (0.52), 1.515 (0.65), 1.577 (5.23), 1.643 (0.40), 1.658 (0.73), 1.673 (0.45), 1.677 (0.64), 1.682 (0.62), 1.692 (1.04), 1.702 (0.57), 1.707 (0.53), 1.717 (0.83), 1.806 (0.49), 1.820 (0.62), 1.822 (0.61), 1.832 (0.50), 1.836 (0.61), 1.841 (0.47), 1.848 (0.59), 1.856 (0.50), 1.862 (0.51), 1.914 (0.44), 1.922 (1.01), 1.929 (1.20), 1.934 (1.36), 1.946 (1.39), 1.950 (1.52), 1.962 (0.66), 1.965 (0.71), 1.986 (0.71), 1.991 (0.64), 2.002 (1.34), 2.006 (1.40), 2.017 (1.50), 2.022 (1.23), 2.031 (0.91), 2.332 (16.00), 2.801 (2.22), 2.817 (4.18), 2.833 (2.46), 3.712 (2.81), 3.727 (4.58), 3.742 (2.00), 4.639 (0.72), 4.655 (1.44), 4.670 (1.44), 4.686 (0.70), 6.939 (2.37), 6.944 (1.08), 6.946 (1.12), 6.962 (1.97), 6.969 (1.21), 6.975 (1.03), 7.405 (2.76), 7.419 (2.77), 7.856 (1.10), 7.870 (1.32), 7.881 (1.32), 7.894 (1.10), 8.150 (3.76), 8.179 (3.68), 9.591 (1.88).
Example 9 5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00134
From intermediate 16 and 5-fluoro-2-methylaniline.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.40 min; MS (ESIneg): m/z=469 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.929 (6.51), 0.948 (16.00), 0.966 (7.35), 1.397 (0.48), 1.415 (0.87), 1.430 (14.73), 1.445 (14.06), 1.454 (1.16), 1.458 (1.00), 1.467 (0.87), 1.473 (1.17), 1.478 (0.79), 1.486 (0.79), 1.492 (0.99), 1.497 (0.66), 1.505 (0.45), 1.511 (0.83), 1.530 (0.47), 1.586 (8.72), 1.639 (0.55), 1.655 (0.99), 1.664 (0.46), 1.670 (0.59), 1.674 (0.83), 1.679 (0.78), 1.689 (1.31), 1.694 (0.50), 1.698 (0.70), 1.703 (0.66), 1.714 (1.07), 1.728 (0.49), 1.820 (0.60), 1.834 (0.76), 1.836 (0.73), 1.846 (0.64), 1.850 (0.74), 1.854 (0.59), 1.862 (0.71), 1.870 (0.61), 1.875 (0.63), 1.879 (0.50), 1.884 (0.50), 1.896 (0.51), 1.910 (0.64), 1.914 (0.62), 1.922 (1.30), 1.929 (1.54), 1.934 (1.72), 1.946 (1.77), 1.950 (1.91), 1.962 (0.83), 1.965 (0.88), 1.986 (0.91), 1.993 (0.83), 2.002 (1.69), 2.006 (1.78), 2.017 (1.90), 2.022 (1.54), 2.031 (1.13), 2.045 (0.48), 2.316 (15.27), 2.801 (2.86), 2.817 (5.28), 2.833 (3.11), 3.712 (3.54), 3.727 (5.83), 3.742 (2.50), 4.640 (0.90), 4.656 (1.79), 4.671 (1.80), 4.687 (0.87), 6.779 (1.00), 6.786 (1.08), 6.799 (1.92), 6.806 (2.07), 6.820 (1.12), 6.826 (1.17), 7.134 (1.45), 7.152 (1.58), 7.155 (1.47), 7.171 (1.27), 7.422 (3.43), 7.437 (3.47), 7.996 (1.87), 8.003 (1.86), 8.024 (1.89), 8.031 (1.84), 8.149 (4.55), 8.178 (4.52), 9.690 (2.14).
Example 10 5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00135
From intermediate 16 and 4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=0.92 min; MS (ESIpos): m/z=454 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.940 (4.74), 0.958 (11.64), 0.977 (5.45), 1.261 (0.41), 1.430 (0.69), 1.444 (10.59), 1.459 (10.71), 1.470 (1.00), 1.484 (0.68), 1.489 (0.97), 1.494 (0.62), 1.503 (0.67), 1.508 (0.80), 1.513 (0.58), 1.522 (0.42), 1.527 (0.72), 1.546 (0.48), 1.560 (0.43), 1.605 (1.27), 1.660 (0.55), 1.675 (0.79), 1.684 (0.42), 1.689 (0.50), 1.694 (0.69), 1.699 (0.64), 1.709 (1.05), 1.714 (0.43), 1.719 (0.58), 1.723 (0.55), 1.734 (0.85), 1.813 (0.48), 1.827 (0.63), 1.839 (0.50), 1.843 (0.61), 1.847 (0.45), 1.854 (0.59), 1.862 (0.50), 1.868 (0.49), 1.917 (0.49), 1.925 (1.05), 1.933 (1.22), 1.937 (1.39), 1.948 (1.39), 1.952 (1.50), 1.964 (0.69), 1.969 (0.73), 1.990 (0.75), 1.996 (0.69), 2.005 (1.36), 2.009 (1.42), 2.020 (1.50), 2.025 (1.23), 2.034 (0.91), 2.048 (0.40), 2.352 (16.00), 2.805 (2.18), 2.820 (4.09), 2.837 (2.36), 3.714 (2.77), 3.729 (4.41), 3.744 (1.94), 4.659 (0.69), 4.674 (1.38), 4.690 (1.36), 4.705 (0.68), 7.185 (2.04), 7.197 (2.07), 7.437 (2.63), 7.451 (2.61), 8.158 (3.51), 8.187 (3.38), 8.350 (2.62), 8.362 (2.53), 9.056 (4.07), 9.699 (1.94).
Example 11 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00136
From intermediate 16 and 2-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=484 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.946 (2.63), 0.964 (6.58), 0.983 (2.99), 1.438 (5.62), 1.453 (5.79), 1.477 (0.40), 1.495 (0.44), 1.601 (1.14), 1.720 (0.54), 1.745 (0.43), 1.916 (0.46), 1.920 (0.54), 1.930 (0.75), 1.944 (0.72), 1.948 (0.78), 1.999 (0.67), 2.004 (0.72), 2.015 (0.75), 2.020 (0.62), 2.029 (0.46), 2.284 (9.26), 2.800 (1.13), 2.816 (2.12), 2.832 (1.25), 3.711 (1.45), 3.726 (2.32), 3.741 (1.02), 3.970 (16.00), 4.664 (0.73), 4.679 (0.72), 6.829 (1.38), 6.842 (1.43), 7.391 (1.43), 7.405 (1.44), 7.938 (1.92), 7.951 (1.85), 8.116 (1.95), 8.146 (1.95), 9.681 (1.15).
Example 12 N-(3,5-dimethylpyrazin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00137
From intermediate 16 and 3,5-dimethylpyrazin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.15 min; MS (ESIpos): m/z=469 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.939 (4.46), 0.957 (10.95), 0.976 (5.06), 1.454 (9.68), 1.470 (10.05), 1.483 (0.51), 1.493 (0.84), 1.508 (0.70), 1.511 (0.66), 1.517 (0.51), 1.525 (0.64), 1.531 (0.64), 1.535 (0.53), 1.544 (0.44), 1.549 (0.74), 1.554 (0.44), 1.582 (2.57), 1.696 (0.64), 1.712 (0.40), 1.716 (0.57), 1.721 (0.54), 1.731 (0.90), 1.741 (0.52), 1.746 (0.48), 1.756 (0.76), 1.842 (0.45), 1.856 (0.56), 1.867 (0.46), 1.872 (0.54), 1.876 (0.41), 1.883 (0.52), 1.892 (0.44), 1.897 (0.47), 1.902 (0.43), 1.906 (0.62), 1.918 (0.80), 1.922 (0.95), 1.932 (1.30), 1.946 (1.26), 1.950 (1.33), 1.962 (0.60), 1.965 (0.62), 1.987 (0.65), 1.993 (0.60), 2.002 (1.20), 2.007 (1.25), 2.017 (1.33), 2.023 (1.07), 2.031 (0.79), 2.557 (14.74), 2.562 (16.00), 2.801 (1.88), 2.817 (3.63), 2.833 (2.09), 3.712 (2.44), 3.727 (3.93), 3.742 (1.71), 4.639 (0.63), 4.655 (1.26), 4.670 (1.24), 4.686 (0.61), 7.412 (2.47), 7.427 (2.45), 8.131 (3.31), 8.161 (3.30), 8.174 (3.72), 10.076 (1.90).
Example 13 5-fluoro-N-(5-methylpyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00138
From intermediate 16 and 5-methylpyrimidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.07 min; MS (ESIpos): m/z=455 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.950 (4.72), 0.968 (11.18), 0.986 (5.34), 1.464 (11.05), 1.480 (11.04), 1.490 (0.63), 1.498 (0.95), 1.513 (0.68), 1.516 (0.91), 1.523 (0.59), 1.531 (0.68), 1.537 (0.72), 1.542 (0.59), 1.550 (0.45), 1.556 (0.76), 1.570 (0.56), 1.575 (0.75), 1.594 (1.86), 1.694 (0.41), 1.708 (0.72), 1.723 (0.46), 1.728 (0.62), 1.733 (0.61), 1.743 (0.99), 1.747 (0.40), 1.753 (0.58), 1.758 (0.54), 1.768 (0.82), 1.866 (0.48), 1.880 (0.63), 1.891 (0.53), 1.896 (0.64), 1.900 (0.54), 1.908 (0.95), 1.915 (0.98), 1.922 (1.43), 1.931 (1.65), 1.936 (1.55), 1.947 (1.51), 1.951 (1.59), 1.955 (1.24), 1.963 (0.70), 1.967 (0.74), 1.988 (0.78), 2.003 (1.43), 2.008 (1.47), 2.018 (1.56), 2.023 (1.25), 2.032 (0.93), 2.047 (0.40), 2.318 (16.00), 2.802 (2.17), 2.818 (4.14), 2.834 (2.35), 2.877 (0.64), 3.101 (0.58), 3.712 (2.81), 3.727 (4.44), 3.742 (1.95), 4.648 (0.71), 4.663 (1.42), 4.679 (1.41), 4.694 (0.70), 7.437 (2.73), 7.452 (2.73), 8.114 (3.58), 8.143 (3.55), 8.560 (3.85), 8.929 (4.40), 10.249 (2.13).
Example 14 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00139
From intermediate 16 and 6-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.24 min; MS (ESIpos): m/z=484 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.934 (2.43), 0.952 (6.05), 0.970 (2.77), 1.428 (5.60), 1.443 (5.62), 1.463 (0.45), 1.481 (0.42), 1.697 (0.53), 1.722 (0.43), 1.920 (0.49), 1.927 (0.58), 1.933 (0.65), 1.943 (0.67), 1.948 (0.72), 2.000 (0.64), 2.005 (0.68), 2.015 (0.72), 2.020 (0.59), 2.029 (0.44), 2.281 (7.18), 2.800 (1.03), 2.815 (2.00), 2.832 (1.16), 3.709 (1.33), 3.725 (2.13), 3.739 (0.96), 3.939 (16.00), 4.651 (0.69), 4.667 (0.70), 6.661 (2.10), 7.407 (1.34), 7.421 (1.33), 8.137 (1.86), 8.167 (1.77), 8.422 (2.61), 9.506 (1.09).
Example 15 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00140
From intermediate 16 and 2-methyl-6-(trifluoromethyl)amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.41 min; MS (ESIpos): m/z=521 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.915 (1.53), 0.932 (2.74), 0.950 (1.66), 1.411 (3.45), 1.425 (3.35), 1.454 (0.92), 1.570 (9.08), 1.615 (0.46), 1.631 (0.81), 1.646 (0.51), 1.650 (0.74), 1.655 (0.65), 1.665 (1.14), 1.670 (0.48), 1.674 (0.62), 1.680 (0.58), 1.689 (0.91), 1.705 (0.42), 1.796 (0.47), 1.819 (0.52), 1.829 (0.48), 1.908 (0.47), 1.915 (0.61), 1.923 (1.32), 1.931 (1.57), 1.936 (1.76), 1.947 (1.79), 1.951 (1.92), 1.963 (0.84), 1.966 (0.88), 1.988 (0.94), 1.993 (0.86), 2.002 (1.72), 2.007 (1.81), 2.018 (1.88), 2.023 (1.53), 2.032 (1.13), 2.045 (0.48), 2.321 (16.00), 2.804 (2.80), 2.820 (5.25), 2.836 (3.03), 3.715 (3.64), 3.731 (5.74), 3.746 (2.48), 4.656 (0.81), 4.672 (1.63), 4.687 (1.62), 4.702 (0.79), 7.322 (1.03), 7.341 (2.38), 7.361 (1.47), 7.401 (3.23), 7.416 (3.19), 7.506 (2.05), 7.525 (1.64), 7.552 (2.05), 7.571 (1.71), 8.152 (3.39), 8.181 (3.40), 9.766 (0.50).
Example 16 N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00141
From intermediate 16 and 2-(difluoromethyl)aniline.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.35 min; MS (ESIpos): m/z=489 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.908 (6.25), 0.926 (15.09), 0.945 (7.37), 1.225 (0.41), 1.259 (0.70), 1.364 (0.46), 1.382 (0.80), 1.389 (0.59), 1.397 (0.77), 1.400 (0.83), 1.407 (1.25), 1.417 (12.87), 1.433 (12.64), 1.441 (1.71), 1.448 (0.86), 1.456 (0.90), 1.462 (0.95), 1.467 (0.71), 1.475 (0.53), 1.481 (0.87), 1.495 (0.42), 1.499 (0.48), 1.600 (16.00), 1.621 (1.11), 1.631 (0.54), 1.637 (0.64), 1.640 (0.80), 1.646 (0.79), 1.655 (1.18), 1.660 (0.54), 1.666 (0.67), 1.670 (0.64), 1.680 (0.92), 1.695 (0.44), 1.825 (0.54), 1.840 (0.72), 1.850 (0.62), 1.854 (0.73), 1.859 (0.62), 1.866 (0.72), 1.873 (0.66), 1.880 (0.63), 1.884 (0.52), 1.889 (0.50), 1.900 (0.61), 1.906 (0.57), 1.914 (0.95), 1.922 (1.46), 1.929 (1.73), 1.934 (1.94), 1.945 (1.97), 1.949 (2.11), 1.961 (0.96), 1.965 (1.00), 1.986 (1.02), 1.992 (0.95), 2.000 (1.90), 2.006 (2.01), 2.016 (2.10), 2.021 (1.73), 2.030 (1.28), 2.044 (0.54), 2.802 (3.02), 2.817 (5.72), 2.834 (3.25), 3.713 (3.70), 3.728 (6.16), 3.743 (2.70), 4.613 (0.79), 4.628 (1.58), 4.644 (1.59), 4.659 (0.79), 6.615 (1.84), 6.753 (3.62), 6.892 (1.75), 7.286 (1.13), 7.305 (2.40), 7.324 (1.44), 7.404 (3.60), 7.419 (3.60), 7.528 (1.21), 7.547 (2.08), 7.556 (2.52), 7.567 (1.24), 7.575 (2.03), 7.975 (2.34), 7.996 (2.11), 8.130 (4.67), 8.159 (4.69), 9.954 (2.50).
Example 17 N-(5-chloropyrimidin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00142
From intermediate 16 and 5-chloropyrimidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.14 min; MS (ESIpos): m/z=475 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.931 (3.70), 0.950 (8.84), 0.969 (4.20), 1.261 (0.51), 1.416 (0.51), 1.432 (0.46), 1.435 (0.50), 1.442 (0.72), 1.450 (0.56), 1.461 (9.31), 1.476 (9.27), 1.486 (0.55), 1.494 (0.63), 1.500 (0.56), 1.505 (0.45), 1.518 (0.53), 1.575 (16.00), 1.582 (8.92), 1.679 (0.62), 1.699 (0.50), 1.704 (0.52), 1.714 (0.80), 1.724 (0.45), 1.728 (0.42), 1.739 (0.65), 1.908 (0.71), 1.917 (0.77), 1.925 (1.18), 1.934 (1.46), 1.939 (1.37), 1.948 (1.54), 1.952 (1.54), 1.956 (1.12), 1.964 (0.81), 1.968 (0.88), 1.982 (0.45), 1.989 (0.63), 2.003 (1.14), 2.009 (1.17), 2.019 (1.28), 2.024 (1.00), 2.033 (0.74), 2.803 (1.76), 2.819 (3.30), 2.835 (1.90), 3.712 (2.19), 3.727 (3.61), 3.742 (1.55), 4.662 (0.55), 4.678 (1.04), 4.693 (1.04), 4.709 (0.53), 7.473 (2.15), 7.488 (2.14), 8.140 (2.85), 8.169 (2.83), 8.669 (7.42), 9.008 (5.44), 10.680 (1.64).
Example 18 N-(3-chloropyridin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00143
From intermediate 16 and 3-chloropyridin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.20 min; MS (ESIpos): m/z=474 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.920 (6.70), 0.939 (16.00), 0.957 (7.63), 1.257 (0.54), 1.399 (0.56), 1.410 (0.43), 1.417 (0.94), 1.425 (0.76), 1.432 (1.07), 1.443 (15.74), 1.459 (15.85), 1.467 (1.16), 1.476 (0.99), 1.481 (0.99), 1.486 (0.80), 1.493 (0.91), 1.500 (0.89), 1.506 (0.95), 1.511 (0.81), 1.519 (0.56), 1.525 (0.94), 1.539 (0.47), 1.544 (0.54), 1.655 (0.65), 1.670 (1.14), 1.681 (0.61), 1.685 (0.74), 1.690 (0.94), 1.695 (0.99), 1.704 (1.46), 1.710 (0.68), 1.715 (0.87), 1.719 (0.85), 1.730 (1.19), 1.744 (0.59), 1.879 (0.75), 1.893 (0.93), 1.896 (1.01), 1.905 (1.19), 1.909 (1.63), 1.918 (2.34), 1.930 (2.86), 1.935 (2.42), 1.941 (2.61), 1.944 (2.88), 1.956 (1.62), 1.961 (1.28), 1.969 (0.81), 1.982 (1.18), 1.988 (1.11), 1.997 (2.14), 2.002 (2.24), 2.013 (2.35), 2.017 (1.96), 2.026 (1.46), 2.040 (0.66), 2.797 (3.07), 2.814 (5.99), 2.829 (3.43), 3.709 (3.89), 3.725 (6.43), 3.740 (2.86), 4.643 (1.00), 4.659 (1.94), 4.674 (1.91), 4.690 (0.98), 7.095 (3.31), 7.106 (3.37), 7.114 (3.66), 7.126 (3.66), 7.406 (3.92), 7.421 (3.90), 7.760 (3.83), 7.765 (3.65), 7.780 (3.51), 7.784 (3.68), 8.181 (4.98), 8.210 (5.09), 8.481 (3.09), 8.486 (3.25), 8.493 (3.20), 8.498 (2.97), 10.484 (3.08).
Example 19 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]-N-[1-(pyrazin-2-yl)piperidin-4-yl]benzamide
Figure US11787797-20231017-C00144
From intermediate 16 and 1-(pyrazin-2-yl)piperidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method B): Rt=1.18 min; MS (ESIpos): m/z=524 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.894 (6.91), 0.913 (16.00), 0.931 (7.84), 1.357 (15.59), 1.372 (15.66), 1.384 (0.86), 1.393 (0.92), 1.395 (0.93), 1.403 (1.21), 1.410 (0.79), 1.421 (1.25), 1.430 (0.56), 1.438 (1.28), 1.443 (0.88), 1.449 (0.83), 1.457 (1.01), 1.463 (1.05), 1.467 (0.82), 1.482 (1.24), 1.495 (1.09), 1.501 (1.03), 1.521 (1.82), 1.528 (1.51), 1.552 (1.84), 1.572 (0.67), 1.580 (0.82), 1.590 (1.02), 1.604 (0.96), 1.614 (0.58), 1.618 (0.75), 1.625 (1.20), 1.628 (1.01), 1.639 (2.21), 1.650 (4.72), 1.663 (1.77), 1.678 (0.75), 1.698 (0.86), 1.712 (1.09), 1.724 (0.89), 1.729 (1.03), 1.733 (0.75), 1.740 (1.01), 1.749 (0.73), 1.754 (0.82), 1.758 (0.59), 1.763 (0.53), 1.774 (0.53), 1.891 (0.61), 1.906 (1.73), 1.918 (2.34), 1.930 (2.36), 1.934 (2.50), 1.950 (1.20), 1.971 (1.24), 1.986 (2.30), 1.990 (2.40), 2.001 (2.53), 2.006 (2.08), 2.014 (1.77), 2.029 (0.67), 2.179 (1.65), 2.187 (1.64), 2.202 (1.54), 2.211 (1.49), 2.782 (3.36), 2.798 (6.55), 2.814 (3.65), 3.142 (1.66), 3.149 (1.87), 3.170 (2.09), 3.176 (3.46), 3.182 (2.07), 3.204 (1.93), 3.211 (1.61), 3.692 (4.15), 3.707 (6.96), 3.722 (3.05), 4.236 (0.56), 4.261 (3.66), 4.271 (2.25), 4.281 (2.15), 4.293 (2.97), 4.531 (1.11), 4.546 (2.07), 4.561 (2.04), 4.576 (1.06), 7.288 (4.32), 7.302 (4.24), 7.844 (5.22), 7.851 (5.51), 8.058 (5.55), 8.068 (3.56), 8.072 (4.06), 8.074 (3.78), 8.079 (3.56), 8.088 (5.35), 8.184 (2.24), 8.195 (6.10), 8.198 (6.16).
Example 20 N-[1-(cyclopropylcarbonyl)piperidin-4-yl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00145
From intermediate 16 and (4-aminopiperidin-1-yl)(cyclopropyl)methanone.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method B): Rt=1.12 min; MS (ESIpos): m/z=514 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.739 (2.24), 0.749 (8.60), 0.757 (9.81), 0.770 (8.61), 0.777 (10.19), 0.786 (2.76), 0.921 (6.84), 0.939 (13.91), 0.958 (10.83), 0.967 (11.75), 0.974 (9.50), 0.979 (11.09), 0.986 (8.74), 0.996 (2.88), 1.353 (11.57), 1.367 (12.46), 1.402 (4.89), 1.423 (5.15), 1.461 (3.04), 1.498 (0.88), 1.516 (0.48), 1.592 (0.85), 1.607 (1.46), 1.627 (1.89), 1.641 (2.60), 1.651 (1.80), 1.655 (1.67), 1.665 (2.00), 1.680 (0.97), 1.700 (1.40), 1.715 (2.14), 1.726 (1.82), 1.730 (2.06), 1.740 (3.55), 1.752 (4.51), 1.760 (4.46), 1.763 (3.17), 1.771 (6.46), 1.780 (2.57), 1.783 (3.26), 1.792 (3.20), 1.803 (1.33), 1.865 (9.27), 1.873 (2.21), 1.882 (2.04), 1.890 (4.00), 1.897 (4.77), 1.902 (5.26), 1.914 (5.46), 1.918 (5.68), 1.930 (2.67), 1.934 (2.75), 1.955 (2.83), 1.961 (2.75), 1.970 (5.28), 1.975 (5.53), 1.985 (5.99), 1.990 (5.16), 1.997 (4.69), 2.005 (2.88), 2.013 (2.73), 2.203 (1.47), 2.764 (7.72), 2.780 (14.85), 2.796 (8.44), 2.866 (0.99), 2.895 (1.68), 2.924 (1.02), 3.283 (1.01), 3.312 (1.67), 3.342 (0.98), 3.675 (9.57), 3.690 (16.00), 3.704 (6.90), 4.153 (1.54), 4.167 (1.65), 4.178 (2.27), 4.188 (2.49), 4.195 (2.83), 4.205 (2.81), 4.214 (2.18), 4.223 (2.36), 4.232 (1.77), 4.250 (0.95), 4.260 (0.48), 4.487 (1.54), 4.510 (1.86), 4.525 (3.68), 4.540 (5.10), 4.556 (4.74), 4.571 (2.42), 4.586 (0.53), 7.288 (9.79), 8.027 (11.72), 8.056 (11.80), 8.157 (4.23), 8.176 (4.12).
Example 21 5-fluoro-N-[1-(methylsulfonyl)piperidin-4-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00146
From intermediate 16 and 1-(methylsulfonyl)piperidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.07 min; MS (ESIpos): m/z=524 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.955 (2.98), 0.973 (7.37), 0.991 (3.43), 1.378 (6.54), 1.393 (6.64), 1.407 (0.42), 1.433 (0.51), 1.448 (0.49), 1.450 (0.53), 1.466 (0.61), 1.485 (0.46), 1.490 (0.44), 1.509 (0.44), 1.600 (1.54), 1.618 (0.94), 1.624 (1.00), 1.639 (0.55), 1.649 (0.47), 1.653 (0.49), 1.659 (0.66), 1.673 (0.67), 1.683 (0.41), 1.697 (0.53), 1.743 (0.46), 1.759 (0.42), 1.770 (0.41), 1.910 (0.68), 1.922 (0.91), 1.934 (0.93), 1.937 (0.99), 1.949 (0.46), 1.953 (0.47), 1.975 (0.49), 1.989 (0.89), 1.994 (0.95), 2.005 (0.99), 2.010 (0.81), 2.017 (0.64), 2.179 (0.63), 2.189 (0.64), 2.785 (1.37), 2.801 (2.70), 2.820 (16.00), 2.835 (0.78), 2.841 (0.81), 2.866 (1.36), 2.871 (1.29), 2.895 (0.79), 2.901 (0.66), 3.696 (1.69), 3.711 (2.82), 3.726 (1.24), 3.817 (1.00), 3.847 (0.93), 4.100 (0.43), 4.119 (0.43), 4.552 (0.44), 4.567 (0.85), 4.582 (0.85), 4.597 (0.43), 7.299 (1.76), 7.314 (1.72), 8.034 (2.31), 8.064 (2.24), 8.190 (0.77), 8.209 (0.76).
Example 22 5-fluoro-N-(1-methyl-2-oxopiperidin-(4R,S)-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide, Mixture of Diastereomers
Figure US11787797-20231017-C00147
From intermediate 16 and rac-4-amino-1-methylpiperidin-2-one.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=0.97 min; MS (ESIpos): m/z=474 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.941 (1.17), 0.952 (1.22), 0.959 (2.87), 0.970 (2.72), 0.977 (1.37), 0.989 (1.22), 1.279 (16.00), 1.350 (2.40), 1.365 (4.96), 1.381 (2.72), 1.621 (1.15), 1.635 (0.69), 1.640 (0.47), 1.645 (0.41), 1.901 (0.44), 1.909 (0.70), 1.922 (0.96), 1.933 (0.88), 1.936 (0.88), 1.941 (0.69), 1.954 (0.45), 1.988 (0.66), 1.993 (0.68), 2.004 (0.72), 2.009 (0.58), 2.018 (0.42), 2.300 (0.45), 2.320 (0.41), 2.342 (0.48), 2.363 (0.48), 2.784 (1.03), 2.800 (2.04), 2.816 (1.52), 2.990 (7.27), 3.362 (0.42), 3.378 (0.78), 3.385 (0.42), 3.392 (0.44), 3.397 (0.44), 3.694 (1.26), 3.709 (2.09), 3.725 (0.90), 4.570 (0.43), 4.582 (0.41), 7.304 (1.27), 7.319 (1.24), 8.042 (1.74), 8.071 (1.70), 8.239 (0.55), 8.256 (0.53).
Example 23 5-fluoro-N-(1-methylpiperidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00148
From intermediate 16 and 1-methylpiperidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method B): Rt=1.11 min; MS (ESIpos): m/z=460 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.919 (4.45), 0.937 (10.63), 0.955 (5.06), 1.344 (9.61), 1.359 (9.80), 1.378 (0.64), 1.385 (0.48), 1.393 (0.54), 1.396 (0.55), 1.403 (0.72), 1.411 (0.52), 1.419 (0.61), 1.421 (0.73), 1.427 (0.48), 1.436 (0.59), 1.440 (0.67), 1.446 (0.53), 1.452 (0.54), 1.459 (0.60), 1.465 (0.65), 1.470 (0.51), 1.484 (0.66), 1.503 (0.64), 1.516 (0.55), 1.538 (1.01), 1.564 (1.07), 1.590 (0.80), 1.604 (0.81), 1.618 (0.46), 1.624 (0.67), 1.628 (0.54), 1.639 (0.96), 1.649 (0.59), 1.652 (0.56), 1.662 (0.75), 1.721 (0.48), 1.735 (0.63), 1.737 (0.61), 1.747 (0.53), 1.751 (0.62), 1.755 (0.48), 1.761 (0.58), 1.762 (0.58), 1.769 (0.45), 1.772 (0.47), 1.776 (0.49), 1.878 (0.52), 1.887 (1.10), 1.894 (1.33), 1.899 (1.48), 1.910 (1.51), 1.914 (1.58), 1.926 (0.75), 1.930 (0.78), 1.951 (0.81), 1.958 (0.79), 1.966 (1.50), 1.971 (1.55), 1.982 (1.65), 1.987 (1.37), 1.995 (1.08), 2.010 (0.77), 2.031 (1.40), 2.041 (1.27), 2.052 (1.16), 2.063 (1.19), 2.131 (0.68), 2.162 (1.17), 2.189 (0.67), 2.298 (16.00), 2.761 (2.44), 2.777 (4.83), 2.793 (3.09), 3.672 (2.59), 3.688 (4.25), 3.703 (1.92), 3.977 (0.48), 3.986 (0.46), 3.995 (0.48), 4.520 (0.68), 4.535 (1.29), 4.551 (1.27), 4.566 (0.65), 7.261 (2.67), 8.031 (3.34), 8.061 (3.30), 8.121 (1.02), 8.141 (1.00).
Examples 24-27 were prepared in analogy according to the general methods described above.
Example 24 N-(2-aminophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00149
Example 25 5-fluoro-N-[2-(methylamino)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00150
Example 26 N-(2-amino-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00151
MS (ESIpos): m/z=468.3 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: −0.149 (0.42), -0.008 (4.72), 0.008 (3.65), 0.146 (0.42), 0.863 (4.75), 0.882 (11.10), 0.900 (5.34), 1.275 (9.68), 1.290 (9.59), 1.323 (0.45), 1.341 (0.71), 1.356 (0.71), 1.366 (0.89), 1.374 (0.68), 1.384 (0.89), 1.403 (0.83), 1.415 (0.71), 1.423 (0.74), 1.428 (0.80), 1.447 (0.80), 1.527 (0.42), 1.541 (0.68), 1.561 (0.74), 1.575 (1.04), 1.585 (0.71), 1.599 (0.77), 1.655 (0.53), 1.670 (0.74), 1.685 (0.77), 1.695 (0.71), 1.710 (0.62), 1.730 (0.42), 1.794 (1.42), 1.806 (2.02), 1.821 (2.08), 1.833 (1.04), 1.888 (2.08), 1.898 (2.14), 1.912 (1.31), 2.146 (16.00), 2.368 (1.10), 2.525 (2.49), 2.671 (0.45), 2.691 (2.32), 2.706 (4.63), 2.723 (2.43), 3.557 (2.70), 3.572 (4.78), 3.587 (2.20), 4.560 (0.77), 4.575 (1.45), 4.590 (1.45), 4.605 (0.74), 4.874 (1.37), 6.458 (2.05), 6.476 (2.20), 6.583 (2.05), 6.601 (2.35), 6.886 (1.96), 6.906 (3.06), 6.925 (1.57), 7.301 (3.00), 7.316 (2.91), 7.641 (3.62), 7.667 (3.56), 9.262 (4.36).
Example 27 N-(4-amino-2-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00152
Example 28 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00153
Example 28 was prepared as described for example 1 from 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzoic acid (intermediate 16) and 2-fluoro-6-methylaniline.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.33 min; MS (ESIpos): m/z=471.3 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.936 (5.02), 0.954 (12.41), 0.972 (5.77), 1.430 (11.33), 1.445 (11.53), 1.458 (0.59), 1.466 (0.57), 1.469 (0.63), 1.477 (0.49), 1.484 (0.61), 1.491 (0.54), 1.496 (0.48), 1.503 (0.61), 1.510 (0.57), 1.516 (0.61), 1.522 (0.49), 1.535 (0.64), 1.582 (4.28), 1.655 (0.40), 1.670 (0.72), 1.684 (0.44), 1.689 (0.63), 1.695 (0.58), 1.704 (1.04), 1.715 (0.57), 1.719 (0.54), 1.729 (0.83), 1.811 (0.48), 1.825 (0.61), 1.837 (0.52), 1.841 (0.61), 1.846 (0.44), 1.853 (0.58), 1.860 (0.46), 1.867 (0.49), 1.902 (0.44), 1.912 (0.44), 1.921 (1.01), 1.928 (1.20), 1.933 (1.35), 1.945 (1.39), 1.948 (1.50), 1.960 (0.66), 1.964 (0.69), 1.985 (0.71), 1.991 (0.63), 2.000 (1.32), 2.005 (1.39), 2.015 (1.48), 2.020 (1.21), 2.029 (0.90), 2.326 (16.00), 2.801 (2.19), 2.817 (4.23), 2.833 (2.45), 3.711 (2.82), 3.727 (4.62), 3.741 (2.00), 4.641 (0.70), 4.656 (1.38), 4.671 (1.36), 4.687 (0.68), 6.986 (0.71), 7.006 (1.53), 7.031 (0.92), 7.060 (1.26), 7.080 (1.83), 7.151 (1.05), 7.164 (1.09), 7.171 (1.44), 7.185 (1.42), 7.190 (0.67), 7.204 (0.62), 7.399 (2.84), 7.414 (2.80), 8.131 (3.86), 8.160 (3.73), 9.562 (2.06).
Example 29 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00154
To a 0° C. stirred solution of 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 17) (80.0 mg, 205 μmol) and catalytic N,N-dimethylformamide (3 drops) in anhydrous dichloromethane (1.5 ml) was added oxalyl chloride (21 μl, 250 μmol). The resulting mixture was warmed to room temperature, stirred for 90 minutes and concentrated under reduced pressure. A solution of the crude acid chloride in dichloromethane (1.0 ml) was then added dropwise to a 0° C. stirred solution of 2,6-difluoroaniline (29 mg, 226 μmol) and triethylamine (32 μl, 230 μmol) in anhydrous dichloromethane (2.0 ml). Following complete addition, the mixture was warmed to room temperature, stirred for 2 hours and concentrated under reduced pressure. The residue was dissolved in DMSO, filtered through a teflon filter and purified by reverse phase column chromatography (acetonitrile, 0.1% aqueous formic acid) to give the amide as a white solid (88 mg, 86%).
LC-MS (method A): Rt=1.19 min; MS (ESIneg): m/z=499 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.035 (0.67), 1.052 (1.37), 1.070 (0.72), 1.428 (16.00), 1.444 (15.78), 1.512 (0.72), 1.795 (3.93), 1.807 (5.48), 1.818 (5.46), 1.822 (5.57), 1.835 (2.76), 1.875 (2.76), 1.890 (5.66), 1.900 (5.84), 1.905 (4.85), 1.914 (3.60), 1.929 (1.37), 2.331 (0.92), 2.518 (5.21), 2.522 (3.46), 2.673 (1.15), 2.678 (0.76), 2.696 (6.07), 2.712 (11.84), 2.729 (6.22), 3.561 (7.12), 3.577 (12.72), 3.591 (5.80), 5.272 (1.15), 5.287 (2.63), 5.304 (3.39), 5.319 (2.47), 5.335 (1.03), 7.187 (4.79), 7.208 (9.78), 7.228 (6.02), 7.367 (1.03), 7.382 (2.36), 7.403 (3.28), 7.424 (1.73), 7.440 (0.72), 7.541 (5.75), 7.560 (8.40), 7.585 (6.27), 9.985 (10.67).
Examples 30-112 were prepared as described for example 29 from 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 17) and the respective amines, as indicated. Products were purified by flash column chromatography or, if explicitely mentioned, by preparative HPLC. Example 52 was prepared from example 51 by deprotection of the azetidine nitrogen, as described below.
Example 30 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[3-(trifluoromethyl)-phenyl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00155
From intermediate 17 and 3-(trifluoromethyl)aniline.
MS (ESIpos): m/z=533 (M+H)+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.851 (0.68), 1.172 (0.55), 1.233 (2.37), 1.404 (16.00), 1.420 (15.81), 1.796 (3.05), 1.808 (4.25), 1.823 (4.35), 1.835 (2.17), 1.890 (4.32), 1.901 (4.51), 1.929 (1.17), 1.987 (1.33), 2.006 (0.52), 2.322 (1.49), 2.326 (1.98), 2.331 (1.36), 2.522 (5.42), 2.537 (1.56), 2.664 (1.62), 2.669 (2.08), 2.673 (1.53), 2.697 (5.03), 2.713 (9.83), 2.730 (5.32), 3.562 (5.87), 3.577 (10.45), 3.592 (4.64), 5.246 (1.10), 5.262 (2.66), 5.278 (3.47), 5.294 (2.50), 5.309 (1.04), 7.464 (3.44), 7.483 (4.51), 7.527 (6.46), 7.542 (6.39), 7.587 (2.89), 7.607 (5.13), 7.626 (2.56), 7.652 (8.63), 7.678 (8.37), 7.835 (3.83), 7.856 (3.18), 8.173 (6.78), 10.616 (10.19).
Example 31 N-[2-chloro-4-(pentafluoro-lambda6-sulfanyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00156
From intermediate 17 and 2-chloro-4-(pentafluoro-lambda6-sulfanyl)aniline.
LC-MS (method A): Rt=1.54 min; MS (ESIpos): m/z=625 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.421 (0.43), 1.623 (5.93), 1.656 (16.00), 1.673 (15.82), 1.914 (0.94), 1.929 (2.69), 1.941 (3.70), 1.953 (3.71), 1.957 (3.96), 1.969 (1.86), 1.972 (1.92), 1.994 (1.90), 2.000 (1.88), 2.009 (3.60), 2.014 (3.79), 2.024 (3.99), 2.029 (3.33), 2.038 (2.44), 2.052 (1.02), 2.805 (5.06), 2.821 (9.80), 2.838 (5.50), 3.713 (6.39), 3.729 (10.67), 3.744 (4.78), 4.879 (1.07), 4.895 (2.48), 4.910 (3.22), 4.926 (2.38), 4.941 (0.96), 7.542 (6.43), 7.556 (6.39), 7.708 (3.70), 7.715 (4.06), 7.732 (3.82), 7.738 (4.24), 7.839 (9.64), 7.845 (8.84), 8.086 (8.20), 8.114 (8.14), 8.727 (4.11), 8.750 (3.83), 9.870 (5.68).
Example 32 5-fluoro-N-(oxetan-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00157
From intermediate 17 and oxetan-3-amine.
LC-MS (method A): Rt=0.92 min; MS (ESIpos): m/z=445 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.631 (15.14), 1.647 (16.00), 1.902 (0.83), 1.909 (1.06), 1.918 (2.41), 1.925 (2.82), 1.930 (3.26), 1.941 (3.31), 1.945 (3.53), 1.957 (1.59), 1.961 (1.66), 1.983 (1.64), 1.989 (1.61), 1.998 (3.18), 2.003 (3.32), 2.014 (3.61), 2.019 (2.89), 2.028 (2.22), 2.042 (0.93), 2.624 (3.46), 2.715 (0.82), 2.790 (4.94), 2.805 (9.55), 2.822 (5.51), 2.993 (1.49), 3.697 (6.16), 3.713 (9.97), 3.728 (4.49), 4.392 (0.50), 4.563 (5.46), 4.580 (10.99), 4.596 (6.03), 4.839 (0.98), 4.854 (2.28), 4.870 (2.97), 4.885 (2.19), 4.900 (0.88), 4.977 (3.73), 4.981 (3.73), 4.995 (7.31), 4.998 (7.15), 5.013 (3.94), 5.016 (4.02), 5.201 (0.60), 5.219 (1.71), 5.235 (3.29), 5.253 (3.05), 5.269 (1.38), 7.391 (6.46), 7.405 (6.37), 8.033 (8.67), 8.062 (8.84), 8.104 (2.07), 8.121 (2.03).
Example 33 N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00158
From intermediate 17 and 2-(difluoromethyl)aniline.
LC-MS (method A): Rt=1.24 min; MS (ESIpos): m/z=515 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.625 (15.67), 1.641 (16.00), 1.710 (0.58), 1.905 (1.16), 1.920 (3.18), 1.932 (4.51), 1.944 (4.50), 1.947 (4.77), 1.959 (2.44), 1.963 (2.46), 1.985 (2.34), 2.004 (4.62), 2.015 (4.86), 2.028 (3.12), 2.043 (1.34), 2.316 (0.45), 2.796 (5.56), 2.812 (10.82), 2.829 (6.17), 3.705 (6.59), 3.721 (11.38), 3.735 (5.40), 4.864 (1.06), 4.880 (2.49), 4.895 (3.25), 4.911 (2.46), 4.926 (1.07), 6.614 (3.39), 6.753 (6.73), 6.891 (3.29), 7.302 (2.16), 7.320 (4.82), 7.339 (2.98), 7.485 (6.25), 7.499 (6.34), 7.525 (2.39), 7.547 (7.45), 7.568 (5.51), 7.919 (4.68), 7.938 (4.17), 8.098 (7.10), 8.127 (6.95), 9.384 (4.86).
Example 34 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-N-(1,3,5-trimethyl-1H-pyrazol-4-yl)benzamide
Figure US11787797-20231017-C00159
From intermediate 17 and 1,3,5-trimethyl-1H-pyrazol-4-amine.
LC-MS (method A): Rt=0.97 min; MS (ESIpos): m/z=497 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.463 (4.62), 1.479 (4.72), 1.761 (1.74), 1.775 (1.78), 1.844 (1.99), 2.007 (16.00), 2.625 (1.74), 2.640 (3.09), 2.656 (1.75), 3.532 (1.92), 3.546 (3.26), 3.561 (2.02), 3.584 (9.16), 4.733 (0.76), 4.748 (0.98), 4.763 (0.75), 7.108 (1.50), 7.284 (1.71), 7.946 (2.04), 7.976 (1.77), 8.376 (1.94).
Example 35 N-(2-chloro-3-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00160
From intermediate 17 and 2-chloro-3-fluoroaniline.
LC-MS (method A): Rt=1.36 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.571 (16.00), 1.657 (1.59), 1.673 (1.59), 2.807 (0.55), 2.822 (1.04), 2.839 (0.60), 3.716 (0.71), 3.731 (1.15), 3.746 (0.50), 6.975 (0.55), 6.979 (0.54), 7.295 (0.46), 7.310 (0.45), 7.515 (0.69), 7.529 (0.77), 8.099 (0.87), 8.128 (0.86), 8.357 (0.46), 8.378 (0.45), 9.748 (0.44).
Example 36 N-(2-chloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00161
From intermediate 17 and 2-chloro-4-fluoroaniline.
LC-MS (method A): Rt=1.35 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.574 (16.00), 1.647 (3.49), 1.662 (3.53), 1.929 (0.58), 1.941 (0.79), 1.953 (0.78), 1.956 (0.86), 1.972 (0.41), 1.993 (0.40), 2.009 (0.76), 2.013 (0.80), 2.019 (1.12), 2.024 (0.87), 2.029 (0.70), 2.038 (0.53), 2.805 (1.20), 2.821 (2.28), 2.837 (1.33), 3.714 (1.55), 3.730 (2.55), 3.744 (1.11), 4.887 (0.57), 4.903 (0.74), 4.918 (0.55), 7.039 (0.48), 7.046 (0.53), 7.058 (0.53), 7.062 (0.56), 7.065 (0.61), 7.069 (0.61), 7.081 (0.49), 7.089 (0.54), 7.176 (1.26), 7.183 (1.16), 7.197 (1.25), 7.204 (1.15), 7.498 (1.48), 7.512 (1.50), 8.106 (1.91), 8.135 (1.83), 8.448 (0.98), 8.462 (1.01), 8.471 (0.99), 8.485 (0.94), 9.613 (1.04).
Example 37 5-fluoro-N-[2-methyl-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00162
From intermediate 17 and 2-methyl-3-(trifluoromethyl)aniline.
LC-MS (method A): Rt=1.36 min; MS (ESIpos): m/z=547 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.577 (16.00), 1.644 (2.65), 1.660 (2.67), 1.933 (0.46), 1.945 (0.63), 1.956 (0.63), 1.960 (0.69), 2.013 (0.61), 2.018 (0.68), 2.028 (0.69), 2.033 (0.57), 2.042 (0.43), 2.407 (3.39), 2.810 (0.92), 2.826 (1.80), 2.842 (1.05), 3.717 (1.15), 3.733 (1.93), 3.748 (0.86), 4.927 (0.42), 4.942 (0.54), 4.958 (0.41), 5.310 (0.41), 7.360 (0.76), 7.380 (0.44), 7.497 (1.12), 7.511 (1.11), 7.535 (0.85), 7.555 (0.68), 7.983 (0.74), 8.003 (0.70), 8.153 (1.37), 8.181 (1.34), 9.136 (0.83).
Example 38 5-fluoro-N-[2-methyl-4-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00163
From intermediate 17 and 2-methyl-4-(trifluoromethyl)aniline.
LC-MS (method A): Rt=1.39 min; MS (ESIpos): m/z=547 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.572 (16.00), 1.628 (1.48), 1.644 (1.48), 2.374 (3.61), 2.809 (0.53), 2.825 (1.01), 2.841 (0.59), 3.717 (0.68), 3.732 (1.13), 3.748 (0.48), 7.499 (0.63), 7.507 (0.71), 7.522 (0.84), 8.132 (0.78), 8.161 (0.77), 8.185 (0.43), 8.206 (0.40), 9.156 (0.43).
Example 39 N-(2-chloro-3,5-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00164
From intermediate 17 and 2-chloro-3,5-difluoroaniline.
LC-MS (method A): Rt=1.43 min; MS (ESIpos): m/z=535 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.571 (16.00), 1.657 (0.75), 1.674 (0.75), 2.823 (0.49), 3.731 (0.56), 8.076 (0.44), 8.105 (0.45).
Example 40 N-(3,5-dimethyl-1,2-oxazol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00165
From intermediate 17 and 3,5-dimethyl-1,2-oxazol-4-amine.
LC-MS (method A): Rt=1.05 min; MS (ESIneg): m/z=482 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.599 (10.02), 1.656 (3.90), 1.672 (3.91), 1.931 (0.67), 1.938 (0.78), 1.943 (0.89), 1.954 (0.90), 1.958 (0.96), 1.970 (0.42), 1.974 (0.45), 1.997 (0.47), 2.002 (0.44), 2.011 (0.88), 2.018 (1.08), 2.026 (0.95), 2.032 (0.77), 2.041 (0.57), 2.204 (0.58), 2.235 (16.00), 2.378 (11.94), 2.806 (1.42), 2.822 (2.62), 2.839 (1.55), 3.712 (1.74), 3.727 (2.76), 3.743 (1.22), 4.919 (0.60), 4.934 (0.79), 4.949 (0.57), 7.477 (1.73), 7.491 (1.74), 8.123 (2.47), 8.152 (2.50), 8.553 (1.23).
Example 41 5-fluoro-N-(4-methyl-1,2-oxazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00166
From intermediate 17 and 4-methyl-1,2-oxazol-5-amine.
LC-MS (method A): Rt=1.07 min; MS (ESIneg): m/z=468 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (3.05), 1.183 (0.56), 1.419 (1.13), 1.434 (1.18), 1.500 (16.00), 1.862 (0.90), 1.873 (0.57), 1.932 (0.69), 1.944 (0.57), 2.105 (0.45), 2.717 (0.52), 2.733 (0.95), 2.749 (0.56), 2.977 (0.62), 3.631 (0.62), 3.646 (1.02), 3.661 (0.44), 7.268 (0.40), 7.277 (0.41), 7.452 (0.42).
Example 42 5-fluoro-N-(4-methyl-1H-imidazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00167
From intermediate 17 and 4-methyl-1H-imidazol-5-amine.
LC-MS (method A): Rt=0.78 min; MS (ESIpos): m/z=469.2 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.184 (0.68), 1.533 (0.84), 1.549 (0.77), 1.580 (3.47), 1.589 (6.33), 1.595 (4.79), 1.605 (6.10), 1.852 (2.06), 1.863 (2.83), 1.878 (2.87), 1.895 (1.40), 1.937 (2.77), 1.948 (2.73), 1.961 (1.66), 1.975 (0.62), 2.159 (1.26), 2.294 (10.47), 2.373 (1.94), 2.378 (1.35), 2.401 (6.22), 2.571 (16.00), 2.726 (2.76), 2.741 (5.10), 2.757 (2.60), 2.924 (0.48), 3.629 (3.04), 3.635 (2.70), 3.645 (4.93), 3.650 (3.79), 3.659 (2.75), 3.728 (0.70), 4.805 (0.49), 4.821 (0.67), 4.837 (0.83), 4.852 (1.08), 4.868 (1.18), 4.883 (0.85), 6.931 (0.49), 7.386 (1.14), 7.401 (1.64), 7.406 (2.32), 7.420 (2.23), 7.453 (0.59), 7.744 (0.60), 7.917 (1.53), 7.945 (2.75), 8.019 (3.33), 8.031 (1.41), 8.059 (1.26), 8.164 (0.73), 8.187 (0.94), 9.012 (2.30), 9.047 (0.75), 9.433 (1.76).
Example 43 5-fluoro-N-(3-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00168
From intermediate 17 and 3-fluoro-2-methylaniline.
LC-MS (method A): Rt=1.27 min; MS (ESIpos): m/z=497 [M−H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.504 (16.00), 1.554 (3.10), 1.570 (3.08), 1.854 (0.54), 1.866 (0.72), 1.877 (0.73), 1.881 (0.78), 1.934 (0.71), 1.939 (0.74), 1.949 (0.79), 1.954 (0.64), 1.963 (0.48), 2.142 (4.42), 2.146 (4.41), 2.730 (1.10), 2.747 (2.14), 2.762 (1.23), 3.638 (1.42), 3.654 (2.31), 3.669 (1.01), 4.824 (0.50), 4.840 (0.65), 4.855 (0.48), 6.833 (0.44), 6.855 (0.89), 6.877 (0.51), 7.133 (0.62), 7.149 (0.62), 7.407 (1.30), 7.422 (1.30), 7.605 (0.93), 7.625 (0.86), 8.061 (1.61), 8.091 (1.62), 9.008 (0.83).
Example 44 N-[2-(dimethylamino)ethyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00169
From intermediate 17 and N,N-dimethylethane-1,2-diamine.
LC-MS (method B): Rt=1.04 min; MS (ESIpos): m/z=459.8 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.436 (0.45), 1.449 (0.75), 1.464 (0.62), 1.523 (13.22), 1.539 (13.33), 1.824 (0.94), 1.830 (1.22), 1.838 (2.56), 1.846 (3.02), 1.851 (3.46), 1.862 (3.45), 1.866 (3.76), 1.878 (1.73), 1.882 (1.83), 1.903 (1.86), 1.910 (1.81), 1.919 (3.39), 1.923 (3.56), 1.934 (3.73), 1.939 (3.12), 1.945 (2.26), 1.948 (2.32), 1.962 (1.07), 2.247 (0.41), 2.366 (16.00), 2.655 (2.48), 2.711 (5.18), 2.726 (9.50), 2.742 (5.45), 2.810 (1.37), 2.854 (1.32), 3.034 (1.50), 3.598 (2.63), 3.608 (2.70), 3.620 (7.79), 3.636 (10.88), 3.650 (4.81), 4.715 (0.99), 4.731 (2.28), 4.746 (3.01), 4.762 (2.20), 4.777 (0.89), 7.282 (6.13), 7.296 (6.17), 7.886 (1.28), 7.899 (2.19), 7.911 (1.23), 7.937 (6.99), 7.966 (6.77).
Example 45 5-fluoro-N-(1-methylpiperidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00170
From intermediate 17 and 1-methylpiperidin-4-amine.
LC-MS (method A): Rt=0.72 min; MS (ESIpos): m/z=486.1 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.510 (13.94), 1.526 (13.91), 1.647 (1.39), 1.671 (1.57), 1.824 (0.89), 1.831 (1.11), 1.839 (2.41), 1.847 (2.81), 1.852 (3.22), 1.863 (3.26), 1.867 (3.54), 1.879 (1.60), 1.883 (1.72), 1.905 (1.71), 1.911 (1.63), 1.920 (3.19), 1.925 (3.34), 1.935 (3.53), 1.940 (2.89), 1.949 (2.27), 1.963 (1.05), 1.994 (1.47), 2.010 (0.95), 2.032 (2.32), 2.068 (1.25), 2.254 (1.85), 2.345 (16.00), 2.550 (0.58), 2.712 (4.93), 2.728 (9.27), 2.744 (5.48), 2.811 (0.50), 2.893 (1.77), 2.918 (1.64), 3.033 (0.54), 3.619 (6.19), 3.635 (10.03), 3.650 (4.44), 3.919 (0.45), 3.936 (0.86), 3.945 (1.06), 3.954 (0.94), 3.963 (1.06), 3.973 (0.84), 3.990 (0.44), 4.713 (0.93), 4.728 (2.21), 4.743 (2.85), 4.759 (2.09), 4.774 (0.85), 7.273 (6.29), 7.287 (6.21), 7.434 (2.21), 7.453 (2.17), 7.968 (8.02), 7.997 (7.92).
Example 46 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[4-(trifluoromethyl)-phenyl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00171
From intermediate 17 and 4-(trifluoromethyl)aniline.
LC-MS (method A): Rt=1.38 min; MS (ESIpos): m/z=533 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.513 (16.00), 1.585 (3.48), 1.599 (3.49), 1.857 (0.66), 1.862 (0.66), 1.867 (0.88), 1.875 (0.79), 1.879 (0.95), 1.936 (0.82), 1.941 (0.76), 1.948 (0.99), 1.953 (0.69), 1.960 (0.57), 2.732 (1.29), 2.745 (2.43), 2.758 (1.38), 3.638 (1.63), 3.651 (2.69), 3.663 (1.23), 4.853 (0.54), 4.865 (0.69), 4.877 (0.51), 7.406 (1.56), 7.417 (1.53), 7.550 (1.68), 7.567 (2.06), 7.711 (1.94), 7.728 (1.53), 8.089 (1.84), 8.113 (1.77), 9.557 (1.01).
Example 47 N-cyclopropyl-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00172
From intermediate 17 and cyclopropanamine.
LC-MS (method A): Rt=1.04 min; MS (ESIpos): m/z=429.2 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.500 (0.91), 0.503 (0.94), 0.508 (0.86), 0.510 (0.93), 0.514 (0.96), 0.516 (0.89), 0.526 (0.42), 0.777 (0.46), 0.781 (1.02), 0.785 (1.02), 0.799 (1.23), 0.801 (0.76), 1.483 (2.67), 1.498 (2.76), 1.515 (16.00), 1.838 (0.43), 1.845 (0.49), 1.850 (0.58), 1.861 (0.58), 1.865 (0.64), 1.918 (0.57), 1.923 (0.59), 1.933 (0.64), 1.939 (0.51), 2.710 (0.94), 2.726 (1.77), 2.742 (1.04), 2.903 (0.61), 2.913 (0.60), 3.617 (1.19), 3.633 (1.90), 3.648 (0.85), 4.694 (0.45), 4.709 (0.59), 4.725 (0.43), 7.251 (1.25), 7.265 (1.21), 8.001 (1.54), 8.030 (1.52).
Example 48 N-(2-cyano-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00173
From intermediate 17 and 2-amino-5-fluorobenzonitrile.
LC-MS (method A): Rt=1.21 min; MS (ESIpos): m/z=508 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.497 (16.00), 1.674 (1.05), 1.690 (1.06), 2.747 (0.72), 2.762 (0.42), 3.638 (0.48), 3.653 (0.79), 7.269 (0.42), 7.288 (0.41), 7.439 (0.50), 7.453 (0.55), 8.016 (0.63), 8.044 (0.64).
Example 49 N-(2-cyano-5-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00174
From intermediate 17 and 2-amino-4-fluorobenzonitrile.
LC-MS (method A): Rt=1.25 min; MS (ESIpos): m/z=508 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.496 (16.00), 1.695 (1.63), 1.711 (1.65), 1.882 (0.41), 1.949 (0.40), 2.731 (0.60), 2.747 (1.13), 2.763 (0.67), 3.638 (0.72), 3.654 (1.21), 3.669 (0.52), 7.450 (0.81), 7.465 (0.77), 7.543 (0.55), 7.557 (0.56), 7.564 (0.54), 7.579 (0.52), 7.983 (1.04), 8.012 (1.02), 8.334 (0.47), 8.340 (0.50), 8.362 (0.48), 8.368 (0.47), 9.792 (0.48).
Example 50 N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00175
From intermediate 17 and 2-chloro-6-fluoroaniline.
LC-MS (method A): Rt=1.24 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.260 (2.60), 1.566 (15.66), 1.651 (15.46), 1.667 (16.00), 1.914 (0.91), 1.920 (1.16), 1.928 (2.65), 1.936 (3.12), 1.941 (3.61), 1.953 (3.68), 1.956 (3.99), 1.960 (2.64), 1.968 (1.74), 1.972 (1.87), 1.993 (1.84), 1.999 (1.68), 2.009 (3.52), 2.014 (3.68), 2.024 (3.94), 2.030 (3.17), 2.035 (2.27), 2.038 (2.38), 2.045 (1.34), 2.052 (1.06), 2.807 (5.60), 2.824 (10.65), 2.840 (6.20), 3.713 (7.20), 3.729 (11.72), 3.744 (5.11), 4.918 (1.08), 4.934 (2.52), 4.949 (3.27), 4.964 (2.42), 4.979 (0.98), 7.006 (0.73), 7.109 (2.08), 7.112 (2.21), 7.129 (3.34), 7.133 (4.49), 7.136 (2.62), 7.152 (2.91), 7.156 (3.08), 7.216 (2.02), 7.230 (1.97), 7.237 (4.68), 7.250 (4.82), 7.257 (3.44), 7.281 (5.08), 7.285 (6.29), 7.288 (5.16), 7.302 (2.07), 7.305 (2.58), 7.308 (2.15), 7.502 (6.93), 7.516 (6.96), 7.528 (0.77), 8.170 (7.37), 8.199 (7.34), 9.033 (4.66).
Example 51 tert-butyl 3-{[5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl]amino}azetidine-1-carboxylate
Figure US11787797-20231017-C00176
From intermediate 17 and tert-butyl 3-aminoazetidine-1-carboxylate.
LC-MS (method A): Rt=1.18 min; MS (ESIpos): m/z=544 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.378 (16.00), 1.403 (1.63), 1.420 (1.61), 2.518 (0.78), 2.523 (0.58), 2.682 (0.48), 2.698 (0.94), 2.715 (0.51), 3.547 (0.56), 3.563 (1.01), 3.577 (0.44), 7.458 (0.74), 7.473 (0.73), 7.499 (0.96), 7.525 (0.93), 8.786 (0.50), 8.803 (0.49).
Example 52 N-(azetidin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00177
To a room temperature stirred solution of tert-butyl 3-{[5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl]amino}azetidine-1-carboxylate (example 51) (56.3 mg, 0.10 mmol, 1.00 eq.) in dichloromethane (0.50 ml) was added trifluoroacetic acid (0.12 ml). The resulting mixture was stirred at room temperature for 1 hour and then concentrated under reduced pressure to give a colourless oil. The residue was dissolved in DMSO, filtered through a teflon filter and purified by reverse phase column chromatography (15-55% acetonitrile, 0.1% aqueous ammonia) to give the title compound as an off white solid (13.7 mg, 28%).
LC-MS (method A): Rt=0.70 min; MS (ESIpos): m/z=444.4 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (0.53), 0.811 (0.53), 1.149 (0.41), 1.158 (4.66), 1.165 (0.51), 1.175 (10.45), 1.184 (2.82), 1.193 (5.41), 1.209 (0.72), 1.227 (0.68), 1.543 (7.53), 1.560 (10.35), 1.567 (15.08), 1.583 (14.09), 1.827 (1.49), 1.843 (4.17), 1.854 (5.70), 1.866 (5.72), 1.870 (6.08), 1.882 (2.89), 1.886 (2.94), 1.909 (2.90), 1.914 (3.11), 1.923 (5.48), 1.928 (6.01), 1.939 (5.94), 1.943 (5.34), 1.950 (3.77), 1.957 (3.65), 1.966 (1.52), 1.978 (0.53), 1.994 (0.51), 2.557 (16.00), 2.646 (1.88), 2.668 (0.63), 2.715 (7.65), 2.731 (14.31), 2.747 (8.08), 2.875 (1.09), 2.923 (1.23), 2.949 (1.37), 3.053 (1.23), 3.456 (0.48), 3.621 (7.02), 3.629 (4.80), 3.636 (11.70), 3.646 (7.94), 3.651 (5.79), 3.664 (5.24), 3.681 (1.74), 3.728 (1.76), 3.742 (1.83), 3.750 (1.84), 3.763 (1.74), 3.888 (0.46), 3.901 (0.51), 3.913 (0.50), 3.927 (0.46), 4.019 (0.43), 4.031 (0.43), 4.044 (0.43), 4.092 (2.78), 4.259 (1.38), 4.267 (1.42), 4.279 (2.25), 4.286 (2.20), 4.301 (1.42), 4.308 (1.37), 4.326 (1.13), 4.339 (1.96), 4.363 (3.16), 4.387 (1.91), 4.412 (0.55), 4.513 (0.48), 4.727 (1.11), 4.742 (2.83), 4.758 (3.88), 4.774 (3.33), 4.791 (1.91), 4.811 (0.67), 4.859 (0.84), 4.877 (1.45), 4.895 (1.40), 4.912 (0.72), 6.931 (0.80), 7.309 (3.42), 7.318 (6.51), 7.323 (4.29), 7.332 (7.15), 7.346 (1.20), 7.454 (0.97), 7.876 (6.03), 7.904 (5.98), 7.936 (1.78), 7.945 (1.02), 7.955 (6.56), 7.974 (0.89), 7.984 (5.05), 8.106 (2.92), 8.123 (2.87), 8.287 (1.33).
Example 53 5-fluoro-N-(6-methoxy-2-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00178
From intermediate 17 and 6-methoxy-2-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.24 min; MS (ESIneg): m/z=508 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.579 (0.96), 1.638 (3.37), 1.654 (3.40), 1.929 (0.54), 1.937 (0.63), 1.941 (0.73), 1.953 (0.75), 1.957 (0.81), 2.010 (0.72), 2.015 (0.77), 2.018 (0.99), 2.025 (0.81), 2.030 (0.66), 2.039 (0.49), 2.446 (9.49), 2.806 (1.15), 2.822 (2.19), 2.838 (1.29), 3.713 (1.47), 3.729 (2.42), 3.744 (1.05), 3.934 (16.00), 4.906 (0.55), 4.922 (0.73), 4.938 (0.52), 6.634 (1.37), 6.655 (1.41), 7.473 (1.49), 7.487 (1.49), 7.931 (1.72), 7.953 (1.62), 8.140 (1.97), 8.169 (1.91), 8.946 (1.11).
Example 54 5-fluoro-N-[1-(methylsulfonyl)piperidin-4-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00179
From intermediate 17 and 1-(methylsulfonyl)piperidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.06 min; MS (ESIpos): m/z=551 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.595 (6.63), 1.612 (4.96), 1.630 (0.60), 1.639 (0.80), 1.918 (0.68), 1.930 (0.91), 1.941 (0.92), 1.945 (1.00), 1.957 (0.43), 1.962 (0.47), 1.984 (0.46), 1.990 (0.45), 1.998 (0.91), 2.003 (0.96), 2.014 (1.01), 2.017 (0.95), 2.028 (0.61), 2.140 (0.42), 2.165 (0.79), 2.791 (1.40), 2.806 (2.89), 2.817 (16.00), 2.822 (2.10), 2.838 (0.44), 2.845 (0.75), 2.850 (0.48), 2.874 (1.33), 2.898 (0.48), 2.904 (0.72), 3.698 (1.75), 3.713 (2.94), 3.728 (1.27), 3.801 (0.98), 3.832 (0.94), 4.093 (0.43), 4.111 (0.43), 4.817 (0.68), 4.832 (0.87), 4.847 (0.64), 7.362 (1.90), 7.376 (1.87), 7.549 (0.76), 7.567 (0.75), 8.050 (2.34), 8.079 (2.33).
Example 55 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00180
From intermediate 17 and 6-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.20 min; MS (ESIpos): m/z=511 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.599 (0.49), 1.637 (3.77), 1.653 (3.74), 1.927 (0.60), 1.935 (0.70), 1.939 (0.82), 1.951 (0.83), 1.955 (0.90), 1.971 (0.42), 1.993 (0.42), 2.008 (0.80), 2.013 (0.85), 2.017 (1.34), 2.023 (0.91), 2.028 (0.74), 2.037 (0.54), 2.261 (8.80), 2.805 (1.25), 2.820 (2.43), 2.836 (1.39), 3.711 (1.62), 3.726 (2.64), 3.741 (1.15), 3.940 (16.00), 4.896 (0.61), 4.911 (0.80), 4.927 (0.58), 6.666 (2.45), 7.473 (1.64), 7.488 (1.65), 8.132 (2.12), 8.161 (2.11), 8.335 (2.99), 8.875 (1.25).
Example 56 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00181
From intermediate 17 and 2-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.22 min; MS (ESIneg): m/z=508 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.605 (0.71), 1.652 (3.93), 1.669 (3.92), 1.927 (0.63), 1.934 (0.73), 1.939 (0.86), 1.951 (0.86), 1.955 (0.94), 1.967 (0.40), 1.971 (0.44), 1.992 (0.44), 1.998 (0.41), 2.007 (0.84), 2.012 (0.89), 2.017 (0.63), 2.023 (0.94), 2.028 (0.76), 2.036 (0.57), 2.278 (11.08), 2.805 (1.33), 2.821 (2.56), 2.837 (1.48), 3.713 (1.74), 3.728 (2.82), 3.743 (1.22), 3.958 (16.00), 4.919 (0.64), 4.935 (0.83), 4.950 (0.60), 6.826 (1.67), 6.838 (1.71), 7.464 (1.73), 7.479 (1.68), 7.954 (2.20), 7.967 (2.13), 8.128 (2.21), 8.157 (2.19), 8.972 (1.33).
Example 57 N-(4,4-difluorocyclohexyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00182
From intermediate 17 and 4,4-difluorocyclohexanamine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=507 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.261 (0.55), 1.580 (16.00), 1.589 (13.98), 1.605 (12.82), 1.626 (2.04), 1.650 (1.01), 1.847 (0.51), 1.881 (1.07), 1.903 (1.26), 1.909 (1.53), 1.918 (2.73), 1.925 (2.88), 1.930 (3.15), 1.941 (3.16), 1.945 (3.53), 1.957 (2.21), 1.961 (2.26), 1.984 (1.89), 1.989 (1.77), 1.998 (2.93), 2.003 (2.85), 2.014 (2.88), 2.019 (2.37), 2.028 (1.73), 2.042 (0.76), 2.100 (2.55), 2.120 (3.85), 2.142 (2.59), 2.174 (0.57), 2.791 (4.12), 2.806 (7.78), 2.823 (4.59), 3.698 (5.24), 3.713 (8.51), 3.728 (3.72), 4.084 (0.90), 4.102 (0.91), 4.796 (0.84), 4.811 (1.95), 4.827 (2.57), 4.842 (1.85), 4.857 (0.73), 7.357 (5.44), 7.372 (5.39), 7.498 (1.71), 7.517 (1.67), 7.529 (0.60), 8.055 (6.90), 8.084 (6.82).
Example 58 N-(1-ethylazetidin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00183
From intermediate 17 and 1-ethylazetidin-3-amine.
LC-MS (method A): Rt=0.75 min; MS (ESIpos): m/z=472 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) [ppm]: 0.972 (7.23), 0.990 (16.00), 1.008 (7.51), 1.450 (0.44), 1.466 (0.47), 1.608 (10.98), 1.625 (11.42), 1.902 (0.62), 1.909 (0.81), 1.917 (1.78), 1.925 (2.14), 1.930 (2.38), 1.941 (2.49), 1.945 (2.59), 1.957 (1.13), 1.961 (1.20), 1.983 (1.22), 1.990 (1.23), 1.998 (2.38), 2.003 (2.44), 2.014 (2.59), 2.019 (2.08), 2.028 (1.53), 2.042 (0.63), 2.463 (1.44), 2.480 (4.24), 2.499 (4.10), 2.517 (1.32), 2.789 (3.85), 2.806 (7.19), 2.822 (5.32), 2.836 (2.60), 2.853 (1.44), 2.886 (2.16), 3.110 (2.62), 3.698 (4.87), 3.713 (8.03), 3.728 (3.47), 3.763 (2.51), 3.781 (4.08), 3.784 (4.03), 3.801 (2.45), 4.723 (1.31), 4.740 (2.43), 4.758 (2.40), 4.775 (1.22), 4.803 (0.72), 4.818 (1.70), 4.834 (2.21), 4.849 (1.61), 4.865 (0.65), 7.006 (0.41), 7.360 (4.90), 7.374 (4.76), 7.528 (0.42), 7.827 (1.52), 7.845 (1.50), 8.039 (6.09), 8.067 (5.99).
Example 59 N-[4-(dimethylamino)cyclohexyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00184
From intermediate 17 and N,N-dimethylcyclohexane-1,4-diamine.
LC-MS (method A): Rt=0.77 min; MS (ESIneg): m/z=512 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.240 (0.49), 1.249 (0.55), 1.255 (0.58), 1.264 (0.58), 1.270 (0.59), 1.278 (0.61), 1.285 (0.61), 1.293 (0.57), 1.466 (0.83), 1.496 (0.79), 1.571 (4.85), 1.587 (4.91), 1.908 (0.81), 1.920 (1.12), 1.931 (1.13), 1.935 (1.21), 1.947 (0.55), 1.951 (0.57), 1.973 (0.57), 1.979 (0.56), 1.988 (1.10), 1.993 (1.16), 2.003 (1.24), 2.010 (1.73), 2.018 (0.88), 2.024 (0.66), 2.033 (0.87), 2.042 (0.84), 2.049 (0.80), 2.057 (0.72), 2.067 (0.73), 2.074 (0.74), 2.189 (0.88), 2.197 (0.91), 2.221 (0.88), 2.229 (0.82), 2.447 (16.00), 2.780 (1.59), 2.796 (3.13), 2.812 (1.77), 3.686 (1.98), 3.702 (3.36), 3.717 (1.47), 3.910 (0.50), 3.919 (0.40), 3.929 (0.50), 4.791 (0.78), 4.806 (1.00), 4.822 (0.73), 7.333 (2.17), 7.348 (2.13), 7.437 (0.91), 7.457 (0.89), 8.043 (2.63), 8.072 (2.57), 8.574 (2.09).
Example 60 N-(2-ethylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00185
From intermediate 17 and 2-ethylaniline.
LC-MS (method A): Rt=1.31 min; MS (ESIpos): m/z=493 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.226 (5.00), 1.245 (10.79), 1.264 (5.32), 1.579 (16.00), 1.619 (6.34), 1.635 (6.33), 1.928 (1.08), 1.941 (1.49), 1.956 (1.59), 1.972 (0.76), 1.993 (0.77), 2.009 (1.47), 2.014 (1.51), 2.024 (1.62), 2.038 (0.97), 2.052 (0.40), 2.639 (1.25), 2.657 (3.50), 2.676 (3.34), 2.695 (1.07), 2.805 (2.14), 2.822 (4.13), 2.838 (2.33), 3.715 (2.70), 3.730 (4.44), 3.745 (1.98), 4.871 (0.44), 4.887 (1.05), 4.903 (1.34), 4.918 (1.00), 7.188 (0.58), 7.204 (1.84), 7.223 (1.55), 7.226 (1.49), 7.257 (1.44), 7.295 (2.09), 7.471 (2.68), 7.485 (2.61), 7.814 (2.01), 7.834 (1.68), 8.139 (3.15), 8.167 (3.08), 9.016 (1.80).
Example 61 N-(2-chloro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00186
From intermediate 17 and 2-chloro-6-methylaniline.
LC-MS (method A): Rt=1.28 min; MS (ESIneg): m/z=511 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.652 (6.60), 1.668 (6.61), 1.918 (0.48), 1.926 (1.08), 1.938 (1.46), 1.949 (1.45), 1.953 (1.58), 1.965 (0.69), 1.969 (0.75), 1.991 (0.75), 1.997 (0.71), 2.006 (1.43), 2.011 (1.50), 2.021 (1.58), 2.026 (1.27), 2.035 (0.95), 2.049 (0.40), 2.318 (16.00), 2.804 (2.17), 2.820 (4.13), 2.836 (2.38), 3.711 (2.69), 3.727 (4.55), 3.742 (1.96), 4.929 (0.43), 4.944 (1.03), 4.959 (1.33), 4.975 (0.98), 7.155 (0.85), 7.174 (2.83), 7.193 (3.57), 7.198 (1.99), 7.202 (2.55), 7.218 (0.76), 7.222 (0.52), 7.315 (1.63), 7.319 (1.67), 7.333 (1.20), 7.338 (1.22), 7.475 (2.72), 7.489 (2.72), 8.157 (3.48), 8.186 (3.42), 8.987 (2.03).
Example 62 N-(2-chloro-4-fluoro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00187
From intermediate 17 and 2-chloro-4-fluoro-6-methylaniline.
LC-MS (method A): Rt=1.30 min; MS (ESIpos): m/z=531 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.576 (16.00), 1.653 (5.89), 1.669 (5.93), 1.930 (0.98), 1.942 (1.33), 1.954 (1.31), 1.957 (1.44), 1.973 (0.69), 1.995 (0.68), 2.010 (1.30), 2.014 (1.37), 2.025 (1.47), 2.030 (1.17), 2.039 (0.88), 2.310 (14.34), 2.807 (2.01), 2.824 (3.83), 2.840 (2.23), 3.715 (2.54), 3.730 (4.23), 3.745 (1.83), 4.927 (0.40), 4.942 (0.95), 4.958 (1.24), 4.973 (0.91), 6.935 (1.08), 6.941 (1.19), 6.957 (1.08), 6.964 (1.16), 7.073 (1.29), 7.080 (1.19), 7.093 (1.31), 7.100 (1.17), 7.479 (2.56), 7.493 (2.55), 8.144 (3.18), 8.172 (3.23), 8.885 (1.84).
Example 63 N-(2-chloro-4,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00188
From intermediate 17 and 2-chloro-4,6-difluoroaniline.
LC-MS (method A): Rt=1.28 min; MS (ESIpos): m/z=535 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.595 (9.60), 1.645 (15.98), 1.662 (16.00), 1.911 (0.94), 1.927 (2.68), 1.939 (3.69), 1.951 (3.67), 1.954 (3.96), 1.970 (1.88), 1.992 (1.88), 2.007 (3.61), 2.012 (3.78), 2.022 (4.01), 2.027 (3.24), 2.037 (2.42), 2.051 (1.01), 2.626 (0.75), 2.805 (5.37), 2.821 (10.44), 2.837 (5.90), 3.711 (6.68), 3.726 (11.35), 3.741 (4.92), 4.917 (1.06), 4.932 (2.48), 4.948 (3.22), 4.963 (2.38), 4.978 (0.96), 6.888 (2.03), 6.895 (2.27), 6.911 (2.80), 6.916 (2.94), 6.918 (2.89), 6.933 (2.04), 6.940 (2.18), 7.067 (2.50), 7.071 (2.82), 7.074 (2.87), 7.077 (2.61), 7.086 (2.64), 7.090 (2.78), 7.093 (2.89), 7.097 (2.37), 7.501 (6.61), 7.515 (6.57), 8.148 (7.17), 8.176 (7.23), 8.926 (5.40).
Example 64 5-fluoro-N-(4-fluoro-2,6-dimethylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00189
From intermediate 17 and 4-fluoro-2,6-dimethylaniline.
LC-MS (method A): Rt=1.28 min; MS (ESIpos): m/z=511 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.606 (1.52), 1.643 (3.27), 1.658 (3.29), 1.929 (0.54), 1.937 (0.62), 1.941 (0.72), 1.953 (0.73), 1.957 (0.80), 2.010 (0.71), 2.015 (0.74), 2.025 (0.79), 2.030 (0.64), 2.039 (0.48), 2.252 (16.00), 2.806 (1.16), 2.823 (2.17), 2.839 (1.28), 3.714 (1.48), 3.729 (2.41), 3.744 (1.04), 4.939 (0.53), 4.955 (0.69), 4.970 (0.50), 6.830 (2.17), 6.853 (2.15), 7.457 (1.45), 7.471 (1.46), 8.143 (1.96), 8.171 (1.93), 8.645 (0.92).
Example 65 N-(2-chloro-4-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00190
From intermediate 17 and 2-chloro-4-methylpyridin-3-amine.
LC-MS (method A): Rt=1.11 min; MS (ESIneg): m/z=512 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.586 (14.95), 1.677 (6.12), 1.693 (6.15), 1.933 (1.03), 1.945 (1.40), 1.956 (1.43), 1.960 (1.55), 1.976 (0.73), 1.998 (0.74), 2.013 (1.40), 2.017 (1.46), 2.028 (1.55), 2.033 (1.30), 2.042 (0.97), 2.056 (0.42), 2.349 (16.00), 2.810 (2.06), 2.827 (4.02), 2.843 (2.31), 3.717 (2.64), 3.732 (4.32), 3.748 (1.94), 4.950 (0.43), 4.965 (0.97), 4.981 (1.27), 4.996 (0.93), 7.192 (2.36), 7.204 (2.43), 7.509 (2.59), 7.523 (2.58), 8.149 (3.33), 8.178 (3.33), 8.212 (3.22), 8.224 (3.22), 9.132 (2.19).
Example 66 N-(2,4-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00191
From intermediate 17 and 2,4-dimethylpyridin-3-amine.
LC-MS (method A): Rt=0.81 min; MS (ESIpos): m/z=494 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.608 (9.87), 1.662 (6.35), 1.678 (6.30), 1.934 (1.08), 1.947 (1.51), 1.962 (1.62), 1.978 (0.81), 2.000 (0.77), 2.019 (1.54), 2.030 (1.61), 2.045 (1.02), 2.058 (0.44), 2.281 (14.78), 2.515 (16.00), 2.626 (2.90), 2.812 (2.01), 2.829 (3.91), 2.845 (2.27), 3.719 (2.48), 3.734 (4.23), 3.750 (1.93), 4.944 (0.43), 4.959 (0.98), 4.974 (1.27), 4.990 (0.92), 7.083 (2.08), 7.096 (2.10), 7.488 (2.53), 7.502 (2.50), 8.159 (3.07), 8.188 (3.08), 8.334 (2.74), 8.346 (2.63), 8.836 (2.11).
Example 67 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}-N-(2,4,6-trimethylpyridin-3-yl)benzamide
Figure US11787797-20231017-C00192
From intermediate 17 and 2,4,6-trimethylpyridin-3-amine.
LC-MS (method A): Rt=0.79 min; MS (ESIneg): m/z=506 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.442 (7.39), 1.458 (7.49), 1.729 (2.46), 1.742 (2.56), 1.801 (2.53), 1.812 (2.60), 2.043 (15.52), 2.285 (16.00), 2.328 (15.22), 2.430 (0.46), 2.594 (2.48), 2.609 (4.67), 2.625 (2.61), 3.500 (2.78), 3.516 (4.81), 3.530 (2.46), 4.737 (0.56), 4.753 (1.22), 4.768 (1.56), 4.783 (1.18), 4.798 (0.52), 6.016 (0.59), 6.788 (4.69), 7.071 (1.94), 7.283 (2.70), 7.922 (2.73), 7.950 (2.73), 8.072 (1.90), 8.584 (3.19).
Example 68 N-(6-chloro-2,3-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00193
From intermediate 17 and 6-chloro-2,3-difluoroaniline.
LC-MS (method A): Rt=1.28 min; MS (ESIpos): m/z=535 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.636 (4.25), 1.653 (16.00), 1.670 (15.48), 1.910 (1.06), 1.926 (2.96), 1.938 (4.26), 1.952 (4.46), 1.968 (2.29), 1.991 (2.20), 2.010 (4.36), 2.021 (4.58), 2.033 (2.92), 2.048 (1.20), 2.803 (4.90), 2.819 (9.54), 2.836 (5.29), 3.709 (5.79), 3.724 (9.99), 3.739 (4.77), 4.932 (1.04), 4.948 (2.42), 4.964 (3.13), 4.979 (2.35), 4.994 (0.98), 7.081 (1.26), 7.103 (3.33), 7.123 (3.55), 7.146 (1.94), 7.211 (2.32), 7.216 (2.47), 7.223 (2.75), 7.228 (2.62), 7.233 (2.05), 7.238 (1.92), 7.245 (1.84), 7.250 (1.72), 7.516 (5.83), 7.530 (5.84), 8.162 (6.02), 8.191 (6.02), 9.091 (5.61).
Example 69 5-fluoro-N-(2-methoxy-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00194
From intermediate 17 and 2-methoxy-6-methylaniline.
LC-MS (method A): Rt=1.25 min; MS (ESIneg): m/z=507 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.720 (5.68), 1.736 (5.77), 2.008 (1.06), 2.020 (1.49), 2.035 (1.57), 2.047 (0.77), 2.051 (0.79), 2.073 (0.77), 2.092 (1.52), 2.103 (1.60), 2.116 (1.00), 2.131 (0.41), 2.375 (13.05), 2.886 (1.84), 2.902 (3.60), 2.918 (2.03), 3.795 (2.23), 3.810 (3.83), 3.825 (1.78), 3.906 (16.00), 5.003 (0.92), 5.018 (1.20), 5.033 (0.89), 6.880 (1.63), 6.901 (1.81), 6.975 (1.59), 6.994 (1.82), 7.250 (1.45), 7.290 (1.14), 7.363 (1.94), 7.532 (2.27), 7.547 (2.29), 8.229 (2.61), 8.258 (2.58), 8.977 (2.03).
Example 70 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00195
From intermediate 17 and o-toluidine.
MS (ESIpos): m/z=479 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.62 (d, 3H), 1.86-2.06 (m, 4H), 2.31 (s, 3H), 2.81 (t, 2H), 3.71 (t, 2H), 4.82-4.97 (m, 1H), 7.13 (t, 1H), 7.20-7.30 (m, 2H), 7.46 (d, 1H), 7.89 (d, 1H), 8.14 (d, 1H), 9.02 (s, 1H).
Example 71 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00196
From intermediate 17 and 2-fluoro-6-methylaniline.
MS (ESIpos): m/z=497 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.66 (d, 3H), 1.90-2.08 (m, 4H), 2.33 (s, 3H), 2.83 (t, 2H), 3.74 (t, 2H), 4.87-5.02 (m, 1H), 6.97-7.12 (m, 2H), 7.21 (dd, 1H), 7.50 (d, 1H), 8.17 (d, 1H), 8.18 (s, 1H).
Example 72 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00197
From intermediate 17 and 2-fluoroaniline.
MS (ESIpos): m/z=483 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.66 (d, 3H), 1.87-2.06 (m, 4H), 2.81 (t, 2H), 3.72 (t, 2H), 4.85-5.00 (m, 1H), 7.03-7.22 (m, 3H), 7.49 (d, 1H), 8.16 (d, 1H), 8.54 (td, 1H), 9.77 (s, 1H).
Example 73 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-phenyl-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00198
From intermediate 17 and aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.25 min; MS (ESIpos): m/z=465 [M+H]+
Example 74 5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00199
From intermediate 17 and 4-fluoro-2-methylaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.26 min; MS (ESIpos): m/z=497 [M+H]+
Example 75 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(2,4,6-trifluorophenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00200
From intermediate 17 and 2,4,6-trifluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.23 min; MS (ESIpos): m/z=519 [M+H]+
Example 76 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[2-(trifluoromethyl)phenyl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00201
From intermediate 17 and 2-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.32 min; MS (ESIpos): m/z=533 [M+H]+
Example 77 5-fluoro-N-(3-methylpyridin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00202
From intermediate 17 and 3-methylpyridin-2-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.00 min; MS (ESIpos): m/z=480 [M+H]+
Example 78 N-(2-chlorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00203
From intermediate 17 and 2-chloroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.35 min; MS (ESIpos): m/z=500 [M+H]+
Example 79 N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00204
From intermediate 17 and 2,6-dichloroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.27 min; MS (ESIpos): m/z=534 [M+H]+
Example 80 5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00205
From intermediate 17 and 5-fluoro-2-methylaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.30 min; MS (ESIpos): m/z=497 [M+H]+
Example 81 N-(2-cyano-3-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00206
From intermediate 17 and 2-amino-6-fluorobenzonitrile.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.24 min; MS (ESIpos): m/z=508 [M+H]+
Example 82 5-fluoro-N-(1-methyl-1H-pyrazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00207
From intermediate 17 and 1-methyl-1H-pyrazol-5-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.99 min; MS (ESIpos): m/z=469 [M+H]+
Example 83 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(tetrahydro-2H-pyran-4-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00208
From intermediate 17 and tetrahydro-2H-pyran-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.01 min; MS (ESIpos): m/z=473 [M+H]+
Example 84 N-(2-chloro-5-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00209
From intermediate 17 and 2-chloro-5-fluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.41 min; MS (ESIpos): m/z=518 [M+H]+
Example 85 5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00210
From intermediate 17 and 4-methylpyridin-3-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.83 min; MS (ESIpos): m/z=480 [M+H]+
Example 86 5-fluoro-N-[2-methyl-5-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00211
From intermediate 17 and 2-methyl-5-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.39 min; MS (ESIpos): m/z=547 [M+H]+
Example 87 5-fluoro-N-(3-methylpyridin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00212
From intermediate 17 and 3-methylpyridin-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.78 min; MS (ESIpos): m/z=480 [M+H]+
Example 88 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00213
From intermediate 17 and 2-methyl-6-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.31 min; MS (ESIpos): m/z=547 [M+H]+
Example 89 N-(1,3-dimethyl-1H-pyrazol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00214
From intermediate 17 and 1,3-dimethyl-1H-pyrazol-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.00 min; MS (ESIpos): m/z=483 [M+H]+
Example 90 N-(1,4-dimethyl-1H-pyrazol-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00215
From intermediate 17 and 1,4-dimethyl-1H-pyrazol-3-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.02 min; MS (ESIpos): m/z=483 [M+H]+
Example 91 5-fluoro-N-(2-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00216
From intermediate 17 and 2-methylpyridin-3-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.83 min; MS (ESIpos): m/z=480 [M+H]+
Example 92 5-fluoro-N-(2-hydroxy-2-methylpropyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00217
From intermediate 17 and 1-amino-2-methylpropan-2-ol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.96 min; MS (ESIpos): m/z=461 [M+H]+
Example 93 5-fluoro-N-[2-(hydroxymethyl)-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00218
From intermediate 17 and [2-amino-6-(trifluoromethyl)phenyl]methanol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.23 min; MS (ESIpos): m/z=563 [M+H]+
Example 94 5-fluoro-N-[3-(hydroxymethyl) phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00219
From intermediate 17 and (3-aminophenyl)methanol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.06 min; MS (ESIpos): m/z=495 [M+H]+
Example 95 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-8-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00220
From intermediate 17 and quinolin-8-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.39 min; MS (ESIpos): m/z=516 [M+H]+
Example 96 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-6-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00221
From intermediate 17 and quinolin-6-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.96 min; MS (ESIpos): m/z=516 [M+H]+
Example 97 3-{[5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoyl]amino}-4-methylbenzoic Acid
Figure US11787797-20231017-C00222
From intermediate 17 and 3-amino-4-methylbenzoic acid.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.10 min; MS (ESIpos): m/z=523 [M+H]+
Example 98 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-5-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00223
From intermediate 17 and quinolin-5-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.96 min; MS (ESIpos): m/z=516 [M+H]+
Example 99 5-fluoro-N-(2-methylquinolin-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00224
From intermediate 17 and 2-methylquinolin-5-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.89 min; MS (ESIpos): m/z=530 [M+H]+
Example 100 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(quinolin-7-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00225
From intermediate 17 and quinolin-7-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.93 min; MS (ESIpos): m/z=516 [M+H]+
Example 101 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(3-sulfamoylphenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00226
From intermediate 17 and 3-aminobenzenesulfonamide.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.02 min; MS (ESIpos): m/z=544 [M+H]+
Example 102 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00227
From intermediate 17 and 7H-pyrrolo[2,3-d]pyrimidin-4-amine
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.96 min; MS (ESIpos): m/z=506 [M+H]+
Example 103 5-fluoro-N-(2-methylquinolin-6-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00228
From intermediate 17 and 2-methylquinolin-6-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.89 min; MS (ESIpos): m/z=530 [M+H]+
Example 104 5-fluoro-N-(2-methyl-1,3-benzothiazol-6-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00229
From intermediate 17 and 2-methyl-1,3-benzothiazol-6-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.23 min; MS (ESIpos): m/z=536 [M+H]+
Example 105 5-fluoro-N-(6-methyl-1H-indazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00230
From intermediate 17 and 6-methyl-1H-indazol-5-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.05 min; MS (ESIpos): m/z=519 [M+H]+
Example 106 5-fluoro-N-(3-oxo-3,4-dihydro-2H-1,4-benzoxazin-7-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00231
From intermediate 17 and 7-amino-2H-1,4-benzoxazin-3(4H)-one.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.03 min; MS (ESIpos): m/z=536 [M+H]+
Example 107 N-(2,3-dimethoxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00232
From intermediate 17 and 2,3-dimethoxyaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.31 min; MS (ESIpos): m/z=525 [M+H]+
Example 108 5-fluoro-N-(1H-indazol-7-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00233
From intermediate 17 and 1H-indazol-7-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.15 min; MS (ESIpos): m/z=505 [M+H]+
Example 109 5-fluoro-N-[1-(4-fluorophenyl)cyclopropyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00234
From intermediate 17 and 1-(4-fluorophenyl)cyclopropanamine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.29 min; MS (ESIpos): m/z=523 [M+H]+
Example 110 5-fluoro-N-(4-fluoro-3-hydroxy-1H-indazol-6-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00235
From intermediate 17 and 6-amino-4-fluoro-1H-indazol-3-ol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.96 min; MS (ESIpos): m/z=539 [M+H]+
Example 111 5-fluoro-N-[(1S,2S)-2-hydroxy-2,3-dihydro-1H-inden-1-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00236
From intermediate 17 and (1S,2S)-1-aminoindan-2-ol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.14 min; MS (ESIpos): m/z=521 [M+H]+
Example 112 N-(3-carbamoyl-2-methylphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00237
From intermediate 17 and 3-amino-2-methylbenzamide.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.95 min; MS (ESIpos): m/z=522 [M+H]+
Example 113 2-[(1S)-1-cyclohexylethoxy]-N-(1,1-dioxidotetrahydro-2H-thiopyran-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00238
To a solution of 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 19) (100 mg, 248 μmol) in dichloromethane (1.0 ml) was added two drops of N,N-dimethylformamide. The solution was cooled to 0° C. and oxalyl chloride (34.6 mg, 273 μmol) was slowly added. The reaction was then warmed to room temperature and stirred for 90 minutes. The solvent was removed under reduced pressure and the residue was re-dissolved in dichloromethane (2.0 ml) and added dropwise to a cooled (0° C.) solution of tetrahydro-2H-thiopyran-4-amine 1,1-dioxide (40.7 mg, 273 μmol) and triethylamine (38 μl, 270 μmol) in dichloromethane (2.0 ml). The mixture was warmed to room temperature and stirred for one hour. Then, the solvent was removed under reduced pressure and the residue was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile), to yield the title compound (90 mg, 67%) as a solid.
LC-MS (method A): Rt=1.13 min; MS (ESIpos): m/z=536 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.993 (0.97), 1.001 (0.94), 1.024 (1.23), 1.031 (1.16), 1.073 (1.11), 1.080 (1.06), 1.103 (1.81), 1.109 (1.58), 1.132 (1.83), 1.159 (2.02), 1.192 (16.00), 1.207 (15.54), 1.220 (1.40), 1.228 (1.22), 1.559 (0.98), 1.566 (1.00), 1.573 (0.99), 1.624 (1.13), 1.658 (1.62), 1.702 (3.47), 1.732 (1.88), 1.770 (0.90), 1.779 (1.94), 1.786 (2.30), 1.791 (2.69), 1.802 (2.75), 1.806 (2.85), 1.818 (1.95), 1.822 (2.10), 1.855 (2.20), 1.859 (2.40), 1.869 (3.17), 1.874 (3.14), 1.884 (2.92), 1.890 (2.39), 1.899 (1.73), 1.905 (0.96), 1.966 (1.39), 1.978 (1.48), 1.994 (1.59), 2.003 (1.63), 2.019 (0.90), 2.149 (1.26), 2.158 (1.81), 2.164 (1.88), 2.173 (1.74), 2.178 (1.52), 2.183 (1.51), 2.188 (1.38), 2.193 (1.38), 2.198 (1.29), 2.208 (0.91), 2.540 (1.18), 2.672 (3.37), 2.688 (6.60), 2.704 (3.61), 3.090 (1.33), 3.098 (1.72), 3.127 (2.11), 3.133 (2.37), 3.141 (1.80), 3.279 (1.62), 3.308 (2.42), 3.342 (1.21), 3.539 (3.92), 3.554 (7.13), 3.568 (3.12), 4.149 (0.85), 4.155 (1.13), 4.165 (0.99), 4.175 (1.13), 4.282 (1.76), 4.297 (2.63), 4.312 (1.76), 7.240 (4.66), 7.256 (4.66), 7.501 (6.75), 7.528 (6.43), 8.224 (3.25), 8.244 (3.16).
Examples 114-138 were prepared as described for example 113 from 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 19) and the respective amines, as indicated. Products were purified by flash column chromatography or, if explicitely mentioned, by preparative HPLC.
Example 114 2-[(1S)-1-cyclohexylethoxy]-N-(4,4-difluorocyclohexyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00239
From intermediate 19 and 4,4-difluorocyclohexanamine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.14 min; MS (ESIpos): m/z=522 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.003 (0.99), 1.011 (0.95), 1.033 (1.26), 1.040 (1.18), 1.079 (1.06), 1.088 (1.21), 1.099 (1.04), 1.111 (1.53), 1.117 (1.48), 1.130 (1.44), 1.139 (1.44), 1.153 (2.22), 1.165 (1.46), 1.175 (1.73), 1.180 (1.94), 1.199 (16.00), 1.214 (15.48), 1.230 (1.11), 1.536 (1.92), 1.542 (2.21), 1.548 (2.02), 1.567 (2.68), 1.572 (2.53), 1.578 (2.19), 1.593 (1.26), 1.599 (1.19), 1.608 (1.15), 1.616 (1.06), 1.627 (1.17), 1.657 (1.54), 1.703 (3.79), 1.731 (1.93), 1.770 (0.95), 1.779 (2.01), 1.786 (2.40), 1.791 (2.75), 1.802 (2.79), 1.806 (2.90), 1.818 (1.58), 1.822 (1.64), 1.835 (1.43), 1.855 (1.92), 1.859 (2.16), 1.869 (3.64), 1.873 (3.75), 1.884 (3.24), 1.889 (2.77), 1.899 (2.47), 1.905 (2.30), 1.913 (2.32), 1.934 (2.76), 1.957 (2.22), 2.014 (2.22), 2.030 (2.85), 2.041 (2.37), 2.052 (1.84), 2.075 (0.84), 2.540 (1.46), 2.672 (3.45), 2.688 (6.74), 2.704 (3.68), 3.539 (4.39), 3.554 (7.73), 3.569 (3.86), 3.974 (0.93), 3.992 (0.91), 4.312 (1.77), 4.328 (2.63), 4.342 (1.75), 7.257 (4.67), 7.272 (4.65), 7.544 (7.00), 7.572 (6.60), 8.111 (3.23), 8.130 (3.16).
Example 115 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methoxy-5-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00240
From intermediate 19 and 2-methoxy-5-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.59 min; MS (ESIpos): m/z=578 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.382 (6.95), 1.397 (6.77), 1.774 (1.31), 1.783 (1.65), 1.813 (1.01), 1.934 (1.00), 1.946 (1.03), 1.950 (1.11), 2.001 (1.35), 2.007 (1.43), 2.017 (1.25), 2.022 (0.96), 2.801 (1.54), 2.817 (2.95), 2.833 (1.69), 3.713 (1.92), 3.729 (3.21), 3.743 (1.39), 3.995 (16.00), 4.386 (1.00), 6.981 (1.43), 7.002 (1.61), 7.353 (0.93), 7.355 (0.99), 7.359 (1.06), 7.360 (1.14), 7.364 (2.07), 7.374 (1.03), 7.379 (2.67), 8.127 (2.63), 8.156 (2.60), 8.995 (1.83), 9.001 (1.79), 10.429 (1.57).
Example 116 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00241
From intermediate 19 and 6-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.39 min; MS (ESIpos): m/z=525 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.368 (5.19), 1.383 (5.27), 1.612 (2.02), 1.948 (1.08), 2.273 (7.42), 2.274 (7.97), 2.800 (1.09), 2.817 (2.10), 2.832 (1.21), 3.710 (1.39), 3.725 (2.28), 3.740 (0.99), 3.939 (16.00), 6.665 (2.17), 6.667 (1.81), 7.384 (1.37), 7.399 (1.34), 8.128 (1.94), 8.157 (1.92), 8.341 (2.75), 9.497 (1.20).
Example 117 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxy-2-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00242
From intermediate 19 and 6-methoxy-2-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.43 min; MS (ESIpos): m/z=525 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.371 (4.50), 1.386 (4.74), 2.468 (8.80), 2.801 (1.00), 2.817 (1.92), 2.834 (1.12), 3.712 (1.28), 3.727 (2.08), 3.742 (0.91), 3.931 (16.00), 6.634 (1.22), 6.655 (1.25), 7.381 (1.26), 7.395 (1.24), 7.996 (1.68), 8.018 (1.56), 8.134 (1.80), 8.164 (1.75), 9.556 (1.07).
Example 118 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00243
From intermediate 19 and 2-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.41 min; MS (ESIpos): m/z=525 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.371 (5.34), 1.387 (5.54), 1.620 (1.18), 2.014 (1.13), 2.282 (9.70), 2.800 (1.15), 2.817 (2.25), 2.832 (1.31), 3.711 (1.49), 3.726 (2.44), 3.741 (1.08), 3.959 (16.00), 6.830 (1.47), 6.843 (1.52), 7.371 (1.46), 7.386 (1.44), 7.943 (1.98), 7.956 (1.95), 8.122 (2.03), 8.151 (2.05), 9.606 (1.27).
Example 119 2-[(1S)-1-cyclohexylethoxy]-N-[3-(dimethylcarbamoyl)phenyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00244
From intermediate 19 and 3-amino-N,N-dimethylbenzamide.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.28 min; MS (ESIpos): m/z=551 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.133 (1.32), 1.140 (1.25), 1.155 (1.32), 1.164 (1.60), 1.178 (1.01), 1.190 (1.85), 1.217 (1.15), 1.267 (1.06), 1.276 (1.38), 1.284 (1.35), 1.290 (1.18), 1.297 (1.04), 1.307 (1.12), 1.315 (1.03), 1.390 (15.78), 1.406 (16.00), 1.627 (3.39), 1.734 (1.25), 1.741 (1.39), 1.749 (1.08), 1.778 (1.29), 1.796 (3.56), 1.825 (2.88), 1.919 (1.59), 1.926 (1.87), 1.931 (2.14), 1.943 (2.23), 1.946 (2.38), 1.950 (1.66), 1.959 (1.08), 1.963 (1.14), 1.984 (1.73), 1.990 (1.96), 1.998 (2.92), 2.004 (2.75), 2.014 (2.89), 2.019 (2.75), 2.026 (2.31), 2.028 (2.29), 2.798 (3.31), 2.813 (6.43), 2.830 (3.67), 3.039 (6.90), 3.129 (6.84), 3.709 (4.18), 3.724 (6.99), 3.739 (3.00), 4.418 (1.58), 4.433 (2.34), 4.449 (1.50), 7.196 (1.92), 7.199 (2.71), 7.202 (2.04), 7.215 (2.44), 7.219 (3.37), 7.221 (2.32), 7.362 (4.22), 7.377 (4.26), 7.389 (2.80), 7.409 (4.80), 7.428 (2.76), 7.584 (1.98), 7.587 (2.30), 7.590 (2.27), 7.592 (2.17), 7.604 (1.64), 7.607 (1.75), 7.610 (1.96), 7.613 (1.73), 7.818 (3.10), 7.822 (4.79), 7.827 (3.01), 8.125 (5.73), 8.154 (5.81), 10.181 (3.75).
Example 120 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[1-(methylsulfonyl)piperidin-4-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00245
From intermediate 19 and 1-(methylsulfonyl)piperidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.20 min; MS (ESIpos): m/z=565 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.315 (6.10), 1.331 (6.01), 1.615 (2.10), 1.909 (0.97), 1.916 (1.07), 1.921 (1.07), 1.933 (1.05), 1.936 (1.19), 2.784 (1.27), 2.800 (2.49), 2.816 (3.13), 2.819 (16.00), 2.851 (1.75), 2.857 (1.27), 3.695 (1.59), 3.710 (2.66), 3.725 (1.16), 4.347 (1.00), 7.291 (1.61), 8.035 (2.20), 8.065 (2.20).
Example 121 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00246
From intermediate 19 and 5-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method A): Rt=1.20 min; MS (ESIpos): m/z=524 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.298 (6.59), 1.313 (6.91), 1.683 (1.19), 1.868 (1.13), 1.873 (1.32), 1.924 (1.17), 1.930 (1.08), 1.940 (1.06), 2.150 (14.84), 2.726 (1.50), 2.742 (2.88), 2.758 (1.65), 3.634 (1.87), 3.650 (3.14), 3.665 (1.32), 3.893 (16.00), 4.360 (1.00), 7.338 (1.81), 7.353 (1.81), 8.042 (3.18), 8.063 (2.46), 8.093 (2.49), 8.677 (2.37), 9.646 (1.54).
Example 122 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[6-(morpholin-4-yl)pyridazin-3-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00247
From intermediate 19 and 6-(morpholin-4-yl)pyridazin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.30 min; MS (ESIpos): m/z=567 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.085 (1.31), 1.095 (1.47), 1.117 (2.32), 1.123 (2.56), 1.137 (1.05), 1.147 (2.08), 1.155 (2.37), 1.160 (1.99), 1.168 (0.99), 1.183 (0.93), 1.191 (0.91), 1.259 (1.62), 1.290 (2.08), 1.323 (1.66), 1.409 (15.58), 1.425 (16.00), 1.674 (1.14), 1.704 (1.04), 1.749 (2.09), 1.756 (2.11), 1.781 (3.03), 1.799 (1.96), 1.808 (1.87), 1.831 (1.06), 1.839 (0.99), 1.847 (1.01), 1.925 (1.94), 1.933 (2.50), 1.938 (2.97), 1.948 (3.79), 1.952 (3.95), 1.964 (1.87), 1.968 (1.89), 1.989 (2.19), 2.003 (2.58), 2.009 (2.71), 2.018 (3.20), 2.024 (2.38), 2.034 (1.68), 2.805 (3.84), 2.820 (7.56), 2.837 (4.22), 3.709 (6.23), 3.717 (10.39), 3.720 (10.18), 3.732 (14.91), 3.747 (3.82), 3.882 (8.63), 3.896 (9.39), 3.906 (6.47), 4.405 (1.64), 4.421 (2.51), 4.437 (1.63), 7.006 (0.57), 7.301 (2.87), 7.381 (4.86), 7.395 (4.80), 8.046 (6.81), 8.076 (6.86), 8.737 (3.23), 8.762 (3.05), 11.073 (1.18).
Example 123 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methoxypyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00248
From intermediate 19 and 6-(morpholin-4-yl)pyridazin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.14 min; MS (ESIpos): m/z=511 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.031 (0.48), 1.038 (0.47), 1.067 (0.83), 1.098 (0.74), 1.132 (0.50), 1.163 (0.59), 1.185 (0.91), 1.205 (0.83), 1.213 (0.58), 1.228 (0.66), 1.237 (0.70), 1.245 (0.41), 1.258 (0.53), 1.383 (7.29), 1.399 (7.32), 1.688 (1.41), 1.727 (0.48), 1.747 (0.94), 1.754 (1.09), 1.779 (1.74), 1.803 (1.09), 1.918 (0.84), 1.925 (1.01), 1.930 (1.15), 1.941 (1.29), 1.945 (1.44), 1.957 (1.07), 1.960 (1.06), 1.983 (0.98), 1.988 (1.04), 1.997 (1.42), 2.012 (1.24), 2.017 (1.02), 2.026 (0.74), 2.796 (1.71), 2.812 (3.28), 2.829 (1.90), 3.707 (2.10), 3.722 (3.52), 3.737 (1.52), 4.033 (16.00), 4.392 (0.75), 4.408 (1.10), 4.424 (0.72), 7.390 (2.08), 7.405 (2.06), 8.140 (2.99), 8.169 (2.95), 8.263 (2.87), 8.772 (4.28), 10.731 (1.73).
Example 124 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-methoxypyrimidin-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00249
From intermediate 19 and 2-methoxypyrimidin-5-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.29 min; MS (ESIpos): m/z=512 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.393 (5.54), 1.409 (5.64), 2.801 (1.12), 2.817 (2.12), 2.834 (1.25), 3.712 (1.40), 3.728 (2.35), 3.743 (1.00), 4.045 (16.00), 7.393 (1.42), 7.408 (1.42), 8.121 (2.01), 8.150 (1.97), 8.866 (10.12), 10.079 (1.31).
Example 125 2-[(1S)-1-cyclohexylethoxy]-N-(4,6-dimethoxypyrimidin-5-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00250
From intermediate 19 and 4,6-dimethoxypyrimidin-5-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.2% aqueous ammonia, acetonitrile).
LC-MS (method B): Rt=1.33 min; MS (ESIpos): m/z=541 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.205 (0.43), 1.359 (2.94), 1.375 (2.89), 1.662 (0.91), 1.767 (0.61), 1.792 (0.60), 1.925 (0.45), 1.937 (0.46), 1.940 (0.49), 1.977 (0.43), 1.991 (0.52), 1.997 (0.56), 2.007 (0.67), 2.012 (0.64), 2.018 (0.40), 2.794 (0.66), 2.810 (1.31), 2.825 (0.74), 3.703 (0.83), 3.718 (1.41), 3.733 (0.61), 4.020 (16.00), 4.419 (0.50), 7.360 (0.82), 7.374 (0.83), 8.107 (1.03), 8.136 (1.03), 8.380 (2.30), 9.304 (0.82).
Example 126 2-[(1S)-1-cyclohexylethoxy]-N-(3,5-dimethylpyrazin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00251
From intermediate 19 and 3,5-dimethylpyrazin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.32 min; MS (ESIpos): m/z=510 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.126 (0.59), 1.157 (0.53), 1.181 (0.45), 1.203 (0.77), 1.228 (0.75), 1.234 (0.66), 1.243 (0.52), 1.251 (0.51), 1.260 (0.75), 1.274 (0.41), 1.396 (4.90), 1.412 (4.84), 1.702 (0.48), 1.745 (0.55), 1.770 (0.98), 1.785 (0.74), 1.795 (0.81), 1.908 (0.54), 1.923 (0.84), 1.935 (0.96), 1.947 (0.93), 1.951 (0.98), 1.966 (0.77), 1.987 (0.60), 2.002 (1.07), 2.007 (1.07), 2.018 (0.89), 2.023 (0.70), 2.032 (0.51), 2.565 (16.00), 2.803 (1.09), 2.819 (2.09), 2.836 (1.18), 3.713 (1.36), 3.729 (2.24), 3.744 (0.98), 4.427 (0.52), 4.442 (0.74), 4.457 (0.49), 7.394 (1.34), 7.409 (1.33), 8.122 (1.70), 8.151 (1.71), 8.172 (1.55), 10.087 (1.09).
Example 127 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxypyrazin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00252
From intermediate 19 and 6-methoxypyrazin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.47 min; MS (ESIpos): m/z=511 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.174 (0.85), 1.205 (1.29), 1.232 (1.01), 1.250 (0.49), 1.261 (0.74), 1.405 (6.24), 1.421 (6.21), 1.622 (0.41), 1.692 (0.43), 1.722 (0.42), 1.782 (0.82), 1.805 (0.78), 1.815 (0.79), 1.830 (0.48), 1.839 (0.54), 1.850 (0.55), 1.874 (0.41), 1.925 (0.64), 1.933 (0.75), 1.937 (0.83), 1.948 (0.85), 1.952 (0.91), 1.964 (0.42), 1.968 (0.45), 1.990 (0.47), 2.005 (1.03), 2.010 (1.16), 2.019 (1.17), 2.025 (0.94), 2.035 (0.74), 2.040 (0.60), 2.047 (0.57), 2.803 (1.29), 2.820 (2.44), 2.836 (1.42), 3.714 (1.66), 3.729 (2.70), 3.744 (1.15), 3.953 (16.00), 4.458 (0.57), 4.473 (0.83), 4.489 (0.55), 7.414 (1.62), 7.428 (1.59), 8.043 (3.93), 8.143 (2.27), 8.172 (2.20), 9.260 (3.63), 10.567 (1.22).
Example 128 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methoxypyrazin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00253
From intermediate 19 and 3-methoxypyrazin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.34 min; MS (ESIpos): m/z=512 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.036 (0.79), 1.041 (0.60), 1.049 (0.57), 1.079 (0.89), 1.112 (0.97), 1.135 (0.55), 1.143 (0.58), 1.166 (0.70), 1.192 (1.34), 1.221 (0.88), 1.229 (0.71), 1.252 (0.86), 1.259 (0.80), 1.278 (3.86), 1.296 (0.56), 1.397 (6.33), 1.412 (6.33), 1.682 (0.57), 1.713 (0.66), 1.748 (0.72), 1.756 (0.69), 1.791 (2.14), 1.817 (1.64), 1.903 (0.41), 1.919 (1.04), 1.931 (1.47), 1.946 (1.63), 1.962 (1.17), 1.983 (1.86), 2.002 (2.29), 2.012 (2.41), 2.040 (0.58), 2.798 (1.63), 2.814 (3.19), 2.830 (1.79), 3.710 (1.95), 3.725 (3.34), 3.740 (1.56), 4.091 (16.00), 4.400 (0.78), 4.416 (1.16), 4.431 (0.77), 7.374 (1.89), 7.389 (1.90), 7.837 (1.71), 7.844 (1.91), 8.064 (1.59), 8.071 (1.60), 8.156 (2.14), 8.185 (2.12), 10.658 (1.61).
Example 129 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(6-methoxypyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00254
From intermediate 19 and 6-methoxypyridazin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.40 min; MS (ESIpos): m/z=511 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.149 (0.81), 1.181 (0.83), 1.445 (5.28), 1.461 (5.44), 1.946 (0.73), 1.950 (0.78), 2.002 (0.83), 2.007 (0.87), 2.017 (1.07), 2.023 (0.90), 2.802 (1.11), 2.818 (2.14), 2.834 (1.23), 3.713 (1.43), 3.729 (2.30), 3.744 (1.01), 4.127 (16.00), 4.436 (0.88), 7.036 (1.70), 7.059 (1.69), 7.061 (1.63), 7.387 (1.42), 7.402 (1.42), 8.105 (1.96), 8.135 (1.92), 8.587 (2.83), 8.610 (2.65), 10.991 (1.13).
Example 130 2-[(1S)-1-cyclohexylethoxy]-N-(5,6-dimethylpyrimidin-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00255
From intermediate 19 and 5,6-dimethylpyrimidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.28 min; MS (ESIpos): m/z=509 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.121 (0.74), 1.129 (0.69), 1.152 (1.26), 1.179 (1.50), 1.206 (1.45), 1.212 (1.37), 1.224 (0.79), 1.239 (1.12), 1.247 (1.04), 1.255 (1.08), 1.263 (1.35), 1.271 (1.08), 1.278 (0.96), 1.287 (0.80), 1.294 (0.76), 1.302 (0.67), 1.369 (0.96), 1.385 (1.02), 1.406 (11.40), 1.421 (11.11), 1.681 (0.88), 1.713 (0.91), 1.729 (0.64), 1.737 (0.66), 1.744 (0.66), 1.773 (2.00), 1.798 (2.32), 1.908 (0.46), 1.924 (1.28), 1.936 (1.70), 1.947 (1.79), 1.951 (1.88), 1.967 (1.14), 1.988 (1.42), 2.007 (2.32), 2.017 (2.31), 2.029 (1.16), 2.047 (0.47), 2.238 (16.00), 2.598 (11.14), 2.803 (2.48), 2.812 (1.16), 2.819 (4.69), 2.836 (2.72), 3.713 (3.07), 3.720 (0.91), 3.728 (5.05), 3.743 (2.21), 4.428 (1.08), 4.444 (1.61), 4.459 (1.06), 7.408 (2.90), 7.423 (2.92), 8.093 (4.16), 8.121 (4.04), 8.787 (4.14), 10.250 (1.31).
Example 131 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-methylpyrimidin-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00256
From intermediate 19 and 4-methylpyrimidin-5-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.21 min; MS (ESIpos): m/z=495 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.036 (0.42), 1.068 (0.56), 1.074 (0.56), 1.100 (0.64), 1.123 (0.52), 1.132 (0.68), 1.138 (0.62), 1.145 (0.54), 1.153 (0.63), 1.161 (0.61), 1.183 (0.82), 1.214 (0.85), 1.245 (0.91), 1.254 (0.71), 1.261 (1.29), 1.399 (6.46), 1.414 (6.67), 1.595 (5.20), 1.695 (0.72), 1.715 (0.83), 1.723 (0.94), 1.731 (0.86), 1.740 (0.94), 1.754 (0.86), 1.762 (0.97), 1.776 (1.24), 1.804 (0.62), 1.928 (0.80), 1.941 (1.05), 1.952 (1.19), 1.956 (1.36), 1.968 (0.97), 1.993 (0.94), 1.999 (0.97), 2.007 (1.26), 2.013 (1.16), 2.023 (1.10), 2.028 (0.92), 2.037 (0.67), 2.580 (16.00), 2.809 (1.55), 2.824 (2.90), 2.840 (1.64), 3.102 (0.42), 3.717 (1.93), 3.733 (3.14), 3.748 (1.38), 4.447 (0.69), 4.463 (1.02), 4.479 (0.65), 7.445 (1.85), 7.459 (1.84), 8.139 (2.52), 8.168 (2.48), 8.935 (3.62), 9.325 (2.90), 9.764 (1.57).
Example 132 2-[(1S)-1-cyclohexylethoxy]-N-(2,4-dimethylpyrimidin-5-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00257
From intermediate 19 and 2,4-dimethylpyrimidin-5-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.2% aqueous ammonia, acetonitrile).
LC-MS (method B): Rt=1.23 min; MS (ESIpos): m/z=509 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.060 (0.45), 1.066 (0.45), 1.114 (0.60), 1.142 (0.76), 1.177 (0.77), 1.210 (0.75), 1.217 (0.47), 1.240 (0.71), 1.260 (0.69), 1.388 (6.64), 1.404 (6.66), 1.618 (1.40), 1.688 (0.69), 1.701 (0.68), 1.710 (0.75), 1.717 (0.87), 1.725 (0.80), 1.736 (0.72), 1.749 (0.69), 1.768 (1.15), 1.798 (0.60), 1.925 (0.73), 1.937 (1.02), 1.948 (1.30), 1.952 (1.44), 1.964 (0.77), 1.990 (0.90), 2.004 (1.01), 2.009 (1.01), 2.019 (1.04), 2.024 (0.85), 2.033 (0.62), 2.527 (16.00), 2.725 (12.54), 2.805 (1.47), 2.820 (2.85), 2.836 (1.62), 3.713 (1.89), 3.729 (3.04), 3.744 (1.33), 4.438 (0.67), 4.454 (1.00), 4.470 (0.64), 7.428 (1.78), 7.443 (1.78), 8.131 (2.56), 8.160 (2.52), 9.102 (3.75), 9.689 (1.62).
Example 133 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methylpyrazin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00258
From intermediate 19 and 3-methylpyrazin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.24 min; MS (ESIpos): m/z=495 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.102 (0.63), 1.110 (0.58), 1.133 (1.08), 1.140 (0.90), 1.156 (0.59), 1.164 (1.04), 1.171 (0.94), 1.181 (0.59), 1.194 (0.60), 1.204 (1.17), 1.209 (1.14), 1.218 (0.53), 1.233 (1.23), 1.242 (0.93), 1.249 (0.86), 1.264 (0.90), 1.273 (0.67), 1.281 (0.60), 1.289 (0.49), 1.405 (9.32), 1.421 (9.40), 1.623 (0.60), 1.673 (0.71), 1.706 (0.72), 1.714 (0.61), 1.722 (0.42), 1.730 (0.41), 1.737 (0.50), 1.743 (0.69), 1.760 (1.44), 1.766 (1.62), 1.780 (1.73), 1.789 (1.61), 1.798 (1.24), 1.924 (0.97), 1.932 (1.16), 1.937 (1.31), 1.948 (1.34), 1.952 (1.44), 1.968 (0.90), 1.988 (1.12), 1.994 (0.91), 2.009 (1.88), 2.018 (1.86), 2.033 (0.88), 2.608 (16.00), 2.805 (2.03), 2.820 (3.89), 2.837 (2.21), 3.714 (2.51), 3.730 (4.21), 3.744 (1.81), 4.435 (0.96), 4.450 (1.39), 4.465 (0.92), 7.408 (2.54), 7.423 (2.52), 8.126 (3.34), 8.155 (3.34), 8.298 (1.88), 8.304 (2.07), 8.389 (2.50), 8.395 (2.21), 10.183 (2.08).
Example 134 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methylpyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00259
From intermediate 19 and 5-methylpyrimidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.2% aqueous ammonia, acetonitrile).
LC-MS (method B): Rt=1.22 min; MS (ESIpos): m/z=495 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.110 (0.74), 1.118 (0.66), 1.141 (1.27), 1.148 (0.99), 1.165 (1.10), 1.172 (1.23), 1.188 (1.05), 1.195 (1.14), 1.202 (0.80), 1.217 (0.89), 1.221 (0.90), 1.238 (0.85), 1.245 (0.97), 1.253 (0.88), 1.263 (0.93), 1.270 (0.82), 1.276 (0.71), 1.285 (0.60), 1.294 (0.52), 1.402 (9.98), 1.418 (9.92), 1.700 (2.07), 1.729 (0.56), 1.736 (0.54), 1.764 (1.73), 1.772 (1.75), 1.788 (1.89), 1.911 (0.52), 1.920 (1.08), 1.927 (1.31), 1.932 (1.46), 1.943 (1.49), 1.947 (1.59), 1.963 (0.98), 1.983 (1.28), 2.004 (2.04), 2.014 (2.19), 2.025 (1.01), 2.042 (0.40), 2.313 (16.00), 2.799 (2.16), 2.815 (4.15), 2.831 (2.34), 3.097 (0.64), 3.708 (2.76), 3.723 (4.43), 3.739 (1.96), 4.423 (1.02), 4.438 (1.51), 4.454 (0.98), 7.409 (2.73), 7.424 (2.70), 8.099 (3.71), 8.128 (3.65), 8.562 (4.24), 8.910 (4.80), 10.247 (2.28).
Example 135 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-methylpyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00260
From intermediate 19 and 4-methylpyridazin-3-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.19 min; MS (ESIpos): m/z=495 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.100 (0.44), 1.129 (1.24), 1.158 (1.74), 1.190 (1.61), 1.223 (1.78), 1.227 (1.79), 1.240 (1.27), 1.249 (1.61), 1.263 (2.61), 1.271 (2.03), 1.294 (1.33), 1.302 (1.23), 1.326 (0.48), 1.433 (13.98), 1.448 (13.80), 1.664 (3.93), 1.765 (2.70), 1.800 (3.50), 1.829 (1.51), 1.911 (0.65), 1.926 (1.69), 1.939 (2.22), 1.950 (2.30), 1.953 (2.42), 1.969 (1.17), 1.991 (1.46), 2.005 (3.08), 2.010 (3.13), 2.020 (2.83), 2.026 (2.45), 2.035 (2.34), 2.398 (16.00), 2.807 (3.36), 2.823 (6.46), 2.839 (3.67), 3.717 (4.19), 3.732 (7.02), 3.747 (3.04), 4.440 (1.41), 4.456 (2.03), 4.470 (1.36), 7.006 (0.53), 7.420 (5.35), 7.435 (5.86), 7.529 (0.58), 8.093 (5.55), 8.121 (5.47), 8.971 (2.05), 8.983 (2.01), 10.558 (2.28).
Example 136 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-fluoropyrimidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00261
From intermediate 19 and 5-fluoropyrimidin-4-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.27 min; MS (ESIneg): m/z=497 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.059 (1.01), 1.067 (0.98), 1.088 (1.15), 1.097 (1.31), 1.111 (1.20), 1.119 (1.05), 1.128 (0.99), 1.136 (1.24), 1.142 (1.47), 1.149 (1.34), 1.157 (0.71), 1.173 (1.01), 1.180 (1.48), 1.188 (0.73), 1.204 (0.55), 1.211 (0.91), 1.233 (0.84), 1.240 (0.84), 1.256 (1.15), 1.264 (1.62), 1.271 (1.51), 1.277 (1.29), 1.287 (1.08), 1.295 (1.23), 1.303 (1.12), 1.308 (1.03), 1.316 (0.63), 1.327 (0.40), 1.400 (16.00), 1.415 (15.57), 1.634 (2.45), 1.691 (1.18), 1.722 (1.07), 1.784 (3.55), 1.796 (2.87), 1.803 (2.96), 1.907 (0.59), 1.914 (0.78), 1.922 (1.74), 1.929 (2.09), 1.934 (2.34), 1.946 (2.42), 1.950 (2.61), 1.962 (1.49), 1.966 (1.81), 1.986 (1.79), 1.993 (1.57), 2.002 (3.11), 2.007 (3.37), 2.016 (3.58), 2.022 (2.33), 2.028 (1.53), 2.031 (1.57), 2.045 (0.67), 2.801 (3.70), 2.817 (7.06), 2.834 (4.10), 3.710 (4.73), 3.726 (7.62), 3.741 (3.34), 4.435 (1.55), 4.451 (2.33), 4.467 (1.52), 7.430 (4.52), 7.444 (4.54), 8.145 (6.44), 8.174 (6.34), 8.551 (5.33), 8.558 (5.23), 8.890 (5.58), 8.895 (5.48), 10.794 (2.81).
Example 137 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[3-(morpholin-4-yl)pyrazin-2-yl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00262
From intermediate 19 and 3-(morpholin-4-yl)pyrazin-2-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.27 min; MS (ESIneg): m/z=564 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.016 (0.54), 1.048 (1.86), 1.079 (2.64), 1.109 (2.34), 1.123 (2.56), 1.154 (2.83), 1.180 (2.10), 1.213 (1.21), 1.245 (0.63), 1.261 (0.97), 1.369 (3.14), 1.385 (4.62), 1.390 (15.80), 1.406 (16.00), 1.637 (2.07), 1.667 (2.27), 1.695 (2.32), 1.729 (3.97), 1.737 (4.24), 1.760 (3.18), 1.833 (0.43), 1.912 (2.02), 1.926 (2.99), 1.938 (3.99), 1.950 (4.06), 1.953 (3.87), 1.965 (1.59), 1.991 (1.56), 2.005 (2.95), 2.011 (2.96), 2.021 (3.20), 2.026 (2.57), 2.035 (1.88), 2.049 (0.77), 2.803 (3.99), 2.812 (2.63), 2.819 (7.65), 2.828 (1.57), 2.835 (4.32), 3.273 (0.95), 3.285 (1.46), 3.306 (2.14), 3.319 (2.79), 3.328 (2.15), 3.359 (2.03), 3.368 (2.80), 3.382 (2.35), 3.403 (1.46), 3.414 (1.01), 3.704 (0.96), 3.716 (5.16), 3.731 (8.33), 3.746 (3.55), 3.784 (0.71), 3.792 (1.12), 3.812 (4.20), 3.821 (7.47), 3.826 (6.26), 3.830 (6.33), 3.836 (7.10), 3.845 (3.71), 3.865 (0.89), 3.873 (0.54), 4.354 (0.44), 4.369 (1.73), 4.385 (2.60), 4.400 (1.73), 4.415 (0.45), 4.485 (0.41), 7.006 (0.48), 7.390 (4.67), 7.405 (4.61), 7.449 (0.81), 7.463 (0.79), 7.529 (0.48), 8.014 (1.32), 8.041 (1.08), 8.072 (5.79), 8.079 (8.31), 8.107 (8.60), 8.113 (6.24), 8.156 (6.14), 8.185 (6.20), 10.210 (3.81).
Example 138 2-[(1S)-1-cyclohexylethoxy]-N-(4,6-dimethylpyrimidin-5-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00263
From intermediate 19 and 4,6-dimethylpyrimidin-5-amine.
The product was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.18 min; MS (ESIpos): m/z=509 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.388 (3.64), 1.404 (3.60), 1.588 (0.60), 1.720 (0.64), 1.756 (0.60), 1.930 (0.52), 1.942 (0.79), 1.953 (0.67), 1.957 (0.70), 1.973 (0.52), 2.009 (0.53), 2.014 (0.57), 2.024 (0.58), 2.029 (0.49), 2.506 (16.00), 2.810 (0.81), 2.826 (1.58), 2.843 (0.89), 3.719 (1.03), 3.734 (1.69), 3.750 (0.75), 4.495 (0.55), 7.433 (1.00), 7.447 (0.99), 8.127 (1.39), 8.156 (1.37), 8.909 (2.11), 9.558 (0.93).
Examples 139-147 were prepared in analogy according to the general methods described above.
Example 139 N-(3-amino-2-methylphenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00264
Example 140 N-[4-amino-2-(trifluoromethyl)phenyl]-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00265
Example 141 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-methyl-4-sulfamoylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00266
Example 142 N-[2-(aminomethyl)-6-methylphenyl]-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00267
Example 143 Methyl 2-({2-[(1R)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoyl}amino)-3-methylbenzoate
Figure US11787797-20231017-C00268
Example 144 2-[(1R)-1-cyclohexylethoxy]-N-(2,3-dihydro-1H-isoindol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00269
Example 145 N-(5-amino-3-methylpyridin-2-yl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00270
Example 146 2-({2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoyl}amino)-3-methylbenzoic Acid
Figure US11787797-20231017-C00271
Example 147 tert-butyl 4-({2-[(1S)-1-cyclohexylethoxy]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)benzoyl}amino)-3-methylbenzoate
Figure US11787797-20231017-C00272
Examples 148-179 were prepared as described for example 113 from 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 19) and the respective amines, as indicated. Products were purified by flash column chromatography or, if explicitely mentioned, by preparative HPLC.
Example 148 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00273
From intermediate 19 and 2-fluoroaniline.
MS (ESIpos): m/z=497 (M+H)+
1H NMR (400 MHz, CDCl3) δ [ppm] 0.96-1.21 (m, 3H), 1.21-1.35 (m, 2H), 1.38 (d, 3H), 1.65-1.86 (m, 5H), 1.89-1.97 (m, 2H), 1.97-2.04 (m, 3H), 2.81 (t, 2H), 3.72 (t, 2H), 4.35-4.44 (m, 1H), 7.03-7.21 (m, 3H), 7.36 (d, 1H), 8.16 (d, 1H), 8.61 (td, 1H), 10.4 (s, 1H).
Example 149 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]-triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00274
From intermediate 19 and 2-fluoro-6-methylaniline.
MS (ESIpos): m/z=511 (M+H)+
1H NMR (400 MHz, CDCl3) δ [ppm] 0.97-1.31 (m, 5H), 1.37 (d, 3H), 1.62-1.80 (m, 5H), 1.89-2.05 (m, 5H), 2.31 (s, 3H), 2.81 (t, 2H), 3.72 (t, 2H), 4.38-4.47 (m, 1H), 7.00 (td, 1H), 7.06 (d, 1H), 7.17 (dd, 1H), 7.38 (d, 1H), 8.14 (d, 1H), 9.52 (s, 1H).
Example 150 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[3-(trifluoromethyl)phenyl]benzamide
Figure US11787797-20231017-C00275
From intermediate 19 and 3-(trifluoromethyl)aniline.
MS (ESIpos): m/z=547 (M+H)+
1H NMR (400 MHz, CDCl3) δ [ppm] 1.06-1.36 (m, 5H), 1.40 (d, 3H), 1.68-1.86 (5H, m), 1.88-1.97 (2H, m), 1.97-2.07 (m, 3H), 2.81 (t, 2H), 3.72 (t, 2H), 4.40-4.48 (m, 1H), 7.37-7.41 (m, 2H), 7.49 (t, 1H), 7.88-7.93 (m, 2H), 8.14 (d, 1H), 10.3 (s, 1H).
Example 151 2-[(1S)-1-cyclohexylethoxy]-N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00276
From intermediate 19 and 2,6-difluoroaniline.
MS (ESIpos): m/z=515 (M+H)+
1H NMR (400 MHz, CDCl3) δ [ppm] 0.97-1.33 (m, 5H), 1.38 (d, 3H), 1.64-1.82 (m, 5H), 1.89-1.96 (m, 2H), 1.96-2.05 (m, 3H), 2.81 (t, 2H), 3.71 (t, 2H), 4.38-4.46 (m, 1H), 6.96-7.04 (m, 2H), 7.17-7.25 (m, 1H), 7.39 (d, 1H), 8.14 (d, 1H), 9.63 (s, 1H).
Example 152 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00277
From intermediate 19 and 4-fluoro-2-methylaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.52 min; MS (ESIpos): m/z=511 [M+H]+
Example 153 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(2,4,6-trifluorophenyl)benzamide
Figure US11787797-20231017-C00278
From intermediate 19 and 2,4,6-trifluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.50 min; MS (ESIpos): m/z=533 [M+H]+
Example 154 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00279
From intermediate 19 and 3-fluoro-2-methylaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.55 min; MS (ESIpos): m/z=511 [M+H]+
Example 155 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-[2-(trifluoromethyl)phenyl]benzamide
Figure US11787797-20231017-C00280
From intermediate 19 and 1-methyl-2-(trifluoromethyl)benzene.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.58 min; MS (ESIpos): m/z=547 [M+H]+
Example 156 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methylpyridin-2-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00281
From intermediate 19 and 2,3-dimethylpyridine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.26 min; MS (ESIpos): m/z=494 [M+H]+
Example 157 2-[(1S)-1-cyclohexylethoxy]-N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00282
From intermediate 19 and 1,3-dichloro-2-methylbenzene.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.54 min; MS (ESIpos): m/z=548 [M+H]+
Example 158 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00283
From intermediate 19 and 5-fluoro-2-methylaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.56 min; MS (ESIpos): m/z=511 [M+H]+
Example 159 2-[(1S)-1-cyclohexylethoxy]-N-(2,4-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00284
From intermediate 19 and 2,4-difluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.60 min; MS (ESIpos): m/z=515 [M+H]+
Example 160 2-[(1S)-1-cyclohexylethoxy]-N-[2-(dimethylamino)ethyl]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00285
From intermediate 19 and N,N-dimethylethane-1,2-diamine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.86 min; MS (ESIpos): m/z=474 [M+H]+
Example 161 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-fluoro-6-(trifluoromethyl) phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00286
From intermediate 19 and 2-fluoro-6-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.53 min; MS (ESIpos): m/z=565 [M+H]+
Example 162 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(1-methyl-1H-pyrazol-5-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00287
From intermediate 19 and 1-methyl-1H-pyrazol-5-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.24 min; MS (ESIpos): m/z=483 [M+H]+
Example 163 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(tetrahydro-2H-pyran-4-yl)benzamide
Figure US11787797-20231017-C00288
From intermediate 19 and tetrahydro-2H-pyran-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.27 min; MS (ESIpos): m/z=487 [M+H]+
Example 164 N-(2-cyano-4-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00289
From intermediate 19 and 2-amino-5-fluorobenzonitrile.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.49 min; MS (ESIpos): m/z=522 [M+H]+
Example 165 N-(2-chloro-5-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00290
From intermediate 19 and 2-chloro-5-fluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.67 min; MS (ESIpos): m/z=532 [M+H]+
Example 166 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00291
From intermediate 19 and 4-methylpyridin-3-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.08 min; MS (ESIpos): m/z=494 [M+H]+
Example 167 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methyl-5-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triaolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00292
From intermediate 19 and 2-methyl-5-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.62 min; MS (ESIpos): m/z=561 [M+H]+
Example 168 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(3-methylpyridin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00293
From intermediate 19 and 3-methylpyridin-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.96 min; MS (ESIpos): m/z=494 [M+H]+
Example 169 N-(2-chloro-6-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00294
From intermediate 19 and 2-chloro-6-fluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.51 min; MS (ESIpos): m/z=532 [M+H]+
Example 170 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methyl-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00295
From intermediate 19 and 2-methyl-3-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.62 min; MS (ESIpos): m/z=561 [M+H]+
Example 171 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-methyl-4-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00296
From intermediate 19 and 2-methyl-4-(trifluoromethyl)aniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.64 min; MS (ESIpos): m/z=561 [M+H]+
Example 172 N-(2-chloro-3-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00297
From intermediate 19 and 2-chloro-3-fluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.64 min; MS (ESIpos): m/z=532 [M+H]+
Example 173 2-[(1S)-1-cyclohexylethoxy]-N-(1,3-dimethyl-1H-pyrazol-4-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00298
From intermediate 19 and 1,3-dimethyl-1H-pyrazol-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.25 min; MS (ESIpos): m/z=497 [M+H]+
Example 174 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(1-methylpiperidin-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00299
From intermediate 19 and 1-methylpiperidin-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=0.85 min; MS (ESIpos): m/z=500 [M+H]+
Example 175 2-[(1S)-1-cyclohexylethoxy]-N-(1,4-dimethyl-1H-pyrazol-3-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00300
From intermediate 19 and 1,4-dimethyl-1H-pyrazol-3-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.29 min; MS (ESIpos): m/z=497 [M+H]+
Example 176 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(2-hydroxy-2-methylpropyl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00301
From intermediate 19 and 1-amino-2-methylpropan-2-ol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.21 min; MS (ESIpos): m/z=475 [M+H]+
Example 177 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-[2-(hydroxymethyl)-3-(trifluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00302
From intermediate 19 and [2-amino-6-(trifluoromethyl)phenyl]methanol.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.45 min; MS (ESIpos): m/z=577 [M+H]+
Example 178 2-[(1S)-1-cyclohexylethoxy]-5-fluoro-N-(5-methyl-1,2-oxazol-4-yl)-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00303
From intermediate 19 and 5-methyl-1,2-oxazol-4-amine.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.33 min; MS (ESIpos): m/z=484 [M+H]+
Example 179 N-(2-chloro-4-fluorophenyl)-2-[(1S)-1-cyclohexylethoxy]-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00304
From intermediate 19 and 2-chloro-4-fluoroaniline.
The product was purified by preparative HPLC (YMC Actus Triart C18 100×30 mm 5 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method C): Rt=1.64 min; MS (ESIpos): m/z=532 [M+H]+
Example 180 N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00305
To a 0° C. stirred solution of 5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 24) (74.3 mg, 190 μmol) and DMF (3 drops) in anhydrous dichloromethane (0.95 ml) was added oxalyl chloride dropwise (28.9 mg, 0.23 mmol). The resulting mixture was warmed to room temperature, stirred for one hour and concentrated under reduced pressure. A solution of the crude acid chloride in dichloromethane (0.63 ml) was then added dropwise to a 0° C. stirred solution of 2-chloro-6-fluoraniline (30.4 mg, 0.21 mmol) and triethylamine (21.1 mg, 0.21 mmol) in dichloromethane (0.70 ml). Following complete addition, the mixture was warmed to room temperature and stirred for one hour. Aqueous hydrochloric acid (1.0 M, 10 ml) was added to the residue and extracted with dichloromethane (3×10 ml). The combined organic extracts were washed with brine (10 ml), dried over magnesium sulfate, filtered and concentrated under reduced pressure to give a pale yellow oil. The residue was purified by reverse phase column chromatography (acetonitrile, 0.1% aqueous formic acid) to give the amide as a white solid (73.3 mg, 66%).
LC-MS (method A): Rt=1.18 min; MS (ESIpos): m/z=519 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.572 (8.35), 1.659 (7.01), 1.676 (7.05), 3.807 (2.84), 3.820 (4.22), 3.834 (3.51), 4.086 (3.74), 4.098 (3.02), 4.100 (4.34), 4.113 (2.89), 4.772 (16.00), 4.911 (0.46), 4.927 (1.09), 4.942 (1.41), 4.958 (1.09), 4.973 (0.42), 7.112 (0.89), 7.116 (0.94), 7.133 (1.48), 7.136 (1.96), 7.140 (1.10), 7.155 (1.20), 7.159 (1.25), 7.222 (0.85), 7.235 (0.84), 7.242 (1.98), 7.256 (2.11), 7.263 (2.04), 7.285 (2.13), 7.290 (2.75), 7.305 (0.88), 7.309 (1.07), 7.312 (0.89), 7.463 (2.95), 7.477 (2.96), 8.182 (3.04), 8.212 (3.06), 9.021 (2.04).
Examples 181-243 were prepared in analogy to example 180 from the respective carboxylic acids and the respective amines, as indicated. Products were purified by flash column chromatography or, if explicitely mentioned, by preparative HPLC.
Example 181 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00306
From Intermediate 24 and 6-methoxy-4-methylpyridin-3-amine.
LC-MS (method A): Rt=1.07 min; MS (ESIpos): m/z=512 [M−H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.589 (0.76), 1.647 (4.45), 1.663 (4.41), 2.019 (0.46), 2.266 (9.79), 3.806 (1.68), 3.819 (2.50), 3.833 (2.13), 3.949 (16.00), 4.086 (2.25), 4.097 (1.77), 4.101 (2.57), 4.114 (1.78), 4.770 (9.83), 4.889 (0.68), 4.905 (0.87), 4.920 (0.65), 6.676 (2.54), 7.439 (1.87), 7.454 (1.85), 8.146 (2.51), 8.174 (2.44), 8.343 (3.08), 8.868 (1.38).
Example 182 5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00307
From Intermediate 24 and 4-methylpyridin-3-amine.
The product was purified by preparative HPLC (Chromatorex C18 125×30 mm 10 μm, 0.1% aqueous ammonia, acetonitrile).
LC-MS (method B): Rt=0.96 min; MS (ESIneg): m/z=480 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.076 (2.64), 1.094 (2.55), 1.435 (6.35), 1.451 (6.32), 1.996 (1.77), 2.085 (0.54), 2.280 (16.00), 2.331 (0.50), 2.518 (3.12), 2.523 (2.07), 2.674 (0.48), 2.950 (5.52), 3.670 (2.13), 3.683 (3.60), 3.697 (2.44), 4.032 (2.62), 4.046 (3.73), 4.058 (2.18), 4.754 (10.85), 5.311 (0.41), 5.327 (1.01), 5.343 (1.28), 5.359 (0.94), 7.312 (2.44), 7.324 (2.48), 7.571 (2.59), 7.585 (2.57), 7.686 (3.14), 7.698 (0.80), 7.711 (3.14), 8.304 (3.42), 8.316 (3.37), 8.572 (5.57), 10.014 (3.83).
Example 183 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00308
From Intermediate 24 and 2,6-difluoroaniline.
The product was purified by preparative HPLC (Chromatorex C18 125×30 mm 10 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.13 min; MS (ESIpos): m/z=503 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.432 (8.16), 1.448 (8.08), 2.084 (16.00), 2.327 (0.50), 2.523 (1.83), 2.531 (0.50), 2.669 (0.47), 3.668 (3.16), 3.681 (5.53), 3.695 (3.55), 4.029 (3.95), 4.043 (5.85), 4.056 (3.34), 4.752 (14.13), 5.265 (0.57), 5.280 (1.33), 5.296 (1.72), 5.312 (1.27), 5.328 (0.52), 7.191 (2.47), 7.212 (5.08), 7.232 (3.16), 7.372 (0.57), 7.388 (1.25), 7.409 (1.77), 7.425 (0.97), 7.430 (0.96), 7.446 (0.41), 7.573 (3.33), 7.584 (5.08), 7.608 (3.29), 10.008 (3.86).
Example 184 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00309
From Intermediate 24 and 2-fluoro-6-methylaniline.
The product was purified by preparative HPLC (Chromatorex C18 125×30 mm 10 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.16 min; MS (ESIpos): m/z=499 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.431 (7.00), 1.447 (7.01), 2.085 (5.21), 2.272 (16.00), 2.518 (2.28), 2.523 (1.65), 3.669 (2.26), 3.682 (3.84), 3.696 (2.61), 4.031 (2.78), 4.045 (4.01), 4.058 (2.37), 4.753 (12.11), 5.307 (0.44), 5.323 (1.10), 5.339 (1.43), 5.356 (1.02), 5.759 (1.00), 7.100 (0.91), 7.117 (2.32), 7.121 (2.26), 7.134 (2.50), 7.143 (1.39), 7.227 (1.08), 7.241 (1.18), 7.247 (1.56), 7.261 (1.20), 7.266 (0.77), 7.281 (0.63), 7.566 (6.67), 7.580 (3.00), 7.590 (3.68), 9.828 (4.20).
Example 185 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00310
From Intermediate 24 and o-toluidine.
LC-MS (method A): Rt=1.21 min; MS (ESIpos): m/z=481 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.201 (8.19), 1.218 (16.00), 1.235 (8.73), 1.580 (1.03), 1.629 (0.64), 1.645 (0.64), 2.321 (1.57), 3.461 (2.72), 3.479 (8.01), 3.496 (7.46), 3.514 (2.60), 4.100 (0.40), 4.770 (1.47).
Example 186 N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00311
From Intermediate 24 and 2,6-dichloroaniline.
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=535 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.512 (12.67), 1.524 (12.83), 3.655 (5.00), 3.664 (8.25), 3.674 (5.40), 3.934 (5.57), 3.944 (8.21), 3.954 (4.80), 4.616 (16.00), 4.783 (1.04), 4.795 (2.13), 4.807 (2.67), 4.819 (2.06), 4.830 (0.98), 7.065 (2.09), 7.081 (4.28), 7.097 (2.87), 7.121 (4.39), 7.312 (4.64), 7.322 (4.44), 8.032 (3.80), 8.055 (3.79), 8.922 (5.01).
Example 187 N-(2-chloro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00312
From Intermediate 24 and 2-chloro-6-methylaniline.
LC-MS (method A): Rt=1.23 min; MS (ESIpos): m/z=515 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.735 (6.96), 1.749 (7.00), 2.080 (0.70), 2.396 (16.00), 3.870 (2.70), 3.880 (4.17), 3.891 (3.27), 4.149 (3.28), 4.160 (4.25), 4.170 (2.78), 4.833 (12.96), 5.011 (0.46), 5.023 (1.08), 5.036 (1.39), 5.048 (1.03), 5.061 (0.42), 7.239 (0.98), 7.255 (3.10), 7.279 (2.25), 7.281 (2.64), 7.294 (0.96), 7.353 (1.66), 7.395 (1.85), 7.398 (1.84), 7.410 (1.51), 7.413 (1.45), 7.520 (2.83), 7.531 (2.84), 8.240 (3.29), 8.263 (3.33), 9.058 (2.51).
Example 188 N-(2-chloro-4-fluoro-6-methylphenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00313
From Intermediate 24 and 2-chloro-4-fluoro-6-methylaniline.
LC-MS (method A): Rt=1.25 min; MS (ESIneg): m/z=531 [M−H]−
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.657 (7.02), 1.670 (7.36), 2.010 (0.44), 2.306 (16.00), 3.801 (2.85), 3.811 (4.07), 3.822 (3.42), 4.081 (3.56), 4.092 (4.15), 4.103 (2.90), 4.762 (14.32), 4.926 (0.45), 4.939 (1.06), 4.951 (1.36), 4.963 (1.00), 4.975 (0.40), 6.935 (1.25), 6.941 (1.36), 6.953 (1.27), 6.959 (1.34), 7.073 (1.50), 7.078 (1.42), 7.089 (1.51), 7.094 (1.37), 7.440 (2.95), 7.452 (2.90), 8.149 (3.65), 8.171 (3.51), 8.874 (2.19).
Example 189 N-(2-chloro-4,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00314
From Intermediate 24 and 2-chloro-4,6-difluoroaniline.
LC-MS (method A): Rt=1.23 min; MS (ESIpos): m/z=537 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.618 (2.57), 1.654 (7.69), 1.667 (7.60), 3.804 (3.07), 3.814 (4.58), 3.825 (3.69), 4.085 (3.92), 4.096 (4.65), 4.106 (3.17), 4.766 (16.00), 4.914 (0.54), 4.927 (1.14), 4.939 (1.44), 4.951 (1.08), 4.963 (0.43), 6.895 (0.93), 6.901 (1.02), 6.914 (1.29), 6.918 (1.37), 6.931 (0.95), 6.937 (0.98), 7.072 (1.14), 7.077 (1.47), 7.081 (1.21), 7.088 (1.21), 7.093 (1.46), 7.097 (1.10), 7.464 (3.02), 7.475 (2.99), 8.161 (3.32), 8.183 (3.26), 8.913 (2.62).
Example 190 5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00315
From Intermediate 24 and 4-fluoro-2-methylaniline.
LC-MS (method A): Rt=1.18 min; MS (ESIpos): m/z=499 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.047 (0.59), 1.466 (7.05), 1.480 (7.07), 1.526 (0.70), 2.131 (16.00), 3.632 (2.72), 3.642 (4.20), 3.653 (3.23), 3.913 (3.33), 3.925 (4.31), 3.935 (2.80), 4.593 (12.98), 4.714 (0.47), 4.727 (1.11), 4.739 (1.47), 4.751 (1.06), 4.764 (0.44), 6.764 (0.54), 6.770 (0.95), 6.786 (3.95), 6.803 (3.10), 7.106 (2.57), 7.281 (2.79), 7.559 (1.06), 7.570 (1.34), 7.576 (1.12), 7.586 (1.18), 7.973 (3.21), 7.996 (3.20), 8.784 (2.24).
Example 191 5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00316
From Intermediate 24 and 5-fluoro-2-methylaniline.
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=499 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.625 (7.46), 1.638 (7.49), 1.667 (0.69), 2.010 (0.50), 2.276 (14.37), 3.798 (3.15), 3.808 (4.50), 3.819 (3.76), 4.080 (4.03), 4.089 (3.35), 4.091 (4.61), 4.101 (3.31), 4.759 (16.00), 4.869 (0.51), 4.882 (1.19), 4.893 (1.52), 4.906 (1.20), 4.919 (0.46), 6.807 (0.90), 6.812 (0.98), 6.824 (1.76), 6.829 (1.83), 6.840 (1.01), 6.846 (1.01), 7.150 (1.37), 7.163 (1.53), 7.166 (1.44), 7.179 (1.23), 7.456 (3.10), 7.467 (3.06), 7.875 (1.63), 7.880 (1.66), 7.896 (1.67), 7.901 (1.61), 8.125 (3.49), 8.147 (3.56), 9.049 (2.13).
Example 192 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00317
From Intermediate 24 and 2-methyl-6-(trifluoromethyl)aniline.
LC-MS (method A): Rt=1.18 min; MS (ESIpos): m/z=549 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.640 (2.42), 1.651 (2.43), 1.672 (2.39), 2.200 (8.34), 2.325 (16.00), 3.800 (2.97), 3.811 (4.44), 3.821 (3.63), 4.078 (3.97), 4.089 (4.62), 4.099 (3.28), 4.140 (0.55), 4.761 (15.84), 4.929 (0.48), 4.941 (1.13), 4.953 (1.45), 4.965 (1.08), 4.977 (0.43), 6.698 (0.49), 6.713 (1.00), 6.729 (0.54), 7.201 (0.80), 7.215 (0.75), 7.318 (0.83), 7.334 (0.84), 7.341 (1.05), 7.356 (2.33), 7.371 (1.40), 7.440 (3.15), 7.450 (3.08), 7.511 (2.01), 7.526 (1.66), 7.554 (2.01), 7.570 (1.73), 8.168 (0.75), 8.190 (0.74).
Example 193 N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00318
From Intermediate 24 and 2-(difluoromethyl)aniline.
LC-MS (method A): Rt=1.20 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.633 (7.89), 1.647 (8.28), 2.620 (0.41), 3.801 (3.22), 3.811 (4.97), 3.821 (3.82), 4.080 (4.09), 4.091 (5.05), 4.101 (3.38), 4.761 (16.00), 4.858 (0.51), 4.870 (1.18), 4.883 (1.54), 4.895 (1.15), 4.908 (0.53), 6.640 (1.65), 6.750 (3.26), 6.861 (1.55), 7.308 (1.06), 7.324 (2.31), 7.339 (1.36), 7.455 (3.09), 7.466 (3.04), 7.533 (1.06), 7.549 (4.62), 7.564 (3.35), 7.933 (2.12), 7.949 (1.94), 8.113 (3.35), 8.135 (3.35), 9.379 (2.25).
Example 194 N-(2-chloro-3,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00319
From Intermediate 24 and 2-chloro-3,6-difluoroaniline.
LC-MS (method A): Rt=1.21 min; MS (ESIpos): m/z=535 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.618 (2.41), 1.664 (7.49), 1.677 (7.43), 2.622 (0.78), 3.805 (3.02), 3.816 (4.41), 3.826 (3.63), 4.086 (3.90), 4.094 (3.26), 4.097 (4.53), 4.107 (3.15), 4.768 (16.00), 4.927 (0.48), 4.939 (1.13), 4.951 (1.43), 4.964 (1.07), 4.976 (0.43), 7.094 (0.41), 7.102 (2.02), 7.107 (1.94), 7.112 (1.96), 7.118 (3.90), 7.121 (1.79), 7.128 (2.15), 7.132 (1.88), 7.477 (3.19), 7.488 (3.08), 8.173 (3.34), 8.196 (3.27), 9.064 (2.29).
Example 195 5-fluoro-N-(3-fluoro-2-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00320
From Intermediate 24 and 3-fluoro-2-methylaniline.
LC-MS (method A): Rt=1.24 min; MS (ESIpos): m/z=499 [M+H]+
1H-NMR (500 MHz, CHLOROFORM-d) δ [ppm]: 1.454 (7.49), 1.467 (7.52), 1.824 (1.58), 2.035 (10.57), 2.039 (10.63), 3.611 (3.16), 3.621 (4.59), 3.632 (3.81), 3.893 (4.07), 3.905 (4.72), 3.915 (3.36), 4.573 (16.00), 4.706 (0.51), 4.718 (1.22), 4.730 (1.51), 4.743 (1.13), 4.756 (0.45), 6.730 (1.14), 6.747 (2.23), 6.765 (1.26), 7.009 (0.75), 7.025 (1.51), 7.038 (1.52), 7.054 (0.71), 7.094 (2.16), 7.281 (3.07), 7.493 (2.38), 7.510 (2.19), 7.954 (3.66), 7.977 (3.54), 8.894 (2.40).
Example 196 5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-N-(2,4,6-trifluoro-phenyl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00321
From Intermediate 24 and 2,4,6-trifluoroaniline.
LC-MS (method A): Rt=1.18 min; MS (ESIpos): m/z=519 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.645 (7.52), 1.661 (7.40), 2.016 (3.38), 3.801 (2.97), 3.814 (4.46), 3.817 (3.24), 3.827 (3.72), 4.082 (3.87), 4.093 (3.20), 4.096 (4.54), 4.109 (3.09), 4.766 (16.00), 4.881 (0.48), 4.896 (1.12), 4.912 (1.44), 4.927 (1.08), 4.943 (0.45), 6.772 (1.14), 6.777 (2.61), 6.785 (0.48), 6.796 (3.50), 6.798 (3.48), 6.810 (0.51), 6.817 (2.76), 6.822 (1.13), 7.459 (3.11), 7.473 (3.08), 8.140 (3.54), 8.169 (3.53), 8.846 (2.50).
Example 197 N-(2,6-dichloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00322
From Intermediate 24 and 2,6-dichloro-4-fluoroaniline.
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=553 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.578 (16.00), 1.660 (6.41), 1.676 (6.62), 3.807 (2.38), 3.820 (3.89), 3.834 (3.08), 4.087 (3.02), 4.101 (4.08), 4.114 (2.58), 4.771 (12.23), 4.923 (0.42), 4.939 (1.02), 4.955 (1.35), 4.969 (1.01), 4.985 (0.43), 7.202 (6.80), 7.221 (6.95), 7.462 (2.56), 7.476 (2.59), 8.168 (2.91), 8.196 (2.92), 8.971 (2.37).
Example 198 N-(4,5-difluoro-2-methylphenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00323
From Intermediate 24 and 4,5-difluoro-2-methylaniline.
LC-MS (method A): Rt=1.27 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.629 (7.16), 1.644 (11.48), 2.259 (13.55), 3.798 (2.87), 3.811 (4.36), 3.825 (3.59), 4.081 (3.82), 4.092 (3.22), 4.095 (4.45), 4.108 (3.06), 4.761 (16.00), 4.870 (0.52), 4.886 (1.19), 4.901 (1.54), 4.917 (1.13), 4.932 (0.46), 7.005 (1.22), 7.026 (1.35), 7.032 (1.35), 7.053 (1.21), 7.452 (3.11), 7.467 (3.07), 7.854 (1.50), 7.873 (1.58), 7.884 (1.57), 7.904 (1.51), 8.122 (3.76), 8.151 (3.76), 8.984 (2.18).
Example 199 5-fluoro-N-[2-methyl-4-(trifluoromethyl)phenyl]-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00324
From Intermediate 24 and 2-methyl-4-(trifluoromethyl)aniline.
LC-MS (method A): Rt=1.37 min; MS (ESIpos): m/z=549 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.615 (5.42), 1.636 (6.64), 1.651 (6.69), 2.375 (16.00), 3.805 (2.71), 3.818 (4.12), 3.820 (3.03), 3.832 (3.51), 4.086 (3.71), 4.097 (2.93), 4.100 (4.26), 4.112 (2.98), 4.768 (15.76), 4.877 (0.45), 4.893 (1.09), 4.908 (1.42), 4.924 (1.05), 4.939 (0.43), 7.474 (2.92), 7.488 (3.03), 7.501 (2.85), 7.516 (1.45), 7.537 (1.39), 8.140 (3.29), 8.169 (3.27), 8.183 (2.01), 8.204 (1.84), 9.144 (2.03).
Example 200 N-(2-chloro-5-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00325
From Intermediate 24 and 2-chloro-5-fluoroaniline.
LC-MS (method A): Rt=1.36 min; MS (ESIneg): m/z=517 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.632 (3.35), 1.656 (7.36), 1.672 (7.40), 3.801 (2.95), 3.814 (4.44), 3.817 (3.14), 3.827 (3.70), 4.081 (3.86), 4.091 (3.09), 4.095 (4.58), 4.107 (3.19), 4.763 (16.00), 4.850 (0.51), 4.865 (1.20), 4.881 (1.57), 4.897 (1.15), 4.912 (0.47), 6.804 (1.19), 6.812 (1.31), 6.822 (1.26), 6.826 (1.41), 6.830 (1.42), 6.834 (1.47), 6.845 (1.29), 6.852 (1.38), 7.351 (2.42), 7.365 (2.43), 7.373 (2.34), 7.387 (2.22), 7.482 (3.21), 7.496 (3.23), 8.091 (4.10), 8.120 (4.07), 8.418 (2.00), 8.425 (2.01), 8.445 (2.02), 8.452 (1.99), 9.751 (1.99).
Example 201 5-fluoro-N-(4-fluoro-2,6-dimethylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00326
From Intermediate 24 and 4-fluoro-2,6-dimethylaniline.
LC-MS (method A): Rt=1.23 min; MS (ESIpos): m/z=513 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.644 (3.44), 1.660 (3.50), 2.248 (16.00), 3.793 (1.21), 3.805 (1.97), 3.819 (1.50), 4.074 (1.59), 4.088 (2.05), 4.101 (1.29), 4.758 (6.48), 4.933 (0.56), 4.948 (0.73), 4.964 (0.54), 6.825 (2.24), 6.848 (2.24), 7.419 (1.51), 7.433 (1.52), 8.140 (1.58), 8.169 (1.56), 8.637 (1.09).
Example 202 N-(2-chloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00327
From Intermediate 24 and 2-chloro-4-fluoroaniline.
LC-MS (method A): Rt=1.32 min; MS (ESIneg): m/z=517 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.842 (0.76), 0.849 (0.72), 1.261 (0.69), 1.293 (0.67), 1.584 (12.78), 1.655 (6.46), 1.672 (6.45), 3.807 (2.75), 3.819 (4.01), 3.822 (2.89), 3.833 (3.56), 4.085 (3.77), 4.096 (2.90), 4.099 (4.19), 4.112 (2.96), 4.768 (16.00), 4.860 (0.46), 4.876 (1.05), 4.891 (1.39), 4.907 (1.02), 4.922 (0.41), 7.042 (0.89), 7.049 (1.02), 7.062 (0.99), 7.065 (1.07), 7.069 (1.16), 7.072 (1.17), 7.084 (0.93), 7.092 (1.04), 7.179 (2.51), 7.186 (2.21), 7.200 (2.56), 7.207 (2.28), 7.468 (2.86), 7.481 (2.83), 8.117 (3.64), 8.147 (3.54), 8.451 (1.95), 8.464 (1.94), 8.473 (1.90), 8.488 (1.84), 9.605 (1.93).
Example 203 N-(2-cyano-4-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00328
From Intermediate 24 and 2-amino-5-fluorobenzonitrile.
LC-MS (method A): Rt=1.17 min; MS (ESIpos): m/z=510 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.610 (1.66), 1.755 (6.55), 1.772 (6.62), 2.016 (0.58), 3.803 (2.77), 3.816 (4.06), 3.819 (2.87), 3.830 (3.45), 4.084 (3.72), 4.095 (2.95), 4.098 (4.20), 4.110 (2.94), 4.767 (16.00), 4.860 (0.45), 4.876 (1.05), 4.891 (1.37), 4.907 (1.00), 4.922 (0.40), 7.341 (1.11), 7.348 (2.45), 7.352 (1.88), 7.360 (1.44), 7.367 (2.47), 7.371 (1.91), 7.374 (1.49), 7.381 (0.88), 7.393 (1.19), 7.401 (0.78), 7.480 (3.06), 7.494 (3.09), 8.101 (3.86), 8.129 (3.83), 8.423 (1.38), 8.435 (1.41), 8.445 (1.35), 8.457 (1.34), 9.741 (2.16).
Example 204 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00329
From Intermediate 24 and 2-methoxy-4-methylpyridin-3-amine.
LC-MS (method A): Rt=1.10 min; MS (ESIneg): m/z=510 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.656 (3.88), 1.672 (3.93), 2.010 (1.01), 2.273 (10.82), 3.798 (1.46), 3.811 (2.26), 3.825 (1.82), 3.956 (16.00), 4.077 (1.92), 4.088 (1.73), 4.091 (2.33), 4.104 (1.52), 4.762 (7.99), 4.913 (0.63), 4.928 (0.82), 4.943 (0.61), 6.824 (1.63), 6.837 (1.66), 7.426 (1.68), 7.440 (1.69), 7.953 (2.05), 7.967 (2.04), 8.135 (2.05), 8.163 (2.06), 8.960 (1.38).
Example 205 N-(4-chloro-2-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00330
From Intermediate 24 and 4-chloro-2-methylpyridin-3-amine.
LC-MS (method A): Rt=0.99 min; MS (ESIpos): m/z=516 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.675 (5.82), 1.691 (5.88), 2.017 (0.50), 2.574 (16.00), 2.719 (0.49), 3.810 (2.35), 3.823 (3.44), 3.826 (2.47), 3.837 (3.00), 4.090 (3.16), 4.100 (2.50), 4.103 (3.53), 4.117 (2.49), 4.774 (13.95), 4.957 (0.91), 4.972 (1.18), 4.988 (0.85), 7.321 (2.24), 7.334 (2.29), 7.472 (2.56), 7.486 (2.55), 8.091 (0.59), 8.172 (3.42), 8.201 (3.38), 8.379 (2.74), 8.392 (2.66), 9.046 (2.06).
Example 206 N-(2-chloro-4-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00331
From Intermediate 24 and 2-chloro-4-methylpyridin-3-amine.
LC-MS (method A): Rt=1.04 min; MS (ESIpos): m/z=516 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.681 (5.98), 1.696 (5.99), 2.013 (2.42), 2.346 (16.00), 3.805 (2.42), 3.817 (3.57), 3.820 (2.60), 3.831 (3.03), 4.084 (3.25), 4.095 (2.62), 4.098 (3.63), 4.111 (2.57), 4.768 (13.88), 4.958 (0.94), 4.973 (1.22), 4.988 (0.88), 7.194 (2.25), 7.206 (2.29), 7.468 (2.62), 7.481 (2.60), 8.036 (0.44), 8.156 (3.46), 8.184 (3.45), 8.212 (3.12), 8.224 (3.06), 9.121 (2.17).
Example 207 N-(2-chloro-4,6-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00332
From Intermediate 24 and 2-chloro-4,6-dimethylpyridin-3-amine.
LC-MS (method A): Rt=1.11 min; MS (ESIneg): m/z=528 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.667 (6.25), 1.683 (6.32), 2.008 (0.54), 2.290 (16.00), 2.514 (15.66), 3.796 (2.39), 3.809 (3.70), 3.823 (2.98), 4.077 (3.06), 4.088 (2.77), 4.091 (3.77), 4.104 (2.50), 4.761 (13.11), 4.927 (0.41), 4.943 (0.99), 4.958 (1.26), 4.974 (0.93), 7.048 (4.33), 7.451 (2.66), 7.465 (2.64), 8.144 (3.40), 8.172 (3.39), 9.017 (2.45).
Example 208 N-(2,4-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00333
From Intermediate 24 and 2,4-dimethylpyridin-3-amine.
LC-MS (method A): Rt=0.73 min; MS (ESIpos): m/z=496 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.671 (6.70), 1.687 (6.81), 1.795 (0.64), 2.295 (15.58), 2.533 (16.00), 3.812 (2.68), 3.824 (3.93), 3.827 (2.79), 3.838 (3.35), 4.092 (3.56), 4.103 (2.85), 4.106 (4.01), 4.119 (2.85), 4.776 (15.04), 4.939 (0.44), 4.955 (1.03), 4.970 (1.36), 4.985 (0.98), 5.001 (0.40), 7.115 (1.84), 7.128 (1.88), 7.454 (2.90), 7.468 (2.89), 8.172 (3.93), 8.200 (3.86), 8.345 (2.84), 8.358 (2.77), 8.839 (2.13).
Example 209 5-fluoro-N-(2-methoxy-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00334
From Intermediate 24 and 2-methoxy-6-methylaniline.
LC-MS (method A): Rt=1.19 min; MS (ESIpos): m/z=511 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.637 (4.76), 1.653 (4.83), 2.283 (11.55), 3.798 (1.85), 3.812 (3.58), 3.818 (16.00), 3.824 (2.91), 4.076 (2.24), 4.090 (2.88), 4.103 (1.82), 4.762 (8.99), 4.900 (0.77), 4.915 (1.01), 4.931 (0.75), 6.793 (1.33), 6.813 (1.47), 6.887 (1.31), 6.906 (1.49), 7.164 (1.31), 7.184 (2.04), 7.204 (1.03), 7.407 (2.00), 7.421 (2.00), 8.150 (2.41), 8.179 (2.39), 8.871 (1.60).
Example 210 N-(6-chloro-2,3-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00335
From Intermediate 24 and 6-chloro-2,3-difluoroaniline.
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=537 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.566 (16.00), 1.666 (4.53), 1.682 (4.58), 3.808 (1.78), 3.821 (2.75), 3.835 (2.22), 4.088 (2.30), 4.103 (2.82), 4.116 (1.84), 4.774 (9.28), 4.938 (0.72), 4.953 (0.94), 4.969 (0.71), 7.090 (0.45), 7.113 (1.12), 7.133 (1.16), 7.136 (0.85), 7.155 (0.72), 7.218 (0.76), 7.224 (0.79), 7.230 (0.92), 7.236 (0.85), 7.241 (0.66), 7.247 (0.65), 7.253 (0.72), 7.259 (0.81), 7.481 (1.90), 7.495 (1.91), 8.183 (2.21), 8.212 (2.18), 9.079 (1.53).
Example 211 5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c]-[1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00336
From Intermediate 21 and 6-methoxy-4-methylpyridin-3-amine.
The product was purified by preparative HPLC (Chromatorex C18 125×30 mm 10 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.20 min; MS (ESIneg): m/z=484 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.858 (2.70), 0.876 (6.35), 0.894 (3.04), 1.292 (5.45), 1.306 (5.50), 1.371 (0.52), 1.390 (0.57), 1.404 (0.61), 1.423 (0.47), 1.428 (0.44), 1.447 (0.45), 1.582 (0.41), 1.597 (0.55), 1.621 (0.43), 1.693 (0.41), 1.709 (0.41), 2.210 (0.59), 2.250 (9.42), 2.518 (1.10), 2.522 (0.71), 3.659 (1.35), 3.672 (2.28), 3.686 (1.59), 3.835 (16.00), 3.866 (1.04), 4.022 (1.70), 4.036 (2.38), 4.048 (1.42), 4.560 (0.41), 4.575 (0.77), 4.591 (0.77), 4.743 (6.99), 6.777 (2.95), 7.371 (1.65), 7.386 (1.64), 7.673 (2.19), 7.699 (2.11), 8.193 (3.65), 9.668 (2.60).
Example 212 N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00337
The product was purified by preparative HPLC (Chromatorex C18 125×30 mm 10 μm, 0.1% aqueous formic acid, acetonitrile).
From Intermediate 21 and 2-chloro-6-fluoroaniline.
LC-MS (method A): Rt=1.30 min; MS (ESIpos): m/z=493 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.860 (6.38), 0.878 (15.05), 0.897 (7.24), 0.921 (0.42), 1.290 (0.75), 1.311 (8.08), 1.325 (8.15), 1.351 (1.04), 1.369 (0.96), 1.376 (1.07), 1.391 (1.01), 1.408 (1.04), 1.427 (0.89), 1.440 (0.87), 1.446 (0.93), 1.465 (0.89), 1.484 (0.54), 1.560 (0.47), 1.574 (0.76), 1.595 (0.91), 1.607 (1.11), 1.619 (0.89), 1.632 (0.79), 1.741 (0.51), 1.756 (0.75), 1.771 (0.85), 1.815 (0.47), 2.084 (1.18), 2.250 (0.71), 2.518 (3.68), 2.523 (2.36), 3.662 (3.26), 3.674 (5.56), 3.688 (3.73), 3.834 (1.16), 4.022 (4.19), 4.036 (5.89), 4.049 (3.47), 4.597 (0.75), 4.612 (1.38), 4.627 (1.35), 4.642 (0.73), 4.724 (0.88), 4.748 (16.00), 7.338 (0.82), 7.358 (2.07), 7.377 (1.45), 7.382 (1.75), 7.406 (2.04), 7.421 (4.15), 7.441 (4.64), 7.447 (3.87), 7.463 (1.29), 7.662 (2.75), 7.688 (2.69), 9.843 (6.16).
Example 213 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00338
From Intermediate 25 and 2-fluoro-6-methylaniline.
MS (ESIpos): m/z=493 (M+H)+
1H NMR (400 MHz, CHLOROFORM-d) δ [ppm] 8.87 (s, 1H), 8.22 (d, 1H), 7.83 (dt, 1H), 7.49 (d, 1H), 7.25-7.13 (m, 3H), 7.12-6.95 (m, 2H), 6.59 (ddd, 1H), 4.95 (p, 1H), 2.32 (s, 3H), 1.67 (d, 3H).
Example 214 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00339
From Intermediate 25 and 2-fluoroaniline.
MS (ESIpos): m/z=479 (M+H)+
1H NMR (400 MHz, CHLOROFORM-d) δ [ppm] 9.78 (s, 1H), 8.55 (t, 1H), 8.24 (d, 1H), 7.83 (dd, 1H), 7.51 (d, 1H), 7.25-7.13 (m, 6H), 7.13-7.06 (m, 2H), 6.59 (ddd, 1H), 4.95 (p, 1H), 1.68 (d, 3H).
Example 215 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00340
From Intermediate 25 and 2,6-difluoroaniline.
MS (ESIpos): m/z=497 (M+H)+
1H NMR (400 MHz, CHLOROFORM-d) δ [ppm] 8.97 (s, 1H), 8.23 (d, 1H), 7.83 (dd, 1H), 7.51 (d, 1H), 7.23 (d, 22H), 7.01 (t, 2H), 6.59 (ddd, 1H), 4.94 (p, 1H), 1.66 (d, 3H).
Example 216 5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]-N-[3-(trifluoromethyl)phenyl]benzamide
Figure US11787797-20231017-C00341
From Intermediate 26 and 3-(trifluoromethyl)aniline.
MS (ESIpos): m/z=503 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.00 (t, 3H), 1.42-1.67 (m, 2H) 1.49 (d, 3H), 1.72-1.86 (m, 1H), 1.87-2.00 (m, 1H), 4.63-4.76 (m, 1H), 6.57 (dd, 1H), 7.17-7.22 (m, 2H), 7.36-7.45 (m, 2H), 7.50 (t, 1H), 7.80-7.89 (m, 2H), 7.94 (s, 1H), 8.22 (d, 1H), 10.34 (s, 1H).
Example 217 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00342
From Intermediate 26 and 2-fluoro-6-methylaniline.
MS (ESIpos): m/z=467 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 0.95 (t, 3H), 1.36-1.58 (m, 2H) 1.45 (d, 3H), 1.63-1.78 (m, 1H), 1.80-1.94 (m, 1H), 2.33 (s, 3H), 4.62-4.73 (m, 1H), 6.53-6.60 (m, 1H), 7.01 (t, 1H), 7.07 (d, 1H), 7.13-7.24 (m, 3H), 7.43 (d, 1H), 7.84 (td, 1H), 8.20 (d, 1H), 9.56 (s, 1H).
Example 218 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00343
From Intermediate 26 and 2-fluoroaniline.
MS (ESIpos): m/z=453 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 0.96 (t, 3H), 1.35-1.60 (m, 2H) 1.47 (d, 3H), 1.66-1.79 (m, 1H), 1.88-2.03 (m, 1H), 4.62-4.75 (m, 1H), 6.57 (dd, 1H), 7.03-7.23 (m, 5H), 7.42 (d, 1H), 7.84 (td, 1H), 8.24 (d, 1H), 8.63 (dt, 1H), 10.48 (s, 1H).
Example 219 5-fluoro-N-(2-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00344
From Intermediate 26 and o-toluidine.
MS (ESIpos): m/z=449 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 0.95 (t, 3H), 1.37-1.57 (m, 2H) 1.45 (d, 3H), 1.62-1.76 (m, 1H), 1.80-1.95 (m, 1H), 2.36 (s, 3H), 4.61-4.73 (m, 1H), 6.54-6.60 (m, 1H), 7.12 (dt, 1H), 7.18-7.21 (m, 2H), 7.22-7.31 (m, 2H), 7.43 (d, 1H), 7.84 (td, 1H), 8.02 (d, 1H), 8.24 (d, 1H), 9.65 (s, 1H).
Example 220 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(2S)-pentan-2-yloxy]benzamide
Figure US11787797-20231017-C00345
From Intermediate 26 and 2,6-difluoroaniline.
MS (ESIpos): m/z=471 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 0.96 (t, 3H), 1.37-1.57 (m, 2H) 1.46 (d, 3H), 1.64-1.79 (m, 1H), 1.81-1.96 (m, 1H), 4.61-4.74 (m, 1H), 6.53-6.60 (m, 1H), 6.96-7.06 (m, 2H), 7.15-7.29 (m, 3H), 7.43 (d, 1H), 7.83 (td, 1H), 8.21 (d, 1H), 9.68 (s, 1H).
Example 221 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00346
From Intermediate 27 and 2-fluoro-6-methylaniline.
MS (ESIpos): m/z=501 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.81 (d, 3H), 2.32 (s, 3H), 5.62 (q, 1H), 6.54 (dd, 1H), 6.98-7.10 (m, 2H), 7.13-7.45 (m, 9H), 7.80 (td, 1H), 8.18 (d, 1H), 9.62 (s, 1H).
Example 222 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00347
From Intermediate 27 and 2,6-difluoroaniline.
MS (ESIpos): m/z=505 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.82 (d, 3H), 5.62 (q, 1H), 6.54 (dd, 1H), 6.98-7.07 (m, 2H), 7.13-7.18 (m, 2H), 7.19-7.45 (m, 7H), 7.79 (td, 1H), 8.18 (d, 1H), 9.74 (s, 1H).
Example 223 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00348
From Intermediate 27 and 2-fluoroaniline.
MS (ESIpos): m/z=487 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.86 (d, 3H), 5.62 (q, 1H), 6.53 (dd, 1H), 7.05-7.44 (m, 11H), 7.79 (td, 1H), 8.20 (d, 1H), 8.65 (dt, 1H), 10.55 (s, 1H).
Example 224 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00349
From Intermediate 28 and o-toluidine.
MS (ESIpos): m/z=487 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.78 (d, 3H), 1.84-2.02 (m, 4H), 2.20 (s, 3H), 2.77 (t, 2H), 3.69 (t, 2H), 5.62 (q, 1H), 7.07-7.14 (m, 1H), 7.17-7.22 (m, 1H), 7.23-7.41 (m, 7H), 8.02 (d, 1H), 8.15 (d, 1H), 9.66 (s, 1H).
Example 225 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]-N-[3-(trifluoromethyl)phenyl]benzamide
Figure US11787797-20231017-C00350
From Intermediate 28 and 3-(trifluoromethyl)aniline.
MS (ESIpos): m/z=541 (M+H)+
1H NMR (300 MHz, CDCl3) δ [ppm] 1.86 (d, 3H), 1.88-2.04 (m, 4H), 2.79 (t, 2H), 3.70 (t, 2H), 5.61 (q, 1H), 7.32-7.49 (m, 8H), 7.67 (s, 1H), 7.77 (d, 1H), 8.13 (d, 1H), 10.2 (s, 1H).
Example 226 5-fluoro-N-(2-methylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00351
From Intermediate 29 and o-toluidine.
LC-MS (method A): Rt=1.24 min; MS (ESIpos): m/z=495 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.627 (6.76), 1.643 (6.70), 2.015 (1.54), 2.021 (0.72), 2.034 (1.36), 2.047 (1.95), 2.059 (1.37), 2.072 (0.70), 2.320 (16.00), 4.005 (2.37), 4.017 (1.90), 4.019 (1.90), 4.031 (2.29), 4.064 (2.68), 4.076 (2.49), 4.089 (2.54), 4.613 (13.95), 4.868 (0.48), 4.884 (1.09), 4.899 (1.43), 4.914 (1.03), 4.930 (0.42), 7.125 (0.70), 7.128 (0.76), 7.147 (1.88), 7.162 (1.38), 7.166 (1.35), 7.242 (2.22), 7.249 (1.37), 7.261 (1.53), 7.287 (0.76), 7.402 (2.86), 7.416 (2.87), 7.885 (2.00), 7.905 (1.72), 8.149 (3.58), 8.177 (3.55), 9.022 (1.83).
Example 227 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00352
From Intermediate 29 and 2-fluoro-6-methylaniline.
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=513 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.649 (6.36), 1.665 (6.38), 2.015 (0.99), 2.020 (0.65), 2.033 (1.26), 2.046 (1.85), 2.059 (1.31), 2.072 (0.67), 2.314 (16.00), 2.628 (0.56), 4.004 (2.24), 4.016 (1.83), 4.031 (2.21), 4.064 (2.56), 4.076 (2.37), 4.088 (2.50), 4.615 (13.93), 4.898 (0.43), 4.913 (1.00), 4.929 (1.31), 4.945 (0.96), 6.991 (0.76), 7.012 (1.53), 7.035 (0.95), 7.063 (1.34), 7.082 (1.82), 7.171 (0.99), 7.185 (1.05), 7.191 (1.44), 7.205 (1.39), 7.211 (0.72), 7.224 (0.64), 7.404 (2.82), 7.417 (2.84), 8.155 (3.59), 8.183 (3.51), 8.864 (2.01).
Example 228 N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00353
From Intermediate 29 and 2-chloro-6-fluoroaniline.
LC-MS (method A): Rt=1.23 min; MS (ESIpos): m/z=533 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.660 (8.08), 1.676 (8.12), 2.025 (0.84), 2.038 (1.70), 2.050 (2.45), 2.063 (1.75), 2.076 (0.88), 4.008 (2.75), 4.020 (2.31), 4.023 (2.31), 4.034 (2.71), 4.067 (3.17), 4.079 (3.09), 4.092 (3.03), 4.619 (16.00), 4.912 (0.54), 4.927 (1.25), 4.943 (1.62), 4.958 (1.20), 4.974 (0.49), 7.112 (0.98), 7.115 (1.06), 7.132 (1.69), 7.135 (2.25), 7.138 (1.30), 7.155 (1.38), 7.159 (1.40), 7.221 (0.95), 7.234 (0.93), 7.241 (2.15), 7.254 (2.22), 7.262 (1.93), 7.285 (2.42), 7.288 (3.20), 7.307 (1.27), 7.311 (1.05), 7.427 (3.39), 7.441 (3.36), 8.179 (3.32), 8.208 (3.34), 9.022 (2.47).
Example 229 N-[2-(difluoromethyl)phenyl]-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00354
From Intermediate 29 and 2-(difluoromethyl)aniline.
LC-MS (method A): Rt=1.23 min; MS (ESIpos): m/z=531 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.633 (8.00), 1.650 (7.36), 2.018 (0.79), 2.031 (1.59), 2.044 (2.31), 2.056 (1.65), 2.069 (0.84), 4.001 (2.65), 4.014 (2.20), 4.016 (2.20), 4.028 (2.61), 4.061 (3.03), 4.073 (2.91), 4.086 (2.92), 4.611 (16.00), 4.855 (0.48), 4.870 (1.14), 4.886 (1.47), 4.901 (1.11), 4.916 (0.46), 6.612 (1.68), 6.751 (3.35), 6.889 (1.63), 7.306 (0.93), 7.324 (2.10), 7.343 (1.29), 7.420 (3.07), 7.434 (3.04), 7.529 (1.00), 7.549 (4.40), 7.568 (3.14), 7.931 (1.94), 7.951 (1.76), 8.108 (3.60), 8.136 (3.50), 9.380 (2.06).
Example 230 5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00355
From Intermediate 29 and 2-methoxy-4-methylpyridin-3-amine.
LC-MS (method A): Rt=1.09 min; MS (ESIneg): m/z=524 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.583 (0.47), 1.632 (0.48), 1.660 (4.31), 1.676 (4.25), 2.017 (1.16), 2.023 (0.46), 2.037 (0.87), 2.049 (1.24), 2.061 (0.88), 2.074 (0.44), 2.126 (0.87), 2.277 (11.34), 2.629 (0.52), 3.960 (16.00), 3.977 (1.50), 4.007 (1.42), 4.019 (1.20), 4.033 (1.43), 4.065 (1.65), 4.078 (1.59), 4.091 (1.52), 4.617 (8.14), 4.915 (0.65), 4.931 (0.84), 4.946 (0.62), 6.827 (1.72), 6.840 (1.73), 7.393 (1.74), 7.407 (1.72), 7.957 (2.23), 7.970 (2.10), 8.136 (2.13), 8.164 (2.07), 8.963 (1.46).
Example 231 N-(2,6-dichlorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00356
From Intermediate 29 and 2,6-dichloroaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=549 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.661 (9.55), 1.677 (8.61), 2.017 (1.63), 2.023 (0.81), 2.037 (1.57), 2.049 (2.31), 2.061 (1.63), 2.074 (0.83), 4.007 (2.63), 4.019 (2.13), 4.021 (2.14), 4.033 (2.59), 4.065 (3.04), 4.078 (2.87), 4.090 (2.92), 4.617 (16.00), 4.926 (0.51), 4.941 (1.22), 4.957 (1.58), 4.972 (1.18), 4.988 (0.47), 7.211 (1.95), 7.231 (3.26), 7.251 (2.88), 7.419 (11.00), 7.439 (9.09), 8.179 (3.72), 8.207 (3.63), 9.072 (2.64).
Example 232 N-(2-chloro-4-fluoro-6-methylphenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00357
From Intermediate 29 and 2-chloro-4-fluoro-6-methylaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.29 min; MS (ESIneg): m/z=545 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.656 (7.01), 1.672 (7.02), 2.011 (0.83), 2.017 (0.80), 2.031 (1.55), 2.043 (2.16), 2.055 (1.53), 2.068 (0.74), 2.306 (16.00), 4.001 (2.48), 4.015 (2.14), 4.027 (2.34), 4.060 (2.75), 4.073 (2.71), 4.085 (2.54), 4.598 (0.54), 4.603 (1.21), 4.611 (13.04), 4.922 (0.46), 4.938 (1.08), 4.953 (1.40), 4.969 (1.03), 4.984 (0.41), 6.932 (1.25), 6.939 (1.40), 6.955 (1.27), 6.962 (1.37), 7.070 (1.49), 7.077 (1.40), 7.090 (1.52), 7.097 (1.36), 7.402 (2.87), 7.416 (2.84), 8.143 (3.47), 8.171 (3.52), 8.875 (2.31).
Example 233 N-(2-chloro-6-methylphenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00358
From Intermediate 29 and 2-chloro-6-methylaniline.
The product was purified by reverse phase column chromatography (Chromatorex C18 10 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=529 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.658 (6.92), 1.674 (6.94), 2.012 (1.83), 2.018 (0.73), 2.032 (1.41), 2.044 (2.05), 2.056 (1.48), 2.070 (0.74), 2.318 (16.00), 4.003 (2.29), 4.015 (1.98), 4.029 (2.29), 4.062 (2.51), 4.074 (2.61), 4.086 (2.46), 4.613 (11.95), 4.924 (0.43), 4.940 (1.05), 4.955 (1.36), 4.970 (1.01), 4.985 (0.41), 7.158 (0.79), 7.177 (2.68), 7.196 (3.65), 7.204 (2.74), 7.219 (0.82), 7.316 (1.70), 7.321 (1.71), 7.335 (1.28), 7.339 (1.28), 7.402 (2.72), 7.416 (2.71), 8.163 (3.23), 8.191 (3.18), 8.977 (2.28).
Example 234 N-(2-chloro-4,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c-][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00359
From Intermediate 29 and 2-chloro-4,6-difluoroaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=551 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.622 (1.96), 1.652 (9.37), 1.667 (9.40), 2.019 (0.97), 2.033 (2.05), 2.044 (2.93), 2.056 (2.15), 2.070 (1.03), 4.002 (3.18), 4.015 (2.87), 4.028 (3.20), 4.062 (3.46), 4.074 (3.77), 4.087 (3.38), 4.613 (16.00), 4.911 (0.59), 4.927 (1.40), 4.942 (1.82), 4.957 (1.36), 4.972 (0.56), 6.889 (1.05), 6.896 (1.17), 6.912 (1.61), 6.917 (1.75), 6.933 (1.09), 6.940 (1.17), 7.067 (1.32), 7.073 (1.86), 7.079 (1.40), 7.088 (1.40), 7.093 (1.88), 7.098 (1.32), 7.424 (3.60), 7.438 (3.60), 8.153 (3.80), 8.181 (3.78), 8.916 (3.39).
Example 235 5-fluoro-N-[2-methyl-6-(trifluoromethyl)phenyl]-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00360
From Intermediate 29 and 2-methyl-6-(trifluoromethyl)aniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.30 min; MS (ESIpos): m/z=563 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.533 (0.71), 1.549 (0.75), 1.604 (3.81), 1.640 (3.52), 1.655 (3.37), 2.023 (0.94), 2.037 (1.88), 2.048 (2.56), 2.060 (1.80), 2.073 (0.83), 2.326 (16.00), 4.007 (2.87), 4.020 (2.59), 4.033 (2.62), 4.065 (3.08), 4.077 (3.23), 4.089 (2.78), 4.608 (1.67), 4.616 (12.95), 4.922 (0.49), 4.937 (1.16), 4.953 (1.50), 4.968 (1.11), 4.983 (0.45), 7.338 (1.02), 7.357 (2.33), 7.377 (1.48), 7.399 (3.00), 7.412 (2.98), 7.511 (2.17), 7.530 (1.74), 7.554 (2.16), 7.573 (1.77), 8.163 (1.12), 8.191 (1.10).
Example 236 N-(2,6-dichloro-4-fluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00361
From Intermediate 29 and 2,6-dichloro-4-fluoroaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.29 min; MS (ESIpos): m/z=567 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.532 (0.51), 1.548 (0.52), 1.605 (2.70), 1.657 (7.33), 1.674 (7.43), 2.016 (0.51), 2.022 (0.80), 2.035 (1.57), 2.048 (2.22), 2.060 (1.57), 2.073 (0.80), 4.005 (2.58), 4.017 (2.09), 4.019 (2.14), 4.031 (2.46), 4.064 (3.01), 4.077 (2.76), 4.089 (2.78), 4.608 (1.52), 4.615 (16.00), 4.925 (0.49), 4.940 (1.15), 4.956 (1.50), 4.971 (1.12), 4.986 (0.45), 7.198 (10.53), 7.218 (10.12), 7.423 (3.20), 7.437 (3.20), 8.159 (4.00), 8.188 (4.08), 8.972 (2.62).
Example 237 5-fluoro-N-(4-fluoro-2,6-dimethylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00362
From Intermediate 29 and 4-fluoro-2,6-dimethylaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=527 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.603 (3.10), 1.650 (3.46), 1.666 (3.46), 2.037 (0.73), 2.049 (1.05), 2.061 (0.75), 2.253 (16.00), 4.007 (1.19), 4.022 (1.01), 4.034 (1.17), 4.067 (1.33), 4.079 (1.32), 4.091 (1.27), 4.617 (6.53), 4.934 (0.55), 4.950 (0.70), 4.965 (0.53), 6.832 (2.23), 6.854 (2.22), 7.381 (1.44), 7.395 (1.43), 8.150 (1.79), 8.179 (1.77), 8.635 (1.05).
Example 238 N-(4-chloro-2-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00363
From Intermediate 29 and 4-chloro-2-methylpyridin-3-amine.
The product was purified by reverse phase column chromatography (Chromatorex C18 10 μm, 0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.03 min; MS (ESIpos): m/z=530 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.682 (7.70), 1.698 (7.71), 2.019 (0.85), 2.030 (0.99), 2.044 (1.84), 2.055 (2.55), 2.067 (1.84), 2.081 (0.94), 2.500 (0.40), 2.665 (8.57), 4.013 (2.72), 4.026 (2.35), 4.039 (2.65), 4.072 (3.15), 4.084 (3.11), 4.097 (2.97), 4.623 (16.00), 4.953 (0.47), 4.968 (1.09), 4.984 (1.40), 4.999 (1.04), 5.014 (0.42), 7.454 (4.21), 7.468 (3.35), 7.529 (0.41), 8.167 (4.09), 8.195 (4.12), 8.411 (1.92), 8.425 (1.88), 9.122 (2.05).
Example 239 N-(2-chloro-4-methylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00364
From Intermediate 29 and 2-chloro-4-methylpyridin-3-amine.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.08 min; MS (ESIneg): m/z=528 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.613 (0.48), 1.629 (0.53), 1.684 (5.61), 1.700 (5.68), 2.016 (1.37), 2.052 (1.84), 2.349 (16.00), 4.010 (1.87), 4.023 (1.83), 4.036 (1.91), 4.068 (2.32), 4.081 (2.47), 4.093 (2.31), 4.620 (11.21), 4.959 (0.75), 4.974 (0.98), 4.990 (0.74), 7.196 (1.58), 7.207 (1.65), 7.433 (2.10), 7.447 (2.13), 8.157 (3.76), 8.184 (3.78), 8.215 (1.40), 8.227 (1.41), 9.123 (2.16).
Example 240 N-(2-chloro-4,6-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00365
From Intermediate 29 and 2-chloro-4,6-dimethylpyridin-3-amine.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.14 min; MS (ESIneg): m/z=542 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.670 (8.31), 1.686 (8.36), 2.011 (2.57), 2.043 (3.09), 2.054 (2.31), 2.299 (15.28), 2.531 (12.01), 4.001 (3.22), 4.014 (3.15), 4.027 (3.22), 4.060 (3.64), 4.073 (4.08), 4.085 (3.55), 4.611 (16.00), 4.932 (0.52), 4.946 (1.21), 4.962 (1.58), 4.977 (1.19), 4.992 (0.50), 7.060 (3.90), 7.418 (3.53), 7.432 (3.52), 8.040 (0.58), 8.142 (5.13), 8.170 (5.21), 9.026 (3.03).
Example 241 N-(2,4-dimethylpyridin-3-yl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00366
From Intermediate 29 and 2,4-dimethylpyridin-3-amine.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=0.80 min; MS (ESIpos): m/z=510 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.641 (3.60), 1.670 (7.51), 1.686 (6.85), 2.030 (0.63), 2.044 (1.25), 2.056 (1.80), 2.068 (1.29), 2.081 (0.65), 2.284 (14.66), 2.517 (16.00), 2.628 (3.85), 4.014 (2.01), 4.026 (1.68), 4.041 (1.98), 4.072 (2.29), 4.084 (2.22), 4.098 (2.19), 4.623 (12.19), 4.954 (0.91), 4.969 (1.20), 4.984 (0.89), 7.006 (0.43), 7.091 (1.99), 7.103 (2.01), 7.411 (2.57), 7.425 (2.54), 7.529 (0.45), 8.128 (0.45), 8.171 (3.30), 8.198 (3.19), 8.340 (2.78), 8.353 (2.73), 8.828 (2.01).
Example 242 5-fluoro-N-(2-methoxy-6-methylphenyl)-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00367
From Intermediate 29 and 2-methoxy-6-methylaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.23 min; MS (ESIpos): m/z=525 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.636 (4.51), 1.652 (4.58), 2.008 (1.69), 2.012 (0.50), 2.026 (0.94), 2.038 (1.32), 2.049 (0.96), 2.062 (0.47), 2.282 (11.94), 3.817 (16.00), 3.996 (1.45), 4.010 (1.28), 4.022 (1.41), 4.056 (1.66), 4.069 (1.70), 4.081 (1.61), 4.607 (8.30), 4.903 (0.70), 4.919 (0.90), 4.934 (0.68), 6.791 (1.26), 6.811 (1.39), 6.885 (1.27), 6.904 (1.45), 7.162 (1.27), 7.183 (1.99), 7.202 (1.00), 7.373 (1.87), 7.387 (1.85), 8.144 (2.67), 8.172 (2.64), 8.875 (1.62).
Example 243 N-(6-chloro-2,3-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c]-[1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00368
From Intermediate 29 and 6-chloro-2,3-difluoroaniline.
The product was purified by reverse phase column chromatography (0.1% aqueous formic acid, acetonitrile).
LC-MS (method A): Rt=1.26 min; MS (ESIpos): m/z=551 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.636 (0.42), 1.664 (7.49), 1.680 (7.54), 2.018 (1.00), 2.025 (0.83), 2.038 (1.59), 2.050 (2.16), 2.062 (1.52), 2.076 (0.77), 4.008 (2.44), 4.022 (2.01), 4.034 (2.39), 4.067 (2.92), 4.079 (2.71), 4.092 (2.75), 4.619 (16.00), 4.926 (0.48), 4.941 (1.13), 4.957 (1.46), 4.972 (1.07), 4.988 (0.43), 7.088 (0.79), 7.107 (0.99), 7.110 (1.88), 7.130 (2.08), 7.134 (1.38), 7.153 (1.31), 7.216 (1.41), 7.222 (1.31), 7.228 (1.64), 7.234 (1.40), 7.239 (1.09), 7.245 (1.01), 7.251 (1.11), 7.256 (1.03), 7.442 (3.17), 7.456 (3.19), 8.177 (4.04), 8.205 (3.89), 9.081 (2.44).
Example 244 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00369
A solution of 4-bromo-N-(2,6-difluorophenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (intermediate 30) (100 mg, 226 μmol), 6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-3(2H)-one (CAS 133365-37-4) (47.9 mg, 339 μmol), tris(dibenzylideneacetone)dipalladium(O) (20.7 mg, 22.6 μmol), 4,5-bis(diphenylphosphino)9,9-dimethylxanthene (39.3 mg, 67.8 μmol), and cesium carbonate (147 mg, 452 μmol) in dimethyl sulfoxide was heated to 110° C. for seventeen hours. The mixture was filtered over celite, the filter cake was washed with ethyl acetate, and the combined filtrate was concentrated under reduced pressure. The residue was purified by by preparative HPLC (X-Bridge Prep C18 5 μm, 0.1% aqueous formic acid, acetonitrile) to yield the title compound as light yellow solid 54.0 mg (97% purity, 46% yield).
LC-MS (method A): Rt=1.14 min; MS (ESIpos): m/z=503 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (0.72), 1.232 (0.96), 1.427 (16.00), 1.442 (16.00), 2.084 (1.05), 2.123 (1.93), 2.137 (5.55), 2.150 (6.91), 2.164 (5.71), 2.178 (1.93), 2.322 (1.77), 2.326 (2.41), 2.331 (1.77), 2.453 (0.80), 2.522 (6.91), 2.664 (1.77), 2.668 (2.41), 2.673 (1.69), 3.288 (1.05), 3.292 (0.80), 3.673 (6.59), 3.688 (13.51), 3.703 (6.19), 4.442 (7.64), 4.456 (9.89), 4.468 (7.40), 5.260 (1.13), 5.276 (2.65), 5.292 (3.30), 5.309 (2.49), 5.324 (1.05), 5.758 (1.85), 7.188 (4.82), 7.208 (10.05), 7.228 (6.19), 7.368 (1.29), 7.385 (2.57), 7.405 (3.46), 7.426 (2.09), 7.442 (1.05), 7.492 (5.95), 7.507 (5.87), 7.544 (6.43), 7.568 (6.27), 9.950 (14.71).
Examples 245-257 were prepared in analogy to example 244 from the respective aryl bromides and the respective triazolone derivative, as indicated.
Example 245 N-(2,6-difluorophenyl)-5-fluoro-4-(8-methyl-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyrimidin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00370
From intermediate 30 and 8-methyl-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyrimidin-3(2H)-one (CAS 425706-28-1).
LC-MS (method A): Rt=1.17 min; MS (ESIpos): m/z=516 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.432 (3.75), 1.447 (3.73), 2.019 (0.42), 2.033 (1.19), 2.047 (1.62), 2.061 (1.25), 2.076 (0.43), 2.084 (0.40), 2.518 (2.12), 2.522 (1.48), 2.754 (0.61), 2.876 (16.00), 3.221 (1.71), 3.235 (2.27), 3.249 (1.64), 3.564 (1.59), 3.579 (3.07), 3.594 (1.52), 5.261 (0.62), 5.277 (0.81), 5.293 (0.59), 7.189 (1.14), 7.209 (2.41), 7.230 (1.51), 7.385 (0.59), 7.405 (0.84), 7.422 (0.59), 7.426 (0.54), 7.499 (1.39), 7.517 (2.25), 7.543 (1.52), 9.895 (3.63).
Example 246 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6-dihydro[1,3]thiazolo[2,3-c][1,2,4]triazol-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00371
From intermediate 30 and 5,6-dihydro[1,3]thiazolo[2,3-c][1,2,4]triazol-3(2H)-one (intermediate 38).
LC-MS (method A): Rt=1.19 min; MS (ESIpos): m/z=505 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (0.63), 1.382 (0.93), 1.398 (1.23), 1.427 (16.00), 1.443 (15.90), 1.525 (6.17), 2.084 (6.10), 2.331 (1.43), 2.518 (8.73), 2.522 (5.53), 2.539 (0.77), 2.673 (1.40), 3.452 (3.43), 3.936 (3.47), 3.941 (3.80), 3.956 (11.37), 3.973 (10.07), 4.018 (9.50), 4.035 (9.70), 4.050 (3.37), 4.055 (2.93), 5.274 (1.17), 5.290 (2.63), 5.305 (3.37), 5.321 (2.50), 5.337 (1.03), 5.748 (1.57), 5.758 (2.80), 7.188 (4.80), 7.209 (10.03), 7.229 (6.20), 7.348 (0.57), 7.369 (1.57), 7.386 (2.53), 7.406 (3.57), 7.427 (2.37), 7.443 (1.20), 7.554 (6.90), 7.560 (8.63), 7.568 (6.83), 7.585 (6.57), 9.979 (14.40).
Example 247 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-2(9H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00372
From intermediate 30 and 2,6,7,9-tetrahydro-3H,5H-[1,2,4]triazolo[3,4-c][1,4]oxazepin-3-one (intermediate 37).
LC-MS (method A): Rt=1.17 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (0.66), 1.430 (9.62), 1.446 (9.54), 1.882 (3.57), 2.084 (4.92), 2.518 (5.90), 2.522 (3.86), 2.673 (0.89), 3.922 (4.07), 3.934 (4.07), 3.947 (3.97), 3.969 (4.20), 3.981 (4.92), 3.993 (3.97), 4.606 (16.00), 5.293 (0.64), 5.308 (1.56), 5.324 (1.99), 5.340 (1.48), 5.355 (0.58), 5.758 (1.43), 7.190 (2.87), 7.211 (5.96), 7.231 (3.72), 7.371 (0.69), 7.387 (1.48), 7.408 (2.10), 7.424 (1.25), 7.445 (0.52), 7.579 (4.07), 7.603 (6.23), 7.616 (3.76), 10.000 (8.44).
Example 248 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7,8,9-tetrahydro-3H-[1,2,4]triazolo[4,3-a]azepin-2(5H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00373
From intermediate 30 and 2,5,6,7,8,9-hexahydro-3H-[1,2,4]triazolo[4,3-a]azepin-3-one (CAS 27182-43-0).
LC-MS (method A): Rt=1.27 min; MS (ESIpos): m/z=515 [M+H]+
1H-NMR (500 MHz, DMSO-d6) δ[ppm]: 1.236 (0.52), 1.432 (16.00), 1.445 (15.91), 1.646 (6.57), 1.691 (10.32), 1.811 (5.58), 2.084 (0.42), 2.358 (2.11), 2.361 (2.86), 2.365 (2.30), 2.518 (8.96), 2.522 (6.52), 2.539 (1.17), 2.631 (2.16), 2.635 (2.91), 2.638 (2.25), 2.756 (6.52), 2.768 (6.05), 2.778 (6.24), 3.362 (0.66), 3.776 (6.38), 5.301 (1.08), 5.314 (2.49), 5.326 (3.28), 5.339 (2.39), 5.351 (1.03), 5.759 (0.99), 7.156 (0.52), 7.171 (0.89), 7.194 (4.74), 7.211 (9.57), 7.227 (5.82), 7.353 (1.03), 7.371 (3.61), 7.384 (5.87), 7.392 (6.33), 7.407 (3.80), 7.424 (2.16), 7.437 (0.99), 7.470 (0.84), 7.479 (1.08), 7.487 (1.27), 7.497 (0.75), 7.562 (6.19), 7.574 (6.85), 7.581 (8.54), 7.859 (0.89), 7.875 (0.84), 9.978 (13.75), 10.210 (0.42).
Example 249 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-a]pyrazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00374
From intermediate 30 and [1,2,4]triazolo[4,3-a]pyrazin-3(2H)-one (CAS 53975-75-0).
LC-MS (method A): Rt=1.17 min; MS (ESIpos): m/z=498 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (0.81), 1.232 (0.49), 1.449 (13.73), 1.465 (13.73), 1.906 (0.81), 2.084 (11.86), 2.336 (1.38), 2.518 (16.00), 2.522 (10.72), 2.539 (1.38), 2.678 (1.30), 3.283 (0.41), 3.371 (0.89), 5.242 (1.06), 5.258 (2.36), 5.274 (2.92), 5.290 (2.11), 5.305 (0.81), 7.202 (4.30), 7.222 (8.69), 7.242 (5.52), 7.381 (1.06), 7.397 (2.11), 7.418 (3.01), 7.435 (1.54), 7.439 (1.62), 7.455 (0.73), 7.642 (9.75), 7.654 (10.15), 7.680 (6.09), 7.704 (8.20), 7.715 (5.36), 7.998 (5.93), 8.002 (5.85), 8.010 (5.60), 8.014 (5.44), 9.056 (8.61), 9.061 (8.28), 10.106 (9.75).
Example 250 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]thiazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00375
From intermediate 30 and 6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]thiazin-3(2H)-one (intermediate 39).
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=519 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.427 (7.80), 1.443 (7.64), 1.647 (0.82), 2.074 (16.00), 2.216 (2.42), 2.228 (3.38), 2.241 (2.53), 2.327 (0.87), 2.669 (0.84), 3.221 (3.81), 3.234 (3.84), 3.248 (3.49), 3.564 (0.46), 3.693 (3.23), 3.708 (5.12), 3.723 (2.99), 5.282 (0.59), 5.298 (1.28), 5.314 (1.63), 5.330 (1.20), 5.345 (0.52), 7.189 (2.42), 7.210 (4.79), 7.230 (3.02), 7.346 (0.70), 7.364 (1.58), 7.386 (2.14), 7.407 (1.88), 7.427 (1.52), 7.443 (0.98), 7.549 (2.96), 7.568 (4.22), 7.594 (3.00), 9.987 (6.52).
Example 251 N-(2,6-difluorophenyl)-4-(6,6-dimethyl-3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-2(3H)-yl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00376
From intermediate 30 and 6,6-dimethyl-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]oxazin-3(2H)-one (intermediate 40).
LC-MS (method A): Rt=1.25 min; MS (ESIpos): m/z=531 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.080 (16.00), 1.430 (2.47), 1.446 (2.47), 2.518 (2.20), 2.523 (1.57), 3.464 (4.00), 4.154 (4.37), 5.312 (0.52), 5.758 (1.46), 7.189 (0.76), 7.209 (1.56), 7.230 (0.97), 7.385 (0.45), 7.406 (0.54), 7.531 (0.95), 7.546 (1.91), 7.572 (1.03), 9.949 (2.24).
Example 252 4-(6,6-difluoro-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-N-(2,6-difluoro-phenyl)-5-fluoro-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00377
From intermediate 30 and 6,6-difluoro-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one (intermediate 41).
LC-MS (method A): Rt=1.25 min; MS (ESIpos): m/z=537 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.429 (16.00), 1.445 (15.89), 1.717 (0.89), 2.074 (1.68), 2.327 (2.32), 2.424 (1.54), 2.442 (3.29), 2.459 (5.29), 2.539 (2.14), 2.669 (2.07), 2.729 (3.79), 2.810 (0.43), 2.888 (4.36), 2.962 (6.14), 2.979 (11.50), 2.996 (5.29), 4.058 (4.96), 4.089 (9.86), 4.121 (4.75), 5.275 (1.11), 5.290 (2.61), 5.306 (3.32), 5.321 (2.50), 5.337 (1.07), 6.875 (0.46), 6.916 (0.50), 7.191 (4.71), 7.212 (10.00), 7.232 (6.43), 7.329 (0.50), 7.349 (0.82), 7.388 (3.29), 7.409 (3.93), 7.426 (2.75), 7.569 (5.93), 7.588 (8.29), 7.614 (6.32), 7.662 (0.57), 7.705 (0.64), 7.951 (0.75), 10.014 (4.89).
Example 253 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo[1,2,4]triazolo[4,3-b]pyridazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00378
From intermediate 30 and [1,2,4]triazolo[4,3-b]pyridazin-3(2H)-one (CAS 33050-35-0).
LC-MS (method A): Rt=1.14 min; MS (ESIpos): m/z=498 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (1.07), 1.233 (1.15), 1.448 (9.81), 1.464 (9.73), 1.907 (0.74), 2.084 (13.69), 2.115 (0.41), 2.332 (2.97), 2.336 (1.32), 2.518 (16.00), 2.522 (10.56), 2.539 (1.07), 2.669 (4.21), 2.673 (3.05), 2.678 (1.32), 5.259 (0.74), 5.274 (1.57), 5.290 (1.98), 5.306 (1.48), 5.322 (0.58), 5.758 (11.22), 7.201 (2.97), 7.221 (6.10), 7.242 (3.88), 7.255 (4.62), 7.265 (4.04), 7.279 (4.04), 7.289 (4.45), 7.381 (0.66), 7.396 (1.48), 7.418 (2.06), 7.438 (1.07), 7.454 (0.49), 7.658 (4.04), 7.682 (4.12), 7.707 (3.71), 7.721 (3.63), 7.939 (3.71), 7.942 (3.79), 7.963 (3.55), 7.966 (3.30), 8.372 (4.45), 8.375 (4.37), 8.382 (4.54), 8.385 (4.12), 10.085 (7.01).
Example 254 2-(4-[(2,6-difluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}phenyl)-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-8-(R,S)-carboxylic acid, mixture of diastereomers
Figure US11787797-20231017-C00379
From intermediate 30 and rac-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-8carboxylic acid (CAS 1432681-89-4).
LC-MS (method A): Rt=1.06 min; MS (ESIpos): m/z=498 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.421 (7.84), 1.435 (13.20), 1.449 (7.69), 1.914 (3.73), 1.928 (5.59), 1.943 (4.58), 2.066 (3.96), 2.080 (5.13), 2.095 (3.65), 2.322 (3.03), 2.326 (4.12), 2.331 (3.11), 2.539 (16.00), 2.664 (3.11), 2.668 (4.19), 2.673 (3.18), 3.513 (2.25), 3.530 (2.87), 3.546 (3.18), 3.561 (3.65), 3.577 (2.17), 3.622 (2.02), 3.635 (3.73), 3.650 (2.80), 3.666 (2.41), 3.680 (1.24), 3.824 (2.49), 3.838 (4.58), 3.852 (2.41), 5.299 (1.79), 5.315 (2.25), 5.326 (1.79), 7.190 (4.35), 7.211 (8.85), 7.231 (5.51), 7.371 (1.01), 7.387 (2.25), 7.407 (3.18), 7.423 (1.86), 7.547 (4.97), 7.556 (4.97), 7.574 (6.83), 7.599 (5.90), 7.621 (1.79), 7.641 (1.01), 9.998 (7.22), 10.003 (7.15).
Example 255 2-(4-[(2-chloro-6-fluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}phenyl)-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-8-(R,S)-carboxylic Acid, Mixture of Diastereomers
Figure US11787797-20231017-C00380
From intermediate 31 and rac-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-8-carboxylic acid (CAS 1432681-89-4).
LC-MS (method A): Rt=1.11 min; MS (ESIpos): m/z=561 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.428 (3.62), 1.441 (5.29), 1.455 (3.34), 1.931 (2.09), 2.083 (16.00), 2.322 (2.23), 2.326 (2.92), 2.331 (2.23), 2.522 (7.93), 2.539 (1.39), 2.665 (2.37), 2.669 (3.06), 2.673 (2.23), 3.538 (0.97), 3.552 (1.11), 3.568 (1.25), 3.637 (1.39), 3.653 (0.97), 3.668 (0.83), 3.843 (0.97), 3.857 (1.81), 5.326 (0.83), 5.342 (0.97), 5.755 (6.68), 7.355 (1.53), 7.371 (0.97), 7.378 (1.11), 7.388 (0.83), 7.408 (1.53), 7.421 (1.81), 7.433 (3.06), 7.438 (3.62), 7.551 (3.76), 7.575 (2.92), 10.062 (3.48).
Example 256 2-(4-[(2-chloro-6-fluorophenyl)carbamoyl]-2-fluoro-5-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}phenyl)-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-6-(R,S)-carboxylic Acid, Mixture of Diastereomers
Figure US11787797-20231017-C00381
From intermediate 31 and rac-3-oxo-2,3,5,6,7,8-hexahydro[1,2,4]triazolo[4,3-a]pyridine-6-carboxylic acid (CAS 1432680-45-9).
LC-MS (method A): Rt=1.14 min; MS (ESIpos): m/z=561 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (0.53), 1.232 (1.26), 1.432 (3.97), 1.448 (3.97), 1.967 (0.46), 1.988 (0.60), 2.001 (0.46), 2.085 (3.83), 2.157 (0.53), 2.323 (2.98), 2.327 (4.10), 2.331 (2.91), 2.518 (16.00), 2.523 (10.51), 2.540 (1.06), 2.665 (3.04), 2.669 (4.17), 2.673 (2.98), 2.734 (0.66), 2.750 (1.26), 2.770 (0.79), 2.793 (0.53), 3.046 (0.46), 3.659 (0.60), 3.678 (0.60), 3.689 (0.99), 3.708 (0.99), 3.751 (0.79), 3.764 (0.86), 3.782 (0.46), 3.796 (0.46), 5.333 (0.53), 5.348 (0.66), 5.363 (0.53), 5.759 (6.08), 7.335 (0.46), 7.353 (0.93), 7.370 (0.60), 7.377 (0.73), 7.407 (0.93), 7.421 (1.06), 7.431 (1.92), 7.438 (2.38), 7.452 (0.46), 7.540 (1.45), 7.565 (1.92), 7.573 (1.45), 10.053 (3.37).
Example 257 N-(2,6-difluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00382
From intermediate 32 and 5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one.
LC-MS (method A): Rt=1.25 min; MS (ESIneg): m/z=481 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.138 (0.43), 1.231 (0.38), 1.432 (1.08), 1.447 (1.13), 1.489 (15.78), 1.504 (15.73), 1.556 (4.63), 1.646 (2.96), 1.794 (3.93), 1.806 (5.66), 1.817 (5.93), 1.882 (5.98), 1.893 (5.87), 2.084 (3.61), 2.349 (2.10), 2.443 (0.43), 2.518 (8.78), 2.523 (5.93), 2.541 (1.29), 2.718 (6.30), 2.734 (12.93), 2.750 (6.84), 3.317 (2.21), 3.376 (1.13), 3.565 (7.70), 3.581 (13.85), 3.596 (6.09), 5.272 (1.13), 5.288 (2.64), 5.304 (3.45), 5.319 (2.59), 5.336 (1.13), 5.758 (2.26), 7.180 (4.85), 7.200 (9.86), 7.221 (6.20), 7.373 (3.18), 7.385 (4.26), 7.395 (5.71), 7.409 (2.26), 7.430 (0.97), 7.478 (0.54), 7.489 (0.59), 7.570 (0.59), 7.587 (0.65), 7.711 (3.77), 7.732 (7.27), 7.772 (6.73), 7.792 (3.56), 7.828 (7.92), 7.854 (0.59), 7.874 (0.48), 8.296 (0.59), 9.685 (16.00).
Example 258 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00383
To a solution of 5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 18) (100 mg, 257 μmol) in dichloromethane (1 ml) was added 1-chloro-N,N,2-trimethylprop-1-en-1-amine (100 μl, 770 μmol) and the solution was stirred at room temperature for thirty minutes. Then, pyridine (100 μl, 1.3 mmol) and a solution of 2,6-difluoroaniline (55 μl, 510 μmol) in dichloromethane (1 ml) were added subsequently and the reaction was stirred for one hour at room temperature. The reaction mixture was concentrated under reduced pressure and the residue was purified by preparative HPLC (X-Bridge Prep C18 5 μm, 0.1% aqueous formic acid, acetonitrile) to yield the title compound as white solid (83 mg, 98% purity, 63%).
LC-MS (method A): Rt=1.19 min; MS (ESIpos): m/z=501 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.428 (16.00), 1.444 (16.00), 1.795 (3.75), 1.807 (5.19), 1.822 (5.33), 1.834 (2.59), 1.875 (2.59), 1.889 (5.33), 1.900 (5.48), 1.913 (3.46), 1.928 (1.30), 2.518 (6.92), 2.523 (4.76), 2.674 (1.44), 2.696 (5.77), 2.712 (11.53), 2.728 (6.05), 3.289 (0.86), 3.385 (0.72), 3.388 (0.72), 3.561 (6.92), 3.577 (12.54), 3.591 (5.62), 5.270 (1.15), 5.286 (2.59), 5.302 (3.32), 5.318 (2.45), 5.333 (1.01), 7.189 (4.90), 7.209 (10.09), 7.229 (6.34), 7.370 (1.15), 7.385 (2.45), 7.406 (3.46), 7.422 (1.73), 7.427 (1.87), 7.443 (0.72), 7.542 (6.05), 7.560 (9.23), 7.585 (6.77), 9.986 (8.22).
Examples 259-260 were prepared as described for example 258 from intermediate 18 and the respective amines, as indicated.
Example 259 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00384
From intermediate 18 and 2-fluoro-6-methylaniline.
LC-MS (method A): Rt=1.22 min; MS (ESIpos): m/z=497 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.429 (7.04), 1.445 (7.00), 1.782 (0.45), 1.797 (1.26), 1.809 (1.73), 1.821 (1.75), 1.824 (1.77), 1.836 (0.87), 1.878 (0.88), 1.892 (1.80), 1.902 (1.84), 1.916 (1.11), 1.931 (0.43), 2.271 (16.00), 2.518 (0.99), 2.523 (0.63), 2.699 (2.09), 2.715 (4.12), 2.730 (2.18), 3.564 (2.48), 3.579 (4.38), 3.594 (1.92), 5.316 (0.46), 5.332 (1.11), 5.348 (1.44), 5.364 (1.04), 5.380 (0.40), 7.100 (0.93), 7.116 (2.35), 7.120 (2.28), 7.133 (2.52), 7.143 (1.42), 7.226 (1.11), 7.240 (1.21), 7.246 (1.58), 7.260 (1.22), 7.266 (0.77), 7.280 (0.65), 7.538 (3.17), 7.545 (4.27), 7.552 (3.11), 7.569 (3.69), 9.810 (4.16).
Example 260 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2R)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00385
From intermediate 18 and 2-fluoroaniline.
LC-MS (method A): Rt=1.29 min; MS (ESIpos): m/z=483 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.470 (16.00), 1.486 (15.97), 1.796 (3.46), 1.808 (4.90), 1.823 (5.00), 1.836 (2.48), 1.877 (2.43), 1.891 (5.02), 1.902 (5.19), 1.915 (3.20), 1.930 (1.23), 2.518 (5.17), 2.523 (3.39), 2.699 (5.52), 2.715 (10.83), 2.731 (5.81), 3.564 (6.48), 3.580 (11.55), 3.594 (5.26), 5.387 (1.08), 5.404 (2.59), 5.420 (3.37), 5.435 (2.47), 5.451 (0.99), 7.188 (0.74), 7.202 (2.23), 7.208 (2.74), 7.216 (5.36), 7.219 (6.08), 7.226 (7.55), 7.237 (5.33), 7.240 (5.26), 7.253 (1.42), 7.295 (2.71), 7.301 (2.45), 7.314 (2.04), 7.322 (2.98), 7.329 (1.73), 7.333 (1.80), 7.341 (1.25), 7.346 (1.68), 7.588 (6.24), 7.602 (6.13), 7.728 (7.09), 7.754 (7.02), 8.057 (2.09), 8.063 (1.88), 8.077 (3.68), 8.082 (3.10), 8.089 (1.94), 8.101 (1.87), 10.024 (9.27).
Example 261 5-fluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00386
To a solution of 2,5-difluoro-N-(2-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide (intermediate 33) (62.0 mg, 160 μmol) in N,N-dimethylformamide (1.3 ml) were added (1S)-1-phenylethanol (58.5 mg, 479 μmol) and cesium carbonate (156 mg, 479 μmol) and the mixture was stirred at 100° C. for four hours. After cooling to room temperature, brine (5 ml) was added and the mixture was extracted with ethyl acetate (3×5 ml). The combined organic phases were dried over magnesium sulfate, concentrated under reduced pressure and the residue was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile) to yield the title compound as white solid (28 mg, 98% purity, 35%).
LC-MS (method A): Rt=1.43 min; MS (ESIpos): m/z=492 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.108 (9.31), 1.684 (15.15), 1.700 (15.18), 1.750 (1.42), 1.765 (3.80), 1.777 (5.46), 1.788 (5.41), 1.792 (5.57), 1.804 (2.86), 1.844 (2.84), 1.859 (5.73), 1.869 (5.78), 1.874 (4.94), 1.883 (3.58), 1.898 (1.40), 2.327 (0.75), 2.523 (2.55), 2.645 (6.08), 2.661 (12.21), 2.677 (6.69), 3.522 (6.93), 3.537 (12.37), 3.552 (5.73), 5.755 (1.35), 5.770 (4.13), 5.786 (4.09), 5.801 (1.28), 7.183 (0.99), 7.188 (1.12), 7.196 (1.21), 7.202 (3.06), 7.207 (2.87), 7.215 (2.89), 7.221 (3.97), 7.226 (2.92), 7.234 (3.16), 7.240 (4.13), 7.247 (4.30), 7.261 (5.84), 7.266 (5.54), 7.276 (7.46), 7.281 (4.36), 7.291 (3.67), 7.294 (5.51), 7.298 (3.49), 7.330 (8.96), 7.341 (11.41), 7.345 (10.26), 7.349 (16.00), 7.355 (11.25), 7.367 (9.58), 7.385 (2.44), 7.389 (2.35), 7.439 (12.21), 7.457 (8.32), 7.808 (7.39), 7.836 (7.18), 8.301 (2.35), 8.305 (2.45), 8.321 (4.36), 8.325 (4.31), 8.340 (2.24), 8.345 (2.12), 10.402 (6.71), 10.407 (6.65).
Example 262 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00387
To a solution of (1S)-1-phenylethanol (53.4 mg, 437 μmol) in N,N-dimethylformamide (1.2 ml) was added sodium hydride (17.5 mg, 60% dispersion in mineral oil, 437 μmol) and the reaction mixture was stirred at room temperature for one hour. Then, (N-(2,6-difluorophenyl)-2,5-difluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide (60 mg, 146 μmol) (intermediate 34) in N,N-dimethylformamide (0.5 ml) was added and the mixture was stirred at 80° C. for three hours. After cooling to room temperature, brine (5 ml) was added and the mixture was extracted with ethyl acetate (3×5 ml). The combined organic phases were dried over magnesium sulfate, concentrated under reduced pressure and the residue was purified by preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous formic acid, acetonitrile) to yield the title compound as white solid (7 mg, 97% purity, 9%).
LC-MS (method A): Rt=1.31 min; MS (ESIneg): m/z=507 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.860 (0.50), 0.967 (1.86), 1.031 (0.50), 1.047 (0.50), 1.107 (5.71), 1.145 (1.74), 1.209 (0.99), 1.232 (1.74), 1.353 (0.37), 1.388 (0.37), 1.594 (7.57), 1.610 (7.57), 1.768 (1.86), 1.780 (2.48), 1.795 (2.73), 1.862 (2.60), 1.872 (2.85), 2.318 (1.61), 2.323 (3.60), 2.327 (5.09), 2.332 (3.60), 2.337 (1.49), 2.518 (16.00), 2.523 (11.29), 2.647 (2.73), 2.664 (8.56), 2.669 (6.70), 2.673 (4.71), 2.679 (4.47), 2.697 (0.87), 2.713 (0.37), 3.291 (0.74), 3.373 (0.37), 3.504 (1.12), 3.522 (3.35), 3.538 (5.95), 3.552 (2.85), 3.565 (0.99), 4.190 (0.50), 5.646 (1.74), 5.663 (1.74), 7.219 (2.48), 7.240 (5.21), 7.249 (2.23), 7.260 (6.20), 7.268 (5.21), 7.273 (3.84), 7.285 (3.10), 7.322 (4.22), 7.341 (6.82), 7.359 (3.10), 7.391 (0.62), 7.407 (1.24), 7.428 (1.86), 7.449 (1.12), 7.465 (5.09), 7.483 (3.60), 7.573 (2.85), 7.600 (2.85), 9.955 (7.19).
Examples 263-267 were prepared as described for example 262 from the respective difluorobenzamide derivatives and the respective alcohols, as indicated.
Example 263 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-[(1S)-1-phenylethoxy]benzamide
Figure US11787797-20231017-C00388
From intermediate 35 and (1S)-1-phenylethanol.
LC-MS (method A): Rt=1.30 min; MS (ESIpos): m/z=505 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 0.968 (0.56), 1.028 (0.60), 1.043 (0.61), 1.108 (4.21), 1.145 (0.41), 1.209 (0.46), 1.591 (6.83), 1.607 (6.79), 1.767 (1.12), 1.779 (1.52), 1.794 (1.60), 1.806 (0.83), 1.845 (0.76), 1.860 (1.64), 1.871 (1.64), 1.884 (1.02), 1.899 (0.41), 2.293 (16.00), 2.323 (0.50), 2.327 (0.71), 2.332 (0.50), 2.518 (1.88), 2.523 (1.37), 2.644 (1.83), 2.660 (3.88), 2.669 (1.31), 2.677 (2.15), 3.520 (2.21), 3.535 (3.97), 3.550 (1.74), 5.628 (0.45), 5.643 (1.55), 5.659 (1.57), 5.675 (0.43), 7.133 (1.75), 7.152 (3.22), 7.170 (1.16), 7.209 (2.76), 7.224 (2.78), 7.244 (1.09), 7.249 (0.61), 7.252 (0.96), 7.257 (1.32), 7.264 (1.95), 7.270 (2.61), 7.276 (1.72), 7.285 (1.45), 7.289 (1.98), 7.292 (1.12), 7.297 (0.68), 7.326 (2.76), 7.345 (4.69), 7.363 (2.18), 7.466 (4.18), 7.484 (3.29), 7.488 (2.36), 7.549 (3.69), 7.575 (3.55), 9.803 (3.93).
Example 264 5-fluoro-N-(2-fluoro-6-methylphenyl)-2-{[(2R,3R)-3-hydroxybutan-2-yl]oxy}-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00389
From intermediate 35 and (2R,3R)-butane-2,3-diol.
LC-MS (method A): Rt=1.04 min; MS (ESIpos): m/z=473 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.108 (16.00), 1.124 (0.43), 1.141 (0.40), 1.273 (0.41), 1.289 (0.41), 2.269 (1.07), 2.693 (0.92), 3.576 (0.42), 4.189 (1.37).
Example 265 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00390
From intermediate 35 and (2S)-1-(dimethylamino)propan-2-ol.
LC-MS (method A): Rt=0.74 min; MS (ESIpos): m/z=486 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.108 (16.00), 1.370 (3.52), 1.385 (3.55), 1.792 (0.46), 1.804 (0.64), 1.819 (0.66), 1.882 (0.63), 1.887 (0.68), 1.898 (0.79), 1.911 (0.43), 2.022 (12.64), 2.253 (6.24), 2.285 (0.46), 2.295 (0.51), 2.318 (0.62), 2.327 (0.69), 2.518 (0.69), 2.523 (0.45), 2.658 (0.51), 2.680 (0.58), 2.692 (1.47), 2.694 (1.25), 2.712 (1.91), 2.728 (0.85), 3.301 (0.55), 3.559 (0.94), 3.575 (1.66), 3.590 (0.74), 4.196 (0.66), 7.127 (0.98), 7.146 (1.47), 7.228 (0.44), 7.242 (0.47), 7.248 (0.61), 7.262 (0.51), 7.441 (1.14), 7.455 (1.12), 7.647 (1.53), 7.674 (1.47), 10.530 (1.44).
Example 266 2-{[(2R)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00391
From intermediate 35 and (2R)-1-(dimethylamino)propan-2-ol.
LC-MS (method A): Rt=0.68 min; MS (ESIpos): m/z=486 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.108 (16.00), 1.371 (0.58), 1.386 (0.58), 2.021 (2.22), 2.253 (1.09), 2.693 (0.42), 4.190 (0.61).
Example 267 5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1-(pyrrolidin-1-yl)propan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00392
From intermediate 35 and (2S)-1-(pyrrolidin-1-yl)propan-2-ol.
LC-MS (method B): Rt=1.30 min; MS (ESIneg): m/z=510 [M−H]−
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.133 (1.05), 1.263 (2.49), 1.323 (0.95), 1.335 (1.19), 1.339 (1.19), 1.354 (0.91), 1.359 (1.00), 1.379 (0.47), 1.464 (0.47), 1.484 (1.01), 1.489 (0.87), 1.513 (11.32), 1.528 (11.00), 1.599 (1.41), 1.912 (0.49), 1.920 (1.08), 1.927 (1.30), 1.933 (1.44), 1.943 (1.49), 1.947 (1.60), 1.959 (0.71), 1.963 (0.75), 1.984 (0.78), 1.990 (0.69), 1.998 (1.42), 2.003 (1.49), 2.014 (1.56), 2.019 (1.30), 2.028 (0.95), 2.042 (0.41), 2.254 (0.71), 2.274 (1.40), 2.289 (1.65), 2.309 (0.93), 2.327 (16.00), 2.364 (1.17), 2.372 (1.24), 2.395 (1.33), 2.404 (1.27), 2.425 (0.92), 2.444 (1.69), 2.459 (1.37), 2.480 (0.66), 2.799 (2.32), 2.815 (4.36), 2.831 (2.58), 3.053 (1.20), 3.077 (1.33), 3.084 (1.19), 3.109 (1.15), 3.708 (2.90), 3.724 (4.83), 3.739 (2.09), 4.548 (0.45), 4.556 (0.62), 4.563 (0.57), 4.572 (0.90), 4.580 (0.56), 4.587 (0.61), 4.596 (0.43), 6.957 (0.77), 6.978 (1.59), 7.001 (0.96), 7.038 (1.38), 7.057 (1.92), 7.134 (1.01), 7.148 (1.08), 7.155 (1.44), 7.168 (1.42), 7.174 (0.69), 7.188 (0.63), 7.362 (2.98), 7.376 (2.98), 7.960 (3.79), 7.988 (3.75), 10.744 (2.04).
Example 268 N-[2-(difluoromethyl)phenyl]-2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00393
To a solution of 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzoic acid (intermediate 20) (100 mg, 264 μmol) in N,N-dimethylformamide (5 ml) was added 1-[bis(dimethylamino)methylene]-1H-[1,2,3]triazolo[4,5-b]pyridin-1-ium 3-oxide hexafluorophosphate (HATU) (201 mg, 529 μmol) and the mixture was stirred at room temperature for 15 minutes. Then, 2-(difluoromethyl)aniline hydrochloride (94.9 mg, 529 μmol) and N,N-diisopropylethylamine (280 μl, 1.6 mmol) were added and the reaction was stirred at room temperature for three hours. The crude reaction solution was subjected to preparative HPLC (X-Bridge Prep C18 5 μm OBD, 0.1% aqueous ammonia, acetonitrile) to yield the title compound (60 mg, 45%).
LC-MS (method B): Rt=1.23 min; MS (ESIpos): m/z=504 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.474 (5.30), 1.490 (5.28), 1.600 (2.88), 1.921 (0.64), 1.934 (0.89), 1.948 (0.95), 1.965 (0.45), 1.985 (0.46), 2.004 (0.90), 2.015 (0.96), 2.029 (0.59), 2.110 (16.00), 2.285 (0.57), 2.294 (0.61), 2.317 (0.67), 2.327 (0.65), 2.769 (0.65), 2.792 (0.81), 2.800 (1.77), 2.815 (2.55), 2.824 (0.86), 2.832 (1.47), 3.709 (1.58), 3.724 (2.65), 3.739 (1.19), 4.613 (0.44), 6.725 (0.79), 6.864 (1.51), 7.003 (0.75), 7.338 (0.49), 7.357 (1.11), 7.376 (0.68), 7.421 (1.64), 7.436 (1.63), 7.501 (0.45), 7.520 (0.92), 7.539 (0.51), 7.626 (1.10), 7.638 (1.14), 7.657 (0.92), 8.013 (1.90), 8.042 (1.87), 10.669 (1.08).
Examples 269-278 were prepared as described for example 268 from the respective benzoic acid derivatives and the respective amines, as indicated.
Example 269 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00394
From intermediate 20 and 4-fluoro-2-methylaniline.
LC-MS (method B): Rt=1.23 min; MS (ESIpos): m/z=486 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.473 (4.17), 1.488 (4.19), 1.603 (2.03), 1.920 (0.45), 1.932 (0.63), 1.943 (0.69), 1.947 (0.69), 1.999 (0.61), 2.004 (0.63), 2.014 (0.68), 2.028 (0.42), 2.111 (16.00), 2.291 (0.61), 2.301 (0.68), 2.315 (6.67), 2.323 (0.90), 2.333 (0.70), 2.731 (0.64), 2.754 (0.65), 2.764 (0.56), 2.786 (0.58), 2.798 (0.94), 2.814 (1.81), 2.830 (1.02), 3.707 (1.15), 3.722 (1.90), 3.737 (0.85), 6.916 (0.45), 6.924 (0.64), 6.949 (0.65), 6.956 (0.45), 6.972 (0.60), 6.979 (0.44), 7.392 (1.24), 7.407 (1.23), 7.447 (0.61), 7.460 (0.63), 7.468 (0.59), 7.482 (0.56), 8.010 (1.45), 8.039 (1.44), 10.336 (0.86).
Example 270 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(5-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00395
From intermediate 20 and 5-fluoro-2-methylaniline.
LC-MS (method B): Rt=1.26 min; MS (ESIpos): m/z=486 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.468 (5.82), 1.483 (5.75), 1.602 (3.25), 1.920 (0.60), 1.933 (0.83), 1.944 (0.83), 1.947 (0.90), 1.963 (0.43), 1.984 (0.49), 2.000 (0.81), 2.004 (0.85), 2.015 (0.91), 2.029 (0.55), 2.152 (16.00), 2.301 (7.13), 2.330 (0.56), 2.341 (0.57), 2.363 (0.66), 2.373 (0.63), 2.735 (0.71), 2.757 (0.73), 2.767 (0.63), 2.789 (0.70), 2.798 (1.28), 2.814 (2.43), 2.831 (1.37), 3.708 (1.56), 3.723 (2.57), 3.738 (1.15), 6.820 (0.41), 6.826 (0.46), 6.840 (0.85), 6.847 (0.92), 6.861 (0.48), 6.868 (0.49), 7.155 (0.68), 7.171 (0.75), 7.176 (0.70), 7.192 (0.61), 7.428 (1.65), 7.442 (1.64), 7.544 (0.78), 7.551 (0.79), 7.570 (0.79), 7.577 (0.78), 8.044 (1.88), 8.073 (1.86), 10.214 (0.91).
Example 271 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00396
From intermediate 20 and 4-methylpyridin-3-amine.
LC-MS (method B): Rt=0.99 min; MS (ESIpos): m/z=469 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.494 (5.60), 1.509 (5.68), 1.653 (2.09), 1.922 (0.67), 1.934 (0.93), 1.946 (0.94), 1.949 (1.00), 1.965 (0.48), 1.986 (0.48), 2.006 (0.95), 2.016 (1.01), 2.030 (0.62), 2.111 (16.00), 2.279 (0.65), 2.287 (0.65), 2.311 (0.73), 2.320 (0.73), 2.341 (10.04), 2.758 (0.70), 2.783 (0.77), 2.791 (0.75), 2.800 (1.37), 2.816 (3.14), 2.833 (1.48), 3.709 (1.62), 3.724 (2.77), 3.739 (1.24), 4.597 (0.58), 7.197 (1.39), 7.209 (1.43), 7.412 (1.74), 7.426 (1.73), 7.993 (1.89), 8.022 (1.92), 8.366 (1.83), 8.379 (1.82), 8.608 (3.02), 10.662 (1.14).
Example 272 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-N-(3,5-dimethylpyrazin-2-yl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00397
From intermediate 20 and 3,5-dimethylpyrazin-2-amine.
LC-MS (method B): Rt=1.02 min; MS (ESIpos): m/z=484 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.496 (5.32), 1.511 (5.37), 1.640 (0.98), 1.920 (0.71), 1.932 (0.98), 1.947 (1.05), 1.963 (0.50), 1.984 (0.51), 2.003 (1.00), 2.014 (1.05), 2.028 (0.64), 2.120 (16.00), 2.274 (0.65), 2.282 (0.73), 2.306 (0.77), 2.314 (0.74), 2.554 (9.81), 2.562 (10.77), 2.798 (1.36), 2.814 (2.80), 2.830 (1.49), 2.843 (0.77), 2.850 (0.66), 2.875 (0.65), 3.707 (1.63), 3.722 (2.76), 3.737 (1.22), 4.589 (0.56), 7.399 (1.72), 7.413 (1.71), 7.957 (1.89), 7.986 (1.89), 8.171 (2.73), 11.249 (1.26).
Example 273 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00398
From intermediate 20 and 6-methoxy-4-methylpyridin-3-amine.
LC-MS (method B): Rt=1.12 min; MS (ESIpos): m/z=499 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.482 (4.25), 1.497 (4.28), 1.659 (1.33), 1.916 (0.49), 1.928 (0.67), 1.939 (0.69), 1.943 (0.73), 1.995 (0.65), 2.000 (0.68), 2.010 (0.72), 2.015 (0.60), 2.024 (0.44), 2.104 (16.00), 2.262 (0.80), 2.271 (7.61), 2.294 (0.73), 2.303 (0.70), 2.735 (0.63), 2.759 (0.65), 2.767 (0.57), 2.794 (1.20), 2.810 (1.92), 2.826 (1.07), 3.703 (1.19), 3.718 (2.02), 3.733 (0.90), 3.874 (0.53), 3.926 (11.06), 4.569 (0.47), 6.661 (1.99), 7.383 (1.33), 7.397 (1.36), 7.966 (1.57), 7.994 (1.53), 8.091 (2.43), 10.536 (1.13).
Example 274 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(4-methylpyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00399
From intermediate 20 and 4-methylpyridazin-3-amine.
LC-MS (method B): Rt=0.90 min; MS (ESIpos): m/z=470 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.282 (16.00), 1.509 (1.84), 1.525 (1.86), 2.171 (1.13), 2.381 (2.30), 2.819 (0.70), 2.836 (0.41), 3.712 (0.50), 3.727 (0.77), 7.424 (0.48), 7.438 (0.48), 7.923 (0.50), 7.951 (0.49), 8.947 (0.63), 8.960 (0.61).
Example 275 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00400
From intermediate 20 and 2-methoxy-4-methylpyridin-3-amine.
LC-MS (method B): Rt=1.11 min; MS (ESIpos): m/z=499 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.479 (5.44), 1.494 (5.36), 1.591 (3.64), 1.921 (0.55), 1.928 (0.66), 1.933 (0.74), 1.945 (0.76), 1.948 (0.83), 2.000 (0.73), 2.005 (0.76), 2.015 (0.80), 2.020 (0.67), 2.029 (0.49), 2.127 (5.59), 2.289 (9.73), 2.800 (1.32), 2.808 (0.60), 2.815 (2.31), 2.832 (1.34), 3.709 (1.53), 3.724 (2.49), 3.739 (1.08), 3.966 (16.00), 6.822 (1.45), 6.835 (1.47), 7.385 (1.25), 7.400 (1.25), 7.943 (1.92), 7.956 (1.89), 7.978 (2.10), 8.007 (2.09), 10.367 (0.56).
Example 276 2-{[(2S)-1-(dimethylamino)propan-2-yl]oxy}-5-fluoro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide
Figure US11787797-20231017-C00401
From intermediate 20 and o-toluidine.
LC-MS (method B): Rt=1.21 min; MS (ESIpos): m/z=468 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.261 (2.04), 1.471 (6.60), 1.487 (6.67), 1.590 (12.40), 1.923 (1.43), 1.929 (2.04), 1.941 (1.69), 1.945 (2.37), 1.949 (2.12), 1.961 (1.11), 1.986 (1.14), 2.001 (2.17), 2.017 (2.19), 2.027 (1.38), 2.155 (2.74), 2.342 (16.00), 2.626 (13.58), 2.720 (0.46), 2.781 (1.79), 2.798 (3.48), 2.816 (4.71), 2.832 (2.54), 3.697 (1.92), 3.710 (3.65), 3.712 (3.76), 3.725 (5.21), 3.740 (2.01), 7.006 (1.06), 7.128 (0.70), 7.144 (2.01), 7.162 (1.44), 7.166 (1.38), 7.222 (1.09), 7.241 (4.26), 7.259 (3.18), 7.413 (1.46), 7.428 (1.46), 7.452 (1.06), 7.466 (1.03), 7.476 (1.01), 7.490 (0.98), 7.528 (1.11), 7.649 (1.64), 7.663 (1.67), 7.672 (1.29), 7.687 (1.03), 8.044 (0.88), 8.072 (0.86).
Example 277 rac-2-{[4-(dimethylamino)butan-2-yl]oxy}-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)benzamide
Figure US11787797-20231017-C00402
From intermediate 22 and 2-fluoro-6-methylaniline.
LC-MS (method B): Rt=1.14 min; MS (ESIpos): m/z=502 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (0.60), 1.007 (2.18), 1.162 (1.63), 1.229 (2.62), 1.250 (14.10), 1.267 (1.43), 1.484 (6.89), 1.499 (7.10), 2.113 (2.61), 2.257 (0.68), 2.287 (16.00), 2.314 (0.70), 2.790 (10.53), 3.206 (1.04), 3.225 (1.65), 3.244 (0.92), 3.768 (2.24), 3.780 (3.49), 3.795 (2.69), 4.051 (2.94), 4.061 (2.75), 4.065 (3.56), 4.077 (2.35), 4.739 (12.57), 4.757 (0.82), 4.771 (0.78), 4.786 (0.45), 6.947 (0.73), 6.969 (1.38), 6.973 (1.26), 6.992 (0.88), 7.064 (1.35), 7.083 (1.86), 7.148 (0.95), 7.163 (1.02), 7.168 (1.35), 7.182 (1.29), 7.188 (0.69), 7.203 (0.60), 7.356 (2.24), 7.370 (2.24), 7.495 (0.44), 8.011 (3.22), 8.039 (3.17), 9.058 (2.34).
Example 278 rac-5-fluoro-N-(2-fluoro-6-methylphenyl)-4-(3-oxo-5,6-dihydro-3H-[1,2,4]triazolo[3,4-c][1,4]oxazin-2(8H)-yl)-2-{[1-(pyrrolidin-1-yl)propan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00403
From intermediate 23 and 2-fluoro-6-methylaniline.
LC-MS (method B): Rt=1.27 min; MS (ESIpos): m/z=514 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.134 (3.48), 0.888 (0.66), 1.262 (7.42), 1.290 (0.45), 1.327 (1.01), 1.339 (1.19), 1.358 (0.93), 1.518 (8.47), 1.533 (8.12), 1.586 (2.79), 2.279 (1.26), 2.293 (1.41), 2.328 (16.00), 2.369 (0.75), 2.377 (0.76), 2.400 (0.84), 2.408 (0.83), 2.429 (0.77), 2.447 (1.42), 2.462 (1.21), 3.064 (0.64), 3.088 (0.83), 3.120 (0.60), 3.801 (2.82), 3.814 (4.27), 3.828 (3.43), 4.080 (3.64), 4.091 (3.07), 4.094 (4.36), 4.107 (2.92), 4.566 (0.64), 4.766 (14.33), 6.960 (0.82), 6.982 (1.68), 7.006 (1.17), 7.042 (1.27), 7.061 (1.77), 7.140 (0.91), 7.154 (1.00), 7.160 (1.30), 7.174 (1.28), 7.180 (0.64), 7.194 (0.55), 7.334 (1.43), 7.348 (1.43), 7.971 (1.88), 7.999 (1.85), 10.754 (1.46).
Example 279 N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7,8,9-tetrahydro-3H-[1,2,4]triazolo[4,3-d][1,4]diazepin-2(5H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide, Salt with Hydrochloric Acid
Figure US11787797-20231017-C00404
Intermediate 36 was treated with a solution of hydrochloric acid in dioxane (4 M, 1 ml) and the mixture was stirred at room temperature for two hours. The resulting suspension was concentrated under reduced pressure to obtain the title compound as yellow solid (53 mg, 95% purity, 91%)
LC-MS (method A): Rt=0.89 min; MS (ESIneg): m/z=514 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.231 (0.70), 1.268 (0.64), 1.434 (13.39), 1.450 (13.32), 1.671 (0.89), 1.907 (0.57), 2.323 (2.61), 2.327 (3.63), 2.331 (2.61), 2.387 (0.76), 2.518 (16.00), 2.523 (10.65), 2.665 (2.68), 2.669 (3.70), 2.673 (2.61), 3.164 (4.14), 3.180 (4.53), 3.188 (5.04), 3.445 (4.65), 3.565 (14.02), 3.589 (0.45), 4.081 (5.04), 4.101 (4.72), 5.239 (0.89), 5.254 (2.17), 5.271 (2.74), 5.287 (2.04), 5.302 (0.83), 5.762 (0.57), 7.020 (3.38), 7.148 (3.95), 7.196 (4.33), 7.216 (8.67), 7.236 (5.48), 7.275 (3.44), 7.341 (0.45), 7.377 (1.27), 7.393 (2.80), 7.414 (3.63), 7.430 (1.85), 7.434 (1.85), 7.451 (0.76), 7.526 (5.23), 7.541 (5.23), 7.595 (5.80), 7.619 (5.61), 9.431 (3.76), 10.024 (12.56).
Example 280 N-(2,6-difluorophenyl)-5-fluoro-4-[(8R,S)-8-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl]-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide, mixture of diastereomers
Figure US11787797-20231017-C00405
Sulfuric acid (1.0 M, 4 ml) was added to a mixture of N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (example 29) (100 mg, 200 μmol), 2-methylpropan-2-ol (4.0 ml) and cerium(4+) disulfate (266 mg, 799 μmol). The mixture was stirred at room temperature over night. Additional cerium(4+) disulfate (266 mg, 799 μmol) was added, and the mixture was stirred at 50° C. over night, after which further cerium(4+) disulfate (266 mg, 799 μmol) was added. The mixture was again stirred at 50° C. over night. The mixture was neutralized with saturated aqueous sodium hydrogen carbonate solution. The resulting precipitate was filtered and washed with water. The filtrate was extracted once with dichloromethane and twice with ethyl acetate. The combined org. layers were washed with brine, filtered via a water-repellent filter and concentrated in vacuo. Methanol (20 ml) was added and the suspension was stirred at room temperature be for the insolubles were filtered. The filtrate was concentrated in vacuo and submitted to the preparative HPLC (X-Bridge Prep C18 5 μm, 0.1% aqueous formic acid, acetonitrile) to yield the title compound (4.6 mg, 4%)
LC-MS (method A): Rt=1.06 min; MS (ESIpos): m/z=517.4 [M+H]+
1H-NMR (600 MHz, METHANOL-d4) δ [ppm]: −0.006 (2.70), 0.005 (2.26), 1.285 (0.95), 1.555 (1.83), 1.567 (16.00), 1.578 (15.09), 1.922 (0.48), 1.933 (0.95), 1.951 (1.99), 1.969 (3.57), 1.974 (3.57), 1.988 (1.75), 2.003 (0.79), 2.006 (0.79), 2.013 (0.52), 2.064 (1.19), 2.072 (1.55), 2.082 (1.79), 2.090 (2.06), 2.099 (1.11), 2.107 (1.03), 2.203 (0.95), 2.220 (1.43), 2.225 (1.75), 2.228 (1.63), 2.237 (1.31), 2.241 (1.15), 2.250 (0.87), 2.259 (0.48), 2.656 (0.75), 2.778 (0.60), 2.788 (0.99), 2.799 (0.52), 3.608 (1.19), 3.616 (1.43), 3.621 (1.35), 3.629 (2.74), 3.637 (1.95), 3.641 (1.99), 3.649 (1.63), 3.674 (0.67), 3.684 (1.07), 3.698 (1.75), 3.708 (3.18), 3.718 (2.26), 3.729 (1.95), 3.738 (0.87), 4.629 (0.56), 4.762 (2.42), 4.770 (4.61), 4.780 (2.50), 5.144 (0.91), 5.152 (1.99), 5.163 (2.54), 5.173 (1.91), 5.184 (0.83), 6.480 (0.75), 6.495 (0.79), 7.086 (5.36), 7.100 (10.08), 7.114 (6.03), 7.355 (0.95), 7.365 (2.14), 7.369 (2.02), 7.379 (3.53), 7.389 (1.91), 7.393 (1.87), 7.403 (0.83), 7.495 (0.56), 7.504 (0.56), 7.531 (6.00), 7.540 (5.92), 7.677 (0.64), 7.694 (0.95), 7.703 (5.48), 7.719 (5.40), 7.894 (1.03).
Example 281 5-chloro-N-(2,6-difluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00406
Two a solution of S-5-chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 44, crude product from previous step, 50.0 mg, 80%-UV) in dichloromethane (3.6 ml) was added two drops of N,N-dimethylformamide followed by oxalyl chloride (11 μl, 140 μmol) at 0° C. The cooling bath was removed and the mixture was stirred for 90 min at room temperature. The solution was concentrated under reduced pressure and subsequently dried in an oil pump vacuum. 2,6-difluoroaniline (17.5 mg, 136 μmol) was dissolved in 2 ml dichloromethane and triethylamine (19 μl, 140 μmol) was added. The solution was cooled to 0° C. and a solution of the pre-formed acid chloride in 2 ml dichloromethane was slowly added. The mixture was stirred at room temperature for 1 h. The reaction mixture was then concentrated under reduced pressure and purified by preparative HPLC (XBridge Prep C18 5μ OBD; solvents: water (+0.1% ammonia), acetonitrile; gradient 5%-95% acetonitrile in 10 min; flow: 30 ml/min) to yield the desired product (28 mg, 99%-UV, 25% over 4 steps).
LC-MS (Method B): Rt=1.20 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.860 (0.55), 0.870 (0.43), 0.879 (0.72), 0.895 (0.71), 0.922 (0.53), 0.927 (1.46), 0.940 (0.83), 0.944 (3.23), 0.950 (0.51), 0.960 (1.88), 0.972 (0.90), 1.019 (0.78), 1.031 (0.46), 1.041 (8.50), 1.048 (0.63), 1.079 (0.45), 1.090 (2.26), 1.097 (0.71), 1.111 (6.27), 1.118 (1.28), 1.141 (0.89), 1.160 (0.42), 1.195 (3.10), 1.263 (2.68), 1.282 (6.27), 1.300 (5.25), 1.352 (0.80), 1.373 (0.65), 1.458 (0.46), 1.492 (0.42), 1.534 (1.80), 1.570 (7.51), 1.645 (15.68), 1.661 (16.00), 1.813 (0.57), 1.885 (0.52), 1.919 (1.01), 1.937 (3.98), 1.949 (3.72), 1.960 (3.78), 1.964 (4.01), 1.976 (1.93), 1.981 (1.96), 2.001 (1.97), 2.016 (3.69), 2.020 (3.84), 2.031 (4.06), 2.036 (3.37), 2.045 (2.53), 2.059 (1.13), 2.140 (0.77), 2.166 (0.73), 2.800 (5.39), 2.816 (10.39), 2.832 (6.01), 3.309 (1.03), 3.719 (6.74), 3.735 (11.20), 3.750 (5.09), 3.893 (0.45), 4.026 (0.55), 4.891 (1.09), 4.906 (2.56), 4.921 (3.31), 4.937 (2.50), 4.952 (1.07), 5.317 (0.51), 6.986 (1.31), 6.993 (5.45), 7.013 (10.68), 7.032 (7.20), 7.218 (1.28), 7.233 (3.81), 7.244 (14.74), 7.254 (4.79), 7.261 (2.47), 7.291 (1.17), 7.529 (0.53), 8.443 (14.21), 8.889 (5.04).
Examples 282-283 were prepared and purified by preparative HPLC as described for example 281 from 5-chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 44) and the respective amines, as indicated.
Example 282 5-chloro-N-(2-chloro-6-fluorophenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00407
The title compound was prepared from intermediate 44 and 2-chloro-6-fluoroaniline.
LC-MS (Method B): Rt=1.24 min; MS (ESIpos): m/z=533 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.888 (0.47), 0.896 (0.48), 0.927 (0.76), 0.944 (0.70), 0.960 (1.10), 1.041 (4.61), 1.091 (0.44), 1.111 (1.18), 1.195 (0.83), 1.263 (3.22), 1.283 (3.83), 1.300 (3.16), 1.352 (0.74), 1.375 (0.46), 1.440 (0.52), 1.459 (0.92), 1.477 (0.61), 1.534 (1.58), 1.567 (9.20), 1.652 (15.71), 1.668 (16.00), 1.920 (1.01), 1.938 (2.95), 1.950 (3.81), 1.965 (4.07), 1.982 (2.02), 2.002 (2.00), 2.021 (3.92), 2.032 (4.11), 2.046 (2.56), 2.060 (1.02), 2.167 (0.45), 2.802 (5.17), 2.818 (9.99), 2.834 (5.58), 3.310 (0.67), 3.721 (6.23), 3.737 (10.60), 3.751 (4.86), 4.915 (1.10), 4.931 (2.55), 4.946 (3.31), 4.961 (2.52), 4.976 (1.03), 5.319 (0.45), 7.006 (0.55), 7.111 (1.90), 7.114 (2.14), 7.134 (4.56), 7.154 (2.66), 7.158 (2.85), 7.220 (1.79), 7.234 (2.61), 7.241 (5.08), 7.249 (14.50), 7.254 (6.38), 7.261 (4.84), 7.288 (7.08), 7.307 (2.79), 7.529 (0.53), 8.459 (12.91), 8.941 (4.90).
Example 283 5-chloro-N-[1-(4-fluorophenyl)cyclopropyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00408
The title compound was prepared from intermediate 44 and 1-(4-fluorophenyl)cyclopropan-1-amine.
LC-MS (Method B): Rt=1.26 min; MS (ESIpos): m/z=539 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.041 (2.22), 1.194 (1.20), 1.262 (0.95), 1.282 (13.05), 1.302 (16.00), 1.307 (8.97), 1.327 (0.48), 1.412 (0.65), 1.533 (0.48), 1.571 (10.56), 1.587 (11.30), 1.906 (0.51), 1.913 (0.68), 1.922 (1.46), 1.929 (1.78), 1.934 (1.98), 1.945 (2.01), 1.949 (2.15), 1.961 (0.97), 1.965 (1.02), 1.986 (1.04), 1.992 (0.96), 2.000 (1.95), 2.006 (2.04), 2.016 (2.15), 2.021 (1.75), 2.030 (1.30), 2.044 (0.54), 2.780 (3.06), 2.796 (5.97), 2.812 (3.36), 3.056 (0.64), 3.699 (3.89), 3.715 (6.37), 3.730 (2.82), 4.783 (0.63), 4.799 (1.47), 4.814 (1.91), 4.830 (1.40), 4.845 (0.57), 6.957 (0.42), 6.965 (4.12), 6.970 (1.33), 6.982 (1.57), 6.987 (8.68), 6.992 (1.52), 7.003 (1.42), 7.009 (4.67), 7.017 (0.49), 7.118 (9.55), 7.312 (0.50), 7.319 (4.77), 7.325 (1.75), 7.333 (4.90), 7.336 (1.94), 7.341 (4.41), 7.349 (1.65), 7.355 (4.18), 8.027 (3.02), 8.297 (12.49).
Example 284 5-chloro-N-[2-(difluoromethyl)phenyl]-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00409
5-Chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-tri-fluoropropan-2-yl]oxy}benzoic acid (intermediate 44, crude product from previous step, 50.0 mg, 80%-UV) was dissolved in N,N-dimethylformamide and to this solution was added 1-[bis(dimethylamino)methylene]-1H-[1,2,3]triazolo[4,5-b]pyridin-1-ium 3-oxide hexafluorophosphate (HATU) (93.7 mg, 246 μmol). After stirring for 20 min at room temperature, 2-(difluoromethyl)aniline (35.3 mg, 246 μmol) and N,N-diisopropylethylamine (260 μl, 1.5 mmol) were added subsequently and the mixture was stirred overnight. The reaction mixture was then concentrated under reduced pressure and the residue was purified by preparative HPLC (XBridge Prep C18 5μ OBD; solvents: water (+0.1% ammonia), acetonitrile; gradient 5%-95% acetonitrile in 10 min; flow: 30 ml/min) to yield the desired product (13 mg, 99%-UV, 12% over 4 steps).
LC-MS (Method B): Rt=1.25 min; MS (ESIpos): m/z=531 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.134 (1.01), 0.878 (0.42), 0.888 (0.43), 0.894 (0.48), 0.927 (0.99), 1.041 (6.11), 1.188 (0.67), 1.195 (1.43), 1.205 (1.41), 1.210 (1.87), 1.214 (1.88), 1.227 (1.91), 1.230 (1.88), 1.263 (3.75), 1.283 (4.75), 1.300 (3.96), 1.439 (1.22), 1.455 (1.24), 1.516 (0.46), 1.534 (1.52), 1.574 (16.00), 1.628 (14.86), 1.644 (15.04), 1.924 (1.21), 1.939 (3.05), 1.951 (4.03), 1.963 (3.99), 1.966 (4.25), 1.982 (2.23), 2.002 (2.32), 2.018 (4.61), 2.033 (4.26), 2.047 (2.61), 2.061 (1.08), 2.315 (0.57), 2.701 (2.70), 2.775 (0.47), 2.791 (1.15), 2.801 (5.44), 2.817 (10.51), 2.833 (5.96), 3.039 (0.65), 3.706 (0.60), 3.723 (7.23), 3.738 (11.46), 3.753 (5.14), 4.862 (0.99), 4.877 (2.36), 4.892 (3.07), 4.908 (2.32), 4.923 (0.99), 6.607 (3.41), 6.744 (6.76), 6.883 (3.24), 7.062 (0.96), 7.251 (13.32), 7.309 (2.12), 7.327 (4.52), 7.346 (2.82), 7.535 (2.19), 7.551 (7.27), 7.570 (5.49), 7.647 (0.91), 7.941 (3.99), 7.962 (3.86), 8.387 (15.06), 9.283 (4.26).
Examples 285-289 were prepared and purified by preparative HPLC as described for example 284 from 5-chloro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzoic acid (intermediate 44) and the respective amines, as indicated.
Example 285 5-chloro-N-(4-methylpyridazin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00410
The title compound was prepared from intermediate 44 and 4-methylpyridazin-3-amine.
LC-MS (Method B): Rt=0.92 min; MS (ESIpos): m/z=497 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.216 (0.43), 1.261 (0.78), 1.589 (5.57), 1.698 (5.73), 1.715 (5.79), 1.933 (0.55), 1.941 (1.18), 1.948 (1.44), 1.953 (1.60), 1.965 (1.67), 1.969 (1.77), 1.981 (0.84), 1.984 (0.86), 2.005 (0.86), 2.020 (1.57), 2.025 (1.67), 2.035 (1.75), 2.040 (1.47), 2.050 (1.08), 2.063 (0.47), 2.102 (0.41), 2.375 (16.00), 2.805 (2.47), 2.812 (1.20), 2.820 (4.82), 2.836 (2.74), 3.724 (3.13), 3.739 (5.23), 3.754 (2.31), 4.903 (0.89), 4.919 (1.15), 4.934 (0.86), 7.407 (2.31), 7.410 (2.40), 7.420 (2.42), 7.422 (2.41), 7.939 (0.43), 8.125 (0.44), 8.393 (5.22), 8.986 (2.31), 8.998 (2.26), 9.714 (2.07).
Example 286 5-chloro-N-(6-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00411
The title compound was prepared from intermediate 44 and 6-methoxy-4-methylpyridin-3-amine.
LC-MS (Method B): Rt=1.15 min; MS (ESIpos): m/z=526 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.041 (1.11), 1.262 (0.78), 1.282 (7.59), 1.299 (0.78), 1.590 (2.70), 1.637 (4.20), 1.652 (4.21), 1.938 (0.66), 1.950 (0.92), 1.962 (0.93), 1.965 (1.01), 1.981 (0.50), 2.002 (0.49), 2.022 (0.96), 2.032 (1.01), 2.037 (0.85), 2.046 (0.63), 2.256 (9.96), 2.800 (1.30), 2.816 (2.58), 2.833 (1.48), 3.720 (1.63), 3.735 (2.76), 3.751 (1.25), 3.941 (16.00), 4.896 (0.65), 4.911 (0.84), 4.926 (0.63), 6.668 (2.71), 7.223 (3.89), 8.327 (3.31), 8.415 (4.84), 8.768 (1.49).
Example 287 5-chloro-N-(2-methoxy-4-methylpyridin-3-yl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00412
The title compound was prepared from intermediate 44 and 2-methoxy-4-methylpyridin-3-amine.
LC-MS (Method B): Rt=1.16 min; MS (ESIpos): m/z=526 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 1.041 (1.53), 1.252 (0.49), 1.262 (0.71), 1.282 (13.71), 1.300 (1.08), 1.587 (4.93), 1.652 (4.45), 1.669 (4.56), 1.939 (0.75), 1.951 (1.04), 1.966 (1.13), 1.982 (0.57), 2.002 (0.57), 2.022 (1.10), 2.032 (1.14), 2.046 (0.72), 2.277 (12.02), 2.802 (1.41), 2.818 (2.85), 2.834 (1.63), 3.722 (1.83), 3.738 (3.05), 3.753 (1.40), 3.960 (16.00), 4.916 (0.70), 4.931 (0.92), 4.947 (0.69), 6.828 (1.83), 6.841 (1.91), 7.228 (4.06), 7.958 (2.27), 7.970 (2.19), 8.410 (5.04), 8.880 (1.58).
Example 288 5-chloro-N-(4-fluoro-2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00413
The title compound was prepared from intermediate 44 and 4-fluoro-2-methylaniline.
LC-MS (Method B): Rt=1.26 min; MS (ESIpos): m/z=513 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.133 (0.56), 0.927 (0.71), 1.041 (5.52), 1.195 (0.52), 1.262 (1.62), 1.282 (6.14), 1.300 (3.56), 1.534 (0.97), 1.585 (4.34), 1.626 (6.65), 1.642 (6.75), 1.939 (1.08), 1.951 (1.53), 1.966 (1.65), 1.982 (0.82), 2.003 (0.78), 2.018 (1.54), 2.023 (1.56), 2.033 (1.65), 2.047 (1.02), 2.061 (0.45), 2.294 (16.00), 2.800 (2.10), 2.817 (4.21), 2.833 (2.41), 3.722 (2.64), 3.737 (4.48), 3.752 (2.08), 4.880 (0.44), 4.895 (1.06), 4.911 (1.37), 4.926 (1.05), 4.941 (0.43), 6.933 (0.43), 6.940 (0.92), 6.958 (3.27), 6.979 (2.91), 7.228 (6.08), 7.714 (0.99), 7.721 (0.49), 7.728 (1.00), 7.732 (1.02), 7.739 (1.02), 7.751 (0.87), 8.415 (7.35), 8.845 (1.95).
Example 289 5-chloro-N-(2-methylphenyl)-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00414
The title compound was prepared from intermediate 44 and 2-methylaniline.
LC-MS (Method B): Rt=1.25 min; MS (ESIpos): m/z=495 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) δ [ppm]: 0.000 (1.18), 0.844 (0.43), 1.007 (2.62), 1.063 (0.47), 1.078 (0.46), 1.160 (2.87), 1.229 (3.13), 1.248 (0.51), 1.265 (1.74), 1.499 (0.51), 1.541 (2.06), 1.558 (0.93), 1.585 (6.44), 1.602 (6.50), 1.895 (0.47), 1.904 (1.03), 1.911 (1.27), 1.916 (1.42), 1.927 (1.46), 1.932 (1.57), 1.943 (0.71), 1.947 (0.74), 1.968 (0.75), 1.973 (0.69), 1.983 (1.39), 1.987 (1.47), 1.998 (1.56), 2.003 (1.29), 2.012 (0.96), 2.026 (0.42), 2.280 (16.00), 2.766 (2.23), 2.782 (4.25), 2.799 (2.50), 3.688 (2.85), 3.704 (4.64), 3.718 (2.07), 4.839 (0.43), 4.855 (1.03), 4.870 (1.36), 4.886 (0.99), 4.901 (0.41), 7.094 (0.69), 7.097 (0.73), 7.113 (1.65), 7.116 (1.81), 7.131 (1.37), 7.134 (1.34), 7.200 (6.41), 7.209 (2.25), 7.218 (1.35), 7.224 (1.53), 7.228 (1.65), 7.256 (0.81), 7.843 (1.92), 7.864 (1.67), 8.389 (8.46), 8.878 (1.71).
Example 290 N-(2,6-difluoro-4-hydroxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide Step A: Synthesis of N-(2,6-difluoro-4-methoxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00415
Synthesized analogously to Example 1 from intermediate 17 and 2,6-difluoro-4-methoxyaniline.
LC-MS (method A): Rt=1.23 min; MS (ESIpos): 5 m/z=531.1 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.424 (5.64), 1.439 (5.73), 1.794 (1.15), 1.806 (1.64), 1.820 (1.67), 1.834 (0.86), 1.889 (1.68), 1.900 (1.73), 2.084 (4.50), 2.669 (0.41), 2.695 (1.73), 2.711 (3.36), 2.727 (1.83), 3.560 (1.94), 3.576 (3.46), 3.590 (1.69), 3.801 (16.00), 5.272 (0.90), 5.289 (1.16), 5.304 (0.86), 6.843 (3.22), 6.867 (3.33), 7.530 (2.57), 7.535 (3.15), 7.545 (2.43), 7.561 (2.48), 9.736 (3.97).
Step B
Figure US11787797-20231017-C00416
The product from Step A (320 mg, 603 μmol) was dissolved in dichloromethane (9.0 ml, 140 mmol) under an atmosphere of argon and cooled to −20° C. A solution of boron tribromide in dichloromethane (2.4 ml, 1.0 M, 2.4 mmol) was added dropwise. The mixture was stirred at 0° C. for 4h and at 6° C. for an additional 60h. The mixture was quenched at 0° C. with a mixture of methanol and water. The phases were separated and the aqueous phase was extracted once more with dichloromethane. The combined organic phases were washed with brine, dried over sodium sulfate and concentrated. HPLC purification yielded the desired product 82.0 mg (97% purity, 26% yield).
LC-MS (method C): Rt=1.07 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.418 (9.52), 1.434 (9.57), 1.793 (1.69), 1.805 (2.43), 1.820 (2.50), 1.833 (1.22), 1.888 (2.48), 1.899 (2.56), 2.084 (16.00), 2.327 (0.99), 2.522 (2.98), 2.669 (1.09), 2.694 (2.73), 2.709 (5.45), 2.725 (2.90), 3.558 (3.17), 3.574 (5.70), 3.589 (2.61), 5.249 (0.62), 5.265 (1.49), 5.282 (1.96), 5.297 (1.42), 5.313 (0.55), 6.539 (5.60), 6.562 (5.70), 7.515 (5.04), 7.521 (4.29), 7.536 (4.57), 7.540 (5.18), 9.611 (6.85), 10.432 (0.42).
Example 291 N-(2,6-difluoro-3-hydroxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00417
Synthesized analogously to Example 290 from N-(2,6-difluoro-3-methoxyphenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide which was synthesized analogously to Example 1 from intermediate 17 and 2,6-difluoro-3-methoxyaniline.
LC-MS (Method A): Rt=1.07 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.232 (0.51), 1.426 (11.47), 1.442 (11.41), 1.795 (2.60), 1.807 (3.69), 1.821 (3.79), 1.834 (1.87), 1.875 (1.84), 1.890 (3.82), 1.900 (3.97), 1.913 (2.46), 1.928 (0.96), 2.084 (3.32), 2.518 (3.59), 2.523 (2.44), 2.696 (4.05), 2.712 (7.98), 2.728 (4.21), 3.561 (4.74), 3.577 (8.55), 3.591 (3.91), 3.856 (0.46), 5.264 (0.78), 5.280 (1.88), 5.296 (2.42), 5.312 (1.76), 5.328 (0.73), 5.759 (1.03), 6.868 (0.88), 6.881 (1.08), 6.891 (2.24), 6.903 (2.33), 6.913 (1.82), 6.926 (1.60), 6.951 (2.14), 6.973 (2.99), 6.996 (1.12), 7.536 (4.66), 7.547 (6.38), 7.571 (4.71), 9.920 (16.00).
Example 292 N-(2,6-difluorophenyl)-5-fluoro-4-(8-imino-3,8-dioxo-5,6,7,8-tetrahydro-8λ6-[1,2,4]triazolo-[3,4-b][1,3]thiazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00418
Following a procedure by Tota et al. (Chem. Commun. 2017, 53, 348-351)N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-6,7-dihydro-5H-[1,2,4]triazolo[3,4-b][1,3]thiazin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (Example 250, 43.0 mg, 82.9 μmol) was dissolved in methanol (500 μl). Ammonium carbamate (19.4 mg, 249 μmol) was added followed by (diacetoxyiodo)benzene (53.4 mg, 166 μmol). The mixture was stirred at room temperature for 4h. The reaction mixture was filtered and purified by prepHPLC to yield the desired product 24.0 mg (95% purity, 50% yield).
LC-MS (Method A): Rt=1.09 min; MS (ESIpos): m/z=550 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.137 (1.59), 1.232 (0.76), 1.432 (8.88), 1.438 (9.29), 1.448 (9.71), 1.453 (8.65), 1.522 (1.29), 2.085 (12.59), 2.116 (0.71), 2.327 (3.47), 2.331 (2.47), 2.336 (1.12), 2.518 (14.88), 2.523 (9.82), 2.669 (3.47), 2.673 (2.47), 2.678 (1.12), 2.729 (3.41), 2.889 (4.12), 3.452 (0.94), 3.530 (0.71), 3.543 (1.24), 3.564 (1.76), 3.580 (2.41), 3.593 (1.53), 3.611 (1.71), 3.623 (2.65), 3.640 (1.82), 3.661 (1.53), 3.674 (0.76), 3.773 (4.71), 3.787 (8.76), 3.802 (4.47), 5.270 (0.82), 5.286 (1.88), 5.301 (2.41), 5.316 (1.82), 5.333 (0.76), 5.760 (16.00), 5.924 (7.65), 7.195 (4.18), 7.215 (8.71), 7.235 (5.41), 7.374 (0.94), 7.390 (2.12), 7.411 (2.76), 7.427 (1.65), 7.447 (0.71), 7.605 (4.65), 7.619 (4.82), 7.631 (6.35), 7.656 (5.94), 7.950 (0.47), 10.067 (10.41).
Example 293 N-(2,6-difluorophenyl)-5-fluoro-4-(7-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00419
LIST OF ABBREVIATIONS
ATP adenosine triphosphate
BSA bovine serum albumin
CYP Cytochrome P450 enzyme
DNA deoxyribonucleic acid
dNTP deoxynucleoside triphosphate
Δ deletion from amino acid
EDTA Ethylenediaminetetraacetate
HMFM Hogness Modified Freezing medium
LB Luria-Bertani broth
LPSd lipopolysaccharide deficient
mod modified
OD550 optical density at 550 nm
PCR polymerase chain reaction
pelB pelB Leader sequence from thr vector pET22b+
POR human cytochrome p450 oxidoreductase
rpm rotation per minute
SAP shrimp alkaline phosphatase
The company GENE Bridges/Heidelberg performed a knockout of the gene rfaP of Escherichia coli DH5α providing the strain Escherichia coli DH5α LPSd.
Culture media were prepared in demineralized water and sterilized at 121° C. for 20 minutes or sterile filtered. All solutions were prepared with MilliQ water and sterile filtered, unless otherwise described. All preparations were performed under sterile conditions.
Luria-Bertani broth (LB) medium: 10 g/L bacto tryptone, 5 g/L bacto yeast extract, 10 g/L sodium chloride.
Luria-Bertani broth agar: 10 g/L bacto tryptone, 5 g/L bacto yeast extract, 10 g/L sodium chloride, 15 g/L agar, 50 mg/L ampicillin, 17 mg/L chloramphenicol.
10× Hogness Modified Freezing medium (HMFM): aqueous solution of 0.27M KH2PO4(monopotassiumphosphate), 0.13M K2HPO4, 68 mM (NH4)2SO4, 4 mM MgSO4, 15 mM trisodium citrate, 36 w/v % glycerol.
2 fold yeast tryptone (2YT) medium: 16 g/L bacto tryptone, 10 g/L bacto yeast extract, 5 g/L sodium chloride.
Plasmid 1: pACYC_pelB_POR:
The pACYC_pelB_POR-plasmid is a derivate of the commercially available pACYC(Duet)-plasmid of the company Novagen. To generate this plasmid two fragments, pACYC_mod and pelB_POR were ligated.
Creation of the pelB_POR Fragment:
The human NAPDH hemoprotein reductase (POR) was amplified via two primer containing the restriction sites BamHI (GAGGATCCGATGGGAGACTCCCACGTG) (SEQ ID NO: 3) and SalI (GAGAGTCGACCTAGCTCCACACGTCCAG) (SEQ ID NO: 4) out of the plasmid pMPSV-CMV::hOR. pMPSV-CMV::hOR plasmid (1 μL) was mixed with MilliQ water (51.5 μL), expand buffer with MgCl2 (7.5 μL), dNTPs (6 μL), Taq-Expand (1 μL), forward primer (4 μL) and reverse primer (4 μL). The PCR was performed according to the following procedure: 1) 94° C. for 5 minutes, 2) 94° C. for 30 seconds, 3) 60° C. for 30 seconds, 4) 72° C. for 90 seconds, 5) go back to step 2 (30 cycles), 6) 72° C. for 5 minutes, 7) 15° C. forever. To combine the POR with an upstream pelB-sequence, the POR has to be cloned into the empty vector pET22b+. As well as the amplified PCR fragment the empty vector pET22b+, provided by the company Novagen, was digested with the restriction enzymes BamHI and SalI. The first digestion was performed with BamHI. Either the empty vector pET22b+ or the amplified PCR fragment (30 μL) was mixed with 10× buffer NEB3.1 (4 μl), BSA solution (10 mg/mL, 0.4 μL), BamHI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested PCR fragment and empty vector pET22b+ were purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with SalI. Either the BamHI digested empty vector pET22b+ or the BamHI digested PCR fragment (30 μL) was mixed with 10× buffer NEB3.1 (4 μl), BSA solution (10 mg/mL, 0.4 μL), SalI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. For the double-digested vector a dephosphorylation with a shrimp alkaline phosphatase followed. The double-digested empty vector pET22b+(40 μL) was mixed with 10×SAP buffer (5 μl), SAP enzyme (2 μL) and MilliQ water (3 μL). After incubation at 37° C. for 30 minutes the reaction was stopped by incubating for 20 minutes at 65° C. The double-digested PCR fragment and the dephosphorylated double-digested empty vector were purified via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed. The ligation of the double-digested POR and the double-digested pET22b+-vector was performed with T4 DNA Ligase. Cut vector (1 μL) was mixed with PCR product (1 μL), 10× Ligase buffer with 10 mM ATP (1.5 μL), T4 DNA Ligase (1 μL) and MilliQ water (10.5 μL). After incubation for 30 minutes at room temperature the ligated DNA was purified by ethanol precipitation. Ligated DNA (15 μL) was mixed with glycogen (1 μL), ammonium acetate (7.5 μL) and 100% ethanol (37.5 μL). After 5 minutes at room temperature a centrifugation at 14000 rpm for 5 minutes was used to precipitate the DNA. The supernatant was removed and the DNA washed with 75% ethanol (100 μL), before the DNA was air-dried and resuspended in MilliQ water (12 μL). The ligated DNA was digested with the restriction enzymes NdeI und XhoI. The first digestion was performed with NdeI. The ligated DNA (30 μL) was mixed with 10× buffer NEB4 (4 μl), NdeI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested vector was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with XhoI. The NdeI digested DNA (30 μL) was mixed with 10× buffer NEB4 (4 μl), BSA solution (10 mg/mL, 0.4 μL), XhoI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The double-digested DNA was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed to isolate the pelB_POR fragment.
Creation of the pACYC_mod Fragment:
To change the upstream promotor of the pACYC(Duet)-vector, the pACYC(Duet)-vector as well as the pCW_CYP1A2 vector, provided by the company Oxford Biomedical Research, was digested with the restriction enzymes MluI and XhoI.
The first digestion was performed with MluI. Either the pACYC(Duet)-vector or the pCW_CYP1A2 vector (30 μL) was mixed with 10× buffer NEB3.1 (4 μl), BSA solution (10 mg/mL, 0.4 μL), MluI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested vector was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with XhoI. Either the MluI digested pACYC(Duet)-vector or the MluI digested pCW_CYP1A2 (30 μL) was mixed with 10× buffer NEB3.1 (4 μl), BSA solution (10 mg/mL, 0.4 μL), XhoI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. For the double-digested pACYC(Duet)-vector a dephosphorylation with a shrimp alkaline phosphatase followed. The double-digested pACYC(Duet) vector (40 μL) was mixed with 10×SAP buffer (5 μl), SAP enzyme (2 μL) and MilliQ water (3 μL). After incubation at 37° C. for 30 minutes the reaction was stopped by incubating for 20 minutes at 65° C. The double-digested CYP1A2 fragment and the dephosphorylated double-digested pACYC(Duet) vector were purified via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed. The ligation of the double-digested CYP1A2 fragment and the double-digested pACYC(Duet)-vector was performed with T4 DNA Ligase. The cut vector (1 μL) was mixed with cut CYP1A2 fragment (1 μL), 10× Ligase buffer with 10 mM ATP (1.5 μL), T4 DNA Ligase (1 μL) and MilliQ water (10.5 μL). After incubation for 30 minutes at room temperature the ligated DNA was purified by ethanol precipitation. Ligated DNA (15 μL) was mixed with glycogen (1 μL), ammonium acetate (7.5 μL) and 100% ethanol (37.5 μL). After 5 minutes at room temperature a centrifugation at 14000 rpm for 5 minutes was used to precipitate the DNA. The supernatant was removed and the DNA washed with 75% ethanol (100 μL), before the DNA was air-dried and resuspended in MilliQ water (12 μL). The ligated DNA was digested with the restriction enzymes NdeI und XhoI. The first digestion was performed with NdeI. The ligated DNA (30 μL) was mixed with 10× buffer NEB4 (4 μl), NdeI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested vector was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with XhoI. The NdeI digested DNA (30 μL) was mixed with 10× buffer NEB4 (4 μl), BSA solution (10 mg/mL, 0.4 μL), XhoI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. Afterwards the double-digested pACYC_mod-vector was a dephosphorylated with a shrimp alkaline phosphatase. The vector (40 μL) was mixed with 10× SAP buffer (5 μl), SAP enzyme (2 μL) and MilliQ water (3 μL). After incubation at 37° C. for 30 minutes the reaction was stopped by incubating for 20 minutes at 65° C. It followed a PCR purification via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed to isolate the pACYC_mod fragment with modified promotor.
Assembly of the pACYC_pelB_POR Plasmid:
The pelB_POR fragment (1 μL) was mixed with pACYC_mod fragment (1 μL), 10×Ligase buffer with 10 mM ATP (1.5 μL), T4 DNA Ligase (1 μL) and MilliQ water (10.5 μL). After incubation for 30 minutes at room temperature the ligated DNA was purified by ethanol precipitation. Ligated DNA (15 μL) was mixed with glycogen (1 μL), ammonium acetate (7.5 μL) and 100% ethanol (37.5 μL). After 5 minutes at room temperature a centrifugation at 14000 rpm for 5 minutes was used to precipitate the DNA. The supernatant was removed and the DNA washed with 75% ethanol (100 μL), before the DNA was air-dried and resuspended in MilliQ water (12 μL).
The analysis of the gene sequence of pACYC_pelB_POR at LGC Genomics GmbH:
Seq. ID No. 1
ggccgcggcaaagccgtttttccataggctccgcccccctgacaagcatc
acgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactata
aagataccaggcgtttccccctggcggctccctcgtgcgctctcctgtt
cctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgt
ctcattccacgcctgacactcagttccgggtaggcagttcgctccaagc
tggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatc
cggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcacca
ctggcagcagccactggtaattgatttagaggagttagtcttgaagtca
tgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctc
ctccaagccagttacctcggttcaaagagttggtagctcagagaacctt
cgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagatt
acgcgcagaccaaaacgatctcaagaagatcatcttattaatcagataa
aatatttctagatttcagtgcaatttatctcttcaaatgtagcacctga
agtcagccccatacgatataagttgtaattctcatgttagtcatgcccc
gcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcgg
tcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttg
cgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcatt
aatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgcca
gggtggtttttcttttcaccagtgagacgggcaacagctgattgccctt
caccgcctggccctgagagagttgcagcaagcggtccacgctggtttgc
cccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataac
atgagctgtcttcggtatcgtcgtatcccactaccgagatgtccgcacc
aacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatc
tgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagca
tttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccg
ttccgctatcggctgaatttgattgcgagtgagatatttatgccagcca
gccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcg
cgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgt
accgtcttcatgggagaaaataatactgttgatgggtgtctggtcagag
acatcaagaaataacgccggaacattagtgcaggcagcttccacagcaa
tggcatcctggtcatccagcggatagttaatgatcagcccactgacgcg
ttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgctt
cgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgag
atttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactgga
ggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgcc
acgcggttgggaatgtaattcagctccgccatcgccgcttccacttttt
cccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaac
ggtctgataagagacaccggcatactctgcgacatcgtataacgttact
ggtttcacattcaccaccctgaattgactctcttccgggcgctatcatg
ccataccgcgaaaggttttgcaccattcgatggtgtcctggcacgacag
gtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtaagt
tagctcactcattaggcaccccaggctttacactttatgcttccggctc
gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
gatcgatccatcgatgagcttactccccatccccctgttgacaattaat
catcggctcgtataatgtgtggaattgtgagcggataacaatttcacac
aggaaacaggatcagcttactccccatccccctgttgacaattaatcat
cggctcgtataatgtgtggaattgtgagcggataacaatttcacacagg
aaacaggatccatcgatgcttaggaggtcatatgaaatacctgctgccg
accgctgctgctggtctgctgctcctcgctgcccagccggcgatggcca
tggatatcggaattaattcggatccgatgggagactcccacgtggacac
cagctccaccgtgtccgaggcggtggccgaagaagtatctcttttcagc
atgacggacatgattctgttttcgctcatcgtgggtctcctaacctact
ggttcctctttagaaagaaaaaagaagaagtccccgagttcaccaaaat
tcagacattgacctcctctgtcagagagagcagctttgtggaaaagatg
aagaaaacggggaggaacatcatcgtgttctacggctcccagacgggga
ctgcagaggagtttgccaaccgcctgtccaaggacgcccaccgctacgg
gatgcgaggcatgtcagcggaccctgaggagtatgacctggccgacctg
agcagcctgccagagatcgacaacgccctggtggttttctgcatggcca
cctacggtgagggagaccccaccgacaatgcccaggacttctacgactg
gctgcaggagacagacgtggatctctctggggtcaagttcgcggtgttt
ggtcttgggaacaagacctacgagcacttcaatgccatgggcaagtacg
tggacaagcggctggagcagctcggcgcccagcgcatctttgagctggg
gttgggcgacgacgatgggaacttggaggaggacttcatcacctggcga
gagcagttctggccggccgtgtgtgaacactttggggtggaagccactg
gcgaggagtccagcattcgccagtacgagcttgtggtccacaccgacat
agatgcggccaaggtgtacatgggggagatgggccggctgaagagctac
gagaaccagaagcccccctttgatgccaagaatccgttcctggctgcag
tcaccaccaaccggaagctgaaccagggaaccgagcgccacctcatgca
cctggaattggacatctcggactccaaaatcaggtatgaatctggggac
cacgtggctgtgtacccagccaacgactctgctctcgtcaaccagctgg
gcaaaatcctgggtgccgacctggacgtcgtcatgtccctgaacaacct
ggatgaggagtccaacaagaagcacccattcccgtgccctacgtcctac
cgcacggccctcacctactacctggacatcaccaacccgccgcgtacca
acgtgctgtacgagctggcgcagtacgcctcggagccctcggagcagga
gctgctgcgcaagatggcctcctcctccggcgagggcaaggagctgtac
ctgagctgggtggtggaggcccggaggcacatcctggccatcctgcagg
actgcccgtccctgcggccccccatcgaccacctgtgtgagctgctgcc
gcgcctgcaggcccgctactactccatcgcctcatcctccaaggtccac
cccaactctgtgcacatctgtgcggtggttgtggagtacgagaccaagg
ccggccgcatcaacaagggcgtggccaccaactggctgcgggccaagga
gcctgccggggagaacggcggccgtgcgctggtgcccatgttcgtgcgc
aagtcccagttccgcctgcccttcaaggccaccacgcctgtcatcatgg
tgggccccggcaccggggtggcacccttcataggcttcatccaggagcg
ggcctggctgcgacagcagggcaaggaggtgggggagacgctgctgtac
tacggctgccgccgctcagatgaggactacctgtaccgggaggagctgg
cgcagttccacagggacggtgcgctcacccagctcaacgtggccttctc
ccgggagcagtcccacaaggtctacgtccagcacctgctaaagcaagac
cgagagcacctgtggaagttgatcgaaggcggtgcccacatctacgtct
gtggggatgcacggaacatggccagggatgtgcagaacaccttctacga
catcgtggctgagctcggggccatggagcacgcgcaggcggtggactac
atcaagaaactgatgaccaagggccgctactccctggacgtgtggagct
aggtcgacaagcttgcggccgcactcgagtctggtaaagaaaccgctgc
tgcgaaatttgaacgccagcacatggactcgtctactagcgcagcttaa
ttaacctaggctgctgccaccgctgagcaataactagcataaccccttg
gggcctctaaacgggtcttgaggggttttttgctgaaacctcaggcatt
tgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaac
cagcaatagacataagcggctatttaacgaccctgccctgaaccgacga
ccgggtcgaatttgctttcgaatttctgccattcatccgcttattatca
cttattcaggcgtagcaaccaggcgtttaagggcaccaataactgcctt
aaaaaaattacgccccgccctgccactcatcgcagtactgttgtaattc
attaagcattctgccgacatggaagccatcacaaacggcatgatgaacc
tgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgc
ccatagtgaaaacgggggcgaagaagttgtccatattggccacgtttaa
atcaaaactggtgaaactcacccagggattggctgagacgaaaaacata
ttctcaataaaccctttagggaaataggccaggttttcaccgtaacacg
ccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggta
ttcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtg
taacaagggtgaacactatcccatatcaccagctcaccgtctttcattg
ccatacggaactccggatgagcattcatcaggcgggcaagaatgtgaat
aaaggccggataaaacttgtgcttatttttctttacggtctttaaaaag
gccgtaatatccagctgaacggtctggttataggtacattgagcaactg
actgaaatgcctcaaaatgttctttacgatgccattgggatatatcaac
ggtggtatatccagtgatttttttctccattttagcttccttagctcctg
aaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcatt
atggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgc
caaaagttggcccagggcttcccggtatcaacagggacaccaggattta
tttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaag
tgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgttt
ttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttca
gctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagc
gctagcggagtgtatactggcttactatgttggcactgatgagggtgtc
agtgaagtgcttcatgtggcaggagaaaaaaggctgcaccggtgcgtca
gcagaatatgtgatacaggatatattccgcttcctcgctcactgactcg
ctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggg
gcggagatttcctggaagatgccaggaagatacttaacagggaagtgag
ag
Plasmid 2: pETDuet_Δ3_CYP2C19:
The pETDuet_Δ3_CYP2C19-plasmid is a derivate of the commercially available pETDuet-1-plasmid of the company Novagen. To generate this plasmid two fragments, pETDuet_mod and Δ3_CYP2C19 were ligated.
Creation of the Δ3_CYP2C19 Fragment:
The human monooxygenase CYP2C19 was amplified via two primer containing the restriction sites NdeI (CCATCGATCATATGGCTCGACAATCTTCTGGACGAGGAAAACTCCCT) (SEQ ID NO: 5) and XhoI (ATTGAGACTCGAGTCAGACAGGAATGAAGCACA) (SEQ ID NO: 6) out of the plasmid pBLUESCRIPTS SK+_2C19. Using the forward primer containing the NdeI restriction site the first 20 amino acids of the CYP2C19 enzymes were deleted und lead to the Δ3_CYP2C19 fragment.
pBLUESCRIPTS SK+_2C19 (1 μL) was mixed with MilliQ water (51.5 μL), expand buffer with MgCl2 (7.5 μL), dNTPs (6 μL), Taq-Expand (1 μL), forward primer (4 μL) and reverse primer (4 μL). The PCR was performed after following program: 1) 94° C. for 5 minutes, 2) 94° C. for 30 seconds, 3) 60° C. for 30 seconds, 4) 72° C. for 90 seconds, 5) go back to step 2 (30 cycles), 6) 72° C. for 5 minutes, 7) 15° C. forever. The amplified PCR fragment was then digested with the restriction enzymes NdeI and XhoI. The first digestion was performed with NdeI. The amplified 25 PCR fragment (30 μL) was mixed with 10× buffer NEB4 (4 μl), NdeI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested PCR fragment was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with XhoI.
The NdeI digested PCR fragment (30 μL) was mixed with 10× buffer NEB4 (4 μl), BSA solution (10 mg/mL, 0.4 μL), XhoI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The double-digested PCR fragment was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed to isolated the Δ3_CYP2C19 fragment.
Creation of the pETDuet_mod Fragment:
To change the upstream promotor of the pETDuet-1-vector, the pETDuet-1-vector as well as the pCW_CYP1A2 vector, provided by the company Oxford Biomedical Research, was digested with the restriction enzymes MluI and XhoI.
The first digestion was performed with MluI. Either the pETDuet-1-vector or the pCW_CYP1A2 vector (30 μL) was mixed with 10× buffer NEB4 (4 μl), BSA solution (10 mg/mL, 0.4 μL), MluI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested vector was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with XhoI. Either the MluI digested pETDuet-1-vector or the MluI digested pCW_CYP1A2 (30 μL) was mixed with 10× buffer NEB4 (4 μl), BSA solution (10 mg/mL, 0.4 μL), XhoI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. For the double-digested pETDuet-1-vector a dephosphorylation with a shrimp alkaline phosphatase followed. The double-digested pETDuet-1 vector (40 μL) was mixed with 10×SAP buffer (5 μl), SAP enzyme (2 μL) and milliQ water (3 μL). After incubation at 37° C. for 30 minutes the reaction was stopped by incubating for 20 minutes at 65° C. The double-digested CYP1A2 fragment and the dephosphorylated double-digested pETDuet-1 vector were purified via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed. The ligation of the double-digested CYP1A2 fragment and the double-digested pETDuet-1-vector was performed with T4 DNA Ligase. The cut vector (1 μL) was mixed with cut CYP1A2 fragment (1 μL), 10× Ligase buffer with 10 mM ATP (1.5 μL), T4 DNA Ligase (1 μL) and MilliQ water (10.5 μL). After incubation for 30 minutes at room temperature the ligated DNA was purified by ethanol precipitation. Ligated DNA (15 μL) was mixed with glycogen (1 μL), ammonium acetate (7.5 μL) and 100% ethanol (37.5 μL). After 5 minutes at room temperature a centrifugation at 14000 rpm for 5 minutes was used to precipitate the DNA. The supernatant was removed and the DNA washed with 75% ethanol (100 μL), before the DNA was air-dried and resuspended in MilliQ water (12 μL). The ligated DNA was digested with the restriction enzymes NdeI und XhoI. The first digestion was performed with NdeI. The ligated DNA (30 μL) was mixed with 10× buffer NEB4 (4 μl), NdeI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. The digested vector was purified via the QIAquick PCR Purification kit from Qiagen. Afterwards the second digestion was performed with XhoI. The NdeI digested DNA (30 μL) was mixed with 10× buffer NEB4 (4 μl), BSA solution (10 mg/mL, 0.4 μL), XhoI restriction enzyme (1 μL) and MilliQ water (5 μL). After incubation at 37° C. for 1 hour the reaction was stopped by incubating for 20 minutes at 65° C. Afterwards the double-digested pETDuet_mod-vector was a dephosphorylated with a shrimp alkaline phosphatase. The vector (40 μL) was mixed with 10×SAP buffer (5 μl), SAP enzyme (2 μL) and milliQ water (3 μL). After incubation at 37° C. for 30 minutes the reaction was stopped by incubating for 20 minutes at 65° C. It followed a PCR purification via the QIAquick PCR Purification kit from Qiagen. Afterwards a gel extraction with the QIAquick Gel Extraction Kit from Qiagen followed to isolate the pETDuet_mod fragment with modified promotor.
Assembly of the pETDuet_Δ3_CYP2C19 Plasmid:
The Δ3_CYP2C19 fragment (1 μL) was mixed with pETDuet_mod fragment (1 μL), 10× Ligase buffer with 10 mM ATP (1.5 μL), T4 DNA Ligase (1 μL) and MilliQ water (10.5 μL). After incubation for 30 minutes at room temperature the ligated DNA was purified by ethanol precipitation. Ligated DNA (15 μL) was mixed with glycogen (1 μL), ammonium acetate (7.5 μL) and 100% ethanol (37.5 μL). After 5 minutes at room temperature a centrifugation at 14000 rpm for 5 minutes was used to precipitate the DNA. The supernatant was removed and the DNA washed with 75% ethanol (100 μL), before the DNA was air-dried and resuspended in MilliQ water (12 μL).
The analysis of the gene sequence of pETDuet_delta3_CYP2C19 at LGC Genomics GmbH:
Seq. ID. No. 2
ttgaagcatttatcagggttattgtctcatgagcggatacatatttgaa
tgtatttagaaaaataaacaaataggtcatgaccaaaatcccttaacgt
gagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggat
cttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaa
aaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacca
actctttttccgaaggtaactggcttcagcagagcgcagataccaaata
ctgtccttctagtgtagccgtagttaggccaccacttcaagaactctgt
agcaccgcctacatacctcgctctgctaatcctgttaccagtggctgct
gccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagt
taccggataaggcgcagcggtcgggctgaacggggggttcgtgcacaca
gcccagcttggagcgaacgacctacaccgaactgagatacctacagcgt
gagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggt
atccggtaagcggcagggtcggaacaggagagcgcacgagggagcttcc
agggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctc
tgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctat
ggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctg
gccttttgctcacatgttctttcctgcgttatcccctgattctgtggat
aaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaa
cgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgat
gcggtattttctccttacgcatctgtgcggtatttcacaccgcaatggt
gcactctcagtacaatctgctctgatgccgcatagttaagccagtatac
actccgctatcgctacgtgactgggtcatggctgcgccccgacacccgc
caacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgc
ttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttt
tcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcag
cgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccag
ctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgg
gccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgta
agggggatttctgttcatgggggtaatgataccgatgaaacgagagagg
atgctcacgatacgggttactgatgatgaacatgcccggttactggaac
gttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaa
aatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgtt
ccacagggtagccagcagcatcctgcgatgcagatccggaacataatgg
tgcagggcgctgacttccgcgtttccagactttacgaaacacggaaacc
gaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcag
tcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaa
ggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcat
gctagtcatgccccgcgcccaccggaaggagctgactgggttgaaggct
ctcaagggcatcggtcgagatcccggtgcctaatgagtgagctaactta
cattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtc
gtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttg
cgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaaca
gctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtc
cacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaac
ggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccg
agatgtccgcaccaacgcgcagcccggactcggtaatggcgcgcattgc
gcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatg
ccctcattcagcatttgcatggtttgttgaaaaccggacatggcactcc
agtcgccttcccgttccgctatcggctgaatttgattgcgagtgagata
tttatgccagccagccagacgcagacgcgccgagacagaacttaatggg
cccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctcca
cgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatggg
tgtctggtcagagacatcaagaaataacgccggaacattagtgcaggca
gcttccacagcaatggcatcctggtcatccagcggatagttaatgatca
gcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggc
ttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagt
tgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgca
gggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgc
cagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgcc
gcttccactttttcccgcgttttcgcagaaacgtggctggcctggttca
ccacgcgggaaacggtctgataagagacaccggcatactctgcgacatc
gtataacgttactggtttcacattcaccaccctgaattgactctcttcc
gggcgctatcatgccataccgcgaaaggttttgcaccattcgatggtgt
cctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgc
aattaatgtaagttagctcactcattaggcaccccaggctttacacttt
atgcttccggctcgtataatgtgtggaattgtgagcggataacaatttc
acacaggaaacaggatcgatccatcgatgagcttactccccatccccct
gttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggat
aacaatttcacacaggaaacaggatcagcttactccccatccccctgtt
gacaattaatcatcggctcgtataatgtgtggaattgtgagcggataac
aatttcacacaggaaacaggatccatcgatgcttaggaggtcatatggc
tcgacaatcttctggacgaggaaaactccctcctggccccactcctctc
ccagtgattggaaatatcctacagatagatattaaggatgtcagcaaat
ccttaaccaatctctcaaaaatctatggccctgtgttcactctgtattt
tggcctggaacgcatggtggtgctgcatggatatgaagtggtgaaggaa
gccctgattgatcttggagaggagttttctggaagaggccatttcccac
tggctgaaagagctaacagaggatttggaatcgttttcagcaatggaaa
gagatggaaggagatccggcgtttctccctcatgacgctgcggaatttt
gggatggggaagaggagcattgaggaccgtgttcaagaggaagcccgct
gccttgtggaggagttgagaaaaaccaaggcttcaccctgtgatcccac
tttcatcctgggctgtgctccctgcaatgtgatctgctccattattttc
cagaaacgtttcgattataaagatcagcaatttcttaacttgatggaaa
aattgaatgaaaacatcaggattgtaagcaccccctggatccagatatg
caataattttcccactatcattgattatttcccgggaacccataacaaa
ttacttaaaaaccttgcttttatggaaagtgatattttggagaaagtaa
aagaacaccaagaatcgatggacatcaacaaccctcgggactttattga
ttgcttcctgatcaaaatggagaaggaaaagcaaaaccaacagtctgaa
ttcactattgaaaacttggtaatcactgcagctgacttacttggagctg
ggacagagacaacaagcacaaccctgagatatgctctccttctcctgct
gaagcacccagaggtcacagctaaagtccaggaagagattgaacgtgtc
attggcagaaaccggagcccctgcatgcaggacaggggccacatgccct
acacagatgctgtggtgcacgaggtccagagatacatcgacctcatccc
caccagcctgccccatgcagtgacctgtgacgttaaattcagaaactac
ctcattcccaagggcacaaccatattaacttccctcacttctgtgctac
atgacaacaaagaatttcccaacccagagatgtttgaccctcgtcactt
tctggatgaaggtggaaattttaagaaaagtaactacttcatgcctttc
tcagcaggaaaacggatttgtgtgggagagggcctggcccgcatggagc
tgtttttattcctgaccttcattttacagaactttaacctgaaatctct
gattgacccaaaggaccttgacacaactcctgttgtcaatggatttgct
tctgtcccgcccttctatcagctgtgcttcattcctgtctgactcgagt
ctggtaaagaaaccgctgctgcgaaatttgaacgccagcacatggactc
gtctactagcgcagcttaattaacctaggctgctgccaccgctgagcaa
taactagcataaccccttggggcctctaaacgggtcttgaggggtttttt
gctgaaaggaggaactatatccggattggcgaatgggacgcgccctgta
gcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgc
tacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcc
tttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggc
tccctttagggttccgatttagtgctttacggcacctcgaccccaaaaa
acttgattagggtgatggttcacgtagtgggccatcgccctgatagacg
gtttttcgccctttgacgttggagtccacgttctttaatagtggactct
tgttccaaactggaacaacactcaaccctatctcggtctattcttttga
tttataagggattttgccgatttcggcctattggttaaaaaatgagctg
atttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaa
tttctggcggcacgatggcatgagattatcaaaaaggatcttcacctag
atccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatg
agtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctat
ctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtc
gtgtagataactacgatacgggagggcttaccatctggccccagtgctg
caatgataccgcgagacccacgctcaccggctccagatttatcagcaat
aaaccagccagccggaagggccgagcgcagaagtggtcctgcaacttta
tccgcctccatccagtctattaattgttgccgggaagctagagtaagta
gttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcat
cgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcc
caacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcgg
ttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagt
gttatcactcatggttatggcagcactgcataattctcttactgtcatg
ccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcat
tctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaat
acgggataataccgcgccacatagcagaactttaaaagtgctcatcatt
ggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttga
gatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatc
ttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaat
gccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatac
tcttcctttttcaatcatga
Generation of Chemo-Competent E. coli DH5a LPSd Cells:
Luria-Bertani broth medium (5 mL) was inoculated with 2 μl of the strain E. coli DH5a LPSd which was stored as glycerol culture. This culture was shaken at 37° C. and 165 rpm overnight. The overnight culture (1 mL) was used to inoculate Luria-Bertani broth medium (25 mL). The culture was shaken at 37° C. and 175 rpm. After 2 hours, the OD550 was 0.4, whereupon the culture was chilled in ice for 10 minutes and subsequently subjected to centrifugation at 4° C. and 4000 rpm for 10 minutes. The supernatant was discarded and the cell pellet was suspended in a cold and sterile aqueous solution of calcium chloride, CaCl2 (5 mL, 0.1 M). The mixture was subjected to centrifugation at 4° C. and 4000 rpm for 10 minutes. The supernatant was discarded and the cell pellet was suspended in a cold and sterile aqueous solution of calciumchloride, CaCl2 (1 mL, 0.1 M). The chemo-competent cells were aliquoted a 200 μL.
Transformation of Chemo-Competent E. coli DH5a LPSd Cells:
Plasmid 1 (2.5 μL) and plasmid 2 (2.5 μL) were added to chemo-competent E. coli DH5a LPSd cells (200 μL) and the suspension was chilled in ice for 30 minutes. Luria-Bertani broth medium (0.5 mL, 37° C.) was added and the culture was shaken at 37° C. and 800 rpm for 1 hour and subsequently subjected to centrifugation at 4000 rpm for 3 minutes. The cells were placed on Luria-Bertani broth agar plates with ampicillin (50 mg/L) and chloramphenicol (17 mg/L) and incubated at 37° C. overnight. The E. coli DH5a LPSd cells harbouring the plasmids were stored in 96 micro-titer plates. To a mixture of 10×HMFM medium (2 mL) and 2YT medium (18 mL) ampicillin (50 mg/L) and chloramphenicol (17 mg/L) were added. Each well of the micro-titer plate containing 200 μL media was inoculated with a single colony of the agar plate. The microtiter plates were shaken at 37° C. and 800 rpm for 16 hours and subsequently stored at −80° C. until further use.
Cultivation of E. coli DH5α LPSd A_pel_POR_D_d3_2C19 and Protein Expression:
Oxford trace metal solution (1 L): aqueous solution of iron(III) chloride, FeCl3 hexahydrate (27 g/L), ZnCl2 (1.31 g/L), cobalt(II) chloride, CoCl2 hexahydrate (2.87 g/L), copper(II) chloride, dihydrate CuCl2×2H2O (1.27 g/L), boric acid, H3BO3 (0.5 g/L), calcium chlorideCaCl2 dihydrate (1.32 g/L), sodium molybdateNa2MoO4 dihydrate (2.35 g/L) and hydrochloric acid (37%, 100 mL).
Media of the preculture: tryptone (16 g/L), sodium chloride (10 g/L) und yeast extract (10 g/L) in water adjusted to pH 7.2 to 7.4 with aqueous sodium hydroxide solution (16%). The media was sterilized at 121° C. for 20 minutes. Afterwards ampicillin (50 mg/L) and chloramphenicol (17 mg/L) were added.
Two precultures (100 mL each) were inoculated with the Escherichia coli DH5a LPSd strain (50 μL) containing the desired plasmids and were shaken at 37° C. and 165 rpm. These precultures (100 mL) were used to inoculate two 10 L steel fermenter. The cultivation media was prepared in the fermenters. Tryptone (12 g/L), yeast extract (24 g/L), predigested beef extract (2 g/L), KH2PO4 (2.2 g/L), K2HPO4 (9.4 g/L) and glycerol (87%, 4.6 g/L) were dissolved in demineralized water (8.7 L) and sterilized for 20 minutes at 121° C. in the fermenter. Afterwards ampicillin (0.5 g) in water (20 mL), chloramphenicol (0.17 g) in ethanol (20 mL), riboflavin (10 mg) in water (20 mL), thiamine hydrochloride (3.37 g) in water (10 mL) and Oxford trace metal solution (2.5 mL) were added. After the inoculation of the first fermenter (17 hours old preculture), the inoculated culture was stirred at 315 rpm at 37° C. with an aeration rate of 3.3 L/min at pH 6.6 which was regulated by addition of aqueous sodium hydroxide solution (16%) or aqueous phosphoric acid solution (16%). After 3 hours, an OD550 of 0.9 was reached, the temperature was decreased to 25° C. within 15 minutes and isopropyl p-D-thiogalactopyranoside (2.38 g) in water (40 mL) and aminolevulinic acid (838 mg) in water (40 mL) were added to start the protein expression. After 9 hours the aqueous phosphoric acid solution (16%) was substituted for an aqueous glucose solution (50%) for pH regulation. After additional 12 hours the cells (206 g) were harvested by centrifugation, suspended in buffer (206 mL; KH2PO4 (4 g/L), K2HPO4 (12.3 g/L), glycerol (4% (v/v)), glucose (5% (w/v)), EDTA (0.5 mM)), frozen in liquid nitrogen and stored at −80° C. until further use in aliquots of 2×150 mL, 2×40 mL und 5×1 mL. The second 10 L steel fermenter was inoculated with the second preculture (16 hours old). The inoculated culture was stirred at 315 rpm at 37° C. with an aeration rate of 3.3 L/min at pH 6.6 which was regulated by addition of aqueous sodium hydroxide solution (16%) and aqueous phosphoric acid solution (16%). After 3 hours, the OD550 was 0.93, the temperature was decreased to 25° C. for 15 minutes, then isopropyl p-D-thiogalactopyranoside (2.38 g) in water (40 mL) and aminolevulinic acid (838 mg) in water (40 mL) were added. After 11.5 hours the aqueous phosphoric acid solution (16%) was substituted for an aqueous glucose solution (50%) for pH regulation. After additional 9.5 hours the cells (176 g) were harvested by centrifugation, suspended in buffer (176 mL; KH2PO4 (4 g/L), K2HPO4 (12.3 g/L), glycerol (4% (v/v)), glucose (5% (w/v)), EDTA (0.5 mM)), frozen in liquid nitrogen and stored at −80° C. until further use in aliquots of 2×150 mL, 2 ×40 mL und 5×1 mL.
Biotransformation with E. coli DH5a LPSd pACYC_pelFPOR_pETDuet_Δ3_CYP2C19:
To a 20 L steel fermenter which contained KH2PO4 (80 g), K2HPO4 (246 g), synperonic (2 mL), demineralized water (19.2 L), aqueous glucose solution (50%, 400 mL) and aqueous EDTA solution (0.5 M, 20 mL)N-(2,6-difluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide (500 mg, 999 μmol) dissolved in DMF (40 mL) was added and the culture was stirred at 215 rpm at 27° C. with an aeration rate of 6.6 L/min. Cells in buffer (760 mL) were added and the culture was stirred at an oxygen partial pressure of 50% regulated by the stirring rate of up to 800 rpm. After 3 hours and 40 minutes the culture was harvested by extraction with 3-methylbutan-2-one. The organic layer was concentrated to give 2.28 g of an oil which was dissolved in a mixture of methanol/water (14/1), was washed with hexane and was concentrated to give 1.51 g of an oil. The crude product was further purified by flash chromatography using silica gel (dichloromethane/methanol gradient) and by preparative HPLC to give the title compound (57.6 mg, 11% yield).
Preparative HPLC Method:
Instrument: Waters Autopurification system; column: Waters XBrigde C18 5μ 100×30 mm; eluent A: water+0.1 vol-% formic acid (99%), eluent B: acetonitrile; gradient: 0.00-0.50 min 10% B (25 →70 mL/min), 0.51-12.50 min 19-39% B (70 mL/min), DAD scan: 210-400 nm.
Analytical HPLC Method:
Instrument: Waters Acquity UPLCMS SingleQuad; column: Acquity UPLC BEH C18 1.7 μm, 50×2.1 mm; eluent A: water+0.1 vol-% formic acid (99%), eluent B: acetonitrile; gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; flow 0.8 mL/min; temperature: 60° C.; DAD scan: 210-400 nm.
Analytical HPLC: Rt=1.02 min.
LC-MS: Rt=0.99 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (600 MHz, DMSO-d6) δ[ppm]: 0.000 (4.64), 0.970 (0.69), 1.111 (16.00), 1.147 (0.44), 1.234 (0.49), 1.435 (8.20), 1.445 (8.18), 1.971 (1.67), 1.980 (3.21), 1.987 (2.99), 1.996 (1.55), 2.519 (0.74), 2.522 (0.71), 2.525 (0.56), 2.654 (1.27), 2.662 (1.31), 2.682 (1.71), 2.690 (1.62), 2.860 (1.84), 2.867 (2.06), 2.888 (1.62), 2.895 (1.48), 3.327 (0.50), 3.574 (0.56), 3.586 (0.93), 3.595 (1.27), 3.606 (1.51), 3.619 (1.00), 3.637 (1.08), 3.646 (2.18), 3.655 (1.43), 3.666 (1.12), 3.675 (0.55), 4.205 (0.96), 4.227 (1.83), 5.306 (2.57), 5.314 (1.85), 5.326 (1.68), 5.336 (1.20), 5.347 (0.51), 7.196 (2.40), 7.209 (4.63), 7.223 (2.77), 7.381 (0.45), 7.392 (1.05), 7.405 (1.56), 7.416 (0.93), 7.555 (2.80), 7.565 (3.03), 7.571 (3.28), 7.588 (2.93), 8.319 (1.92), 9.996 (3.60).
Example 294 N-(2,6-difluorophenyl)-5-fluoro-4-(6-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00420
For the preparation of the title compound see Example 293. Preparative HPLC (method see Example 293) gave the title compound (36.9 mg, 7% yield).
Analytical HPLC: Rt=1.03 min.
LC-MS: Rt=1.01 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (600 MHz, DMSO-d6) δ[ppm]: −0.005 (0.49), 0.000 (10.71), 0.971 (0.94), 1.111 (16.00), 1.148 (0.62), 1.211 (0.46), 1.234 (0.72), 1.435 (8.50), 1.445 (8.38), 1.853 (0.43), 1.864 (0.58), 1.872 (1.10), 1.876 (1.11), 1.883 (1.11), 1.886 (0.98), 1.890 (1.02), 1.893 (0.93), 1.900 (0.80), 1.920 (0.58), 1.929 (1.35), 1.938 (1.48), 1.948 (0.95), 1.960 (0.73), 2.517 (1.01), 2.521 (0.95), 2.524 (0.76), 2.693 (0.70), 2.701 (1.08), 2.710 (0.78), 2.722 (1.26), 2.729 (1.77), 2.739 (1.01), 2.800 (0.99), 2.810 (1.26), 2.817 (1.08), 2.828 (1.62), 2.838 (0.76), 2.845 (0.74), 2.856 (0.60), 3.498 (1.41), 3.503 (1.48), 3.519 (2.03), 3.524 (1.94), 3.606 (2.25), 3.612 (2.50), 3.627 (1.73), 3.633 (1.61), 4.194 (0.78), 4.231 (1.97), 5.296 (0.67), 5.306 (1.44), 5.317 (2.18), 5.327 (3.21), 7.195 (2.50), 7.209 (4.79), 7.223 (2.84), 7.381 (0.49), 7.392 (1.13), 7.406 (1.66), 7.416 (1.00), 7.555 (2.93), 7.565 (3.39), 7.570 (3.57), 7.586 (2.95), 8.318 (1.63), 9.987 (3.71).
Example 295 N-(2,6-difluorophenyl)-5-fluoro-4-(6-hydroxy-3-oxo-5,6-dihydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00421
For the preparation of the title compound see Example 293. Preparative HPLC gave the title compound (42.7 mg, 8% yield).
Preparative HPLC Method:
Instrument: Waters Autopurification system; column: Waters XBrigde C18 5μ 100×30 mm; Eluent A: water+0.2 Vol-% aqueous ammonia (32%), Eluent B: methanol; Gradient: 0.00-0.50 min 20% B (25 →70 mL/min), 0.51-7.50 min 39-59% B (70 mL/min), DAD scan: 210-400 nm.
Analytical HPLC Method:
Instrument: Waters Acquity UPLCMS SingleQuad; column: Acquity UPLC BEH C18 1.7 μm, 50×2.1 mm; Eluent A: water+0.2 Vol-% aqueous ammonia (32%), Eluent B: methanol; Gradient: 0-1.6 min 1-99% B, 1.6-2.0 min 99% B; flow 0.8 mL/min; temperature: 60° C.; DAD scan: 210-400 nm.
Analytical HPLC: Rt=1.32 min.
LC-MS: Rt=1.03 min; MS (ESIpos): m/z=515 [M+H]+
1H-NMR (600 MHz, DMSO-d6) δ[ppm]: 0.000 (14.44), 0.842 (0.43), 0.855 (0.68), 1.111 (1.15), 1.235 (3.80), 1.441 (14.33), 1.451 (14.18), 1.844 (0.41), 2.388 (0.45), 2.616 (0.47), 3.510 (0.58), 3.681 (2.18), 3.689 (2.29), 3.703 (3.02), 3.711 (2.95), 3.811 (3.07), 3.820 (3.36), 3.832 (2.34), 3.841 (2.28), 3.854 (0.52), 4.294 (0.42), 4.302 (0.42), 4.583 (3.20), 5.297 (1.17), 5.307 (2.21), 5.317 (2.74), 5.327 (2.08), 5.731 (1.45), 6.537 (0.89), 6.554 (16.00), 6.576 (0.71), 7.201 (4.58), 7.214 (8.87), 7.227 (5.24), 7.387 (0.93), 7.400 (2.17), 7.411 (3.17), 7.422 (1.92), 7.436 (0.71), 7.572 (0.61), 7.581 (0.76), 7.597 (5.56), 7.603 (6.18), 7.613 (9.32), 10.018 (5.03).
Example 296 N-(2,6-difluorophenyl)-5-fluoro-4-(8-hydroxy-3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]-pyridin-2(3H)-yl)-2-{[(2S)-1,1,1-trifluoropropan-2-yl]oxy}benzamide
Figure US11787797-20231017-C00422
For the preparation of the title compound see Example 293. Preparative HPLC (method see Example 295) gave the title compound (124 mg, 24% yield).
Analytical HPLC: Rt=1.29 min.
LC-MS: Rt=1.00 min; MS (ESIpos): m/z=517 [M+H]+
1H-NMR (600 MHz, DMSO-d6) δ[ppm]: 0.000 (3.79), 1.113 (16.00), 1.237 (0.47), 1.442 (3.57), 1.452 (3.57), 1.841 (0.52), 1.849 (0.99), 1.858 (0.85), 1.871 (0.51), 1.938 (0.50), 1.946 (0.48), 2.545 (0.64), 3.515 (0.65), 3.523 (0.46), 3.529 (0.47), 3.616 (0.72), 3.626 (0.53), 3.636 (0.52), 4.651 (0.74), 4.658 (0.72), 5.289 (0.51), 5.300 (0.67), 5.311 (0.49), 5.947 (0.70), 5.955 (0.69), 7.192 (1.08), 7.205 (2.08), 7.219 (1.24), 7.394 (0.46), 7.397 (0.43), 7.407 (0.71), 7.571 (1.28), 7.581 (1.43), 7.585 (1.49), 7.602 (1.27), 8.310 (1.10), 10.004 (1.56).
Example 297 rac-tert-butyl[2-{2-[(2-chloro-6-fluorophenyl)carbamoyl]-4-fluoro-5-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)phenoxy}propyl]carbamate
Figure US11787797-20231017-C00423
Prepared analogously to Example 244 from Intermediate 47 and 5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-3(2H)-one
LC-MS (Method B): Rt=1.24 min; MS (ESIneg): m/z=576 [M−H]−
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.215 (0.72), 1.244 (2.67), 1.261 (16.00), 1.298 (0.50), 1.790 (0.57), 1.802 (0.80), 1.817 (0.82), 1.871 (0.41), 1.885 (0.84), 1.897 (0.85), 1.909 (0.52), 2.074 (3.12), 2.084 (0.43), 2.518 (0.75), 2.523 (0.49), 2.690 (0.90), 2.706 (1.76), 2.722 (0.93), 3.260 (0.41), 3.556 (1.06), 3.571 (1.90), 3.586 (0.85), 7.143 (0.48), 7.342 (0.64), 7.361 (0.44), 7.365 (0.44), 7.393 (0.43), 7.399 (0.59), 7.413 (0.67), 7.426 (0.97), 7.441 (1.73), 7.458 (0.43), 7.462 (0.43), 7.710 (0.68), 7.737 (0.65), 9.779 (1.57).
Example 298 rac-2-{[1-aminopropan-2-yl]oxy}-N-(2-chloro-6-fluorophenyl)-5-fluoro-4-(3-oxo-5,6,7,8-tetrahydro[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)benzamide, salt with hydrochloric acid
Figure US11787797-20231017-C00424
Rac-tert-butyl [2-{2-[(2-chloro-6-fluorophenyl)carbamoyl]-4-fluoro-5-(3-oxo-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)phenoxy}propyl]carbamate (Example 297, 75.0 mg, 130 μmol) was dissolved in dioxane (2.0 ml). A solution of hydrochloric acid in dioxane was added (320 μl, 4.0 M, 1.3 mmol) and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated to yield the desired product (42.0 mg, 95% purity, 60% yield).
LC-MS (Method A): Rt=0.78 min; MS (ESIpos): m/z=478 [M+H]+
1H-NMR (400 MHz, DMSO-d6) δ[ppm]: 1.154 (0.46), 1.172 (0.76), 1.301 (16.00), 1.317 (15.62), 1.352 (0.46), 1.798 (3.08), 1.810 (4.37), 1.825 (4.45), 1.837 (2.17), 1.893 (4.48), 1.907 (4.83), 1.987 (1.41), 2.331 (1.48), 2.518 (9.84), 2.522 (6.04), 2.673 (1.67), 2.697 (5.05), 2.713 (9.88), 2.729 (5.32), 3.094 (1.52), 3.115 (1.67), 3.127 (2.93), 3.149 (2.85), 3.190 (3.04), 3.198 (3.46), 3.223 (1.86), 3.231 (1.56), 3.378 (0.65), 3.564 (5.89), 3.580 (10.41), 3.594 (4.67), 4.823 (1.98), 7.351 (1.75), 7.355 (1.94), 7.372 (3.65), 7.375 (4.22), 7.393 (2.74), 7.399 (3.00), 7.413 (2.01), 7.426 (2.28), 7.433 (3.99), 7.447 (4.14), 7.453 (3.34), 7.465 (9.62), 7.469 (8.63), 7.485 (2.66), 7.490 (2.66), 7.498 (5.32), 7.512 (5.09), 7.646 (0.46), 7.674 (6.16), 7.700 (5.70), 8.080 (1.94).
EXPERIMENTAL SECTION—BIOLOGICAL ASSAYS
The following table 2 lists the abbreviations used herein, in particular in the Biological Assays part of the Experimental Section:
TABLE 2
Abbreviations
Abbreviation Meaning
ATCC American Type Culture Collection
DDK name of a polypeptide tag
DHODH Dihydroorotate Dehydrogenase
ATP adensoin triphosphate
BSA bovine serum albumin
CYP cytochrom P450 enzyme
Δ deletion from amino acid
DNA desoxyribonucleic acid
DMSO dimethylsulfoxide
dNTP desoxynucleoside triphosphate
EDTA ethylendiamintetraacetate
h hour(s)
HMFM Hogness Modified Freezing Medium
IC50 half maximal inhibitory concentration
LB Luria-Bertani broth
LPSd lipopolysaccharide deficient
μM micromolar
mM millimolar
mod. modified
MTP microtiter plate
MYC name of a polypeptide tag
μl microliter
nM nanomolar
OD550 optical density at 550 nm
PBS Phosphate Buffered Saline
pelB pelB Leadersequence from vector pET22b+
PCR polymerase chain reaction
POR human NAPDH hemoprotein reductase
rpm rotation per minute
RPMI Roswell Park Memorial Institute
rt room temperature
SAP shrimp alkaline phosphatase
THP cell line name
Triton X name of a detergent
Tris tris(hydroxymethyl)aminomethane
Examples were tested in selected biological assays one or more times. When tested more than once, data are reported as either average values or as median values, wherein
    • the average value, also referred to as the arithmetic mean value, represents the sum of the values obtained divided by the number of times tested, and
    • the median value represents the middle number of the group of values when ranked in ascending or descending order. If the number of values in the data set is odd, the median is the middle value. If the number of values in the data set is even, the median is the arithmetic mean of the two middle values.
Examples were synthesized one or more times. When synthesized more than once, data from biological assays represent average values or median values calculated utilizing data sets obtained from testing of one or more synthetic batch.
The in vitro activity of the compounds of the present invention can be demonstrated in the following assays:
In Vitro Assay 1: DHODH Enzymatic Assay-1
The enzymatic assay couples DHODH activity with bleaching of the dye 2,6-dichlorophenolindophenol (DCIP) (Knecht and Loffler, 1998; Miller et al., 1968). The assay was conducted in buffer containing 50 mM Tris, 0.1% Triton X-100, 150 mM potassium chloride, 2 nM DHODH, 1 mM dihydroorotate, 0.1 mM decylubiquinone, 0.06 mM DCIP, and 2% DMSO at pH 8.0 at 32 degree celsius. The reaction was initiated by addition of substrates. Enzyme activity was monitored kinetically by the reduction in DCIP absorbance at 600 nm. Purified recombinant human DHODH enzyme was purchased from Novus (cat. no. NBP1-98916). Other chemicals were purchased from Sigma-Aldrich. Absorbance measurements were obtained using a BMG clarion star plate-reading spectrophotometer.
In Vitro Assay 2: DHODH Enzymatic Assay-2
The enzymatic assay couples DHODH activity with bleaching of the dye 2,6-Dichlorophenolindophenol (DCIP) (Knecht and Loffler, 1998; Miller et al., 1968). The assay was conducted in aqueous buffer containing 50 mM Tris, 0.1% Triton X-100, 150 mM potassium chloride, 0.4 μg/mL DHODH, 1 mM dihydroorotate, 0.1 mM decylubiquinone, 0.06 mM DCIP, and 0.17% DMSO at pH 8.0 at room temperature. Compounds were added via pin transfer or via D300 digital dispenser, and the reaction was initiated by addition of substrates. Enzyme activity was monitored kinetically by the reduction in DCIP absorbance at 600 nm. Purified recombinant human DHODH (full-length, C-terminal MYC/DDK-tag) enzyme was purchased from Origene (cat. no. TP039034). Other chemicals, including leflunomide and teriflunomide, were purchased from Sigma-Aldrich. Absorbance measurements were obtained using a Molecular Devices Spectramax M5 plate-reading spectrophotometer.
In Vitro Assay 3: H460 (Lung Cancer)
Alamar Blue:
4000 cells/well of NCI-H460 cells were seeded in 90% RPMI 1640 (Invitrogen, #22400-089) and 10% fetal bovine serum (Invitrogen, #10099-141) and Penicillin/Streptomycin in 96 well plates. The next day, cells were incubated with different concentrations of test compounds for 72h. Cellular viability was analysed incubating cells with 12 μl of Alamar Blue (Invitrogen) per well for 2 hours at 37° C. Finally the plate was analysed using excitation wavelength: 544 nm and emission wavelength: 590 nm.
CellTiter-Glo®:
250 cells/well of NCI-H460 cells were seeded in 90% RPMI 1640 (Invitrogen, #22400-089) and 10% fetal bovine serum (Invitrogen, #10099-141) and Penicillin/Streptomycin in 96 well plates. The next day, cells were incubated with different concentrations of test compounds for 72h. Cellular viability was analyzed using CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7572) according to manufacturer's instructions.
In Vitro Assay 4: THP-1 Proliferation Assay-1 (AML)
2000 cells/well of THP-1 cells were seeded in RPMI 1640 with Glutamax (Gibco, #11875-093) and 10% fetal calf serum (Biochrom, #S0615) in 384-well plates. The next day, cells were incubated with different concentrations of test compounds for 72h. Cellular viability was analyzed using CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7570) according to manufacturer's instructions.
TABLE 3
IC50 values of examples in in vitro assays 1-4
in vitro in vitro in vitro
assay 1: assay 2: in vitro assay 4:
DHODH DHODH assay 3: THP-1
enzymatic enzymatic H460 proliferation
assay 1 assay 2 (lung cancer) assay
Example IC50 [mol/l] IC50 [nmol/l] IC50 [nmol/l] (AML)
No. (mean values) (mean values) (mean values) IC50 [mol/l]
1 1.00 E−8 2.0 7.85 E−9
2 2.18 E−7 30.0 8.76 E−8
3 2.30 E−7 33.0 8.92 E−8
4 5.90 E−6
5 1.70 E−7 1.47 E−7
6 1.00 E−9  6.52 E−10
7 1.13 E−8 3.0 0.5
8 4.50 E−9 4.38 E−9
9 1.60 E−8 4.99 E−9
10 1.70 E−8 3.59 E−8
11 5.80 E−9 5.96 E−9
12 6.50 E−7
13 1.90 E−7
14 1.20 E−8 1.36 E−8
15 2.70 E−9  8.36 E−10
16 5.10 E−9 3.00 E−9
17 3.10 E−7
18 3.50 E−8 2.18 E−8
19 9.00 E−8 2.32 E−7
20 4.50 E−7
21 8.50 E−7
22 8.00 E−6
23 6.00 E−6
24 57.8 2.4
25 1.5 E3 2.9
26 9.00 E−9 11.0 1.2
27 1.70 E−9 1.8 2.0
28 9.25 E−8 2.0
29 2.80 E−8 3.0 3.25 E−8
30 4.75 E−7 141.0 9.26 E−8
31 1.50 E−6
32 3.00 E−5
33 7.25 E−9 1.85 E−8
34 4.30 E−7
35 3.90 E−8
36 4.00 E−8 3.12 E−8
37 5.00 E−8
38 8.50 E−8
39 1.50 E−7
40 1.70 E−7
41 2.10 E−7
42 4.60 E−7
43 2.00 E−8 2.91 E−8
44 4.50 E−6
45 3.00 E−5
46 6.00 E−7
47 1.60 E−6
48 1.10 E−7 1.70 E−7
49 2.20 E−7
50 3.50 E−9 5.01 E−9
3.40 E−9
5.50 E−9
4.50 E−9
5.50 E−9
<5.00 E−9 
3.30 E−9
51 1.40 E−6
52 8.50 E−6
53 2.90 E−7
54 8.00 E−6
55 5.43 E−8 1.15 E−7
56 1.78 E−8 3.15 E−8
57 2.20 E−7
58 2.80 E−6
59 6.80 E−6
60 1.40 E−8 1.45 E−8
61 2.00 E−9  7.86 E−10
62 3.00 E−9 >1.00 E−5 
63 8.50 E−9 1.03 E−8
64 4.30 E−9
65 1.50 E−8 2.59 E−8
66 9.00 E−8 2.92 E−7
67 1.20 E−7
68 9.00 E−9 1.23 E−8
69 6.00 E−9 5.85 E−9
70 1.15 E−8 1.0 E5 1.04 E−8
71 6.33 E−9 2.0 6.04 E−9
72 4.85 E−7 235.0
73 1.20 E−7
74 1.10 E−8 2.40 E−8
75 4.30 E−8 1.81 E−8
76 9.50 E−9 1.62 E−8
77 1.70 E−7
78 1.70 E−8 2.57 E−8
79 <5.00 E−9   8.33 E−11
2.10 E−9 <5.00 E−12
2.50 E−9
80 1.50 E−8 2.13 E−8
81 1.60 E−7
82 9.00 E−7
83 2.50 E−6
84 9.60 E−8 3.96 E−8
85 7.50 E−8 8.55 E−7
86 3.50 E−8 2.03 E−8
87 2.00 E−7
88 <5.00 E−9  7.78 E−9
5.00 E−9
89 2.50 E−6
90 3.00 E−7
91 2.50 E−7
92 1.80 E−6
93 1.80 E−6
94 2.40 E−6
95 1.50 E−6
96 3.00 E−5
97 3.00 E−5
98 3.80 E−6
99 2.20 E−7
100 6.50 E−6
101 3.00 E−5
102 8.50 E−7
103 4.50 E−6
104 3.10 E−6
105 4.50 E−8 1.61 E−7
106 1.60 E−7
107 1.80 E−7
108 2.20 E−6
109 5.50 E−8 1.31 E−7
110 3.00 E−5
111 5.00 E−7
112 3.00 E−7
113 1.50 E−6
114 3.90 E−8 2.43 E−8
115 1.00 E−6
116 3.30 E−9
117 2.00 E−8
118 2.50 E−9
119 1.00 E−7
120 2.50 E−8 6.21 E−7
121 5.00 E−8
122 2.20 E−7
123 8.00 E−7
124 2.30 E−7
125 8.00 E−8 >1.00 E−5 
126 6.50 E−8 2.66 E−7
127 3.00 E−7
128 1.50 E−7
129 7.00 E−7
130 3.50 E−7
131 1.80 E−7
132 2.00 E−7
133 7.50 E−8
134 1.80 E−8 4.38 E−8
135 2.90 E−9 2.52 E−8
136 1.90 E−7
137 5.00 E−7
138 4.90 E−8 1.04 E−7
139 2.4 E3 2.4
140 5.00 E−9 127.9 0.8
141 4.47 E−8 111.5 75.0
142 1.43 E−8 80.0 18.7
143 175.4 5.3
144 1.50 E−7 468.8 185.8
145 2.0 E4 8.2
146 2.5 E3 229.7
147 5.00 E−8 30.1 6.0
148 6.50 E−8 29.0 1.60 E−8
149 6.25 E−9 2.0 4.49 E−9
150 2.10 E−7 64.0
151 1.20 E−8 3.0 2.35 E−9
152 <5.00 E−9  4.66 E−9
3.20 E−9
153 2.00 E−8 1.12 E−8
154 1.70 E−8 7.88 E−9
155 6.05 E−9 3.52 E−9
156 9.50 E−9 6.49 E−9
157 <5.00 E−9   2.73 E−10
2.70 E−9
158 6.85 E−9 1.19 E−9
159 1.80 E−7
160 4.00 E−7
161 3.60 E−8
162 2.30 E−8 3.45 E−8
163 9.00 E−8 1.81 E−7
164 2.50 E−8 1.59 E−8
165 4.00 E−8 1.11 E−8
166 <5.00 E−9  6.30 E−9
4.00 E−9
167 2.00 E−8 1.05 E−8
168 1.60 E−8 9.59 E−7
169 <5.00 E−9  9.69 E−10
2.60 E−9
170 2.35 E−8 1.22 E−8
171 2.00 E−8 5.33 E−9
172 2.00 E−7
173 1.60 E−7
174 7.50 E−7
175 1.60 E−8 1.28 E−8
176 1.50 E−7
177 9.00 E−8 8.84 E−7
178 4.10 E−8 3.98 E−8
179 3.00 E−8 6.73 E−9
180 1.20 E−8 1.38 E−8
181 3.15 E−7 8.02 E−7
182 7.00 E−7 1.20 E−6
183 7.00 E−8 9.24 E−8
184 3.00 E−8 3.64 E−8
185 4.50 E−8 5.65 E−8
186 5.30 E−9 5.21 E−9
187 7.00 E−9 1.65 E−8
188 9.00 E−9 7.40 E−8
189 4.00 E−8 8.75 E−8
190 6.00 E−8 2.79 E−8
191 7.50 E−8 2.63 E−7
192 1.60 E−8 5.48 E−9
193 6.00 E−8 8.77 E−8
194 3.20 E−8 3.72 E−8
195 1.90 E−7 9.37 E−8
196 2.10 E−7
197 7.00 E−9 6.04 E−9
198 2.30 E−7
199 6.00 E−7
200 4.50 E−7
201 3.20 E−8 3.41 E−8
202 2.50 E−7
203 1.00 E−6
204 1.00 E−7 2.25 E−7
205 1.70 E−7
206 1.00 E−7 2.05 E−7
207 6.00 E−8 3.19 E−7
208 5.60 E−7
209 2.50 E−8 3.42 E−8
210 4.60 E−8 4.22 E−8
211 7.50 E−8 6.62 E−8
212 1.10 E−8 4.62 E−9
213 1.95 E−8 3.03 E−8
214 3.50 E−7
215 6.10 E−8 9.37 E−8
216 1.75 E−6 1.2 E3
217 1.70 E−8 5.0 7.23 E−9
218 3.55 E−7 748.0
219 1.41 E−7 6.0 1.42 E−8
220 5.00 E−8 26.0 2.87 E−8
221 4.78 E−7 29.0
222 1.20 E−7 55.0
223 4.50 E−6 3.8 E3
224 2.30 E−8 1.0
225 1.35 E−6 561.0
226 1.80 E−8 2.11 E−8
227 1.00 E−8 1.46 E−8
228 3.00 E−9 5.48 E−9
229 2.30 E−8 2.54 E−8
230 3.00 E−8 4.65 E−8
231 3.00 E−9 1.51 E−9
232 2.90 E−9 4.13 E−9
233 3.20 E−9 2.33 E−9
234 1.50 E−8 1.36 E−8
235 5.00 E−9 4.74 E−9
236 4.10 E−9 1.60 E−9
237 7.50 E−9 8.47 E−9
238 9.00 E−8 3.90 E−7
239 2.50 E−8 3.97 E−8
240 2.30 E−8 2.19 E−8
241 2.50 E−7
242 9.00 E−9 5.24 E−9
243 1.80 E−8 1.13 E−8
244 3.00 E−7
245 5.80 E−8 6.47 E−8
246 1.00 E−7
247 3.08 E−8 2.66 E−8
248 1.50 E−8 3.19 E−8
249 2.00 E−7
250 1.60 E−7
251 3.00 E−5
252 1.50 E−7
253 1.30 E−6
254 2.00 E−7 1.11 E−6
255 6.00 E−8 4.14 E−7
256 3.00 E−5
257 1.60 E−8 2.22 E−8
258 2.50 E−7
259 1.00 E−7
260 1.00 E−6
261 5.17 E−7 285.0
262 1.83 E−8 5.0 7.55 E−9
263 1.27 E−8 5.0 3.28 E−9
264 7.00 E−6
265 1.83 E−8 2.38 E−8
266 4.00 E−7
267 1.80 E−8 2.67 E−8
268 2.50 E−8 4.18 E−8
269 3.00 E−8 4.12 E−8
270 2.50 E−8 3.79 E−8
271 1.40 E−7
272 3.00 E−5
273 1.50 E−7
274 1.00 E−6
275 8.00 E−8 1.33 E−7
276 1.60 E−8 2.75 E−8
277 8.00 E−6
278 9.50 E−8
279 1.10 E−6
280 1.60 E−8 8.59 E−9
281 2.40 E−7
282 4.00 E−8
283 5.00 E−7
284 1.30 E−7
285 8.00 E−6
286 7.00 E−7
287 2.00 E−7
288 2.80 E−7
289 1.80 E−7
290 3.40 E−9 7,35 E−9
291 1.50 E−8 6,09 E−7
292 4.50 E−6
293 1,40 E−6
294 1,00 E−6
295 1,00 E−6
296 7,00 E−8
297 6.80 E−7
298 1.60 E−6
In accordance with further embodiments, the present invention provides compounds of general formula (I), that inhibit DHODH as described in in vitro assay 1 with an IC50≤50 nM.
In accordance with further embodiments, the present invention provides compounds of general formula (I), that inhibit DHODH as described in in vitro assay 1 with an IC50≤15 nM.
In Vitro Assay 5: THP-1 Proliferation Assay-2
Tumor and normal cells are cultivated in their respective media (ATCC recommended media). On day 1 of the assay, adherent cells are detached from the culture vessels by trypsinization. Suspension cells are centrifuged at 300×g and resuspended in fresh media. Cells are seeded at densities of 300-1000 cells/30 μL/well in the inner wells of white 384-well plates (Perkin Elmer). The outer wells of each plate are filled with 60 μL PBS/well to reduce evaporation. One plate is used for treatment of cells, the second plate is the start plate. All plates are incubated at 37° C., 5% CO2 for 24 hrs. On day 2, 30 μL/well of CellTiter Glow (CTG, Promega) is added to the start plate, the plate is shaken at rt for 10 min on a laboratory plate shaker and then the plate is read in a Infinite M200 Pro MTP Reader (Tecan, Luminescence, 0.1s). Compounds from a 10 mM stock (in DMSO) are added in triplicates to the treatment plate in tenfold dilutions (from 1E−6M to 1E−12M) with a HP D300 Digital Dispenser (the dispenser adds substances to wells in nanoliter volumes, therefore any volume added with this device does not count toward the final volume in the well). For rescue/specificity experiments with uridine, 100 μM uridine/well (diluted from a 10 mM stock solution in DMSO; Sigma-Aldrich) are added with the HP D300 Digital Dispenser. Treatment plates are incubated for a further 72 hrs at 37° C., 5% carbon dioxide, On day 5 of the assay, 30 μL/well of CellTiter Glow (CTG, Promega) is added to the treatment plate, the plate is shaken at rt for 10 min on a laboratory plate shaker and then the plate is read in a Infinite M200 Pro MTP Reader (Tecan, Luminescence, 0.1s).
In Vitro Assay 6: SUDHL-10 Proliferation Assay (Lymphoma)
2000 cells/well of SUDHL-10 cells were seeded in RPMI 1640 with Glutamax (Gibco, #11875-093) and 10% fetal calf serum (Biochrom, #S0615) in 384-well plates. The next day, cells were incubated with different concentrations of test compounds for 72h. Cellular viability was analyzed using CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7570) according to manufacturer's instructions.
TABLE 4
IC50 values of examples in in vitro assay 6
in vitro assay 6:
SUDHL10
Example IC50 [mol/l]
No. (mean values)
30 9.53 E−9
181 8.71 E−8
220 1.75 E−9

In Vitro Assay 7: xCelligence Proliferation Assay (HCT116 (Colorectal Carcinoma, A498 (Kidney Carcinoma), Panc1 (Pancreas Carcinoma) Cell Lines)
Impedance measurement is a dimensionless parameter termed Cell Index (CI) which is derived as a relative change in measured electrical impedance caused by an increase of cell number on the bottom of the cell culture well.
To determine CI, 2000 cells/well are seeded into 96-well E-plates. Cells are placed in the Real-Time Cell Analyzer (RTCA) station (ACEA Biosciences) and incubated for 24h. Subsequently, compounds are added at concentrations as indicated and cells are replaced in the Real-Time Cell Analyzer (RTCA) station and analyzed until cells reach confluency. Impedance is measured every 60 min. Cell index is determined by the xCelligence software and presented as CI over time.
In Vitro Assay 8: U-87 MG Proliferation Assay (Glioblastoma)
U-87 MG cells are plated in MEM Earle's medium+10% FCS with 4000 cells/well in a 96-well microtiter plate (d-1). Compound is added at d0. Cell number is determined by Alamar Blue staining (2h) at d0 and d3. Fluorescence is determined in Victor3 (Excitation 530 nm; emission 590 nm). C0 is defined as the signal measured at d4 for cells without treatment (0.1% DMSO). CI is defined as the signal measured at d0.
TABLE 5
IC50 values of examples in in vitro assay 8
in vitro assay 8:
U-87 MG
Example IC50 [mol/l]
No. (mean values)
30 2.2 E−6

In Vitro Assay 9: Colo 205 Proliferation Assay (Colorectal Carcinoma)
COLO 205 cells are plated in RPM1640 medium with stable glutamine+10% FCS+10 mM Hepes+1 mM Natriumpyruvat+1×Non Essential Amino Acids with 4000 cells/well in a 96-well microtiter plate (d-1). Compound is added at d0. Cell number is determined by Alamar Blue staining (2h) at d0 and d3. Fluorescence is determined in Victor3 (Excitation 530 nm; emission 590 nm). C0 is defined as the signal measured at d4 for cells without treatment (0.1% DMSO). CI is defined as the signal measured at d0.
In Vitro Assay 10: MKN-45 Proliferation Assay (Gastric Cancer)
MKN-45 cells are plated in RPMI1640 medium with stable glutamine+20% FCS with 4000 cells/well in a 96-well microtiter plate (d-1). Compound is added at d0. Cell number is determined by Alamar Blue staining (2h) at d0 and d3. Fluorescence is determined in Victor3 (Excitation 530 nm; emission 590 nm). C0 is defined as the signal measured at d4 for cells without treatment (0.1% DMSO). CI is defined as the signal measured at d0.
In Vitro Assay 11: MIA PaCa2 Proliferation Assay (Pancreatic Carcinoma)
MIA PaCa 2 cells are plated in DMEM/HAMS F12 medium+10% FCS+2.5% Horse Serum with 4000 cells/well in a 96-well microtiter plate (d-1). Compound is added at d0. Cell number is determined by Alamar Blue staining (2h) at d0 and d3. Fluorescence is determined in Victor3 (Excitation 530 nm; emission 590 nm). C0 is defined as the signal measured at d4 for cells without treatment (0.1% DMSO). C1 is defined as the signal measured at d0.
In Vitro Assay 12: DU 145 Proliferation Assay (Prostate Cancer)
DU 145 cells are plated in DMEM/HAMS F12 medium+10% FCS with 4000 cells/well in a 96-well microtiter plate (d-1). Compound is added at d0. Cell number is determined by Alamar Blue staining (2h) at d0 and d3. Fluorescence is determined in Victor3 (Excitation 530 nm; emission 590 nm). C0 is defined as the signal measured at d4 for cells without treatment (0.1% DMSO). CI is defined as the signal measured at d0.
TABLE 6
IC50 values of examples in in vitro assay 12
in vitro assay 12:
DU 145
Example IC50 [mol/l]
No. (mean values)
30 3.5 E−7

Assay 13: MOLM 13 Differentiation Assay (AML)
20000 cells per well of MOLM 13 cells are seeded in RPMI 1640 with Glutamax (Gibco, #11875-093) and 10% fetal calf serum (Biochrom, #S0615) and incubated with different concentrations of test compounds for 96h. After treatment for 10 min with Human TruStain FcX, (Biolegend, #422302) or BD Human Fc Block (#564220) at RT, cells are incubated with 2 μg/ml APC anti-mouse/human CD11b Antibody (Biolegend, Cat #101212) for 30 min at 4° C. Cells are analyzed by Fluorescence-activating cell sorting (FACS) (BD FACS Canto, BD Biosciences).
Assay 14: Cancer Cell Proliferation Panel
The CellTiter-Blue® Cell Viability Assay (#G8081, Promega) is used according to manufacturer's instructions. Briefly, cells are harvested from exponential phase cultures, counted and plated in 96-well flat-bottom microtiter plates at a cell density of 4,000-60,000 cells/well depending on the cell line's growth rate. After a 24 h recovery period to allow the cells to resume exponential growth, 10 μl of culture medium (four control wells/plate) or of culture medium with test compound are added. The compound is applied at 10 concentrations in duplicate in half-log increments up to 30 μM and treatment is continued for three days. After three days treatment of cells, 20 μl/well CellTiter-Blue® reagent is added. Following an incubation period of up to four hours, fluorescence (FU) is measured by using the Enspire Multimode Plate Reader (excitation λ=531 nm, emission λ=615 nm).
For calculations, the mean values of duplicate/quadruplicate (untreated control) data are used.

Claims (2)

The invention claimed is:
1. A pharmaceutical combination comprising:
one or more first active ingredients of general formula (I)
Figure US11787797-20231017-C00425
in which
R1 represents a group selected from
a C1-C8-alkyl group, which is optionally substituted with a group selected from
C3-C8-cycloalkyl, phenyl and monocyclic or bicyclic heteroaryl,
wherein said phenyl substituent is optionally substituted, one, two or three times with one or more substituents independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
a C2-C8-haloalkyl group,
a C3-C8-cycloalkyl group, which is optionally substituted, one or two times, each substituent independently selected from a halogen atom, a hydroxy group, a phenyl group and a —N(R7)(R8) group,
wherein said phenyl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom, a C1-C3-alkyl group, a C1-C4-haloalkyl group, a C1-C3-alkoxy group and a hydroxy group,
a C2-C6-cyanoalkyl group,
a C2-C6-hydroxyalkyl group,
a (C2-C6-hydroxyalkyl)-O—(C2-C6-alky)- group,
a —(C2-C6-alkyl)-N(R7)(R8) group,
a —(C1-C6-alkyl)-C(═O)N(R7)(R8) group,
a 4- to 7-membered, optionally unsaturated, heterocyclic group, which is connected to the rest of the molecule via a carbon atom, and which is optionally substituted one or two times, each substituent independently selected from a C1-C3-alkyl group, a 5- to 6-membered heteroaryl group, a-C(═O)O(C1-C4-alkyl) group, a —C(═O)(C1-C6-alkyl) group, a —C(═O)(C3-C6-cycloalkyl) group, a —S(═O)2(C1-C6-alkyl) group and a oxo (═O) group,
wherein said 5- to 6-membered heteroaryl substituent is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C3-alkyl, C1-C4-haloalkyl, C1-C3-alkoxy and hydroxy,
a phenyl group, which is optionally substituted, one, two, three, four or five times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C3-C8-cycloalkyl, C1-C6-haloalkyl, C1-C6-hydroxyalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, hydroxy, aryl, —O-aryl, cyano, —C(═O)OR6, —C(═O)N(R7)(R8), —N(R7)(R8), —(C1-C6-alkyl)-N(R7)(R8), —(C1-C6-alkyl)-C(═O)OR6, —(C1-C6-alkyl)-C(═O)N(R7)(R8),), —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2N(R7)(R8), —S(═O)2(C1-C6-alkyl), —S(═O)2—O—(C2-C6-alkenyl), —S(═O)(═NR14)(C1-C3-alkyl), —N(O)2, —P(═O)(C1-C3-alkyl)2 and SF5,
or wherein two vicinal substituents of said phenyl groups may form together a 5- or 6-membered, optionally heterocyclic, aromatic or non-aromatic ring, having optionally 1-3 heteroatoms independently selected from —N═, —NH—, —N(R7)—, —O—, —S—, and optionally containing a C(═O) group, and wherein the so formed ring is optionally substituted one or two times, each substituent independently selected from a halogen atom or a group selected from
C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(O)OH, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8) and
a monocyclic or bicyclic heteroaryl group which is optionally substituted one, two or three times, each substituent independently selected from a halogen atom or a group selected from
C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
R2 represents a hydrogen atom or a halogen atom,
R3 represents a group selected from
a C1-C6-alkyl group,
a C3-C8-cycloalkyl group,
a C1-C6-haloalkyl group,
a C1-C6-hydroxyalkyl group,
a C2-C6-alkenyl group,
a C2-C6-alkinyl group,
a C4-C8-cycloalkenyl group,
a (C1-C6-alkyl)-N(R7)R8 group,
a —(C1-C6-alkyl)-N(H)C(═O)R6 group,
a —(C1-C6-alkyl)-N(H)C(═O)OR15 group,
a —(C1-C6-alkyl)-(4- to 7-membered nitrogen containing heterocycloalkyl) group, wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is connected to the alkyl group via a carbon atom of the heterocycloalkyl group and wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a C1-C3-alkyl group,
and
a phenyl group,
which is optionally substituted, one, two or three times, each substituent independently selected from a halogen atom or a group selected from C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C6-alkyl), —N(O)2, and —N(R7)(R8),
R4 and R5 jointly form an optionally unsaturated, heterocyclic ring A of partial formula (i)
Figure US11787797-20231017-C00426
whereby ring A in addition to the two mandatory atoms, the nitrogen atom and the carbon atom bridging the two rings, bears additional 3 to 6 members selected from —O—, —S—, —S(═O)—, —S(═O)2—, —S(═O)(═NR14)—, —N═, —N(R7)—, —C(═O)—, —C(═O)—, —CH═, —CR11═, —C(R12)2—, —C(H)(R13)—,
R6 represents a hydrogen atom or a group selected from
a C1-C6-alkyl group and a benzyl group,
R7 and R8 represent, independently from each occurrence, a hydrogen atom or a group selected from
a C1-C6-alkyl group, a C2-C6-alkenyl group, a C2-C6-hydroxyalkyl group, a haloalkyl group, a aryl group, a (C1-C6-alkyl)-aryl group, and a —(C2-C6-alkyl)-N(R9)(R10) group, or
R7 and R8 together with the nitrogen to which they are attached represent a
nitrogen containing 4- to 7-membered heterocycloalkyl group,
wherein said 4- to 7-membered nitrogen containing heterocycloalkyl group is optionally substituted with a group selected from
C1-C6-alkyl, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), —S(═O)2(C1-C3-alkyl), —S(═O)2—(C2-C6-alkenyl), and —C(═O)OR6 —,
R9 and R10 represent, independently from each occurrence, a hydrogen atom or a C1-C3-alkyl group,
or
R9 and R10 together with the nitrogen to which they are attached represent a
nitrogen containing 4- to 7-membered heterocycloalkyl group,
R11 represents, independently from each occurrence a hydrogen atom, a halogen atom or a group selected from
C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6 —, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8)
R12 represents, independently from each occurrence, a hydrogen atom, a halogen atom or a C1-C3-alkyl group,
R13 represents a group selected from
C1-C6-alkyl, C1-C6-haloalkyl, C2-C6-alkenyl, C2-C6-alkynyl, aryl, —(C1-C6-alkyl)-aryl, -aryl-(C1-C6-alkyl), C3-C8-cycloalkyl, C1-C6-alkoxy, —O(C2-C6-alkenyl), C1-C6-haloalkoxy, C3-C8-cycloalkoxy, aryl, —O-aryl, cyano, —C(═O)OR6 —, hydroxy, —SH, —S—(C1-C6-alkyl), —S—(C2-C6-alkenyl), S(═O)2—(C1-C6-alkyl), —S(═O)2—(C2-C6-alkenyl), —N(O)2, and —N(R7)(R8),
R14 represents a hydrogen atom or a group selected from
a cyano group and a —C(═O)(C1-C3-haloalkyl) group,
R15 represents a group selected from
a C1-C6-alkyl group and a benzyl group,
or a tautomer, an N-oxide, or a salt thereof, or a salt of a tautomer or an N-oxide of said compound, and
one or more further active ingredients.
2. The pharmaceutical combination according to claim 1, wherein the one or more further active ingredients comprise an anti-cancer agent.
US17/161,615 2016-10-27 2021-01-28 4,5-annulated 1,2,4-triazolones Active 2037-03-07 US11787797B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/161,615 US11787797B2 (en) 2016-10-27 2021-01-28 4,5-annulated 1,2,4-triazolones

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CNPCT/CN2016/103642 2016-10-27
PCT/EP2017/077301 WO2018077944A2 (en) 2016-10-27 2017-10-25 4,5-annulated 1,2,4-triazolones
US201916345178A 2019-04-25 2019-04-25
US17/161,615 US11787797B2 (en) 2016-10-27 2021-01-28 4,5-annulated 1,2,4-triazolones

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US16/345,178 Division US10968216B2 (en) 2016-10-27 2017-10-25 4,5-annulated 1,2,4-triazolones
PCT/EP2017/077301 Division WO2018077944A2 (en) 2016-10-27 2017-10-25 4,5-annulated 1,2,4-triazolones

Publications (2)

Publication Number Publication Date
US20210188846A1 US20210188846A1 (en) 2021-06-24
US11787797B2 true US11787797B2 (en) 2023-10-17

Family

ID=60293935

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/345,178 Active US10968216B2 (en) 2016-10-27 2017-10-25 4,5-annulated 1,2,4-triazolones
US17/161,615 Active 2037-03-07 US11787797B2 (en) 2016-10-27 2021-01-28 4,5-annulated 1,2,4-triazolones

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US16/345,178 Active US10968216B2 (en) 2016-10-27 2017-10-25 4,5-annulated 1,2,4-triazolones

Country Status (8)

Country Link
US (2) US10968216B2 (en)
EP (1) EP3532474B1 (en)
JP (3) JP2019535689A (en)
CN (2) CN114921391B (en)
CA (1) CA3041650A1 (en)
TW (1) TW201827430A (en)
UY (1) UY37460A (en)
WO (1) WO2018077944A2 (en)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10968216B2 (en) 2016-10-27 2021-04-06 Bayer Aktiengesellschaft 4,5-annulated 1,2,4-triazolones
TW201945346A (en) 2018-04-10 2019-12-01 德商拜耳廠股份有限公司 Method for the preparation of a 2,4,5-trisubstituted 1,2,4-triazolone
EP3553052A1 (en) * 2018-04-10 2019-10-16 Bayer AG 5-oxo-4,5-dihydro-1h-1,2,4-triazol derivatives for the treatment of cancer
WO2019197269A1 (en) * 2018-04-11 2019-10-17 Bayer Aktiengesellschaft Combinations of copanlisib with triazolone derivatives and their use in the treatment of cancer
TW202104207A (en) 2019-04-17 2021-02-01 美商健生生物科技公司 Dihydroorotate dehydrogenase inhibitors
AU2020338985A1 (en) * 2019-08-29 2022-04-14 Janssen Biotech, Inc. Substituted urea dihydroorotate dehydrogenase inhibitors
EP4041714B1 (en) * 2019-10-10 2023-12-13 Janssen Biotech, Inc. Bi-aryl dihydroorotate dehydrogenase inhibitors
JP2023527213A (en) * 2020-05-29 2023-06-27 メッドシャイン ディスカバリー インコーポレイテッド triazolone compounds
CN116804004A (en) * 2020-07-14 2023-09-26 南京征祥医药有限公司 Compounds as DHODH inhibitors
WO2022070069A1 (en) * 2020-09-30 2022-04-07 Janssen Biotech, Inc. Dihydroorotate dehydrogenase inhibitors
JP2024514339A (en) * 2021-04-16 2024-04-01 ホットスポット セラピューティクス インコーポレイテッド Compounds, compositions, and methods for treating cancer
CN117616026A (en) * 2021-07-05 2024-02-27 微境生物医药科技(上海)有限公司 1,2, 4-triazolone derivatives as DHODH inhibitors, preparation method and application thereof
WO2023093812A1 (en) * 2021-11-26 2023-06-01 南京明德新药研发有限公司 Crystal form of triazolone compound and use thereof
WO2024015864A1 (en) * 2022-07-12 2024-01-18 Hotspot Therapeutics, Inc. Cbl-b inhibitors and anti-pd1/anti-pd-l1 for use in the treatment of cancer
WO2024015863A1 (en) * 2022-07-12 2024-01-18 Hotspot Therapeutics, Inc. Cbl-b inhibitor, compositions comprising a cbl-b inhibitor in a method of treating a disease associated with cell proliferation

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998002422A1 (en) 1996-07-11 1998-01-22 Bayer Aktiengesellschaft Substituted aromatic carbonyl compounds and their derivatives
US6444613B1 (en) 1999-03-12 2002-09-03 Hoechst Schering Agrevo Gmbh Defoliant
WO2003006425A2 (en) 2001-07-10 2003-01-23 4Sc Ag Novel compounds as anti-inflammatory, immunomodulatory and anti-proliferatory agents
WO2010077686A1 (en) 2008-12-08 2010-07-08 Sirtris Pharmaceuticals, Inc. Isoindolinone and related analogs as sirtuin modulators
US20110275603A1 (en) 2010-05-06 2011-11-10 Rhizen Pharmaceuticals Sa Novel immunomodulator and anti-inflammatory compounds
US20120028959A1 (en) 2009-04-02 2012-02-02 Merck Serono S.A. Dihydroorotate dehydrogenase inhibitors
WO2013087579A1 (en) 2011-12-12 2013-06-20 Bayer Intellectual Property Gmbh Substituted triazolopyridines and their use as ttk inhibitors
WO2013186692A1 (en) 2012-06-15 2013-12-19 Glenmark Pharmaceuticals S.A. TRIAZOLONE COMPOUNDS AS mPGES-1 INHIBITORS
WO2014128669A2 (en) 2013-02-25 2014-08-28 Aurigene Discovery Technologies Limited Trisubstituted benzotriazole derivatives as dihydroorotate oxygenase inhibitors
US20160251341A1 (en) 2015-02-27 2016-09-01 Verseon Corporation Substituted triazole compounds as serine protease inhibitors
CN106543139A (en) 2015-09-17 2017-03-29 沈阳中化农药化工研发有限公司 A kind of triadimefon compound and application thereof
US20190307728A1 (en) 2018-04-10 2019-10-10 Bayer Pharma Aktiengesellschaft Methods of treatment with a 2,4,5-trisubstituted 1,2,4-triazolone
EP3553052A1 (en) 2018-04-10 2019-10-16 Bayer AG 5-oxo-4,5-dihydro-1h-1,2,4-triazol derivatives for the treatment of cancer
WO2019197269A1 (en) 2018-04-11 2019-10-17 Bayer Aktiengesellschaft Combinations of copanlisib with triazolone derivatives and their use in the treatment of cancer
WO2019197239A1 (en) 2018-04-10 2019-10-17 Bayer Aktiengesellschaft Method for the preparation of a 2,4,5-trisubstituted 1,2,4-triazolone
US20200123129A1 (en) 2016-10-27 2020-04-23 Bayer Aktiengesellschaft 2,4,5-trisubstituted 1,2,4-triazolones useful as inhibitors of dhodh
US10968216B2 (en) 2016-10-27 2021-04-06 Bayer Aktiengesellschaft 4,5-annulated 1,2,4-triazolones

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19901846A1 (en) 1999-01-19 2000-07-20 Bayer Ag New aryl-substituted aza-heterocyclic compounds, useful as pre- or post-emergence, total or selective herbicides, show defoliant, dessicant and especially weed-killing activity
AU2002241768A1 (en) * 2000-10-30 2002-06-18 Pharmacia Corporation Aspergillus ochraceus 11 alpha hydroxylase and oxidoreductase
JP6199742B2 (en) * 2010-12-16 2017-09-20 ファルマツェル、ゲーエムベーハー Novel 7β-hydroxysteroid dehydrogenase mutant and method for preparing ursodeoxycholic acid
EP2675440B1 (en) 2011-02-14 2020-03-25 Merck Sharp & Dohme Corp. Cathepsin cysteine protease inhibitors
EP2914729B1 (en) * 2012-11-01 2022-01-26 The University of British Columbia Cytochrome p450 and cytochrome p450 reductase polypeptides, encoding nucleic acid molecules and uses thereof
CN104561093A (en) * 2014-12-25 2015-04-29 华东师范大学 Recombination human CYP3A4 (cytochrome P450 3A4) /CPR (cytochrome P450 oxidoreductase) /cyt b5 (cytochrome b5) protein co-transfection co-expression method

Patent Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998002422A1 (en) 1996-07-11 1998-01-22 Bayer Aktiengesellschaft Substituted aromatic carbonyl compounds and their derivatives
US6444613B1 (en) 1999-03-12 2002-09-03 Hoechst Schering Agrevo Gmbh Defoliant
WO2003006425A2 (en) 2001-07-10 2003-01-23 4Sc Ag Novel compounds as anti-inflammatory, immunomodulatory and anti-proliferatory agents
WO2010077686A1 (en) 2008-12-08 2010-07-08 Sirtris Pharmaceuticals, Inc. Isoindolinone and related analogs as sirtuin modulators
US20120028959A1 (en) 2009-04-02 2012-02-02 Merck Serono S.A. Dihydroorotate dehydrogenase inhibitors
CN102574786A (en) 2009-04-02 2012-07-11 默克雪兰诺有限公司 Dihydroorotate dehydrogenase inhibitors
US20110275603A1 (en) 2010-05-06 2011-11-10 Rhizen Pharmaceuticals Sa Novel immunomodulator and anti-inflammatory compounds
CN103097353A (en) 2010-05-06 2013-05-08 印蔻真治疗公司 Novel immunomodulator and anti inflammatory compounds
WO2013087579A1 (en) 2011-12-12 2013-06-20 Bayer Intellectual Property Gmbh Substituted triazolopyridines and their use as ttk inhibitors
JP2015500308A (en) 2011-12-12 2015-01-05 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングＢａｙｅｒ Ｉｎｔｅｌｌｅｃｔｕａｌ Ｐｒｏｐｅｒｔｙ ＧｍｂＨ Substituted triazolopyridines and their use as TTK inhibitors
JP2015523353A (en) 2012-06-15 2015-08-13 グレンマーク・ファーマシューティカルズ・エスエー Triazolone compounds as mPGES-1 inhibitors
WO2013186692A1 (en) 2012-06-15 2013-12-19 Glenmark Pharmaceuticals S.A. TRIAZOLONE COMPOUNDS AS mPGES-1 INHIBITORS
WO2014128669A2 (en) 2013-02-25 2014-08-28 Aurigene Discovery Technologies Limited Trisubstituted benzotriazole derivatives as dihydroorotate oxygenase inhibitors
US20160251341A1 (en) 2015-02-27 2016-09-01 Verseon Corporation Substituted triazole compounds as serine protease inhibitors
CN106543139A (en) 2015-09-17 2017-03-29 沈阳中化农药化工研发有限公司 A kind of triadimefon compound and application thereof
US20200123129A1 (en) 2016-10-27 2020-04-23 Bayer Aktiengesellschaft 2,4,5-trisubstituted 1,2,4-triazolones useful as inhibitors of dhodh
US10968216B2 (en) 2016-10-27 2021-04-06 Bayer Aktiengesellschaft 4,5-annulated 1,2,4-triazolones
US20190307728A1 (en) 2018-04-10 2019-10-10 Bayer Pharma Aktiengesellschaft Methods of treatment with a 2,4,5-trisubstituted 1,2,4-triazolone
EP3553052A1 (en) 2018-04-10 2019-10-16 Bayer AG 5-oxo-4,5-dihydro-1h-1,2,4-triazol derivatives for the treatment of cancer
WO2019197239A1 (en) 2018-04-10 2019-10-17 Bayer Aktiengesellschaft Method for the preparation of a 2,4,5-trisubstituted 1,2,4-triazolone
WO2019197269A1 (en) 2018-04-11 2019-10-17 Bayer Aktiengesellschaft Combinations of copanlisib with triazolone derivatives and their use in the treatment of cancer

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
Baumann et al., "Dihydroorotate dehydrogenase inhibitor A771726 (leflunomide) induces apoptosis and diminishes proliferation of multiple myeloma cells," Molecular Cancer Therapeutics, Feb. 2009, vol. 8, No. 2, pp. 366-375.
Christian et al., "The novel dihydroorotate dehydrogenase (DHODH) inhibitor BAY 2402234 triggers differentiation and is effective in the treatment of myeloid malignancies," Leukemia, Apr. 2, 2019, vol. 33, pp. 2403-2415.
English translation of the Office Action dated Jun. 26, 2023 in corresponding Japanese Patent Application No. 2022-103480 (6 pages).
International Search Report and Written Opinion for corresponding International Patent Application No. PCT/EP2017/077301, dated May 4, 2018 (20 pages).
Ishige et al., "Whole organism biocatalysis," Current Opinion in Chemical Biology, Apr. 2005, vol. 9, Iss. 2, pp. 174-180.
Iwata et al., "High Catalytic Activity of Human Cytochrome P450 Co-expressed with Human NADPH-Cytochrome P450 Reductase in Escherichia coli," Biochemical Pharmacology, 1998, vol. 55, 1315-1325.
Lau et al., "In Vitro Functional Characterisation of Cytochrome P450 (CYP) 2C19 Allelic Variants CYP2C19*23 and CYP2C19*24," Biochemical Genetics, 2017, vol. 55, pp. 48-62.
Loffler et al., "Dihydroorotat-ubiquinone oxidoreductase links mitochondria in the biosynthesis of pyrimidine nucleotides," Molecular and Cellular Biochemistry, Sep. 1997, vol. 174, pp. 125-129.
Office Action dated Aug. 9, 2022 in corresponding European Patent Application No. 17797091.0 (9 pages).
Office Action dated Jun. 26, 2023 in corresponding Japanese Patent Application No. 2022-103480 (4 pages).
Phillips et al., "Triazolopyrimidine-Based Dihydroorotate Dehydrogenase Inhibitors with Potent and Selective Activity against the Malaria Parasite Plasmodium falciparum," Journal of Medicinal Chemistry, Jan. 31, 2008, vol. 51, No. 12, pp. 3649-3653.
Sanz et al., "Management of acute promyelocytic leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet," Blood, Feb. 26, 2009, vol. 113, No. 9, pp. 1875-1891.
Sykes et al., "Inhibition of Dihydroorotate Dehydrogenase Overcomes Differentiation Blockade in Acute Myeloid Leukemia," Cell, Sep. 22, 2016, vol. 167, Iss. 1, pp. 171-186, e15.

Also Published As

Publication number Publication date
WO2018077944A3 (en) 2018-06-14
JP2022130571A (en) 2022-09-06
CA3041650A1 (en) 2018-05-03
CN110248937A (en) 2019-09-17
EP3532474A2 (en) 2019-09-04
US10968216B2 (en) 2021-04-06
EP3532474B1 (en) 2024-03-27
UY37460A (en) 2018-05-31
US20210188846A1 (en) 2021-06-24
CN114921391B (en) 2024-01-02
CN110248937B (en) 2022-03-29
CN114921391A (en) 2022-08-19
JP2019535689A (en) 2019-12-12
WO2018077944A2 (en) 2018-05-03
US20190375747A1 (en) 2019-12-12
TW201827430A (en) 2018-08-01
JP2024063131A (en) 2024-05-10

Similar Documents

Publication Publication Date Title
US11787797B2 (en) 4,5-annulated 1,2,4-triazolones
US11130745B2 (en) 2,4,5-trisubstituted 1,2,4-triazolones useful as inhibitors of DHODH
US10179123B2 (en) 2-aryl- and 2-arylalkyl-benzimidazoles as mIDH1 inhibitors
US11773070B2 (en) Dihydrooxadiazinones
US20230357239A1 (en) Pyrido[2,3-d]pyrimidin-4-amines as sos1 inhibitors
US10894784B2 (en) Heteroarylbenzimidazole compounds
CA3216503A1 (en) Phosphorus derivatives as novel sos1 inhibitors
US11897867B2 (en) 6-phenyl-4,5-dihydropyridazin-3(2H)-one derivatives as PDE3A and PDE3B inhibitors for treating cancer
WO2017207534A1 (en) Substituted heteroarylbenzimidazole compounds
WO2024079252A1 (en) Sos1 inhibitors
US20240182452A1 (en) 6-phenyl-4,5-dihydropyridazin-3(2h)-one derivatives as pde3a and pde3b inhibitors for treating cancer
WO2020048831A1 (en) 5-aryl-3,9-diazaspiro[5.5]undecan-2-one compounds
EA039707B1 (en) 2,4,5-trisubstituted 1,2,4-triazolones, methods of preparing same, intermediate compounds, pharmaceutical composition and use of compounds for treating a hyperproliferative disease

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

AS Assignment

Owner name: THE BROAD INSTITUTE, INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:FERRARA, STEVEN JAMES;REEL/FRAME:063524/0342

Effective date: 20171218

Owner name: PRESIDENT AND FELLOWS OF HARVARD COLLEGE, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SYKES, DAVID B.;REEL/FRAME:063524/0358

Effective date: 20171218

Owner name: THE GENERAL HOSPITAL CORPORATION, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SYKES, DAVID B.;REEL/FRAME:063524/0358

Effective date: 20171218

Owner name: BAYER PHARMA AKTIENGESELLSCHAFT, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GRADL, STEFAN NIKOLAUS;NGUYEN, DUY;EIS, KNUT;AND OTHERS;SIGNING DATES FROM 20190216 TO 20191106;REEL/FRAME:063524/0275

Owner name: BAYER AKTIENGESELLSCHAFT, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GRADL, STEFAN NIKOLAUS;NGUYEN, DUY;EIS, KNUT;AND OTHERS;SIGNING DATES FROM 20190216 TO 20191106;REEL/FRAME:063524/0275

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE