US11638717B2 - Complex of nucleic acid medicine and multibranched lipid - Google Patents
Complex of nucleic acid medicine and multibranched lipid Download PDFInfo
- Publication number
- US11638717B2 US11638717B2 US16/497,323 US201816497323A US11638717B2 US 11638717 B2 US11638717 B2 US 11638717B2 US 201816497323 A US201816497323 A US 201816497323A US 11638717 B2 US11638717 B2 US 11638717B2
- Authority
- US
- United States
- Prior art keywords
- circumflex over
- substituted
- unsubstituted
- compound
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active, expires
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
Definitions
- the present invention relates to a complex of a nucleic acid medicine having suppressing activity of the target gene expression and a multibranched lipid(s). More particularly, it relates to a complex in which a multibranched lipid(s) binds to an oligonucleotide having suppressing activity of the target gene expression through a linker (hereinafter referred to as “the complex of the present invention”).
- Nucleic acid medicines targeting mRNA include antisense oligonucleotides, siRNA, microRNAs (hereinafter referred to as “miRNA”) and the like.
- An antisense oligonucleotide is an oligonucleotide complementary to mRNA, mRNA precursor or ncRNA (non-coding RNA) such as ribosomal RNA, transfer RNA, miRNA and the like, of the target gene, and a single-stranded DNA, RNA and/or structural analog thereof which consists of about 8 to 30 bases.
- the antisense oligonucleotide suppresses the function of mRNA, mRNA precursor or ncRNA by forming a double strand with the target mRNA, mRNA precursor or ncRNA.
- a siRNA is a low molecular weight double-strand RNA complementary to the target gene which consists of about 19 to 25 base pairs.
- a siRNA is incorporated into a protein called RISC to be a single-stranded siRNA (guide strand), and then the more unstable single strand (passenger strand) is degraded.
- the guide strand binds to mRNA of the target gene having a complementary base sequence and then suppresses the gene expression by base sequence-specific mRNA degradation.
- miRNA is an endogenous, non-coding RNA of about 20 to 25 bases encoded on the genome. miRNA is transcribed from a miRNA gene on the genomic DNA first as a primary transcript (Primary miRNA, Pri-miRNA) having a length of about several hundred to several thousand bases, and then processed into a pre-miRNA (precursor miRNA) having a hairpin structure of about 60 to 110 bases. Thereafter, it moves from the nucleus into the cytoplasm and is further spliced into a double-stranded miRNA of about 20 to 25 bases.
- Primary miRNA Primary miRNA
- pre-miRNA pre-miRNA having a hairpin structure of about 60 to 110 bases. Thereafter, it moves from the nucleus into the cytoplasm and is further spliced into a double-stranded miRNA of about 20 to 25 bases.
- the double-stranded miRNA is incorporated into a protein called RISC to be a single-stranded miRNA (guide strand), and then the more unstable single strand (passenger strand) is degraded.
- the single-stranded miRNA binds to mRNA of the target gene having a partially complementary base sequence and inhibit translation of the target gene.
- nucleic acids themselves are S-oligos (phosphorothioates) in which the phosphoric acid part is modified, 2′,4′-BNA (bridged nucleic acid)/LNA (locked nucleic acid) in which the sugar moiety is modified, and the like (see Patent Documents 1 to 5).
- S-oligos phosphorothioates
- 2′,4′-BNA bridged nucleic acid
- LNA locked nucleic acid
- Non-Patent Documents 1 and 2 disclose siRNAs in which single-chain lipids binds at the 3′-end.
- Patent Documents 6 and 7 and the like disclose a siRNA to which a lipid comprising an GalNac (N-acetylgalactosamine) derivative binds.
- Patent Document 8 discloses a siRNA to which phosphatidylethanolamine binds.
- Patent Document 9 discloses that by binding tocophenol to a double-stranded oligonucleotide comprising an RNA oligonucleotide complementary to an antisense oligonucleotide, the oligonucleotide was efficiently delivered to and accumulated in the liver and suppressed expression of the target gene in the liver compared to a single-stranded antisense oligonucleotide in mice.
- Patent Document 10 discloses that by binding a GalNac derivative to a double-stranded oligonucleotide comprising an RNA oligonucleotide complementary to an antisense oligonucleotide, when it administered not only intravenously but also subcutaneously, the oligonucleotide was efficiently delivered to and accumulated in the liver and suppressed expression of the target gene in the liver.
- the purpose of the present invention is to provide novel complexes which can enhance suppressing activity of the target gene expression of the nucleic acid medicines in the complexes.
- the present inventors have intensively studied and synthesized a complex in which a multibranched lipid binds to an oligonucleotide comprising a nucleic acid medicine. They have found that a complex comprising siRNA as a nucleic acid medicine improves the suppressing activity of the target gene expression without using a gene transfection reagent and improves the suppressing activity of the target gene expression not only in liver but also in skeletal muscles, heart, fats, and the like. They have also found that a complex comprising a miRNA as a nucleic acid medicine have improved antitumor effect compared to a miRNA. They have also found that the complexes are resistant to lipolytic enzymes.
- the present invention relates to a complex in which multibranched lipids bind through a linker to an oligonucleotide comprising a nucleic acid medicine.
- a multibranched lipid comprising 1 to 3 chain(s) consisting of an amide-mediated alkyl at the terminus thereof is especially preferable.
- the present inventors have confirmed that the suppressing activity of the target gene expression is reduced in a complex in which a multibranched lipid comprising four chains of amide-mediated alkyl at the terminus bind to an oligonucleotide comprising a nucleic acid medicine (Comparative Example: siRNA 101).
- the present invention specifically relates to the followings.
- a 11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, or a group of the formula:
- a 1 to A 10 and A 16 to A 19 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene, when A 1 and A 2 or A 16 and A 17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, substituted or unsubstituted alkynylene or any carbon atom of A 1 and any carbon atom of A 2 , or any carbon atom of A 16 and any carbon atom of A 17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle, Y 1 to Y 7 are each independently a bond or O, X 1 , X 3 and X 6 are each independently NR 1 C( ⁇ O), C( ⁇ O)NR 1 , R 2 C( ⁇ O)NR 1 or NR 1 C( ⁇ O)R 2 , X 2 , X 4 , X 5
- a 1 to A 5 and Y 1 to Y 5 are a bond
- a 6 to A 10 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene,
- X 1 to X 5 are NHC( ⁇ O), and
- L 0 binds to the oligonucleotide and L 6 binds to lipid.
- L 0 is a bond, a nucleotide linker or a non-nucleotide linker
- L 1 is a group of the formula:
- Z are each independently O or S
- R 6 are each independently hydroxy, alkyl or alkyloxy
- L 2 and L 4 are each independently a bond or substituted or unsubstituted C1 to C20 alkylene
- L 3 are each independently a bond
- C( ⁇ O)NR 7 wherein R 7 is hydrogen or substituted or unsubstituted alkyl
- NR 8 C( ⁇ O) wherein R 8 is hydrogen, substituted or unsubstituted alkyl or R 8 and a carbon atom in alkylene of L 2 taken together may form substituted or unsubstituted nitrogen-containing ring
- S—S L 5 are each independently a bond, substituted or unsubstituted C1 to C20 alkylene, C( ⁇ O)NR 9 , NR 9 C( ⁇ O), NR 9 , O, or substituted or unsubstituted non-aromatic heterocyclyl
- R 9 is each independently hydrogen, substituted or unsubstituted alkyl,
- OL is an oligonucleotide having suppressing activity of the target gene expression
- 5′ means that it binds at the 5′-end of the oligonucleotide
- 3′ means that it binds at the 3′-end of the oligonucleotide
- Z 1-1 is O or S
- L 0-1 is a bond
- L 5-1 is a bond
- L 6-1 is a bond or an amino acid linker
- LI is a lipid of any one of a group of the formula: (LI-1) to (LI-9).
- a 1-1 is a bond or methylene
- a 2-1 is C1 to C4 straight alkylene
- a 11-1 is C7 to C23 straight or branched alkyl
- a 12-1 is C3 to C23 straight or branched alkyl or alkenyl, a group comprising a fat-soluble compound, or a group of the formula:
- a 13-1 , A 14-1 and A 15-1 are C9 to C13 straight alkyl.
- a 20-1 and A 21-1 is C13 straight alkyl, and A 12-2 is C15 straight alkyl or a group comprising a fat-soluble compound.
- a 11-2 is C15 straight alkyl
- a 12-3 is C1 to C4 straight alkyl substituted with amino
- a 20-2 and A 21-2 are C13 straight alkyl, and A 12-4 is C4 straight alkyl substituted with amino.
- a 11-3 and A 12-5 are C15 straight alkyl.
- a pharmaceutical composition comprising the complex of any one of (1-1) to (1-6).
- the present invention also includes the followings.
- the first strand is an oligonucleotide consisting of a sequence capable of hybridizing with the target sequence in the target gene, and
- the second strand is an oligonucleotide consisting of a sequence capable of hybridizing with the first strand
- X 1 ′ and X 2 ′ are each independently a bond, NR 1 ′C( ⁇ O), C( ⁇ O)NR 1 ′, R 2 ′C( ⁇ O)NR 1 ′ or NR 1 ′C( ⁇ O)R 2 ′, R 2 ′ is O or NR 3 ′, R 1 ′ and R 3 ′ are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl, A 1 ′ and A 2 ′ are each independently substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl, and p′ and q′ are each independently an integer of 0 to 4, provided that a substituent for alkyl, alkenyl and alkynyl is halogen, carboxy, amino, imino, formyl, formyloxy
- Group ⁇ ′ hydroxy, alkyl, alkyloxy, mercapto, alkylthio, amino, alkylamino and halogen.
- a 1 ′, A 2 ′, p′ or q′ has the same meaning as claim 1 .
- (2-3) The complex of (2-1) or (2-2), wherein A 1 ′ and A 2 ′ are each independently C6 to C30 alkyl.
- (2-4) The complex of any one of (2-1) to (2-3), wherein the lipid binds to the second strand.
- (2-5) The complex of (2-4), wherein the lipid binds at the 3′ end and/or 5′ end of the oligonucleotide.
- (2-6) The complex of any one of (2-1) to (2-5), wherein the linker is
- L 1 ′ binds to the oligonucleotide, and L 5 ′ binds to the lipid.
- L 1 ′ is C( ⁇ O)NH, NHC( ⁇ O), NHC( ⁇ O)NH,
- L 2 ′ are each independently substituted or unsubstituted C1 to C20 alkylene which aromatic ring may mediate, or aromatic ring
- L 3 ′ are each independently a bond
- C( ⁇ O)NR 5 ′ wherein R 5 ′ is hydrogen or substituted or unsubstituted alkyl; or NR 6 ′C( ⁇ O), wherein R 6 ′ is hydrogen, substituted or unsubstituted alkyl or R 6 ′ and a carbon atom in alkylene of L 2 ′ taken together may form substituted or unsubstituted nitrogen-containing ring
- L 4 ′ are each independently a bond or substituted or unsubstituted C1 to C20 alkylene which aromatic ring may mediate, or aromatic ring
- L 5 ′ is a bond
- r′ is an integer of 0
- the complexes of the present invention are capable of exerting suppressing activity of the target gene expression of nucleic acid medicines in the complexes without using a gene transfer reagent.
- the nucleic acid medicines in the complexes are delivered, accumulated, and exerts the activity not only in liver but also in skeletal muscles, heart, fats and the like, a therapeutic or prophylactic effect of the disease, which it is desired to suppress the target gene expression in skeletal muscles, heart, fats and the like, can be obtained by administration a complex of the present invention including an appropriate nucleic acid medicine.
- a genetic manipulation method which is well known in this field can be used.
- it is a method described in Molecular Cloning, A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press (2012) or Current Protocols Essential Laboratory Techniques, Current Protocols (2012).
- nucleoside means a compound that a nucleic-acid base and a sugar are bonded by an N-glycoside bond.
- oligonucleotide means nucleotides that some of same or different kinds of nucleotide are bonded.
- a linkage between a sugar and a sugar in an oligonucleotide may be a linkage having a natural nucleic acid, phosphodiester (D-oligo), an artificially modified linkage or a linkage without phosphorus atom. Any linkage which is well-known in this field can be used. Examples of an artificially modified linkage are phosphorothioate (S-oligo), methylphosphonate (M-oligo) and boranophosphate. Furthermore, a linkage described in WO2013/022966, WO2011/005761, WO2014/012081, WO2015/125845 or the like can be used.
- linkage without phosphorus atom is a bivalent substituent deriving from non-aromatic carbocyclyl or the like substituted with alkyl, non-aromatic carbocyclyl, haloalkyl or halogen.
- Example is a bivalent substituent deriving from siloxane, sulfide, sulfoxide, sulfone, acetyl, acetyl formate, acetyl thioformate, acetyl methylene formate, acetyl thioformate, alkenyl, sulfamate, methyleneimino, methylenehydrazino, sulfonate, sulfonamide, amide or the like.
- linkages may be same or different.
- RNA nucleoside means a natural DNA nucleoside or natural RNA nucleoside, and a part of a nucleotide, which is one unit for a component of an oligonucleotide.
- a “natural DNA nucleoside” is as below.
- B X1 is adenine, guanine, cytosine or thymine.
- a “natural RNA nucleoside” is as below.
- B X2 is adenine, guanine, cytosine or uracil.
- DNA oligonucleotide means an oligonucleotide that some DNA nucleosides are bounded.
- RNA oligonucleotide means an oligonucleotide that some RNA nucleosides are bounded.
- nucleoside derivative means a nucleoside wherein the nucleic-acid base and/or sugar part of DNA nucleoside or RNA nucleoside was artificially modified. It also means abasic nucleoside wherein the nucleic-acid base is deleted. Any well-known modification for a nucleoside in this field can be used.
- nucleic-acid base examples include 5-methyl cytosine, 5-hydroxymethyl cytosine and 5-propynyl cytosine.
- modification for a sugar part is a substituent at the 2′ position of a sugar moiety.
- examples are 2′-F, 2′-OCH 3 (2′-OMe) and 2′-OCH 2 CH 2 OCH 3 (2′-MOE).
- the other example is the following bridged structure between the 4′ and 2′ positions of a sugar moiety.
- Y 4 ′ is O, S, NH or CH 2
- R 7 ′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl
- R 8 ′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl
- R 9 ′ is a hydrogen atom, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aromatic carbocyclyl, substituted or unsubstituted non-aromatic carbocyclyl, substituted or unsubstituted aromatic heterocyclyl, substituted or
- R 7 ′ and R 8 ′ is preferably a hydrogen atom.
- R 9 ′ is preferably a hydrogen atom, alkyl, alkenyl, alkynyl, aromatic carbocyclyl, non-aromatic carbocyclyl, aromatic heterocyclyl, non-aromatic heterocyclyl, aromatic carbocyclylalky, non-aromatic carbocyclylalky, aromatic heterocyclylalkyl or non-aromatic heterocyclylalkyl, and may have any one or more substituent(s) selected from Group ⁇ ′.
- Group ⁇ ′ hydroxy, alkyl, alkyloxy, mercapto, alkylthio, amino, alkylamino and halogen.
- the bridged structure is preferably 4′-(CR 7 ′R 8 ′)m′-O-2′ or 4′-(CR 7 ′R 8 ′)m 1 ′-C( ⁇ O)—NR 9 ′-2′ (AmNA, Bridged nucleic acid),
- R 7 ′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
- R 8 ′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
- R 9 ′ is a hydrogen atom, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
- n′ is an integer of 1 to 4,
- m 1 ′ is an integer of 0 to 2.
- the bridged structure is more preferably 4′-(CH 2 )m′-O-2′, wherein m′ is an integer of 1 to 4, or 4′-C( ⁇ O)—NR 9 ′-2′, wherein R 9 ′ is a hydrogen atom or alkyl.
- 4′-(CH 2 )m′-O-2′ wherein m′ is an integer of 1 to 4, is more preferably 4′-CH 2 —O-2′ (LNA, Locked nucleic acid).
- LNA Locked nucleic acid
- Halogen includes a fluorine atom, a chlorine atom, a bromine atom and an iodine atom. A fluorine atom and a chlorine atom are especially preferable.
- Alkyl includes a C1 to C15, preferably a C1 to C10, more preferably a C1 to C6 and even more preferably a C1 to C4 linear or branched hydrocarbon group. Examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, n-heptyl, isoheptyl, n-octyl, isooctyl, n-nonyl and n-decyl.
- a preferred embodiment is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl or n-pentyl.
- a more preferred embodiment is methyl, ethyl, n-propyl, isopropyl or tert-butyl.
- Alkenyl includes a C2 to C15, preferably a C2 to C10, more preferably a C2 to C6 and further preferably a C2 to C4 linear or branched hydrocarbon group having one or more double bond(s) at any position(s).
- Examples include vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, prenyl, butadienyl, pentenyl, isopentenyl, pentadienyl, hexenyl, isohexenyl, hexadienyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodecenyl, tridecenyl, tetradecenyl and pentadecenyl.
- a preferred embodiment is vinyl, allyl, propenyl, isopropenyl or butenyl.
- Alkynyl includes a C2 to C10, preferably a C2 to C8, more preferably a C2 to C6 and further preferably a C2 to C4 linear or branched hydrocarbon group having one or more triple bond(s) at any position(s). Examples include ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl and decynyl. Furthermore, it may have double bond(s) at any position(s). A preferred embodiment is ethynyl, propynyl, butynyl or pentynyl.
- “Aromatic carbocyclyl” means a cyclic aromatic hydrocarbon group which is monocyclic or polycyclic having two or more rings. Examples include phenyl, naphthyl, anthryl and phenanthryl. A preferred embodiment is phenyl.
- Non-aromatic carbocyclyl means a cyclic saturated hydrocarbon group or cyclic unsaturated non-aromatic hydrocarbon group, which is monocyclic or polycyclic having two or more rings.
- Examples of the non-aromatic carbocyclyl, which is polycyclic having two or more rings, include a fused ring group wherein a non-aromatic carbocyclyl, which is monocyclic or polycyclic having two or more rings, is fused with a ring of the above “aromatic carbocyclyl”.
- non-aromatic carbocyclyl also include a group having a bridge and a group to form a spiro ring as follows:
- the non-aromatic carbocyclyl which is monocyclic, is preferably C3 to C16, more preferably C3 to C12 and further preferably C4 to C8 carbocyclyl.
- Examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl and cyclohexadienyl.
- non-aromatic carbocyclyl which is polycyclic having two or more rings, include indanyl, indenyl, acenaphthyl, tetrahydronaphthyl and fluorenyl.
- “Aromatic heterocyclyl” means an aromatic cyclyl, which is monocyclic or polycyclic having two or more rings, containing one or more of heteroatom(s) selected independently from O, S and N.
- aromatic heterocyclyl which is polycyclic having two or more rings
- aromatic heterocyclyl examples include a fused ring group wherein an aromatic heterocyclyl, which is monocyclic or polycyclic having two or more rings, is fused with a ring of the above “aromatic carbocyclyl” and/or “non-aromatic carbocyclyl”.
- the aromatic heterocyclyl which is monocyclic, is preferably a 5- to 8-membered and more preferably 5- to 6-membered ring.
- Examples include pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazolyl, triazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, isothiazolyl, thiazolyl and thiadiazolyl.
- aromatic heterocyclyl which is bicyclic, include indolyl, isoindolyl, indazolyl, indolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, naphthyridinyl, quinoxalinyl, purinyl, pteridinyl, benzimidazolyl, benzisoxazolyl, benzoxazolyl, benzoxadiazolyl, benzisothiazolyl, benzothiazolyl, benzothiadiazolyl, benzofuryl, isobenzofuryl, benzothienyl, benzotriazolyl, imidazopyridyl, triazolopyridyl, imidazothiazolyl, pyrazinopyridazinyl, oxazolopyridyl and thiazolopyridyl.
- aromatic heterocyclyl which is polycyclic having three or more rings, include carbazolyl, acridinyl, xanthenyl, phenothiazinyl, phenoxathiinyl, phenoxazinyl and dibenzofuryl.
- Non-aromatic heterocyclyl means a non-aromatic cyclyl, which is monocyclic or polycyclic having two or more rings, containing one or more heteroatom(s) selected independently from O, S and N.
- non-aromatic heterocyclyl which is polycyclic having two or more rings
- non-aromatic heterocyclyl include a fused ring group wherein a non-aromatic heterocycle, which is monocyclic or polycyclic having two or more rings, is fused with a ring of “aromatic carbocyclyl”, “non-aromatic carbocyclyl” and/or “aromatic heterocyclyl”.
- non-aromatic heterocyclyl also include a group having a bridge and a group to form a spiro ring as follows:
- the non-aromatic heterocyclyl which is monocyclic, is preferably a 3- to 8-membered and more preferably 5- to 6-membered ring.
- Examples include dioxanyl, thiiranyl, oxiranyl, oxetanyl, oxathiolanyl, azetidinyl, thianyl, thiazolidinyl, pyrrolidinyl, pyrrolinyl, imidazolidinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl, piperidyl, piperazinyl, morpholinyl, morpholino, thiomorpholinyl, thiomorpholino, dihydropyridyl, tetrahydropyridyl, tetrahydrofuryl, tetrahydropyranyl, dihydrothiazolyl, tetrahydrothiazolyl, tetrahydrois
- non-aromatic heterocyclyl which is polycyclic having two or more rings, include indolinyl, isoindolinyl, chromanyl and isochromanyl.
- Haloalkyl means a group wherein one or more “halogen” binds to “alkyl”. Examples include monofluoromethyl, monofluoroethyl, monofluoropropyl, 2,2,3,3,3-pentafluoropropyl, monochloromethyl, trifluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 2,2,2-trichloroethyl, 1,2-dibromoethyl and 1,1,1-trifluoropropane-2-yl. A preferred embodiment is trifluoromethyl or trichloromethyl.
- Alkylamino includes monoalkylamino and dialkylamino.
- “Monoalkylamino” means a group wherein a hydrogen atom attached to a nitrogen atom of an amino group is replaced with “alkyl”. Examples include methylamino, ethylamino and isopropylamino. Preferably, it is methylamino or ethylamino.
- Dialkylamino means a group wherein two hydrogen atoms attached to a nitrogen atom of an amino group are replaced with two “alkyl”. These two alkyl groups may be the same or different. Examples include dimethylamino, diethylamino, N, N-diisopropylamino, N-methyl-N-ethylamino and N-isopropyl-N-ethylamino. Preferably, it is dimethylamino or diethylamino.
- Alkylcarbonylamino means a group wherein one or two hydrogen atoms attached to a nitrogen atom of an amino group are replaced with one or two “alkylcarbonyl”, “alkenylcarbony” or “alkynylcarbony”. The two alkylcarbonyl groups may be the same or different.
- alkylcarbonylamino include methylcarbonylamino, and ethylcarbonylamino.
- alkenylcarbonylamino include vinylcarbonylamino and propenylcarbonylamino.
- alkynylcarbonylamino include ethynylcarbonylamino and propynylcarbonylamino.
- Alkylcarbamoyl “alkenylcarbamoyl” or “alkynylcarbamoyl” means a group wherein one or two hydrogen atoms attached to a nitrogen atom of a carbamoyl group are replaced with one or two alkyl(s), alkenyl(s) or alkynyl(s). These two alkyl groups may be the same or different.
- alkylcarbamoyl include methylcarbamoyl, ethylcarbamoyl, dimethylcarbamoyl and diethylcarbamoyl.
- alkenylcarbamoyl examples include vinylcarbamoyl and propenylcarbamoyl.
- alkynylcarbamoyl examples include ethynylcarbamoyl and propynylcarbamoyl.
- “Aromatic carbocyclylalkyl” means an alkyl substituted with one or more “aromatic carbocyclyl”. Examples include benzyl, phenethyl, phenylpropyl, benzhydryl, trityl, naphthylmethyl and a group of the formula of
- aromatic carbocyclylalkyl is benzyl, phenethyl or benzhydryl.
- Non-aromatic carbocyclylalkyl means an alkyl substituted with one or more “non-aromatic carbocyclyl”.
- the “non-aromatic carbocyclylalkyl” also includes “non-aromatic carbocyclylalkyl” wherein the alkyl part is substituted with “aromatic carbocyclyl”. Examples include cyclopropylmethyl, cyclobutylmethyl, cyclopenthylmethyl, cyclohexylmethyl and a group of the formula of
- Aromatic heterocyclylalkyl means an alkyl substituted with one or more “aromatic heterocyclyl”.
- the “aromatic heterocyclylalkyl” also includes “aromatic heterocyclylalkyl” wherein the alkyl part is substituted with the above “aromatic carbocyclyl” and/or “non-aromatic carbocyclyl”.
- Examples include pyridylmethyl, furanylmethyl, imidazolylmethyl, indolylmethyl, benzothiophenylmethyl, oxazolylmethyl, isoxazolylmethyl, thiazolylmethyl, isothiazolylmethyl, pyrazolylmethyl, isopyrazolylmethyl, pyrrolidinylmethyl, benzoxazolylmethyl and groups of the formula of
- Non-aromatic heterocyclylalkyl means an alkyl substituted with one or more “non-aromatic heterocyclyl”.
- the “non-aromatic heterocyclylalkyl” also includes “non-aromatic heterocyclylalkyl” wherein the alkyl part is substituted with “aromatic carbocyclyl”, “non-aromatic carbocyclyl” and/or “aromatic heterocyclyl”. Examples include tetrahydropyranylmethyl, morpholinylethyl, piperidinylmethyl, piperazinylmethyl and groups of the formula of
- substituents for “substituted or unsubstituted alkyl”, “substituted or unsubstituted alkenyl”, “substituted or unsubstituted alkynyl”, “substituted or unsubstituted alkyloxy”, “substituted or unsubstituted alkylcarbonylamino”, “substituted or unsubstituted alkenylcarbonylamino”, “substituted or unsubstituted alkynylcarbonylamino”, “substituted or unsubstituted alkylcarbamoyl”, “substituted or unsubstituted alkenylcarbamoyl “or “substituted or unsubstituted alkynylcarbamoyl” include the following substituents.
- a carbon atom at any position(s) may be bonded to one or more group(s) selected from the following Group
- Group ß halogen, hydroxy, carboxy, amino, imino, hydroxyamino, hydroxyimino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, alkyloxy, alkenyloxy, alkynyloxy, haloalkyloxy, alkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, monoalkylamino, dialkylamino, alkylsulfonyl, alkenylsulfonyl, alkynylsulfonyl, monoalkylcarbonylamino,
- Examples of the substituents on the ring of “aromatic carbocyclyl”, “non-aromatic carbocyclyl”, “aromatic heterocyclyl” or “non-aromatic heterocyclyl” of “substituted or unsubstituted aromatic carbocyclyl”, “substituted or unsubstituted non-aromatic carbocyclyl”, “substituted or unsubstituted aromatic heterocyclyl” and “substituted or unsubstituted non-aromatic heterocyclyl” include the following substituents.
- An atom at any position(s) on the ring may be bonded to one or more group(s) selected from the following Group ⁇ .
- substituted or unsubstituted non-aromatic carbocyclyl and “substituted or unsubstituted non-aromatic heterocyclyl” may be substituted with “oxo”. In this case, it means a group wherein two hydrogen atoms on a carbon atom are substituted as below.
- the complex of the present invention is that
- a 11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl or a group of the formula:
- a 1 to A 10 and A 16 to A 19 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene, when A 1 and A 2 or A 16 and A 17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene or any carbon atom of A 1 and any carbon atom of A 2 , or any carbon atom of A 16 and any carbon atom of A 17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle, Y 1 to Y 7 are each independently a bond or O, X 1 , X 3 and X 6 are each independently NR 1 C( ⁇ O), C( ⁇ O)NR 1 , R 2 C( ⁇ O)NR 1 or NR 1 C( ⁇ O)R 2 , X 2 , X 4 , X
- any oligonucleotide known to have “suppressing activity of the target gene expression” can be used as the “oligonucleotide having suppressing activity of the target gene expression” of the complex of the present invention, and the oligonucleotide includes a nucleic acid medicine.
- a nucleic acid medicine includes, for example, a double-stranded oligonucleotide such as a siRNA and a miRNA, and a single-stranded oligonucleotide such as an antisense oligonucleotide.
- the “nucleic acid medicine” is an antisense oligonucleotide, it may form a double-stranded oligonucleotide with a sequence capable of hybridizing.
- the oligonucleotide of the complex of the present invention is an oligonucleotide, which is 8 to 50 bases, consisting of a sequence capable of hybridizing with the target sequence in the target gene. For example, it is 8 to 50 bases, 8 to 40 bases, 8 to 30 bases, 10 to 25 bases, and 15 to 25 bases.
- the second strand is an oligonucleotide, which is 8 to 60 bases, consisting of a sequence capable of hybridizing with the first strand consisting of a sequence capable of hybridizing with the target sequence in the target gene.
- the length of a second strand can be same with that of the first strand, and one or several nucleotide(s) shorter than that of the first strand as long as it can be hybridized with the first oligonucleotide.
- the length of a second strand can be longer than that of the first strand by adding one or several nucleotide(s) at one or both sides of a part hybridizing with the first strand.
- “one or several base(s)” means one to ten, one to five, one to three, or one or two bases.
- a preferable length of a second strand depends on the length of the first strand. For example, it is a length of 50% or more, 60% or more, 70% or more, 50 to 100%, 60 to 100% or 70 to 100% of the length of a first strand. A particularly preferred embodiment is 50 to 100% of the length of a first strand.
- An oligonucleotide in the complex of the present invention includes the one comprising one or several mismatch(es) in a part of hybridization as long as it can be hybridized under a stringent condition with the target sequence in the target gene.
- it is the oligonucleotide whose part for hybridization has at least 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more homology to the target sequence.
- an oligonucleotide of a second strand includes the one comprising one or several mismatch(es) in a part of hybridization as long as it can be hybridized under a stringent condition with a first strand capable of hybridizing with the target sequence in the target gene.
- it is the oligonucleotide whose part for hybridization has at least 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more homology to the first strand.
- the homology shows the similarity as a score, for example, by BLAST, a search program using algorithm discovered by Altschul et al. (The Journal of Molecular Biology, 215, 403-410 (1990).)
- a “stringent condition” mean a condition under which a base sequence forms hybrid (so-called specific hybrid) with a specific sequence but any base sequence without the equivalent function does not form hybrid (so-called non-specific hybrid) with the specific sequences. People skilled in this field can easily select the condition by changing a temperature during hybridization reaction or washing, salt concentration in hybridization or washing buffer, or the like.
- an example of a stringent condition of the present invention is, but not limited to the condition, which the oligonucleotide is hybridized in 6 ⁇ SSC (0.9 M NaCl, 0.09 M trisodium citrate) or 6 ⁇ SSPE (3 M NaCl, 0.2 M NaH 2 PO 4 , 20 mM EDTA-2Na, pH 7.4) at 42° C. and then washed with 0.5 ⁇ SSC at 42° C.
- 6 ⁇ SSC 0.9 M NaCl, 0.09 M trisodium citrate
- 6 ⁇ SSPE 3 M NaCl, 0.2 M NaH 2 PO 4 , 20 mM EDTA-2Na, pH 7.4
- One or several mismatch(es) means one to five, preferably one to three, and more preferably one or two mismatch(es).
- oligonucleotide in the complex of the present invention is an oligonucleotide which nucleosides selected from the group consisting of DNA nucleosides, RNA nucleosides and nucleoside derivatives are bounded. All nucleosides can be same, or two or more kinds of nucleosides.
- nucleoside derivative in an oligonucleotide in the complex of the present invention any modification(s) for a nucleoside which is well-known in this field such as the above examples can be used.
- a preferred embodiment is a nucleoside having a substituent at the 2′ position of sugar and/or a nucleoside having a bridge structure between at the 4′ and 2′ positions of sugar.
- a substituent at the 2′ position of a sugar a preferred embodiment is F, OCH 3 or OCH 2 CH 2 OCH 3 .
- OCH 3 is especially preferable.
- a preferred embodiment is 4′-(CH 2 )m′-O-2′, wherein m′ is an integer of 1 to 4, or 4′-C( ⁇ O)—NR 9 ′-2′, wherein R 9 ′ is hydrogen atom or alkyl.
- any well-known internucleoside linkage such as the above examples in this field can be used. All internucleoside linkages can be same, or two or more kinds of linkages.
- a preferred embodiment is D-oligo and/or S-oligo.
- the oligonucleotides in the complex of the present invention can be synthesized according to the usual methods in this field. For example, they can be easily synthesized by an automated nucleic acid synthesizer which is commercially available (e.g., the synthesizer by Applied Biosystems and Dainippon Seiki).
- a method for synthesizing is solid-phase synthesis using phosphoramidites, solid-phase synthesis using hydrogen phosphonates or the like. Examples are disclosed in the following Example 1, Tetrahedron Letters 22, 1859-1862 (1981) and the like.
- an oligonucleotide in the complex of the present invention is a double-stranded oligonucleotide
- the synthesized first strand and second strand form a double-stranded oligonucleotide by hybridizing according to the well-known method. Examples are disclosed in the following Example 1 Example 1 in WO2013/089283 and the like.
- the lipid binds through a linker to the oligonucleotide.
- the “lipid” for the complex of the present invention is a lipid of a group of the formula:
- a 11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl or a group of the formula:
- a 1 to A 10 and A 16 to A 19 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene, when A 1 and A 2 or A 16 and A 17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene or any carbon atom of A 1 and any carbon atom of A 2 , or any carbon atom of A 16 and any carbon atom of A 17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle, Y 1 to Y 7 are each independently a bond or O, X 1 , X 3 and X 6 are each independently NR 1 C( ⁇ O), C( ⁇ O)NR 1 , R 2 C( ⁇ O)NR 1 or NR 1 C( ⁇ O)R 2 , X 2 , X 4 , X
- a substituent for the alkyl, alkenyl, alkynyl, alkylene, alkenylene and alkynylene is halogen, hydroxy, carboxy, amino, imino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, aromatic carbocyclyl, non-aromatic carbocyclyl, non-aromatic heterocyclyl, non-aromatic heterocyclyl, aromatic carbocyclylcarbonyl, non-aromatic carbocyclylcarbonyl, aromatic heterocyclylcarbonyl or non-aromatic heterocyclylcarbonyl,
- Group ⁇ hydroxy, alkyl, alkyloxy, mercapto, alkylthio, amino, alkylamino and halogen.
- a 1 and A 2 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene or substituted or unsubstituted alkynylene, and “any carbon atom of A 1 and any carbon atom of A 2 taken together form substituted aromatic carbocycle or substituted non-aromatic carbocycle” means a group of the following left formula.
- a 16 and A 17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene or substituted or unsubstituted alkynylene, and “any carbon atom of A 16 and any carbon atom of A 17 taken together form substituted aromatic carbocycle or substituted non-aromatic carbocycle” means a group of the following right formula.
- ring B 1 or ring B 2 is substituted or unsubstituted aromatic carbocycle or substituted or unsubstituted non-aromatic carbocycle, and the other symbols has the same meaning as above.
- a group of the formula: Y 1 -[A 6 -X 1 ]m-A 11 and a group of the formula: Y 2 -[A 7 -X 2 ]n-A 12 bind to the different carbon atoms on ring B 1 , and one or more of any substituent selected from the above ⁇ group may be at the other carbon atom on ring B 1 .
- a group of the formula: Y 6 -[A 18 -X 6 ]s-A 20 and a group of the formula: Y 7 -[A 19 -X 7 ]t-A 21 bind to the different carbon atoms on ring B 2 , and one or more of any substituent selected from the above ⁇ group may be at the other carbon atom on ring B 2 .
- a group of the formula: Y 6 -[A 18 -X 6 ]s-A 20 and a group of the formula: Y 7 -[A 19 -X 7 ]t-A 21 bind to the different carbon atoms on ring B 2 , and one or more of any substituent selected from the above ⁇ group may be at the other carbon atom on ring B 1 .
- Ring B 1 or Ring B 2 a particularly preferred embodiment is phenyl.
- a particularly preferred embodiment is a bond or unsubstituted alkylene.
- a particularly preferred embodiment is NHC( ⁇ O) or NHC( ⁇ O)NH.
- a particularly preferred embodiment is a bond or NHC( ⁇ O).
- a fat-soluble compound is not limited as long as it is well-known a fat-soluble compound in this field.
- examples include fat-soluble vitamins such as vitamin E, vitamin A, vitamin B, ⁇ -carotene, vitamin D and/or vitamin K (e.g., tocopherol and folic acid), crotamiton, teprenone, indometacin, prednisolone and tannic acid.
- a preferred embodiment is a group comprising tocopherol, folic acid or cRGD.
- a group comprising tocopherol means the following.
- a group comprising folic acid means the following.
- a group comprising cRGD means the following.
- alkyl, alkenyl or alkynyl is preferably C6 to C30 and more preferably C6 to C24, and may be branched.
- the length of each A 11 and A 12 , A 13 to A 15 or A 20 and A 21 may be same or different.
- a particularly preferred embodiment is unsubstituted alkyl.
- a particularly preferred embodiment is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or a group comprising a fat-soluble compound.
- a particularly preferred embodiment is 1.
- lipid particularly preferred embodiments are the followings.
- a 1-X , A 2-X , A 18-X and A 19-X are alkylene, A 11-X , A 13-X , A 15-X , A 20-X and A 21-X are alkyl, and A 12-X and A 14-X are substituted or unsubstituted alkyl, or a group comprising a fat-soluble compound.
- lipid in the complex of the present invention, can bind through a linker to at least one or more position(s) selected from at the 3′-end, at the 5′-end or in the strand of the oligonucleotide.
- the lipid preferably binds at one or two position(s) in the oligonucleotide.
- the lipid preferably binds to the second strand.
- a particularly preferred embodiment is that the lipid binds at the 3′-end and/or the 5′-end of the second strand.
- lipid When a lipid binds at the 5′-end of an olgonucleotide, for example, it can bind in the following manner.
- B 1 is a base at the 3′-end of an oligonucleotide
- Z a is O or S
- n1 or n2 are each independently an integer of 5 to 29, and preferably each independently and integer of 10 to 18.
- lipid When a lipid binds at the 3′-end of an oligonucleotide, for example, it can bind in the following manner.
- B 1 is a base at the 5′-end of an oligonucleotide
- Z a is O or S
- n1 or n2 are each independently an integer of 5 to 29, and preferably each independently an integer of 10 to 18.
- lipid When a lipid binds in the strand of an oligonucleotide, for example, it can bind in the following manner.
- Z a or Z b are each independently O or S
- n1 or n2 are each independently an integer of 5 to 29, and preferably each independently an integer of 10 to 18.
- the lipid can be synthesized in reference to well-known methods in this field. Examples of the lipid or the preparation methods are disclosed in the following Example 1, Non-patent Document 3 and the like.
- the lipid binds through a linker to an oligonucleotide.
- a linker any linker used in this field can be used.
- L 0 binds to the oligonucleotide and L 6 binds to lipid.
- L 0 is a bond, a nucleotide linker or non-nucleotide linker, L 1 is a group of the formula:
- Z are each independently O or S, and R 6 are each independently hydroxy, alkyl or alkyloxy, L 2 and L 4 are each independently a bond or substituted or unsubstituted C1 to C20 alkylene, L 3 are each independently a bond; C( ⁇ O)NR 7 , wherein R 7 is hydrogen or substituted or unsubstituted alkyl; NR 8 C( ⁇ O), wherein R 8 is hydrogen, substituted or unsubstituted alkyl or R 8 and a carbon atom in alkylene of L 2 taken together may form substituted or unsubstituted nitrogen-containing ring; or S—S, L 5 are each independently a bond, substituted or unsubstituted C1 to C20 alkylene, C( ⁇ O)NR 9 , NR 9 C( ⁇ O), NR 9 , O or substituted or unsubstituted non-aromatic heterocyclyl, R 9 are each independently hydrogen, substituted or unsubstituted alkyl, substituted
- a nucleotide linker is a linker consisting of an oligonucleotide which nucleosides selected from the group consisting of DNA nucleosides, RNA nucleosides and nucleoside derivatives are bounded. All nucleosides can be same, or two or more kinds of nucleosides.
- the length of a nucleotide linker is 1 to 10 bases, 2 to 8 bases, 4 bases, 5 bases, 6 bases and 7 bases. Examples are the following linkers.
- B 3 is adenine (A), guanine (G), cytosine (C), 5-methylcytosine (5-Me-C), thymine (T) or uracil (U). Furthermore, B 3 may be absent (Ab).
- W are each independently H or OH, and preferably H.
- Z e are each independently O or S.
- v is an integer of 1 to 10.
- a particularly preferred embodiment is that B 3 is adenine or thymine; Z e is O; and v is 1 to 9.
- non-nucleotide linker examples include a linker which one to several alkanediol(s) (e.g., butanediol) are bounded, and a linker which one to several ethylene glycol(s) (e.g., triethylene glycol, hexaethylene glycol) are bounded.
- alkanediol(s) e.g., butanediol
- ethylene glycol(s) e.g., triethylene glycol, hexaethylene glycol
- “One to several” means 1 to 10, 1 to 8, 5, 6 or 7.
- a preferred embodiment is a linker which 3 to 9 butanediols are bounded.
- R 8 and a carbon atom in alkylene of L 2 taken together may form substituted or unsubstituted nitrogen-containing ring” means the following.
- Alkylene may have one or more of any substituent selected from the above ⁇ group.
- a nitrogen-containing ring may have one or more of any substituent selected from the above ⁇ group.
- L 5 is “substituted or unsubstituted non-aromatic heterocyclyl”
- a preferred embodiment is succinimide. It may have one or more of any substituent selected from the above ⁇ group.
- amino acid linker means a linker derived from one or more amino acid(s). Any amino acid which is well-known in this field can be used as the amino acid. A preferred embodiment is a linker consisting of 2 to 10 amino acids. Examples include a linker derived from Lys-Ala-Ala-Cys-Trp (SEQ ID NO: 14, Compound 101) or Lys-Val-Lys-Cys-Trp (SEQ ID NO: 15, Compound 102) synthesized in the following A) of Example 1.
- Z is O or S.
- a preferred embodiment is substituted or unsubstituted C1 to C20 alkylene.
- a particularly preferred embodiment is a bond; C( ⁇ O)NH; or NR 8 C( ⁇ O), wherein R 8 and a carbon atom in alkylene of L 2 taken together may form substituted or unsubstituted nitrogen-containing ring.
- a particularly preferred embodiment is a bond, C( ⁇ O)NH, NH or O.
- OL means that it binds to an oligonucleotide having suppressing activity of the target gene expression
- LI means that it binds to the lipid
- Z d and Z e are each independently O or S.
- v1 or v2 are each independently an integer of 0 to 10, preferably each independently an integer of 0 to 5, and more preferably each independently an integer of 0 to 3.
- v3 to v6 are each independently an integer of 1 to 4, preferably each independently an integer of 1 to 3, and more preferably each independently 2 or 3.
- “Nucleotide Linker” and “Amino acid Linker” has the same meaning as above.
- “Lipid” and linker are synthesized as a compound comprising a lipid and a part of a linker, the compound is supported on a resin and introduced to an oligonucleotide to obtain “a complex” of the present invention as the following Example 1.
- an oligonucleotide in the complex of the present invention is a double-stranded oligonucleotide, after that, the other oligonucleotide is hybridized to obtain “a complex” of the present invention.
- Examples of “A compound comprising a lipid and a part of a linker” include the compounds described in the following Example 1.
- the 3′-end or the 5′-end without binding a lipid of an oligonucleotide, or a linker can be further modified.
- the well-known modified group in this field can be used. Examples include a protecting group of a hydroxyl group, reporter molecule, cholesterol, phospholipid, pigment and fluorescent molecule.
- the 3′-end or the 5′-end without binding a lipid of an oligonucleotide may comprise a phosphate ester.
- the “phosphate ester” means a phosphate group at the end comprising phosphate ester or modified phosphate ester. Although the phosphate ester moiety may be at the either end, a preferred embodiment is at the 5′-end nucleoside. Examples include a group of the formula: —O—P( ⁇ O)(OH)OH and the modified group.
- O or OH is optionally substituted with H; O; OR′; S; N(R′), wherein R′ is H, amino-protecting group, or substituted or unsubstituted alkyl; or alkyl.
- the 5′-end or the 3′-end may each independently comprise substituted or unsubstituted 1 to 3 phosphate moiety.
- the present invention encompasses a pharmaceutical composition in the complex of the present invention or a compound specifically described in the following Examples, which is the complex of the present invention.
- a pharmaceutical composition of the present invention has any or all of the following excellent characteristics:
- CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A4 inhibition e.g., CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A4 inhibition.
- a nucleoside(s) or an internucleoside linkage(s) may be modified.
- An oligonucleotide with an appropriate modification(s) has any or all of the following characteristics compared to an oligonucleotide without a modification(s):
- Any administration method and formulation for a pharmaceutical composition of the present invention can be used if it is a well-known administration method and formulation in this field.
- a pharmaceutical composition of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
- Examples of an administration method include topical (including ophthalmic, intravaginal, intrarectal, intranasal and transdermal), oral and parenteral.
- parenteral administration include intravenous injection or drip, subdermal, intraperitoneal or intramuscular injection, lung administration by aspiration or inhalation, intrathecal administration and intraventricular administration.
- a preferred embodiment is intravenous injection or subcutaneous administration.
- a formulation such as a transdermal patch, ointment, lotion, cream, gel, drop, suppository, spray, liquid and powder can be used.
- composition for oral administration examples include powder, granule, suspension or solution dissolved in water or non-aqueous vehicle, capsule, powder and tablet.
- compositions for parenteral, intrathecal or intraventricular administration include sterile aqueous solutions which contain buffers, diluents and other suitable additives.
- a pharmaceutical composition of the present invention can be obtained by mixing an effective amount with various pharmaceutical additives suitable for the administration form, such as excipients, binders, moistening agents, disintegrants, lubricants and diluents as needed.
- various pharmaceutical additives suitable for the administration form such as excipients, binders, moistening agents, disintegrants, lubricants and diluents as needed.
- the composition is an injection, it together with a suitable carrier can be sterilized to obtain a composition.
- excipients examples include lactose, saccharose, glucose, starch, calcium carbonate and crystalline cellulose.
- binders examples include methylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gelatin and polyvinylpyrrolidone.
- disintegrants examples include carboxymethylcellulose, sodium carboxymethylcellulose, starch, sodium alginate, agar and sodium lauryl sulfate.
- lubricants examples include talc, magnesium stearate and macrogol.
- Cacao oil, macrogol, methylcellulose or the like may be used as base materials of suppositories.
- compositions When the composition is prepared as solutions, emulsified injections or suspended injections, solubilizing agents, suspending agents, emulsifiers, stabilizers, preservatives, isotonic agents and the like which are usually used may be added as needed.
- solubilizing agents for oral administration, sweetening agents, flavors or the like may be added.
- Dosing of a pharmaceutical composition of the present invention is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is affected or a diminution of the disease state is achieved.
- Optimal dosing schedules can be calculated from measurements of drug accumulation in the body. Persons of ordinary skill in the art can easily determine optimal dosages, dosing methodologies and repetition rates.
- Optimal dosages can be generally calculated based on IC50 or EC50 in vitro or in vivo animal experiments although they change according to relative efficacy of a nucleic acid medicine in the complex of the present invention. Dosages shown as mg/kg are calculated according to the usual method when, for example, a molecular weight of a nucleic acid medicine (derived from the sequences and chemical structures) and the effective dosage such as IC50 (derived from experiments) are provided.
- a pharmaceutical composition of the present invention can be used together with an appropriate nucleic acid medicine for the prevention or treatment of various diseases in which the effect of the nucleic acid medicine is expected.
- DMEM Dulbecco's Modified Eagle's Medium
- HBTU O-benzotriazole-N, N, N′, N′-tetramethyluronium-hexafluoro-phosphate
- PBS phosphate buffered saline
- TBS tert-butyldimethylsilyl
- PDA detection wavelength 254 nm (Detection range 210-500 nm)
- PDA detection wavelength 254 nm (Detection range 210-500 nm)
- PDA detection wavelength 254 nm (Detection range 210-500 nm)
- n′ is an integer of 5 to 29.
- n′ is an integer of 5 to 29.
- HybridCPG resin was washed twice with pyridine, twice with isopropanol and twice with diethyl ether, and dried under reduced pressure.
- the supported amount of Compound 12-6 was calculated by colorimetric assay of the DMTr cation, and Compound 13-6 whose supported amount is 114 ⁇ mol/g was obtained.
- n′ is an integer of 5 to 29.
- Compound 17 was synthesized from Compound 15 according to the methods described in Nucleic Acids Research, 42, 8796-8807 (2014).
- n′ is an integer of 5 to 29. 6-1) Synthesis of Compound 27-12 Step 1
- Compound 19 was synthesized from Compound 1 according to the methods described in Journal of Medicinal Chemistry, 48, 7781 (2005).
- Compound 28-7-7-7 was synthesized according to the methods described in Journal of Controlled Release, 220, 44-50 (2015).
- Compound 41 was synthesized from Compound 40 described in Bioorganic & Medicinal Chemistry Letters, 13(6), 1037-1040; 2003 in a similar method to Step 1 of 1-1) and Steps 1 to 4 of 3-1).
- Decanoic acid (1.16 g, 6.75 mmol, Tokyo Chemical Industry Co., Ltd.) was dissolved in DMF (14 mL) and dichloromethane (14 mL).
- DIEA (3.14 mL, 18 mmol) and HBTU (2.82 g, 7.43 mmol) were added thereto, and the mixture was vigorously stirred at room temperature for one hour.
- Compound 43 (see Chemistry-A European Journal (2010), 16, (15), 4519-4532, S4519, 2.0 g, 2.25 mmol) was added at room temperature, and the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure.
- Compound 52 was synthesized from Compound 51 in a similar method to Steps 2 and 3 of 3-2).
- Compound 57 was synthesized from Compound 56 (6.94 g, 24.4 mmol, Tokyo Chemical Industry Co., Ltd.) in a similar method to Step 1 of 3-1).
- n′ is an integer of 5 to 29. 13-1
- Compound 65-12 was synthesized from Compound 64-12 in a similar method to Step 2 of 1-1).
- Palmitic acid 300 mg, 1.17 mmol was dissolved in DMF (6.0 mL) and dichloromethane (2.0 mL).
- DIEA 0.31 mL, 1.76 mmol
- HBTU 489 mg, 1.29 mmol
- To the resulting cloudy solution, Compound 66 (409 mg, 1.17 mmol) was added at room temperature for three days.
- Aqueous saturated sodium bicarbonate solution 8.0 mL
- water 2.0 mL
- the resulting solid was washed with water (40 mL) to obtain Compound 67-14 (719 mg, quant.) as white solid.
- Palmitic acid (209 mg, 0.81 mmol) was dissolved in DMF (6.0 mL).
- HBTU (309 mg, 0.81 mmol) was added thereto, and the mixture was stirred at room temperature for 10 minutes.
- Compound 70-3 300 mg, 0.81 mmol, Watanabe Chemical Industries, Ltd
- DIEA 0.14 mL, 0.81 mmol
- the mixture was stirred at 50° C. for 5 minutes. Then, the mixture was stirred at room temperature for three hours.
- 2 M hydrochloric acid was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, and dried over sodium sulfate.
- Compound 89-3-12 was synthesized from Compound 70-3 and Compound 9-12 in a similar method to Steps 1 to 3 of 15-1).
- Compound 92-3-12 was synthesized from Compound 91-3 in a similar method to Step 1 of 15-1) as pale red solid (1.11 g).
- the precipitate was dissolved in DMSO, and purified by reversed phase (YMC Pack C4, 150 ⁇ 10 mm I.D., Flow rate: 3-5 mL/min, 10 mM TEAA-acetonitrile, isocratic elution (Washed with 50% acetonitrile, and then eluted with 95% acetonitrile), Detection 260 nm, 280 nm).
- the collected fraction was condensed and lyophilized to obtain the lipid-peptide (e.g., Compound 101 or Compound 102) as white solid.
- Compound 103 was synthesized from Fmoc-D-Lys(Fmoc)-OH (Watanabe Chemical Industries, Ltd) in a similar method to 16-1).
- n′ is an integer of 5 to 29.
- 6-N-Boc-caproic acid (1.0 g, Sigma-Aldrich) was dissolved in DMF (20 mL).
- DIEA 2.3 mL
- HBTU 1.8 g
- Compound 106 (0.45 g, Tokyo Chemical Industry Co., Ltd.) was added thereto, and the mixture was stirred at room temperature overnight.
- the reaction mixture was poured into saturated sodium bicarbonate solution (50 mL), and extracted with ethyl acetate (100 mL).
- Compound 111 was synthesized from Compound 110 in a similar method to Step 4 of 3-1).
- Compound 122 was synthesized according to the methods described in Non-Patent Document Journal of the American Chemical Society, 2008, 130, 11467-11476.
- Compound 123 was purchased from Sigma-Aldrich.
- Compound 124 was purchased from Link-Technologies Ltd.
- Oligonucleotides used in examples of this description were synthesized using phosphoramidite method by AKTA Oligopilot10 (GE Healthcare), NS-8-I (Dainippon Seiki co., ltd.) or NS-8-II (Dainippon Seiki co., ltd.).
- a monomer was prepared in 0.1 M acetonitrile solution using the amidite derived from the above amidite synthesis.
- the coupling time was 32 seconds to 10 minutes, and 8 to 10 equivalents of the amidite unit were used to condense with one monomer.
- ETT activator (5-ethylthio)-1H-tetrazole) (Sigma-Aldrich) was used as an activator, CapA and CapB (Sigma-Aldrich) was used as a capping reagent.
- Deb (3 w/v % TCA CH 2 C12 solution) (Wako Pure Chemical Industries, Ltd.) or Deb (3 w/v % Dichloroacetic acid, Toluene Solution) was used as a detritylation reagent.
- NA-6, NA-7, NA-21 and NA-23 were derived by consigning synthesis and purification of oligonucleotides to GeneDesign Inc.
- the target lipid conjugated oligonucleotides were synthesized in a similar way as the above B).
- a stirrer, Molecular Sieves 4A 1/16 and the amidite synthesized in the above A) (e.g., Compound 5-n′. 10 to 100 equivalents of an oligonucleotide) were put in a microwave tube (2-5 ml, 10-20 ml) made by Biotage, and the solution was adjusted to 0.2 M with chloroform (added 2-methyl-2-butane as a stabilizer).
- oligonucleotides supported to solid phase CPG resin or polystyrene resin
- 0.25 M ETT activator which is ((5-ethylthio)-1H-tetrazole) in dichloromethane, (the same amount of chloroform) were added, sealed and heated at 40° C. for 10 minutes to one hour.
- the reaction mixture was diluted twice with chloroform, and the resin was collected by filtration.
- the resulting resin was used in PS oxidization in NS-8-I (Dainippon Seiki co., ltd.) or NS-8-II (Dainippon Seiki co., ltd.). Then the dried resin was subject to deprotection of the following D) to synthesize the target lipid conjugated oligonucleotide.
- lipid-supported resin synthesized in the above A) e.g., Compound 13-n′, Compound 27-n′ and Compound 33-s′-t′-u′
- the target lipid conjugated oligonucleotides were synthesized in a similar method to the above B).
- a single-stranded oligonucleotide comprising an amino linker (e.g., NA-23 or NA-24) was put in a microfuge tube (1.5 ml), DMSO (addition of 0.5% DIEA) and sodium bicarbonate solution (0.2 M NaHCO 3 ) were added as 1:5 to prepare in 1 mM.
- the compound synthesized in the above A) e.g., Compound 14-n′. 2 to 10 equivalents of an oligonucleotide as DMSO solution
- a single-stranded oligonucleotide comprising an amino linker (e.g., NA-23, NA-24) (1.2 ⁇ mol) and 6-maleimidohexanoic acid N-hydroxysuccinimide ester (26 ⁇ mol) were mixed and reacted under the presence of 0.1% DIEA in DMSO (1 mL) at room temperature for two to four hours. The reaction mixture was ultrafiltered, and then lyophilizated to obtain white solid.
- an amino linker e.g., NA-23, NA-24
- 6-maleimidohexanoic acid N-hydroxysuccinimide ester 26 ⁇ mol
- the resulting white solid and a compound synthesized in the above A) (e.g., Compound 100 or Compound 101. 2 to 50 equivalents of an oligonucleotide) were dissolved in 4 mL of the solvent (DMSO/acetonitrile (1:1) or DMSO) and reacted at room temperature to synthesize the target lipid conjugated oligonucleotide.
- the solvent DMSO/acetonitrile (1:1) or DMSO
- oligonucleotide comprising an amino linker (e.g., NA-23 or NA-24) in 25 mM phosphate buffer solution (pH 7.4)
- 10 equivalents of NHS-PEG4-Maleimide (ThermoFisher Scientific) was added and the mixture was stirred at room temperature for five hours.
- the excess NHS-PEG4-Maleimide was removed from the reaction mixture with Ultrafiltration kit (molecular weight cut off: 3,000).
- a compound synthesized in the above A) e.g., Compound 123. 3 to 10 equivalents of an oligonucleotide
- Oligonucleotides without a lipid were purified by reversed phase HPLC in Condition 1.
- Buffer A 100 mM TEAA (triethylammonium acetate, pH 7.0) aqueous solution or 100 mM AcONa aqueous solution (pH5.4)
- Oligonucleotides with a lipid were purified by reversed phase HPLC in Condition 2.
- B concentration at the beginning was adjusted from 20% to 50%.
- Buffer A 100 mM TEAA (Triethylammonium acetate pH 7.0) aqueous solution or 100 mM AcONa aqueous solution (pH 5.4)
- VivaSpin20 (MWCO 3000) (Sartorius) and Amicon Ultra-4 Centrifugal Filter Units-3K
- ultrafiltration was repeated for the resulting oligonucleotide to remove salt component from the fraction. Then, it was lyophilized to obtain the target oligonucleotide as powder.
- the desalting procedure was carried out after transforming the salt form with 100 mM sodium acetate solution (20 mL).
- the resulting oligonucleotides were confirmed as the target sequences by matching the found molecular weights determined by UPLC/MS measurement and the calculated molecular weights.
- Buffer A 200 mM 1,1,1,3,3,3-hexafluoro-2-propanol/8 mM triethylamine
- Buffer A 200 mM 1,1,1,3,3,3-hexafluoro-2-propanol/8 mM triethylamine
- the synthesized oligonucleotides are shown in Tables 1 to 10.
- n small letter
- N capital letter
- rN RNA
- dN DNA
- ⁇ circumflex over ( ) ⁇ is —P(S)OH—
- * is —P(O)OH—.
- Ab (Abasic) is the following group.
- L means a compound introduced at the 5′ end of an oligonucleotide (optionally comprising an oligonucleotide linker), and each compound covalently binds with a substituted or unsubstituted methylene of the 5′ end of an oligonucleotide.
- M means a compound introduced at the 3′-end of an oligonucleotide (optionally comprising an oligonucleotide linker), and each compound covalently binds with a sugar of the 3′-end of an oligonucleotide.
- L x-n′ binds at the 5′-end of an oligonucleotide, which may also include an oligonucleotide linker, as below.
- OL5′ means that the terminal bond of L x-n′ binds at 5′-end of an oligonucleotide having suppressing activity of the target gene expression or an oligonucleotide linker via “ ⁇ circumflex over ( ) ⁇ (—P(S)OH—)” or “*(—P(O)OH—)” as described in the above tables.
- n′ is an integer of 5 to 29.
- L 5-n′ is a group derived from Compound 5-n′ which is synthesized in the above A)
- L 65-n′ is a group derived from Compound 65-n′.
- M x-n′ binds at 3′-end of an oligonucleotide, which may also include an oligonucleotide linker, as below.
- OL3′ means that the terminal bond of M x-n′ binds at 3′-end of an oligonucleotide having suppressing activity of the target gene expression or an oligonucleotide linker via “ ⁇ circumflex over ( ) ⁇ (—P(S)OH—)” or “*(—P(O)OH—)” as described in the above tables.
- n′ is an integer of 5 to 29.
- M 13-n′ is a group derived from Compound 13-n′ which is synthesized in the above A).
- M 13a-n′ is a group which binds to a group except for an oligonucleotide.
- M 13-n′ binds to M 124 which is a group derived from Compound 124 which is synthesized in the above A).
- r1 is a group selected from the following Substituent (an′′) to (g).
- n′′ is an integer of 2 to 29.
- M 13b-r1 is a group synthesized in a similar method as Compound 13-n′ in the above A) and derived from Compound 75-n′′ (Substituent (an′′)), Compound 77 (Substituent (b)), Compound 78 (Substituent (c)), Compound 80 (Substituent (d)), Compound 83 (Substituent (e)), Compound 82 (Substituent (f)) or Compound 86 (Substituent (g)).
- n′ is an integer of 5 to 29, and s′, t′ and u′ are each independently an integer of 3 to 20.
- M 27-n′ is a group derived from Compound 27-n′ which is synthesized in the above A), and M 33-s′-t′-u′ is a group derived from Compound 33-s′-t′-u′.
- n′ are each independently an integer of 5 to 29.
- M 42 is a group derived from Compound 42 which is synthesized in the above A)
- M 48-n′ is a group derived from Compound 48-n′
- M 55-m′-n′ is a group derived from Compound 55-m′-n′.
- M NA-102 is a group derived from the following NA-24 and Compound 103 according to the above 4) of C).
- M NA-89 is a group derived from the NA-102 and Compound 75-12 according to the above 4) of C).
- n′ is an integer of 5 to 29.
- M 120 is a group derived from Compound 120 which is synthesized in the above A), and M 120-n′ is a group derived from NA-104 and Compound 75-n′′ according to the above 4) of C).
- n′ is integer of 5 to 29.
- M 112-n′ is a group which is synthesized and derived in a similar method as Compound 112 which is synthesized in the above A), and M 9 7 is a group derived from Compound 97.
- j is an integer of 1 to 3
- n′ is an integer of 5 to 29.
- M 100-j-n′ is a group which is synthesized and derived in a similar method as Compound 100-j-n′ which is synthesized in the above A).
- r2 is a group selected from Substituent (an′′) to (e), (g) of r1 and the following (h) and (i).
- M 112b-r2 is a group which is synthesized in a similar method as Compound 112 in the above A) and derived from Compound 75-n′′ (Substituent (an′′)), Compound 77 (Substituent (b)), Compound 78 (Substituent (c)), Compound 80 (Substituent (d)), Compound 83 (Substituent (e)), Compound 86 (Substituent (g)), Compound 76 (Substituent (h)) or Compound 81 (Substituent (i)).
- k is an integer of 0 to 4
- n′ is an integer of 1 to 4.
- M 69-n′ is a group derived from Compound 69-n′ which is synthesized in the above A
- M 74-k is a group derived from Compound 74-k-14
- M NA-95 is a group derived from Compound 95-2-14 which is synthesized in the above A).
- r3 is a group selected from the following Substituent (j) to (1).
- M 90a and M 90b-r3 are groups derived from Compound 90-k-n′ which is synthesized in the above A) and Compound 121 (Substituent (j)), Compound 122 (Substituent (k)) or Compound 123 (Substituent (1)) according to the above 6) of C).
- n′ is an integer of 5 to 29.
- M 105-n′ is a group derived from Compound 105-n′ which is synthesized in the above A).
- k is an integer of 0 to 4
- r4 is a group selected from the following Substituent (m) to (o).
- M 95-r4 is a group derived from Compound 95-k-14 which is synthesized in the above A) and Compound 88 (Substituent (m)), Compound 3-14 (Substituent (n)) or hexyl isocyanate (Substituent (o)).
- M NA-100 is a group derived from Compound 101 according to the above 5) of C
- M NA-101 is a group derived from Compound 102 according to the above 5) of C).
- M 62 is a group derived from Compound 62 which is synthesized in the above A).
- Substituents for NA-22 to 24 in the comparative examples binds to an oligonucleotide as below.
- a substituent for M NA-24 was purchased from Link Technology Co., Ltd. Nucleic acid derivatives comprising an amino linker at 3′-end were synthesized by synthesizing an oligonucleotide in a similar method to the above B) with the resin for nucleic acid resin (3′-amino CPG).
- siRNAs The synthesized oligonucleotides (siRNAs) are shown in Tables 14 to 15.
- siRNA-1, 18, 19 and 20 are the comparative examples.
- siRNA-101 is a comparative example.
- HeLa cells human cervical cancer cell line, were cultured in DMEM Low Glucose (Sigma)+10% Fetal Bovine Serum (FBS)+Penicillin (100 units/mL)+Streptomycin (100 ug/mL). The cells were maintained at 37° C., 95 to 98% humidity and 5% CO 2 . In all cells for this experiment, siRNAs were transfected into cells without any gene transfection reagent. To a culture supernatant of the HeLa cells, the complex of the present invention comprising siRNA as a nucleic acid medicine or siRNA without a lipid (siRNA-1) as a comparative example was added to be at final concentration of 1 ⁇ M.
- siRNA-1 siRNA
- Fw primer (SEQ ID NO: 5) CTACCCTCTGGTAGATTGTCG; and Rv primer: (SEQ ID NO: 6) TCGAGAGCTTCAGACTCGTCTA.
- the primer sequences for measuring the level of human GAPDH expression are identical to The primer sequences for measuring the level of human GAPDH expression.
- Fw primer (SEQ ID NO: 7) GCACCGTCAAGGCTGAGAAC; and Rv primer: (SEQ ID NO: 8) TGGTGAAGACGCCAGTGGA.
- siRNA % mRNA siRNA-1 96 siRNA-2 10 siRNA-3 7 siRNA-4 28 siRNA-5 30
- Hepa1c1c7 cells mouse hepatoma cell line, were cultured in MEM Alpha (Thermo Fisher Scientific)+10% Fetal Bovine Serum (FBS)+Penicillin (100 units/mL)+Streptomycin (100 ug/mL). The cells were maintained at 37° C., 95 to 98% humidity and 5% CO 2 . In all cells for this experiment, siRNAs were transfected into cells without any gene transfection reagent. To a culture supernatant of the Hepa1c1c7 cells, the complex of the present invention comprising siRNA as a nucleic acid medicine was added to be at final concentration of 2 ⁇ M. After 72 hours, the cells were collected with CellAmp RNA Prep Kit (Takara) and quantitative PCR was performed with One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara). Gapdh was used as an endogenous control.
- MEM Alpha Thermo Fisher Scientific
- FBS Fetal Bovine Serum
- the primer sequences for measuring the level of mouse Hprt1 expression are identical to The primer sequences for measuring the level of mouse Hprt1 expression.
- Fw primer (SEQ ID NO: 9) TTGTTGTTGGATATGCCCTTGACTA; and Rv primer: (SEQ ID NO: 10) AGGCAGATGGCCACAGGACTA.
- the primer sequences for measuring the level of mouse Gapdh expression are identical to The primer sequences for measuring the level of mouse Gapdh expression.
- Fw primer (SEQ ID NO: 11) TGTGTCCGTCGTGGATCTGA; and Rv primer: (SEQ ID NO: 12) TTGCTGTTGAAGTCGCAGGAG.
- siRNA % mRNA siRNA-22 45 siRNA-23 45 siRNA-24 20 siRNA-27 11 siRNA-28 36 siRNA-29 25 siRNA-31 35 siRNA-32 45 siRNA-36 14 siRNA-37 16 siRNA-38 18 siRNA-39 13 siRNA-40 33 siRNA-41 16 siRNA-42 18 siRNA-44 26 siRNA-45 17 siRNA-46 18 siRNA-47 19 siRNA-49 37 siRNA-50 36 siRNA-51 29 siRNA-52 27 siRNA-54 16 siRNA-55 16 siRNA-56 18 siRNA-57 17 siRNA-59 19 siRNA-60 44 siRNA-61 16 siRNA-62 37 siRNA-63 31 siRNA-64 20 siRNA-65 21 siRNA-66 42 siRNA-67 44 siRNA-68 49 siRNA-69 51 siRNA-70 32 siRNA-71 41 siRNA-72 54 siRNA-73 50 siRNA-74 20 siRNA-75 49 siRNA-76 39 siRNA-77 23 siRNA-78 29 siRNA-79 30 siRNA-80 22 siRNA-81 21
- both the complexes of the present invention whose lipid was bound at the 3′-end of the second strand showed higher knockdown activities against HPRT1 compared to the comparative example without lipid (siRNA-1) or the comparative example with the eight-branched lipid (siRNA-101). It is thought that the complexes of the present invention with high knockdown activity without any gene transfection reagent are capable of fully exerting the effects of the comprised nucleic acid medicines and are very useful in drug discovery.
- the complex of the present invention siRNA-2, siRNA-6 or siRNA-7) or siRNA without a lipid (siRNA-1) as a comparative example was added to be at final concentration of 0.5 ⁇ M. After 72 hours, the cells were collected, and quantitative PCR was performed. GAPDH was used as an endogenous control. The primer sequences for measuring the level of HPRT1 and GAPDH are the same as Experiment 1. The results are shown in Table 18.
- the complexes of the present invention whose comprised nucleic acid medicine were modified (the oligonucleotide of the first strand comprises phosphorothioates) (siRNA-6 and siRNA-7) also showed higher knockdown activities against HPRT1.
- C57BL/6JJcl mice (8 weeks old male and 8 weeks old female mice) were introduced from CLEA Japan, Inc.
- Tumor-bearing model mice were produced as follows.
- the cell line A431 from human epithelioid cell carcinoma was cultured in DMEM Low Glucose (Sigma)+10% Fetal Bovine Serum (FBS)+Penicillin (100 units/mL)+Streptomycin (100 ug/mL).
- FBS Fetal Bovine Serum
- Penicillin 100 units/mL
- Streptomycin 100 ug/mL
- Approximately 100,000 cells were implanted in the back of nude mouse, Balbc-nu/nu (5 weeks old male mice). After about 10 days, the tumor diameters were reached about 1 cm, then the mice were subjected to the experiments.
- siRNA-8 to siRNA-17 Approximately 0.2 mL of the complex of the present invention (siRNA-8 to siRNA-17) dissolved in saline (OTSUKA NORMAL SALINE, Otsuka Pharmaceutical Factory, Inc.), or siRNA without lipid (siRNA-18) or siRNA which has an only linker bound to the second strand (siRNA-21) as a comparative example was administered intravenously to each mouse at a dose of 50 mg/kg or 25 mg/kg.
- mice Three days after administration to male mice, approximately 0.5 mL of whole blood and tissue of liver, kidney, lung, spleen, fat, muscle, small intestine, large intestine, testis, bone, bone marrow, thymus, respiratory tract, skin, dorsal root ganglia, spinal cord and brain were collected under isoflurane anesthesia. Three days after administration to female mice, uteri and ovaries were collected under isoflurane anesthesia. Tumor tissues were collected from the tumor-bearing model mice 3 days after administration.
- RNAs were extracted according to the manufacturer's recommended protocols using RNeasy 96 Universal Tissue Kit (Qiagen) from the collected tissues and QIAamp RNA Blood Mini Kit (Qiagen) from the blood cells comprising whole blood. Quantitative PCR was performed with One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara) using 20 ng (dorsal root ganglion and blood cells) or 100 ng (the other tissues) of the obtained RNAs. Gapdh was used as an endogenous control. The primer sequences for measuring the level of mouse Hprt1 and mouse Gapdh are the same as Experiment 2.
- siRNA-17 12 21 28 siRNA % mRNA (Liver) % mRNA (Heart) % mRNA (Muscle) siRNA-18 86 102 siRNA-21 59 75 74 siRNA-8 20 35 39 siRNA-9 12 30 34 siRNA-10 10 25 27 siRNA-11 9 21 17 siRNA-12 7 23 24 siRNA-13 7 29 27 siRNA-14 8 29 59 siRNA-15 7 30 72 siRNA-16 8 31 78 siRNA-17 12 21 28
- siRNA-22 siRNA-24 6 siRNA-25 6 siRNA-26 6 siRNA-27 7 siRNA-28 8 siRNA-29 11 siRNA-30 7 siRNA-31 5 siRNA-32 7 siRNA-33 8 siRNA-34 5 siRNA-35 7 siRNA-42 6 siRNA-43 6 siRNA-76 9 siRNA-90 9 siRNA-91 10 siRNA-95 11 siRNA-93 9 siRNA-101 130
- siRNA-36 13 siRNA-37 9 siRNA-39 10 siRNA-40 12 siRNA-41 14 siRNA-44 10 siRNA-45 10 siRNA-46 11 siRNA-47 11 siRNA-48 12 siRNA-49 14 siRNA-50 22 siRNA-51 13 siRNA-52 13 siRNA-53 33 siRNA-63 12 siRNA-79 15 siRNA-80 12 siRNA-81 10 siRNA-82 15 siRNA-83 13 siRNA-86 11 siRNA-87 13 siRNA-88 30 siRNA-89 15 siRNA-54 13 siRNA-57 15 siRNA-58 18 siRNA-59 11 siRNA-60 13 siRNA-61 15 siRNA-92 9
- siRNA-36 33 siRNA-37 33 siRNA-39 35 siRNA-41 33 siRNA-44 31 siRNA-45 44 siRNA-46 42 siRNA-47 37 siRNA-49 48 siRNA-50 46 siRNA-51 38 siRNA-52 31 siRNA-63 38 siRNA-79 40 siRNA-80 42 siRNA-81 43 siRNA-82 36 siRNA-83 36 siRNA-86 31 siRNA-87 43 siRNA-88 42 siRNA-89 33 siRNA-54 36 siRNA-57 48 siRNA-59 39 siRNA-61 30 siRNA-92 35 siRNA-93 26
- the complexes of the present invention whose lipid were bound at the 3′-end of the second strand showed activity with higher efficiency not only in liver but also in skeletal muscle, heart and fat compared to the comparative example without lipid (siRNA-18) and the comparative example with the eight-branched lipid (siRNA-101). About 40% knockdown was also observed in lung, spleen, small intestine, large intestine, bone, ovary, uterus, and tumor.
- the complex of the present invention comprising a nucleic acid medicine with activity against diseases with muscle lesions, particularly diseases such as muscular dystrophy, myotonic dystrophy, myopathy, amyotrophic lateral sclerosis, age-related amyotrophy, cancerous amotorism, spinal muscular atrophy, myasthenia gravis, Guillain Valley's syndrome and polymyositis, can deliver the nucleic acid medicine and exert effects on skeletal muscle. Therefore, the complexes of the present invention are very useful.
- siRNA-18 or siRNA-20 which is a siRNA without lipid.
- siRNA-19 which is siRNA with phosphatidylethanolamine
- fatty acids were degraded over time and released.
- siRNA-11 siRNA with phosphatidylethanolamine
- fatty acids were not released.
- the complexes of the present invention show excellent knockdown activity. In addition, they are resistant to degradation by lipolytic enzymes and suggested to have metabolic stability. Therefore, the activity of a nucleic acid medicine in vivo can be improved by comprising the nucleic acid medicine in the complex of the present invention.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Veterinary Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
- Patent Document 1: WO98/39352
- Patent Document 2: WO2005/021570
- Patent Document 3: WO2003/068795
- Patent Document 4: WO2011/052436
- Patent Document 5: WO2011/156202
- Patent Document 6: WO2009/126933
- Patent Document 7: WO2012/037254
- Patent Document 8: WO2009/123185
- Patent Document 9: WO2013/089283
- Patent Document 10: WO2015/105083
- Patent Document 11: WO2017/057540
- Non-Patent Document 1: Nature Biotechnology, 2007, vol. 25, no. 10, 1149-1157
- Non-Patent Document 2: Bioorganic & Medicinal Chemistry, 2008, vol. 16, 7698-7704
- Non-Patent Document 3: Journal of Controlled Release, 2015, vol. 220, 44-50
wherein
A11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, or a group of the formula:
A1 to A10 and A16 to A19 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene,
when A1 and A2 or A16 and A17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, substituted or unsubstituted alkynylene or
any carbon atom of A1 and any carbon atom of A2, or any carbon atom of A16 and any carbon atom of A17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle,
Y1 to Y7 are each independently a bond or O,
X1, X3 and X6 are each independently NR1C(═O), C(═O)NR1, R2C(═O)NR1 or NR1C(═O)R2,
X2, X4, X5 and X7 are each independently a bond, NR3C(═O), C(═O)NR3,
R4C(═O)NR3, NR3C(═O)R4 or S—S,
R2 and R4 are each independently O or NR5,
R1, R3 and R5 are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
A12 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, or a group comprising a fat-soluble compound,
A13 to A15, A20 and A21 are each independently substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
m, n, p, q, r, s and t are each independently 1 or 2,
provided that a substituent for the alkyl, alkenyl, alkynyl, alkylene, alkenylene and alkynylene is halogen, hydroxy, carboxy, amino, imino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, aromatic carbocyclyl, non-aromatic carbocyclyl, non-aromatic heterocyclyl, non-aromatic heterocyclyl, aromatic carbocyclylcarbonyl, non-aromatic carbocyclylcarbonyl, aromatic heterocyclylcarbonyl or non-aromatic heterocyclylcarbonyl, and may have any one or more substituent(s) selected from Group α.
wherein
L0 binds to the oligonucleotide and L6 binds to lipid.
L0 is a bond, a nucleotide linker or a non-nucleotide linker,
L1 is a group of the formula:
wherein
Z are each independently O or S,
R6 are each independently hydroxy, alkyl or alkyloxy,
L2 and L4 are each independently a bond or substituted or unsubstituted C1 to C20 alkylene,
L3 are each independently a bond; C(═O)NR7, wherein R7 is hydrogen or substituted or unsubstituted alkyl; NR8C(═O), wherein R8 is hydrogen, substituted or unsubstituted alkyl or R8 and a carbon atom in alkylene of L2 taken together may form substituted or unsubstituted nitrogen-containing ring; or S—S,
L5 are each independently a bond, substituted or unsubstituted C1 to C20 alkylene, C(═O)NR9, NR9C(═O), NR9, O, or substituted or unsubstituted non-aromatic heterocyclyl,
R9 is each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
u is 1 or 2, and
L6 is a bond or an amino acid linker.
(1-6) The complex of any one of (C-1) to (C-7) which is any one of the followings:
wherein
OL is an oligonucleotide having suppressing activity of the target gene expression,
5′ means that it binds at the 5′-end of the oligonucleotide,
3′ means that it binds at the 3′-end of the oligonucleotide,
Z1-1 is O or S,
L0-1 is a bond, a nucleotide linker or a non-nucleotide linker,
L5-1 is a bond, NH or O,
L6-1 is a bond or an amino acid linker,
LI is a lipid of any one of a group of the formula: (LI-1) to (LI-9).
wherein
A1-1 is a bond or methylene,
A2-1 is C1 to C4 straight alkylene,
A11-1 is C7 to C23 straight or branched alkyl, and
A12-1 is C3 to C23 straight or branched alkyl or alkenyl, a group comprising a fat-soluble compound, or a group of the formula:
wherein
A20-1 and A21-1 is C13 straight alkyl, and
A12-2 is C15 straight alkyl or a group comprising a fat-soluble compound.
wherein
A20-2 and A21-2 are C13 straight alkyl, and
A12-4 is C4 straight alkyl substituted with amino.
wherein
A11-4 is C14 straight alkyl, and
A12-6 is C6 to C12 straight alkyl.
(1-7) A pharmaceutical composition comprising the complex of any one of (1-1) to (1-6).
(1-8) The complex of (1-5), wherein, in the linker,
L2 is substituted or unsubstituted C1 to C20 alkylene,
L3 is NR8C(═O), wherein R8 is hydrogen or substituted or unsubstituted alkyl,
L4 is a bond,
L5 is a bond, NR9 or 0,
u is 1, and
L6 is a bond.
(1-9) The complex of (1-5), wherein, in the linker,
L0 is a bond,
L2 to L5 is a bond,
L6 is a bond, and
u is 1.
(1-10) The complex of (1-5), wherein, in the linker,
L0 is a bond,
L3 is NR8C(═O), wherein R8 and a carbon atom in alkylene of L2 taken together may form substituted or unsubstituted nitrogen-containing ring,
L5 is C(═O)NR9 or O,
u is 1, and
L6 is a bond.
(1-11) The complex of (1-5), wherein, in the linker,
L0 is a bond or a nucleotide linker,
L2 and L4 are substituted or unsubstituted C1 to C20 alkylene,
L3 is NHC(═O) or S—S,
L5 is O, and
u is 1.
(1-12) The complex of (1-5), wherein, in the linker,
L2 and L4 are substituted or unsubstituted C1 to C20 alkylene,
L3 is NR8C(═O), wherein R8 is hydrogen or substituted or unsubstituted alkyl,
L5 is substituted or unsubstituted non-aromatic heterocyclyl,
u is 1, and
L6 is an amino acid linker.
wherein
X1′ and X2′ are each independently a bond, NR1′C(═O), C(═O)NR1′,
R2′C(═O)NR1′ or NR1′C(═O)R2′,
R2′ is O or NR3′,
R1′ and R3′ are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
A1′ and A2′ are each independently substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl, and
p′ and q′ are each independently an integer of 0 to 4,
provided that a substituent for alkyl, alkenyl and alkynyl is halogen, carboxy, amino, imino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, aromatic carbocyclyl, non-aromatic carbocyclyl, non-aromatic heterocyclyl or non-aromatic heterocyclyl, and may have any one or more substituent(s) selected from Group α′.
wherein A1′, A2′, p′ or q′ has the same meaning as claim 1.
(2-3) The complex of (2-1) or (2-2), wherein A1′ and A2′ are each independently C6 to C30 alkyl.
(2-4) The complex of any one of (2-1) to (2-3), wherein the lipid binds to the second strand.
(2-5) The complex of (2-4), wherein the lipid binds at the 3′ end and/or 5′ end of the oligonucleotide.
(2-6) The complex of any one of (2-1) to (2-5), wherein the linker is
wherein
L1′ binds to the oligonucleotide, and L5′ binds to the lipid.
L1′ is C(═O)NH, NHC(═O), NHC(═O)NH,
wherein Z′ is O or S, and R4′ is alkyl or alkyloxy,
L2′ are each independently substituted or unsubstituted C1 to C20 alkylene which aromatic ring may mediate, or aromatic ring,
L3′ are each independently a bond; C(═O)NR5′, wherein R5′ is hydrogen or substituted or unsubstituted alkyl; or NR6′C(═O), wherein R6′ is hydrogen, substituted or unsubstituted alkyl or R6′ and a carbon atom in alkylene of L2′ taken together may form substituted or unsubstituted nitrogen-containing ring;
L4′ are each independently a bond or substituted or unsubstituted C1 to C20 alkylene which aromatic ring may mediate, or aromatic ring,
L5′ is a bond, C(═O)NH, NHC(═O), NH or O, and
r′ is an integer of 0 to 2.
(2-7) A pharmaceutical composition comprising the complex of any one of (2-1) to (2-6).
wherein
Y4′ is O, S, NH or CH2,
R7′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
R8′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
R9′ is a hydrogen atom, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aromatic carbocyclyl, substituted or unsubstituted non-aromatic carbocyclyl, substituted or unsubstituted aromatic heterocyclyl, substituted or unsubstituted non-aromatic heterocyclyl, substituted or unsubstituted aromatic carbocyclylalky, substituted or unsubstituted non-aromatic carbocyclylalky, substituted or unsubstituted aromatic heterocyclylalkyl, or substituted or unsubstituted non-aromatic heterocyclylalkyl,
Y1′ is CR10′ or N,
Y2′ is CR11′ or N,
Y3′ is CR12′ or N,
R10′, R11′ and R12′ are each independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted amino, substituted or unsubstituted alkyloxy, substituted or unsubstituted alkylcarbonylamino, substituted or unsubstituted alkenylcarbonylamino, substituted or unsubstituted alkynylcarbonylamino, substituted or unsubstituted alkylcarbamoyl, substituted or unsubstituted alkenylcarbamoyl, or substituted or unsubstituted alkynylcarbamoyl,
m′ is an integer of 1 to 4,
m1′ is an integer of 0 to 3,
m2′ is 0 or 1.
wherein
A11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl or a group of the formula:
A1 to A10 and A16 to A19 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene,
when A1 and A2 or A16 and A17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene or
any carbon atom of A1 and any carbon atom of A2, or any carbon atom of A16 and any carbon atom of A17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle,
Y1 to Y7 are each independently a bond or O,
X1, X3 and X6 are each independently NR1C(═O), C(═O)NR1, R2C(═O)NR1 or NR1C(═O)R2,
X2, X4, X5 and X7 are each independently a bond, NR3C(═O), C(═O)NR3,
R4C(═O)NR3, NR3C(═O)R4 or S—S,
R2 and R4 are each independently O or NR5,
R1, R3 and R5 are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
A12 and A14 are substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, or a group comprising a fat-soluble compound,
A13, A15, A20 and A21 are each independently substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
m, n, p, q, r, s and t are each independently 1 or 2,
provided that a substituent for the alkyl, alkenyl, alkynyl, alkylene, alkenylene and alkynylene is halogen, hydroxy, carboxy, amino, imino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, aromatic carbocyclyl, non-aromatic carbocyclyl, non-aromatic heterocyclyl, non-aromatic heterocyclyl, aromatic carbocyclylcarbonyl, non-aromatic carbocyclylcarbonyl, aromatic heterocyclylcarbonyl or non-aromatic heterocyclylcarbonyl, and may have any one or more substituent(s) selected from Group α.
wherein
A11 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl or a group of the formula:
A1 to A10 and A16 to A19 are each independently a bond, substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene,
when A1 and A2 or A16 and A17 are substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, or substituted or unsubstituted alkynylene or
any carbon atom of A1 and any carbon atom of A2, or any carbon atom of A16 and any carbon atom of A17 taken together may form substituted aromatic carbocycle or substituted non-aromatic carbocycle,
Y1 to Y7 are each independently a bond or O,
X1, X3 and X6 are each independently NR1C(═O), C(═O)NR1, R2C(═O)NR1 or NR1C(═O)R2,
X2, X4, X5 and X7 are each independently a bond, NR3C(═O), C(═O)NR3,
R4C(═O)NR3, NR3C(═O)R4 or S—S,
R2 and R4 are each independently O or NR5,
R1, R3 and R5 are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
A12 and A14 is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, or a group comprising a fat-soluble compound,
A13, A15, A20 and A21 are each independently substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
m, n, p, q, r, s and t are each independently 1 or 2.
provided that a substituent for the alkyl, alkenyl, alkynyl, alkylene, alkenylene and alkynylene is halogen, hydroxy, carboxy, amino, imino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso, azide, hydrazino, ureide, amidino, guanidino, trialkylsilyl, aromatic carbocyclyl, non-aromatic carbocyclyl, non-aromatic heterocyclyl, non-aromatic heterocyclyl, aromatic carbocyclylcarbonyl, non-aromatic carbocyclylcarbonyl, aromatic heterocyclylcarbonyl or non-aromatic heterocyclylcarbonyl, and may have any one or more substituent(s) selected from Group α.
wherein ring B1 or ring B2 is substituted or unsubstituted aromatic carbocycle or substituted or unsubstituted non-aromatic carbocycle, and the other symbols has the same meaning as above. A group of the formula: Y1-[A6-X1]m-A11 and a group of the formula: Y2-[A7-X2]n-A12 bind to the different carbon atoms on ring B1, and one or more of any substituent selected from the above γ group may be at the other carbon atom on ring B1. A group of the formula: Y6-[A18-X6]s-A20 and a group of the formula: Y7-[A19-X7]t-A21 bind to the different carbon atoms on ring B2, and one or more of any substituent selected from the above γ group may be at the other carbon atom on ring B2. A group of the formula: Y6-[A18-X6]s-A20 and a group of the formula: Y7-[A19-X7]t-A21 bind to the different carbon atoms on ring B2, and one or more of any substituent selected from the above γ group may be at the other carbon atom on ring B1.
wherein
A1-X, A2-X, A18-X and A19-X are alkylene,
A11-X, A13-X, A15-X, A20-X and A21-X are alkyl, and
A12-X and A14-X are substituted or unsubstituted alkyl, or a group comprising a fat-soluble compound.
wherein
B1 is a base at the 3′-end of an oligonucleotide,
Za is O or S,
n1 or n2 are each independently an integer of 5 to 29, and preferably each independently and integer of 10 to 18.
wherein
B1 is a base at the 5′-end of an oligonucleotide,
Za is O or S,
n1 or n2 are each independently an integer of 5 to 29, and preferably each independently an integer of 10 to 18.
wherein
B1 and B2 are neighboring bases in an oligonucleotide,
Za or Zb are each independently O or S,
n1 or n2 are each independently an integer of 5 to 29, and preferably each independently an integer of 10 to 18.
wherein
L0 binds to the oligonucleotide and L6 binds to lipid.
L0 is a bond, a nucleotide linker or non-nucleotide linker,
L1 is a group of the formula:
wherein Z are each independently O or S, and R6 are each independently hydroxy, alkyl or alkyloxy,
L2 and L4 are each independently a bond or substituted or unsubstituted C1 to C20 alkylene,
L3 are each independently a bond; C(═O)NR7, wherein R7 is hydrogen or substituted or unsubstituted alkyl; NR8C(═O), wherein R8 is hydrogen, substituted or unsubstituted alkyl or R8 and a carbon atom in alkylene of L2 taken together may form substituted or unsubstituted nitrogen-containing ring; or S—S,
L5 are each independently a bond, substituted or unsubstituted C1 to C20 alkylene, C(═O)NR9, NR9C(═O), NR9, O or substituted or unsubstituted non-aromatic heterocyclyl,
R9 are each independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkynyl,
u is 1 or 2, and
L6 is a bond or amino acid linker.
wherein
B3 is adenine (A), guanine (G), cytosine (C), 5-methylcytosine (5-Me-C), thymine (T) or uracil (U). Furthermore, B3 may be absent (Ab).
W are each independently H or OH, and preferably H.
Ze are each independently O or S.
v is an integer of 1 to 10.
wherein a is an integer of 0 to 18, and b is an integer of 1 to 5. Alkylene may have one or more of any substituent selected from the above β group. A nitrogen-containing ring may have one or more of any substituent selected from the above γ group.
wherein
OL means that it binds to an oligonucleotide having suppressing activity of the target gene expression,
LI means that it binds to the lipid,
Zd and Ze are each independently O or S.
v1 or v2 are each independently an integer of 0 to 10, preferably each independently an integer of 0 to 5, and more preferably each independently an integer of 0 to 3.
v3 to v6 are each independently an integer of 1 to 4, preferably each independently an integer of 1 to 3, and more preferably each independently 2 or 3.
“Nucleotide Linker” and “Amino acid Linker” has the same meaning as above.
4) Synthesis of Compound 14-n′
wherein s′, t′ and are each independently an integer of 3 to 20.
7-1) Synthesis of Compound 33-7-7-7
Step 1
wherein m′ and n′ are each independently an integer of 5 to 29.
10-1) Synthesis of Compound 55-5-7
Step 1
wherein k is an integer of 0 to 4, and n′ is an integer of 5 to 29.
15-1) Synthesis of Compound 74-3-14
Step 1
wherein k is an integer of 0 to 4, n′ is an integer of 5 to 29.
19-1) Synthesis of Compound 90-3-12
Step 1
wherein k is an integer of 0 to 4, and n′ is an integer of 5 to 29.
20-1) Synthesis of Compound 95-3-12
Step 1
wherein j is an integer of 1 to 3, and n′ is an integer of 5 to 29.
22-1) Synthesis of Compound 100-3-18
Step 1
| TABLE 1 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ ⇒ 3′) | cation |
| NA-1 | U*u*A*a*A*g*u*u*G*a* | *dT{circumflex over ( )}dT | |
| (1) | G*A*G*a*U*c*A*u*C | ||
| NA-2 | *g*A*u*G*a*U*c*u*c* | *dT{circumflex over ( )}dT{circumflex over ( )}M27-12 | |
| (2) | U*c*A*A*C*u*U*u*A*a | ||
| NA-3 | g*A*u*G*a*U*c*u*c*U* | *dT{circumflex over ( )}dT*M27-12 | |
| (2) | c*A*A*C*u*U*u*A*a | ||
| NA-4 | L5-12{circumflex over ( )} | g*A*u*G*a*U*c*u*c*U* | *dT{circumflex over ( )}dT |
| (2) | c*A*A*C*u*U*u*A*a | ||
| NA-5 | L5-12* | g*A*u*G*a*U*c*u*c*U* | *dT{circumflex over ( )}dT |
| (2) | c*A*A*C*u*U*u*A*a | ||
| NA-6 | U*u*A*a*A*g*u*u*G*a* | {circumflex over ( )}dT{circumflex over ( )}dT | |
| (1) | G*A*G*a{circumflex over ( )}U{circumflex over ( )}c{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}C | ||
| NA-7 | U{circumflex over ( )}u*A{circumflex over ( )}a*A{circumflex over ( )}g*u{circumflex over ( )}u*G{circumflex over ( )}a* | {circumflex over ( )}dT{circumflex over ( )}dT | |
| (1) | G{circumflex over ( )}A*G{circumflex over ( )}a*U{circumflex over ( )}c*A{circumflex over ( )}u*C | ||
| NA-8 | g*A*u*G*a*U*c*u*c*U* | *dT{circumflex over ( )}dT | |
| (2) | c*A*A*C*u*U*u*A*a | ||
| NA-9 | -P(O) | U{circumflex over ( )}u{circumflex over ( )}A*a*A*g*u*u*G*a* | {circumflex over ( )}dT{circumflex over ( )}dT |
| (1) | (OH)2 | G*A*G*a*U*c*A*u*C | |
| NA-10 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13-6 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-11 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13-8 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-12 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13-10 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| TABLE 2 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ ⇒ 3′) | cation |
| NA-13 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M13-12 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-14 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M13-14 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-15 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M13-16 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-16 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M13-18 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-17 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M13-20 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-18 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M13-22 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-19 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | {circumflex over ( )}M33-7-7-7 | |
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-20 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c* | ||
| (2) | A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-21 | rG*rU*rA*rG*rG*rA*rG*rU* | ||
| (3) | rA*rG*rU*rG*rA*rA*rA*rG* | ||
| rG*rC*rC*rA*rG | |||
| NA-22 | LNA-22* | rG*rG*rC*rC*rU*rU*rU*rC* | |
| (4) | rA*rC*rU*rA*rC*rU*rC*rC* | ||
| rU*rA*rC*rG*rA | |||
| NA-23 | LNA-23* | rG*rG*rC*rC*rU*rU*rU*rC* | |
| (4) | rA*rC*rU*rA*rC*rU*rC*rC* | ||
| rU*rA*rC*rG*rA | |||
| TABLE 3 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ ⇒ 3′) | cation |
| NA-24 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}MNA-24 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-25 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}Bu*Bu*Bu*Bu* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | Bu*Bu*M42 | |
| NA-26 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}Bu*Bu*Bu*Bu* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | Bu*Bu*M48-8 | |
| NA-27 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}Bu*Bu*Bu*Bu* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | Bu*Bu*M48-12 | |
| NA-28 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}Bu*Bu*Bu*Bu* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | Bu*Bu*M55-5-7 | |
| NA-29 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M124{circumflex over ( )}M13a-14 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-30 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dT*dT*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*M13-14 | |
| NA-31 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dT*dT*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*M124* | |
| M13a-14 | |||
| NA-32 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M48-12 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-33 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(a6) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-34 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(a10) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-35 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(a18) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| TABLE 4 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-36 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(b) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-37 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(c) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-38 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(d) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-39 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *A*A*A*A*A* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | A*M13-14 | |
| NA-40 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *a*a*a*a*a* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | a*M13-14 | |
| NA-41 | G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U*c*A*A* | *u*u*u*u*u* | |
| (13) | C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | u*M13-14 | |
| NA-42 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*dA*M13-14 | |
| NA-43 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dG*dG*dG*dG* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dG*dG*M13-14 | |
| NA-44 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dC*dC*dC*dC* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dC*dC*M13-14 | |
| NA-45 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112-12 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-46 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M100-3-18 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| TABLE 5 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-47 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *Ab*Ab*Ab | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | *M13-14 | |
| NA-48 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *Ab*Ab*Ab*Ab* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | Ab*Ab*M13-14 | |
| NA-49 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *Ab*Ab*Ab*Ab* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | Ab*Ab*Ab*Ab* | |
| Ab*M13-14 | |||
| NA-50 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *rA*rA*rA*rA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | rA*rA*M13-14 | |
| NA-51 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(e) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-52 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(f) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-53 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M69-1 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-54 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M74-3 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-55 | L65-12{circumflex over ( )} | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-56 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M13b-(g) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-57 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | M13-14 | |
| NA-58 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*M13-14 | |
| TABLE 6 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-59 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*dA*dA*M13-14 | |
| NA-60 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*dA*dA*dA | |
| *M13-14 | |||
| NA-61 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M97 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-62 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112-14 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-63 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112-16 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-64 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*dA*M13-14 | |
| NA-65 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(a2) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-66 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(a6) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-67 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(a10) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-68 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(a12) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-69 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(a18) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-70 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(h) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| TABLE 7 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-71 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(b) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-72 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(c) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-73 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(d) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-74 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b(i) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-75 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(e) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-76 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M112b-(g) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-77 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M90a | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-78 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M90b-(j) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-79 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M90b-(k) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-80 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M90b-(l) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-81 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )} | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA{circumflex over ( )}dA{circumflex over ( )}M112-12 | |
| NA-82 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )} | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA{circumflex over ( )}dA{circumflex over ( )}M13-14 | |
| TABLE 8 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-83 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA{circumflex over ( )}dA{circumflex over ( )} | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA{circumflex over ( )}dA{circumflex over ( )}M13-14 | |
| NA-84 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dA*dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA{circumflex over ( )}dA{circumflex over ( )}M13-14 | |
| NA-85 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )}dA{circumflex over ( )} | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*dA*M13-14 | |
| NA-86 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dA{circumflex over ( )}dA*dA*dA* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dA*dA*M13-14 | |
| NA-87 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dA{circumflex over ( )}dA*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*M13-14 | |
| NA-88 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dA{circumflex over ( )}dA*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*dT*dT* | |
| M13-14 | |||
| NA-89 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}MNA-89 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-90 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M105-14 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| TABLE 9 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-91 | L65-12{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )} | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | |
| (2) | dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )} | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | |
| TABLE 10 | |||
| ID | 5′ end | 3′ end | |
| (SEQ | modifi- | Oligonucleotide | modifi- |
| ID) | cation | (5′ → 3′) | cation |
| NA-92 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )}dT{circumflex over ( )} | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT{circumflex over ( )}dT{circumflex over ( )}M48-12 | |
| NA-93 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M95-3-(m) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-94 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M95-3-(n) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-95 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}MNA-95 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-96 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dT*dT*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*M112-12 | |
| NA-97 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | *dT*dT*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*M112-14 | |
| NA-98 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M95-3-(o) | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-99 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}dT{circumflex over ( )}dT*dT*dT* | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | dT*dT*MNA-95 | |
| NA-100 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}MNA-100 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-101 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}MNA-101 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-102 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}MNA-102 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-103 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M62 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-104 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M120 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-105 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M120-6 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
| NA-106 | g{circumflex over ( )}A{circumflex over ( )}u{circumflex over ( )}G{circumflex over ( )}a{circumflex over ( )}U*c*u*c*U* | {circumflex over ( )}M120-12 | |
| (2) | c*A*A*C{circumflex over ( )}u{circumflex over ( )}U{circumflex over ( )}u{circumflex over ( )}A{circumflex over ( )}a | ||
wherein n′ is an integer of 5 to 29, and s′, t′ and u′ are each independently an integer of 3 to 20.
wherein r2 is a group selected from Substituent (an″) to (e), (g) of r1 and the following (h) and (i).
wherein k is an integer of 0 to 4, and r4 is a group selected from the following Substituent (m) to (o).
| TABLE 11 | ||||
| Theoretical Mw | Found Mw | |||
| Oligonucleotide | [M − H]− | [M − H]− | ||
| NA-1 | 6853.31 | 6854 | ||
| NA-2 | 7525.28 | 7527 | ||
| NA-3 | 7509.21 | 7510 | ||
| NA-4 | 7328.07 | 7328 | ||
| NA-5 | 7312.00 | 7312 | ||
| NA-8 | 6738.18 | 6739 | ||
| NA-9 | 6981.50 | 6983 | ||
| NA-10 | 6868.18 | 6869 | ||
| NA-11 | 6924.29 | 6925 | ||
| NA-12 | 6980.40 | 6982 | ||
| NA-13 | 7036.50 | 7037 | ||
| NA-14 | 7092.61 | 7094 | ||
| NA-15 | 7148.72 | 7150 | ||
| NA-16 | 7204.83 | 7206 | ||
| NA-17 | 7260.94 | 7262 | ||
| NA-18 | 7317.04 | 7318 | ||
| NA-19 | 6934.41 | 6935 | ||
| NA-20 | 6274.41 | 6276 | ||
| NA-22 | 7537.19 | 7537 | ||
| NA-24 | 6499.65 | 6501 | ||
| TABLE 12 | ||||
| Theoretical Mw | Found Mw | |||
| Oligonucleotide | [M − H]− | [M − H]− | ||
| NA-25 | 8108.26 | 8108 | ||
| NA-26 | 8405.57 | 8405 | ||
| NA-27 | 8573.90 | 8575 | ||
| NA-28 | 8004.11 | 8002 | ||
| NA-29 | 7437.05 | 7437 | ||
| NA-30 | 8901.67 | 8902 | ||
| NA-31 | 9230.09 | 9230 | ||
| NA-32 | 7663.40 | 7663 | ||
| NA-33 | 6980.40 | 6981 | ||
| NA-34 | 7036.50 | 7037 | ||
| NA-35 | 7148.72 | 7149 | ||
| NA-36 | 6980.40 | 6981 | ||
| NA-37 | 7092.61 | 7093 | ||
| NA-38 | 7020.46 | 7021 | ||
| NA-39 | 9135.92 | 9137 | ||
| NA-40 | 9063.70 | 9065 | ||
| NA-41 | 7878.67 | 7879 | ||
| NA-42 | 8955.76 | 8955 | ||
| NA-43 | 9051.76 | 9052 | ||
| NA-44 | 8811.61 | 8812 | ||
| NA-45 | 7048.51 | 7049 | ||
| NA-46 | 7507.15 | 7508 | ||
| NA-47 | 7616.80 | 7618 | ||
| NA-48 | 8157.10 | 8157 | ||
| NA-49 | 8697.40 | 8698 | ||
| NA-50 | 9051.80 | 9052 | ||
| NA-51 | 7036.42 | 7039 | ||
| NA-52 | 7116.63 | 7117 | ||
| NA-53 | 6854.20 | 6855 | ||
| NA-54 | 6866.25 | 6867 | ||
| NA-55 | 7005.41 | 7007 | ||
| NA-56 | 6993.40 | 6996 | ||
| NA-57 | 8329.34 | 8330 | ||
| NA-58 | 8642.55 | 8643 | ||
| NA-59 | 9268.97 | 9268 | ||
| NA-60 | 9582.18 | 9582 | ||
| NA-61 | 7104.62 | 7105 | ||
| NA-62 | 7104.62 | 7105 | ||
| NA-63 | 7160.73 | 7163 | ||
| NA-64 | 8911.71 | 8912 | ||
| NA-65 | 6936.34 | 6938 | ||
| NA-66 | 6992.45 | 6994 | ||
| NA-67 | 7048.56 | 7050 | ||
| NA-68 | 7076.61 | 7078 | ||
| NA-69 | 7160.78 | 7162 | ||
| NA-70 | 6978.42 | 6980 | ||
| NA-71 | 6992.45 | 6994 | ||
| NA-72 | 7104.67 | 7106 | ||
| NA-73 | 7032.52 | 7034 | ||
| NA-74 | 7035.43 | 7037 | ||
| NA-75 | 7048.47 | 7051 | ||
| NA-76 | 7005.45 | 7007 | ||
| NA-77 | 7164.70 | 7166 | ||
| NA-78 | 7447.10 | 7448 | ||
| NA-79 | 7588.10 | 7590 | ||
| NA-80 | 8269.90 | 8272 | ||
| NA-81 | 9024.10 | 9026 | ||
| NA-82 | 9068.20 | 9070 | ||
| NA-83 | 9020.00 | 9021 | ||
| NA-84 | 8987.90 | 8989 | ||
| NA-85 | 9036.10 | 9037 | ||
| NA-86 | 8987.90 | 8989 | ||
| TABLE 13 | ||||
| Theoretical Mw | Found Mw | |||
| Oligonucleotide | [M − H]− | [M − H]− | ||
| NA-87 | 8969.90 | 8971 | ||
| NA-88 | 9596.30 | 9598 | ||
| NA-89 | 7048.50 | 7050 | ||
| NA-90 | 7140.66 | 7142 | ||
| NA-91 | 8927.04 | 8930 | ||
| NA-92 | 9584.04 | 9585 | ||
| NA-93 | 7322.96 | 7325 | ||
| NA-94 | 7403.09 | 7406 | ||
| NA-95 | 7090.60 | 7093 | ||
| NA-96 | 8857.60 | 8860 | ||
| NA-97 | 8913.70 | 8916 | ||
| NA-98 | 6993.44 | 6995 | ||
| NA-99 | 8931.82 | 8934 | ||
| NA-100 | 7689.20 | 7692 | ||
| NA-101 | 7774.40 | 7777 | ||
| NA-102 | 6627.80 | 6630 | ||
| NA-103 | 8825.39 | 8825 | ||
| NA-104 | 6831.19 | 6833 | ||
| NA-105 | 6957.39 | 6959 | ||
| NA-106 | 7041.55 | 7043 | ||
H) Preparation of the Double-Stranded Oligonucleotide
| TABLE 14 | |||
| siRNA | ID | ||
| siRNA-1 | NA-1 | ||
| NA-8 | |||
| siRNA-2 | NA-1 | ||
| NA-2 | |||
| siRNA-3 | NA-1 | ||
| NA-3 | |||
| siRNA-4 | NA-1 | ||
| NA-4 | |||
| siRNA-5 | NA-1 | ||
| NA-5 | |||
| siRNA-6 | NA-6 | ||
| NA-2 | |||
| siRNA-7 | NA-7 | ||
| NA-2 | |||
| siRNA-8 | NA-9 | ||
| NA-10 | |||
| siRNA-9 | NA-9 | ||
| NA-11 | |||
| siRNA-10 | NA-9 | ||
| NA-12 | |||
| siRNA-11 | NA-9 | ||
| NA-13 | |||
| siRNA-12 | NA-9 | ||
| NA-14 | |||
| siRNA-13 | NA-9 | ||
| NA-15 | |||
| siRNA-14 | NA-9 | ||
| NA-16 | |||
| siRNA-15 | NA-9 | ||
| NA-17 | |||
| siRNA-16 | NA-9 | ||
| NA-18 | |||
| siRNA-17 | NA-9 | ||
| NA-19 | |||
| siRNA-18 | NA-9 | ||
| NA-20 | |||
| siRNA-19 | NA-21 | ||
| NA-22 | |||
| siRNA-20 | NA-21 | ||
| NA-23 | |||
| siRNA-21 | NA-9 | ||
| NA-24 | |||
| siRNA-22 | NA-9 | ||
| NA-25 | |||
| siRNA-23 | NA-9 | ||
| NA-26 | |||
| siRNA-24 | NA-9 | ||
| NA-27 | |||
| siRNA-25 | NA-9 | ||
| NA-28 | |||
| siRNA-26 | NA-9 | ||
| NA-29 | |||
| siRNA-27 | NA-9 | ||
| NA-30 | |||
| siRNA-28 | NA-9 | ||
| NA-31 | |||
| siRNA-29 | NA-9 | ||
| NA-32 | |||
| siRNA-30 | NA-9 | ||
| NA-33 | |||
| siRNA-31 | NA-9 | ||
| NA-34 | |||
| siRNA-32 | NA-9 | ||
| NA-35 | |||
| siRNA-33 | NA-9 | ||
| NA-36 | |||
| siRNA-34 | NA-9 | ||
| NA-37 | |||
| siRNA-35 | NA-9 | ||
| NA-38 | |||
| siRNA-36 | NA-9 | ||
| NA-39 | |||
| siRNA-37 | NA-9 | ||
| NA-40 | |||
| siRNA-38 | NA-9 | ||
| NA-41 | |||
| siRNA-39 | NA-9 | ||
| NA-42 | |||
| siRNA-40 | NA-9 | ||
| NA-43 | |||
| siRNA-41 | NA-9 | ||
| NA-44 | |||
| siRNA-42 | NA-9 | ||
| NA-45 | |||
| siRNA-43 | NA-9 | ||
| NA-46 | |||
| siRNA-44 | NA-9 | ||
| NA-47 | |||
| siRNA-45 | NA-9 | ||
| NA-48 | |||
| siRNA-46 | NA-9 | ||
| NA-49 | |||
| siRNA-47 | NA-9 | ||
| NA-50 | |||
| siRNA-48 | NA-9 | ||
| NA-51 | |||
| siRNA-49 | NA-9 | ||
| NA-52 | |||
| siRNA-50 | NA-9 | ||
| NA-53 | |||
| siRNA-51 | NA-9 | ||
| NA-54 | |||
| siRNA-52 | NA-9 | ||
| NA-55 | |||
| siRNA-53 | NA-9 | ||
| NA-56 | |||
| siRNA-54 | NA-9 | ||
| NA-57 | |||
| siRNA-55 | NA-9 | ||
| NA-58 | |||
| siRNA-56 | NA-9 | ||
| NA-59 | |||
| siRNA-57 | NA-9 | ||
| NA-60 | |||
| siRNA-58 | NA-9 | ||
| NA-61 | |||
| siRNA-59 | NA-9 | ||
| NA-62 | |||
| siRNA-60 | NA-9 | ||
| NA-63 | |||
| TABLE 15 | |||
| siRNA | ID | ||
| siRNA-61 | NA-9 | ||
| NA-64 | |||
| siRNA-62 | NA-9 | ||
| NA-65 | |||
| siRNA-63 | NA-9 | ||
| NA66 | |||
| siRNA-64 | NA-9 | ||
| NA-67 | |||
| siRNA-65 | NA-9 | ||
| NA-68 | |||
| siRNA-66 | NA-9 | ||
| NA-69 | |||
| siRNA-67 | NA-9 | ||
| NA-70 | |||
| siRNA-68 | NA-9 | ||
| NA-71 | |||
| siRNA-69 | NA-9 | ||
| NA-72 | |||
| siRNA-70 | NA-9 | ||
| NA-73 | |||
| siRNA-71 | NA-9 | ||
| NA-74 | |||
| siRNA-72 | NA-9 | ||
| NA-75 | |||
| siRNA-73 | NA-9 | ||
| NA-76 | |||
| siRNA-74 | NA-9 | ||
| NA-77 | |||
| siRNA-75 | NA-9 | ||
| NA-78 | |||
| siRNA-76 | NA-9 | ||
| NA-79 | |||
| siRNA-77 | NA-9 | ||
| NA-80 | |||
| siRNA-78 | NA-9 | ||
| NA-81 | |||
| siRNA-79 | NA-9 | ||
| NA-82 | |||
| siRNA-80 | NA-9 | ||
| NA-83 | |||
| siRNA-81 | NA-9 | ||
| NA-84 | |||
| siRNA-82 | NA-9 | ||
| NA-85 | |||
| siRNA-83 | NA-9 | ||
| NA-86 | |||
| siRNA-84 | NA-9 | ||
| NA-87 | |||
| siRNA-85 | NA-9 | ||
| NA-88 | |||
| siRNA-86 | NA-9 | ||
| NA-89 | |||
| siRNA-87 | NA-9 | ||
| NA-90 | |||
| siRNA-88 | NA-9 | ||
| NA-91 | |||
| siRNA-89 | NA-9 | ||
| NA-92 | |||
| siRNA-90 | NA-9 | ||
| NA-93 | |||
| siRNA-91 | NA-9 | ||
| NA-94 | |||
| siRNA-92 | NA-9 | ||
| NA-95 | |||
| siRNA-93 | NA-9 | ||
| NA-96 | |||
| siRNA-94 | NA-9 | ||
| NA-97 | |||
| siRNA-95 | NA-9 | ||
| NA-98 | |||
| siRNA-96 | NA-9 | ||
| NA-99 | |||
| siRNA-97 | NA-9 | ||
| NA-100 | |||
| siRNA-98 | NA-9 | ||
| NA-101 | |||
| siRNA-99 | NA-9 | ||
| NA-105 | |||
| siRNA-100 | NA-9 | ||
| NA-106 | |||
| siRNA-101 | NA-9 | ||
| NA-103 | |||
| Fw primer: | |
| (SEQ ID NO: 5) | |
| CTACCCTCTGGTAGATTGTCG; | |
| and | |
| Rv primer: | |
| (SEQ ID NO: 6) | |
| TCGAGAGCTTCAGACTCGTCTA. |
| Fw primer: | |
| (SEQ ID NO: 7) | |
| GCACCGTCAAGGCTGAGAAC; | |
| and | |
| Rv primer: | |
| (SEQ ID NO: 8) | |
| TGGTGAAGACGCCAGTGGA. |
| TABLE 16 | |||
| siRNA | % mRNA | ||
| siRNA-1 | 96 | ||
| siRNA-2 | 10 | ||
| siRNA-3 | 7 | ||
| siRNA-4 | 28 | ||
| siRNA-5 | 30 | ||
| Fw primer: | |
| (SEQ ID NO: 9) | |
| TTGTTGTTGGATATGCCCTTGACTA; | |
| and | |
| Rv primer: | |
| (SEQ ID NO: 10) | |
| AGGCAGATGGCCACAGGACTA. |
| Fw primer: | |
| (SEQ ID NO: 11) | |
| TGTGTCCGTCGTGGATCTGA; | |
| and | |
| Rv primer: | |
| (SEQ ID NO: 12) | |
| TTGCTGTTGAAGTCGCAGGAG. |
| TABLE 17 | |||
| siRNA | % mRNA | ||
| siRNA-22 | 45 | ||
| siRNA-23 | 45 | ||
| siRNA-24 | 20 | ||
| siRNA-27 | 11 | ||
| siRNA-28 | 36 | ||
| siRNA-29 | 25 | ||
| siRNA-31 | 35 | ||
| siRNA-32 | 45 | ||
| siRNA-36 | 14 | ||
| siRNA-37 | 16 | ||
| siRNA-38 | 18 | ||
| siRNA-39 | 13 | ||
| siRNA-40 | 33 | ||
| siRNA-41 | 16 | ||
| siRNA-42 | 18 | ||
| siRNA-44 | 26 | ||
| siRNA-45 | 17 | ||
| siRNA-46 | 18 | ||
| siRNA-47 | 19 | ||
| siRNA-49 | 37 | ||
| siRNA-50 | 36 | ||
| siRNA-51 | 29 | ||
| siRNA-52 | 27 | ||
| siRNA-54 | 16 | ||
| siRNA-55 | 16 | ||
| siRNA-56 | 18 | ||
| siRNA-57 | 17 | ||
| siRNA-59 | 19 | ||
| siRNA-60 | 44 | ||
| siRNA-61 | 16 | ||
| siRNA-62 | 37 | ||
| siRNA-63 | 31 | ||
| siRNA-64 | 20 | ||
| siRNA-65 | 21 | ||
| siRNA-66 | 42 | ||
| siRNA-67 | 44 | ||
| siRNA-68 | 49 | ||
| siRNA-69 | 51 | ||
| siRNA-70 | 32 | ||
| siRNA-71 | 41 | ||
| siRNA-72 | 54 | ||
| siRNA-73 | 50 | ||
| siRNA-74 | 20 | ||
| siRNA-75 | 49 | ||
| siRNA-76 | 39 | ||
| siRNA-77 | 23 | ||
| siRNA-78 | 29 | ||
| siRNA-79 | 30 | ||
| siRNA-80 | 22 | ||
| siRNA-81 | 21 | ||
| siRNA-82 | 28 | ||
| siRNA-83 | 23 | ||
| siRNA-84 | 19 | ||
| siRNA-85 | 21 | ||
| siRNA-86 | 25 | ||
| siRNA-89 | 32 | ||
| siRNA-92 | 21 | ||
| siRNA-93 | 20 | ||
| siRNA-94 | 20 | ||
| siRNA-95 | 35 | ||
| siRNA-96 | 25 | ||
| siRNA-97 | 27 | ||
| siRNA-98 | 38 | ||
| siRNA-99 | 36 | ||
| siRNA-100 | 19 | ||
| siRNA-101 | 104 | ||
| TABLE 18 | |||
| siRNA | % mRNA | ||
| siRNA-1 | 67 | ||
| siRNA-2 | 21 | ||
| siRNA-6 | 10 | ||
| siRNA-7 | 16 | ||
| TABLE 19 | |||
| siRNA | % mRNA (Liver) | % mRNA (Heart) | % mRNA (Muscle) |
| siRNA-18 | 86 | 86 | 102 |
| siRNA-21 | 59 | 75 | 74 |
| siRNA-8 | 20 | 35 | 39 |
| siRNA-9 | 12 | 30 | 34 |
| siRNA-10 | 10 | 25 | 27 |
| siRNA-11 | 9 | 21 | 17 |
| siRNA-12 | 7 | 23 | 24 |
| siRNA-13 | 7 | 29 | 27 |
| siRNA-14 | 8 | 29 | 59 |
| siRNA-15 | 7 | 30 | 72 |
| siRNA-16 | 8 | 31 | 78 |
| siRNA-17 | 12 | 21 | 28 |
| TABLE 20 | |||
| siRNA | % mRNA (Liver) | ||
| siRNA-22 | 8 | ||
| siRNA-24 | 6 | ||
| siRNA-25 | 6 | ||
| siRNA-26 | 6 | ||
| siRNA-27 | 7 | ||
| siRNA-28 | 8 | ||
| siRNA-29 | 11 | ||
| siRNA-30 | 7 | ||
| siRNA-31 | 5 | ||
| siRNA-32 | 7 | ||
| siRNA-33 | 8 | ||
| siRNA-34 | 5 | ||
| siRNA-35 | 7 | ||
| siRNA-42 | 6 | ||
| siRNA-43 | 6 | ||
| siRNA-76 | 9 | ||
| siRNA-90 | 9 | ||
| siRNA-91 | 10 | ||
| siRNA-95 | 11 | ||
| siRNA-93 | 9 | ||
| siRNA-101 | 130 | ||
| TABLE 21 | |||
| siRNA | % mRNA (Muscle) | ||
| siRNA-22 | 44 | ||
| siRNA-25 | 39 | ||
| siRNA-26 | 35 | ||
| siRNA-27 | 24 | ||
| siRNA-28 | 29 | ||
| siRNA-29 | 39 | ||
| siRNA-30 | 35 | ||
| siRNA-31 | 19 | ||
| siRNA-32 | 30 | ||
| siRNA-33 | 34 | ||
| siRNA-34 | 34 | ||
| siRNA-35 | 27 | ||
| siRNA-42 | 23 | ||
| siRNA-76 | 24 | ||
| siRNA-90 | 55 | ||
| siRNA-95 | 21 | ||
| siRNA-101 | 100 | ||
| TABLE 22 | |||
| siRNA | % mRNA (Liver) | ||
| siRNA-36 | 13 | ||
| siRNA-37 | 9 | ||
| siRNA-39 | 10 | ||
| siRNA-40 | 12 | ||
| siRNA-41 | 14 | ||
| siRNA-44 | 10 | ||
| siRNA-45 | 10 | ||
| siRNA-46 | 11 | ||
| siRNA-47 | 11 | ||
| siRNA-48 | 12 | ||
| siRNA-49 | 14 | ||
| siRNA-50 | 22 | ||
| siRNA-51 | 13 | ||
| siRNA-52 | 13 | ||
| siRNA-53 | 33 | ||
| siRNA-63 | 12 | ||
| siRNA-79 | 15 | ||
| siRNA-80 | 12 | ||
| siRNA-81 | 10 | ||
| siRNA-82 | 15 | ||
| siRNA-83 | 13 | ||
| siRNA-86 | 11 | ||
| siRNA-87 | 13 | ||
| siRNA-88 | 30 | ||
| siRNA-89 | 15 | ||
| siRNA-54 | 13 | ||
| siRNA-57 | 15 | ||
| siRNA-58 | 18 | ||
| siRNA-59 | 11 | ||
| siRNA-60 | 13 | ||
| siRNA-61 | 15 | ||
| siRNA-92 | 9 | ||
| TABLE 23 | |||
| siRNA | % mRNA (Muscle) | ||
| siRNA-36 | 33 | ||
| siRNA-37 | 33 | ||
| siRNA-39 | 35 | ||
| siRNA-41 | 33 | ||
| siRNA-44 | 31 | ||
| siRNA-45 | 44 | ||
| siRNA-46 | 42 | ||
| siRNA-47 | 37 | ||
| siRNA-49 | 48 | ||
| siRNA-50 | 46 | ||
| siRNA-51 | 38 | ||
| siRNA-52 | 31 | ||
| siRNA-63 | 38 | ||
| siRNA-79 | 40 | ||
| siRNA-80 | 42 | ||
| siRNA-81 | 43 | ||
| siRNA-82 | 36 | ||
| siRNA-83 | 36 | ||
| siRNA-86 | 31 | ||
| siRNA-87 | 43 | ||
| siRNA-88 | 42 | ||
| siRNA-89 | 33 | ||
| siRNA-54 | 36 | ||
| siRNA-57 | 48 | ||
| siRNA-59 | 39 | ||
| siRNA-61 | 30 | ||
| siRNA-92 | 35 | ||
| siRNA-93 | 26 | ||
| TABLE 24 | ||||||
| siRNA | 0 min | 5 min | 15 min | 60 min | ||
| siRNA-20 | 0 | 14.9 | 14.2 | 8.8 | ||
| siRNA-19 | 0 | 332.3 | 428.1 | 854.3 | ||
| siRNA-18 | 0 | 1.8 | 4.9 | 0 | ||
| siRNA-11 | 0 | 2.6 | 0 | 0 | ||
Claims (20)
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017-064336 | 2017-03-29 | ||
| JPJP2017-064336 | 2017-03-29 | ||
| JP2017064336 | 2017-03-29 | ||
| PCT/JP2018/012649 WO2018181428A1 (en) | 2017-03-29 | 2018-03-28 | Complex of nucleic acid medicine and multibranched lipid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20200384010A1 US20200384010A1 (en) | 2020-12-10 |
| US11638717B2 true US11638717B2 (en) | 2023-05-02 |
Family
ID=63677278
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/497,323 Active 2039-03-21 US11638717B2 (en) | 2017-03-29 | 2018-03-28 | Complex of nucleic acid medicine and multibranched lipid |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US11638717B2 (en) |
| EP (1) | EP3603648B1 (en) |
| JP (1) | JP7190794B2 (en) |
| WO (1) | WO2018181428A1 (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7353301B2 (en) | 2018-05-07 | 2023-09-29 | アルニラム ファーマスーティカルズ インコーポレイテッド | Extrahepatic delivery |
| JP7583712B2 (en) * | 2018-05-30 | 2024-11-14 | ノバルティス アーゲー | Lipid-modified nucleic acid compounds and methods |
| CN109761857A (en) * | 2019-03-04 | 2019-05-17 | 浙江华贝药业有限责任公司 | N-2- palmityl-N-6- fluorenylmethyloxycarbonyl-L-lysine method of purification |
| CN109928895A (en) * | 2019-03-04 | 2019-06-25 | 浙江华贝药业有限责任公司 | A kind of synthetic method of N-2- alkanoyl-N-6- fluorenylmethyloxycarbonyl-L-lysine |
| CN109734627A (en) * | 2019-03-04 | 2019-05-10 | 浙江华贝药业有限责任公司 | A kind of new compound N -2- alkanoyl-N-6- fluorenylmethyloxycarbonyl-L-lysine |
| CA3131977C (en) * | 2019-03-22 | 2022-04-26 | Integrated Nanotherapeutics Inc. | Lipid conjugate prepared from scaffold moiety |
| JP7584410B2 (en) * | 2019-06-03 | 2024-11-15 | 塩野義製薬株式会社 | Method for producing biantennary lipid-linked oligonucleotides and intermediates |
| US20220267778A1 (en) | 2019-07-30 | 2022-08-25 | Shionogi & Co., Ltd. | Nucleic acid drug targeting murf1 |
| IL293341A (en) * | 2019-11-26 | 2022-07-01 | Dtx Pharma Inc | Compound comprising a nucleic acid and a half-life extension motif |
| CN113456587B (en) * | 2021-06-08 | 2022-10-04 | 中国农业大学 | Preparation and application of a glutathione-responsive nano-drug carrier targeting breast cancer stem cells |
| CR20240200A (en) | 2021-11-18 | 2024-09-02 | Novartis Ag | Compounds targeting pmp22 for the treatment of charcot-marie-tooth disease |
Citations (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5512671A (en) | 1993-02-16 | 1996-04-30 | Wake Forest University | Ether lipid-nucleoside covalent conjugates |
| US20090239814A1 (en) | 2007-12-04 | 2009-09-24 | Alnylam Pharmaceuticals, Inc. | Carbohydrate Conjugates as Delivery Agents for Oligonucleotides |
| WO2009126933A2 (en) | 2008-04-11 | 2009-10-15 | Alnylam Pharmaceuticals, Inc. | Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components |
| EP2264167A1 (en) | 2008-03-31 | 2010-12-22 | National Institute of Advanced Industrial Science and Technology | Double-stranded lipid-modified rna having high rna interference effect |
| WO2010150004A1 (en) | 2009-06-22 | 2010-12-29 | Sylentis S.A.U. | Novel drugs for inhibition of gene expression |
| WO2012016188A2 (en) | 2010-07-30 | 2012-02-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
| WO2012037254A1 (en) | 2010-09-15 | 2012-03-22 | Alnylam Pharmaceuticals, Inc. | MODIFIED iRNA AGENTS |
| WO2013089283A1 (en) | 2011-12-16 | 2013-06-20 | National University Corporation Tokyo Medical And Dental University | Chimeric double-stranded nucleic acid |
| US20130178541A1 (en) | 2010-09-20 | 2013-07-11 | Matthew G. Stanton | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2014022739A2 (en) | 2012-08-03 | 2014-02-06 | Alnylam Pharmaceuticals, Inc. | Modified rnai agents |
| EP2751270A1 (en) | 2011-08-29 | 2014-07-09 | Isis Pharmaceuticals, Inc. | Oligomer-conjugate complexes and their use |
| WO2015012912A2 (en) | 2013-04-22 | 2015-01-29 | Northwestern University | Alkyne phosphoramidites and preparation of spherical nucleic acid constructs |
| WO2015105083A1 (en) | 2014-01-07 | 2015-07-16 | 塩野義製薬株式会社 | Double-stranded oligonucleotide containing antisense oligonucleotide and sugar derivative |
| WO2017057540A1 (en) * | 2015-09-30 | 2017-04-06 | 塩野義製薬株式会社 | Nucleic acid derivative having immunostimulatory activity |
| US20180264105A1 (en) | 2015-09-30 | 2018-09-20 | Shionogi & Co., Ltd. | Nucleic acid derivative having immunostimulatory activity |
Family Cites Families (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3756313B2 (en) | 1997-03-07 | 2006-03-15 | 武 今西 | Novel bicyclonucleosides and oligonucleotide analogues |
| DE69829760T3 (en) | 1997-09-12 | 2016-04-14 | Exiqon A/S | BI- AND TRI-CYCLIC-NUCLEOSIDE, NUCLEOTIDE AND OLIGONUCLEOTIDE ANALOG |
| AU777049B2 (en) | 1999-03-18 | 2004-09-30 | Qiagen Gmbh | Xylo-LNA analogues |
| US7098192B2 (en) | 1999-04-08 | 2006-08-29 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of STAT3 expression |
| DK2354148T3 (en) | 2002-02-13 | 2013-10-14 | Takeshi Imanishi | Nucleoside analogs and oligonucleotide derivatives comprising nucleotide analogs thereof |
| CA2495037A1 (en) | 2002-08-14 | 2004-02-26 | Pharmacia Corporation | Antisense modulation of acyl-coa synthetase 1 expression |
| ES2382807T3 (en) | 2003-08-28 | 2012-06-13 | Takeshi Imanishi | New artificial nucleic acids of the N-O link type with cross-linking |
| US8143230B2 (en) | 2006-05-05 | 2012-03-27 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of PCSK9 |
| US20100260818A1 (en) | 2007-07-11 | 2010-10-14 | Fertin Pharma A/S | Stable medicated chewing gum comprising cyclodextrin inclusion complex |
| WO2009071680A2 (en) | 2007-12-07 | 2009-06-11 | Santaris Pharma A/S | Rna antagonist compounds for the modulation of mcl-1 |
| CN102037144B (en) | 2008-04-01 | 2013-09-25 | 生物检索技术股份有限公司 | Stabilized nucleic acid dark quencher-fluorophore probes |
| EP2451461A4 (en) | 2009-07-06 | 2013-05-29 | Ontorii Inc | NOVEL NUCLEIC ACID PRECURSORS AND THEIR METHODS OF USE |
| CN102596983B (en) | 2009-10-29 | 2016-06-15 | 国立大学法人大阪大学 | Cross-linked artificial nucleosides and nucleotides |
| US8846637B2 (en) | 2010-06-08 | 2014-09-30 | Isis Pharmaceuticals, Inc. | Substituted 2′-amino and 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom |
| EP2742136B1 (en) | 2011-08-11 | 2017-09-27 | Ionis Pharmaceuticals, Inc. | Gapped oligomeric compounds comprising 5'-modified deoxyribonucleosides in the gap and uses thereof |
| SG11201500232UA (en) | 2012-07-13 | 2015-04-29 | Wave Life Sciences Pte Ltd | Chiral control |
| US9441002B2 (en) | 2012-10-27 | 2016-09-13 | Chemgenes Corporation | Dithiolane based thiol modifier for labeling and stronger immobilization of bio-molecules on solid surfaces |
| JPWO2014112463A1 (en) | 2013-01-15 | 2017-01-19 | 国立大学法人大阪大学 | Nucleosides and nucleotides having a sulfonamide structure |
| WO2014126229A1 (en) | 2013-02-18 | 2014-08-21 | 塩野義製薬株式会社 | Nucleoside and nucleotide, having nitrogen-containing hetercycle structure |
| WO2015125845A1 (en) | 2014-02-20 | 2015-08-27 | 塩野義製薬株式会社 | Phosphate site modification of nucleic acid containing nitrogen-containing non-aromatic heterocycle |
-
2018
- 2018-03-28 WO PCT/JP2018/012649 patent/WO2018181428A1/en not_active Ceased
- 2018-03-28 EP EP18775491.6A patent/EP3603648B1/en active Active
- 2018-03-28 JP JP2019509946A patent/JP7190794B2/en active Active
- 2018-03-28 US US16/497,323 patent/US11638717B2/en active Active
Patent Citations (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5512671A (en) | 1993-02-16 | 1996-04-30 | Wake Forest University | Ether lipid-nucleoside covalent conjugates |
| US20090239814A1 (en) | 2007-12-04 | 2009-09-24 | Alnylam Pharmaceuticals, Inc. | Carbohydrate Conjugates as Delivery Agents for Oligonucleotides |
| EP2229186A2 (en) | 2007-12-04 | 2010-09-22 | Alnylam Pharmaceuticals Inc. | Carbohydrate conjugates as delivery agents for oligonucleotides |
| JP2011505425A (en) | 2007-12-04 | 2011-02-24 | アルニラム ファーマスーティカルズ インコーポレイテッド | Carbohydrate conjugates as oligonucleotide delivery agents |
| EP2264167A1 (en) | 2008-03-31 | 2010-12-22 | National Institute of Advanced Industrial Science and Technology | Double-stranded lipid-modified rna having high rna interference effect |
| JPWO2009123185A1 (en) | 2008-03-31 | 2011-07-28 | 独立行政法人産業技術総合研究所 | Double-stranded lipid-modified RNA with high RNA interference effect |
| WO2009126933A2 (en) | 2008-04-11 | 2009-10-15 | Alnylam Pharmaceuticals, Inc. | Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components |
| WO2010150004A1 (en) | 2009-06-22 | 2010-12-29 | Sylentis S.A.U. | Novel drugs for inhibition of gene expression |
| US20120142765A1 (en) | 2009-06-22 | 2012-06-07 | Sylentis S.A.U. | Sphingosine-bound siRNA |
| WO2012016188A2 (en) | 2010-07-30 | 2012-02-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
| US20130202652A1 (en) | 2010-07-30 | 2013-08-08 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for delivery of active agents |
| WO2012037254A1 (en) | 2010-09-15 | 2012-03-22 | Alnylam Pharmaceuticals, Inc. | MODIFIED iRNA AGENTS |
| US20130178541A1 (en) | 2010-09-20 | 2013-07-11 | Matthew G. Stanton | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| JP2014500233A (en) | 2010-09-20 | 2014-01-09 | メルク・シャープ・エンド・ドーム・コーポレイション | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| EP2618847A2 (en) | 2010-09-20 | 2013-07-31 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| EP2751270A1 (en) | 2011-08-29 | 2014-07-09 | Isis Pharmaceuticals, Inc. | Oligomer-conjugate complexes and their use |
| US20150018540A1 (en) | 2011-08-29 | 2015-01-15 | Isis Pharmaceuticals, Inc. | Oligomer-conjugate complexes and their use |
| WO2013089283A1 (en) | 2011-12-16 | 2013-06-20 | National University Corporation Tokyo Medical And Dental University | Chimeric double-stranded nucleic acid |
| US20150197746A1 (en) | 2012-08-03 | 2015-07-16 | Alnylam Pharmaceuticals, Inc. | MODIFIED RNAi AGENTS |
| WO2014022739A2 (en) | 2012-08-03 | 2014-02-06 | Alnylam Pharmaceuticals, Inc. | Modified rnai agents |
| WO2015012912A2 (en) | 2013-04-22 | 2015-01-29 | Northwestern University | Alkyne phosphoramidites and preparation of spherical nucleic acid constructs |
| US20160159834A1 (en) | 2013-04-22 | 2016-06-09 | Northwestern University | Alkyne phosphoramidites and preparation of spherical nucleic acid constructs |
| WO2015105083A1 (en) | 2014-01-07 | 2015-07-16 | 塩野義製薬株式会社 | Double-stranded oligonucleotide containing antisense oligonucleotide and sugar derivative |
| WO2017057540A1 (en) * | 2015-09-30 | 2017-04-06 | 塩野義製薬株式会社 | Nucleic acid derivative having immunostimulatory activity |
| JPWO2017057540A1 (en) | 2015-09-30 | 2018-06-21 | 塩野義製薬株式会社 | Nucleic acid derivatives having immunostimulatory activity |
| US20180264105A1 (en) | 2015-09-30 | 2018-09-20 | Shionogi & Co., Ltd. | Nucleic acid derivative having immunostimulatory activity |
Non-Patent Citations (13)
| Title |
|---|
| Extended European Search Report dated Dec. 1, 2020 in European Patent Application No. 18 775 491.6, 7 pages. |
| International Search Report dated Jul. 3, 2018 in PCT/JP2018/012649 filed on Mar. 28, 2018. |
| Japanese Office Action dated Mar. 15, 2022 in Japanese Patent Application No. 2019-509946, 4 pages. |
| Nikan, M. et al., "Docosahexaenoic Acid Conjugation Enhances Distribution and Safety of siRNA upon Local Administration in Mouse Brain", Molecular Therapy—Nucleic Acids, vol. 5, 2016, pp. 1-11. |
| Nikan, M. et al., "Synthesis and Evaluation of Parenchymal Retention and Efficacy of a Metabolically Stable O-Phosphocholine-N-docosahexaenoyl-L-serine siRNA Conjugate in Mouse Brain", Bioconjugate Chemistry, vol. 28, 2017, pp. 1758-1766. |
| Osborn, M. F. et al., "Hydrophobicity drives the systemic distribution of lipid-conjugated siRNAs via lipid transport pathways", Nucleic Acids Research, vol. 47, No. 3, 2019, pp. 1070-1081. |
| Spelios et al (Biochemistry, vol. 49, No. 27, pp. 5753-5759 (2010)) (Year: 2010). * |
| Spelios, M. et al., "Effect of spacer attachment sites and pH-sensitive headgroup expansion on cationic lipid-mediated gene delivery of three novel myristoyl derivatives", Biophysical Chemistry, vol. 129, 2007, pp. 137-147. |
| Structure attachments Kugimiya, Spelios. * |
| Suzuki, Y. et al., "siRNA-lipid nanoparticles with long-term storage stability facilitate potent gene-silencing in vivo", Journal of Controlled Release, vol. 220, 2015, pp. 44-50. |
| Tao Chen, et al., "DNA Micelle Flares for Intracellular mRNA Imaging and Gene Therapy," Angew. Chem. Int. Ed., vol. 52, 2013, pp. 2012-2016. |
| Ueno, Y. et al., "Synthesis and silencing properties of siRNAs possessing lipophilic groups at their 3′-termini", Bioorganic & Medicinal Chemistry, vol. 16, 2008, pp. 7698-7704. |
| Wolfrum, C. et al., "Mechanismsand optimization of in vivo delivery of lipophilic siRNAs", Nature Biotechnology, vol. 25, No. 10, 2007, pp. 1149-1157. |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3603648A4 (en) | 2020-12-30 |
| JP7190794B2 (en) | 2022-12-16 |
| EP3603648A1 (en) | 2020-02-05 |
| EP3603648B1 (en) | 2025-09-17 |
| US20200384010A1 (en) | 2020-12-10 |
| WO2018181428A1 (en) | 2018-10-04 |
| JPWO2018181428A1 (en) | 2020-02-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11638717B2 (en) | Complex of nucleic acid medicine and multibranched lipid | |
| JP6482475B2 (en) | Double stranded oligonucleotides comprising antisense oligonucleotides and sugar derivatives | |
| CN111698995B (en) | Triacetylene linkers and methods of use | |
| KR101849801B1 (en) | Single-stranded nucleic acid molecule having nitrogen-containing alicyclic skeleton | |
| US20200157545A1 (en) | Oligonucleotide compositions and methods of use thereof | |
| US20230277675A1 (en) | Systemic delivery of oligonucleotides | |
| KR102230325B1 (en) | Nucleic acid derivatives with immune activation activity | |
| US20230226193A1 (en) | Lipid conjugates for the delivery of therapeutic agents | |
| CN117838875B (en) | Drug delivery system for local delivery of therapeutic agents and uses thereof | |
| AU2022349576A1 (en) | Multivalent ligand clusters with diamine scaffold for targeted delivery of therapeutic agents | |
| US11041152B2 (en) | MicroRNA-143 derivative | |
| US20220195437A1 (en) | Tau-targeting oligonucleotide gapmers | |
| US20250213698A1 (en) | Bicyclic heterocycles and their ligands for targeted delivery of therapeutic agents | |
| JP6611298B2 (en) | Nucleic acid derivatives having immunostimulatory activity | |
| AU2021231864A1 (en) | Therapeutic agents and conjugates thereof | |
| US20210283170A1 (en) | Methods and compounds for treatment of lymphocyte-related diseases and conditions | |
| WO2020044349A1 (en) | Compounds, cojugates and compositions for use in the methods for trans-membrane delivery of molecules | |
| CN119925624A (en) | Liver targeting compound and conjugate thereof, preparation method and use | |
| HK40096278A (en) | Multivalent ligand clusters with diamine scaffold for targeted delivery of therapeutic agents | |
| WO2025264952A2 (en) | Novel rna therapeutics and uses thereof | |
| US20250215432A1 (en) | Branched triple lipid-modified nucleic acid compounds | |
| HK40115097A (en) | Trkb ligand conjugated compounds and uses thereof | |
| HK40051488B (en) | Nucleic acid, composition and conjugate containing nucleic acid, preparation method, and use | |
| HK40034155A (en) | Compounds and methods for trans-membrane delivery of molecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: SHIONOGI & CO., LTD., JAPAN Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KUGIMIYA, AKIRA;SEKIGUCHI, MITSUAKI;KURODA, NORIKAZU;AND OTHERS;SIGNING DATES FROM 20190904 TO 20190909;REEL/FRAME:050478/0273 |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |














































































































