WO2015105083A1 - Double-stranded oligonucleotide containing antisense oligonucleotide and sugar derivative - Google Patents

Double-stranded oligonucleotide containing antisense oligonucleotide and sugar derivative Download PDF

Info

Publication number
WO2015105083A1
WO2015105083A1 PCT/JP2015/050083 JP2015050083W WO2015105083A1 WO 2015105083 A1 WO2015105083 A1 WO 2015105083A1 JP 2015050083 W JP2015050083 W JP 2015050083W WO 2015105083 A1 WO2015105083 A1 WO 2015105083A1
Authority
WO
WIPO (PCT)
Prior art keywords
1h
compound
substituted
group
3h
Prior art date
Application number
PCT/JP2015/050083
Other languages
French (fr)
Japanese (ja)
Inventor
釘宮 啓
昌浩 阪上
関口 光明
Original Assignee
塩野義製薬株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2014-001195 priority Critical
Priority to JP2014001195 priority
Application filed by 塩野義製薬株式会社 filed Critical 塩野義製薬株式会社
Publication of WO2015105083A1 publication Critical patent/WO2015105083A1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)
    • C12Y602/01003Long-chain-fatty-acid-CoA ligase (6.2.1.3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Abstract

The present invention provides a double-stranded oligonucleotide that is a novel complex that is capable of efficiently transporting a DNA antisense oligonucleotide to the liver and in which: the antisense chain is a DNA antisense oligonucleotide that has 8-25 bases and that may contain a nucleoside derivative; the sense chain is an RNA oligonucleotide that has 8-35 bases, that comprises a sequence that is hybridizable to the antisense chain under stringent conditions, and that may contain a DNA nucleoside and/or a nucleoside derivative; and a sugar derivative that is capable of interacting with an asialoglycoprotein receptor via a linker is bound to the 3'-end and/or the 5'-end of the sense chain.

Description

Double-stranded oligonucleotide containing the antisense oligonucleotide and sugar derivatives

The present invention, antisense strand, an antisense oligonucleotide having a silencing activity of the target protein, two sugar derivative having an interaction with the asialoglycoprotein receptor via a linker to the sense strand are linked on-stranded oligonucleotide.

Antisense oligonucleotides are oligonucleotides complementary to the mRNA of the target gene, mRNA precursor or ribosomal RNA, transfer RNA, a miRNA like ncRNA (non-coding RNA), 1 present of about 8 to 30 bases stranded DNA, an RNA and / or their structural analogs. mRNA to which the antisense oligonucleotide is targeted, mRNA precursor, or ncRNA and mRNA by forming a double-stranded, suppresses the action of mRNA precursors or ncRNA.

However, nucleic acid drugs such as antisense oligonucleotides and siRNA may easily decomposed by nucleases in vivo, due to the low efficiency of uptake into target cells, it is difficult practically. To overcome two major problems, the chemical modification of nucleic acid itself as an active ingredient, the study of drug delivery system for delivering a nucleic acid into a target cell (DDS) has been performed for many years.

Examples of antisense oligonucleotides itself chemical modification, a phosphate moiety is modified S- oligo (phosphorothioate), 2 which the sugar moiety is modified ', 4'-BNA (bridged nucleic acid) / LNA ( locked nucleic acid) (there are Patent documents 1-5 reference), or the like.

Examples of DDS, a method such as utilizing a carrier such as cationic liposomes and polymeric micelles are known. Further, Non-Patent Document 1, the liposomes modified with galactose derivative is a sugar derivative having an interaction with asialoglycoprotein receptor, to be useful for incorporation of a medicament into the liver cells have been suggested. Patent Document 6-8, suggesting that the liposomes modified with GalNac (N-acetylgalactosamine) derivative is a sugar derivative having an interaction with asialoglycoprotein receptor, is useful for incorporation of the siRNA into the liver cells It is. Patent Document 9 describes a siRNA that GalNac derivatives are linked via a linker, when the siRNA is administered subcutaneously, it is described that target gene expression in the liver was inhibited.

In Patent Document 10, by binding the tocopherol in double-stranded oligonucleotide containing RNA oligonucleotides complementary to the antisense oligonucleotide, in mice, as compared to the single-stranded antisense oligonucleotide, efficiently delivered to the liver, it is integrated, the expression of a target gene in the liver have been described to have been suppressed.

International Publication No. WO 98/39352 International Publication No. WO 2005/021570 International Publication No. WO 2003/068795 International Publication No. WO 2011/052436 International Publication No. WO 2011/156202 International Publication No. WO 2009/073809 International Publication No. WO 2009/082606 International Publication No. WO 2009/082607 International Publication No. WO 2012/037254 International Publication No. WO 2013/089283 International Publication No. WO 2014/118267

J. Med. Chem 1999, 42, 609-618 Nucleic Acids Research, 2014, Vol.42, No. 13, 8796-8807

An object of the present invention is to provide efficiently transportable novel conjugates of DNA antisense oligonucleotide to the liver.

When using antisense oligonucleotides as pharmaceuticals, single-stranded antisense oligonucleotide as an active ingredient, because poor absorption from stability problems and intestines in the stomach, since the low incorporation efficiency into target cells in general, research and development in injection easier to reach the target tissue is carried out. However, for example, the thickness of the patient's subcutaneous fat because such difficult injection due by the disease in some cases the dosage form other than injection is preferred.
The present inventors have conducted studies using a tocopherol-modified double-stranded oligonucleotide according to the method described in Patent Document 10. Single-stranded antisense oligonucleotides compared to administration, the intravenous administration it was confirmed that the inhibitory activity on the expression of the target gene is improved in the liver, the expression suppressing activity of the target gene subcutaneously improvement could not be confirmed.
After that, it double-stranded oligonucleotide of the present invention, intravenous administration, subcutaneous administration together and found to have excellent inhibitory activity on the expression of a target gene in the liver. Double-stranded oligonucleotide of the present invention is an antisense oligonucleotide, the active ingredient in nucleic acid drug efficient delivery to the liver, and the integrated, can be effective, it is very useful.
Furthermore, the present inventors have found that intravenous administration using a double-stranded oligonucleotide of the present invention, the aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured at the time of subcutaneous administration, observed liver toxicity it has been confirmed that there is no. Therefore, the double-stranded oligonucleotide of the present invention is low toxicity, and it is safe enough for pharmaceutical use.

Double-stranded oligonucleotide of the present invention, for example, utilizes GalNac derivatives. Patent Document 9 describes a siRNA that GalNac derivatives are linked via a linker, when the siRNA is intravenously or subcutaneous administration, it is described that target gene expression in the liver was inhibited there. However, the following reasons are DDS which has been shown to be available in the siRNA, not necessarily applicable to it antisense oligonucleotide.
mRNA and the expression inhibition method of the proteins that target may approach RNA interference (RNAi) using antisense method or siRNA with antisense oligonucleotides. The antisense method, for example, cutting the mRNA strand by RNA / DNA heteroduplexes which recognizes RNaseH generated by hybridizing to targeted mRNA using single-stranded DNA of about 20mer (antisense oligonucleotide) by a method of suppressing the production of proteins. On the other hand, RNA interference, for example, of 20 ~ 30 mer double-stranded RNA; By using (siRNA short interfering RNA), incorporated into RISC (RNA-induced silencing complex) in the cell, homologous to subsequently captured siRNA by specific mRNA strand is cut, a method of suppressing protein expression.
Antisense technology and both RNA interference, in order to exhibit sufficient effect in vivo, it is important to increase the delivery efficiency of the decomposition-resistant and target organs for in vivo nucleases. For such problems, chemically modified nucleic acid or a biological ligand molecule (e.g., GalNac derivative) but approaches using have been reported, the difference in the cutting mechanism of differences and mRNA chain molecular structure, usable chemical modification the nucleic acid of the type and optimum ligand molecule and its binding portion is considered different.

That is, the present invention relates to the following.
(1) antisense strand is DNA antisense oligonucleotides which may contain 8-25 bases nucleoside derivative,
Sense strand comprises a hybridizable sequence in the antisense strand under stringent conditions, an RNA oligonucleotide of DNA nucleosides and / or nucleoside derivative which may contain 8-35 bases,
The 3 'end and / or 5' end of the sense strand,
Double-stranded oligonucleotide sugar derivative having an interaction with the asialoglycoprotein receptor via a linker is attached.
(2) is a sugar derivative,

Figure JPOXMLDOC01-appb-C000009

(In the formula,
P 1A, P 1B, P 2A , P 2B, P 3A, P 3B, P 4A, P 4B, P 4C, T 1A, T 1B, T 2A, T 2B, T 3A, T 3B, T 4A, T 4B and T 4C are each independently absent, CO, NH, O, S , OC (= O), NHC (= O), a CH 2, CH 2 NH or CH 2 O,
Q 1A, Q 1B, Q 2A , Q 2B, Q 3A, Q 3B, Q 4A, Q 4B and Q 4C are each independently absent or a substituted or unsubstituted alkylene,
R 1A, R 1B, R 2A , R 2B, R 3A, R 3B, R 4A, R 4B and R 4C are each independently absent, NH, O, S, CH 2, C (= O) O, C (= O) NH , NHCH (R 5) C (= O), C (= O) CH (R 5) NH, CO, CH = N-O, a heterocyclic ring,
Figure JPOXMLDOC01-appb-C000010

It is in,
R 5 is a hydrogen atom or an amino acid side chain,
q 1A, q 1B, q 2A , q 2B, q 3A, q 3B, q 4A, q 4B and q 4C are each independently an integer of 0 to 20,
LG 1A, LG 1B, LG 2A , LG 2B, LG 3A, LG 3B, LG 4A, LG 4B and LG 4C are each, independently,
Figure JPOXMLDOC01-appb-C000011

(In the formula,
R X1, R X2 and R X3 are each independently a hydrogen atom or a substituted or unsubstituted alkyl,
R X4 is OH or NHCOR X4 '(R X4' is a substituted or unsubstituted alkyl))
In it, (1), wherein the double-stranded oligonucleotide.
(3) a sugar derivative,
Figure JPOXMLDOC01-appb-C000012

In it, (2), wherein the double-stranded oligonucleotide.
(4) a sugar derivative,
Figure JPOXMLDOC01-appb-C000013

In it, (3), wherein the double-stranded oligonucleotide.
(5) nucleoside derivative is Kureoshido having a crosslinked structure between the position and the 2 'position of' 4 nucleoside and / or sugar having a substituent at the 2 'position of the sugar, (1) to (4) any the double-stranded oligonucleotide of the crab according.
(6) the substituent is, F, is OCH 3 or OCH 2 CH 2 OCH 3, ( 5) , wherein the double-stranded oligonucleotide.
(7) crosslinked structure, 4 '- (CH 2) m-O-2' (m is an integer of 1 to 4) or 4'-C (= O) -NR 6 -2 '(R 6 is is a hydrogen atom or alkyl), (5), wherein the double-stranded oligonucleotide.
(8) linker,
Figure JPOXMLDOC01-appb-C000014

(In the formula,
L 1 is attached to the 3 'end and / or 5' end of the sense strand, L 5 is linked to the sugar derivative.
L 1 is C (= O) NH, NHC (= O), NHC (= O) NH,
Figure JPOXMLDOC01-appb-C000015

(Wherein, R 7 is an alkyl or alkyloxy), and
L 2 are each independently carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 3 are each independently absent, C (= O) NR 8 (R 8 is hydrogen or a substituted or unsubstituted alkyl), NR 9 C (= O ) (R 9 is hydrogen or a substituted or or is unsubstituted alkyl, R 9 may form a nitrogen-containing ring substituted or unsubstituted together with the carbon in the alkylene of L 2),
Figure JPOXMLDOC01-appb-C000016

It is in,
L 4 are each independently absent, carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 5 represents C (= O) NH, NHC (= O), is NH or O,
n is 1 or 2)
In it, (1) to (7) double-stranded oligonucleotide according to any one.
(9) linker,
Figure JPOXMLDOC01-appb-C000017

(In the formula,
L 1 is attached to the 3 'end and / or 5' end of the sense strand, L 5 is linked to the sugar derivative.
L 1 is C (= O) NH, NHC (= O), NHC (= O) NH,
Figure JPOXMLDOC01-appb-C000018

(Wherein, R 7 is an alkyl or alkyloxy), and
L 2 are each independently carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 3 are each independently absent, C (= O) NR 8 (R 8 is hydrogen or a substituted or unsubstituted alkyl) or NR 9 C (= O) ( R 9 is hydrogen or a substituted or or is unsubstituted alkyl, R 9 is may also be) to form a nitrogen heterocycle substituted or unsubstituted together with the carbon in the alkylene of L 2,
L 4 are each independently absent, carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 5 represents C (= O) NH, NHC (= O), is NH or O,
n is 1 or 2)
In it, (1) to (7) double-stranded oligonucleotide according to any one.
(10) (1) to (9) a pharmaceutical composition comprising double-stranded oligonucleotide according to any one.

Double-stranded oligonucleotide of the present invention, the antisense oligonucleotide is active ingredient, be any route of administration intravenous or subcutaneous administration, delivery stably to the liver, are integrated, show high activity. The double-stranded oligonucleotide is because the toxicity was not observed, it is useful as a nucleic acid pharmaceuticals.

α- tocopherol modified oligonucleotide knockdown assessment of (SEQ-7) (Comparative Example). Residual amount of mRNA was the title of the physiological saline-administered group as a relative value is 100. Dose of SEQ-7 (10,3.3 or 1.1 mg / kg) was the title in terms of the antisense strand amount. Knockdown evaluation of the double-stranded oligonucleotide of the invention (SEQ-8). Residual amount of mRNA was the title of the physiological saline-administered group as a relative value is 100. Dose of SEQ-8 ​​(20,6.6 or 2.2 mg / kg) was the title in terms of the antisense strand amount. Study of the modified positions of the sugar derivative having an interaction with the asialoglycoprotein receptor in the double-stranded oligonucleotide of the present invention. Residual amount of mRNA was the title of the physiological saline-administered group as a relative value is 100. Dose of SEQ-8 ​​~ 11 (20,6.6 or 2.2 mg / kg) was the title in terms of the antisense strand amount. Knockdown evaluation of the double-stranded oligonucleotide of the invention (SEQ-21 or 22). Residual amount of mRNA was the title of the physiological saline-administered group as a relative value is 100. Dose of SEQ-21 or 22 (4 or 2 mg / kg) was the title in terms of the antisense strand amount. Knockdown evaluation of the double-stranded oligonucleotide of the invention (SEQ-20,23 ~ 25). Residual amount of mRNA was the title of the physiological saline-administered group as a relative value is 100. Dose of SEQ-20,23 ~ 25 (4 or 2 mg / kg) was the title in terms of the antisense strand amount. Comparison of knockdown of the double-stranded oligonucleotide of the invention (SEQ-31) and other structures of the antisense oligonucleotides (SEQ-26, 29, 30 or 32). Residual amount of mRNA was the title of the physiological saline-administered group as a relative value is 100. Dose of SEQ-30 ~ 32 (0.2mg / kg) was the title in terms of the antisense strand amount.

The terminology used herein, except where specifically mentioned, is used in the sense commonly used in the art.
In the present invention, it is possible to use known genetic engineering methods in the art. For example, Molecular Cloning, A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press (2001), Current Protocols in Molecular Biology, methods such as that described in John Wiley & Sons (2003) and the like.

The nucleoside refers to a compound nucleobase and the sugar has an N- glycoside bond. The oligonucleotide, identical or different nucleoside means a plurality linked nucleotides.

Bond between the sugar and the sugar in the oligonucleotide, binding to natural nucleic acids have, may be the phosphodiester (D-oligo), an artificial modified does not have made a bond or phosphorus atom bonds it may be. If known binding in the art, all of which it is available. The bonding artificially modified is made, phosphorothioate (S- oligos), methyl phosphonate (M- oligos), boranophosphonate, and the like. The bonding that do not have a phosphorus atom, an alkyl, non-aromatic carbocyclic, haloalkyl, aromatic carbocyclic ring such as substituted with halogen. For example, a siloxane, sulfide, sulfoxide, sulfone, acetyl, acetyl formic acid, acetyl thioformate, Mechirengi acid acetyl, thioformate acetyl, alkenyl, sulfamate, Mechiren'imino, methylene hydrazino, sulfonate, sulfonamide, amide. In an oligonucleotide, all may be the same bond or a different binding.

As used herein, "DNA nucleoside" or "RNA nucleoside" is a natural DNA nucleosides or natural RNA nucleoside means a portion of a nucleotide is one unit constituting the oligonucleotide. The "natural DNA nucleosides" refers to the following.

Figure JPOXMLDOC01-appb-C000019

(Wherein, B X1 is adenine, guanine, cytosine or thymine.)
The "natural RNA nucleoside", means the following.
Figure JPOXMLDOC01-appb-C000020

(Wherein, B X2 is adenine, guanine, cytosine or uracil.)

"DNA oligonucleotide" is an oligonucleotide that is DNA nucleosides plurality bond, "RNA oligonucleotide" is an oligonucleotide in which the RNA nucleosides plurality bonds.

As used herein, "nucleoside derivative" means an artificial modified nucleobase and / or the sugar moiety of the DNA nucleosides or the RNA nucleosides were made nucleosides. If modification of the known nucleoside in the art, all of which are available.

The modification of nucleic acid bases, for example, 5-methylcytosine, 5-hydroxymethyl cytosine, 5-propynyl cytosine, and the like.

Modifications of the sugar moiety, for example, substitution of the 2 'position of the sugar.Specifically, 2'-F, 2'-OCH 3 (2'-OMe), which is 2'-OCH 2 CH 2 OCH 3 (2'-MOE) and the like.
Further, for example, cross-linked structure between the 4 'position and 2' position of the following sugars.
4 '- (CR 10 R 11 ) m-O-2', 4 '- (CR 10 R 11) m-S-2', 4 '- (CR 10 R 11) m-O-C (= O) -2 ', 4' - (CR 10 R 11) m-NR 6 -O- (CR 10 R 11) m 1 -2 ', 4' - (CR 10 R 11) m 1 -C (= O) - NR 6 -2 'or 4' - (CR 10 R 11 ) m 2 -C (= O) -NR 6 -X 1 -2 ', 4' - (CR 10 R 11) m 1 -SO 2 -NR 6 -2 ', or

Figure JPOXMLDOC01-appb-C000021

It is in,
here,
X 1 is, O, S, NH or CH 2,
R 6 is a hydrogen atom, a substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aromatic carbocyclic group, a substituted or unsubstituted non-aromatic carbocyclic ring Shikimoto, substituted or unsubstituted aromatic heterocyclic group, a substituted or unsubstituted non-aromatic heterocyclic group, a substituted or unsubstituted aromatic carbocyclic alkyl, substituted or unsubstituted non-aromatic carbocyclic alkyl a substituted or unsubstituted aromatic heterocyclic alkyl or substituted or unsubstituted non-aromatic heterocyclic alkyl,
R 10 are each independently a hydrogen atom, a halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl,
R 11 are each independently a hydrogen atom, a halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl,
Y 1 is CR 12 or N,
Y 2 is CR 13 or N,
Y 3 is CR 14 or N,
And each R 12, R 13 and R 14 are independently a hydrogen atom, a halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted amino, substituted or unsubstituted alkoxy, substituted or unsubstituted alkylcarbonylamino, substituted or unsubstituted alkenyl carbonylamino, substituted or unsubstituted alkynyl carbonylamino, substituted or unsubstituted alkylcarbamoyl, a substituted or unsubstituted alkenyl carbamoylmethyl or substituted or is a non-substituted alkyl carbamoylmethyl,
m is an integer of 1 to 4,
m 1 is an integer of 0 to 3,
m 2 is 0 or 1.

R 6 is preferably a hydrogen atom, an alkyl, alkenyl, alkynyl, aromatic carbocyclic group, a non-aromatic carbocyclic group, aromatic heterocyclic group, non-aromatic heterocyclic group, aromatic carbon ring alkyl, non-aromatic carbocyclic alkyl, an aromatic heterocyclic alkyl or non-aromatic heterocyclic alkyl, the optional substituents selected from α group may have one or more.
α group a hydroxyl group, alkyl, alkyloxy, mercapto, alkylthio, amino, alkylamino or halogen.

R 10 and R 11 are preferably hydrogen atoms.

As crosslinking structure, preferably, 4 '- (CR 10 R 11) m-O-2' or 4 '- (CR 10 R 11 ) m 1 -C (= O) -NR 6 -2' (AmNA, It is a Bridged nucleic acid),
here,
R 6 is a hydrogen atom, a substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl,
R 10 are each independently a hydrogen atom, a halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl,
R 11 are each independently a hydrogen atom, a halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl,
m is an integer of 1 to 4,
m 1 is an integer of 0-2.

As crosslinking structure, particularly preferably, 4 '- (CH 2) m-O-2' (m is an integer of 1 to 4) or, 4'-C (= O) -NR 6 -2 '(R 6 is a hydrogen) atoms or alkyl.
4 - (m is an integer of 1 ~ 4) '(CH 2 ) m-O-2' in, particularly preferably 4'-CH 2 -O-2 ' (LNA, Locked nucleic acid). Specific examples and methods for their preparation, WO 98/39352, WO 2003/068795, are described in WO 2005/021570 or the like.
4'-C (= O) -NR 6 -2 '(R 6 is a hydrogen atom or an alkyl) in the, particularly preferably 4'-C (= O) -NCH 3 -2' it is. Specific examples and methods for their preparation are described in WO 2011/052436.

For modification and modification methods known nucleotide in the art, for example, it is also disclosed in the following patent documents.
WO 98/39352, WO 99/014226, WO 2000/056748, WO 2005/021570, WO 2003/068795, WO 2011/052436, International Publication No. 2004 / No. 016749, WO 2005/083124, WO 2007/143315, WO 2009/071680, WO 2014/112463, WO 2014/126229, and the like.

The present invention is described in detail below.

"Duplex oligonucleotide" in the present invention is antisense strand is DNA antisense oligonucleotides which may contain 8-25 bases nucleoside derivative,
Sense strand comprises a hybridizable sequence in the antisense strand under stringent conditions, an RNA oligonucleotide of DNA nucleosides and / or nucleoside derivative which may contain 8-35 bases,
The 3 'end and / or 5' end of the sense strand,
Sugar derivative having an interaction with the asialoglycoprotein receptor via a linker is double-stranded oligonucleotide bound.

Antisense strand of "double-stranded oligonucleotide" in the present invention is a DNA antisense oligonucleotides which may contain 8-25 bases nucleoside derivatives.

"DNA antisense oligonucleotides", mRNA of a target gene, a complementary oligonucleotide to the mRNA precursor or ncRNA, composed of single-stranded DNA. mRNA to which the antisense oligonucleotide is targeted to inhibit the action of mRNA, pre-mRNA or ncRNA by forming a pre-mRNA or ncRNA and duplex. To the "DNA antisense oligonucleotide", mRNA to be targeted, not only those that are pre-mRNA or ncRNA completely complementary to, mRNA, as long as that can hybridize with mRNA precursor or ncRNA stringent conditions also included are those which one or several mismatches are present.
The ncRNA (non-coding RNA), is a generic name of RNA that functions without being translated into protein. For example, ribosomal RNA, transfer RNA, miRNA, and the like.
The "target gene" is not particularly limited, expressed in various diseases include genes increased.

The length of the "DNA antisense oligonucleotide" is 8 to 25 bases. For example, 8-19 bases, 10-19 bases, 13-19 bases, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases or 19 bases.

Sense strand of "double-stranded oligonucleotide" in the present invention comprises a hybridizable sequence in the antisense strand under stringent conditions, DNA nucleosides and / or nucleoside derivative which may contain 8-35 bases which is the RNA oligonucleotide.

RNA oligonucleotides of the sense strand, as long as capable of hybridizing with DNA antisense oligonucleotide under stringent conditions of the antisense strand, the hybridizing region, also include those which one or several mismatches are present.
For example, the hybridizing region is at least 70% complementary sequence of DNA antisense oligonucleotides of the antisense strand, preferably 80% or more, more preferably 90% or more, most preferably 95% or more It includes the antisense oligonucleotides. Here, homology, for example, Altschul et al (The Journal of Molecular Biology, 215,403-410 (1990).) By using the search program BLAST, using the algorithm developed by similarity score is shown .

The length of the sense strand of double-stranded oligonucleotide of the present invention is 8 to 35 bases. For example, 8 to 30,8 to 19 bases, 10-19 bases, 13-19 bases, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases or 19 bases. The length of the sense strand may be the same length as the antisense strand, to the extent that they hybridize with the antisense strand may be one or minute short of several bases than the length of the antisense strand. In addition, by one or several bases are added to one or both sides of the region that hybridizes with the antisense strand, the length of the sense strand may be longer than the length of the antisense strand. If the length of the sense strand is longer than the length of the antisense strand, by a base with each other in the sense strand will hybridize in the antisense strand hybridize to portions not, may have a hairpin structure.
The "one or several bases", 1 to 10, 1 to 5, means a 1 to 3 or 1 or 2 bases.

The "stringent conditions", forming a certain base sequence to form a specific sequence and hybrid (a so-called specific hybrid), equivalent functions having no nucleotide sequence the specific sequence and hybrid (so-called non-specific hybrid) It refers to the condition that you do not. Those skilled in the art, and the temperature during the hybridization reaction and washing, by varying the hybridization reaction solution and wash salt concentration and the like, can be selected such conditions easily. Specifically, 6 × SSC (0.9M NaCl, 0.09M sodium citrate) or 6 × SSPE (3M NaCl, 0,2M NaH 2 PO 4, 20mM EDTA · 2Na, pH7.4) in 42 ° C. in hybridized, the conditions of washing by 0.5 × SSC at further 42 ° C. is, may be mentioned as an example of stringent conditions of the present invention, but is not limited thereto. As hybridization method, conventionally well-known techniques in the art, for example, can be used Southern blot hybridization method or the like. Specifically, Molecular Cloning: A Laboratory Manual, Second Edition (1989) (Cold Spring Harbor Laboratory Press), Current Protocols in Molecular Biology (1994) (Wiley-Interscience), DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition (1995) can be carried out according to the method described in (Oxford University Press) and the like.

The "one or several mismatches", 1 to 5, preferably 1 to 3, and more preferably mean one or two mismatches.

RNA oligonucleotides DNA antisense oligonucleotide and a sense strand of antisense strand in "double-stranded oligonucleotide" in the present invention preferably contains a nucleoside derivative 1 or more. Sense strand may further comprise a DNA nucleoside. That, DNA antisense oligonucleotides of the antisense strand, at least one nucleoside is DNA nucleosides, other nucleoside may be nucleoside derivatives be DNA nucleosides. RNA oligonucleotides of the sense strand is at least one nucleoside is RNA nucleosides, other nucleosides RNA nucleosides, DNA nucleoside may be either of the nucleoside derivatives.
The pattern of the nucleoside derivatives and DNA nucleosides or RNA nucleosides, for example, gapmer or Mikusuma.
The gapmer comprises a central region ( "gap") and the regions on both sides of the said central region, wings ( 'the side "5' 5 'side" 3' wing 'or 3 Wing "), at least in each wing It refers to an oligonucleotide containing one nucleoside derivatives. For example, the "5 'wing' and / or" 3 'wing', the nucleoside derivative 1 or more, preferably 1 to 5, more preferably 2 to 3 containing. Modified types in one wing, the number, position modification type in the other wing, the number may be different be the same as position.
The Mikusuma, refers to an oligonucleotide containing a nucleoside derivative at random.
DNA antisense oligonucleotides of the antisense strand, particularly preferably, a gap-mer.

Nucleoside derivative in "double-stranded oligonucleotide" in the present invention, as described above, if the modification of the known nucleoside in the art, all of which are available.
Preferably, a nucleoside having a crosslinked structure between the position and the 2 'position of' 4 nucleoside and / or sugar having a substituent at the 2 'position of the sugar.
The preferred substituents on the 2 'position of the sugar, F, is OCH 3 or OCH 2 CH 2 OCH 3.
The preferred cross-linking structure between the 4 'position and 2' position of the sugar, 4 '- (CH 2) m-O-2' ( m is an integer 1 ~ 4), 4'-C (= O) -NR 6 -2 '(R 6 is a hydrogen atom or an alkyl).

Preferably the DNA antisense oligonucleotides of the antisense strand in the "double-stranded oligonucleotide" in the present invention are phosphorothioate (S- oligos).

RNA oligonucleotides DNA antisense oligonucleotide and a sense strand of antisense strand in "double-stranded oligonucleotide" in the present invention can be synthesized by conventional methods in the art, for example, commercial nucleic acid automatic synthesizer (e.g., AppliedBiosystems Co., Ltd. large Nippon Seiki Co., etc.) can be readily synthesized by. Synthesis solid phase synthesis using phosphoramidite are solid phase synthesis or the like using hydrogen phosphonate. For example, 1) to 7 below in Example 3), Tetrahedron Letters 22, 1859-1862 (1981), is disclosed in WO 2011/052436 and the like.

Synthetic antisense strand and sense strand form a double-stranded oligonucleotide by hybridizing a known method. For example, 11 of Example 3 below), disclosed in Example 1 or the like of WO 2013/089283.

"Duplex oligonucleotide" in the present invention, the 3 'end and / or 5' end of the sense strand, sugar derivative having an interaction with the asialoglycoprotein receptor via a linker is attached.

The "asialoglycoprotein receptor" present in the liver cell surface, and recognizes the galactose residue of asialoglycoproteins has a function of decomposing uptake into cells. That is, the "sugar derivative having an interaction with the asialoglycoprotein receptor" has a structure similar to galactose residues, means a compound that binds with the asialoglycoprotein receptor is incorporated into the cells. For example, GalNac (N-acetylgalactosamine) derivatives, galactose derivatives, lactose derivatives.

The GalNac derivative is a compound containing the following group.

Figure JPOXMLDOC01-appb-C000022

(In the formula,
R X1, R X2 and R X3 are each independently hydrogen atom or a substituted or unsubstituted alkyl,
R X4 'is a substituted or unsubstituted alkyl. )

The galactose derivative, a compound containing the following group.

Figure JPOXMLDOC01-appb-C000023

(Wherein, R X1, R X2 and R X3 are each independently hydrogen atom or a substituted or unsubstituted alkyl.)

Lactose derivatives are compounds containing the following group.

Figure JPOXMLDOC01-appb-C000024

(In the formula,
R X1 represents a hydrogen atom or a substituted or unsubstituted alkyl,
R X2 and R X3 are each independently hydrogen atom or a substituted or unsubstituted alkyl,
R X4 are each independently, OH or NHCOR X4 '(R X4' is a substituted or unsubstituted alkyl). )

Preferably a "sugar derivative having an interaction with the asialoglycoprotein receptor" include the following.

Figure JPOXMLDOC01-appb-C000025

(In the formula,
P 0A, P 1A, P 1B , P 2A, P 2B, P 3A, P 3B, P 4A, P 4B, P 4C, T 0A, T 1A, T 1B, T 2A, T 2B, T 3A, T 3B , T 4A, T 4B and T 4C are each independently absent, CO, NH, O, S , OC (= O), NHC (= O), in CH 2, CH 2 NH or CH 2 O Yes,
Q 0A, Q 1A, Q 1B , Q 2A, Q 2B, Q 3A, Q 3B, Q 4A, Q 4B and Q 4C are each independently absent or a substituted or unsubstituted alkylene,
R 0A, R 1A, R 1B , R 2A, R 2B, R 3A, R 3B, R 4A, each R 4B and R 4C independently absent, NH, O, S, CH 2, C ( = O) O, C (= O) NH, NHCH (R 5) C (= O), C (= O) CH (R 5) NH, CO, CH = N-O, a heterocyclic ring,
Figure JPOXMLDOC01-appb-C000026

(Note that if R 0A ~ R 4C are represented by the above formula wherein, Q 0A ~ Q 4C binds to the left)
It is in,
R 5 is a hydrogen atom or an amino acid side chain,
q 0A, q 1A, q 1B , q 2A, q 2B, q 3A, q 3B, q 4A, q 4B and q 4C are each independently an integer of 0 to 20,
LG 0A, LG 1A, LG 1B , LG 2A, LG 2B, LG 3A, LG 3B, LG 4A, LG 4B and LG 4C are each, independently,
Figure JPOXMLDOC01-appb-C000027

(In the formula,
R X1, R X2 and R X3 are each independently a hydrogen atom or a substituted or unsubstituted alkyl,
R X4 is OH or NHCOR X4 '(R X4' is a substituted or unsubstituted alkyl))

"Amino acid side chain" is a part of the structure of an amino acid, for example, CH 3, CH 2 SH, CH 2 COOH, CH 2 CH 2 COOH, CH 2 C 6 H 5, CH 2 C 3 H 3 N 2, CH (CH 3) CH 2 CH 3, (CH 2) 4 NH 2, CH 2 CH (CH 3) 2, CH 2 CH 2 SCH 3, CH 2 CONH 2, CH 2 CH 2 CONH 2, (CH 2) 3 NHC (NH) NH 2, CH 2 OH, CH (OH) CH 3, CH 2 SeH, CH (CH 3) 2, CH 2 C 8 H 6 N, include CH 2 C 6 H 4 OH, etc. It is.

Any of the above (I) ~ (IV), more preferably preferably,

Figure JPOXMLDOC01-appb-C000028

It is.

Particularly preferably,

Figure JPOXMLDOC01-appb-C000029

It is.

Linkers via a sense strand and sugar derivatives, as long as the linker used in the art, it is either available.

For example, the following.

Figure JPOXMLDOC01-appb-C000030

(In the formula,
L 1 is attached to the 3 'end and / or 5' end of the sense strand, L 5 is linked to the sugar derivative.
L 1 is C (= O) NH, NHC (= O), NHC (= O) NH,
Figure JPOXMLDOC01-appb-C000031

(Wherein, R 7 is an alkyl or alkyloxy), and
L 2 are each independently carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 3 are each independently absent, C (= O) NR 8 (R 8 is hydrogen or a substituted or unsubstituted alkyl), NR 9 C (= O ) (R 9 is hydrogen or a substituted or or is unsubstituted alkyl, R 9 may form a nitrogen-containing ring substituted or unsubstituted together with the carbon in the alkylene of L 2),
Figure JPOXMLDOC01-appb-C000032

(Note that if L 3 is represented by the above formula, wherein, L 2 is attached to the left side)
It is in,
L 4 are each independently absent, carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 5 represents C (= O) NH, NHC (= O), is NH or O,
n is 1 or 2).

Or, it includes the following.

Figure JPOXMLDOC01-appb-C000033

(In the formula,
L 1 is attached to the 3 'end and / or 5' end of the sense strand, L 5 is linked to the sugar derivative.
L 1 is C (= O) NH, NHC (= O), NHC (= O) NH,
Figure JPOXMLDOC01-appb-C000034

(Wherein, R 7 is an alkyl or alkyloxy), and
L 2 are each independently carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 3 are each independently absent, C (= O) NR 8 (R 8 is hydrogen or a substituted or unsubstituted alkyl) or NR 9 C (= O) ( R 9 is hydrogen or a substituted or or is unsubstituted alkyl, R 9 is may also be) to form a nitrogen heterocycle substituted or unsubstituted together with the carbon in the alkylene of L 2,
L 4 are each independently absent, carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
L 5 represents C (= O) NH, NHC (= O), is NH or O,
n is 1 or 2).

L 2 or L 4 is a case of "aromatic rings alkylene may also be substituted or unsubstituted optionally through" or "aromatic ring", as the aromatic ring, preferably a benzene ring, a biphenyl ring and the like It is.

"R 9 also may form a nitrogen-containing ring substituted or unsubstituted together with the carbon in the alkylene in L 2" is a means below.

Figure JPOXMLDOC01-appb-C000035

(In the formula, a is an integer of 0 ~ 18, b is an integer of 1-5. Alkylene or nitrogen-containing heterocycle may have a substituent.)
Specific examples thereof include the following.
Figure JPOXMLDOC01-appb-C000036

'If sugar derivative via a linker to the end are bound, 3 of the sugar end of the oligonucleotide 3' of the sense strand L 1 is attached to the position.
'When bound sugar derivative to the end, the fourth end of the oligonucleotide 5' of the sense strand L 1 is bonded via a methylene substituted or unsubstituted in position.

Specifically as linkers include the following.

Figure JPOXMLDOC01-appb-C000037

Preferably as L 1,

Figure JPOXMLDOC01-appb-C000038

It is.
The preferred L 2, substituted or unsubstituted alkylene of 1 to 20, a benzene ring or a biphenyl ring.
The preferred L 3, absent, C (= O) or NH or NR 9 C (= O) ( R 9 is hydrogen, R 9 is substituted or together with the carbon in the alkylene of L 2 may form an unsubstituted nitrogen-containing ring), NR 9 C (= O ) (R 9 forms a nitrogen-containing ring substituted or unsubstituted together with the carbon in the alkylene of L 2 ),
Figure JPOXMLDOC01-appb-C000039

(Note that if L 3 is represented by the above formula, wherein, L 2 is attached to the left side)
It is.
The preferred L 4, absent, alkylene substituted or unsubstituted 1-20, a benzene ring or a biphenyl ring.
Preferably the L 5 represents a C (= O) NH.

Figure JPOXMLDOC01-appb-C000040

As, in particular, include the following.
Figure JPOXMLDOC01-appb-C000041

Figure JPOXMLDOC01-appb-C000042

Figure JPOXMLDOC01-appb-C000043

(Wherein, X is O or S, n 1 and n 2 are each independently represent an integer of 1 ~ 20, n 3 is an integer of 1-6.)

Linker "sugar derivative having an interaction with the asialoglycoprotein receptor", was synthesized as a compound containing a portion of the street sugar derivative and the linker described in Example 1 below, the street the compounds described in the following Examples immobilized on resin, it is introduced into RNA oligonucleotides as sense strand according to 9) and 10) of example 3 below. Thereafter, by hybridizing as antisense strand of DNA antisense oligonucleotide according to 11) of Example 3 below, "double-stranded oligonucleotide" in the present invention is obtained. Specific examples of the "compound comprising a part of the sugar derivative and linker", include the compounds described in the following Examples 1.
Method adjustment and specific examples of and linker "sugar derivatives having an interaction with the asialoglycoprotein receptor" includes, for example, Non-Patent Document 1, Patent Documents 6 ~ 9, Bioconjugate Chemistry, 22,17-225 (1991), Bioconjugate Chemistry, has also been disclosed in 14,18-29 (2003), and the like.

3 'end or 5' end sugar derivative is not bound in the "double-stranded oligonucleotide" of the present invention or a linker, it may be further modified. To allow tracking of the oligonucleotides, for improving the pharmacokinetic or pharmacodynamic oligonucleotides, or to improve the stability or binding affinity of the oligonucleotide, utilizing the known modifying group in the art can. For example, a hydroxyl protecting group, reporter molecule, cholesterol, phospholipids, pigments, fluorescent molecules, and the like.
Also, 3 'end or 5' end sugar derivative is not bound in the "double-stranded oligonucleotide" in the present invention may contain a phosphate moiety. The term "phosphate moiety" includes phosphoric acid esters and modified phosphate ester is meant a terminal phosphate group. Phosphoric acid ester moiety, may be located at either end, it is preferred that the 5'-terminal nucleoside. Specifically, the formula: is -O-P (= O) (OH) group or a modifying group represented by OH. That is, substitution of one or more O and OH is, H, O, OR ', S, N (R') (wherein R ', H, an amino protecting group or a substituted or unsubstituted alkyl), or alkyl it may be. 5 'or 3' end may contain a phosphate moiety of 1-3 substituted or unsubstituted independently.

The terms other than the above for use herein will be described below. In the present specification, the following terms may have been used alone, or if other terms are used together, unless otherwise specified, have the same significance.

The term "halogen" encompasses fluorine atom, a chlorine atom, a bromine atom, and iodine atom. Especially fluorine atom or a chlorine atom.

The term "alkyl", 1 to 15 carbon atoms, preferably covers straight-chain or branched hydrocarbon group having 1 to 10 carbon atoms, more preferably having 1 to 6 carbon atoms, more preferably 1 to 4 carbon atoms to. For example, heptyl methyl, ethyl, n- propyl, isopropyl, n- butyl, isobutyl, sec- butyl, tert- butyl, n- pentyl, isopentyl, neopentyl, n- hexyl, isohexyl, to n-, isoheptyl, n- octyl , isooctyl, n- nonyl, n- decyl and the like.
In a preferred embodiment of "alkyl" include methyl, ethyl, n- propyl, isopropyl, n- butyl, isobutyl, sec- butyl, tert- butyl, n- pentyl. As a further preferred embodiment, methyl, ethyl, n- propyl, isopropyl, tert- butyl.

The term "alkenyl", having one or more double bonds at any position, 2 to 15 carbon atoms, preferably having 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, more preferably 2 to 4 carbon atoms It includes straight-chain or branched hydrocarbon group. For example, vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, prenyl, butadienyl, pentenyl, isopentenyl, pentadienyl, hexenyl, isohexenyl, hexadienyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodecenyl, tridecenyl, tetradecenyl, pentadecenyl etc. the.
In a preferred embodiment of the "alkenyl" include vinyl, allyl, propenyl, isopropenyl, butenyl.

The term "alkynyl", having one or more triple bonds in any position, 2 to 10 carbon atoms, preferably from 2 to 8 carbon atoms, more preferably 2 to 6 carbon atoms, more preferably 2 to 4 carbon atoms It includes straight-chain or branched hydrocarbon group. For example, it includes ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl and the like. These may have a double bond addition in any position.
In a preferred embodiment of "alkynyl" include ethynyl, propynyl, butynyl, pentynyl.

"Alkylene", 1 to 15 carbon atoms, preferably a divalent hydrocarbon of 1 to 10, more preferably 1 to 6 carbon atoms, more preferably a straight-chain or branched having 1 to 4 carbon-carbon It embraces radicals. For example, methylene, ethylene, trimethylene, propylene, tetramethylene, pentamethylene, hexamethylene, and the like.

"Aromatic carbocyclic group", the above monocyclic or bicyclic, means a cyclic aromatic hydrocarbon group. For example, phenyl, naphthyl, anthryl, phenanthryl and the like.
In a preferred embodiment of the "aromatic carbocyclic group", phenyl.

The "non-aromatic carbocyclic group" means a mono- or bicyclic more, cyclic saturated hydrocarbon group or a cyclic non-aromatic unsaturated hydrocarbon group. 2 non-aromatic carbocyclic group or ring, the monocyclic or non-aromatic carbocyclic group or ring also includes those ring in the "aromatic carbocyclic group" is fused.
Further, "non-aromatic carbocyclic group" also includes cross-linked to have group, or form a spiro ring group as follows.

Figure JPOXMLDOC01-appb-C000044

The non-aromatic carbocyclic group of monocyclic, preferably 3 to 16 carbon atoms, more preferably 3 to 12 carbon atoms, more preferably 4 to 8 carbon atoms. For example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclohexadienyl and the like.
The bicyclic or non-aromatic carbocyclic group, for example, indanyl, indenyl, acenaphthyl, tetrahydronaphthyl, fluorenyl and the like.

The "aromatic heterocyclic group", refers O, with 1 or more in the same or different hetero atoms selected arbitrarily from S and N ring, the above monocyclic or bicyclic, aromatic cyclic group to.
2 aromatic heterocyclic group having at least ring, a monocyclic or aromatic heterocyclic group having at least ring also includes those ring in the "aromatic carbocyclic group" is fused.
The aromatic heterocyclic group of a single ring, preferably 5- to 8-membered, more preferably 5- or 6-membered. For example, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazolyl, triazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, isothiazolyl, thiazolyl, thiadiazolyl, and the like.
The 2-aromatic heterocyclic group ring, for example, indolyl, isoindolyl, indazolyl, indolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, naphthyridinyl, quinoxalinyl, purinyl, pteridinyl, benzimidazolyl, benzisoxazolyl, benz oxazolyl, benzoxadiazolyl, benzisothiazolyl, benzothiazolyl, benzothiadiazolyl, benzofuryl, isobenzofuryl, benzothienyl, benzotriazolyl, imidazopyridyl, triazolopyridyl pyridyl, imidazothiazolyl, Pirajinopiri Dajiniru, oxazolopyridyl, thiazolopyridyl and the like.
The three or more rings of an aromatic heterocyclic group, for example, carbazolyl, acridinyl, xanthenyl, phenothiazinyl, phenoxathiinyl, phenoxazinyl, dibenzofuryl and the like.

The "non-aromatic heterocyclic group", O, having one or more identical or different hetero atoms in the ring is selected from S and N, optionally mono- or above 2 rings, cyclic non-aromatic cyclic It refers to the group.
2 non-aromatic heterocyclic group having at least ring, a monocyclic or non-aromatic heterocyclic group having at least ring, the "aromatic carbocyclic group", "non-aromatic carbocyclic group", and / or include those wherein each ring in the "aromatic heterocyclic group" is fused.
Further, "non-aromatic heterocyclic group" also includes cross-linked to have group, or form a spiro ring group as follows.

Figure JPOXMLDOC01-appb-C000045

Non-aromatic heterocyclic groups monocyclic, preferably 3-8 membered, more preferably 5- or 6-membered. For example, dioxanyl, thiiranyl, oxiranyl, oxetanyl, oxathiolanyl, azetidinyl, thianyl, thiazolidinyl, pyrrolidinyl, pyrrolinyl, imidazolidinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl, piperidyl, piperazinyl, morpholinyl, morpholino, thiomorpholinyl, thiomorpholino, dihydropyridyl, tetrahydropyridyl, tetrahydro furyl, tetrahydropyranyl, dihydrothiazolyl, tetrahydropyran thiazolyl, tetrahydroisoquinoline thiazolyl, dihydro benzoxazinyl, hexahydroazepinyl, tetrahydropyran diazepinium sulfonyl, tetrahydronaphthyl pyridazinyl, hexahydropyrimidinyl, dioxolanyl, Jiokisajiniru , aziridinyl, Jiokisoriniru, oxepanyl, thiolanyl, lichen Le, triazinyl, and the like.
The bicyclic or non-aromatic heterocyclic group, for example, indolinyl, isoindolinyl, chromanyl, isochromanyl and the like.

"Heterocycle" means a ring derived from the above "aromatic heterocyclic group" and "non-aromatic heterocyclic group".

The "aromatic ring" means a ring derived from the above "aromatic carbocyclic group" and "aromatic heterocyclic group".

The term "alkyloxy" means a group in which the "alkyl" is bonded to an oxygen atom. For example, methoxy, ethoxy, n- propyloxy, isopropyloxy, n- butyloxy, tert- butyloxy, iso-butyloxy, sec- butyloxy, pentyloxy, isopentyloxy, hexyloxy and the like to.
In a preferred embodiment of "alkyloxy" include methoxy, ethoxy, n- propyloxy, isopropyloxy, include tert- butyloxy.

The "alkenyloxy" means a group where the "alkenyl" is bonded to an oxygen atom.
For example, vinyloxy, allyloxy, 1-propenyloxy, 2-butenyloxy, 2-pentenyloxy, 2-hexenyloxy, 2-heptenyloxy, 2-octenyloxy, and the like.

The "alkynyloxy" means a group where the "alkynyl" is bonded to an oxygen atom.
For example, ethynyloxy, 1-propynyloxy, 2-propynyloxy, 2-butynyloxy, 2-pentynyloxy, 2-hexynyloxy, 2-Hepuchiniruokishi, 2 Okuchiniruokishi and the like.

The term "haloalkyl", one or more of the above "halogen" means a group attached to the "alkyl". For example, monofluoromethyl, monofluoroethyl, mono-fluoropropyl, 2,2,3,3,3-pentafluoro-propyl, monochloromethyl, trifluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 2, 2,2-trichloroethyl, 1,2-dibromo-ethyl, 1,1,1-trifluoro-2-yl, and the like.
In a preferred embodiment of "haloalkyl" include trifluoromethyl, include trichloromethyl.

The term "haloalkoxy" means a group where the "haloalkyl" is bonded to an oxygen atom. For example, mono-fluoromethoxy, mono-fluoroethoxy, trifluoromethoxy, trichloromethoxy, trifluoroethoxy, trichloroethoxy, and the like.
In a preferred embodiment of the "haloalkyloxy", trifluoromethoxy include trichloromethoxy.

The term "alkyloxyalkyl" means a group where the "alkyloxy" is bonded to the "alkyl". For example, methoxymethyl, methoxyethyl, ethoxymethyl, and the like.

The term "alkyloxy alkyloxy" means a group where the "alkyloxy" is bonded to the "alkyloxy". For example, methoxymethoxy, methoxyethoxy, ethoxymethoxy, ethoxyethoxy and the like.

"Alkylthio" means a group in which the "alkyl" is bonded to a sulfur atom.

The term "alkylcarbonyl" means a group in which the "alkyl" is bonded to a carbonyl group. For example, methylcarbonyl, ethylcarbonyl, propylcarbonyl, isopropylcarbonyl, tert- butylcarbonyl, iso-butylcarbonyl, sec- butylcarbonyl, pentylcarbonyl, isopentyl carbonyl, cyclohexyl-carbonyl, and the like to.
In a preferred embodiment of the "alkylcarbonyl", methylcarbonyl, ethylcarbonyl, n- propylcarbonyl and the like.

The "alkenylcarbonyl" refers to a group in which the "alkenyl" is bonded to a carbonyl group. For example, ethylene-les alkenyl carbonyl include propenylcarbonyl and the like.

The "alkynylcarbonyl" means a group where the "alkynyl" is bonded to a carbonyl group. For example, ethynylcarbonyl, propynylcarbonyl, and the like.

"Alkyl amino" include monoalkylamino and dialkylamino.
The term "mono-alkylamino" means a group in which the "alkyl" is substituted for one hydrogen atom bonded to the nitrogen atom of the amino group. For example, methylamino, ethylamino, isopropylamino and the like. Preferably, it includes methylamino, ethylamino.
The "dialkylamino" means a group in which the "alkyl" is substituted with two hydrogen atoms bonded to the nitrogen atom of the amino group. Two of the alkyl may be the same or different. For example, dimethylamino, diethylamino, N, N- diisopropylamino, N- methyl -N- ethylamino, N- isopropyl -N- ethylamino and the like. Preferably, dimethylamino, and diethylamino.

"Alkylsulfonyl" means a group in which the "alkyl" is bonded to a sulfonyl group. For example, methylsulfonyl, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl, tert- butylsulfonyl, iso-butylsulfonyl, etc. sec- butylsulfonyl and the like.
In a preferred embodiment of the "alkylsulfonyl" include methylsulphonyl, ethylsulfonyl.

The "alkenyl-sulfonyl" means a group where the "alkenyl" is bonded to a sulfonyl group. For example, ethylene-les sulfonyl sulfonyl include propenyl sulfonyl and the like.

The "alkynylsulfonyl" means a group where the "alkynyl" is bonded to a sulfonyl group. For example, ethynyl sulfonyl include propynyl sulfonyl and the like.

The "mono-alkylcarbonylamino" means a group where the "alkylcarbonyl" is substituted for one hydrogen atom bonded to the nitrogen atom of the amino group. For example, methylcarbonylamino, ethylcarbonylamino, propyl carbonyl amino, isopropyl carbonyl amino, tert- butylcarbonylamino, isobutyl carbonylamino, sec- butyl carbonylamino, and the like.
Preferred embodiments of the "mono-alkylcarbonylamino" include methylcarbonylamino and ethylcarbonylamino.

The "dialkylamino carbonyl amino" means a group where the "alkylcarbonyl" is replaced with two hydrogen atoms bonded to the nitrogen atom of the amino group. Two alkylcarbonyl groups may be the same or different. For example, dimethyl carbonylamino, diethyl carbonyl amino, N, N-diisopropyl carbonylamino, and the like.
In a preferred embodiment of the "dialkylamino carbonyl amino", dimethylamino carbonyl amino, diethyl carbonylamino.

The "mono-alkylsulfonylamino" refers to the "alkylsulfonyl" is substituted for one hydrogen atom bonded to the nitrogen atom of the amino group group. For example, methylsulfonylamino, ethylsulfonylamino, propylsulfonyl amino, isopropylsulfonyl amino, tert- butyl sulfonylamino, iso-butylsulfonyl amino, sec- butyl sulfonylamino or the like.
Preferred embodiments of the "mono-alkylsulfonylamino" include methylsulfonylamino and ethylsulfonylamino.

The "dialkylamino sulfonylamino" means a group where the "alkylsulfonyl" is replaced with two hydrogen atoms bonded to the nitrogen atom of the amino group. Two alkyl sulfonyl group may be the same or different. For example, dimethyl sulfonylamino, diethyl sulfonylamino, N, N-diisopropyl-sulfonylamino and the like.
In a preferred embodiment of the "dialkylamino carbonyl amino", dimethylamino sulfonylamino include diethyl sulfonylamino.

The term "alkylimino" means a group in which the "alkyl" is substituted for the hydrogen atom bonded to the nitrogen atom of the imino group. For example, methylimino, ethylimino, n- propylimino, isopropyl imino, and the like.

The "alkenylimino" means a group where the "alkenyl" is substituted for the hydrogen atom bonded to the nitrogen atom of the imino group. For example, Echireniruimino, Puropeniruimino and the like.

The "alkynylimino" means a group where the "alkynyl" is substituted for the hydrogen atom bonded to the nitrogen atom of the imino group. For example, Echiniruimino include propynyl imino and the like.

The term "alkylcarbonyl imino" means a group where the "alkylcarbonyl" is substituted for the hydrogen atom bonded to the nitrogen atom of the imino group. For example, methylcarbonyl imino, ethylcarbonyl imino, n- propyl carbonylimino, isopropyl carbonylimino the like.

The "alkenylcarbonyl imino" means a group where the "alkenylcarbonyl" is replaced with a hydrogen atom bonded to the nitrogen atom of the imino group. For example, ethylene-les sulfonyl carbonylimino include propenyl carbonylimino like.

The "alkynylcarbonyl imino" means a group where the "alkynylcarbonyl" is replaced with a hydrogen atom bonded to the nitrogen atom of the imino group. For example, ethynyl carbonylimino, propynyl carbonylimino like.

The term "alkyloxy imino" means a group where the "alkyloxy" is substituted for the hydrogen atom bonded to the nitrogen atom of the imino group. For example, methyl oximino, ethyl oximino, n- propyl oximino, isopropyl oximino, and the like.

The "alkenyloxy imino" means a group where the "alkenyloxy" is replaced with a hydrogen atom bonded to the nitrogen atom of the imino group. For example, ethylene-les sulfonyl oxyimino include propenyloxy imino like.

The "alkynyloxy imino" means a group where the "alkynyloxy" is replaced with a hydrogen atom bonded to the nitrogen atom of the imino group. For example, ethynyl oximino, propynyl oximino, and the like.

The term "alkylcarbonyloxy" means a group where the "alkylcarbonyl" is bonded to an oxygen atom. For example, methyl carbonyloxy, ethyl carbonyloxy, propyl carbonyloxy, isopropyl carbonyloxy, tert- butylcarbonyloxy, iso-butylcarbonyloxy, sec- butylcarbonyloxy, and the like.
Preferred embodiments of "alkylcarbonyloxy" include methyl carbonyloxy, ethyl carbonyloxy.

The "alkenylcarbonyloxy" means a group where the "alkenylcarbonyl" is bonded to an oxygen atom. For example, ethylene-les sulfonyl carbonyloxy include propenyloxy carbonyloxy like.

The "alkynyloxy alkylcarbonyloxy" means a group where the "alkynylcarbonyl" is bonded to an oxygen atom. For example, ethynyl carbonyloxy include propynyl carbonyloxy and the like.

The term "alkyloxycarbonyl" refers to a group in which the "alkyloxy" is bonded to a carbonyl group. For example, methyloxycarbonyl, ethyloxycarbonyl, propyloxycarbonyl, isopropyloxycarbonyl, tert- butyloxycarbonyl, isobutyloxycarbonyl, sec- butyloxycarbonyl, pentyloxycarbonyl, like isopentyloxy carbonyl, cyclohexyl oxycarbonyl, etc., to the It is.
Preferred embodiments of the "alkyloxycarbonyl", methyloxycarbonyl, ethyloxycarbonyl, a propyl oxycarbonyl.

The "alkenyloxycarbonyl" refers to a group in which the "alkenyloxy" is bonded to a carbonyl group. For example, ethylene-les aryloxycarbonyl include propenyloxy carbonyl and the like.

The "alkynyloxy carbonyl" means a group where the "alkynyloxy" is bonded to a carbonyl group. For example, ethynyl oxycarbonyl include propynyloxy carbonyl and the like.

The term "alkylsulfanyl" means a group in which the "alkyl" is substituted for the hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, methylsulfanyl, ethylsulfanyl, n- propylsulfanyl, isopropyl sulfanyl, and the like.

The "alkenyl Alpha alkenyl" means a group where the "alkenyl" is substituted for the hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, ethylene-les Nils Alpha sulfonyl include propenyl Nils Alpha sulfonyl and the like.

The "alkynyl Nils Alpha alkenyl" means a group where the "alkynyl" is substituted for the hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, ethynyl sulfanyl, propynyl sulfanyl like.

The term "alkylsulfinyl" means a group in which the "alkyl" is bonded to a sulfinyl group. For example, methylsulfinyl, ethylsulfinyl, n- propyl sulfinyl, isopropyl-sulfinyl, and the like.

The "alkenylsulfinyl" means a group where the "alkenyl" is bonded to a sulfinyl group. For example, ethylene-les Nils sulfinyl include propenyl Nils sulfinyl and the like.

The "alkynylsulfinyl" means a group where the "alkynyl" is bonded to a sulfinyl group. For example, ethynyl alkylsulfinyl, propynyl sulfinyl like.

The "mono-alkylcarbamoyl" means a group that the above "alkyl" is substituted for one hydrogen atom bonded to the nitrogen atom of the carbamoyl group. For example, methylcarbamoyl, ethylcarbamoyl, and the like.

The "dialkylcarbamoyl" means a group in which the "alkyl" is substituted with two hydrogen atoms bonded to the nitrogen atom of the carbamoyl group. Two alkyl groups may be the same or different. For example, dimethylcarbamoyl, diethylcarbamoyl and the like.

The "mono-alkylsulfamoyl" means a group in which the "alkyl" is substituted for one hydrogen atom bonded to the nitrogen atom of the sulfamoyl group. For example, methylsulfamoyl, dimethylsulfamoyl, and the like.

By "dialkylsulfamoyl" means a group in which the "alkyl" is substituted with two hydrogen atoms bonded to the nitrogen atom of the sulfamoyl group. Two alkyl groups may be the same or different. For example, dimethylsulfamoyl, and the like diethylsulfamoyl is.

The term "trialkylsilyl" refers to a group in which the "alkyl" 3 is bonded to a silicon atom. 3 alkyl may be the same or different. For example, trimethylsilyl, triethylsilyl, tert- butyldimethylsilyl and the like.

"Aromatic carbocyclic alkyl", "non-aromatic carbocyclic alkyl", "aromatic heterocyclic alkyl", and "non-aromatic heterocycle-alkyl",
"Aromatic carbocyclic alkyloxy", "non-aromatic carbocyclic alkyloxy", "aromatic heterocyclic alkyloxy", and "non-aromatic heterocyclic alkyloxy",
"Aromatic carbocyclic alkyloxycarbonyl", "non-aromatic carbocyclic alkyloxycarbonyl", "aromatic heterocyclic alkyloxycarbonyl", and "non-aromatic heterocyclic alkyloxycarbonyl",
"Aromatic carbocyclic alkyloxyalkyl", "non-aromatic carbocyclic alkyloxyalkyl", "aromatic heterocyclic alkyloxyalkyl", and "non-aromatic heterocycle alkyloxyalkyl", and "aromatic carbocyclic alkyl amino ", the alkyl portion of the" non-aromatic carbocyclic alkylamino "," aromatic heterocyclic alkylamino ", and" non-aromatic heterocycle-alkyl amino "is also the same as the above" alkyl ".

The term "aromatic carbocyclic alkyl" refers to alkyl substituted with one or more of the above "aromatic carbocyclic group". For example, benzyl, phenethyl, phenylpropyl, groups represented benzhydryl, trityl, naphthylmethyl, below

Figure JPOXMLDOC01-appb-C000046

Etc. The.
Preferred embodiments of the "aromatic carbocyclic alkyl" include benzyl, phenethyl, and benzhydryl.

The "non-aromatic carbocyclic alkyl" refers to alkyl substituted with one or more of the above "non-aromatic carbocyclic group". Further, "non-aromatic carbocyclic alkyl" includes the alkyl moiety be the is substituted with "aromatic carbocyclic group", "non-aromatic carbocyclic alkyl". For example, a group represented cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl cyclohexane, below

Figure JPOXMLDOC01-appb-C000047

Etc. The.

The "aromatic heterocyclic alkyl" refers to alkyl substituted with one or more of the above "aromatic heterocyclic group". Further, "aromatic heterocycle" means an alkyl moiety is substituted by the above "aromatic carbocyclic group" and / or "non-aromatic carbocyclic group", "aromatic heterocyclic alkyl" also encompasses . For example, pyridylmethyl, furanylmethyl, imidazolylmethyl, indolylmethyl, benzothiophenyl methyl, oxazolylmethyl, isoxazolylmethyl, thiazolylmethyl, benzisothiazolyl methyl, pyrazolylmethyl, iso pyrazolylmethyl, pyrrolidinylmethyl, benz groups represented oxazolylmethyl, below

Figure JPOXMLDOC01-appb-C000048

Etc. The.

The "non-aromatic heterocyclylalkyl" refers to alkyl substituted with one or more of the above "non-aromatic heterocyclic group". Further, "non-aromatic heterocycle" means an alkyl moiety is substituted by the above "aromatic carbocyclic group", "non-aromatic carbocyclic group" and / or "aromatic heterocyclic group" also includes "non-aromatic heterocyclic alkyl". For example, a group represented tetrahydropyranylmethyl, morpholinylethyl ethyl, piperidinylmethyl, piperazinylmethyl, below

Figure JPOXMLDOC01-appb-C000049

Etc. The.

The term "aromatic carbocyclic alkyloxy" means an alkyloxy substituted with one or more of the above-mentioned "aromatic carbocyclic group". For example, benzyloxy, phenethyloxy, phenylpropyloxy, benzhydryloxy, trityloxy, groups represented naphthyl methyloxy, below

Figure JPOXMLDOC01-appb-C000050

Etc. The.

The "non-aromatic carbocyclic alkyloxy" means an alkyloxy substituted with one or more of the "non-aromatic carbocyclic group". Further, "non-aromatic carbocyclic alkyloxy" embraces alkyl moiety be the "aromatic carbocyclic group" is substituted with the "non-aromatic carbocyclic ring alkyloxy". For example, a group represented cyclopropylmethyloxy, cyclobutylmethyl oxy, cyclopentyloxy methyloxy, cyclohexyl methyloxy cyclohexane, below

Figure JPOXMLDOC01-appb-C000051

Etc. The.

The "aromatic heterocyclic alkyloxy", means an alkyloxy substituted with one or more of the above "aromatic heterocyclic group". Further, "aromatic heterocyclic alkyloxy", also "aromatic heterocyclic alkyloxy" which the alkyl moiety is substituted by the above "aromatic carbocyclic group" and / or "non-aromatic carbocyclic group" It encompasses. For example, pyridylmethyloxy, furanyl methyloxy, imidazolylmethyl oxy, indolyl methyloxy, benzothiophenyl methyloxy, oxazolylmethyl oxy, isoxazolylmethyl oxy, thiazolyl methyloxy, benzisothiazolyl methyloxy , pyrazolyl methyloxy, iso-pyrazolyl methyloxy, pyrrolidinylmethyl oxy, benzoxazolyl methyloxy, groups shown below

Figure JPOXMLDOC01-appb-C000052

Etc. The.

The "non-aromatic heterocyclic alkyloxy", means an alkyloxy substituted with one or more of the "non-aromatic heterocyclic group". Further, "non-aromatic heterocyclic alkyloxy", the alkyl moiety is the above-mentioned "aromatic carbocyclic group", is replaced by "non-aromatic carbocyclic group" and / or "aromatic heterocyclic group" It encompasses Some "non-aromatic heterocyclic alkyloxy". For example, a group represented tetrahydropyranyl methyloxy, morpholinylethyl ethyloxy, piperidinylmethyl oxy, piperazinyl methyloxy, below

Figure JPOXMLDOC01-appb-C000053

Etc. The.

The term "aromatic carbocyclic alkyloxycarbonyl" refers to alkyloxycarbonyl optionally substituted with one or more of the above-mentioned "aromatic carbocyclic group". For example, benzyloxycarbonyl, phenethyloxycarbonyl carbonyl, phenylpropyl oxycarbonyl, benzhydryloxy carbonyl, trityl oxycarbonyl, naphthylmethyl oxycarbonyl, group shown below

Figure JPOXMLDOC01-appb-C000054

Etc. The.

The "non-aromatic carbocyclic alkyloxycarbonyl" refers to alkyloxycarbonyl optionally substituted with one or more of the "non-aromatic carbocyclic group". Further, "non-aromatic carbocyclic alkyloxycarbonyl" also includes "non-aromatic carbocyclic alkyloxycarbonyl" as the alkyl moiety is substituted by the above "aromatic carbocyclic group". For example, cyclopropylmethyl oxycarbonyl, cyclobutylmethyl butyloxycarbonyl, cyclopentylmethyl butyloxycarbonyl, cyclohexyl methyl oxycarbonyl cyclohexane, groups shown below

Figure JPOXMLDOC01-appb-C000055

Etc. The.

The "aromatic heterocyclic alkyloxycarbonyl" refers to alkyloxycarbonyl optionally substituted with one or more of the above "aromatic heterocyclic group". Further, "aromatic heterocycle-alkyloxy carbonyl", "aromatic heterocyclic alkyloxycarbonyl wherein the alkyl moiety is substituted by the above" aromatic carbocyclic group "and / or" non-aromatic carbocyclic group " "also encompasses. For example, pyridylmethyloxy carbonyl, furanyl methyloxy carbonyl, imidazolylmethyl oxycarbonyl, indolylmethyl oxycarbonyl, benzothiophenyl methyloxy carbonyl, oxazolylmethyl butyloxycarbonyl, isoxazolylmethyl butyloxycarbonyl, thiazolylmethyl oxycarbonyl, benzisothiazolyl methyloxy carbonyl, pyrazolyl methyloxy carbonyl, iso-pyrazolyl methyloxy carbonyl, pyrrolidinylmethyl butyloxycarbonyl, benzoxazolyl methyloxy carbonyl, groups shown below

Figure JPOXMLDOC01-appb-C000056

Etc. The.

The "non-aromatic heterocyclic alkyloxycarbonyl" refers to alkyloxycarbonyl optionally substituted with one or more of the "non-aromatic heterocyclic group". Further, "non-aromatic heterocycle-alkyloxy carbonyl", the alkyl moiety is substituted by the above "aromatic carbocyclic group", "non-aromatic carbocyclic group" and / or "aromatic heterocyclic group" and are "non-aromatic heterocyclic alkyloxycarbonyl" also encompasses. For example, a group represented tetrahydropyranyl methyloxy, morpholinylethyl ethyloxy, piperidinylmethyl oxy, piperazinyl methyloxy, below

Figure JPOXMLDOC01-appb-C000057

Etc. The.

The term "aromatic carbocyclic alkyloxyalkyl" means alkyloxy alkyl substituted with one or more of the above "aromatic carbocyclic group". For example, benzyloxymethyl, phenethyl oxy methyl, phenylpropyl oxymethyl, benzhydryloxy methyl, trityloxymethyl, naphthylmethyl oxymethyl, group shown below

Figure JPOXMLDOC01-appb-C000058

Etc. The.

The "non-aromatic carbocyclic alkyloxyalkyl" means alkyloxy alkyl substituted with one or more of the above "non-aromatic carbocyclic group". Further, "non-aromatic carbocyclic alkyloxy" means an alkyl moiety nonaromatic carbocyclic ring is attached is substituted with the above "aromatic carbocyclic group", "non-aromatic carbocyclic alkyloxyalkyl "also encompasses. For example, a group represented cyclopropylmethyl oxymethyl, cyclobutylmethyl oxymethyl, cyclopentylmethyl oxymethyl, cyclohexyl methyl oxymethyl cyclohexane, below

Figure JPOXMLDOC01-appb-C000059

Etc. The.

The "aromatic heterocyclic alkyloxyalkyl" means alkyloxy alkyl substituted with one or more of the above "aromatic heterocyclic group". Further, "aromatic heterocycle-alkyloxy" means an alkyl moiety in which an aromatic heterocycle is attached is substituted by the above "aromatic carbocyclic group" and / or "non-aromatic carbocyclic group" It encompasses Some "aromatic heterocyclic alkyloxyalkyl". For example, pyridylmethyloxy methyl, tetrahydropyranyl methyloxymethyl, imidazolylmethyl oxymethyl, indolylmethyl oxymethyl, benzothiophenyl methyloxymethyl, oxazolylmethyl oxymethyl, isoxazolylmethyl oxymethyl, thiazolylmethyl oxymethyl, benzisothiazolyl methyloxymethyl, pyrazolyl methyloxymethyl, iso-pyrazolyl methyl oxymethyl, pyrrolidinylmethyl oxymethyl, benzoxazolyl methyloxymethyl, groups shown below

Figure JPOXMLDOC01-appb-C000060

Etc. The.

The "non-aromatic heterocyclic alkyloxyalkyl" means alkyloxy alkyl substituted with one or more of the above "non-aromatic heterocyclic group". Further, "non-aromatic heterocyclic alkyloxy" alkyl moiety nonaromatic heterocycle is attached has the "aromatic carbocyclic group", "non-aromatic carbocyclic group" and / or "aromatic family encompasses are "non-aromatic heterocycle-alkyloxy alkyl" is also substituted by a heterocyclic group ". For example, a group represented tetrahydropyranyl methyloxymethyl, morpholinylmethyl ethyloxymethyl, piperidinylmethyl oxymethyl, piperazinylmethyl oxymethyl, below

Figure JPOXMLDOC01-appb-C000061

Etc. The.

The term "aromatic carbocyclic alkylamino" refers to the "aromatic carbocyclic alkyl" is one hydrogen atom bonded to the nitrogen atom of the amino group or two and replaced groups. For example, benzylamino, phenethylamino, phenylpropylamino, benzhydrylamino, tritylamino, naphthyl methylamino, dibenzylamino, and the like.

The "non-aromatic carbocyclic alkylamino" refers to the "non-aromatic carbocyclic alkyl" is one hydrogen atom bonded to the nitrogen atom of the amino group or two and replaced groups. For example, cyclopropylmethylamino, cyclobutylmethyl amino, cyclopentylmethyl amino, cyclohexyl methylamino etc. cyclohexylene.

The "aromatic heterocyclic alkylamino" refers to the "aromatic heterocyclic alkyl" is one hydrogen atom bonded to the nitrogen atom of the amino group or two and replaced groups. For example, pyridylmethylamino, furanyl methylamino, imidazolylmethyl amino, indolyl methylamino, benzothiophenyl methylamino, oxazolylmethyl amino, isoxazolylmethyl amino, thiazolyl methylamino, benzisothiazolyl methylamino , pyrazolyl methylamino, iso pyrazolyl methylamino, pyrrolidinylmethyl amino, benzoxazolyl methylamino, and the like.

The "non-aromatic heterocycle-alkyl amino" refers to the "non-aromatic heterocyclic alkyl" is one hydrogen atom bonded to the nitrogen atom of the amino group or two and replaced groups. For example, tetrahydropyranyl methylamino, morpholinylethyl ethylamino, piperidinylmethyl amino, piperazinyl methylamino, and the like.

"Aromatic carbocyclic oxy", "aromatic carbocyclic carbonyl", "aromatic carbocyclic oxycarbonyl", "aromatic carbocyclic sulfanyl", and "aromatic carbocyclic ring" portion of the "aromatic carbocyclic sulfonyl" also is the same as the above "aromatic carbocyclic group".
The term "aromatic carbocyclic oxy" means a group "aromatic carbocyclic ring" is bonded to an oxygen atom. For example, phenyloxy, naphthyloxy and the like.
The term "aromatic carbocyclic carbonyl" means a group "aromatic carbocycle" is bonded to a carbonyl group. For example, phenylcarbonyl, naphthylcarbonyl, and the like.
The term "aromatic carbocyclic oxycarbonyl" means a group in which the "aromatic carbocyclic oxy" is bonded to a carbonyl group. For example, phenyloxycarbonyl, naphthyloxycarbonyl, and the like.
The term "aromatic carbocyclic sulfanyl" refers to groups "aromatic carbocycle" is replaced with a hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, phenylsulfanyl, naphthylsulfanyl and the like.
The term "aromatic carbocyclic sulfonyl" means a group "aromatic carbocycle" is bonded to a sulfonyl group. For example, phenylsulfonyl, naphthylsulfonyl, and the like.

"Non-aromatic carbocyclic oxy", "non-aromatic carbocyclic carbonyl", "non-aromatic carbocyclic oxycarbonyl", "non-aromatic carbocyclic ring sulfanyl", and "non-aromatic" non-aromatic carbocyclic sulfonyl " family carbocyclic "portion is also the same as the" non-aromatic carbocyclic group ".
The "non-aromatic carbocyclic oxy" means a group "nonaromatic carbocyclic ring" is bonded to an oxygen atom. For example, cyclopropyloxy, cyclohexyloxy, Kiseniruokishi etc. cyclohexylene.
The "non-aromatic carbocyclic carbonyl" means a group "nonaromatic carbocyclic ring" is bonded to a carbonyl group. For example, cyclopropylcarbonyl, cyclohexylcarbonyl, hexenyl ylcarbonyl etc. cyclohexylene.
The "non-aromatic carbocyclic oxycarbonyl" means a group in which the "non-aromatic carbocyclic oxy" is bonded to a carbonyl group. For example, cyclopropyl, cyclohexyloxycarbonyl, hexenyl hexyloxycarbonyl etc. cyclohexylene.
The "non-aromatic carbocyclic ring sulfanyl" refers to the group "non-aromatic carbocycle" is replaced with a hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, cyclopropyl sulfanyl, cyclohexylsulfanyl, cyclohexenyl sulfanyl like.
The "non-aromatic carbocyclic sulfonyl" means a group "nonaromatic carbocyclic ring" is bonded to a sulfonyl group. For example, cyclopropylsulfonyl, cyclohexylsulfonyl, cyclohexenyl sulfonyl, and the like.

"Aromatic heterocyclic oxy", "aromatic heterocyclic carbonyl", "aromatic heterocyclic oxycarbonyl", "aromatic heterocyclic sulfanyl", and "aromatic heterocyclic" moiety of the "aromatic heterocyclic sulfonyl" also is the same as the above "aromatic heterocyclic group".
The "aromatic heterocyclic oxy" means a group "aromatic heterocycle" is bonded to an oxygen atom. For example, pyridyloxy, benzoxazolyl-oxy and the like.
The "aromatic heterocyclic carbonyl" means a group "aromatic heterocycle" is bonded to a carbonyl group. For example, pyridylcarbonyl, etc. benzoxazolyl carbonyl and the like.
The "aromatic heterocyclic oxycarbonyl" means a group in which the "aromatic heterocyclic oxy" is bonded to a carbonyl group. For example, pyridyloxycarbonyl, etc. benzoxazolyl butyloxycarbonyl and the like.
The "aromatic heterocyclic sulfanyl" refers to groups "aromatic heterocyclic ring" is replaced with a hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, pyridyl sulfanyl, oxazolinyl Rusuru sulfanyl, and the like.
The "aromatic heterocyclic sulfonyl" means a group "aromatic heterocycle" is bonded to a sulfonyl group. For example, pyridylsulfonyl, etc. benzoxazolyl sulfonyl and the like.

"Non-aromatic heterocycle-oxy", "non-aromatic heterocyclic carbonyl", "non-aromatic heterocyclic oxycarbonyl", "non-aromatic heterocyclic sulfanyl", and "non-aromatic heterocyclic sulfonyl", "non-aromatic family heterocycle "moiety is also the same as the" non-aromatic heterocyclic group ".
The "non-aromatic heterocycle-oxy" means a group "non-aromatic heterocycle" is bonded to an oxygen atom. For example, piperidinyloxy, tetrahydrofuryl oxy and the like.
The "non-aromatic heterocyclic-carbonyl" means a group "non-aromatic heterocycle" is bonded to a carbonyl group. For example, piperidinylcarbonyl, tetrahydrofuryl carbonyl, and the like.
The "non-aromatic heterocyclic oxycarbonyl" means a group in which the "non-aromatic heterocycle-oxy" is bonded to a carbonyl group. For example, piperidinyloxy carbonyl, tetrahydrofuryl butyloxycarbonyl, and the like.
The "non-aromatic heterocyclic sulfanyl" refers to groups "non-aromatic heterocycle" is replaced with a hydrogen atom bonded to a sulfur atom of sulfanyl group. For example, piperidinylmethyl Nils Alpha sulfonyl, tetrahydrofuryl sulfanyl, and the like.
The "non-aromatic heterocyclic sulfonyl" means a group "non-aromatic heterocycle" is bonded to a sulfonyl group. For example, piperidinylsulfonyl, tetrahydrofuryl sulfonyl, and the like.

"Substituted or unsubstituted alkyl", "substituted or unsubstituted alkenyl", "substituted or unsubstituted alkynyl", "substituted or unsubstituted alkylene", "substituted or unsubstituted methylene," "substituted or unsubstituted alkyloxy ", the" substituted or unsubstituted alkenyloxy "," substituted or unsubstituted alkynyloxy "," substituted or unsubstituted alkylcarbonyl "," substituted or unsubstituted alkenylcarbonyl "," substituted or unsubstituted of alkynylcarbonyl "," substituted or unsubstituted monoalkylamino "," substituted or unsubstituted dialkylamino "," substituted or unsubstituted alkylsulfonyl "," substituted or unsubstituted alkenylsulfonyl "," substituted or unsubstituted alkynylsulfonyl of substitution "," substituted young properly Unsubstituted, mono- alkylcarbonylamino "," substituted or unsubstituted dialkylamino carbonyl amino "," substituted or unsubstituted mono alkylsulfonylamino "," substituted or unsubstituted dialkylamino sulfonylamino "," substituted or unsubstituted alkyl imino "," substituted or unsubstituted alkenylimino "," substituted or unsubstituted alkynylimino "," substituted or unsubstituted alkylcarbonyl imino "," substituted or unsubstituted alkenylcarbonyl imino "," substituted or unsubstituted alkynyl carbonylimino "," substituted or unsubstituted alkyl oximino "," substituted or unsubstituted alkenyloxy imino "," substituted or unsubstituted alkynyloxy imino "," substituted or unsubstituted alkylcarbonyloxy , "Substituted or unsubstituted alkenylcarbonyloxy", "substituted or unsubstituted alkynyl carbonyloxy", "substituted or unsubstituted alkyloxycarbonyl of", "substituted or unsubstituted alkenyloxycarbonyl", "substituted or unsubstituted alkynyloxy carbonyl "," substituted or unsubstituted alkylsulfanyl "," substituted or unsubstituted alkenyl Alpha alkenyl "," substituted or unsubstituted alkylene Nils Alpha alkenyl "," substituted or unsubstituted alkylsulfinyl "," substituted or unsubstituted alkenylsulfinyl substituent "," substituted or unsubstituted alkynylsulfinyl "," substituted or unsubstituted mono-alkylcarbamoyl "," substituted or unsubstituted dialkylcarbamoyl "," substituted or unsubstituted mode The Roh alkylsulfamoyl "and" substituted or unsubstituted substituent dialkylsulfamoyl "includes the following substituents. Carbon atoms at any position may be bonded with one or more groups selected from the following substituents.
Substituents: halogen, hydroxy, carboxy, amino, imino, hydroxyamino, hydroxyimino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso , azido, hydrazino, ureido, amidino, guanidino, trialkylsilyl, alkyloxy, alkenyloxy, alkynyloxy, haloalkoxy, alkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, monoalkylamino, dialkylamino, alkylsulfonyl, alkenylsulfonyl, alkynyl sulfonyl, mono-alkyl-carbonyl, dialkylamino-carbonyl amino, mono alkylsulfonyl Mino, dialkyl sulfonylamino, alkylimino, alkenylimino, alkynylimino, alkylcarbonyl imino, alkenylcarbonyl imino, alkynylcarbonyl imino, alkyl-oximino, alkenyloxy imino, alkynyloxy imino, alkylcarbonyloxy, alkenylcarbonyloxy, alkynyl carbonyloxy , alkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, alkylsulfanyl, alkenyl Alpha alkenyl, alkynyl Nils Alpha alkenyl, alkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, monoalkylcarbamoyl, dialkylcarbamoyl, mono alkylsulfamoyl, dialkylsulfamoyl, aromatic family carbocyclic group, Aromatic carbocyclic group, aromatic heterocyclic group, non-aromatic heterocyclic group, aromatic carbon ring-oxy, non-aromatic carbocyclic oxy, aromatic heterocyclic oxy, non-aromatic heterocycle-oxy, aromatic carbocyclic carbonyl, non-aromatic carbocyclic carbonyl, aromatic heterocyclic carbonyl, non-aromatic heterocyclic carbonyl, aromatic carbocyclic oxycarbonyl, nonaromatic carbocyclic oxycarbonyl, aromatic heterocyclic oxycarbonyl, non-aromatic heterocyclic ring oxycarbonyl, aromatic carbocyclic alkyloxy, non-aromatic carbocyclic alkyloxy, aromatic heterocyclic alkyloxy, non-aromatic heterocycle-alkyloxy, aromatic carbocyclic alkyloxycarbonyl, non-aromatic carbocyclic alkyloxycarbonyl , aromatic heterocyclic alkyloxycarbonyl, non-aromatic heterocyclic alkyloxycarbonyl, aromatic carbocyclic alkylamino, non Aromatic carbocyclic alkylamino, aromatic heterocyclic alkylamino, non-aromatic heterocyclic alkylamino, aromatic carbocyclic sulfanyl, non-aromatic carbocyclic sulfanyl, aromatic heterocyclic sulfanyl, non-aromatic heterocyclic sulfanyl, nonaromatic family carbocyclic sulfonyl, aromatic carbocyclic sulfonyl, aromatic heterocyclic sulfonyl, and non-aromatic heterocyclic sulfonyl.

"Substituted or unsubstituted aromatic carbocyclic group", "substituted or unsubstituted non-aromatic carbocyclic group", "substituted or unsubstituted aromatic heterocyclic group", and "substituted or unsubstituted non-aromatic heterocyclic group ",
"Substituted or unsubstituted aromatic carbocyclic oxy", "substituted or unsubstituted non-aromatic carbocyclic oxy", "substituted or unsubstituted aromatic heterocyclic oxy", and "substituted or unsubstituted non-aromatic heterocyclic oxy ",
"Substituted or unsubstituted aromatic carbocyclic carbonyl", "substituted or unsubstituted non-aromatic carbocyclic carbonyl", "substituted or unsubstituted aromatic heterocyclic-carbonyl", and "substituted or unsubstituted non-aromatic heterocyclic carbonyl ",
"Substituted or unsubstituted aromatic carbocyclic oxycarbonyl", "substituted or unsubstituted non-aromatic carbocyclic oxycarbonyl", "substituted or unsubstituted aromatic heterocyclic oxycarbonyl", and "substituted or unsubstituted non-aromatic heterocyclic oxycarbonyl ",
"Substituted or unsubstituted aromatic carbocyclic sulfanyl", "substituted or unsubstituted non-aromatic carbocyclic ring sulfanyl", "substituted or unsubstituted aromatic heterocyclic sulfanyl", and "substituted or unsubstituted non-aromatic heterocyclic sulfanyl ", and" substituted or unsubstituted aromatic carbocyclic sulfonyl "," non-aromatic carbocyclic sulfonyl substituted or unsubstituted "," substituted or unsubstituted aromatic heterocyclic sulfonyl ", and" substituted or unsubstituted "aromatic carbocyclic non-aromatic heterocyclic sulfonyl", "" non-aromatic carbon ring ", a substituent on the ring of the" aromatic heterocycle "and" non-aromatic heterocycle "and" substituted or the ring substituent on the unsubstituted nitrogen-containing ring "include the following substituents. Atom at any position on the ring may be bonded with one or more groups selected from the following substituents.
Substituents: halogen, hydroxy, carboxy, amino, imino, hydroxyamino, hydroxyimino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso , azido, hydrazino, ureido, amidino, guanidino, trialkylsilyl, alkyl, alkenyl, alkynyl, haloalkyl, alkyloxy, alkenyloxy, alkynyloxy, haloalkoxy, alkyloxyalkyl, alkyloxyalkyloxy, alkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, monoalkylamino, dialkylamino, alkylsulfonyl, alkenyl sulfonyl, Ruki sulfonyl sulfonyl, mono- alkylcarbonylamino, dialkylamino carbonyl amino, mono alkylsulfonylamino, dialkylamino sulfonylamino, alkylimino, alkenylimino, alkynylimino, alkylcarbonyl imino, alkenylcarbonyl imino, alkynylcarbonyl imino, alkyl-oximino, alkenyloxy imino , alkynyloxy imino, alkylcarbonyloxy, alkenylcarbonyloxy, alkynyl alkylcarbonyloxy, alkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, alkylsulfanyl, alkenyl Alpha alkenyl, alkynyl Nils Alpha alkenyl, alkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, monoalkyl carba mode Le, dialkylcarbamoyl, mono alkylsulfamoyl, dialkylsulfamoyl, aromatic carbocyclic group, a non-aromatic carbocyclic group, aromatic heterocyclic group, non-aromatic heterocyclic group, aromatic carbon ring oxy, aromatic carbocyclic oxy, aromatic heterocyclic oxy, non-aromatic heterocycle-oxy, aromatic carbocyclic carbonyl, non-aromatic carbocyclic carbonyl, aromatic heterocyclic carbonyl, non-aromatic heterocyclic carbonyl, aromatic carbocyclic oxycarbonyl, nonaromatic carbocyclic oxycarbonyl, aromatic heterocyclic oxycarbonyl, non-aromatic heterocyclic oxycarbonyl, aromatic carbocyclic alkyl, non-aromatic carbocyclic alkyl, an aromatic heterocyclic alkyl, non-aromatic heterocyclicalkyl, aromatic carbocyclic alkyloxy, non-aromatic carbocyclic alkyloxy, aromatic heterocyclic alkyloxy, non-aromatic heterocyclic alkyl Oxy, aromatic carbocyclic alkyloxycarbonyl, non-aromatic carbocyclic alkyloxycarbonyl, aromatic heterocyclic alkyloxycarbonyl, non-aromatic heterocyclic alkyloxycarbonyl, aromatic carbocyclic alkyloxyalkyl, non-aromatic carbocyclic alkyl oxyalkyl, aromatic heterocyclic alkyloxyalkyl, non-aromatic heterocyclic alkyloxyalkyl, aromatic carbocyclic alkylamino, nonaromatic carbocyclic alkylamino, aromatic heterocyclic alkylamino, non-aromatic heterocyclic alkylamino, aromatic carbocyclic sulfanyl, non-aromatic carbocyclic sulfanyl, aromatic heterocyclic sulfanyl, non-aromatic heterocyclic sulfanyl, non-aromatic carbocyclic sulfonyl, aromatic carbocyclic sulfonyl, aromatic heterocyclic sulfonyl, and non-aromatic heterocyclic ring sulfonyl.

Further, "substituted or unsubstituted non-aromatic carbocyclic group" and "substituted or unsubstituted non-aromatic heterocyclic group" may be substituted by "oxo". In this case, the two hydrogen atoms on a carbon atom as follows is meant a group which is substituted.

Figure JPOXMLDOC01-appb-C000062

Above, "a substituted or unsubstituted non-aromatic carbocyclic oxy", "substituted or unsubstituted non-aromatic heterocyclic oxy", "non-aromatic carbocyclic ring carbonyl substituted or unsubstituted", "substituted or unsubstituted non-aromatic heterocyclic carbonyl "," substituted or unsubstituted non-aromatic carbocyclic oxycarbonyl "," non-aromatic heterocyclic oxycarbonyl substituted or unsubstituted "," substituted or unsubstituted non-aromatic carbocyclic sulfanyl "," substituted or unsubstituted non-aromatic heterocyclic sulfanyl "," non-aromatic carbocyclic sulfonyl substituted or unsubstituted "and nonaromatic carbocyclic ring" non-aromatic heterocyclic sulfonyl substituted or unsubstituted " , and non-aromatic heterocyclic moiety may be substituted by the same manner as described above "oxo".

The present invention also encompasses a pharmaceutical composition containing "duplex oligonucleotide" in the present invention. Administration and formulation of the pharmaceutical composition of the present invention, any known method of administration and formulations in the art, all of which are available. Administration and formulation of the antisense oligonucleotide can be, for example, is also disclosed in the following documents.
WO 2004/016749, WO 2005/083124, WO 2007/143315, WO 2009/071680, WO 2013/089283, and the like.

The pharmaceutical compositions of the present invention, whether which of the local or systemic treatment is desired, or in accordance with the area to be treated, can be administered by a variety of methods. Methods of administration include, for example, (including eye drops, vaginal, rectal, intranasal, transdermal) topically, orally, or may be parenterally. Parenteral administration, intravenous injection or infusion, subcutaneous, intraperitoneal or intramuscular injection, suction or pulmonary administration by inhalation, intrathecal administration include intraventricular administration and the like. Preferably, an intravenous injection or subcutaneous administration.

When topically administering a pharmaceutical composition of the present invention, transdermal patches, ointments, lotions, creams, gels, dropwise, suppositories, sprays, it is possible to use solutions, preparation of powders, and the like.
The composition for oral administration, powders, granules, aqueous or non-suspension was dissolved in an aqueous medium or solution, capsules, powders, tablets and the like.
Parenteral, subdural space, or, as the intraventricular administration compositions, buffered, sterile aqueous solutions and the like containing diluents and other suitable additives.

The pharmaceutical compositions of the present invention, excipients suitable for the dosage form to an effective amount of the antisense oligonucleotides of the present invention, binding agents, wetting agents, disintegrants, lubricants, additives for various medicaments such as diluent agent can be obtained by mixing as needed. It may be a formulation subjected to sterilization treatment with a suitable carrier in the case of injections.

Examples of the excipient lactose, saccharose, glucose, starch, calcium carbonate or crystalline cellulose and the like. As the binder methylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gelatin or polyvinylpyrrolidone, and the like. Carboxymethylcellulose as a disintegrating agent, sodium carboxymethylcellulose, starch, sodium alginate, agar powder, or sodium lauryl sulfate. Lubricants Talc, magnesium or macrogol stearate. The suppository base may be used cocoa butter, macrogol or methyl cellulose. Moreover, solutions or emulsifiable, additive solubilizers that are normally used when preparing a suspension of the injection, suspending agents, emulsifiers, stabilizers, preservatives, isotonic agents and the like as appropriate it may be. Flavoring agents in the case of oral administration, may be added fragrances and the like.

Administered depend on the severity and reactivity of the condition being treated, the treatment course, several days to several months, or until a cure is achieved, or, lasting until diminution of disease state is achieved. Optimal dosing schedule is possible to calculate from the measurements of drug accumulation in the body. One skilled in the art, the optimal dose, dosing method, and may define a recurrence frequency. Optimal dose will vary depending on the relative potency of individual antisense oligonucleotides, generally, it can be calculated based on the IC50 or EC50 in vitro and in vivo animal experiments. For example, the molecular weight of the antisense oligonucleotide (derived from the antisense oligonucleotide sequence and chemical structure), for example, if an effective dose such as IC50 (derived experimentally) is given, in mg / kg doses expressed is calculated according to customary.

Incidentally, abbreviations used herein are as defined below.
Ac: Acetyl Bn: benzyl Bz: benzoyl DABCO: 1,4-diazabicyclo [2.2.2] octane DMTr: dimethoxytrityl DMF: N, N'-dimethylformamide EDC: 1-ethyl-3- (3-dimethylamino propyl) carbodiimide Fmoc: 9--fluorenylmethyloxycarbonyl HBTU: O-benzotriazol -N, N, N ', N'- tetramethyl - uronium - hexafluoro - phosphate Me: methyl Ph: phenyl TBS: tert-butyl dimethylsilyl TFA: trifluoroacetic acid TMSOTf: trimethylsilyl trifluoromethanesulfonate

Examples and Reference Examples of the present invention below, and by way of test examples further illustrate the invention, but the invention is not limited to these.

NMR analysis obtained in Example was carried out at 300MHz, was measured using DMSO-d6 or CDCl 3.

UPLC analysis was using the following conditions.
Mobile phase: [A] 0.1% formic acid-containing aqueous solution [B] 0.1% formic acid-containing acetonitrile solution Gradient: After linear gradient of 5% -100% solvent [B] in 3.5 minutes, 0.5 minutes, and maintained at 100% solvent [B].
Column: ACQUITY UPLC (registered trademark) BEH C18 (1.7μm, i.d.2.1x50mm) (Waters)
Flow rate: 0.8 mL / min PDA detection wavelength: 254 nm (detection range 210-500 nm)

Synthesis of compounds containing a sugar derivative having an interaction with Example 1 asialoglycoprotein receptor

1) Synthesis of Compound 1

Figure JPOXMLDOC01-appb-C000063

Compound 101 Step 1 Compound 102 (15.0g, 88.0mmol) in N, N'sodium hydride at room temperature in dimethylformamide solution (100mL) (60% w / w, 5.26g, 1.5eq. ) was added and after stirring for 30 min, benzyl bromide (10.42 g, 88.0 mmol) and the mixture was stirred at room temperature for 5.5 hours. After addition of methanol (5ml) to the reaction solution, saturated brine was added, extracted with ethyl acetate, washed with saturated brine, then dried over magnesium sulfate. The solvent was distilled off under reduced pressure, the resulting residue was purified by silica gel column chromatography (SiO 2: 330 g, n-hexane: ethyl acetate = 90: 10 → 75: 25 ) to give compound 102 (11.0 g, yield to obtain the rate 42%) as an oil.
ESI-MS (m / z): 293.10 (M + 1).

Step 2 N synthetic compounds 102 compounds 103 (5.00g, 17.1mol), N'- dimethylformamide (40 mL) to room temperature pyridinium dichromate (19.3 g, 51.3 mmol) was added, at room temperature after stirring for 5.5 hours, ethyl acetate (200 mL) was added and the reaction mixture was filtered through celite. After addition of saturated brine to the filtrate, extracted with ethyl acetate, washed with saturated brine, then dried over magnesium sulfate. The solvent was distilled off under reduced pressure, the resulting residue was purified by silica gel column chromatography (SiO 2: 120 g, n-hexane: ethyl acetate = 90: 10 → 50: 50 ) to give compound 103 (3.32 g, yield to obtain the rate 63%).
1 H-NMR (CDCl 3) δ: 7.36 -7.32 (m, 4H), 7.28 (dd, J = 8.4, 4.0 Hz, 1H), 7.20 (m, 1H), 4.51 (s, 2H, -OCH 2 Ph ), 3.46 (t, J = 6.7 Hz, 2H), 2.34 (t, J = 7.5 Hz, 2H), 1.68-1.56 (m, 4H), 1.40-1.23 (m, 14H).

Figure JPOXMLDOC01-appb-C000064

By the method described in Step 3 Compound 104 and Compound 105 Example 3 Synthesis WO 2012/037254, the compound 104 was synthesized, was synthesized followed by compound 105.

Step 4 N synthetic compounds 103 compounds 106 (218mg, 17.1mmol), N'- dimethylformamide (3 mL) to N at room temperature, N'- diisopropylethylamine (405μl, 2.32mmol), HBTU (324mg, 0 .855Mmol) was added and after stirring 10 minutes at room temperature, N compound 105 (218mg, 17.1mmol), N'- dimethylformamide (3 mL), N, N'-diisopropylethylamine (75 [mu] l, 0.428 mmol) the mixture was stirred at room temperature for 12 hours. The reaction solution was diluted with chloroform, 10% aqueous solution of sodium hydrogen carbonate, washed successively, then dried over magnesium sulfate and saturated brine. The solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24 g, chloroform: methanol = 90: 10 → 80: 20 ) to afford the compound 106 (430 mg, 58% yield).
1 H-NMR (CDCl 3) δ: 7.38-7.31 (m, 4H), 7.23 (m, 1H), 7.00-6.90 (m, 3H, -NH), 6.69-6.60 (m, 2H, -NH), 6.46 (br.s, 1H, -NH), 5.35 (d, J = 2.9 Hz, 3H, H-4 of GalNAc), 5.24-5.14 (m, 3H, H-3 of GalNAc), 4.61 (d, J = 8.4 Hz, 3H, H- 1 of GalNAc), 4.50 (s, 2H, -CH 2 Ph), 4.22-4.00 (m, 9H), 3.99-3.88 (m, 6H), 3.79-3.60 (m, 12H ), 3.56-3.43 (m, 3H), 3.47 (t, J = 6.7 Hz, 2H), 3.39-3.20 (m, 12H), 2.47-2.40 (m, 6H), 2.32-2.16 (m, 6H), 2.15 (s, 9H), 2.05 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.85-1.50 (18H, m), 1.32-1.23 (12H, m).

Pd-C (10%, 50mg) at room temperature in methanol (3 mL) of compound 106 in Step 5 Compound 107 (90 mg, 0.043 mmol) was added, under hydrogen atmosphere and stirred at room temperature for 12 hours. After the catalyst was filtered off from the reaction mixture, as a colorless powder of compound 107 (79 mg, 92% yield) by concentrating the filtrate.
ESI-MS (m / z): 1992.10 (M-1).

Compound 107 Step 6 Compound 1 (722 mg, 0.362 mmol) at 0 ℃ in methylene chloride (7 mL), N, N'-diisopropylethylamine (253μl, 1.45mmol), 3- (chloro (diisopropylamino) Hosufinokishi) propanenitrile (0.162 mL, 0.725 mmol) and the mixture was stirred for 2 hours at room temperature. The reaction was diluted with methylene chloride, 10% aqueous sodium bicarbonate solution, washed with saturated brine, then dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24 g, chloroform: methanol: triethylamine = 95: 5: 1 → 90 : 10: 1) to give the compound 1 (551 mg, 57% yield) as a colorless powder It was obtained as a.
1 H-NMR (CDCl 3) δ: 7.25-7.15 (m, 5H, -NH), 7.05-6.90 (m, 2H, -NH), 6.70-6.61 (m, 2H, -NH), 6.45 (s, 1H, -NH), 5.35 (br.s, 3H, H-4 of GalNAc), 5.20 (m, 3H, H-3 of GalNAc), 4.61 (d, J = 8.3 Hz, 3H, H-1 of GalNAc ), 4.22-4.01 (m, 9H), 3.98-3.89 (m, 6H), 3.83 (dd, J = 14.0, 6.9 Hz, 3H, H-6 of GalNAc), 3.72-3.62 (m, 12H), 3.59 (dd, J = 14.0, 8.0 Hz, 3H, H-6 of GalNAc), 3.56-3.47 (m, 3H), 3.36-3.10 (m, 12H), 2.65 (t, J = 7.2 Hz, 2H, -OCH 2 CH 2 CN), 2.47-2.40 ( m, 6H), 2.32-2.18 (m, 6H), 2.15 (s, 9H), 2.05 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H ), 1.80-1.52 (12H, m) , 1.37-1.20 (24H, m), 1.19 (d, J = 6.5 Hz, -CH (CH 3) 2), 1.18 (d, J = 6.5 Hz, -CH ( CH 3) 2).

2) Synthesis of Compound 2

Figure JPOXMLDOC01-appb-C000065

Compound 105 (1.20 g, 0.629 mmol) in solution in methylene (12 mL) of triethylamine at room temperature chloride (0.218 ml, 1.57 mmol), succinic anhydride (76 mg, 0.755 mmol) was added, stirred for 12 hours at room temperature did. The reaction solution was concentrated, the resulting residue was purified by silica gel column chromatography (SiO 2: 40 g, chloroform: methanol = 75: 25 → chloroform: methanol: water = 6: 4: 1) to give compound 2 (612 mg to give a 51% yield) as a colorless powder.
1 H-NMR (CDCl 3) δ: 5.35 (br.s, 3H, H-4 of GalNAc), 5.19 (m, 3H, H-3 of GalNAc), 4.61 (d, J = 8.2 Hz, 3H, H -1 of GalNAc), 4.22-4.01 (m, 9H), 3.97-3.89 (m, 6H), 3.79-3.57 (m, 12H), 3.57-3.45 (m, 3H), 3.37-3.17 (m, 12H) , 2.66-2.57 (m, 2H), 2.52-2.37 (m, 6H), 2.31-2.18 (m, 2H), 2.15 (s, 9H), 2.05 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.72-1.52 (18H, m).

3) Synthesis of Compound 3

Figure JPOXMLDOC01-appb-C000066

It was synthesized by the method described in Example 2 of WO 2012/037254.

4) Synthesis of Compound 4

Figure JPOXMLDOC01-appb-C000067

Synthetic Bioorganic Medicinal Chemistry Letters step 1 Compound 109, according to the method described in 11,383-386 (2001), was synthesized in two steps from compound 108.

Compound 109 Step 2 Compound 110 (11.84g, 19.2mmol) in N, N'-dimethylformamide solution (50 mL) to the imidazole at room temperature (1.57g, 23.1mmol, 1.2eq.), 3 butyldimethylsilyl chloride (1.59 g, 21.2 mmol, 1.1 eq.), and the mixture was stirred at room temperature for 2 hours. The reaction solution was diluted with ethyl acetate, 10% aqueous solution of sodium hydrogen carbonate, washed successively, then dried over magnesium sulfate and saturated brine, the solvent was distilled off under reduced pressure to give compound 110 (14.35 g, crude).

N of compound 110 in Step 3 Compound 111 (14.35 g, crude), N'-dimethylformamide solution (50 mL) of piperidine was added and stirred at room temperature for 5.5 hours, concentrated under a reduced pressure reaction gave a crude product of compound 111 (14.46 g).

Synthesis step 4 Compound 112 12-methoxy-12-oxo-over dodecanoic acid (1.81 g, 7.40 mmol) N, and at room temperature N'- dimethylformamide (10 ml), N, N'- diisopropylethylamine (4 .31ml, 24.7mmol), HBTU (3.27g, 8.63mmol) was added and after stirring 10 minutes at room temperature, N compound 111 (4.83 g, 6.16 mmol), N'-dimethylformamide solution ( 8ml) and the mixture was stirred at room temperature for 12 hours. The reaction solution was diluted with ethyl acetate, 10% aqueous solution of sodium hydrogen carbonate, washed with brine, then dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 320 g, n-hexane: ethyl acetate: triethylamine = 60: 40: 1 → 40 : 60: 1) to give the compound 112 (2.94 g, from compound 109 the 65% yield) as a colorless foam.

Step 5 Compound 113 Compound 112 (2.70 g, 3.68 mmol) in methanol (20ml) of - tetrahydrofuran (8 ml) aqueous sodium hydroxide 2 mol / L at room temperature (. 3.68ml, 2eq) was added, at room temperature in the mixture was stirred for 2 hours. After neutralizing by addition of hydrochloric acid of 2 mol / L in the reaction solution at -78 ° C., diluted with ethyl acetate, washed with saturated brine, then dried over magnesium sulfate, the solvent was evaporated in vacuo to give, compound 113 was obtained (2.23 g, 88% yield).
1 H-NMR (CDCl 3) δ: 7.39 (d, J = 7.8 Hz, 2H), 7.28 (d, J = 8.5 Hz, 4H), 7.25-7.21 (m, 2H), 7.18 (d, J = 7.3 Hz, 1H), 6.79 (d, J = 8.5 Hz, 4H), 5.66 (d, J = 8.2 Hz, 1H, -NH), 4.11 (m, 1H), 3.79 (dd, J = 9.7, 3.4 Hz, 1H), 3.75 (s, 6H), 3.66 (dd, J = 9.7, 6.0 Hz, 1H), 3.31 (dd, J = 8.7, 4.5 Hz, 1H), 3.04 (dd, J = 8.7, 6.1 Hz, 1H ), 2.23 (br.s, 2H), 2.06 (t, J = 7.5 Hz, 2H), 1.62-1.45 (m, 4H), 1.32-1.10 (m, 14H), 0.81 (s, 9H), -0.02 (s, 4H)

Compound 113 Step 6 Compound 114 (671mg, 17.1mmol) N of, N'- dimethylformamide (5 mL) in N at room temperature, N'- diisopropylethylamine (0.549ml, 3.14mmol), HBTU (358mg , 0.94 mmol) was added and after stirring 10 minutes at room temperature, N compound 105 (1.20 g, 0.629 mmol), N'-dimethylformamide solution (5 mL), N, N'-diisopropylethylamine (0. 132 ml, 0.755 mmol) and the mixture was stirred at room temperature for 12 hours. The reaction solution was diluted with ethyl acetate, 10% aqueous solution of sodium hydrogen carbonate, washed with brine, then dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 40 g, chloroform: methanol: triethylamine = 95: 5: 1 → 90 : 10: 1) to afford the compound 114 (685 mg, 44% yield) .
ESI-MS (m / z): 1271 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.41 (d, J = 8.0Hz, 2H), 7.29 (d, J = 8.7 Hz, 4H), 7.29-7.16 (m, 8H), 7.07-6.96 (m, 8H ), 6.82 (d, J = 8.7 Hz, 4H), 6.79-6.70 (m, 2H, -NH), 6.53 (m, 1H, -NH), 5.68 (d, J = 8.5 Hz, -NH), 5.35 (d, J = 3.0 Hz, 3H, H-4 of GalNAc), 5.24-5.16 (m, 3H, H-3 of GalNAc), 4.61 (d, J = 8.3 Hz, 3H, H-1 of GalNAc), 4.21-4.01 (m, 12H), 3.98-3.88 (m, 6H), 3.79 (s, 6H), 3.75-3.61 (m, 12H), 3.56-3.46 (m, 3H), 3.39-3.19 (m, 12H ), 3.07 (m, 1H), 2.98 (m, 1H), 2.45-2.39 (m, 6H), 2.35-2.16 (m, 6H), 2.17-2.06 (m, 4H), 2.15 (s, 9H), 2.04 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.80-1.51 (22H, m), 1.30-1.21 (12H, m), 0.82 (s, 9H), 0.02 (s, 3H), 0.00 (s, 3H).

Compound 114 Step 7 Compound 115 (563 mg, 0.226 mmol) at room temperature 1 mol / L tetrabutylammonium fluoride dough tetrahydrofuran solution in tetrahydrofuran (3 ml) of (0.510ml, 2.25eq.) Was added, 12 at room temperature after stirring time, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24 g, chloroform: methanol: triethylamine = 95: 5: 1 → 90 : 10: 1) to afford the compound 115 (485 mg, 90% yield) .
ESI-MS (m / z): 1214 (M / 2 + Na).

Compound 115 Step 8 Compound 4 (485mg, 0.204mmol) dimethylaminopyridine at room temperature to a dichloromethane solution (3 ml) of (50mg, 0.407mmol, 2.0eq.), Succinic anhydride (31 mg, 0.305 mmol, 1.5 eq.) was added and stirred at room temperature for 2 hours, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24 g, chloroform: methanol: triethylamine = 95: 5: 1 → 80 : 20: 1) to afford the compound 4 (435 mg, 86% yield) .
ESI-MS (m / z): 1263 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.40 (d, J = 7.7 Hz, 2H), 7.29 (d, J = 8.5 Hz, 4H), 7.21 (m, 1H), 7.02-7.02 (m, 3H, - NH), 6.83 (d, J = 8.5 Hz, 4H), 6.65 (m, 1H, -NH), 6.19 (d, J = 8.2 Hz, -NH), 5.35 (d, J = 3.0 Hz, 3H, H -4 of GalNAc), 5.19 (m, 3H, H-3 of GalNAc), 4.61 (d, J = 8.3 Hz, 3H, H-1 of GalNAc), 4.35 (m, 1H), 4.31-4.27 (m, 2H), 4.21-4.01 (m, 9H), 3.99-3.88 (m, 6H), 3.79 (s, 6H), 3.75-3.61 (m, 12H), 3.55-3.45 (m, 3H), 3.38-3.19 ( m, 12H), 3.21-3.12 (m, 2H), 2.88-2.80 (m, 2H), 2.54 (br.s, 2H), 2.46-2.40 (m, 6H), 2.32-2.18 (m, 3H), 2.18-2.08 (m, 6H), 2.15 (s, 9H), 2.04 (s, 9H), 1.99 (s, 9H), 1.95 (s, 9H), 1.80-1.50 (22H, m), 1.32-1.21 ( 12H, m).

5) Synthesis of Compound 5

Figure JPOXMLDOC01-appb-C000068

Compound 116 Step 1 Compound 117 (10.0g, 30.9mmol) in pyridine solution (40 ml) in at room temperature 4,4'-dimethoxytrityl chloride (11.0g, 32.5mmol, 1.05eq.) Was added and stirred for 2 hours at room temperature. The reaction solution was diluted with ethyl acetate, 10% aqueous solution of sodium hydrogen carbonate, washed successively, then dried over magnesium sulfate and saturated brine, the solvent was distilled off under reduced pressure to give compound 117 (22.95 g, crude).

Compound 117 (22.85 g, crude) of Step 2 compound 118 N of, N'- dimethylformamide (70 ml) piperidine (3.65 ml, 36.9 mmol) was added and stirred at room temperature for 2 hours, the reaction by concentration under reduced pressure the liquid to obtain a crude product of compound 118 (22.75 g).

By a similar manner to Step 4 of the synthesis of compound 4 Step 3 Compound 119 Method, a compound 119 was obtained as a colorless foam (69% yield from Compound 117). In 1 H-NMR 6: observed as 4 rotamers mixture.
1 H-NMR (CDCl 3) δ: (Major) 7.79-7.74 (m, 2H), 7.65-7.55 (m, 2H), 7.44-7.34 (m, 5H), 7.39-7.26 (m, 7H), 7.21 (m, 1H), 6.85-6.76 (m, 4H), 5.64 (d, J = 8.7 Hz, 1H. -NH), 4.58 (m, 1H), 4.38 (m, 1H), 4.38-4.26 (m, 2H), 4.18 (m, 1H), 3.79 (s, 6H), 3.68-3.58 (m, 2H), 3.58-3.44 (m, 2H), 2.81 (m, 1H), 2.01-1.70 (m, 4H) , 0.75 (s, 9H), -0.11 (s, 3H), -0.06 (s, 3H). (Minor) 7.79-7.74 (m, 2H), 7.65-7.55 (m, 2H), 7.44-7.34 (m , 5H), 7.39-7.26 (m, 7H), 7.10 (m, 1H), 6.85-6.76 (m, 4H), 5.58 (d, J = 7.9 Hz, 1H. -NH), 4.66 (m, 1H) , 3.70 (s, 6H), 3.25-3.13 (m, 2H), 2.01-1.70 (m, 4H), 0.87 (s, 9H), 0.04 (s, 3H), 0.03 (s, 3H).

In the same manner as in Synthesis Process 2 Step 4 Compound 120 to give Compound 120 as a crude product.

In the same manner as in Step 4 of the synthesis of compound 4 step 5 compound 121, compound 121 was obtained as a colorless foam (46% yield from Compound 119).
ESI-MS (m / z): 854 (M + Na), 830 (MH).

In the same manner as in Step 5 of the synthesis of compound 4 Step 6 Compound 122 was obtained to give the compound 122 as a colorless foam (90% yield).
ESI-MS (m / z): 816 (M - H).
1 H-NMR (CDCl 3) δ: 7.42-7.35 (m, 2H), 7.32-7.24 (m, 6H), 7.19 (m, 1H), 6.82 (d, J = 8.7 Hz, 2H), 6.81 (d , J = 8.7 Hz, 2H), 4.94 (m, 1H, -NH), 4.35 (m, 1H), 3.79 (s, 6H), 3.75 (dd, J = 8.4, 4.8 Hz, 0.5H), 3.70- 3.54 (m, 4H), 3.52 (dd, J = 8.4, 3.6 Hz, 0.5H), 3.25 (dd, J = 10.0, 5.6 Hz, 0.5H), 3.16 (dd, J = 10.0, 3.9 Hz, 0.5H ), 2.81 (m, 1H), 2.40-2.30 (m, 2H), 2.19 (t, J = 8.0 Hz, 2H), 2.03-1.80 (m, 4H), 1.70-1.47 (m, 4H), 1.42- 1.20 (m, 14H), 0.84 (s, 3H), 0.72 (s, 6H), -0.09 (s, 2H), -0.16 (s, 2H).

Figure JPOXMLDOC01-appb-C000069

In the same manner as in Step 6 of Compound 4 Step 7 Compound 123 was obtained to give the compound 123 as a colorless foam (61% yield).
ESI-MS (m / z): 1319 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.43-7.35 (m, 2H), 7.32-7.24 (m, 9H), 7.24-7.14 (m, 3H), 7.03-6.92 (m, 3H), 6.85-6.72 ( m, 4H), 6.67-6.77 (m, 2H), 5.35 (d, J = 2.8 Hz, 3H, H-4 of GalNAc), 5.22-5.15 (m, 3H, H-3 of GalNAc), 4.61 (d , J = 8.3 Hz, 3H, H-1 of GalNAc), 4.21-4.03 (m, 9H), 3.98-3.88 (m, 6H), 3.78 (s, 6H), 3.78-3.53 (m, 14H), 3.53 -3.47 (m, 3H), 3.38-3.18 (m, 14H), 2.46-2.40 (m, 6H), 2.32-2.16 (m, 6H), 2.18-2.12 (m, 4H), 2.15 (s, 9H) , 2.05 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.80-1.50 (20H, m), 1.33-1.21 (18H, m).

Compound 123 Step 8 Compound 124 (780 mg, 0.301 mmol) at room temperature 1 mol / L tetrabutylammonium fluoride dough tetrahydrofuran solution in tetrahydrofuran (5ml) of (0.451ml, 1.55eq.) Was added, 12 at room temperature after stirring time, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24 g, chloroform: methanol: triethylamine = 95: 5: 1 → 75 : 251) to afford the compound 124 (635 mg, 85% yield).
ESI-MS (m / z): 1262 (M / 2 + Na).

Compound of Step 9 Compound 5 124 (545mg, 0.220mmol) in dichloromethane (4 ml) to room temperature with triethylamine (0.061ml, 0.440mmol, 2.0eq.), Succinic anhydride (33 mg, 0.330 mmol, 1.5 eq.), dimethylaminopyridine (5 mg) were added and stirred for 2 hours at room temperature, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24 g, chloroform: methanol: triethylamine = 100: 0: 1 → 75 : 25: 1) to give the colorless compound 5 (471 mg, 83% yield) It was obtained as a powder.
ESI-MS (m / z): 1289 (M / 2-H).
1 H-NMR (CDCl 3) δ: 7.40-7.33 (m, 2H), 7.33-7.19 (m, 6H), 7.20 (m, 1H), 711-7.00 (m, 3H, -NH), 6.82 (d , J = 7.7 Hz, 4H), 6.67 (d, J = 7.8 Hz, 1H, -NH), 6.64 (br.s, 1H, -NH), 5.35 (d, J = 2.9 Hz, 3H, H-4 of GalNAc), 5.22-5.15 (m, 3H, H-3 of GalNAc), 5.12-5.01 (m, 2H), 4.61 (d, J = 8.3 Hz, 3H, H-1 of GalNAc), 4.31 (m, 1H), 4.28-4.00 (m, 9H), 3.98-3.88 (m, 6H), 3.79 (s, 6H), 3.73-3.50 (m, 12H), 3.58-3.47 (m, 3H), 3.49-3.21 ( m, 12H), 3.28-3.11 (m, 2H), 2.93-2.82 (m, 3H), 2.57-2.43 (m, 3H), 2.47-2.40 (m, 6H), 2.34-2.08 (m, 11H), 2.17 (s, 9H), 2.04 (s, 9H), 1.99 (s, 9H), 1.95 (s, 9H), 1.80-1.50 (24H, m), 1.34-1.22 (14H, m).

6) As shown in the following synthesis of compound 6 is synthesized by the same process as Compound 5.

Figure JPOXMLDOC01-appb-C000070

Figure JPOXMLDOC01-appb-C000071

7) Synthesis of Compound 7

Figure JPOXMLDOC01-appb-C000072

Step 1 Compound 111 Compound 133 (620 mg, crude) in dichloromethane (2.5 ml) to room temperature with triethylamine (0.169ml, 1.22mmol), succinic anhydride (89mg, 0.893mmol) was added, at room temperature after stirring for 2 hours, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 24g, n- hexane: ethyl acetate: triethylamine = 50: 50: 1 → chloroform: methanol: triethylamine = 95: 5: 1 → 75 : 25: 1) at purified gave compound 133 (453 mg, 79% yield from compound 109) as a colorless foam.
1 H-NMR (CDCl 3) δ: 7.43 (d, J = 7.9 Hz, 2H), 7.31 (d, J = 8.7 Hz, 4H), 7.27 (d, J = 7.1 Hz, 2H), 7.20 (dd, J = 7.9, 7.1 Hz, 1H), 6.82 (d, J = 8.7 Hz, 4H), 6.59 (m, 1H, -NH), 4.14 (m, 1H), 3.80 (m, 1H), 3.79 (s, 6H), 3.71 (m, 1H), 3.71 (dd, J = 9.5, 6.5 Hz, 1H), 3.71 (dd, J = 8.7, 4.5 Hz, 1H), 3.08 (dd, J = 8.7, 5.8 Hz, 1H ), 2.54 (t, J = 6.4 Hz, 2H), 2.46 (t, J = 6.4 Hz, 2H), 0.82 (s, 9H), 0.01 (s, 4H)

By a similar manner to Step 6 of the synthesis of compound 4 Step 2 Compound 134 Method to give compound 134 as a colorless foam (57% yield).
1 H-NMR (CDCl 3) δ: 7.40 (d,, J = 7.7 Hz, 2H), 7.28 (d,, J = 8.7 Hz, 4H), 7.26-7.24 (m, 2H), 7.20 (dd,, J = 7.7, 7.7 Hz, 1H), 7.02-6.89 (m, 3H, -NH), 6.84-6.74 (m, 3H, -NH), 6.82 (d, J = 8.7 Hz, 4H), 6.72 (br. s, 1H, -NH), 6.16 (m, 1H, -NH), 5.35 (d, J = 2.9 Hz, 3H, H-4 of GalNAc), 5.22-5.14 (m, 3H, H-3 of GalNAc) , 4.62 (d, J = 8.4 Hz, 3H, H-1 of GalNAc), 4.21-4.02 (m, 10H), 3.97-3.87 (m, 6H), 3.80 (m, 1H), 3.79 (s, 6H) , 3.69 (m, 1H), 3.65-3.58 (m, 12H), 3.55-3.47 (m, 3H), 3.35-3.19 (m, 12H), 3.18 (t,, J = 7.3 Hz, 2H), 2.49- 2.42 (m, 4H), 2.42-2.35 (m, 6H), 2.27-2.18 (m, 6H), 2.14 (s, 9H), 2.04 (s, 9H), 1.99 (s, 9H), 1.95 (s, 9H), 1.79-1.52 (12H, m), 0.82 (s, 9H), 0.01 (s, 2H), -0.01 (s, 2H).

By the same step as step 7 of Compound 4 Step 3 compound 135 to afford compound 135 as a colorless powder (60% yield).
ESI-MS (m / z): 1157 (M + Na).

In the same manner as in Step 8 of Compound 4 Step 4 compound 7 to give compound 7.

8) Synthesis of Compound 8

Figure JPOXMLDOC01-appb-C000073

By a similar manner to Step 1 of the synthesis of compound 7 Step 1 Compound 136 Method to give compound 136 as a colorless foam (85% yield). It was observed as a rotamer mixture 1, H-NMR 63:37.
ESI-MS (m / z): 703 (MH).
1 H-NMR (CDCl 3) δ: (Major) 7.44-7.35 (m, 2H), 7.32-7.24 (m, 6H), 7.19 (dd, J = 7.0, 7.0Hz, 1H), 7.13 (dd, J = 8.0 Hz, 1H, -NH), 6.86-6.76 (m, 4H), 4.83 (m, 1H), 4.36 (m, 1H), 3.78 (s, 6H), 3.72-3.41 (m, 6H), 2.63 -2.57 (m, 2H), 2.55-2.48 (m, 2H), 2.04-1.68 (m, 4H), 0.72 (s, 9H), -0.08 (s, 3H), -0.15 (s, 3H). ( Minor) 7.44-7.35 (m, 2H), 7.32-7.24 (m, 6H), 7.19 (dd, J = 7.0, 7.0Hz, 1H), 6.96 (dd, J = 7.5 Hz, 1H, -NH), 6.86 -6.76 (m, 4H), 4.89 (m, 1H), 4.36 (m, 1H), 3.78 (s, 6H), 3.72-3.41 (m, 6H), 2.63-2.57 (m, 2H), 2.55-2.48 (m, 2H), 2.04-1.68 (m, 4H), 0.85 (s, 9H), 0.03 (s, 3H), 0.01 (s, 3H).

In the same manner as in Step 6 of the synthesis of compound 4 Step 2 Compound 137 to give Compound 137 as a colorless foam (50% yield). It was observed as a rotamer mixture 1, H-NMR 70:30.
ESI-MS (m / z): 1263 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: (Major) 7.38 (dd, J = 7.8, 7.8Hz, 2H), 7.35-7.23 (m, 9H), 7.19 (dd, J = 7.0, 7.0Hz, 1H), 7.12-6.86 (m, 4H), 6.85-6.77 (m, 6H), 6.68 (s, 1H), 5.35 (d, J = 2.8 Hz, 3H, H-4 of GalNAc), 5.25-5.17 (m, 3H , H-3 of GalNAc), 4.74 (m, 1H), 4.66-4.59 (m, 3H, H-1 of GalNAc), 4.22-3.98 (m, 9H), 3.97-3.86 (m, 6H), 3.79 ( s, 6H), 3.75-3.57 (m, 16H), 3.57-3.39 (m, 5H), 3.36-3.11 (m, 13H), 2.51-2.45 (m, 4H), 2.44-2.36 (m, 8H), 2.30-2.13 (m, 8H), 2.15 (s, 9H), 2.04 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.78-1.52 (18H, m), 0.74 (s, 9H), -0.07 (s, 3H), -0.13 (s, 3H). (Minor) 7.38 (dd, J = 7.8, 7.8Hz, 2H), 7.35-7.23 (m, 9H), 7.19 (dd, J = 7.0, 7.0Hz, 1H), 7.12-6.86 (m, 4H), 6.85-6.77 (m, 6H), 6.64 (s, 1H), 5.35 (d, J = 2.8 Hz, 3H, H-4 of GalNAc ), 5.25-5.17 (m, 3H, H-3 of GalNAc), 4.74 (m, 1H), 4.66-4.59 (m, 3H, H-1 of GalNAc), 4.22-3.98 (m, 9H), 3.97- 3.86 (m, 6H), 3.79 (s, 6H), 3.75-3.57 (m, 16H), 3.57-3.39 (m, 5H), 3.36-3.11 (m, 13H), 2.51-2.45 (m, 4H), 2.44-2.36 (m, 8H), 2.30-2.13 (m, 8H), 2.15 (s, 9H), 2.04 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.78-1.52 (18H, m), 0.85 (s, 9H), 0.03 (s, 3H) , 0.01 (s, 3H).

In the same manner as in Step 8 of Compound 5 step 3 Compound 138 to give Compound 138 as a colorless foam (80% yield).

In the same manner as in Step 9 of the synthesis of compound 5 Step 4 Compound 8 to give compound 8 as a colorless foam (82% yield).
ESI-MS (m / z): 1255 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.40-7.30 (m, 5H), 7.30-7.22 (m, 6H), 7.20 (m, 1H), 7.11-6.96 (m, 4H), 6.94-6.79 (m, 4H), 6.81 (d, J = 8.1 Hz, 4H), 5.35 (d, J = 2.8 Hz, 3H, H-4 of GalNAc), 5.25-5.16 (m, 3H, H-3 of GalNAc), 4.62 ( d, J = 8.3 Hz, 3H, H-1 of GalNAc), 4.35 (dd, J = 11.4, 4.3Hz, 1H), 4.29 (m, 1H), 4.22-4.02 (m, 10H), 3.98-3.85 ( m, 6H), 3.79 (s, 6H), 3.74-3.58 (m, 14H), 3.56-3.45 (m, 4H), 3.38-3.19 (m, 12H), 3.21-3.11 (m, 2H), 2.62- 2.43 (m, 8H), 2.45-2.38 (m, 6H), 2.32-2.14 (m, 8H), 2.15 (s, 9H), 2.04 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.80-1.50 (18H, m).

9) Synthesis of Compound 9

Figure JPOXMLDOC01-appb-C000074

By a similar manner to Step 1 of the synthesis of compound 7 Step 1 Compound 140 Method to give compound 140 as a colorless foam (57% yield).
ESI-MS (m / z): 663 (MH).
1 H-NMR (CDCl 3) δ: 7.39 (d, J = 7.3 Hz, 2H), 7.32-7.24 (m, 6H), 7.20 (dd, J = 7.3, 7.3 Hz, 1H), 7.02 (t, J = 5.5 Hz, NH), 6.84 (d, J = 10.6 Hz, NH), 6.82 (d, J = 8.6 Hz, 4H), 4.41 (ddd, J = 10.6, 6.8, 3.8 Hz), 4.05 (dd, J = 9.6, 3.8 Hz, 1H), 3.78 (s, 6H), 3.61 (dd, J = 9.6, 6.8 Hz, 1H), 3.49 (m, 1H), 3.41 (m, 1H), 3.22 (dt, J = 9.1, 6.0 Hz, 1H), 3.14 (dt, J = 9.1, 6.0 Hz, 1H), 2.66 (dt, J = 16.4, 6.3 Hz, 1H), 2.58 (dt, J = 16.4, 6.3 Hz, 1H), 2.48 (t, J = 6.3 Hz, 2H), 0.85 (s, 9H), 0.04 (s, 6H).

In the same manner as in Step 6 of the synthesis of compound 4 Step 2 Compound 141 to give Compound 141 as a colorless foam (57% yield).
ESI-MS (m / z): 1355 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.40 (d, J = 7.8 Hz, 2H), 7.33-7.16 (m, 12H), 7.08-6.86 (m, 3H), 6.85-6.71 (m, 4H), 6.81 (d, J = 8.6 Hz, 2H), 5.39-5.31 (m, 3H, H-4 of GalNAc), 5.25-5.15 (m, 3H, H-3 of GalNAc), 4.62 (d, J = 8.1 Hz, 3H, H-1 of GalNAc), 4.38 (m, 1H), 4.22-3.97 (m, 10H), 3.97-3.86 (m, 6H), 3.79 (s, 6H), 3.71-3.56 (m, 14H), 3.55-3.45 (m, 3H), 3.40-3.06 (m, 15H), 2.63-2.44 (m, 4H), 2.43-2.34 (m, 6H), 2.32-2.16 (m, 4H), 2.15 (s, 9H ), 2.04 (s, 9H), 1.99 (s, 9H), 1.94 (s, 9H), 1.79-1.52 (18H, m), 0.84 (s, 9H), 0.02 (s, 3H), 0.01 (s, 3H).

In the same manner as in Step 8 of Compound 5 step 3 Compound 142 to give Compound 142 as a colorless foam (68% yield).
ESI-MS (m / z): 1186 (M / 2 + Na).

In the same manner as in Step 9 of the synthesis of compound 5 Step 4 Compound 9, to give compound 9 as a colorless foam (83% yield).
ESI-MS (m / z): 1235 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.46 (m, 1H), 7.41 (d, J = 7.6 Hz, 2H), 7.36-7.22 (m, 11H), 7.19 (dd, J = 7.0, 7.0Hz, 1H ), 7.05 (m, 1H), 7.02-6.95 (m, 2H), 7.00 (br s, 1H), 6.86-6.77 (m, 2H), 6.81 (d, J = 8.6 Hz, 4H), 5.39-5.32 (m, 3H, H-4 of GalNAc), 5.25-5.14 (m, 3H, H-3 of GalNAc), 4.62 (d, J = 8.3Hz, H-1 of GalNAc), 4.56-4.39 (m, 2H ), 4.22-4.03 (m, 9H), 3.98-3.91 (m, 6H), 3.79 (s, 6H), 3.70-3.55 (m, 13H), 3.55-3.46 (m, 4H), 3.35-3.14 (m , 15H), 2.63-2.47 (m, 5H), 2.47-2.34 (m, 9H), 2.29-2.16 (m, 6H), 2.14 (s, 9H), 2.04 (s, 9H), 1.99 (s, 9H ), 1.94 (s, 9H), 1.79-1.52 (18H, m).

10) Synthesis of Compound 14

Figure JPOXMLDOC01-appb-C000075

Compound 143 Step 1 Compound 144 (10.0 g, 37.7 mmol) in 1,2-dimethoxyethane solution (100 mL) to room temperature (4-tert-butoxycarbonyl) phenyl) boronic acid (9.21 g, 41. 5 mmol), 2 mol / L aqueous potassium carbonate solution (56.6ml, 113mmol), PdCl 2 (dppf) (3.07g, 3.77mmol) was added, and the mixture was stirred for 1 hour at 80 ° C.. After cooling, the reaction solution was diluted with ethyl acetate, washed with brine, then dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The resulting residue was added with n- hexane was powdered, washed with ethyl acetate and n- hexane, and dried under reduced pressure at 70 ° C., a black compound 144 (13.5 g, 99% yield) It was obtained as a powder.
1 H-NMR (CDCl 3) δ: 8.64 (s, 1H), 8.11 (d, J = 8.0 Hz, 2H), 8.11 (d, J = 8.0 Hz, 1H), 8.10 (s, 1H), 8.05 ( d, J = 8.7 Hz, 1H), 7.96 (d, J = 8.7 Hz, 1H), 7.82 (d, J = 8.0 Hz, 1H), 4.00 (s, 3H), 1.63 (s, 9H).

Trifluoroacetic acid Compound 144 Step 2 Compound 145 (3.0g, 8.28mmol) (60ml) - was suspended in dichloromethane (10 ml), and stirred for 1 hour at 25 ° C.. The insolubles from the reaction solution was filtered, washed with n- hexane and dried under reduced pressure at 70 ° C., to give compound 145 (13.5 g, 99% yield) as a colorless solid.
1 H-NMR (d 6 -DMSO ) δ: 8.71 (s, 1H), 8.44 (s, 1H), 8.29 (d, J = 8.7 Hz, 1H), 8.17 (d, J = 8.7 Hz, 1H), 8.12 (d, J = 8.2 Hz, 2H), 8.06 (d, J = 8.7 Hz, 1H), 8.02 (d, J = 8.7 Hz, 1H), 8.02 (d, J = 8.2 Hz, 1H), 3.96 ( s, 3H).

In the same manner as Compound 4 step 4 step 3 Compound 146 to give Compound 146 as a colorless solid (74% yield).
ESI-MS (m / z): 892 (MH).

After treatment in the same manner as in Step 5 of the synthesis of compound 4 Step 4 Compound 147, silica gel column chromatography (chloroform: methanol: triethylamine = 97.5: 2.5: 1 → 90: 10: 1) and purify by It gave compound 147 as a colorless solid (47% yield). In 1 H-NMR it was observed as a rotamer mixture 60:40.
ESI-MS (m / z) : 878 (M +).
1 H-NMR (CDCl 3) δ: (Major) 8.56 (s, 1H), 8.11 (dd, J = 8.0, 1.3 Hz, 1H), 7.94 (d, J = 8.0 Hz, 1H), 7.93 (s, 1H), 7.91-7.84 (m, 3H), 7.67 (d, J = 8.0 Hz, 2H), 7.66 (m, 1H), 7.43 (d, J = 8.0 Hz, 2H), 7.36-7.18 (m, 7H ), 6.85-6.74 (m, 4H), 5.06 (m, 1H), 4.43 (m, 1H), 3.93 (dd, 1H, J = 9.5, 5.5 Hz), 3.85-3.60 (m, 4H), 3.78 ( s, 6H), 3.56 (dd, 1H, J = 9.0, 3.8 Hz), 3.28 (m, 1H), 2.07-1.78 (m, 4H), 0.77 (s, 9H), -0.02 (s, 3H), -0.08 (s, 3). (Minor) 8.61 (s, 1H), 8.16 (dd, J = 8.0, 1.3 Hz, 1H), 8.01 (s, 1H), 7.99 (d, J = 8.7 Hz, 1H) , 7.91-7.84 (m, 3H), 7.73 (d, J = 8.0 Hz, 2H), 7.72 (m, 1H), 7.39 (d, J = 8.0 Hz, 2H), 7.36-7.18 (m, 7H), 6.85-6.74 (m, 4H), 5.15 (m, 1H), 4.52 (m, 1H), 4.00 (dd, 1H, J = 9.5, 4.7 Hz), 3.85-3.60 (m, 4H), 3.67 (s, 3H), 3.64 (s, 3H), 3.56 (dd, 1H, J = 9.0, 3.8 Hz), 3.23 (m, 1H), 2.07-1.78 (m, 4H), 0.89 (s, 9H), 0.07 (s , 3H), 0.06 (s, 3).

Figure JPOXMLDOC01-appb-C000076

In the same manner as in Step 6 of Compound 4 Step 5 Compound 148 to give Compound 148 as a colorless foam (52% yield). It was observed as a rotamer mixture 1, H-NMR 59:41.
ESI-MS (m / z): 1350 (M / 2 + H).
1 H-NMR (CDCl 3) δ: (Major) 8.40 (br.s, 1H), 8.11 (br.s, 1H), 8.08 (dd, J = 8.5, 2.0Hz, 1H), 7.99-7.88 (m , 4H), 7.83 (m, 1H), 7.80 (d, J = 8.3Hz, 2H), 7.45-7.41 (m, 2H), 7.36-7.08 (m, 12H), 6.93-6.86 (m, 3H), 6.85-6.81 (m, 4H), 6.77 (t, J = 9.0Hz, 3H, -NH), 5.34 (d, J = 3.0Hz, 3H, H-4 of GalNAc), 5.18 (dd, J = 11.0, 3.0Hz, 3H, H-3 of GalNAc), 5.05 (m, 1H), 4.60 (d, J = 8.0Hz, 3H, H-1 of GalNAc), 4.42 (m, 1H), 4.20-4.04 (m, 10H), 3.94-3.84 (m, 13H), 3.82-3.73 (m, 6H), 3.79 (s, 6H), 3.57-3.45 (m, 5H), 3.31-3.15 (m, 12H), 2.49 (t, J = 5.5Hz, 6H), 2.26-2.11 (m, 8H), 2.14 (s, 9H), 2.04 (s, 9H), 1.99 (s, 9H), 1.92 (s, 9H), 1.81-1.49 (20H , m), 0.76 (s, 9H), -0.04 (s, 3H), -0.10 (s, 3H). (Minor) 8.40 (br.s, 1H), 8.11 (br.s, 1H), 8.08 ( dd, J = 8.5, 2.0Hz, 1H), 7.99-7.88 (m, 4H), 7.83 (m, 1H), 7.80 (d, J = 8.3Hz, 2H), 7.40-7.36 (m, 2H), 7.36 -7.08 (m, 12H), 6.93-6.86 (m, 3H), 6.85-6.81 (m, 4H), 6.77 (t, J = 9.0Hz, 3H, -NH), 5.34 (d, J = 3.0Hz, 3H, H-4 of GalNAc), 5.18 (dd, J = 11.0, 3.0Hz, 3H, H-3 of GalNAc), 5.05 ( m, 1H), 4.60 (d, J = 8.0Hz, 3H, H-1 of GalNAc), 4.51 (m, 1H), 4.20-4.04 (m, 10H), 3.94-3.84 (m, 13H), 3.82- 3.73 (m, 6H), 3.79 (s, 6H), 3.57-3.45 (m, 5H), 3.31-3.15 (m, 12H), 2.49 (t, J = 5.5Hz, 6H), 2.26-2.11 (m, 8H), 2.14 (s, 9H), 2.04 (s, 9H), 1.99 (s, 9H), 1.92 (s, 9H), 1.81-1.49 (20H, m), 0.89 (s, 9H), -0.07 ( s, 3H), -0.05 (s, 3H).

In the same manner as in Step 8 of Compound 5 step 6 Compound 149 to give Compound 149 as a colorless foam (yield%).

In the same manner as in Step 9 of the synthesis of compound 5 Step 7 Compound 14 to give compound 14 as a colorless foam (82% yield).
ESI-MS (m / z): 1343 (M / 2 + H).
1 H-NMR (CDCl 3) δ: 7.99-7.87 (m, 4H), 7.84-7.75 (m, 3H), 7.47-7.35 (m, 2H), 7.34-7.25 (m, 7H), 7.25-7.06 ( m, 6H), 6.94-6.73 (m, 5H), 6.83 (d, J = 8.5 Hz, 4H), 5.35 (d, J = 3.0Hz, 3H, H-4 of GalNAc), 5.21-5.13 (m, 3H, H-3 of GalNAc), 4.59-4.53 (m, 3H, H-1 of GalNAc), 4.41-4.25 (m, 2H), 4.20-4.05 (m, 9H), 3.95-3.84 (m, 12H) , 3.81-3.73 (m, 6H), 3.79 (s, 6H), 3.50-3.40 (m, 4H), 3.29-3.21 (m, 2H), 3.21-3.06 (m, 12H), 2.53-2.42 (m, 10H), 2.25-2.08 (m, 10H), 2.13 (s, 9H), 2.03 (s, 9H), 2.01 (s, 9H), 1.98 (s, 9H), 1.75-1.43 (18H, m).

11) Synthesis of Compound 18

Figure JPOXMLDOC01-appb-C000077

Compound 150 Step 1 Compound 151 (18.1g, 76.0mmol) and methyl acrylate (5.0 g, 5.23 mmol) in tetrahydrofuran solution was dissolved (100 mL), sodium hydride at 0 ℃ (116mg, 2 after adding .90mmol), and stirred for 2 hours at the same temperature. The reaction solution was diluted with ethyl acetate, saturated aqueous ammonium chloride solution, washed with brine, then dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 320 g, n-hexane: ethyl acetate = 60: 40 → 40: 60 ) to give the colorless oily compound 151 (11.8 g, 62% yield) It was obtained as a thing.
ESI-MS (m / z): 327 (M + H).
1 H-NMR (CDCl 3) δ: 7.38-7.31 (m, 4H), 7.29 (m, 1H), 4.57 (s, 2H), 3.75 (t, J = 6.5 Hz, 2H), 3.71-3.60 (m , 15H), 2.60 (t, J = 6.5 Hz, 2H).

Step 2 Compound 152 Compound 151 (1.02 g, 3.13 mmol) in methanol (10 mL) was added 10% palladium-carbon (200 mg) was dissolved was added, under atmospheric pressure under a hydrogen atmosphere and stirred for 12 hours at room temperature, from the reaction mixture and the catalyst is filtered off, the filtrate was concentrated.
The resulting residue acetonitrile (5 ml) - was dissolved in a mixed solution of water (5 ml), at room temperature 2,2,6,6-tetramethylpiperidine 1-oxyl (98mg, 0.625mmol), iodobenzene diacetate Doo (2.22 g, 6.88 mmol) was added and stirred for 1 hour at the same temperature. After The reaction mixture was poured into saturated sodium bicarbonate solution, the aqueous layer was washed with ethyl acetate. Was added to the resultant 2 mol / L hydrochloric acid aqueous layer was acidified, extracted with chloroform, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2: 30 g, chloroform: methanol = 97.5: 2.5 → 75: 25 → chloroform: methanol: water = 6: 4: 1) to obtain Compound 152 It was obtained (483 mg, 62% yield) as a colorless oil.
ESI-MS (m / z): 251 (M + H).
1 H-NMR (CDCl 3) δ: 4.09 (s, 2H), 3.76 (t, J = 6.6 Hz, 2H), 3.74-3.60 (m, 8H), 3.69 (s, 3H), 2.61 (t, J = 6.6 Hz, 2H).

By a similar manner to Compound 4 Step 4 Step 3 compound 153 approach, to give the compound 153 as a colorless oil (70% yield). In 1 H-NMR it was observed as a rotamer mixture 60:40.
ESI-MS (m / z): 859 (M + Na).
1 H-NMR (CDCl 3) δ: (Major) 7.40 (d, J = 8.0 Hz, 2H), 7.32-7.22 (m, 7H), 7.19 (m, 1H), 6.84-6.78 (m, 4H), 4.87 (m, 1H), 4.38 (m, 1H), 4.02 (d, 1H, J = 14.3 Hz), 3.96 (d, 1H, J = 14.3 Hz), 3.86-3.53 (m, 18H), 3.76 (s , 6H), 3.49 (dd, 1H, J = 8.7, 3.4 Hz), 2.60 (t, 2H, J = 6.5 Hz), 2.03-1.71 (m, 4H), 0.74 (s, 9H), -0.07 (s , 3H), -0.13 (s, 3). (Minor) 7.37 (d, J = 8.0 Hz, 2H), 7.32-7.22 (m, 7H), 7.19 (m, 1H), 6.84-6.78 (m, 4H ), 4.94 (m, 1H), 4.38 (m, 1H), 3.86-3.53 (m, 18H), 3.76 (s, 6H), 3.49 (dd, 1H, J = 8.7, 3.4 Hz), 3.17 (m, 1H), 3.13 (m, 1H), 2.03-1.71 (m, 4H), 0.86 (s, 9H), 0.03 (s, 3H), 0.02 (s, 3).

After treatment in the same manner as in Step 5 of the synthesis of compound 4 Step 4 Compound 154, silica gel column chromatography (chloroform: methanol: triethylamine = 97.5: 2.5: 1 → 85: 15: 1) and purify by It gave compound 154 as a colorless foam (74% yield). It was observed as a rotamer mixture 1, H-NMR 65:35.
1 H-NMR (CDCl 3) δ: (Major) 8.56 (s, 1H), 8.11 (dd, J = 8.0, 1.3 Hz, 1H), 7.94 (d, J = 8.0 Hz, 1H), 7.93 (s, 1H), 7.91-7.84 (m, 3H), 7.67 (d, J = 8.0 Hz, 2H), 7.66 (m, 1H), 7.43 (d, J = 8.0 Hz, 2H), 7.36-7.18 (m, 7H ), 6.85-6.74 (m, 4H), 5.06 (m, 1H), 4.43 (m, 1H), 3.93 (dd, 1H, J = 9.5, 5.5 Hz), 3.85-3.60 (m, 4H), 3.78 ( s, 6H), 3.56 (dd, 1H, J = 9.0, 3.8 Hz), 3.28 (m, 1H), 2.07-1.78 (m, 4H), 0.77 (s, 9H), -0.02 (s, 3H), -0.08 (s, 3). (Minor) 8.61 (s, 1H), 8.16 (dd, J = 8.0, 1.3 Hz, 1H), 8.01 (s, 1H), 7.99 (d, J = 8.7 Hz, 1H) , 7.91-7.84 (m, 3H), 7.73 (d, J = 8.0 Hz, 2H), 7.72 (m, 1H), 7.39 (d, J = 8.0 Hz, 2H), 7.36-7.18 (m, 7H), 6.85-6.74 (m, 4H), 5.15 (m, 1H), 4.52 (m, 1H), 4.00 (dd, 1H, J = 9.5, 4.7 Hz), 3.85-3.60 (m, 4H), 3.67 (s, 3H), 3.64 (s, 3H), 3.56 (dd, 1H, J = 9.0, 3.8 Hz), 3.23 (m, 1H), 2.07-1.78 (m, 4H), 0.89 (s, 9H), 0.07 (s , 3H), 0.06 (s, 3).

Figure JPOXMLDOC01-appb-C000078

In the same manner as in Step 6 of Compound 4 Step 5 Compound 155 to give Compound 155 as a colorless foam (46% yield). In 1 H-NMR it was observed as a rotamer mixture 60:40.
1 H-NMR (CDCl 3) δ: (Major) 7.42-7.35 (m, 2H), 7.33-7.15 (m, 11H), 7.04-6.92 (m, 3H), 6.85-6.76 (m, 6H), 6.75 -6.68 (m, 2H), 5.35 (d, J = 3.0Hz, 3H, H-4 of GalNAc), 5.25-5.20 (m, 3H, H-3 of GalNAc), 4.84 (m, 1H), 4.66- 4.59 (m, 3H, H-1 of GalNAc), 4.35 (m, 1H), 4.22-3.98 (m, 11H), 3.98-3.88 (m, 6H), 3.79 (s, 6H), 3.75-3.57 (m , 27H), 3.55-3.41 (m, 4H), 3.37-3.12 (m, 12H), 2.47-2.19 (m, 8H), 2.32-2.17 (m, 8H), 2.15 (s, 9H), 2.05 (s , 9H), 1.99 (s, 9H), 1.95 (s, 9H), 1.99-1.52 (m, 20H), 0.75 (s, 9H), -0.06 (s, 3H), -0.11 (s, 3H) ( Minor) 7.42-7.35 (m, 2H), 7.33-7.15 (m, 11H), 7.04-6.92 (m, 3H), 6.85-6.76 (m, 6H), 6.75-6.68 (m, 2H), 5.35 (d , J = 3.0Hz, 3H, H-4 of GalNAc), 5.25-5.20 (m, 3H, H-3 of GalNAc), 4.92 (m, 1H), 4.66-4.59 (m, 3H, H-1 of GalNAc ), 4.40 (m, 1H), 4.22-3.98 (m, 11H), 3.98-3.88 (m, 6H), 3.79 (s, 6H), 3.75-3.57 (m, 27H), 3.55-3.41 (m, 4H ), 3.37-3.12 (m, 12H), 2.47-2.19 (m, 8H), 2.32-2.17 (m, 8H), 2.15 (s, 9H), 2.05 (s, 9H), 1.99 (s, 9H), 1.95 (s, 9H), 1.99-1.52 (m, 20H), 0.86 (S, 9H), 0.03 (s, 3H), 0.02 (s, 3H).

In the same manner as in Step 8 of Compound 5 step 6 Compound 156 to give Compound 156 as a colorless foam (66% yield).
ESI-MS (m / z): 1242 (M / 2 + H).

In the same manner as in Step 9 of the synthesis of compound 5 Step 7 Compound 18 to give Compound 18 as a colorless foam (75% yield).
ESI-MS (m / z): 1315 (M / 2 + Na).
1 H-NMR (CDCl 3) δ: 7.60 (m, 1H), 7.37 (dd, J = 7.5, 7.5Hz, 2H), 7.38-7.30 (m, 9H), 7.20 (m, 1H), 7.13-6.98 (m, 3H), 6.94-6.76 (m, 4H), 6.82 (d, J = 8.6 Hz, 4H), 5.35 (d, J = 3.1Hz, 3H, H-4 of GalNAc), 5.20 (dd, J = 11.0, 3.1Hz, 3H, H-3 of GalNAc), 5.07 (m, 1H), 4.62 (d, J = 8.4Hz, 3H, H-1 of GalNAc), 4.26-3.98 (m, 12H), 3.97 -3.88 (m, 6H), 3.79 (s, 6H), 3.75-3.58 (m, 24H), 3.55-3.46 (m, 4H), 3.40-3.21 (m, 12H), 3.22-3.14 (m, 2H) , 2.87-2.77 (m, 2H), 2.56 (br s, 2H), 2.54-2.46 (m, 2H), 2.46-2.38 (m, 8H), 2.32-2.18 (m, 8H), 2.15 (s, 9H ), 2.04 (s, 9H), 1.99 (s, 9H), 1.95 (s, 9H), 1.80-1.52 (18H, m).

12) Synthesis of Compound 19

Figure JPOXMLDOC01-appb-C000079

It was synthesized according to the procedure described for the synthesis WO 2011/148922 step 1 Compound 157.

Synthetic Bioorganic Medicinal Chemistry Letters step 2 compound 158, in the same procedure as the method described in 11,383-386 (2001), the compound 158 from compound 157 was synthesized in two steps.

Step 3 was reacted in the same manner as steps 2 and 3 of the synthesis of compound 4 Compound 159, silica gel column chromatography (SiO 2: 320 g, n-hexane: ethyl acetate: triethylamine = 200: 100: 3) Purification by to give compound 159 as a colorless foam (91% yield).
1 H-NMR (CDCl 3) δ: 7.44-7.41 (m, 2H), 7.34-7.28 (m, 4H), 7.27-7.25 (m, 2H), 7.19 (m, 1H), 6.84-6.79 (m, 4H), 3.78 (s, 6H), 3.68 (dd, J = 10.0, 5.9 Hz, 1H), 3.63 (dd, J = 10.0, 5.6 Hz, 1H), 3H), 3.15 (dd, J = 9.2, 5.3 Hz, 1H), 3.63 (dd, J = 9.2, 5.9 Hz, 1H), 2.68 (m, 1H), 2.35 (s, 3H), 0.85 (s, 9H), 0.02 (s, 6H).

In the same manner as Step 4 of Step 4 Compound 160 Compound 4 to give compound 160 as a colorless foam (52% yield). It was observed as a rotamer mixture 1, H-NMR 57:43.
1 H-NMR (CDCl 3) δ: (Major) 7.42 (m, 2H), 7.32-7.23 (m, 6H), 7.21 (dd, J = 7.3, 7.3 Hz, 1H), 6.84-6.76 (m, 4H ), 4.15 (m, 1H), 3.79 (s, 3H), 3.78 (s, 3H), 3.71 (m, 1H), 3.66 (s, 3H), 3.59-3.51 (m, 1H), 3.17-3.12 ( m, 2H), 2.67 (s, 3H), 2.48 (m, 1H), 2.34-2.25 (m, 3H), 1.73-1.54 (m, 4H), 1.40-1.25 (m, 12H), 0.81 (s, 9H), -0.02 (s, 3H), -0.03 (s, 3H). (Minor) 7.42 (m, 2H), 7.32-7.23 (m, 6H), 7.21 (dd, J = 7.3, 7.3 Hz, 1H ), 6.84-6.76 (m, 4H), 4.79 (m, 1H), 3.79 (s, 3H), 3.78 (s, 3H), 3.71 (m, 1H), 3.66 (s, 3H), 3.59-3.51 ( m, 1H), 3.28 (dd, J = 9.5, 5.0 Hz, 1H), 3.18 (dd, J = 9.5, 8.0 Hz, 1H), 2.89 (s, 3H), 2.48 (m, 1H), 2.34-2.25 (m, 3H), 1.73-1.54 (m, 4H), 1.40-1.25 (m, 12H), 0.78 (s, 9H), -0.04 (s, 6H)

In the same manner as in Step 5 of the synthesis of compound 4 Step 5 Compound 161 to give Compound 161 as a colorless foam (90% yield).

Figure JPOXMLDOC01-appb-C000080

In the same manner as in Step 6 of Compound 4 Step 6 Compound 162 to give Compound 162 as a colorless foam (51% yield). It was observed as a rotamer mixture 1, H-NMR 58:42.
1 H-NMR (CDCl 3) δ: (Major) 7.39 (dd, J = 9.3, 9.3 Hz, 2H), 7.33-7.23 (m, 9H), 7.21 (dd, J = 7.5, 7.5Hz, 1H), 7.14-7.00 (m, 3H, -NH), 6.98-6.86 (m, 3H), 6.84-6.81 (m, 4H), 6.62 (m, 1H, -NH), 5.39-5.33 (m, 3H, H- 4 of GalNAc), 5.23-5.16 (m, 3H, H-3 of GalNAc), 4.65-4.59 (m, 3H, H-1 of GalNAc), 4.21-4.04 (m, 10H), 3.98-3.83 (m, 6H), 3.791 (s, 6H), 3.73-3.63 (m, 13H), 3.59-3.55 (m, 2H), 3.55-3.46 (m, 3H), 3.37-3.20 (m, 12H), 3.19-3.13 ( m, 2H), 2.69-2.65 (m, 3H), 2.47-2.39 (m, 6H), 2.37-2.13 (m, 10H), 2.15 (s, 9H), 2.04 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.80-1.51 (18H, m), 1.40-1.24 (12H, m), 0.81 (s, 9H), -0.018 (s, 3H), -0.04 (s, 3H) . (Minor) 7.39 (dd, J = 9.3, 9.3 Hz, 2H), 7.33-7.23 (m, 9H), 7.21 (dd, J = 7.5, 7.5Hz, 1H), 7.14-7.00 (m, 3H, - NH), 6.98-6.86 (m, 3H), 6.84-6.81 (m, 4H), 6.62 (m, 1H, -NH), 5.39-5.33 (m, 3H, H-4 of GalNAc), 5.23-5.16 ( m, 3H, H-3 of GalNAc), 4.65-4.59 (m, 3H, H-1 of GalNAc), 4.21-4.04 (m, 10H), 3.98-3.83 (m, 6H), 3.785 (s, 6H) , 3.73-3.63 (m, 13H), 3.59-3.55 (m, 2H), 3.55-3.46 (m, 3H), 3.37-3.20 (m, 12H), 3.19-3.13 (m, 2H), 2.85-2.80 (m, 3H), 2.47-2.39 (m, 6H), 2.37- 2.13 (m, 10H), 2.15 (s, 9H), 2.04 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.80-1.51 (18H, m), 1.40-1.24 (12H, m), 0.78 (s, 9H), -0.026 (s, 3H), -0.024 (s, 3H).

In the same manner as in Step 7 of the synthesis of compound 4 Step 7 Compound 163 to give Compound 163 as a colorless foam (83% yield).
ESI-MS (m / z): 1220 (M / 2 + Na).

In the same manner as in Step 8 of Compound 4 Step 8 Compound 19 to give Compound 19 as a colorless foam (71% yield).
ESI-MS (m / z): 1248 (M / 2 + H), 1247 (M / 2).
1 H-NMR (CDCl 3) δ: 7.40-7.34 (m, 2H), 7.34-7.18 (m, 11H), 7.14-7.03 (m, 3H, -NH), 6.94-6.80 (m, 2H), 6.85 -6.81 (m, 4H), 6.68 (m, 1H, -NH), 5.35 (d, J = 3.0 Hz, 3H, H-4 of GalNAc), 5.24-5.16 (m, 3H, H-3 of GalNAc) , 4.61 (d, J = 8.0 Hz, 3H, H-1 of GalNAc), 4.32 (m, 1H), 4.22-4.04 (m, 11H), 3.98-3.86 (m, 5H), 3.79 (s, 6H) , 3.75-3.60 (m, 13H), 3.55-3.45 (m, 3H), 3.36-3.14 (m, 15H), 2.95-2.84 (s, 3H), 2.61-2.54 (m, 4H), 2.49-2.40 ( m, 8H), 2.35-2.18 (m, 6H), 2.15 (s, 9H), 2.03 (s, 9H), 2.00 (s, 9H), 1.95 (s, 9H), 1.80-1.51 (18H, m) , 1.39-1.18 (16H, m).

13) Synthesis of Compound 20

Figure JPOXMLDOC01-appb-C000081

Dichloromethane (3.6 mL) oxalyl chloride (171μL, 1.95mmol) of Compound 164 Step 1 Compound 165 (U.S. Patent Application Publication No. 2012/0157509) (90mg, 0.489mmol) was added, at room temperature in after stirring 21 hours, the solvent was distilled off. The resulting residue was dissolved in dichloromethane (1.8 mL), under ice-cooling, Compound 105 (877 mg, 0.489 mmol) and pyridine (158μL, 1.96mmol) in dichloromethane to (5.4 mL) was added, 7 hours It stirred. And extracted with chloroform with 10% aqueous citric acid solution to the reaction solution. The organic layer was dried over anhydrous magnesium sulfate, to give compound 165 by distilling off the solvent (365 mg, 38% yield) as a pale yellow solid material.
ESI-MS (m / z) = 1959.8. (M + H)
HPLC Peak RT = 1.42 minutes

Compound 165 (150 mg, 0.077 mmol) of Step 2 compound 20 in methanol solution (3.5 mL) of, at room temperature, were added and stirred water (3.0 mL) and triethylamine (2.0 mL) 19 h. After the methanol and triethylamine was distilled off under reduced pressure, Dowex (R) -50 W × 8-200 (purchased from Sigma-Aldrich) (600 mg) was added to the residue, followed by stirring at room temperature, slowly for 45 minutes and filtered. Compound 20 was evaporated to (113mg, 93%) as a pale yellow solid material.
ESI-MS (m / z) = 1981.8. (M + H)
HPLC Peak RT = 0.71 minutes

14) Synthesis of Compound 21

Figure JPOXMLDOC01-appb-C000082

Step 1 Compound 167 Compound prepared according to the procedure described for the synthesis EP 624377 of 166 (161mg, 0.27mmol) in N, diethylamine N- dimethylformamide (1mL) (84uL, 0.80mmol ), and the mixture was stirred at room temperature for 3 hours. The reaction solution was evaporated diethylamine and N, N- dimethylformamide by vacuum concentration, the reaction solution weight was 1g. Subsequently, Compound 2 (200mg, 0.13mmol) N in DMF solution (2 mL) of, N- diisopropylethylamine (55uL, 0.32mmol) and HBTU a (44 mg, 0.12 mmol) was added at room temperature, stirred for 10 minutes did. Thereto and 0.5g of (0.13 mmol equivalent) was added the compound 167 reaction solution described above and stirred for an additional 24 hours. Under ice cooling, water was added to the aqueous layer washed with chloroform to the reaction solution. The residue obtained aqueous layer was concentrated under reduced pressure and dissolved in N, N- dimethylformamide (2 mL). Silica gel and concentrated under reduced pressure added (2 g) Dry chromatography (SiO 10 g) was purified by (chloroform: methanol = 90:: 10 → 60 40), the compound 167 pale brown solid (60 mg, 25% yield) It was obtained as a.
ESI-MS (m / z) = 1129 [M + 2H] 2+, 753 [M + 3H] 3+
HPLC Peak RT = 1.31 minutes

Compound 167 Step 2 Compound 21 (10mg, 4.43μmol) N in the N- methylpyrrolidone solution (0.15 mL), N- diisopropylethylamine (7.7μL, 44μmol) and 4-nitrophenyl chloroformate (5 mg, 22Umol) added and the mixture was stirred at room temperature for 24 hours. Then, N, N- diisopropylethylamine (7.7μL, 44μmol) and 4-nitrophenyl chloroformate (5mg, 22μmol) was added and stirred further at room temperature for 24 hours. At LC / MS measurements, to confirm the disappearance and formation of compound 21 starting material. By omitting purification steps, using the reaction solution in Example 3 (7-10).
ESI-MS (m / z) = 1211 [M + 2H] 2+, 808 [M + 3H] 3+
HPLC Peak RT = 1.73 minutes

The following compounds are obtained analogously can be synthesized.

Figure JPOXMLDOC01-appb-C000083

Figure JPOXMLDOC01-appb-C000084

Figure JPOXMLDOC01-appb-C000085

Synthesis Example 2 immobilized 1 to the resin compound containing a sugar derivative having an interaction with the asialoglycoprotein receptor) Compound 1001

Figure JPOXMLDOC01-appb-C000086

Compound 3 (290 mg, 100 [mu] mol) from the addition of diisopropylethylamine (50 [mu] L) in DMF solution (2 mL) was stirred under ice-cooling. Isobutyl chloroformate (13 [mu] L, 100 [mu] mol) was added in DMF (0.2 mL) was stirred for 3 minutes. PrimerSupport200 (underivatized support) After addition of diisopropylethylamine (350 [mu] L) in DMF suspension of (GE Healthcare Inc.) (1 g), and stirred with shaking for 24 hours under room temperature by the addition of compound 3 reaction described above. The reaction solution was filtered, washed with PrimerSupport with acetonitrile (40 mL), was bubbled dry. Dry PrimerSupport acetic anhydride (20% v / v), pyridine (20% v / v), N- and acetonitrile solution (10 mL) was added methyl imidazole (10% v / v), with shaking at room temperature for 1 hour It stirred. The reaction solution was filtered, washed with acetonitrile (40 mL) and dichloromethane (20 mL), and dried under reduced pressure. Loading of Compound 3 was calculated by colorimetric quantitation of DMTr cation, to give the compound 1001 30 [mu] mol / g.

In a similar way, it is possible to immobilize the compound 4,5,8,9,14 synthesized in Example 1.

2) Synthesis of Compound 1002

Figure JPOXMLDOC01-appb-C000087

Compound 1002 resin support amount 62μmol / g

3) Synthesis of Compound 1003

Figure JPOXMLDOC01-appb-C000088

Compound 1003 resin support amount 52μmol / g

4) Synthesis of Compound 1004

Figure JPOXMLDOC01-appb-C000089

Compound 1004 resin support amount 53μmol / g

5) Synthesis of Compound 1005 (solid phase of the resin)

Figure JPOXMLDOC01-appb-C000090

Compound 1005 resin support amount 64μmol / g

6) Synthesis of Compound 1006

Figure JPOXMLDOC01-appb-C000091

Compound 1006 resin support amount 20 [mu] mol / g

Oligonucleotides were synthesized SEQ-1 ~ SEQ-36 shown in Table 2-4 in Example 3 Oligonucleotide synthesis following methods.

1) DNA having the amidite synthesis standard protecting groups amidite, RNA amidite, 2'OMe-RNA amidites were purchased from Proligo Reagents Corporation. Specifically, using the following.
· N6-benzoyl-5'-O-dimethoxytrityl-2 'deoxyadenosine -3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · 5'-O-dimethoxytrityl-thymidine-3'-O -N, N'-diisopropyl-2-cyanoethyl phosphoramidite · N2-tert-butyl-phenoxyacetyl-5'-O-dimethoxytrityl-2 'deoxyguanosine -3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N4-benzoyl-5'-O-dimethoxytrityl-2 'deoxycytidine -3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N6-benzoyl-5'-O-dimethoxy trityl adenosine -2'tert butyldimethylsilyl -3'-O-N, N'- diisopropyl - 2-cyanoethyl phosphoramidite · 5'-O-dimethoxytrityl-uridine -2'tert butyldimethylsilyl -3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N2- isobutyryl-5'-O - dimethoxytrityl guanosine -2'tert butyldimethylsilyl, 3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N4-benzoyl-5'-O-dimethoxytrityl-deoxycytidine -2'tert butyldimethylsilyl -3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N6-benzoyl-5'-O-dimethoxytrityl - adenosine -2'-O-methyl -3'-O-N, N ' - diisopropyl-2-cyanoethyl phosphoramidite · 5'-O-dimethoxytrityl c Jin -2'-O-methyl -3'-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N2- isobutyryl-5'-O-dimethoxytrityl - guanosine -2'-O-methyl-3 '-O-N, N'- diisopropyl-2-cyanoethyl phosphoramidite · N4-benzoyl-5'-O-dimethoxytrityl-deoxycytidine -2'-O-methyl -3'-O-N, N'- diisopropyl - 2-cyanoethyl phosphoramidite

AmNA amidites, according to the method described in the method and the following described in WO 2011/052436, was synthesized.

(1-1) (2R, 3S, 4R, 5R) -3- (tert- butyl-dimethyl-Kill) -2-hydroxymethyl-5- (5-methyl-2,4-dioxo-3,4-dihydro pyrimidine -1 (2H) - yl) -4-(2,2,2-trifluoro -N- methylacetamide) tetrahydrofuran-2-potassium carboxylate (compound 914)

Figure JPOXMLDOC01-appb-C000092

Under nitrogen atmosphere step 1 Compound 909, Compound 901 (synthesis Organic Letters, analogous to the method described in 7,1569-1572 (2005), 1300g, 2.53mol) in DMF (3.9 L) suspension in, was added dropwise TBS chloride (1717g, 11.39mol) and DMF (2.6 L) solution at an internal temperature of 5 ~ 15 ° C.. Then, sodium iodide at an internal temperature of 10 ~ 20 ℃ (1138g, 7.59mol) was added, dropwise at the same temperature N- methylimidazole (999mL, 12.7mol). After stirring for 6 hours at an internal temperature of 20 ~ 30 ° C., and allowed to stand overnight. The reaction solution was poured into a mixture of ice-water (10.4 L) and ethyl acetate (3.9 L), further ethyl acetate (2.6 L), was added water (2.6 L). The organic layer 1 mol / L hydrochloric acid (6.5 L), 10% aqueous sodium carbonate solution (6.5 L), washed successively with 10% brine (6.5 L). The solvent was distilled off under reduced pressure, the obtained residue (2.68 kg) was added methanol (2.6 L). The solvent was distilled off under reduced pressure again to give the crude product of compound 909 (2.62kg).

In methanol (6.5 L) solution of step 2 compound 910 crude compound 909 obtained in Step 1. Preparation (2.62kg), 35% hydrochloric acid (633mL, 7.59mol) at an internal temperature of 20 ~ 30 ° C. The It dropped, and stirred for 4 hours. The reaction solution was poured into a mixture of diisopropyl ether (6.5 L) and ice water (3.9 L), further diisopropyl ether (6.5 L), was added water (2.6 L). The aqueous layer was washed with diisopropyl ether (3.25L), sodium carbonate (1073g, 10.1mol) and water (6.5 L) solution of was added and the mixture was extracted with ethyl acetate (19.5 L and 6.5 L), the organic layer was dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, tetrahydrofuran was added (2.6 L) to the resulting residue. The solvent was distilled off under reduced pressure again to give the crude product of compound 910 (1.08 kg).
1 H-NMR (DMSO-d 6) δ: 0.13 (s, 6H), 0.91 (s, 9H), 1.40-1.55 (br, 1H), 1.79 (s, 3H), 2.28 (s, 3H), 3.15 -3.20 (d, J = 4.1Hz, 1H), 3.52-3.65 (m, 2H), 3.85 (s, 1H), 4.30-4.35 (d, J = 4.1Hz, 1H), 5.18-5.24 (br, 1H ), 5.64-5.70 (d, J = 7.3Hz), 7.73 (s, 1H), 11.34 (s, 1H).

Under nitrogen atmosphere step 3 Compound 911, crude compound 910 obtained in Step 2 (17.7 g) and pyridine (10.1 mL, 125 mmol) in tetrahydrofuran (80 mL) solution of an internal temperature 0 ~ 10 ° C. It was added dropwise trifluoroacetic anhydride (17.8mL, 125mmol), stirred for 1 hour. Under ice cooling the reaction solution, and poured into 20% aqueous sodium carbonate solution (112 mL), was added tetrahydrofuran (24 mL) and water (48 mL). Under ice-cooling for 20 minutes, After stirring for 1 hour at room temperature, ethyl acetate (112 mL), n-hexane (80 mL), was added 10% brine (32 mL) and water (176 mL). The organic layer 2 mol / L hydrochloric acid (80mL), 0.4mol / L hydrochloric acid (80mL), 5% aqueous sodium bicarbonate solution (80 mL), washed successively with 10% brine (80 mL). Each aqueous layer was respectively extracted with ethyl acetate (80 mL). The organic layers were combined and dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, the resulting residue was dissolved in ethyl acetate (24 mL) was added to and dissolved by heating to 60 ° C., was added n- hexane (72 mL). After cooling the resulting slurry to room temperature, after the obtained solid was filtered and washed with ethyl acetate / n-hexane (3.2mL / 60.8mL), performed daily ventilation drying, Compound 911 (15. to give 8 g, the overall yield 79.1%) from step 1.
1 H-NMR (DMSO-d 6) δ: -0.01 (2.1H, s), 0.02 (0.9H, s), 0.08 (2.1H, s), 0.09 (s, 0.9H, s), 0.86 (6.3 H, s), 0.87 (2.7H, s), 1.78 (0.9H, d, J = 0.8Hz), 1.79 (2.1H, d, J = 0.8Hz), 3.12 (0.9H, s), 3.20 (2.1 H, s), 3.61-3.57 (1.0H, m), 3.72-3.67 (1.0H, m), 3.99 (0.7H, q, J = 3.3Hz), 4.02 (0.3H, m), 4.45 (0.3H , m), 4.45 (0.3H, m), 4.52 (0.7H, dd, J = 6.8, 3.3Hz), 4.77 (0.7H, dd, J = 7.6, 6.8Hz), 5.30 (0.7H, t, J = 4.7Hz), 5.38 (0.3H, t, J = 4.7Hz), 6.37 (0.3H, m), 6.39 (0.7H, d, J = 7.6Hz), 7.73 (1.0H, s), 11.44 (0.7 H, brs), 11.5 (0.3H, brs).

Under nitrogen atmosphere step 4 Compound 912, Compound 911 (450g, 935mmol) in dimethyl sulfoxide (1.35 L) solution of, EDC (538g, 2800mmol), dimethyl sulfoxide (675 mL), pyridinium p-toluenesulfonate (235g, 935mmol ) and dimethyl sulfoxide were added sequentially (225 mL), and stirred for 2.5 hours at an internal temperature of 20 ~ 30 ° C.. Then the internal temperature 10 ~ 20 ° C. with ethyl acetate (4.5 L), was added sequentially water (2.25 L) and ethyl acetate (2.25 L). The organic layer was washed twice with water (2.25 L), the solvent was distilled off under reduced pressure, acetonitrile was added (900 mL) to the resulting residue. The solvent was distilled off under reduced pressure again to give the crude product of compound 912 (540 g).

In acetonitrile (1.8L) solution of step 5 Compound 913 crude compound 912 obtained in step 4 of (540g), 37% aqueous formalin solution (900 mL), successively added N- methylmorpholine (900 mL), It was stirred for 4 hours at an internal temperature of 70 ~ 80 ° C.. After cooling the reaction mixture to an internal temperature of 20 ~ 30 ° C., ethyl acetate (2.25 L) was added, followed by an internal temperature 10 ~ 20 ℃ 4mol / L hydrochloric acid (2.25 L) was added. The organic layer was washed twice with water (2.25 L), was obtained ethyl acetate solution containing the compound 913.

Step 6 Sodium dihydrogen phosphate dihydrate in ethyl acetate solution containing the compound 913 obtained in step 5 of compound 914 (292g, 1870mmol) in water (1.35 L) aqueous solution, squalene (898mL, 1870mmol) was successively added acetonitrile (1.35 L). Sodium chlorite at an internal temperature of 20 ~ 30 ℃ (423g, 4670mmol) was added dropwise water (2.25 L) was added and stirred for 3 hours. Then the internal temperature 10 ~ 15 0.5mol / L sodium hydroxide aqueous solution at ° C. (3.6 L), sodium thiosulfate pentahydrate (1160g, 4670mmol) added sequentially to a stirred 20 min at an internal temperature of 5 ~ 15 ° C. did. Ethyl acetate (900 mL) and water (900 mL) was added to the reaction solution, and the organic layer was washed with water (900 mL). After washing the combined aqueous layers with ethyl acetate (900 mL), was added ethyl acetate (5.4 L) and 2 mol / L aqueous hydrochloric acid solution (2.25 L) to the aqueous layer. The organic layer was washed with 10% brine (2.25 L), and dried over anhydrous sodium sulfate. The mixture is filtered, the drying agent was added to the filtrate to potassium acetate obtained was washed with ethyl acetate (1.35L) (82.5g, 841mmol) and ethanol (338 mL). The mixture was stirred for 1 hour at an internal temperature of 20 ~ 30 ° C.. The resulting slurry was obtained by filtering the solid ethyl acetate / ethanol and washed with (3860mL / 193mL), dried under aeration for 1 day, compound 914 (283 g, 53.8% overall yield from step 4) It was obtained.
1 H-NMR (DMSO-d 6) δ: -0.11 (1.8H, s), -0.09 (1.2H, s), 0.09 (1.8H, s), 0.10 (1.2H, s), 0.82 (3.6H , s), 0.83 (5.4H, s), 1.77 (1.2H, s), 1.78 (1.8H, s), 3.18 (1.2H, s), 3.33 (1.8H, s), 3.54 (1.0H, d , J = 10.8Hz), 3.68 (0.6H, d, J = 10.8Hz), 3.69 (0.4H, d, J = 10.8Hz), 4.18 (0.4H, dd, J = 8.6, 7.8Hz), 4.49 ( 0.4H, d, J = 8.6Hz), 4.51 (0.6H, d, J = 8.6Hz), 4.73 (0.6H, dd, J = 8.6, 7.8Hz), 6.1 (1H, br), 6.90 (0.4H , d, J = 7.8Hz), 6.92 (0.6H, d, J = 7.8Hz), 7.61 (0.6H, s), 7.65 (0.4H, s).

(1-2) Synthesis of T amidite

Figure JPOXMLDOC01-appb-C000093

Under nitrogen atmosphere step 1 Compound 915, Compound 914 (455mg, 0.807mmol) in pyridine (4 mL) suspension of, 1 mol / L tetrabutylammonium fluoride - tetrahydrofuran solution (0.888mL, 0.888mmol) and added dropwise, after stirring for 9 hours at an internal temperature of 60 ~ 70 ° C., were left to stand overnight at room temperature. After stirring for 9 hours at day more inner temperature 60 ~ 70 ° C., it was left to stand overnight at room temperature. EDC hydrochloride (310 mg, 1.62 mmol) and the mixture was stirred for 9 hours at an internal temperature of 60 ~ 70 ° C., add the EDC hydrochloride (310 mg, 1.62 mmol), was left to stand overnight at room temperature. After stirring for 5 hours at room temperature was added 4,4'-dimethoxytrityl chloride (547 mg, 1.61 mmol), and further 4,4'-dimethoxytrityl chloride (547 mg, 1.61 mmol) was added and stirred for 2 hours. To the reaction solution, 5% aqueous sodium bicarbonate solution (10 mL) was added, followed by extraction with ethyl acetate (10 mL), and washed three times with water (5 mL). Each water wash was extracted with ethyl acetate (5 mL). The combined organic layers were evaporated under reduced pressure, the resulting residue was purified by silica gel column chromatography - (chloroform methanol) to give compound 915 (334 mg, 69.1% yield).
1H-NMR (CDCl3) δ: 1.70 (s, 3H), 1.97 (d, J = 5.1Hz, 1H), 3.02 (s, 3H), 3.61 (d, J = 12.3Hz, 1H), 3.79 (s, 6H), 3.95 (d, J = 12.3Hz, 1H), 4.11 (s, 1H), 4.37 (d, J = 4.9Hz, 1H), 5.41 (s, 1H), 6.85 (dd, J = 8.5, 2.5 Hz, 4H), 7.23-7.36 (m, 7H), 7.45 (d, J = 7.7Hz, 2H), 7.76 (s, 1H), 8.55 (s, 1H).

According to the method according to the method described in the synthesis WO 2011/052436 step 2 compound 916 (T amidite), to synthesize a compound 916.

(1-3) A (Bz) amidite synthesis of

Figure JPOXMLDOC01-appb-C000094

Under nitrogen atmosphere step 1 Compound 917, Compound 914 (170g, 271mmol) and 6-N-benzoyl adenine (64.9g, 271mmol) in cyclopentyl methyl ether (1700 mL) suspension of, N, O-bis (trimethylsilyl ) acetamide (466mL, 1900mmol) and TMSOTf (98mL, 543mmol) and the mixture was stirred for 4 hours at 70 ~ 73 ° C.. The reaction mixture under ice-cooling, tetrahydrofuran (2920mL), 2mol / L hydrochloric acid (1700 mL) and water was added to (1020 mL), and partitioned into an organic layer and an aqueous layer, the organic layer 0.1 mol / L hydrochloric acid (1700 mL) and washed with water (1700 mL). The solvent chloroform (340 mL) to the residue obtained was distilled off under reduced pressure, and the mixture was filtered slurry obtained by stirring 20 minutes. After collected by filtration solid was washed with chloroform (510 mL), to give compound 917 by air drying (165 g, 80.9% yield).
1H-NMR (DMSO-d6) δ: -0.06 (s, 3H), 0.13 (s, 2.1H), 0.14 (s, 0.9H), 0.89 (s, 9H), 3.22 (s, 0.9H), 3.31 (s, 2.1H), 3.82 (d, J = 12.0Hz, 1H), 3.89-3.95 (m, 1H), 4.70 (d, J = 7.3Hz, 0.3H), 4.75 (d, J = 7.3Hz, 0.7H), 5.04 (t, J = 7.5Hz, 0.3H), 5.41 (brs, 0.7H), 5.49 (t, J = 8.0Hz, 0.7H), 5.55 (brs, 0.3H), 7.02 (d, J = 8.5Hz, 0.3H), 7.04 (d, J = 8.5Hz, 0.7H), 7.56 (t, J = 7.4Hz, 2H), 7.66 (t, J = 7.4Hz, 1H), 8.04 (d, J = 7.8Hz, 2H), 8.78 (s, 1H), 8.80 (s, 1H), 11.31 (s, 1H), 13.34 (brs, 1H).

Under nitrogen atmosphere Step 2 Compound 918, Compound 917 (4.75 g, 7.44 mmol) in tetrahydrofuran (25 mL) solution of, 1 mol / L tetrabutylammonium fluoride - tetrahydrofuran solution (14.9 mL, 14.9 mmol) and It dropped, and stirred for 3.5 hours at an internal temperature 60 ~ 65 ° C.. EDC hydrochloride (1.71 g, 8.92 mmol) was added and stirred for 1 hour at an internal temperature of 60 ~ 65 ° C.. The solvent was distilled off under reduced pressure, the obtained residue acetonitrile (50 mL) was added, repeated three times by distilling off the solvent under reduced pressure again to give the crude product of compound 918 (9.12 g).
1H-NMR (CDCl3) δ: 3.14 (s, 3H), 4.09 (dd, J = 13.8, 6.8Hz, 1H), 4.18 (dd, J = 14.0, 3.3Hz, 1H), 4.37 (s, 1H), 4.64 (s, 1H), 5.26 (m, 1H), 5.89 (s, 1H), 6.46 (brs, 1H), 7.52 (t, J = 7.5Hz, 2H), 7.60 (t, J = 7.3Hz, 1H ), 8.01 (d, J = 7.7Hz, 2H), 8.56 (s, 1H), 8.78 (s, 1H), 9.31 (s, 1H).

Under nitrogen atmosphere step 3 Compound 919, in dichloromethane (25 mL) solution of the crude product of Compound 918 obtained in Step 2 (9.12g), DABCO (2.09g, 18.6mmol) and 4,4'- dimethoxytrityl chloride (5.04 g, 14.9 mmol) and the mixture was stirred for 2 hours at room temperature. 4,4'-dimethoxytrityl chloride (1.26 g, 3.72 mmol) was added and stirred an additional 2 hours. The reaction mixture of 5% aqueous sodium bicarbonate solution (50 mL) and dichloromethane (50 mL) was added, the organic layer was washed with water (50ml), water wash was extracted with dichloromethane (50 mL). The combined organic layers methanol (50 mL) was added and the solvent was distilled off until the weight 60 g, methanol (50 mL) was added again and the solvent was distilled off until the weight 67 g. Methanol (25 mL) was again added, the slurry was filtered obtained was stirred at room temperature for 30 minutes. After collected by filtration solid was washed with methanol (35 mL), to give compound 919 (4.31g, 81.3% overall yield from Step 2) by air drying.
1H-NMR (DMSO-d6) δ: 2.98 (s, 3H), 3.26 (d, J = 11.0Hz, 1H), 3.42 (d, J = 11.7Hz, 1H), 3.73 (s, 6H), 4.67 ( s, 1H), 4.79 (brs, 1H), 6.14 (s, 1H), 6.19 (brs, 1H), 6.88 (d, J = 8.3Hz, 4H), 7.21-7.32 (m, 7H), 7.39 (d , J = 7.8Hz, 2H), 7.57 (t, J = 7.4 Hz, 2H), 7.67 (t, J = 7.4Hz, 1H), 8.06 (d, J = 7.4Hz, 2H), 8.53 (s, 1H ), 8.84 (s, 1H), 11.33 (brs, 1H).
1 H-NMR (CDCl 3) δ: 8.98 (1H, s), 8.81 (1H, s), 8.39 (1H, s), 8.03 (1H, d, J = 8.0 Hz), 7.63 (1H, t, J = 8.0 Hz), 7.55 (2H, t, J = 8.0 Hz), 7.46 (2H, d, J = 8.0 Hz), 7.38-7.24 (7H, m), 6.86 (4H, d, J = 8.0 Hz), 5.89 (1H, s), 4.51 (1H, s), 4.47 (1H, m), 3.91 (1H, d, J = 12.0 Hz), 3.79 (6H, s), 3.73 (1H, d, J = 12.0 Hz ), 3.15 (3H, s), 2.07 (1H, br s, 4.0 Hz).
LC-MS: UPLC 4min base 2.28 min M + H = 713

Under nitrogen atmosphere step 4 Compound 920 (A amidite), compound 919 (500 mg, 0.702 mmol) and N, N'-diisopropylethylamine (0.368mL, 2.11mmol) in pyridine (2 mL) suspension of ice under cooling, it was added dropwise 2-cyanoethyl -N, N-diisopropyl-chloro phosphoramidite Jito (0.235 ml, 1.05 mmol) and stirred for 2 hours at room temperature. The reaction mixture under ice-cooling, was added 5% aqueous sodium hydrogen carbonate solution (5 mL), and extracted with ethyl acetate (5 mL). The organic layer was washed twice with 3% aqueous sodium chloride solution (5 mL), wash each extracted with ethyl acetate (5 mL), and dried over sodium sulfate the combined organic layers. The solvent was distilled off under reduced pressure, the resulting residue was purified by silica gel column chromatography (ethyl acetate) to give compound 920 (391 mg, 61.0% yield).
1H-NMR (DMSO-d6) δ: 0.87 (d, J = 6.8Hz, 2H), 0.92 (d, J = 6.5Hz, 4H), 1.06 (d, J = 6.8Hz, 2H), 1.08 (d, J = 6.8Hz, 4H), 2.55 (dd, J = 11.7, 5.4Hz, 1.3H), 2.70 (m, 0.7H), 2.99 (s, 2H), 3.01 (s, 1H), 3.18 (d, J = 11.5Hz, 0.7H), 3.22 (d, J = 11.5Hz, 0.3H), 3.43-3.57 (m, 4.3H), 3.65-3.70 (m, 0.7H), 3.72 (s, 2H), 3.73 ( s, 4H), 4.98 (s, 1H), 5.04 (d, J = 4.8Hz, 0.3H), 5.12 (d, J = 7.8Hz, 0.7H), 6.28 (s, 0.7H), 6.29 (s, 0.3H), 6.85-6.89 (m, 4H), 7.21-7.31 (m, 7H), 7.36-7.39 (m, 2H), 7.57 (t, J = 7.5Hz, 2H), 7.66 (t, J = 7.3 Hz, 1H), 8.06 (d, J = 7.5Hz, 2H), 8.50 (s, 0.3H), 8.52 (s, 0.7H), 8.83 (s, 1H), 11.31 (brs, 1H).
31P-NMR (DMSO-d6) δ: 150.13 (s, 0.3H), 150.42 (s, 0.7H).

(1-4) Synthesis of G (Pac) amidite

Figure JPOXMLDOC01-appb-C000095

Under nitrogen atmosphere step 1 Compound 921, Compound 914 (15.0 g, 26.6 mmol) and guanine (4.02 g, 26.6 mmol) N in cyclopentyl methyl ether (135 mL) suspension of, O- bis (trimethylsilyl ) acetamide (65.1ML, 266 mmol) and cyclopentyl methyl ether (7.5 mL) was added and after stirring for 10 minutes at an inner temperature of 60 ~ 70 ℃, TMSOTf (11.83g, 53.20mmol) and cyclopentyl methyl ether (7 .5ML) and the mixture was stirred for 2 hours. The reaction mixture ethyl acetate (150 mL) at an internal temperature of 20 ~ 30 ° C. was added, further internal temperature 15 ~ 2 mol / L hydrochloric acid at 30 ° C. (75 mL), tetrahydrofuran (150 mL) and water (75 mL) was added, the organic layer was washed with water It was washed twice with (150mL). Wash combined and extracted with ethyl acetate (150 mL), washed with water (75 mL). The combined organic layers were evaporated under reduced pressure, ethyl acetate (37.5 mL) and n- hexane (112.5 mL) was added to the obtained residue and stirred at room temperature for 20 minutes. The resulting slurry was filtered and the filtrate collected solid with ethyl acetate -n- hexane: After washing with (1 9,75mL), the compound 921 by air drying (14.35 g, 91.8% yield) Obtained.
1H-NMR (DMSO-d6) δ: -0.09 (3H, s), 0.11 (3H, s), 0.85 (9H, s), 3.10 - 3.60 (4H, m), 3.74 (1H, dd, J = 11.8 , 6.8Hz), 3.90 (1H, dd, J = 11.9, 9.4Hz), 4.65 (1H, m), 5.09 (1H, t, J = 8.2Hz), 6.50 - 6.70 (3H, m), 8.00 (1H , d, J = 9.0Hz), 10.74 (1H, s), 13.24 (1H, brs).

Under nitrogen atmosphere Step 2 Compound 922, Compound 921 (14.0 g, 23.9 mmol) and N- methylimidazole (7.60mL, 95.4mmol) N of the N'- dimethylacetamide (70 mL) solution , 1 mol / L tetrabutylammonium fluoride - tetrahydrofuran solution (28.6 mL, 28.6 mmol) and N, N'-dimethylacetamide and (14 mL) was added, and stirred for 8 hours at an internal temperature of 70 ~ 80 ° C.. EDC hydrochloride (13.72g, 71.55mmol) and N, N'-dimethylacetamide and (7 mL) was added at an internal temperature of 20 ~ 30 ° C., and stirred for 4 hours. To the reaction mixture N- methylimidazole (7.60mL, 95.4mmol) was added to, TBS chloride (14.38g, 95.40mmol) was added at an internal temperature of 20 ° C. and stirred for 2 hours at room temperature. Ethyl acetate (280 mL) and 10% brine (140 mL) was added to the reaction solution, and the organic layer was washed twice with water (140 mL). Wash were each extracted with ethyl acetate (140 mL). The combined organic layers were evaporated under reduced pressure, acetonitrile (56 mL) to the resulting residue, isopropyl alcohol (28 mL) and water (266 mL) at room temperature, and the mixture was stirred for 1 hour at an internal temperature of 0 ~ 10 ° C.. The resulting slurry was filtered and the filtrate collected solid was acetonitrile - water: After washing with (1 9,70mL), dried under reduced pressure at 60 ° C., compound 922 (7.71 g, yield: 74.1% ) was obtained.
1H-NMR (DMSO-d6) δ: -0.09 (3H, s), 0.10 (3H, s), 0.81 (9H, s), 2.92 (3H, s), 3.89 (2H, dd, J = 33.0, 12.7 Hz), 4.33 (2H, s), 5.67 (1H, s), 5.93 (1H, brs), 6.54 (2H, brs), 7.69 (1H, s), 10.72 (1H, brs).

Under nitrogen atmosphere step 3 Compound 923, Compound 922 (7.50 g, 17.2 mmol) in pyridine (37.5mL, 464mmol) suspension, internal temperature 10 ~ 20 ° C. with trimethylsilyl chloride (9.33 g, 85 .9Mmol) was added dropwise and stirred for 30 minutes at room temperature. Then the internal temperature 0 ~ 5 ° C. with phenoxyacetyl chloride (3.52 g, 20.6 mmol) was added dropwise, and stirred for 1 hour at room temperature. The reaction solution was diluted with ethyl acetate (150 mL), was added dropwise a mixed solution of 10% brine at an internal temperature of 0 ~ 10 ℃ (37.5mL) and concentrated hydrochloric acid (30.0 mL). The organic layer was washed twice with 1 mol / L hydrochloric acid (75 mL) and water (75 mL), then ethyl acetate (37.5 mL) and 2 mol / L hydrochloric acid methanol solution (38.7 mL, 77.4 mmol) were added sequentially, It was stirred at room temperature for 1 hour. The resulting slurry methanol (15 mL) was added and after stirring for 30 minutes at room temperature, filtered and the filtrate collected solid was washed with ethyl acetate (45 mL), compound 923 (5.51 g by air-drying, yield to obtain the rate 70.3%).
1H-NMR (DMSO-d6) δ: 2.95 (3H, s), 3.68 (1H, d, J = 13.6Hz), 3.82 (1H, d, J = 13.3Hz), 4.35 (1H, s), 4.41 ( 1H, s), 4.92 (2H, s), 5.80 (1H, s), 6.99 (3H, m), 7.32 (2H, m), 8.19 (1H, s), 11.82 (2H, br).

Under nitrogen atmosphere step 4 Compound 924 (G amidite), compound 923 (500 mg, 1.10 mmol) in dimethylacetamide (3.5 mL) was added 4,4'-dimethoxytrityl chloride (1.11 g, 3 .29Mmol) and DABCO (369 mg, 3.21 mmol) and the mixture was stirred for 2.5 hours at room temperature. DABCO in the reaction solution 10 ° C. or less (369 mg, 3.21 mmol) and 2-cyanoethyldiisopropylchlorophosphoroamidite (0.587mL, 2.63mmol) and the mixture was stirred for 1 hour at room temperature. The reaction mixture in ethyl acetate (10 mL), 5% aqueous sodium hydrogen carbonate solution (2.5 mL) and 10% brine (2.5 mL) was added and the organic layer was washed twice with 10% brine (5 mL). Washing solution was extracted with ethyl acetate (2.5 mL) combined. After drying the organic layer over anhydrous sodium sulfate combined, the solvent was distilled off under reduced pressure, the resulting residue was purified by silica gel column chromatography (hexane / ethyl acetate), compound 924 (720 mg, ethyl acetate 9.9 wt% containing, to obtain a yield 61.7%).
1H-NMR (DMSO-d6) δ: 11.87 (1.0H, br s), 11.77 (1.0H, br s), 8.07 (1.0H, s), 7.40 (1.9H, t, J = 7.4 Hz), 7.35 -7.23 (9.0H, m), 7.02-6.97 (3.0H, m), 6.93-6.88 (4.0H, m), 6.08 (1.0H, s), 4.91 (2.0H, s), 4.78 (1.0H, s), 4.64 (0.7H, d, J = 8.8 Hz), 4.59 (0.3H, d, J = 6.0 Hz), 3.75 (4.2H, s), 3.74 (1.8H, s), 3.72-3.60 (0.6 H, m), 3.60-3.49 (1.3H, m), 3.48-3.39 (1.4H, m), 3.21 (0.7H, dd, J = 15.4, 11.6 Hz), 2.98 (0.9H, s), 2.97 ( 2.1H, s), 2.70 (0.6H, dd, J = 10.1, 5.4 Hz), 2.58 (1.4H, t, J = 5.9 Hz), 1.09-1.05 (6.0H, m), 0.91-0.83 (6.0H , m).
31P-NMR (CDCl3) δ: 148.90, 149.98

(1-5) MeC (Bz) amidite synthesis of

Figure JPOXMLDOC01-appb-C000096

Compound 915 108.1 g of Step 1 compound 925 (. 4.2eq) (purity: 92.53%, content of 100 g, 0.167 mol), DMF 300 ml, imidazole 47.8 g, TBS chloride 51.6 g (2. 05eq.) was 23 hours at nearby charged 25 ° C.. Ethyl acetate 600ml, adding water 600ml carry out a liquid separation, the aqueous layer was re-extracted with ethyl acetate 300 ml. The organic layers were combined, washed with 5% aqueous sodium hydrogen carbonate solution 600 ml, 5% brine 600 ml, was collected and the solvent. After toluene 500 ml × 3 times solvent substitution for the purpose of removal of TBSOH, amorphous loosen those solidified to obtain a compound 925 of interest (132.6 g, crude yield 111.2%).
1H-NMR (CDCl3) δ: 8.33 (1H, s), 7.89 (1H, s), 7.41 (2H, d, J = 7.0 Hz), 7.33-7.21 (7H, m), 6.82 (4H, dd, J = 8.8, 5.6 Hz), 5.43 (1H, s), 4.50 (1H, s), 4.04 (1H, s), 3.87 (1H, d, J = 11.8 Hz), 3.789 (3H, s), 3.787 (3H , s), 3.41 (1H, d, J = 11.8 Hz), 3.00 (3H, s), 1.56 (3H, s), 0.75 (9H, s), 0.04 (2H, s), -0.04 (2H, s ).

Compound 925 Step 2 Compound 926 132.6 g (0.167 mol equivalent), acetonitrile 800 ml, triethylamine 50.7 g (3 eq.), 4-dimethylaminopyridine 2.0g (0.1eq.), 2 ', 4' , 6'-triisopropyl chloride 65.8 g (1.3 eq.) and the mixture was stirred for 22 hours at around 25 ° C.. Was stirred for 2 hours at around 25 ° C. was added 25% aqueous ammonia 800 ml. The acetonitrile was coarsely collected, ethyl acetate 400ml, was added to 400ml of water to carry out a liquid separation, the aqueous layer was re-extracted with ethyl acetate 300 ml. The organic layers were combined, subjected to 5% saline 400 ml × 2 washes were collected and the solvent. Loosen those solidified amorphous yield the desired compound 926 (192.8g, crude yield 161.9% from compound 915).
1H-NMR (CDCl3) δ: 7.97 (1H, s), 7.53 (2H, d, J = 7.2 Hz), 7.35-7.25 (7H, m), 6.83 (4H, dd, J = 8.8, 6.8 Hz), 5.51 (1H, s), 4.46 (1H, s), 4.19 (1H, s), 3.88 (1H, d, J = 11.7 Hz), 3.79 (6H, s), 3.39 (1H, d, J = 11.7 Hz ), 3.02 (3H, s), 1.85 (3H, s), 1.66 (3H, s), 0.74 (9H, s), 0.04 (2H, s), -0.04 (2H, s).

Compound 926 Step 3 Compound 927 192.8g (0.167mol equivalent), DMF 500 ml, benzoic acid anhydride 75.6 g (2 eq.) Was added and stirred for 22 hours at around 25 ° C.. Ethyl acetate was added 1000ml, 5% sodium hydrogen carbonate 1000ml carry out a liquid separation, the aqueous layer was re-extracted with ethyl acetate 500 ml. The organic layers were combined, washed with 5% aqueous sodium hydrogen carbonate solution 500 ml, 5% brine 500 ml, to give a solvent recovered crude product of compound 927. Silica gel 1.3 kg, was purified by developing solvent hexane / ethyl acetate = 8/2 → 6/4, amorphous loosen those solidifying the target compound 927 (124.1g, 91% yield from Compound 915 ) was obtained.
1H-NMR (CDCl3) δ: 8.33 (2H, d, J = 7.2 Hz), 8.05 (1H, s), 7.53 (1H, dd, J = 7.4, 7.4 Hz), 7.49-7.41 (5H, m), 7.35-7.28 (7H, m), 7.25 (1H, m), 6.84 (4H, dd, J = 8.8, 6.4 Hz), 5.49 (1H, s), 4.51 (1H, s), 4.10 (1H, s) , 3.90 (1H, d, J = 11.7 Hz), 3.803 (3H, s), 3.800 (3H, s), 3.42 (1H, d, J = 11.7 Hz), 3.11 (3H, s), 1.85 (3H, s), 0.74 (9H, s), 0.04 (2H, s), -0.04 (2H, s).

Compound 927 Step 4 Compound 928 124.1g (0.152mol), tetrahydrofuran 869Ml, stirring was carried out for 2 hours added 1 mol / L tetrabutylammonium fluoride / tetrahydrofuran 182ml (1.2eq.). The solvent was recovered, separated and was conducted by adding ethyl acetate 620 ml, 5% aqueous sodium bicarbonate 620 ml. The washed solvent was recovered with 5% brine 620 ml. After toluene 620 ml × 3 times solvent substitution for the purpose of removal of TBSOH, amorphous loosen those solidified to give desired compound 928 a (119.2 g, 119% yield from Compound 927).
1H-NMR (CDCl3) δ: 13.44 (1H, br s), 8.32 (2H, d, J = 7.5 Hz), 7.92 (1H, s), 7.55 (1H, dd, J = 7.3, 7.3 Hz), 7.50 -7.43 (4H, m), 7.40-7.30 (7H, m), 7.26 (1H, m), 6.86 (4H, dd, J = 8.8, 3.6 Hz), 5.46 (1H, s), 4.37 (1H, br .s), 4.16 (1H, s), 3.92 (1H, d, J = 12.3 Hz), 3.803 (3H, s), 3.800 (3H, s), 3.57-3.42 (4H, m), 3.63 (1H, d, J = 12.3 Hz), 3.03 (3H, s), 1.90 (3H, s).

Step 5 Compound 929 (MeC (Bz) amidite) Compound 928 108.2 g of (0.138 mol equivalent) was charged dichloromethane 564ml, N, N'- diisopropylethylamine 35.7g of (2 eq.), 2 at 5 ° C. or less - it was added dropwise cyanoethyl diisopropylchlorophosphoramidite phosphoramidite 49.0g (1.5eq.). Thereafter, the mixture was stirred for 2 hours at around 25 ° C.. And 5% aqueous sodium hydrogen carbonate solution 564ml was added for liquid separation to obtain a crude product MeC (Bz) and the solvent was recovered. Silica gel 2.3 kg, was purified by developing solvent hexane / ethyl acetate = 7/3 → 5/5, amorphous loosen those solidifying the target compound 929 (MeC (Bz) amidites, 105.2 g, Compound 927 84% yield from two diastereomers ratio (calculated from the integral value of the HPLC) = 54: 46) was obtained.
1H-NMR (CDCl3) δ: (major diastereomer) 13.47 (1H, br s), 8.33 (2H, d, J = 7.4 Hz), 7.98 (1H, s), 7.52 (1H, dd, J = 7.4, 7.4 Hz), 7.50-7.42 (4H, m), 7.37-7.24 (8H, m), 6.86 (4H, dd, J = 8.8, 6.6 Hz), 5.52 (1H, s), 4.64 (1H, d, J = 6.9 Hz), 4.37 (1H, s), 3.92 (1H, d, J = 11.7 Hz), 3.812 (3H, s), 3.807 (3H, s), 3.57-3.42 (4H, m), 3.51 (1H, d, J = 11.7 Hz), 3.02 (3H, s), 2.36 (2H, t, J = 5.9 Hz), 1.77 (3H, s), 1.14 (6H, d, J = 6.8 Hz), 1.05 (6H, d, J = 6.8 Hz). (minor diastereomer) 13.47 (1H, br s), 8.33 (2H, d, J = 7.3 Hz), 7.98 (1H, s), 7.56 (1H, dd, J = 7.3, 7.3 Hz), 7.47-7.43 (4H, m), 7.35-7.28 (7H, m), 7.22 (1H, m), 6.86 (4H, dd, J = 8.8, 5.5 Hz), 5.51 (1H, s), 4.60 (1H, d, J = 4.3 Hz), 4.43 (1H, s), 3.88 (1H, d, J = 11.7 Hz), 3.802 (3H, s), 3.798 (3H, s), 3.64 (1H, m) , 3.52 (1H, d, J = 11.7 Hz), 3.52-3.44 (3H, m), 3.04 (3H, s), 2.60-2.52 (2H, m), 1.79 (3H, s), 1.11 (6H, d , J = 6.8 Hz), 0.99 (6H, d, J = 6.8 Hz).
31P-NMR (CDCl3) δ: 151.24, 151.05.

2) Solid phase synthesis All oligonucleotides using AKTA Oligopilot10 the (GE Healthcare), and synthesized by the phosphoramidite method. Monomers using amidite obtained above amidite synthesis was prepared 0.1M acetonitrile solution. Coupling time was between 5-10 minutes, using four equivalents of amidite to condensation of one monomer. The PO oxidized using iodine / pyridine / water /=12.7/9/1(w/v/v), acetonitrile / 3-picoline in the PS oxide 0.2 mol / L phenylacetyl disulfide 1/1 (v / v) solution was used.

3) Deprotection I (excision from the resin, deprotection of the base and phosphoric acid)
Excision of DNA oligonucleotides (SEQ-1, 12) by using a 0.2 mol / L sodium hydroxide (methanol / water = 4/1) and shaken at room temperature for 15 hours. After washing the resin with 50% aqueous ethanol, and concentrated under reduced pressure to neutralize the filtrate with 5% aqueous citric acid.
Excision of SEQ-2 ~ 6,13 ~ 19,27 ~ 29,33,34,36 are using 28% aqueous ammonia / methylamine / ethanol = 6/2/2 (v / v), 24 at room temperature It was shaken time. After washing the resin with 50% aqueous ethanol, after which the filtrate was concentrated under reduced pressure to give a white powder in a freeze-dried.

4) Deprotection II (deprotection of 2'-TBS group)
A white powder was obtained, N- methylpyrrolidone / triethylamine / 3-hydrogen fluoride triethylamine = 6/1/2 (v / v) was stirred for 1.5 hours under 65 ° C. In addition. Precipitate and stirred vigorously for 10 minutes at room temperature the same amount of ethoxytrimethylsilane was added to the reaction solution was obtained. After centrifugation at 2500 × g (2 minutes), it was carefully removed and the organic solvent layer. After vigorously stirred with diethyl ether resulting precipitate was removed and the organic solvent is performed similarly centrifuged to obtain a crude RNA body (white solid).

5) Purification SEQ-1, 12 was subjected to purification by anion exchange mode. SEQ-2 ~ 6,13 ~ 19,27 ~ 29,33,34,36 was subjected to purification by reverse phase mode.

Conditions Mobile phase A solution of the anion-exchange mode: 20mmol / L Tris-HCl (pH8) / 1mmol / L EDTA
Solution B: 20mmol / L Tris-HCl (pH8) / 1mmol / L EDTA 2.0M NaBr
B concentration gradient: 10-80%
Column: SOURCE 30Q (26/10) (GE Healthcare Co., Ltd.)
Flow rate: 19mL / min
Column temperature: room temperature detection UV: 260nm

Conditions of reverse phase mode, SEQ-2 selects the purification conditions 2, SEQ-3 ~ 6,13 ~ 19,27 ~ 29,33,34,36 chose purification conditions 1.

Purification conditions 1
Mobile phase A solution: 10mmol / L TEAA (pH7)
Solution B: 10mM TEAA (pH7) / acetonitrile = 1/1 (v / v)
B concentration gradient: 20-60%
Column: YMC Hydrosphere C18 (20x100mm) (manufactured by YMC Co., Ltd.)
Flow rate: 15mL / min
Column temperature: room temperature detection UV: 260nm

Purification conditions 2
Mobile phase A solution: 50 mmol / L phosphate buffer (pH 8)
Solution B: Acetonitrile B concentration gradient: 30-60%
Column: YMC-Pack C4 (20x100mm) (manufactured by YMC Co., Ltd.)
Flow rate: 15mL / min
Column temperature: room temperature detection UV: 260nm

6) desalting and lyophilization the resulting oligonucleotide purification oligonucleotide using VivaSpin20 (MWCO 3000) (Sartorius Corp.) to remove salt components contained in the fraction by repeated ultrafiltration. Then, to obtain an oligonucleotide of interest in a freeze-dried as a powder.

7) Each in PO oxide for oligonucleotide using iodine / pyridine / water /=12.7/9/1(W/v/v), the PS oxide 0.2 mol / L phenylacetyl disulfide in acetonitrile / using a 3-picoline 1/1 (v / v) solution.
(7-1) Introduction of synthetic 5 'end of the α- tocopherol of SEQ-2 (Compound 204) was used 5'-Tocopherol-CE Phosphoramidite (purchased from link technologies Inc.).

(7-2) SEQ-3, or 4 sugar derivative (GalNac derivative, compound 205) having an interaction with the asialoglycoprotein receptor of the synthetic 5 'end of the (linker L6) is the introduction of using Compound 1.

(7-3) SEQ-5, 6 or 13 synthetic 3 'sugar derivatives (GalNac derivative, compound 205) having an interaction with the asialoglycoprotein receptor of terminal synthetic solid support the introduction of the (linker L7) compound 1001 was used as a.

(7-4) was terminated oligonucleotide synthesis in a state that SEQ-14 to expose the amino group at the 5 'ends using MMT-Hexylaminolinker amidite commercially available synthetic Sigma Aldrich (linker L8). Thereafter, the introduction of sugar derivatives (GalNac derivative, compound 205) having an interaction with the asialoglycoprotein receptor by condensation with compound 2 using HBTU, cut, subjected to deprotection.

(7-5) SEQ-15, 16 or 28 synthetic solid support in the introduction of the synthetic 3 'end of the asialoglycoprotein receptor and a sugar derivative having an interaction (GalNac derivative, compound 205) of (linker L9) compound 1002 was used as a.

(7-6) SEQ-29 sugar derivatives (GalNac derivative, compound 205) having an interaction with the asialoglycoprotein receptor of synthetic 3 'end of the (linker L9) Compound 1002 as a synthetic solid phase support for the introduction of Using. Amidite reagent for the introduction of the LNA (compound 203) was purchased from Cosmo Bio Co., Ltd.

(7-7) SEQ-17 (linker L10), 18 (linker L11), 19 with synthetic 3 'interact with the asialoglycoprotein receptor of the end of (linker L12) or 33 (linker L13) sugar derivatives (GalNac derivative, compound 205) as a synthetic solid phase support in the introduction of, with each compound 1003,1004,1005 or 1006.

(7-8) SEQ-34 sugar derivatives (GalNac derivative, compound 205) having an interaction with the asialoglycoprotein receptor of synthetic 3 'end of the (linker L9L14) Compound 1002 as a synthetic solid phase support for the introduction of Using. Moreover, the introduction of disulfide linkages using Thiol-Modifier-C6-S-S CE Phosphoroamidete reagents available from LinkTechnology Corporation.

(7-9) obtaining a SEQ-35 oligonucleotide having an amino group at the 5 'ends using MMT-Hexylaminolinker amidite commercially available synthetic Sigma Aldrich (linker L15). Then, it is possible to introduce a sugar derivative having an interaction with the asialoglycoprotein receptor by condensation with compound 20 (GalNac derivative, compound 205).

(7-10) a SEQ-36 oligonucleotide having an amino group at the 5 'ends using MMT-Hexylaminolinker amidite commercially available synthetic Sigma Aldrich (linker L16) was synthesized on the resin. The resin (14 mg, 0.5 [mu] mol equivalent) with respect to, NMP solution (0.15mL, 4μmol equivalent) of compound 21 were added to heat for one day under 50 ° C., the interaction with the asialoglycoprotein receptor sugar derivatives (GalNac derivative, compound 205) having installs a.

(7-11) oligonucleotides of the purchase oligonucleotide (SEQ-26) was purchased from, Inc. Gene Design Inc. (Osaka, Japan).

8) oligonucleotides purity analysis resulting oligonucleotide that measured molecular weight by UPLC / MS measurement is consistent with the theoretical molecular weight, it was confirmed that the sequence of interest is synthesized.
Xevo G2 Tof System (manufactured by Waters)
Column: Aquity OST C18 (2.1x50mm) (manufactured by Waters)
Mobile phase A solution: 200 mM 1,1,1,3,3,3-hexafluoro-2-propanol / 8 mM triethylamine solution B: methanol B concentration gradient: 10-30% (10min)
Temperature: 50 ℃
Flow rate: 0.2mL / min

It relates SEQ-1 ~ 6,12 ~ 19,27 ~ 29,33,34,36, after purification, by actual measurement value and the theoretical value of the molecular weight by LC / MS measurement match, the sequence of interest is synthesized It was confirmed. The results are shown in Table 1.



Figure JPOXMLDOC01-appb-T000097

9) double stranded nucleic acids in preparation SEQ-7 double stranded nucleic acid ~ 11, 20 ~ 25, 30 ~ 32 were prepared as follows. After mixing equimolar amounts of each oligonucleotide to a concentration 0.5 mmol / L solution by adding distilled water. Then 10 minutes allowed to stand under 60 ° C., to obtain a double-stranded nucleic acid by causing naturally cooled to room temperature. Confirmation of duplex formation was performed by size exclusion chromatography.
Column: YMC-PAC Diol-120 (4.6x300mm) (manufactured by YMC Co., Ltd.)
Mobile phase: 10% acetonitrile containing 1xPBS solution flow rate 0.5 mL / min
Temperature: room temperature is likewise possible to prepare the double-stranded nucleic acid of SEQ-37 ~ 40.

10) The sequence synthesized oligonucleotides oligonucleotides shown in Tables 2-4.

Figure JPOXMLDOC01-appb-T000098

Figure JPOXMLDOC01-appb-T000099

Figure JPOXMLDOC01-appb-T000100

Figure JPOXMLDOC01-appb-C000101

Figure JPOXMLDOC01-appb-C000102

Figure JPOXMLDOC01-appb-C000103

Figure JPOXMLDOC01-appb-C000104

Figure JPOXMLDOC01-appb-C000105

Of ACSL1 in mouse liver of double-stranded oligonucleotides in vivo activity evaluation single stranded antisense oligonucleotides (SEQ-1) and the sense strand of double-stranded oligonucleotide containing tocopherol (SEQ-7) containing a comparative example tocopherol knockdown activity evaluation by the mRNA expression level changes were carried out. 4 weeks C57BL / 6J (male 7-week-old, CLEA Japan, Inc.), hyperlipidemia fat diet: diet-induced obesity by giving (60% kcal fat TestDiet Co.) 4 weeks of (DIO) mice were produced. To DIO mice, saline (Otsuka saline Note, Otsuka Pharmaceutical Factory) solution of SEQ-7 dissolved in about 0.2mL to, 1.1 mg / kg, 3 doses per mouse individuals with antisense oligo amount conversion was intravenously administered or subcutaneous administration so that .3mg / kg or 10 mg / kg. As a positive control, a solution of SEQ-1, the dose per individual mice were administered so that 10 mg / kg. Liver tissue was collected under Somnopentyl anesthesia after administration 7 days. RNA extraction from the liver was carried out in the manufacturer's recommended protocol as using the RNeasy 96 Universal Tissue Kit (Qiagen Inc.). The 1000ng of the obtained RNA, using SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (Life Science Co., Ltd.), to obtain cDNA by performing the reverse transcription according to standard protocols. Quantitative PCR was performed using a SYBR Premix Ex Taq II (Takara Bio Inc.).
Primers were used to measure the expression level of mouse ACSL1 is
Fw primer: AGGTGCTTCAGCCCACCATC (SEQ ID NO: 3)
Rv primer: AAAGTCCAACAGCCATCGCTTC (SEQ ID NO: 4)
Using,
Primers were used to measure the expression level of mouse GAPDH is
Fw primer: TGTGTCCGTCGTGGATCTGA (SEQ ID NO: 5)
Rv primer: TTGCTGTTGAAGTCGCAGGAG (SEQ ID NO: 6)
It was used. Knockdown efficiency for mRNA reduction of Acsl1 normalized with Gapdh, shown as a percentage of saline-administered group.
GAPDH was used as an endogenous control, primer used was the same as in vitro experiments. The results are shown in Figure 1. The mRNA amount of ACSL1 normalized with GAPDH, showed the ratio of physiological saline-administered group. As a result, double-stranded oligonucleotide containing tocopherol (SEQ-7) is improved by about 9 times the knockdown activity was confirmed in comparison to intravenous administration and single-stranded antisense oligonucleotides (SEQ-1) It was, but improving knockdown activity in subcutaneous administration was not confirmed.

The double-stranded knockdown activity present embodiment of the double-stranded oligonucleotide of oligo in vivo activity evaluation nucleotide (4-1) The present invention of intravenous administration or subcutaneous administration of Example 4 the present invention, single-stranded antisense oligonucleotide nucleotide ACSL1 in mouse liver (SEQ-1) a double-stranded oligonucleotide of the present invention containing sugar derivatives (GalNAc derivative) having interaction with the asialoglycoprotein receptor the 5 'end of the sense strand (SEQ-8) knock-down activity evaluation of by the mRNA expression level changes were carried out. 4 weeks C57BL / 6J (male 7-week-old, CLEA Japan, Inc.), hyperlipidemia fat diet: diet-induced obesity by giving (60% kcal fat TestDiet Co.) 4 weeks of (DIO) mice were produced. To DIO mice, saline (Otsuka saline Note, Otsuka Pharmaceutical Factory) solution of SEQ-8 ​​dissolved in, 2.2 mg / kg to about 0.2 mL, the dose per mouse individuals antisense strand amount conversion, 6 was intravenously administered or subcutaneous administration so that .6mg / kg and 20 mg / kg. As a positive control, a solution of SEQ-1, the dose per individual mice were administered so that 20 mg / kg. Liver tissue was collected under Somnopentyl anesthesia after administration 7 days, were carried out activity evaluation. The results are shown in Figure 2. As a result, double-stranded oligonucleotide of the invention (SEQ-8) is also improved in a dose-dependent manner knockdown activity in both intravenous and subcutaneous administration, single-stranded antisense oligonucleotides (SEQ-1) improvement in comparison to about 9 times the knockdown activity and was confirmed.

(4-2) asialo the 5 'terminus or 3' terminus of the binding position or different present invention having a phosphate binding double-stranded oligonucleotide knockdown activity single-stranded antisense oligonucleotides (SEQ-1) sense strand been knockdown activity evaluation by mRNA expression level changes in ACSL1 in mouse liver sugar derivative having an interaction with glycoprotein receptor double-stranded oligonucleotide of the present invention comprising (GalNAc derivative) (SEQ-8 ​​~ 11) . 4 weeks C57BL / 6J (male 7-week-old, CLEA Japan, Inc.), hyperlipidemia fat diet: diet-induced obesity by giving (60% kcal fat TestDiet Co.) 4 weeks of (DIO) mice were produced. To DIO mice, saline (Otsuka saline Note, Otsuka Pharmaceutical Factory) either SEQ-8 ​​~ 11 dissolved in the solution, about 0.2 mL, the dose per mouse individuals antisense strand equivalent amount 2.2mg It was administered subcutaneously as a /kg,6.6mg/kg and 20 mg / kg. As a positive control, a solution of SEQ-1, the dose per individual mice were administered so that 20 mg / kg. Liver tissue was collected under Somnopentyl anesthesia after administration 7 days, were carried out activity evaluation. The results are shown in Figure 3. As a result, double-stranded oligonucleotides of the present invention, in subcutaneous administration, no difference in knockdown activity by the difference in the binding position and the phosphate binding of the sugar derivative having an interaction with the asialoglycoprotein receptor, single-stranded improvement of antisense oligonucleotides (SEQ-1) as compared to about 9 times the knockdown activity was confirmed.

(4-3) In the knockdown activity present embodiment of the double-stranded oligonucleotide of the present invention different from the phosphate bonds, asialoglycoprotein single stranded antisense oligonucleotides (SEQ-12) to the 3 'end of the sense strand sugar derivatives having interaction with receptors was performed knockdown activity evaluation by mRNA expression level changes in ACSL1 in mouse livers double-stranded oligonucleotides (SEQ-21 or 22) of the present invention comprising (GalNAc derivative). 4 weeks C57BL / 6J (male 7-week-old, CLEA Japan, Inc.), hyperlipidemia fat diet: diet-induced obesity by giving (60% kcal fat TestDiet Co.) 4 weeks of (DIO) mice were produced. To DIO mice, saline (Otsuka saline Note, Otsuka Pharmaceutical Factory) solution of SEQ-21 or 22 was dissolved in about 0.2mL to, 2 mg / kg and 4mg doses per mouse individuals antisense strand amount conversion / was administered intravenously or subcutaneously such that kg. As a positive control, a solution of SEQ-12, the dose per individual mice were administered so that 20 mg / kg. Liver tissue was collected under Somnopentyl anesthesia in 3 days and 7 days after administration, was carried out activity evaluation. The results are shown in Figure 4. As a result, double-stranded oligonucleotide of the invention (SEQ-21 or 22) is improved in a dose-dependent manner knockdown activity, phosphate bond linking the sugar derivative having an interaction with the asialoglycoprotein receptor There was no difference in knockdown activity by differences, showed comparable activity at a dose of one-tenth as compared with the single-stranded antisense oligonucleotides (SEQ-12).

(4-4) In a different knockdown activity present embodiment of the double-stranded oligonucleotide of the present invention the linker site structure, and asialoglycoprotein receptor was attached via various linker structures at the 3 'end of the sense strand knockdown activity evaluation by mRNA expression level changes in ACSL1 in mouse livers double-stranded oligonucleotides (SEQ-20,23 ~ 25) of the present invention which comprises a sugar derivative having an interaction (GalNAc derivatives) was carried out. C57BL / 6J (male 8 weeks old, CLEA Japan) to saline (Otsuka saline Note, Otsuka Pharmaceutical Factory) double-stranded oligonucleotide was dissolved in a solution, about 0.2 mL, dose per individual mouse 2 times a week every other such that the 2 mg / kg and 4 mg / kg in the antisense strand weight basis, was administered subcutaneously. 7 days after the last dose, the liver tissue was taken under Somnopentyl anesthesia, it was carried out activity evaluation. The results are shown in Figure 5. As a result, the double-stranded oligonucleotide set of the present invention (SEQ-20,23 ~ 25), a large difference in knockdown activity by the difference in the linker moiety structure linking the sugar derivative having an interaction with the asialoglycoprotein receptor It was not observed. Further, any of the double-stranded oligonucleotide was also improved in a dose-dependent manner knockdown activity.

(4-5) In the knockdown activity comparative embodiment of the double-stranded oligonucleotide and the single stranded oligonucleotide of the present invention, a sugar derivative having an interaction with the asialoglycoprotein receptor to the 3 'end of the sense strand (GalNAc knock by mRNA expression level change in ApoB in mouse livers double-stranded oligonucleotides (SEQ-31) and 3 'end antisense oligonucleotides comprising asialoglycoprotein receptor (SEQ-29) of the present invention including derivative) It was down activity evaluation. For comparison, antisense oligonucleotides (SEQ-26), double-stranded oligonucleotides (SEQ-30) that does not include a sugar derivative having an interaction with the asialoglycoprotein receptor, asialoglycoprotein the 3 'end of the antisense strand protein receptor and To誘 c conductor (GalNAc derivative) having an interactive using double-stranded oligonucleotides (SEQ-32) containing. C57BL / 6J (male 7-week-old, CLEA Japan) to saline (Otsuka saline Note, Otsuka Pharmaceutical Factory) double-stranded oligonucleotide was dissolved in a solution, about 0.2 mL, dose per individual mouse It was administered subcutaneously as a 0.2 mg / kg in the antisense strand amount conversion. Liver tissue was collected under Somnopentyl anesthesia on the third day after the administration, it was carried out activity evaluation.
RNA extraction from the liver was carried out in the manufacturer's recommended protocol as using RNeasy Mini Kit (Qiagen, Inc.). The 10ng of the obtained RNA, using a One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara Bio Inc.) to evaluate the expression level of ApoB mRNA perform quantitative PCR.
Primers were used to measure the expression level of mouse ApoB are
Fw primer: TCATGTGGCTGATGGACTCATTC (SEQ ID NO: 7)
Rv primer: CGTCCACAGTATATGTTCCAGCGTA (SEQ ID NO: 8)
It was used.
Primers were used to measure the expression level of mouse Gapdh is
Fw primer: TGTGTCCGTCGTGGATCTGA (SEQ ID NO: 5)
Rv primer: TTGCTGTTGAAGTCGCAGGAG (SEQ ID NO: 6)
It was used.
For mRNA expression levels of ApoB normalized by mRNA expression level of Gapdh in each sample administration group were compared relative values ​​when the expression level of the physiological saline administration group as 100% (percent). The results are shown in Figure 6. As a result, double-stranded oligonucleotide of the invention (SEQ-31) also showed a 80% knockdown activity at low dosages range antisense oligonucleotides (SEQ-26) shows no activity, the previous examples similar to the results shown, improvement in activity was confirmed. On the other hand, comprises a sugar derivative having SEQ-30, interact with the asialoglycoprotein receptor is a double-stranded oligonucleotide containing no sugar derivatives (GalNAc derivative) having interaction with the asialoglycoprotein receptor (GalNAc derivative) although, the SEQ-32 binds to the antisense strand of SEQ-29 or double-stranded oligonucleotide is a single stranded structure, improving knockdown activity was not observed.
From the above results, the double-stranded oligonucleotide of the present invention, it was found to be a good efficiency optimum design for knockdown of target genes in the liver.

As apparent from the above embodiments, the double-stranded oligonucleotide of the present invention, intravenous administration, be any of subcutaneous administration, has excellent inhibitory activity on the expression of a target gene in the liver. Thus, double-stranded oligonucleotide of the present invention is very useful as a complex to transport efficiently DNA antisense oligonucleotide is the active ingredient to the liver.

Claims (9)

  1. Antisense strand is DNA antisense oligonucleotides which may contain 8-25 bases nucleoside derivative,
    Sense strand comprises a hybridizable sequence in the antisense strand under stringent conditions, an RNA oligonucleotide of DNA nucleosides and / or nucleoside derivative which may contain 8-35 bases,
    The 3 'end and / or 5' end of the sense strand,
    Double-stranded oligonucleotide sugar derivative having an interaction with the asialoglycoprotein receptor via a linker is attached.
  2. Sugar derivatives,
    Figure JPOXMLDOC01-appb-C000001

    (In the formula,
    P 1A, P 1B, P 2A , P 2B, P 3A, P 3B, P 4A, P 4B, P 4C, T 1A, T 1B, T 2A, T 2B, T 3A, T 3B, T 4A, T 4B and T 4C are each independently absent, CO, NH, O, S , OC (= O), NHC (= O), a CH 2, CH 2 NH or CH 2 O,
    Q 1A, Q 1B, Q 2A , Q 2B, Q 3A, Q 3B, Q 4A, Q 4B and Q 4C are each independently absent or a substituted or unsubstituted alkylene,
    R 1A, R 1B, R 2A , R 2B, R 3A, R 3B, R 4A, R 4B and R 4C are each independently absent, NH, O, S, CH 2, C (= O) O, C (= O) NH , NHCH (R 5) C (= O), C (= O) CH (R 5) NH, CO, CH = N-O, a heterocyclic ring,
    Figure JPOXMLDOC01-appb-C000002

    It is in,
    R 5 is a hydrogen atom or an amino acid side chain,
    q 1A, q 1B, q 2A , q 2B, q 3A, q 3B, q 4A, q 4B and q 4C are each independently an integer of 0 to 20,
    LG 1A, LG 1B, LG 2A , LG 2B, LG 3A, LG 3B, LG 4A, LG 4B and LG 4C are each, independently,
    Figure JPOXMLDOC01-appb-C000003

    (In the formula,
    R X1, R X2 and R X3 are each independently a hydrogen atom or a substituted or unsubstituted alkyl,
    R X4 is OH or NHCOR X4 '(R X4' is a substituted or unsubstituted alkyl))
    In it, according to claim 1, wherein the double-stranded oligonucleotide.
  3. Sugar derivatives,
    Figure JPOXMLDOC01-appb-C000004

    In it, according to claim 2, wherein the double-stranded oligonucleotide.
  4. Sugar derivatives,
    Figure JPOXMLDOC01-appb-C000005

    In it, according to claim 3, wherein the double-stranded oligonucleotide.
  5. Nucleoside derivative is a nucleoside having a crosslinked structure between the position and the 2 'position of' 4 nucleoside and / or sugar having a substituent at the 2 'position of the sugar, according to any one of claims 1 to 4 two stranded oligonucleotides.
  6. It said substituents, F, is OCH 3 or OCH 2 CH 2 OCH 3, claim 5 double stranded oligonucleotide according.
  7. Crosslinked structure, 4 '- (CH 2) m-O-2' (m is an integer of 1 to 4) or 4'-C (= O) -NR 6 -2 '(R 6 is a hydrogen atom or it is alkyl as), according to claim 5, wherein the double-stranded oligonucleotide.
  8. Linker,
    Figure JPOXMLDOC01-appb-C000006

    (In the formula,
    L 1 is attached to the 3 'end and / or 5' end of the sense strand, L 5 is linked to the sugar derivative.
    L 1 is C (= O) NH, NHC (= O), NHC (= O) NH,
    Figure JPOXMLDOC01-appb-C000007

    (Wherein, R 7 is an alkyl or alkyloxy), and
    L 2 are each independently carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
    L 3 are each independently absent, C (= O) NR 8 (R 8 is hydrogen or a substituted or unsubstituted alkyl), NR 9 C (= O ) (R 9 is hydrogen or a substituted or or is unsubstituted alkyl, R 9 may form a nitrogen-containing ring substituted or unsubstituted together with the carbon in the alkylene of L 2),
    Figure JPOXMLDOC01-appb-C000008

    It is in,
    L 4 are each independently absent, carbon atoms also may substituted or unsubstituted optionally via the aromatic ring is an alkylene or an aromatic ring of 1-20,
    L 5 represents C (= O) NH, NHC (= O), is NH or O,
    n is 1 or 2)
    In it, a double-stranded oligonucleotide according to any one of claims 1 to 7.
  9. Pharmaceutical compositions containing a double-stranded oligonucleotide according to any one of claims 1-8.
PCT/JP2015/050083 2014-01-07 2015-01-06 Double-stranded oligonucleotide containing antisense oligonucleotide and sugar derivative WO2015105083A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2014-001195 2014-01-07
JP2014001195 2014-01-07

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
JP2015556799A JP6482475B2 (en) 2014-01-07 2015-01-06 Double stranded oligonucleotides comprising antisense oligonucleotides and sugar derivatives

Publications (1)

Publication Number Publication Date
WO2015105083A1 true WO2015105083A1 (en) 2015-07-16

Family

ID=53523908

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2015/050083 WO2015105083A1 (en) 2014-01-07 2015-01-06 Double-stranded oligonucleotide containing antisense oligonucleotide and sugar derivative

Country Status (2)

Country Link
JP (1) JP6482475B2 (en)
WO (1) WO2015105083A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017010575A1 (en) * 2015-07-16 2017-01-19 協和発酵キリン株式会社 β2GPI GENE EXPRESSION INHIBITING NUCLEIC ACID COMPLEX
WO2017131236A1 (en) 2016-01-29 2017-08-03 協和発酵キリン株式会社 Nucleic acid complex
WO2017178656A1 (en) * 2016-04-14 2017-10-19 Roche Innovation Center Copenhagen A/S TRITYL-MONO-GalNAc COMPOUNDS AND THEIR USE
WO2018004004A1 (en) 2016-06-30 2018-01-04 協和発酵キリン株式会社 Nucleic acid complex
WO2018181428A1 (en) * 2017-03-29 2018-10-04 塩野義製薬株式会社 Complex of nucleic acid medicine and multibranched lipid
WO2019027009A1 (en) * 2017-08-02 2019-02-07 協和発酵キリン株式会社 Nucleic acid complex
WO2019027015A1 (en) * 2017-08-02 2019-02-07 協和発酵キリン株式会社 Nucleic acid complex
EP3357507A4 (en) * 2015-09-30 2019-05-29 Shionogi & Co., Ltd Nucleic acid derivative having immunostimulatory activity

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005113571A2 (en) * 2004-05-13 2005-12-01 The University Of North Carolina At Chapel Hill Methods for the delivery of oligomeric compounds
JP2011528221A (en) * 2008-07-16 2011-11-17 オンコセラピー・サイエンス株式会社 ect2 oncogenes as a therapeutic target and prognostic indicators of lung and esophageal cancer
WO2012037254A1 (en) * 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. MODIFIED iRNA AGENTS
WO2012083046A2 (en) * 2010-12-17 2012-06-21 Arrowhead Research Corporation Galactose cluster-pharmacokinetic modulator targeting moiety for sirna
WO2013033230A1 (en) * 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013089283A1 (en) * 2011-12-16 2013-06-20 National University Corporation Tokyo Medical And Dental University Chimeric double-stranded nucleic acid
WO2014179620A1 (en) * 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005113571A2 (en) * 2004-05-13 2005-12-01 The University Of North Carolina At Chapel Hill Methods for the delivery of oligomeric compounds
JP2011528221A (en) * 2008-07-16 2011-11-17 オンコセラピー・サイエンス株式会社 ect2 oncogenes as a therapeutic target and prognostic indicators of lung and esophageal cancer
WO2012037254A1 (en) * 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. MODIFIED iRNA AGENTS
WO2012083046A2 (en) * 2010-12-17 2012-06-21 Arrowhead Research Corporation Galactose cluster-pharmacokinetic modulator targeting moiety for sirna
WO2013033230A1 (en) * 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013089283A1 (en) * 2011-12-16 2013-06-20 National University Corporation Tokyo Medical And Dental University Chimeric double-stranded nucleic acid
WO2014179620A1 (en) * 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JEKERIE, V. ET AL.: "Functional comparison of single- and double-stranded mdrl antisense oligodeoxynucleotides in human ovarian cancer", CELL LINES., J. PHARM. PHARM. SCI., vol. 8, no. 3, 2005, pages 516 - 527 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017010575A1 (en) * 2015-07-16 2017-01-19 協和発酵キリン株式会社 β2GPI GENE EXPRESSION INHIBITING NUCLEIC ACID COMPLEX
EP3357507A4 (en) * 2015-09-30 2019-05-29 Shionogi & Co., Ltd Nucleic acid derivative having immunostimulatory activity
WO2017131236A1 (en) 2016-01-29 2017-08-03 協和発酵キリン株式会社 Nucleic acid complex
WO2017178656A1 (en) * 2016-04-14 2017-10-19 Roche Innovation Center Copenhagen A/S TRITYL-MONO-GalNAc COMPOUNDS AND THEIR USE
WO2018004004A1 (en) 2016-06-30 2018-01-04 協和発酵キリン株式会社 Nucleic acid complex
KR20190022832A (en) 2016-06-30 2019-03-06 교와 핫꼬 기린 가부시키가이샤 Nucleic acid complex
WO2018181428A1 (en) * 2017-03-29 2018-10-04 塩野義製薬株式会社 Complex of nucleic acid medicine and multibranched lipid
WO2019027009A1 (en) * 2017-08-02 2019-02-07 協和発酵キリン株式会社 Nucleic acid complex
WO2019027015A1 (en) * 2017-08-02 2019-02-07 協和発酵キリン株式会社 Nucleic acid complex

Also Published As

Publication number Publication date
JP6482475B2 (en) 2019-03-13
JPWO2015105083A1 (en) 2017-03-23

Similar Documents

Publication Publication Date Title
JP3756313B2 (en) New bicyclo nucleosides and oligonucleotide analogues
ES2242291T3 (en) Nucleotide bi and tricyclic nucleotide analogues and oligonucleotides.
US5959099A (en) Protecting group for synthesizing oligonucleotide analogs
JP3927630B2 (en) A viral infection of the preventive or therapeutic agent
JP2766360B2 (en) Staurosporine derivatives
US7053199B2 (en) Nucleoside analogs and oligonucleotide derivatives containing these analogs
US5712378A (en) Sugar modified nucleosides and their use for synthesis of oligonucleotides
US5596091A (en) Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
JP5064237B2 (en) Lincomycin derivatives and an antimicrobial agent to do this as an active ingredient
US5866691A (en) Lactam nucleic acids
US7427672B2 (en) Artificial nucleic acids of n-o bond crosslinkage type
KR20010030586A (en) Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US20030207804A1 (en) Modified peptide nucleic acids
CN101801371B (en) Process for the preparation of compounds useful as inhibitors of sglt
JP3210672B2 (en) Novel peptide nucleic acid
US6770748B2 (en) Bicyclonucleoside and oligonucleotide analogue
JP5572090B2 (en) Tetrahydropyran nucleic acid analogs
CN101506368B (en) By the phosphotriester charge transport transduction reversible protective group and the nucleic acid
DK2612917T3 (en) Antisense nucleic acid
CN1665828B (en) Novel substituted sulfamate anticonvulsant derivatives
US10307434B2 (en) Nucleic acid prodrugs and methods of use thereof
AU698442B2 (en) Modified oligonucleotides, their preparation and their use
AU2009323766B2 (en) Method for the synthesis of phosphorus atom modified nucleic acids
WO2001007455A1 (en) Novel bicyclonucleoside analogues
PT98931B (en) Process for the connection of nucleosides with a siloxan bridge

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15735281

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase in:

Ref document number: 2015556799

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15735281

Country of ref document: EP

Kind code of ref document: A1