US10011871B2 - Compositions and methods for accurately identifying mutations - Google Patents

Compositions and methods for accurately identifying mutations Download PDF

Info

Publication number
US10011871B2
US10011871B2 US14/378,870 US201314378870A US10011871B2 US 10011871 B2 US10011871 B2 US 10011871B2 US 201314378870 A US201314378870 A US 201314378870A US 10011871 B2 US10011871 B2 US 10011871B2
Authority
US
United States
Prior art keywords
nucleic acid
nucleotides
cypher
sequencing
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US14/378,870
Other versions
US20150024950A1 (en
Inventor
Jason H. Bielas
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fred Hutchinson Cancer Center
Original Assignee
Fred Hutchinson Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=47750867&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US10011871(B2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Fred Hutchinson Cancer Center filed Critical Fred Hutchinson Cancer Center
Priority to US14/378,870 priority Critical patent/US10011871B2/en
Assigned to FRED HUTCHINSON CANCER RESEARCH CENTER reassignment FRED HUTCHINSON CANCER RESEARCH CENTER ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BERTOUT, JESSICA A., BIELAS, JASON H.
Publication of US20150024950A1 publication Critical patent/US20150024950A1/en
Application granted granted Critical
Publication of US10011871B2 publication Critical patent/US10011871B2/en
Assigned to FRED HUTCHINSON CANCER CENTER reassignment FRED HUTCHINSON CANCER CENTER MERGER AND CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: FRED HUTCHINSON CANCER RESEARCH CENTER, SEATTLE CANCER CARE ALLIANCE
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1065Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • the present disclosure relates to compositions and methods for accurately detecting mutations using sequencing and, more particularly, uniquely tagging double stranded nucleic acid molecules such that sequence data obtained for a sense strand can be linked to sequence data obtained from the anti-sense strand when obtained via massively parallel sequencing methods.
  • Detection of spontaneous mutations can be challenging because these mutational events are rare and may exist in one or only a few copies of DNA.
  • the most direct way to detect mutations is by sequencing, but the available sequencing methods are not sensitive enough to detect rare mutations.
  • mutations that arise de novo in mitochondrial DNA mtDNA
  • mtDNA mitochondrial DNA
  • these mutations are not easily found since a mutation must be present in as much as 10-25% of a population of molecules to be detected by sequencing (Jones et al., Proc. Nat'l. Acad. Sci. U.S.A.
  • the spontaneous somatic mutation frequency in genomic DNA has been estimated to be as low as 1 ⁇ 10 ⁇ 8 and 2.1 ⁇ 10 ⁇ 6 in human normal and cancerous tissues, respectively (Bielas et al., Proc. Nat'l Acad. Sci. U.S.A. 103:18238-42, 2008).
  • PCR polymerase chain reaction
  • digital PCR digital PCR
  • massively parallel sequencing represents a particularly powerful form of digital PCR because multiple millions of template DNA molecules can be analyzed one by one.
  • the amplification of single DNA molecules prior to or during sequencing by PCR and/or bridge amplification suffers from the inherent error rate of polymerases employed for amplification, and spurious mutations generated during amplification may be misidentified as spontaneous mutations from the original (endogenous unamplified) nucleic acid.
  • DNA templates damaged during preparation may be amplified and incorrectly scored as mutations by massively parallel sequencing techniques.
  • the present disclosure provides a double-stranded nucleic acid molecule library that includes a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of X a —X b —Y, X b —X a —Y, Y—X a —X b , Y—X b —X a , X a —Y—X b , or X b —Y—X a (in 5′ to 3′ order), wherein (a) X a comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) X b comprises a second random cypher.
  • each of the plurality of random cyphers comprise a length ranging from about 5 nucleotides to about 50 nucleotides (or about 5 nucleotides to about 10 nucleotides, or a length of about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides).
  • the double-stranded sequences of the X a and X b cyphers are the same (e.g., X a ⁇ X b ) for one or more target nucleic acid molecules, provided that each such target nucleic acid molecule does not have the same double-stranded cypher sequence as any other such target nucleic acid molecule.
  • the double-stranded sequence of the X a cypher for each target nucleic acid molecule is different from the double-stranded sequence of the X b cypher.
  • the double-stranded nucleic acid library is contained in a self-replicating vector, such as a plasmid, cosmid, YAC, or viral vector.
  • the present disclosure provides a method for obtaining a nucleic acid sequence or accurately detecting a true mutation in a nucleic acid molecule by amplifying each strand of the aforementioned double-stranded nucleic acid library wherein a plurality of target nucleic acid molecules and plurality of random cyphers are amplified, and sequencing each strand of the plurality of target nucleic acid molecules and plurality of random cyphers.
  • the sequencing is performed using massively parallel sequencing methods.
  • the sequence of one strand of a target nucleic acid molecule associated with the first random cypher aligned with the sequence of the complementary strand associated with the second random cypher results in a measureable sequencing error rate ranging from about 10 ⁇ 6 to about 10 ⁇ 8 .
  • FIG. 1 is a cartoon illustration of an exemplary vector of the present disclosure useful for generating a double-stranded nucleic acid library.
  • FIG. 2 is a cartoon illustration of an exemplary vector of the present disclosure, wherein adaptor sequences are included and are useful for, for example, bridge amplification methods before sequencing.
  • FIGS. 3A and 3B show characteristics of a cypher library and the detection of true mutations.
  • A Data generated in a single next generation sequence run on MiSeq® demonstrates broad coverage and diversity at the upstream seven base pair cypher in a vector library, wherein the vector used is illustrated in FIG. 2 .
  • B Cypher Seq eliminates errors introduced during library preparation and sequencing. Target nucleic acid molecules were ligated into a cypher vector library containing previously catalogued dual, double-stranded cyphers. The target sequences were amplified and sequenced. All sequencing reads having identical cypher pairs, along with their reverse complements, were grouped into families.
  • FIGS. 4A and 4B show that the cypher system can distinguish true mutations from artifact mutations.
  • A Wild-type TP53 Exon 4 was ligated into a library of Cypher Seq vectors and sequenced on the Illumina MiSeq® instrument with a depth of over a million. Sequences were then compared to wild-type TP53 sequence. Detected substitutions were plotted before (A) and after correction (B) with Cypher Seq.
  • the present disclosure provides a double-stranded nucleic acid library wherein target nucleic acid molecules include dual cyphers (i.e., barcodes or origin identifier tags), one on each end (same or different), so that sequencing each complementary strand can be connected or linked back to the original molecule.
  • the unique cypher on each strand links each strand with its original complementary strand (e.g., before any amplification), so that each paired sequence serves as its own internal control.
  • sequence data obtained from one strand of a single nucleic acid molecule can be specifically linked to sequence data obtained from the complementary strand of that same double-stranded nucleic acid molecule.
  • sequence data obtained from one end of a double-stranded target nucleic acid molecule can be specifically linked to sequence data obtained from the opposite end of that same double-stranded target nucleic acid molecule (if, for example, it is not possible to obtain sequence data across the entire target nucleic acid molecule fragment of the library).
  • compositions and methods of this disclosure allow a person of ordinary skill in the art to more accurately distinguish true mutations (i.e., naturally arising in vivo mutations) of a nucleic acid molecule from artifact “mutations” (i.e., ex vivo mutations or errors) of a nucleic acid molecule that may arise for various reasons, such as a downstream amplification error, a sequencing error, or physical or chemical damage.
  • a transition mutation of adenine (A) to guanine (G) identified on one strand will be complemented with a thymine (T) to cysteine (C) transition on the other strand.
  • artifact “mutations” that arise later on an individual (separate) DNA strand due to polymerase errors during isolation, amplification or sequencing are extremely unlikely to have a matched base change in the complementary strand.
  • compositions and methods for distinguishing systematic errors e.g., polymerase read fidelity errors
  • biological errors e.g., chemical or other damage
  • SNPs single nucleotide polymorphisms
  • the two cyphers on each target molecule have sequences that are distinct from each other and, therefore, provide a unique pair of identifiers wherein one cypher identifies (or is associated with) a first end of a target nucleic acid molecule and the second cypher identifies (or is associated with) the other end of the target nucleic acid molecule.
  • the two cyphers on each target molecule have the same sequence and, therefore, provide a unique identifier for each strand of the target nucleic acid molecule.
  • Each strand of the double-stranded nucleic acid library (e.g., genomic DNA, cDNA) can be amplified and sequenced using, for example, next generation sequencing technologies (such as, emulsion PCR or bridge amplification combined with pyrosequencing or sequencing by synthesis, or the like).
  • the sequence information from each complementary strand of a first double-stranded nucleic acid molecule can be linked and compared (e.g., computationally “de-convoluted”) due to the unique cyphers associated with each end or strand of that particular double-stranded nucleic acid molecule.
  • each original double-stranded nucleic acid molecule fragment found in a library of molecules can be individually reconstructed due to the presence of an associated unique barcode or pair of barcode (identifier tag) sequences on each target fragment or strand.
  • any spontaneous or induced mutation will be present in both strands of a native genomic, double-stranded DNA molecule.
  • a mutant DNA template amplified using PCR will result in a PCR product in which 100% of the molecules produced by PCR include the mutation.
  • a change due to polymerase error will only appear in one strand of the initial template DNA molecule (while the other strand will not have the artifact mutation). If all DNA strands in a PCR reaction are copied equally efficiently, then any polymerase error that emerges from the first PCR cycle likely will be found in at least 25% of the total PCR product.
  • DNA sequences amplified from the strand that incorporated an erroneous nucleotide base during the initial amplification might constitute more or less than 25% of the population of amplified DNA sequences depending on the efficiency of amplification, but still far less than 100%.
  • any polymerase error that occurs in later PCR cycles will generally represent an even smaller proportion of PCR products (i.e., 12.5% for the second cycle, 6.25% for the third, etc.) containing a “mutation.”
  • PCR-induced mutations may be due to polymerase errors or due to the polymerase bypassing damaged nucleotides, thereby resulting in an error (see, e.g., Bielas and Loeb, Nat.
  • cytosine which is recognized by Taq polymerase as a uracil and results in a cytosine to thymine transition mutation (Zheng et al., Mutat. Res. 599:11-20, 2006) —that is, an alteration in the original DNA sequence may be detected when the damaged DNA is sequenced, but such a change may or may not be recognized as a sequencing reaction error or due to damage arising ex vivo (e.g., during or after nucleic acid isolation).
  • Deep sequencing Next generation sequencing has opened the door to sequencing multiple copies of an amplified single nucleic acid molecule—referred to as deep sequencing.
  • the thought on deep sequencing is that if a particular nucleotide of a nucleic acid molecule is sequenced multiple times, then one can more easily identify rare sequence variants or mutations. In fact, however, the amplification and sequencing process has an inherent error rate (which may vary depending on DNA quality, purity, concentration (e.g., cluster density), or other conditions), so no matter how few or how many times a nucleic acid molecule is sequenced, a person of skill in the art cannot distinguish a polymerase error artifact from a true mutation (especially rare mutations).
  • the present disclosure in a further aspect, provides methods for identifying mutations present before amplification or sequencing of a double-stranded nucleic acid library wherein the target molecules include a single double-stranded cypher or dual cyphers (i.e., barcodes or identifier tags), one on each end, so that sequencing each complementary strand can be connected back to the original molecule.
  • the target molecules include a single double-stranded cypher or dual cyphers (i.e., barcodes or identifier tags), one on each end, so that sequencing each complementary strand can be connected back to the original molecule.
  • the method enhances the sensitivity of the sequencing method such that the error rate is 5 ⁇ 10 ⁇ 6 , 10 ⁇ 6 , 5 ⁇ 10 ⁇ 7 , 10 ⁇ 7 , 5 ⁇ 10 ⁇ 8 , 10 ⁇ 8 or less when sequencing many different target nucleic acid molecules simultaneously or such that the error rate is 5 ⁇ 10 ⁇ 7 , 10 ⁇ 7 , 5 ⁇ 10 ⁇ 8 , 10 ⁇ 8 or less when sequencing a single target nucleic acid molecule in depth.
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
  • any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness are to be understood to include any integer within the recited range, unless otherwise indicated.
  • the terms “about” and “consisting essentially of” mean ⁇ 20% of the indicated range, value, or structure, unless otherwise indicated. It should be understood that the terms “a” and “an” as used herein refer to “one or more” of the enumerated components.
  • the term “random cypher” or “cypher” or “barcode” or “identifier tag” and variants thereof are used interchangeably and refer to a nucleic acid molecule having a length ranging from about 5 to about 50 nucleotides.
  • all of the nucleotides of the cypher are not identical (i.e., comprise at least two different nucleotides) and optionally do not contain three contiguous nucleotides that are identical.
  • the cypher is comprised of about 5 to about 15 nucleotides, about 6 to about 10 nucleotides, and preferably about 7 to about 12 nucleotides. Cyphers will generally be located at one or both ends a target molecule may, which may be incorporated directly onto target molecules of interest or onto a vector into which target molecules will be later added.
  • target nucleic acid molecules and variants thereof refer to a plurality of double-stranded nucleic acid molecules that may be fragments or shorter molecules generated from longer nucleic acid molecules, including from natural samples (e.g., a genome), or the target nucleic acid molecules may be synthetic (e.g., cDNA), recombinant, or a combination thereof.
  • Target nucleic acid fragments from longer molecules may be generated using a variety of techniques known in the art, such as mechanical shearing or specific cleavage with restriction endonucleases.
  • nucleic acid molecule library refers to a collection of nucleic acid molecules or fragments.
  • the collection of nucleic acid molecules or fragments is incorporated into a vector, which can be transformed or transfected into an appropriate host cell.
  • the target nucleic acid molecules of this disclosure may be introduced into a variety of different vector backbones (such as plasmids, cosmids, viral vectors, or the like) so that recombinant production of a nucleic acid molecule library can be maintained in a host cell of choice (such as bacteria, yeast, mammalian cells, or the like).
  • a collection of nucleic acid molecules representing the entire genome is called a genomic library and a collection of DNA copies of messenger RNA is referred to as a complimentary DNA (cDNA) library.
  • cDNA complimentary DNA
  • the ends of the target nucleic acid fragments may have overhangs or may be “polished” (i.e., blunted).
  • the target nucleic acid molecule fragments can be, for example, cloned directly into a cypher vector to generate a vector library, or be ligated with adapters to generate, for example, polonies.
  • the target nucleic acid molecules which are the nucleic acid molecules of interest for amplification and sequencing, may range in size from a few nucleotides (e.g., 50) to many thousands (e.g., 10,000).
  • the target fragments in the library range in size from about 100 nucleotides to about 750 nucleotides or about 1,000 nucleotides, or from about 150 nucleotides to about 250 nucleotides or about 500 nucleotides.
  • nucleic acid molecule priming site or “PS” and variants thereof are short, known nucleic acid sequences contained in the vector.
  • a PS sequence can vary in length from 5 nucleotides to about 50 nucleotides in length, about 10 nucleotides to about 30 nucleotides, and preferably are about 15 nucleotides to about 20 nucleotides in length.
  • a PS sequence may be included at the one or both ends or be an integral part of the random cypher nucleic acid molecules, or be included at the one or both ends or be an integral part of an adapter sequence, or be included as part of the vector.
  • a nucleic acid molecule primer that is complementary to a PS included in a library of the present disclosure can be used to initiate a sequencing reaction.
  • a primer complementary to the PS can be used to prime a sequencing reaction to obtain the sequence of the random cypher and some sequence of a target nucleic acid molecule cloned downstream of the cypher.
  • a primer complementary to the first PS can be used to prime a sequencing reaction to obtain the sequence of the random cypher, the second PS and some sequence of a target nucleic acid molecule cloned downstream of the second PS.
  • a primer complementary to the second PS can be used to prime a sequencing reaction to directly obtain the sequence of the target nucleic acid molecule cloned downstream of the second PS.
  • more target molecule sequence information will be obtained since the sequencing reaction beginning from the second PS can extend further into the target molecule than does the reaction having to extend through both the cypher and the target molecule.
  • next generation sequencing refers to high-throughput sequencing methods that allow the sequencing of thousands or millions of molecules in parallel.
  • next generation sequencing methods include sequencing by synthesis, sequencing by ligation, sequencing by hybridization, polony sequencing, and pyrosequencing.
  • primers By attaching primers to a solid substrate and a complementary sequence to a nucleic acid molecule, a nucleic acid molecule can be hybridized to the solid substrate via the primer and then multiple copies can be generated in a discrete area on the solid substrate by using polymerase to amplify (these groupings are sometimes referred to as polymerase colonies or polonies). Consequently, during the sequencing process, a nucleotide at a particular position can be sequenced multiple times (e.g., hundreds or thousands of times)—this depth of coverage is referred to as “deep sequencing.”
  • base calling refers to the computational conversion of raw or processed data from a sequencing instrument into quality scores and then actual sequences.
  • many of the sequencing platforms use optical detection and charge coupled device (CCD) cameras to generate images of intensity information (i.e., intensity information indicates which nucleotide is in which position of a nucleic acid molecule), so base calling generally refers to the computational image analysis that converts intensity data into sequences and quality scores.
  • CCD charge coupled device
  • ion torrent sequencing technology which employs a proprietary semiconductor ion sensing technology to detect release of hydrogen ions during incorporation of nucleotide bases in sequencing reactions that take place in a high density array of micro-machined wells.
  • next generation sequencing technologies e.g., chain-termination sequencing, dye-terminator sequencing, reversible dye-terminator sequencing, sequencing by synthesis, sequencing by ligation, sequencing by hybridization, polony sequencing, pyrosequencing, ion semiconductor sequencing, nanoball sequencing, nanopore sequencing, single molecule sequencing, FRET sequencing, base-heavy sequencing, and microfluidic sequencing
  • chain-termination sequencing dye-terminator sequencing
  • reversible dye-terminator sequencing sequencing by synthesis
  • sequencing by ligation sequencing by hybridization
  • polony sequencing pyrosequencing
  • ion semiconductor sequencing ion semiconductor sequencing
  • nanoball sequencing nanopore sequencing
  • single molecule sequencing single molecule sequencing
  • FRET sequencing base-heavy sequencing
  • microfluidic sequencing microfluidic sequencing
  • nucleic acid fragments e.g., genomic or cDNA library.
  • use with other nucleic acid libraries or methods for making a library of nucleic acid fragments may also be suitable.
  • a double-stranded nucleic acid library comprises a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of X a —Y—X b (in 5′ to 3′ order), wherein (a) X a comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) X b comprises a second random cypher; wherein each of the plurality of random cyphers have a length of about 5 to about 50 nucleotides.
  • the double-stranded sequence of the X a cypher for each target nucleic acid molecule is different from the double-stranded sequence of the X b cypher.
  • the double-stranded X a cypher is identical to the X b cypher for one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic acid molecule is different.
  • the plurality or pool of random cyphers used in the double-stranded nucleic acid molecule library or vector library comprise from about 5 nucleotides to about 40 nucleotides, about 5 nucleotides to about 30 nucleotides, about 6 nucleotides to about 30 nucleotides, about 6 nucleotides to about 20 nucleotides, about 6 nucleotides to about 10 nucleotides, about 6 nucleotides to about 8 nucleotides, about 7 nucleotides to about 9 or about 10 nucleotides, or about 6, about 7 or about 8 nucleotides.
  • a cypher preferably has a length of about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides.
  • a pair of random cyphers associated with nucleic acid sequences or vectors will have different lengths or have the same length.
  • a target nucleic acid molecule or vector may have an upstream (5′) first random cypher of about 6 nucleotides in length and a downstream (3′) second random cypher of about 9 nucleotides in length, or a target nucleic acid molecule or vector may have an upstream (5′) first random cypher of about 7 nucleotides in length and a downstream (3′) second random cypher of about 7 nucleotides in length.
  • both the X a cypher and the X b cypher each comprise 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, or 20 nucleotides.
  • the X a cypher comprises 6 nucleotides and the X b cypher comprises 7 nucleotides or 8 nucleotides; or the X a cypher comprises 7 nucleotides and the X b cypher comprises 6 nucleotides or 8 nucleotides; or the X a cypher comprises 8 nucleotides and the X b cypher comprises 6 nucleotides or 7 nucleotides; or the X a cypher comprises 10 nucleotides and the X b cypher comprises 11 nucleotides or 12 nucleotides.
  • each of the random cyphers or barcodes will govern the total number of possible barcodes available for use in a library. Shorter barcodes allow for a smaller number of unique cyphers, which may be useful when performing a deep sequence of one or a few nucleotide sequences, whereas longer barcodes may be desirable when examining a population of nucleic acid molecules, such as cDNAs or genomic fragments. In certain embodiments, multiplex sequencing may be desired when targeting specific nucleic acid molecules, specific genomic regions, smaller genomes, or a subset of cDNA transcripts.
  • Multiplex sequencing involves amplifying two or more samples that have been pooled into, for example, a single lane of a flow cell for bridge amplification to exponentially increase the number of molecules analyzed in a single run without sacrificing time or cost.
  • a unique index sequence (comprising a length ranging from about 4 nucleotides to about 25 nucleotides) specific for a particular sample is included with each dual cypher vector library.
  • index sequences will be used such that ten dual cypher vector libraries are used in which each library has a single, unique index sequence identifier (but each library has a plurality of random cyphers).
  • a barcode of 7 nucleotides would have a formula of 5′-NNNNNNN-3′ (SEQ ID NO.:1), wherein N may be any naturally occurring nucleotide.
  • the four naturally occurring nucleotides are A, T, C, and G, so the total number of possible random cyphers is 4 7 , or 16,384 possible random arrangements (i.e., 16,384 different or unique cyphers).
  • the number of random cyphers would be 4,096 and 65,536, respectively.
  • nucleotide cyphers there may be fewer than the pool of 4,094, 16,384 or 65,536 unique cyphers, respectively, available for use when excluding, for example, sequences in which all the nucleotides are identical (e.g., all A or all T or all C or all G) or when excluding sequences in which three contiguous nucleotides are identical or when excluding both of these types of molecules.
  • the first about 5 nucleotides to about 20 nucleotides of the target nucleic acid molecule sequence may be used as a further identifier tag together with the sequence of an associated random cypher.
  • a double-stranded nucleic acid library comprises a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of X a —Y—X b (in 5′ to 3′ order), wherein (a) X a comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) X b comprises a second random cypher; wherein each of the plurality of random cyphers have a length of about 5 to about 50 nucleotides and wherein (i) at least two of those nucleotides are different in each cypher or (ii) each cypher does not contain three contiguous nucleotides that are identical.
  • each cypher does not contain three contiguous nucleotides that are identical
  • the double-stranded X a cypher is identical to the X b cypher for one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic acid molecule is different.
  • a double-stranded nucleic acid library comprises a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of X a —X b —Y, X b —X a —Y, Y—X a —X b , Y—X b —X a , X a —Y, X b —Y, Y—X a , or Y—X b (in 5′ to 3′ order), wherein (a) X a comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) X b comprises a second random cypher; wherein each of the plurality of random cyphers have a length of about 5 to about 50 nucleotides.
  • an X a cypher further comprises about a 5 nucleotide to about a 20 nucleotide sequence of the target nucleic acid molecule that is downstream of the X a cypher, or an X b cypher further comprises about a 5 nucleotide to about a 20 nucleotide sequence of the target nucleic acid molecule that is upstream of the X b cypher, or an X a cypher and X b cypher further comprise about a 5 nucleotide to about a 20 nucleotide sequence of the target nucleic acid molecule that is downstream or upstream, respectively, of each cypher.
  • a first target molecule is associated with and disposed between a first random cypher r and a second random cypher X b
  • a second target molecule is associated with and disposed between a third random cypher r and a fourth random cypher X b
  • the target molecules of a library or of a vector library each has a unique X a cypher (i.e., none of the X a cyphers have the same sequence) and each has a unique X b cypher (i.e., none of the X b cyphers have the same sequence), and wherein none or only a minority of the X a and X b cyphers have the same sequence.
  • first target nucleic acid molecule is associated with and disposed between random cypher r number 1 and random cypher X b number 2 and a second target nucleic acid molecule is associated with and disposed between random cypher X′ number 16,383 and random cypher X b number 16,384, then a third target nucleic acid molecule can only be associated with and disposed between any pair of random cypher numbers selected from numbers 3 to 16,382, and so on for each target nucleic acid molecule of a library until each of the different random cyphers have been used (which may or may not be all 16,382).
  • each target nucleic acid molecule of a library will have a unique
  • random cypher sequences from a particular pool of cyphers may be used more than once.
  • each target nucleic acid molecule or a subset of target molecules has a different (unique) pair of cyphers.
  • each target nucleic acid molecule or a subset of target molecules has identical cyphers on each end of one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic acid molecule is different.
  • a second target molecule having identical cyphers on each end will have to have a different cypher—such as random cypher number 555 or the like—which may be any other cypher other than 10.
  • target nucleic acid molecules of the nucleic acid molecule library will each have dual unique cyphers X a and X b , wherein none of the X a cyphers have the same sequence as any other X′ cypher, none of the X b cyphers have the same sequence as any other X b cypher, and none of the X a cyphers have the same sequence as any X b cypher.
  • target nucleic acid molecules of the nucleic acid molecule library will each have a unique pair of X a —X b cyphers wherein none of the r or X b cyphers have the same sequence.
  • a mixture of any of the aforementioned embodiments may make up a nucleic acid molecule library of this disclosure.
  • the plurality of target nucleic acid molecules that together are used to generate a nucleic acid molecule library may each have a length that ranges from about 10 nucleotides to about 10,000 nucleotides, from about 50 nucleotides to about 5,000 nucleotides, from about 100 nucleotides to about 1,000 nucleotides, or from about 150 nucleotides to about 750 nucleotides, or from about 250 nucleotides to about 500 nucleotides.
  • the plurality of random cyphers may further be linked to a first nucleic acid molecule priming site (PS1), linked to a second nucleic acid molecule priming site (PS2), or linked to both a first and a second nucleic acid molecule priming site.
  • a plurality of random cyphers may each be associated with and disposed between a first nucleic acid molecule priming site (PS1) and a second nucleic acid molecule priming site (PS2), wherein the double-stranded sequence of PS1 is different from the double-stranded sequence of PS2.
  • each pair of X a —X b cyphers may be associated with and disposed between an upstream and a downstream nucleic acid molecule priming site (PS1) (see, e.g., FIG. 2 ).
  • PS1 nucleic acid molecule priming site
  • a first nucleic acid molecule priming site PS1 will be located upstream (5′) of the first random cypher r and the first nucleic acid molecule priming site PS1 will also be located downstream (3′) of the second random cypher X b .
  • an oligonucleotide primer complementary to the sense strand of PS1 can be used to prime a sequencing reaction to obtain the sequence of the sense strand of the first random cypher r or to prime a sequencing reaction to obtain the sequence of the anti-sense strand of the second random cypher X b
  • an oligonucleotide primer complementary to the anti-sense strand of PS1 can be used to prime a sequencing reaction to obtain the sequence of the anti-sense strand of the first random cypher r or to prime a sequencing reaction to obtain the sequence of the sense strand of the second random cypher X b .
  • the second nucleic acid molecule priming site PS2 will be located downstream (3′) of the first random cypher r and the second nucleic acid molecule priming site PS2 will also be located upstream (5′) of the second random cypher X b .
  • an oligonucleotide primer complementary to the sense strand of PS2 can be used to prime a sequencing reaction to obtain the sequence of the sense strand from the 5′-end of the associated double-stranded target nucleic acid molecule or to prime a sequencing reaction to obtain the sequence of the anti-sense strand from the 3′-end of the associated double-stranded target nucleic acid molecule, whereas an oligonucleotide primer complementary to the anti-sense strand of PS2 can be used to prime a sequencing reaction to obtain the sequence of the anti-sense strand from the 5′-end of the associated double-stranded target nucleic acid molecule or to prime a sequencing reaction to obtain the sequence of the sense strand from the 3′-end of the associated double-stranded target nucleic acid molecule.
  • the entire target nucleic acid molecule sequence may be obtained if it is short enough or only a portion of the entire target nucleic acid molecule sequence may be obtained if it is longer than about 100 nucleotides to about 250 nucleotides.
  • compositions and methods of the instant disclosure is that even though a target nucleic acid molecule is too long to obtain sequence data for the entire molecule or fragment, the sequence data obtained from one end of a double-stranded target molecule can be specifically linked to sequence data obtained from the opposite end or from the second strand of that same double-stranded target molecule because each target molecule in a library of this disclosure will have double-stranded cyphers, or a unique X a —X b pair of cyphers. Linking the sequence data of the two strands allows for sensitive identification of “true” mutations wherein deeper sequencing actually increases the sensitivity of the detection, and these methods can provide sufficient data to quantify the number of artifact mutations.
  • a plurality of random cyphers may further comprise a first restriction endonuclease recognition sequence (RE1) and a second restriction endonuclease recognition sequence (RE2), wherein the first restriction endonuclease recognition sequence RE1 is located upstream (5′) of the first random cypher X a and the second restriction endonuclease recognition sequence RE2 is located downstream (3′) of the second random cypher X b .
  • a first restriction endonuclease recognition sequence RE1 and a second restriction endonuclease recognition sequence RE2 are the same or different.
  • RE1, RE2, or both RE1 and RE2 are “rare-cutter” restriction endonucleases that have a recognition sequence that occurs only rarely within a genome or within a target nucleic acid molecule sequence or are “blunt-cutters” that generate nucleic acid molecules with blunt ends after digestion (e.g., SmaI).
  • Such rare cutter enzymes generally have longer recognition sites with seven- or eight-nucleotide or longer recognition sequences, such as AarI, AbeI, AscI, AsiSI, BbvCI, BstRZ2461, BstSWI, CciNI, CsiBI, CspBI, FseI, NotI, MchAI, MspSWI, MssI, PacI, PmeI, SbfI, SdaI, SgfI, SmiI, SrfI, Sse232I, Sse8387I, SwaI, TagII, VpaK32I, or the like.
  • AarI AbeI, AscI, AsiSI, BbvCI, BstRZ2461
  • BstSWI CciNI, CsiBI, CspBI, FseI, NotI, MchAI, MspSWI, MssI, PacI, PmeI, SbfI,
  • a nucleic acid molecule library comprises nucleic acid molecules having a formula of 5 ‘-RE1-PS1-X a —PS2-Y-PS2-X b —PS1-RE2-3’, wherein RE1 is a first restriction endonuclease recognition sequence, PS1 is a first nucleic acid molecule priming site, PS2 is a second nucleic acid molecule priming site, RE2 is a second restriction endonuclease recognition sequence, Y comprises a target nucleic acid molecule, and X a and X b are cyphers comprising a length ranging from about 5 nucleotides to about 50 nucleotides or about 6 nucleotides to about 15 nucleotides or about 7 nucleotides to about 9 nucleotides.
  • RE1 and RE2 are sequences recognized by the same restriction endonuclease or an isoschizomer or neoschizomer thereof, or RE1 and RE2 have different sequences recognized by different restriction endonucleases.
  • PS1 and PS2 have different sequences.
  • target nucleic acid molecules of the nucleic acid molecule library will each have dual unique cyphers X a and X b , wherein none of the X a cyphers have the same sequence as any other X a cypher, none of the X b cyphers have the same sequence as any other X b cypher, and none of the X a cyphers have the same sequence as any X b cypher.
  • target nucleic acid molecules of the nucleic acid molecule library will each have a unique cypher or pair of X a —X b cyphers wherein none of the r or X b cyphers have the same sequence.
  • bridge amplification may involve ligating adapter sequences to each end of a population of target nucleic acid molecules.
  • Single-stranded oligonucleotide primers complementary to the adapters are immobilized on a solid substrate, the target molecules containing the adapter sequences are denatured into single strands, and hybridized to complementary primers on the solid substrate.
  • An extension reaction is used to copy the hybridized target molecule and the double-stranded product is denatured into single strands again.
  • the copied single strands then loop over (form a “bridge”) and hybridize with a complementary primer on the solid substrate, upon which the extension reaction is run again.
  • a complementary primer on the solid substrate
  • a nucleic acid molecule library comprises nucleic acid molecules having a formula of 5′-RE1-AS-PS1-X a —PS2-Y-PS2-X b —PS1-AS-RE2-3′, wherein RE1 and RE2 are first and second restriction endonuclease recognition sequences, PS1 and PS2 are a first and second nucleic acid molecule priming sites, AS is an adapter sequence comprising a length ranging from about 20 nucleotides to about 100 nucleotides, Y comprises a target nucleic acid molecule, and X a and X b are cyphers comprising a length ranging from about 5 nucleotides to about 50 nucleotides or about 6 nucleotides to about 15 nucleotides or about 7 nucleotides to about 9 nucleotides.
  • a nucleic acid molecule library comprises nucleic acid molecules having a formula of 5′-RE1-AS-PS1-X a —Y—X b —PS1-AS-RE2-3′, wherein RE1 and RE2 are first and second restriction endonuclease recognition sequences, PS1 is a first nucleic acid molecule priming site, AS is an adapter sequence comprising a length ranging from about 20 nucleotides to about 100 nucleotides, Y comprises a target nucleic acid molecule, and X a and X b are cyphers comprising a length ranging from about 5 nucleotides to about 50 nucleotides or about 6 nucleotides to about 15 nucleotides or about 7 nucleotides to about 9 nucleotides.
  • the AS adapter sequence of the aforementioned vector may further comprise a PS2 that is a second nucleic acid molecule priming site or the PS2 may be a part of the original AS sequence.
  • the nucleic acid molecule library may further comprise an index sequence (comprising a length ranging from about 4 nucleotides to about 25 nucleotides) located between each of the first and second AS and the PS1 so that the library can be pooled with other libraries having different index sequences to facilitate multiplex sequencing (also referred to as multiplexing) either before or after amplification.
  • Each of the aforementioned dual barcoded target nucleic acid molecules may be assembled into a carrier library in the form of, for example, a self-replicating vector, such as a plasmid, cosmid, YAC, viral vector or other vectors known in the art.
  • a self-replicating vector such as a plasmid, cosmid, YAC, viral vector or other vectors known in the art.
  • any of the aforementioned double-stranded nucleic acid molecules comprising a plurality of target nucleic acid molecules and a plurality of random cyphers are contained in a vector.
  • such a vector library is carried in a host cell, such as bacteria, yeast, or mammalian cells.
  • the present disclosure also provides vectors useful for generating a library of dual barcoded target nucleic acid molecules according to this disclosure.
  • Exemplary vectors comprising cyphers and other elements of this disclosure are illustrated in FIGS. 1 and 2 .
  • a plurality of nucleic acid vectors comprising a plurality of random cyphers, wherein each vector comprises a region having a formula of 5′-RE1-PS1-X a —PS2-RE3-PS2-X b —PS1-RE2-3′, wherein (a) RE1 is a first restriction endonuclease recognition sequence, (b) PS1 is a first nucleic acid molecule priming site, (c) X a comprises a first random cypher, (d) RE3 is a third restriction endonuclease recognition sequence, wherein RE3 is a site into which a target nucleic acid molecule can be inserted, (e) X b comprises a second random cypher, (f) PS2 is a second nucleic acid molecule priming site, and (g) RE2 is a second restriction endonuclease recognition sequence; and wherein each of the plurality of random c
  • the sequence of the X a cypher is different from the sequence of the X b cypher in each vector (that is, each vector has a unique pair).
  • the plurality of nucleic acid vectors may further comprise at least one adapter sequence (AS) between RE1 and PS1 and at least one AS between PS1 and RE2, or comprise at least one AS between RE1 and X a cypher and at least one AS between X b cypher and RE2, wherein the AS optionally has a priming site.
  • AS adapter sequence
  • the plurality of random cyphers can each have the same or different number of nucleotides, and comprise from about 6 nucleotides to about 8 nucleotides to about 10 nucleotides to about 12 nucleotides to about 15 nucleotides.
  • a plurality of target nucleic acid molecules comprising from about 10 nucleotides to about 10,000 nucleotides or comprising from about 100 nucleotides to about 750 nucleotides or to about 1,000 nucleotides, may be inserted into the vector at RE3.
  • RE3 will cleave DNA into blunt ends and the plurality of target nucleic acid molecules ligated into this site will also be blunt-ended.
  • the plurality of nucleic acid vectors wherein each vector comprises a region having a formula of 5′-RE1-PS1-X a —PS2-RE3-PS2-X b —PS1-RE2-3′ the X a cyphers and X b cyphers on each vector is sequenced before a target nucleic acid molecule is inserted into each vector.
  • the plurality of nucleic acid vectors wherein each vector comprises a region having a formula of 5′-RE1-PS1-X a —PS2-RE3-PS2-X b —PS1-RE2-3′ the X a cyphers and X b cyphers on each vector is sequenced after a target nucleic acid molecule is inserted into each vector or is sequenced at the same time a target nucleic acid molecule insert is sequenced.
  • the dual barcoded target nucleic acid molecules and the vectors containing such molecules of this disclosure may further be used in sequencing reactions to determine the sequence and mutation frequency of the molecules in the library.
  • this disclosure provides a method for obtaining a nucleic acid sequence by preparing a double-stranded dual barcoded nucleic acid library as described herein and then sequencing each strand of the plurality of target nucleic acid molecules and plurality of random cyphers.
  • target nucleic acid molecules and and associated cyphers are excised for sequencing directly from the vector using restriction endonuclease enzymes prior to amplification.
  • next generation sequencing methods are used to determine the sequence of library molecules, such as sequencing by synthesis, pyrosequencing, reversible dye-terminator sequencing or polony sequencing.
  • determining the error rate due to amplification and sequencing by determining the sequence of one strand of a target nucleic acid molecule associated with the first random cypher and aligning with the sequence of the complementary strand associated with the second random cypher to distinguish between a pre-existing mutation and an amplification or sequencing artifact mutation, wherein the measured sequencing error rate will range from about 10 ⁇ 6 to about 5 ⁇ 10 ⁇ 6 to about 10 ⁇ 7 to about 5 ⁇ 10 ⁇ 7 to about 10 ⁇ 8 to about 10 ⁇ 9 .
  • a person of ordinary skill in the art can associate each DNA sequence read to an original template DNA. Given that both strands of the original double-stranded DNA are barcoded with associated barcodes, this increases the sensitivity of the sequencing base call by more easily identifying artifact “mutations” sequence changes introduced during the sequencing process.
  • compositions and methods of this instant disclosure will be useful in detecting rare mutants against a large background signal, such as when monitoring circulating tumor cells; detecting circulating mutant DNA in blood, monitoring or detecting disease and rare mutations by direct sequencing, monitoring or detecting disease or drug response associated mutations. Additional embodiments may be used to quantify DNA damage, quantify or detect mutations in viral genomes (e.g., HIV and other viral infections) or other infectious agents that may be indicative of response to therapy or may be useful in monitoring disease progression or recurrence. In yet other embodiments, these compositions and methods may be useful in detecting damage to DNA from chemotherapy, or in detection and quantitation of specific methylation of DNA sequences.
  • viral genomes e.g., HIV and other viral infections
  • these compositions and methods may be useful in detecting damage to DNA from chemotherapy, or in detection and quantitation of specific methylation of DNA sequences.
  • Cancer cells contain numerous clonal mutations, i.e., mutations that are present in most or all malignant cells of a tumor and have presumably been selected because they confer a proliferative advantage.
  • An important question is whether cancer cells also contain a large number of random mutations, i.e., randomly distributed unselected mutations that occur in only one or a few cells of a tumor. Such random mutations could contribute to the morphologic and functional heterogeneity of cancers and include mutations that confer resistance to therapy.
  • the instant disclosure provides compositions and methods for distinguishing clonal mutations from random mutations.
  • genomic DNA from patient-matched normal and tumor tissue is prepared using Qiagen® kits (Valencia, Calif.), and quantified by optical absorbance and quantitative PCR (qPCR).
  • the isolated genomic DNA is fragmented to a size of about 150-250 base pairs (short insert library) or to a size of about 300-700 base pairs (long insert library) by shearing.
  • the DNA fragments having overhang ends are repaired (i.e., blunted) using T4 DNA polymerase (having both 3′ to 5′ exonuclease activity and 5′ to 3′ polymerase activity) and the 5′-ends of the blunted DNA are phosphorylated with T4 polynucleotide kinase (Quick Blunting Kit I, New England Biolabs), and then purified.
  • T4 DNA polymerase having both 3′ to 5′ exonuclease activity and 5′ to 3′ polymerase activity
  • T4 polynucleotide kinase Quality Blunting Kit I, New England Biolabs
  • the ligated cypher vector library is purified and the target genomic library fragments are amplified by using, for example, the following PCR protocol: 30 seconds at 98° C.; five to thirty cycles of 10 seconds at 98° C., 30 seconds at 65° C., 30 seconds at 72° C.; 5 minutes at 72° C.; and then store at 4° C.
  • the amplification is performed using sense strand and anti-sense strand primers that anneal to a sequence located within the adapter region (in certain embodiments, the primer will anneal to a sequence upstream of the AS), and is upstream of the unique cypher and the target genomic insert (and, if present, upstream of an index sequence if multiplex sequencing is desired; see, e.g., FIG. 2 ) for Illumina bridge sequencing.
  • the sequencing of the library described above will be performed using, for example, an Illumina® Genome Analyzer II sequencing instrument as specified by the manufacturer.
  • the unique cypher tags are used to computationally deconvolute the sequencing data and map all sequence reads to single molecules (i.e., distinguish PCR and sequencing errors from real mutations). Base calling and sequence alignment will be performed using, for example, the Eland pipeline (Illumina, San Diego, Calif.). The data generated will allow identification of tumor heterogeneity at the single-nucleotide level and reveal tumors having a mutator phenotype.
  • mtDNA mitochondrial DNA
  • mtDNA mitochondrial DNA
  • Dual cypher sequencing of present disclosure can be leveraged to quantify circulating tumor cells (CTCs) and circulating tumor mtDNA (ctmtDNA) could be used to diagnose and stage cancer, assess response to therapy, and evaluate progression and recurrence after surgery.
  • CTCs circulating tumor cells
  • ctmtDNA circulating tumor mtDNA
  • mtDNA isolated for prostatic cancer and peripheral blood cells from the same patient will be sequenced to identify somatic homoplasmic mtDNA mutations.
  • These mtDNA biomarkers will be statistically assessed for their potential fundamental and clinical significance with respect to Gleason score, clinical stage, recurrence, therapeutic response, and progression.
  • TP53 is mutated in 96% of high grade serous ovarian carcinoma (HGSC), responsible for two-thirds of all ovarian cancer deaths (Cancer Genome Atlas Research Network, Nature 474:609, 2011), and current models indicate that TP53 loss is an early event in HGSC pathogenesis (Bowtell, Nat. Rev. Cancer 10:803, 2010).
  • HGSC high grade serous ovarian carcinoma
  • Current models indicate that TP53 loss is an early event in HGSC pathogenesis
  • the near universality and early occurrence of TP53 mutations in HGSC make TP53 a promising biomarker candidate for early detection and disease monitoring of HGSC.
  • Dual cypher sequencing of present disclosure was used to detect somatic TP53 mutations that arose during replication in E. coli.
  • the product was then purified (Zymo Research DNA Clean & Concentrator-5) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England BioLabs) and EcoRI-HF (New England BioLabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC 19 backbone.
  • Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1 ⁇ SybrSafe (Invitrogen) and the appropriate bands were excised.
  • the DNA in the gel fragments was purified using a Zymo-Clean gel DNA recovery kit (Zymo Research) and quantified using a spectrophotometer (Nanophotometer, Implen). Ligation reactions using T4 DNA ligase HC (Invitrogen) and a 1:3 vector to insert molar ratio at room temperature for 2 hours were carried out, then ethanol precipitated, and resuspended in water. Purified DNA (2 ⁇ l) was electroporated into ElectroMAX DH10B T1 Phage Resistant Cells (Invitrogen). The transformed cells were plated at a 1:100 dilution on LB agar media containing 100 ⁇ g/mL carbenicillin and incubated overnight at 37° C. to determine colony counts, and the remainder of the transformation was spiked into LB cultures for overnight growth at 37° C. The DNA from the overnight cultures was purified using the QIAquick Spin Miniprep Kit (Qiagen).
  • FIG. 3A shows that the each nucleotide was detected at approximately the same rate at each random position of the cypher (here the 5′ cyphers were sequenced).
  • SKOV-3 human ovarian carcinoma cell line
  • McCoy's 5a Medium supplemented with 10% Fetal Bovine Serum, 1.5 mM/L-glutamine, 2200 mg/L sodium bicarbonate, and Penicillin/Streptomycin.
  • SKOV-3 cells were harvested and DNA was extracted using a DNeasy Blood and Tissue Kit (Qiagen).
  • PCR primers were designed to amplify exon 4 of human TP53; forward primer sequence: TCTGTCTCCTTCCTCTTCCTACA (SEQ ID NO.:5) and reverse primer sequence: AACCAGCCCTGTCGTCTCT (SEQ ID NO.:6).
  • PCR Thirty cycles of PCR were performed on SKOV-3 DNA using 0.5 ⁇ M primers and GoTaq Hot Start Colorless Master Mix (Promega) under the following cycling conditions: 95° C. for 2 minutes; 30 cycles of 95° C. for 30 seconds, 63° C. for 30 seconds, 72° C. for 1 minute; followed by 72° C. for 5 minutes.
  • Each PCR product was then cloned into TOPO vectors (Invitrogen), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen), plated on LB agar media containing 100 ⁇ g/mL carbenicillin and incubated overnight at 37° C.
  • the TP53 exon 4 DNA band was then manually excised and purified using the Zymo-Clean gel DNA recovery kit followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation.
  • the digested DNA was then blunted and phosphorylated using the Quick Blunting Kit (New England BioLabs) and purified with a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation.
  • the Cypher Seq vector library was digested with SmaI, treated with Antartic Phosphatase (New England BioLabs), and run on a 1.5% UltraPure Low-Melting Point Agarose gel. The appropriate band was excised and purified using the Zymo-Clean gel DNA recovery kit, followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. Blunt-end ligations of the vector and TP53 exon 4 DNA were then carried out in 20 ⁇ l reactions using T4 DNA Ligase HC (Invitrogen) and a 1:10 vector to insert molar ratio. The ligations were incubated at 16° C.
  • ElectroMAX DH10b T1-phage resistant cells Bacteria were grown overnight at 37° C. in LB containing 100 ⁇ g/mL carbenicillin and DNA was purified using the QIAquick Spin Miniprep Kit. The presence of the appropriate insert was verified by diagnostic restriction digest and gel electrophoresis.
  • the sequencing construct containing the Illumina adapters, barcodes, and TP53 DNA was then amplified using 10 cycles of PCR and primers designed against the adapter ends (forward primer: AATGATACGGCGACCACCGA, SEQ ID NO.:7; and reverse primer: CAAGCAGAAGACGGCATACGA, SEQ ID NO.:8).
  • PCR cycling conditions were as follows: 95° C. for 2 minutes; 10 cycles of 95° C. for 30 seconds, 63° C. for 30 seconds, 72° C. for 1 minute; followed by 72° C. for 5 minutes.
  • the sequencing construct was gel purified (Zymo-Clean gel DNA recovery kit), phenol/chloroform/isoamyl alcohol extracted and ethanol precipitated.
  • the library was quantified using the Quant-iT PicoGreen assay (Invitrogen) before loading onto the Illumina MiSeq® flow cell. Finally, the library was sequenced. Sequencing was performed as instructed by the manufacturer's protocol with MiSeq® at Q30 quality level (Illumina).
  • TP53 Exon 4 DNA from a dual cypher vector library produced in E. coli was sequenced with a depth of over a million, and all sequencing reads with identical cypher pairs and their reverse complements were grouped into families to create a consensus sequence. As illustrated in FIG. 3B , errors introduced during library preparation (open circle) and during sequencing (gray circle and triangle) were computationally eliminated from the consensus sequence and only mutations present in all reads (black diamonds, FIG. 3B ) of a cypher family were counted as true mutations (see bottom of FIG. 3B ).
  • Wild-type TP53 Exon 4 sequence was compared to the actual sequence results and substitutions were plotted before ( FIG. 4A ) and after correction with Cypher Seq ( FIG. 4B ).
  • the detected error frequency was 3.9 ⁇ 10 ⁇ 4 /bp ( FIG. 4A ).
  • the initial error frequency reflects assay-related errors (e.g., PCR, sequencing, and other errors introduced after bar-coding). This means that detecting a rare mutation is difficult due to the noise-to-signal ratio being very high.
  • Cypher Seq correction the error frequency dropped to 8.8 ⁇ 10 ⁇ 7 /bp ( FIG. 4B ).
  • the remaining substitutions are most likely biological in nature and most likely reflect errors introduced during replication in E. coli prior to ligation into the barcoded vectors.
  • true mutations i.e., those that arise naturally in a cell during replication
  • true mutations are readily detectable using the cypher system of the instant disclosure.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure provides compositions and methods for accurately detecting mutations by uniquely tagging double stranded nucleic acid molecules with dual cyphers such that sequence data obtained from a sense strand can be linked to sequence data obtained from an anti-sense strand when sequenced, for example, by massively parallel sequencing methods.

Description

CROSS REFERENCE TO RELATED APPLICATION
This application claims the benefit of U.S. provisional patent application Ser. Nos. 61/600,535, filed Feb. 17, 2012, which is incorporated herein by reference in its entirety.
STATEMENT REGARDING SEQUENCE LISTING
The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing 360056_409WO_SEQUENCE_LISTING_.txt. The text file is 4 KB, was created on Feb. 14, 2013, and is being submitted electronically via EFS-Web.
BACKGROUND
1. Technical Field
The present disclosure relates to compositions and methods for accurately detecting mutations using sequencing and, more particularly, uniquely tagging double stranded nucleic acid molecules such that sequence data obtained for a sense strand can be linked to sequence data obtained from the anti-sense strand when obtained via massively parallel sequencing methods.
2. Description of Related Art
Detection of spontaneous mutations (e.g., substitutions, insertions, deletions, duplications), or even induced mutations, that occur randomly throughout a genome can be challenging because these mutational events are rare and may exist in one or only a few copies of DNA. The most direct way to detect mutations is by sequencing, but the available sequencing methods are not sensitive enough to detect rare mutations. For example, mutations that arise de novo in mitochondrial DNA (mtDNA) will generally only be present in a single copy of mtDNA, which means these mutations are not easily found since a mutation must be present in as much as 10-25% of a population of molecules to be detected by sequencing (Jones et al., Proc. Nat'l. Acad. Sci. U.S.A. 105:4283-88, 2008). As another example, the spontaneous somatic mutation frequency in genomic DNA has been estimated to be as low as 1×10−8 and 2.1×10−6 in human normal and cancerous tissues, respectively (Bielas et al., Proc. Nat'l Acad. Sci. U.S.A. 103:18238-42, 2008).
One improvement in sequencing has been to take individual DNA molecules and amplify the number of each molecule by, for example, polymerase chain reaction (PCR) and digital PCR. Indeed, massively parallel sequencing represents a particularly powerful form of digital PCR because multiple millions of template DNA molecules can be analyzed one by one. However, the amplification of single DNA molecules prior to or during sequencing by PCR and/or bridge amplification suffers from the inherent error rate of polymerases employed for amplification, and spurious mutations generated during amplification may be misidentified as spontaneous mutations from the original (endogenous unamplified) nucleic acid. Similarly, DNA templates damaged during preparation (ex vivo) may be amplified and incorrectly scored as mutations by massively parallel sequencing techniques. Again, using mtDNA as an example, experimentally determined mutation frequencies are strongly dependent on the accuracy of the particular assay being used (Kraytsberg et al., Methods 46:269-73, 2008)—these discrepancies suggest that the spontaneous mutation frequency of mtDNA is either below, or very close to, the detection limit of these technologies. Massively parallel sequencing cannot generally be used to detect rare variants because of the high error rate associated with the sequencing process—one process using bridge amplification and sequencing by synthesis has shown an error rate that varies from about 0.06% to 1%, which depends on various factors including read length, base-calling algorithms, and the type of variants detected (see Kinde et al., Proc. Nat'l. Acad. Sci. U.S.A. 108:9530-5, 2011).
BRIEF SUMMARY
In one aspect, the present disclosure provides a double-stranded nucleic acid molecule library that includes a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of Xa—Xb—Y, Xb—Xa—Y, Y—Xa—Xb, Y—Xb—Xa, Xa—Y—Xb, or Xb—Y—Xa (in 5′ to 3′ order), wherein (a) Xa comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) Xb comprises a second random cypher. Furthermore, each of the plurality of random cyphers comprise a length ranging from about 5 nucleotides to about 50 nucleotides (or about 5 nucleotides to about 10 nucleotides, or a length of about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides).
In certain embodiments, the double-stranded sequences of the Xa and Xb cyphers are the same (e.g., Xa═Xb) for one or more target nucleic acid molecules, provided that each such target nucleic acid molecule does not have the same double-stranded cypher sequence as any other such target nucleic acid molecule. In certain other embodiments, the double-stranded sequence of the Xa cypher for each target nucleic acid molecule is different from the double-stranded sequence of the Xb cypher. In further embodiments, the double-stranded nucleic acid library is contained in a self-replicating vector, such as a plasmid, cosmid, YAC, or viral vector.
In a further aspect, the present disclosure provides a method for obtaining a nucleic acid sequence or accurately detecting a true mutation in a nucleic acid molecule by amplifying each strand of the aforementioned double-stranded nucleic acid library wherein a plurality of target nucleic acid molecules and plurality of random cyphers are amplified, and sequencing each strand of the plurality of target nucleic acid molecules and plurality of random cyphers. In certain embodiments, the sequencing is performed using massively parallel sequencing methods. In certain embodiments, the sequence of one strand of a target nucleic acid molecule associated with the first random cypher aligned with the sequence of the complementary strand associated with the second random cypher results in a measureable sequencing error rate ranging from about 10−6 to about 10−8.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a cartoon illustration of an exemplary vector of the present disclosure useful for generating a double-stranded nucleic acid library.
FIG. 2 is a cartoon illustration of an exemplary vector of the present disclosure, wherein adaptor sequences are included and are useful for, for example, bridge amplification methods before sequencing.
FIGS. 3A and 3B show characteristics of a cypher library and the detection of true mutations. (A) Data generated in a single next generation sequence run on MiSeq® demonstrates broad coverage and diversity at the upstream seven base pair cypher in a vector library, wherein the vector used is illustrated in FIG. 2. (B) Cypher Seq eliminates errors introduced during library preparation and sequencing. Target nucleic acid molecules were ligated into a cypher vector library containing previously catalogued dual, double-stranded cyphers. The target sequences were amplified and sequenced. All sequencing reads having identical cypher pairs, along with their reverse complements, were grouped into families. Comparison of family sequences allowed for generation of a consensus sequence wherein ‘mutations’ (errors) arising during library preparation (open circle) and during sequencing (gray circle and triangle) were computationally eliminated. Generally, mutations that are present in all or substantially all reads (black diamond) from the same cypher and its reverse complement are counted as true mutations.
FIGS. 4A and 4B show that the cypher system can distinguish true mutations from artifact mutations. (A) Wild-type TP53 Exon 4 was ligated into a library of Cypher Seq vectors and sequenced on the Illumina MiSeq® instrument with a depth of over a million. Sequences were then compared to wild-type TP53 sequence. Detected substitutions were plotted before (A) and after correction (B) with Cypher Seq.
DETAILED DESCRIPTION
In one aspect, the present disclosure provides a double-stranded nucleic acid library wherein target nucleic acid molecules include dual cyphers (i.e., barcodes or origin identifier tags), one on each end (same or different), so that sequencing each complementary strand can be connected or linked back to the original molecule. The unique cypher on each strand links each strand with its original complementary strand (e.g., before any amplification), so that each paired sequence serves as its own internal control. In other words, by uniquely tagging double-stranded nucleic acid molecules, sequence data obtained from one strand of a single nucleic acid molecule can be specifically linked to sequence data obtained from the complementary strand of that same double-stranded nucleic acid molecule. Furthermore, sequence data obtained from one end of a double-stranded target nucleic acid molecule can be specifically linked to sequence data obtained from the opposite end of that same double-stranded target nucleic acid molecule (if, for example, it is not possible to obtain sequence data across the entire target nucleic acid molecule fragment of the library).
The compositions and methods of this disclosure allow a person of ordinary skill in the art to more accurately distinguish true mutations (i.e., naturally arising in vivo mutations) of a nucleic acid molecule from artifact “mutations” (i.e., ex vivo mutations or errors) of a nucleic acid molecule that may arise for various reasons, such as a downstream amplification error, a sequencing error, or physical or chemical damage. For example, if a mutation pre-existed in the original double-stranded nucleic acid molecule before isolation, amplification or sequencing, then a transition mutation of adenine (A) to guanine (G) identified on one strand will be complemented with a thymine (T) to cysteine (C) transition on the other strand. In contrast, artifact “mutations” that arise later on an individual (separate) DNA strand due to polymerase errors during isolation, amplification or sequencing are extremely unlikely to have a matched base change in the complementary strand. The approach of this disclosure provides compositions and methods for distinguishing systematic errors (e.g., polymerase read fidelity errors) and biological errors (e.g., chemical or other damage) from actual known or newly identified true mutations or single nucleotide polymorphisms (SNPs).
In certain embodiments, the two cyphers on each target molecule have sequences that are distinct from each other and, therefore, provide a unique pair of identifiers wherein one cypher identifies (or is associated with) a first end of a target nucleic acid molecule and the second cypher identifies (or is associated with) the other end of the target nucleic acid molecule. In certain other embodiments, the two cyphers on each target molecule have the same sequence and, therefore, provide a unique identifier for each strand of the target nucleic acid molecule. Each strand of the double-stranded nucleic acid library (e.g., genomic DNA, cDNA) can be amplified and sequenced using, for example, next generation sequencing technologies (such as, emulsion PCR or bridge amplification combined with pyrosequencing or sequencing by synthesis, or the like). The sequence information from each complementary strand of a first double-stranded nucleic acid molecule can be linked and compared (e.g., computationally “de-convoluted”) due to the unique cyphers associated with each end or strand of that particular double-stranded nucleic acid molecule. In other words, each original double-stranded nucleic acid molecule fragment found in a library of molecules can be individually reconstructed due to the presence of an associated unique barcode or pair of barcode (identifier tag) sequences on each target fragment or strand.
By way of background, any spontaneous or induced mutation will be present in both strands of a native genomic, double-stranded DNA molecule. Hence, such a mutant DNA template amplified using PCR will result in a PCR product in which 100% of the molecules produced by PCR include the mutation. In contrast to an original, spontaneous mutation, a change due to polymerase error will only appear in one strand of the initial template DNA molecule (while the other strand will not have the artifact mutation). If all DNA strands in a PCR reaction are copied equally efficiently, then any polymerase error that emerges from the first PCR cycle likely will be found in at least 25% of the total PCR product. But DNA molecules or strands are not copied equally efficiently, so DNA sequences amplified from the strand that incorporated an erroneous nucleotide base during the initial amplification might constitute more or less than 25% of the population of amplified DNA sequences depending on the efficiency of amplification, but still far less than 100%. Similarly, any polymerase error that occurs in later PCR cycles will generally represent an even smaller proportion of PCR products (i.e., 12.5% for the second cycle, 6.25% for the third, etc.) containing a “mutation.” PCR-induced mutations may be due to polymerase errors or due to the polymerase bypassing damaged nucleotides, thereby resulting in an error (see, e.g., Bielas and Loeb, Nat. Methods 2:285-90, 2005). For example, a common change to DNA is the deamination of cytosine, which is recognized by Taq polymerase as a uracil and results in a cytosine to thymine transition mutation (Zheng et al., Mutat. Res. 599:11-20, 2006) —that is, an alteration in the original DNA sequence may be detected when the damaged DNA is sequenced, but such a change may or may not be recognized as a sequencing reaction error or due to damage arising ex vivo (e.g., during or after nucleic acid isolation).
Due to potential artifacts and alterations of nucleic acid molecules arising from isolation, amplification and sequencing, the accurate identification of true somatic DNA mutations is difficult when sequencing amplified nucleic acid molecules. Consequently, evaluation of whether certain mutations are related to, or are a biomarker for, various disease states (e.g., cancer) or aging becomes confounded.
Next generation sequencing has opened the door to sequencing multiple copies of an amplified single nucleic acid molecule—referred to as deep sequencing. The thought on deep sequencing is that if a particular nucleotide of a nucleic acid molecule is sequenced multiple times, then one can more easily identify rare sequence variants or mutations. In fact, however, the amplification and sequencing process has an inherent error rate (which may vary depending on DNA quality, purity, concentration (e.g., cluster density), or other conditions), so no matter how few or how many times a nucleic acid molecule is sequenced, a person of skill in the art cannot distinguish a polymerase error artifact from a true mutation (especially rare mutations).
While being able to sequence many different DNA molecules collectively is advantageous in terms of cost and time, the price for this efficiency and convenience is that various PCR errors complicate mutational analysis as long as their frequency is comparable to that of mutations arising in vivo—in other words, genuine in vivo mutations will be essentially indistinguishable from changes that are artifacts of PCR or sequencing errors.
Thus, the present disclosure, in a further aspect, provides methods for identifying mutations present before amplification or sequencing of a double-stranded nucleic acid library wherein the target molecules include a single double-stranded cypher or dual cyphers (i.e., barcodes or identifier tags), one on each end, so that sequencing each complementary strand can be connected back to the original molecule. In certain embodiments, the method enhances the sensitivity of the sequencing method such that the error rate is 5×10−6, 10−6, 5×10−7, 10−7, 5×10−8, 10−8 or less when sequencing many different target nucleic acid molecules simultaneously or such that the error rate is 5×10−7, 10−7, 5×10−8, 10−8 or less when sequencing a single target nucleic acid molecule in depth.
Prior to setting forth this disclosure in more detail, it may be helpful to an understanding thereof to provide definitions of certain terms to be used herein. Additional definitions are set forth throughout this disclosure.
In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. Also, any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness, are to be understood to include any integer within the recited range, unless otherwise indicated. As used herein, the terms “about” and “consisting essentially of” mean±20% of the indicated range, value, or structure, unless otherwise indicated. It should be understood that the terms “a” and “an” as used herein refer to “one or more” of the enumerated components. The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms “include,” “have” and “comprise” are used synonymously, which terms and variants thereof are intended to be construed as non-limiting.
As used herein, the term “random cypher” or “cypher” or “barcode” or “identifier tag” and variants thereof are used interchangeably and refer to a nucleic acid molecule having a length ranging from about 5 to about 50 nucleotides. In certain embodiments, all of the nucleotides of the cypher are not identical (i.e., comprise at least two different nucleotides) and optionally do not contain three contiguous nucleotides that are identical. In further embodiments, the cypher is comprised of about 5 to about 15 nucleotides, about 6 to about 10 nucleotides, and preferably about 7 to about 12 nucleotides. Cyphers will generally be located at one or both ends a target molecule may, which may be incorporated directly onto target molecules of interest or onto a vector into which target molecules will be later added.
As used herein, “target nucleic acid molecules” and variants thereof refer to a plurality of double-stranded nucleic acid molecules that may be fragments or shorter molecules generated from longer nucleic acid molecules, including from natural samples (e.g., a genome), or the target nucleic acid molecules may be synthetic (e.g., cDNA), recombinant, or a combination thereof. Target nucleic acid fragments from longer molecules may be generated using a variety of techniques known in the art, such as mechanical shearing or specific cleavage with restriction endonucleases.
As used herein, a “nucleic acid molecule library” and variants thereof refers to a collection of nucleic acid molecules or fragments. In certain embodiments, the collection of nucleic acid molecules or fragments is incorporated into a vector, which can be transformed or transfected into an appropriate host cell. The target nucleic acid molecules of this disclosure may be introduced into a variety of different vector backbones (such as plasmids, cosmids, viral vectors, or the like) so that recombinant production of a nucleic acid molecule library can be maintained in a host cell of choice (such as bacteria, yeast, mammalian cells, or the like).
For example, a collection of nucleic acid molecules representing the entire genome is called a genomic library and a collection of DNA copies of messenger RNA is referred to as a complimentary DNA (cDNA) library. Methods for introducing nucleic acid molecule libraries into vectors are well known in the art (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., Eds., Greene Publishing and Wiley-Interscience, New York, 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Vols. 1-3, 1989; Methods in Enzymology, Vol. 152, Guide to Molecular Cloning Techniques, Berger and Kimmel, Eds., San Diego: Academic Press, Inc., 1987).
Depending on the type of library to be generated, the ends of the target nucleic acid fragments may have overhangs or may be “polished” (i.e., blunted). Together, the target nucleic acid molecule fragments can be, for example, cloned directly into a cypher vector to generate a vector library, or be ligated with adapters to generate, for example, polonies. The target nucleic acid molecules, which are the nucleic acid molecules of interest for amplification and sequencing, may range in size from a few nucleotides (e.g., 50) to many thousands (e.g., 10,000). Preferably, the target fragments in the library range in size from about 100 nucleotides to about 750 nucleotides or about 1,000 nucleotides, or from about 150 nucleotides to about 250 nucleotides or about 500 nucleotides.
As used herein, a “nucleic acid molecule priming site” or “PS” and variants thereof are short, known nucleic acid sequences contained in the vector. A PS sequence can vary in length from 5 nucleotides to about 50 nucleotides in length, about 10 nucleotides to about 30 nucleotides, and preferably are about 15 nucleotides to about 20 nucleotides in length. In certain embodiments, a PS sequence may be included at the one or both ends or be an integral part of the random cypher nucleic acid molecules, or be included at the one or both ends or be an integral part of an adapter sequence, or be included as part of the vector. A nucleic acid molecule primer that is complementary to a PS included in a library of the present disclosure can be used to initiate a sequencing reaction.
For example, if a random cypher only has a PS upstream (5′) of the cypher, then a primer complementary to the PS can be used to prime a sequencing reaction to obtain the sequence of the random cypher and some sequence of a target nucleic acid molecule cloned downstream of the cypher. In another example, if a random cypher has a first PS upstream (5′) and a second PS downstream (3′) of the cypher, then a primer complementary to the first PS can be used to prime a sequencing reaction to obtain the sequence of the random cypher, the second PS and some sequence of a target nucleic acid molecule cloned downstream of the second PS. In contrast, a primer complementary to the second PS can be used to prime a sequencing reaction to directly obtain the sequence of the target nucleic acid molecule cloned downstream of the second PS. In this latter case, more target molecule sequence information will be obtained since the sequencing reaction beginning from the second PS can extend further into the target molecule than does the reaction having to extend through both the cypher and the target molecule.
As used herein, “next generation sequencing” refers to high-throughput sequencing methods that allow the sequencing of thousands or millions of molecules in parallel. Examples of next generation sequencing methods include sequencing by synthesis, sequencing by ligation, sequencing by hybridization, polony sequencing, and pyrosequencing. By attaching primers to a solid substrate and a complementary sequence to a nucleic acid molecule, a nucleic acid molecule can be hybridized to the solid substrate via the primer and then multiple copies can be generated in a discrete area on the solid substrate by using polymerase to amplify (these groupings are sometimes referred to as polymerase colonies or polonies). Consequently, during the sequencing process, a nucleotide at a particular position can be sequenced multiple times (e.g., hundreds or thousands of times)—this depth of coverage is referred to as “deep sequencing.”
As used herein, “base calling” refers to the computational conversion of raw or processed data from a sequencing instrument into quality scores and then actual sequences. For example, many of the sequencing platforms use optical detection and charge coupled device (CCD) cameras to generate images of intensity information (i.e., intensity information indicates which nucleotide is in which position of a nucleic acid molecule), so base calling generally refers to the computational image analysis that converts intensity data into sequences and quality scores. Another example is the ion torrent sequencing technology, which employs a proprietary semiconductor ion sensing technology to detect release of hydrogen ions during incorporation of nucleotide bases in sequencing reactions that take place in a high density array of micro-machined wells. There are other examples of methods known in the art that may be employed for simultaneous sequencing of large numbers of nucleotide molecules. Various base calling methods are described in, for example, Niedringhaus et al. (Anal. Chem. 83:4327, 2011), which methods are herein incorporated by reference in their entirety.
In the following description, certain specific details are set forth in order to provide a thorough understanding of various embodiments of this disclosure. However, upon reviewing this disclosure, one skilled in the art will understand that the invention may be practiced without many of these details. In other instances, newly emerging next generation sequencing technologies, as well as well-known or widely available next generation sequencing methods (e.g., chain-termination sequencing, dye-terminator sequencing, reversible dye-terminator sequencing, sequencing by synthesis, sequencing by ligation, sequencing by hybridization, polony sequencing, pyrosequencing, ion semiconductor sequencing, nanoball sequencing, nanopore sequencing, single molecule sequencing, FRET sequencing, base-heavy sequencing, and microfluidic sequencing), have not all been described in detail to avoid unnecessarily obscuring the descriptions of the embodiments of the present disclosure. Descriptions of some of these methods, which methods are herein incorporated by reference in their entirety, can be found, for example, in PCT Publication Nos. WO 98/44151, WO 00/18957, and WO 2006/08413; and U.S. Pat. Nos. 6,143,496, 6,833,246, and 7,754,429; and U.S. Patent Application Publication Nos. U.S. 2010/0227329 and U.S. 2009/0099041.
Various embodiments of the present disclosure are described for purposes of illustration, in the context of use with vectors containing a library of nucleic acid fragments (e.g., genomic or cDNA library). However, as those skilled in the art will appreciate upon reviewing this disclosure, use with other nucleic acid libraries or methods for making a library of nucleic acid fragments may also be suitable.
In certain embodiments, a double-stranded nucleic acid library comprises a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of Xa—Y—Xb (in 5′ to 3′ order), wherein (a) Xa comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) Xb comprises a second random cypher; wherein each of the plurality of random cyphers have a length of about 5 to about 50 nucleotides. In certain embodiments, the double-stranded sequence of the Xa cypher for each target nucleic acid molecule is different from the double-stranded sequence of the Xb cypher. In certain other embodiments, the double-stranded Xa cypher is identical to the Xb cypher for one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic acid molecule is different.
In further embodiments, the plurality or pool of random cyphers used in the double-stranded nucleic acid molecule library or vector library comprise from about 5 nucleotides to about 40 nucleotides, about 5 nucleotides to about 30 nucleotides, about 6 nucleotides to about 30 nucleotides, about 6 nucleotides to about 20 nucleotides, about 6 nucleotides to about 10 nucleotides, about 6 nucleotides to about 8 nucleotides, about 7 nucleotides to about 9 or about 10 nucleotides, or about 6, about 7 or about 8 nucleotides. In certain embodiments, a cypher preferably has a length of about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides. In certain embodiments, a pair of random cyphers associated with nucleic acid sequences or vectors will have different lengths or have the same length. For example, a target nucleic acid molecule or vector may have an upstream (5′) first random cypher of about 6 nucleotides in length and a downstream (3′) second random cypher of about 9 nucleotides in length, or a target nucleic acid molecule or vector may have an upstream (5′) first random cypher of about 7 nucleotides in length and a downstream (3′) second random cypher of about 7 nucleotides in length.
In certain embodiments, both the Xa cypher and the Xb cypher each comprise 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, or 20 nucleotides. In certain other embodiments, the Xa cypher comprises 6 nucleotides and the Xb cypher comprises 7 nucleotides or 8 nucleotides; or the Xa cypher comprises 7 nucleotides and the Xb cypher comprises 6 nucleotides or 8 nucleotides; or the Xa cypher comprises 8 nucleotides and the Xb cypher comprises 6 nucleotides or 7 nucleotides; or the Xa cypher comprises 10 nucleotides and the Xb cypher comprises 11 nucleotides or 12 nucleotides.
The number of nucleotides contained in each of the random cyphers or barcodes will govern the total number of possible barcodes available for use in a library. Shorter barcodes allow for a smaller number of unique cyphers, which may be useful when performing a deep sequence of one or a few nucleotide sequences, whereas longer barcodes may be desirable when examining a population of nucleic acid molecules, such as cDNAs or genomic fragments. In certain embodiments, multiplex sequencing may be desired when targeting specific nucleic acid molecules, specific genomic regions, smaller genomes, or a subset of cDNA transcripts. Multiplex sequencing involves amplifying two or more samples that have been pooled into, for example, a single lane of a flow cell for bridge amplification to exponentially increase the number of molecules analyzed in a single run without sacrificing time or cost. In related embodiments, a unique index sequence (comprising a length ranging from about 4 nucleotides to about 25 nucleotides) specific for a particular sample is included with each dual cypher vector library. For example, if ten different samples are being pooled in preparation for multiplex sequencing, then ten different index sequences will be used such that ten dual cypher vector libraries are used in which each library has a single, unique index sequence identifier (but each library has a plurality of random cyphers).
For example, a barcode of 7 nucleotides would have a formula of 5′-NNNNNNN-3′ (SEQ ID NO.:1), wherein N may be any naturally occurring nucleotide. The four naturally occurring nucleotides are A, T, C, and G, so the total number of possible random cyphers is 47, or 16,384 possible random arrangements (i.e., 16,384 different or unique cyphers). For 6 and 8 nucleotide barcodes, the number of random cyphers would be 4,096 and 65,536, respectively. In certain embodiments of 6, 7 or 8 random nucleotide cyphers, there may be fewer than the pool of 4,094, 16,384 or 65,536 unique cyphers, respectively, available for use when excluding, for example, sequences in which all the nucleotides are identical (e.g., all A or all T or all C or all G) or when excluding sequences in which three contiguous nucleotides are identical or when excluding both of these types of molecules. In addition, the first about 5 nucleotides to about 20 nucleotides of the target nucleic acid molecule sequence may be used as a further identifier tag together with the sequence of an associated random cypher.
In still further embodiments, a double-stranded nucleic acid library comprises a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of Xa—Y—Xb (in 5′ to 3′ order), wherein (a) Xa comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) Xb comprises a second random cypher; wherein each of the plurality of random cyphers have a length of about 5 to about 50 nucleotides and wherein (i) at least two of those nucleotides are different in each cypher or (ii) each cypher does not contain three contiguous nucleotides that are identical. In certain embodiments wherein each cypher does not contain three contiguous nucleotides that are identical, the double-stranded Xa cypher is identical to the Xb cypher for one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic acid molecule is different.
In yet further embodiments, a double-stranded nucleic acid library comprises a plurality of target nucleic acid molecules and a plurality of random cyphers, wherein the nucleic acid library comprises molecules having a formula of Xa—Xb—Y, Xb—Xa—Y, Y—Xa—Xb, Y—Xb—Xa, Xa—Y, Xb—Y, Y—Xa, or Y—Xb (in 5′ to 3′ order), wherein (a) Xa comprises a first random cypher, (b) Y comprises a target nucleic acid molecule, and (c) Xb comprises a second random cypher; wherein each of the plurality of random cyphers have a length of about 5 to about 50 nucleotides.
In any of the embodiments described herein, an Xa cypher further comprises about a 5 nucleotide to about a 20 nucleotide sequence of the target nucleic acid molecule that is downstream of the Xa cypher, or an Xb cypher further comprises about a 5 nucleotide to about a 20 nucleotide sequence of the target nucleic acid molecule that is upstream of the Xb cypher, or an Xa cypher and Xb cypher further comprise about a 5 nucleotide to about a 20 nucleotide sequence of the target nucleic acid molecule that is downstream or upstream, respectively, of each cypher.
In yet further embodiments, a first target molecule is associated with and disposed between a first random cypher r and a second random cypher Xb, a second target molecule is associated with and disposed between a third random cypher r and a fourth random cypher Xb, and so on, wherein the target molecules of a library or of a vector library each has a unique Xa cypher (i.e., none of the Xa cyphers have the same sequence) and each has a unique Xb cypher (i.e., none of the Xb cyphers have the same sequence), and wherein none or only a minority of the Xa and Xb cyphers have the same sequence.
For example, if the length of the random cypher is 7 nucleotides, then there will a total of 16,384 different barcodes available as first random cypher r and second random cypher Xb. In this case, if a first target nucleic acid molecule is associated with and disposed between random cypher r number 1 and random cypher Xb number 2 and a second target nucleic acid molecule is associated with and disposed between random cypher X′ number 16,383 and random cypher Xb number 16,384, then a third target nucleic acid molecule can only be associated with and disposed between any pair of random cypher numbers selected from numbers 3 to 16,382, and so on for each target nucleic acid molecule of a library until each of the different random cyphers have been used (which may or may not be all 16,382). In this embodiment, each target nucleic acid molecule of a library will have a unique pair of cyphers that differ from each of the other pairs of cyphers found associated with each other target nucleic acid molecule of the library.
In any of the embodiments described herein, random cypher sequences from a particular pool of cyphers (e.g., pools of 4,094, 16,384 or 65,536 unique cyphers) may be used more than once. In further embodiments, each target nucleic acid molecule or a subset of target molecules has a different (unique) pair of cyphers. For example, if a first target molecule is associated with and disposed between random cypher number 1 and random cypher number 100, then a second target molecule will need to be flanked by a different dual pair of cyphers—such as random cypher number 1 and random cypher number 65, or random cypher number 486 and random cypher number 100—which may be any combination other than 1 and 100. In certain other embodiments, each target nucleic acid molecule or a subset of target molecules has identical cyphers on each end of one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic acid molecule is different. For example, if a first target molecule is flanked by cypher number 10, then a second target molecule having identical cyphers on each end will have to have a different cypher—such as random cypher number 555 or the like—which may be any other cypher other than 10. In still further embodiments, target nucleic acid molecules of the nucleic acid molecule library will each have dual unique cyphers Xa and Xb, wherein none of the Xa cyphers have the same sequence as any other X′ cypher, none of the Xb cyphers have the same sequence as any other Xb cypher, and none of the Xa cyphers have the same sequence as any Xb cypher. In still further embodiments, target nucleic acid molecules of the nucleic acid molecule library will each have a unique pair of Xa—Xb cyphers wherein none of the r or Xb cyphers have the same sequence. A mixture of any of the aforementioned embodiments may make up a nucleic acid molecule library of this disclosure.
In any of the embodiments described herein, the plurality of target nucleic acid molecules that together are used to generate a nucleic acid molecule library (or used for insertion into a vector to generate a vector library containing a plurality of target nucleic acid molecules) may each have a length that ranges from about 10 nucleotides to about 10,000 nucleotides, from about 50 nucleotides to about 5,000 nucleotides, from about 100 nucleotides to about 1,000 nucleotides, or from about 150 nucleotides to about 750 nucleotides, or from about 250 nucleotides to about 500 nucleotides.
In any of the embodiments described herein, the plurality of random cyphers may further be linked to a first nucleic acid molecule priming site (PS1), linked to a second nucleic acid molecule priming site (PS2), or linked to both a first and a second nucleic acid molecule priming site. In certain embodiments, a plurality of random cyphers may each be associated with and disposed between a first nucleic acid molecule priming site (PS1) and a second nucleic acid molecule priming site (PS2), wherein the double-stranded sequence of PS1 is different from the double-stranded sequence of PS2. In certain embodiments, each pair of Xa—Xb cyphers may be associated with and disposed between an upstream and a downstream nucleic acid molecule priming site (PS1) (see, e.g., FIG. 2).
In any of the embodiments described herein, a first nucleic acid molecule priming site PS1 will be located upstream (5′) of the first random cypher r and the first nucleic acid molecule priming site PS1 will also be located downstream (3′) of the second random cypher Xb. In certain embodiments, an oligonucleotide primer complementary to the sense strand of PS1 can be used to prime a sequencing reaction to obtain the sequence of the sense strand of the first random cypher r or to prime a sequencing reaction to obtain the sequence of the anti-sense strand of the second random cypher Xb, whereas an oligonucleotide primer complementary to the anti-sense strand of PS1 can be used to prime a sequencing reaction to obtain the sequence of the anti-sense strand of the first random cypher r or to prime a sequencing reaction to obtain the sequence of the sense strand of the second random cypher Xb.
In any of the embodiments described herein, the second nucleic acid molecule priming site PS2 will be located downstream (3′) of the first random cypher r and the second nucleic acid molecule priming site PS2 will also be located upstream (5′) of the second random cypher Xb. In certain embodiments, an oligonucleotide primer complementary to the sense strand of PS2 can be used to prime a sequencing reaction to obtain the sequence of the sense strand from the 5′-end of the associated double-stranded target nucleic acid molecule or to prime a sequencing reaction to obtain the sequence of the anti-sense strand from the 3′-end of the associated double-stranded target nucleic acid molecule, whereas an oligonucleotide primer complementary to the anti-sense strand of PS2 can be used to prime a sequencing reaction to obtain the sequence of the anti-sense strand from the 5′-end of the associated double-stranded target nucleic acid molecule or to prime a sequencing reaction to obtain the sequence of the sense strand from the 3′-end of the associated double-stranded target nucleic acid molecule.
Depending on the length of the target nucleic acid molecule, the entire target nucleic acid molecule sequence may be obtained if it is short enough or only a portion of the entire target nucleic acid molecule sequence may be obtained if it is longer than about 100 nucleotides to about 250 nucleotides. An advantage of the compositions and methods of the instant disclosure is that even though a target nucleic acid molecule is too long to obtain sequence data for the entire molecule or fragment, the sequence data obtained from one end of a double-stranded target molecule can be specifically linked to sequence data obtained from the opposite end or from the second strand of that same double-stranded target molecule because each target molecule in a library of this disclosure will have double-stranded cyphers, or a unique Xa—Xb pair of cyphers. Linking the sequence data of the two strands allows for sensitive identification of “true” mutations wherein deeper sequencing actually increases the sensitivity of the detection, and these methods can provide sufficient data to quantify the number of artifact mutations.
In any of the embodiments described herein, a plurality of random cyphers may further comprise a first restriction endonuclease recognition sequence (RE1) and a second restriction endonuclease recognition sequence (RE2), wherein the first restriction endonuclease recognition sequence RE1 is located upstream (5′) of the first random cypher Xa and the second restriction endonuclease recognition sequence RE2 is located downstream (3′) of the second random cypher Xb. In certain embodiments, a first restriction endonuclease recognition sequence RE1 and a second restriction endonuclease recognition sequence RE2 are the same or different. In certain embodiments, RE1, RE2, or both RE1 and RE2 are “rare-cutter” restriction endonucleases that have a recognition sequence that occurs only rarely within a genome or within a target nucleic acid molecule sequence or are “blunt-cutters” that generate nucleic acid molecules with blunt ends after digestion (e.g., SmaI). Such rare cutter enzymes generally have longer recognition sites with seven- or eight-nucleotide or longer recognition sequences, such as AarI, AbeI, AscI, AsiSI, BbvCI, BstRZ2461, BstSWI, CciNI, CsiBI, CspBI, FseI, NotI, MchAI, MspSWI, MssI, PacI, PmeI, SbfI, SdaI, SgfI, SmiI, SrfI, Sse232I, Sse8387I, SwaI, TagII, VpaK32I, or the like.
In certain embodiments, a nucleic acid molecule library comprises nucleic acid molecules having a formula of 5 ‘-RE1-PS1-Xa—PS2-Y-PS2-Xb—PS1-RE2-3’, wherein RE1 is a first restriction endonuclease recognition sequence, PS1 is a first nucleic acid molecule priming site, PS2 is a second nucleic acid molecule priming site, RE2 is a second restriction endonuclease recognition sequence, Y comprises a target nucleic acid molecule, and Xa and Xb are cyphers comprising a length ranging from about 5 nucleotides to about 50 nucleotides or about 6 nucleotides to about 15 nucleotides or about 7 nucleotides to about 9 nucleotides. In further embodiments, RE1 and RE2 are sequences recognized by the same restriction endonuclease or an isoschizomer or neoschizomer thereof, or RE1 and RE2 have different sequences recognized by different restriction endonucleases. In further embodiments, PS1 and PS2 have different sequences. In further embodiments, target nucleic acid molecules of the nucleic acid molecule library will each have dual unique cyphers Xa and Xb, wherein none of the Xa cyphers have the same sequence as any other Xa cypher, none of the Xb cyphers have the same sequence as any other Xb cypher, and none of the Xa cyphers have the same sequence as any Xb cypher. In still further embodiments, target nucleic acid molecules of the nucleic acid molecule library will each have a unique cypher or pair of Xa—Xb cyphers wherein none of the r or Xb cyphers have the same sequence.
Also contemplated in the present disclosure is using a library of double-stranded barcoded or dual double-stranded barcoded target nucleic acid molecules for amplification and sequencing reactions to detect true mutations. In order to facilitate certain amplification or sequencing methods, other features may be included in the compositions of the instant disclosure. For example, bridge amplification may involve ligating adapter sequences to each end of a population of target nucleic acid molecules. Single-stranded oligonucleotide primers complementary to the adapters are immobilized on a solid substrate, the target molecules containing the adapter sequences are denatured into single strands, and hybridized to complementary primers on the solid substrate. An extension reaction is used to copy the hybridized target molecule and the double-stranded product is denatured into single strands again. The copied single strands then loop over (form a “bridge”) and hybridize with a complementary primer on the solid substrate, upon which the extension reaction is run again. In this way, many target molecules may be amplified at the same time and the resulting product is subject to massive parallel sequencing.
In certain embodiments, a nucleic acid molecule library comprises nucleic acid molecules having a formula of 5′-RE1-AS-PS1-Xa—PS2-Y-PS2-Xb—PS1-AS-RE2-3′, wherein RE1 and RE2 are first and second restriction endonuclease recognition sequences, PS1 and PS2 are a first and second nucleic acid molecule priming sites, AS is an adapter sequence comprising a length ranging from about 20 nucleotides to about 100 nucleotides, Y comprises a target nucleic acid molecule, and Xa and Xb are cyphers comprising a length ranging from about 5 nucleotides to about 50 nucleotides or about 6 nucleotides to about 15 nucleotides or about 7 nucleotides to about 9 nucleotides.
In further embodiments, a nucleic acid molecule library comprises nucleic acid molecules having a formula of 5′-RE1-AS-PS1-Xa—Y—Xb—PS1-AS-RE2-3′, wherein RE1 and RE2 are first and second restriction endonuclease recognition sequences, PS1 is a first nucleic acid molecule priming site, AS is an adapter sequence comprising a length ranging from about 20 nucleotides to about 100 nucleotides, Y comprises a target nucleic acid molecule, and Xa and Xb are cyphers comprising a length ranging from about 5 nucleotides to about 50 nucleotides or about 6 nucleotides to about 15 nucleotides or about 7 nucleotides to about 9 nucleotides. In related embodiments, the AS adapter sequence of the aforementioned vector may further comprise a PS2 that is a second nucleic acid molecule priming site or the PS2 may be a part of the original AS sequence. In still further embodiments, the nucleic acid molecule library may further comprise an index sequence (comprising a length ranging from about 4 nucleotides to about 25 nucleotides) located between each of the first and second AS and the PS1 so that the library can be pooled with other libraries having different index sequences to facilitate multiplex sequencing (also referred to as multiplexing) either before or after amplification.
Each of the aforementioned dual barcoded target nucleic acid molecules may be assembled into a carrier library in the form of, for example, a self-replicating vector, such as a plasmid, cosmid, YAC, viral vector or other vectors known in the art. In certain embodiments, any of the aforementioned double-stranded nucleic acid molecules comprising a plurality of target nucleic acid molecules and a plurality of random cyphers, are contained in a vector. In still further embodiments, such a vector library is carried in a host cell, such as bacteria, yeast, or mammalian cells.
The present disclosure also provides vectors useful for generating a library of dual barcoded target nucleic acid molecules according to this disclosure. Exemplary vectors comprising cyphers and other elements of this disclosure are illustrated in FIGS. 1 and 2.
In certain embodiments, there are provided a plurality of nucleic acid vectors, comprising a plurality of random cyphers, wherein each vector comprises a region having a formula of 5′-RE1-PS1-Xa—PS2-RE3-PS2-Xb—PS1-RE2-3′, wherein (a) RE1 is a first restriction endonuclease recognition sequence, (b) PS1 is a first nucleic acid molecule priming site, (c) Xa comprises a first random cypher, (d) RE3 is a third restriction endonuclease recognition sequence, wherein RE3 is a site into which a target nucleic acid molecule can be inserted, (e) Xb comprises a second random cypher, (f) PS2 is a second nucleic acid molecule priming site, and (g) RE2 is a second restriction endonuclease recognition sequence; and wherein each of the plurality of random cyphers comprise a length ranging from about 5 nucleotides to about 50 nucleotides, preferably from about 7 nucleotides to about 9 nucleotides; and wherein the plurality of nucleic acid vectors are useful for preparing a double-stranded nucleic acid molecule library in which each vector has a different target nucleic acid molecule insert. In certain embodiments, the sequence of the Xa cypher is different from the sequence of the Xb cypher in each vector (that is, each vector has a unique pair). In further embodiments, the plurality of nucleic acid vectors may further comprise at least one adapter sequence (AS) between RE1 and PS1 and at least one AS between PS1 and RE2, or comprise at least one AS between RE1 and Xa cypher and at least one AS between Xb cypher and RE2, wherein the AS optionally has a priming site.
In further vector embodiments, the plurality of random cyphers can each have the same or different number of nucleotides, and comprise from about 6 nucleotides to about 8 nucleotides to about 10 nucleotides to about 12 nucleotides to about 15 nucleotides. In still other embodiments, a plurality of target nucleic acid molecules comprising from about 10 nucleotides to about 10,000 nucleotides or comprising from about 100 nucleotides to about 750 nucleotides or to about 1,000 nucleotides, may be inserted into the vector at RE3. In certain embodiments, RE3 will cleave DNA into blunt ends and the plurality of target nucleic acid molecules ligated into this site will also be blunt-ended.
In certain embodiments, the plurality of nucleic acid vectors wherein each vector comprises a region having a formula of 5′-RE1-PS1-Xa—PS2-RE3-PS2-Xb—PS1-RE2-3′ the Xa cyphers and Xb cyphers on each vector is sequenced before a target nucleic acid molecule is inserted into each vector. In further embodiments, the plurality of nucleic acid vectors wherein each vector comprises a region having a formula of 5′-RE1-PS1-Xa—PS2-RE3-PS2-Xb—PS1-RE2-3′ the Xa cyphers and Xb cyphers on each vector is sequenced after a target nucleic acid molecule is inserted into each vector or is sequenced at the same time a target nucleic acid molecule insert is sequenced.
The dual barcoded target nucleic acid molecules and the vectors containing such molecules of this disclosure may further be used in sequencing reactions to determine the sequence and mutation frequency of the molecules in the library. In certain embodiments, this disclosure provides a method for obtaining a nucleic acid sequence by preparing a double-stranded dual barcoded nucleic acid library as described herein and then sequencing each strand of the plurality of target nucleic acid molecules and plurality of random cyphers. In certain embodiments, target nucleic acid molecules and and associated cyphers are excised for sequencing directly from the vector using restriction endonuclease enzymes prior to amplification. In certain embodiments, next generation sequencing methods are used to determine the sequence of library molecules, such as sequencing by synthesis, pyrosequencing, reversible dye-terminator sequencing or polony sequencing.
In still further embodiments, there are provided methods for determining the error rate due to amplification and sequencing by determining the sequence of one strand of a target nucleic acid molecule associated with the first random cypher and aligning with the sequence of the complementary strand associated with the second random cypher to distinguish between a pre-existing mutation and an amplification or sequencing artifact mutation, wherein the measured sequencing error rate will range from about 10−6 to about 5×10−6 to about 10−7 to about 5×10−7 to about 10−8 to about 10−9. In other words, using the methods of this disclosure, a person of ordinary skill in the art can associate each DNA sequence read to an original template DNA. Given that both strands of the original double-stranded DNA are barcoded with associated barcodes, this increases the sensitivity of the sequencing base call by more easily identifying artifact “mutations” sequence changes introduced during the sequencing process.
In certain embodiments, the compositions and methods of this instant disclosure will be useful in detecting rare mutants against a large background signal, such as when monitoring circulating tumor cells; detecting circulating mutant DNA in blood, monitoring or detecting disease and rare mutations by direct sequencing, monitoring or detecting disease or drug response associated mutations. Additional embodiments may be used to quantify DNA damage, quantify or detect mutations in viral genomes (e.g., HIV and other viral infections) or other infectious agents that may be indicative of response to therapy or may be useful in monitoring disease progression or recurrence. In yet other embodiments, these compositions and methods may be useful in detecting damage to DNA from chemotherapy, or in detection and quantitation of specific methylation of DNA sequences.
EXAMPLES Example 1 Dual Cypher Sequencing of a Tumor Genomic Library
Cancer cells contain numerous clonal mutations, i.e., mutations that are present in most or all malignant cells of a tumor and have presumably been selected because they confer a proliferative advantage. An important question is whether cancer cells also contain a large number of random mutations, i.e., randomly distributed unselected mutations that occur in only one or a few cells of a tumor. Such random mutations could contribute to the morphologic and functional heterogeneity of cancers and include mutations that confer resistance to therapy. The instant disclosure provides compositions and methods for distinguishing clonal mutations from random mutations.
To examine whether malignant cells exhibit a mutator phenotype resulting in the generation of random mutations throughout the genome, dual cypher sequencing of present disclosure will be performed on normal and tumor genomic libraries. Briefly, genomic DNA from patient-matched normal and tumor tissue is prepared using Qiagen® kits (Valencia, Calif.), and quantified by optical absorbance and quantitative PCR (qPCR). The isolated genomic DNA is fragmented to a size of about 150-250 base pairs (short insert library) or to a size of about 300-700 base pairs (long insert library) by shearing. The DNA fragments having overhang ends are repaired (i.e., blunted) using T4 DNA polymerase (having both 3′ to 5′ exonuclease activity and 5′ to 3′ polymerase activity) and the 5′-ends of the blunted DNA are phosphorylated with T4 polynucleotide kinase (Quick Blunting Kit I, New England Biolabs), and then purified. The end-repaired DNA fragments are ligated into the SmaI site of the library of dual cypher vectors shown in FIG. 2 to generate a target genomic library.
The ligated cypher vector library is purified and the target genomic library fragments are amplified by using, for example, the following PCR protocol: 30 seconds at 98° C.; five to thirty cycles of 10 seconds at 98° C., 30 seconds at 65° C., 30 seconds at 72° C.; 5 minutes at 72° C.; and then store at 4° C. The amplification is performed using sense strand and anti-sense strand primers that anneal to a sequence located within the adapter region (in certain embodiments, the primer will anneal to a sequence upstream of the AS), and is upstream of the unique cypher and the target genomic insert (and, if present, upstream of an index sequence if multiplex sequencing is desired; see, e.g., FIG. 2) for Illumina bridge sequencing. The sequencing of the library described above will be performed using, for example, an Illumina® Genome Analyzer II sequencing instrument as specified by the manufacturer.
The unique cypher tags are used to computationally deconvolute the sequencing data and map all sequence reads to single molecules (i.e., distinguish PCR and sequencing errors from real mutations). Base calling and sequence alignment will be performed using, for example, the Eland pipeline (Illumina, San Diego, Calif.). The data generated will allow identification of tumor heterogeneity at the single-nucleotide level and reveal tumors having a mutator phenotype.
Example 2 Dual Cypher Sequencing of a mtDNA Library
Mutations in mitochondrial DNA (mtDNA) lead to a diverse collection of diseases that are challenging to diagnose and treat. Each human cell has hundreds to thousands of mitochondrial genomes and disease-associated mtDNA mutations are homoplasmic in nature, i.e., the identical mutation is present in a preponderance of mitochondria within a tissue (Taylor and Turnbull, Nat. Rev. Genet. 6:389, 2005; Chatterjee et al., Oncogene 25:4663, 2006). Although the precise mechanisms of mtDNA mutation accumulation in disease pathogenesis remain elusive, multiple homoplasmic mutations have been documented in colorectal, breast, cervical, ovarian, prostate, liver, and lung cancers (Copeland et al., Cancer Invest. 20:557, 2002; Brandon et al., Oncogene 25:4647, 2006). Hence, the mitochondrial genome provides excellent potential as a specific biomarker of disease, which may allow for improved treatment outcomes and increased overall survival.
Dual cypher sequencing of present disclosure can be leveraged to quantify circulating tumor cells (CTCs) and circulating tumor mtDNA (ctmtDNA) could be used to diagnose and stage cancer, assess response to therapy, and evaluate progression and recurrence after surgery. First, mtDNA isolated for prostatic cancer and peripheral blood cells from the same patient will be sequenced to identify somatic homoplasmic mtDNA mutations. These mtDNA biomarkers will be statistically assessed for their potential fundamental and clinical significance with respect to Gleason score, clinical stage, recurrence, therapeutic response, and progression.
Once specific homoplasmic mutations from individual tumors are identified, patient-matched blood specimens will be examined for the presence of identical mutations in the plasma and buffy coat to determine the frequencies of ctmtDNA and CTCs, respectfully. This will be accomplished by using the dual cypher sequencing technology of this disclosure, and as described in Example 1, to sensitively monitor multiple mtDNA mutations concurrently. The distribution of CTCs in peripheral blood from patients with varying PSA serum levels and Gleason scores will be determined.
Example 3 High-Resolution Detection of TP53 Mutations
A recent genomics study determined that TP53 is mutated in 96% of high grade serous ovarian carcinoma (HGSC), responsible for two-thirds of all ovarian cancer deaths (Cancer Genome Atlas Research Network, Nature 474:609, 2011), and current models indicate that TP53 loss is an early event in HGSC pathogenesis (Bowtell, Nat. Rev. Cancer 10:803, 2010). Thus, the near universality and early occurrence of TP53 mutations in HGSC make TP53 a promising biomarker candidate for early detection and disease monitoring of HGSC. Dual cypher sequencing of present disclosure was used to detect somatic TP53 mutations that arose during replication in E. coli.
Dual Cypher Vector Construction
An oligonucleotide containing EcoRI and BamHI restriction enzyme sites, adapter sequences, indices, and random 7-nucleotide barcodes flanking a SmaI restriction enzyme site with the following sequence was made (Integrated DNA Technologies): GATACAGGATCCAATGATACGGCGACCACCGAGATCTACACTAGATCGCGC CTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAGNNNNNNNCCCGGGNN CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGCAGACCGTA AGGCGAATCTCGTATGCCGTCTTCTGCTTGGAATTCGATACA (SEQ ID NO.:2). To amplify and create a double-stranded product from this single-stranded DNA oligonucleotide, 30 cycles of PCR were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies) as per the manufacturer's instructions (forward primer sequence: GATACAGGATCCAATGATACGG, SEQ ID NO.:3; reverse primer sequence: TGTATCGAATTCCAAGCAGAAG, SEQ ID NO.:4). The following cycling conditions were used: 95° C. for 2 minutes, followed by 30 cycles of 95° C. for 1 minute and 64° C. for 1 minute. The double-stranded nature of the product was verified using a SmaI (New England BioLabs) restriction digest. The product was then purified (Zymo Research DNA Clean & Concentrator-5) and subjected to EcoRI/BamHI restriction digest using BamHI-HF (New England BioLabs) and EcoRI-HF (New England BioLabs) to prepare the construct for ligation into an EcoRI/BamHI-digested pUC 19 backbone. Digested vector and construct were run on a 1.5% UltraPure Low-Melting Point Agarose (Invitrogen) electrophoresis gel with 1×SybrSafe (Invitrogen) and the appropriate bands were excised. The DNA in the gel fragments was purified using a Zymo-Clean gel DNA recovery kit (Zymo Research) and quantified using a spectrophotometer (Nanophotometer, Implen). Ligation reactions using T4 DNA ligase HC (Invitrogen) and a 1:3 vector to insert molar ratio at room temperature for 2 hours were carried out, then ethanol precipitated, and resuspended in water. Purified DNA (2 μl) was electroporated into ElectroMAX DH10B T1 Phage Resistant Cells (Invitrogen). The transformed cells were plated at a 1:100 dilution on LB agar media containing 100 μg/mL carbenicillin and incubated overnight at 37° C. to determine colony counts, and the remainder of the transformation was spiked into LB cultures for overnight growth at 37° C. The DNA from the overnight cultures was purified using the QIAquick Spin Miniprep Kit (Qiagen).
A single next generation sequencing run on MiSeq® demonstrated optimal coverage and diversity at the upstream seven basepair cypher in the vector library. FIG. 3A shows that the each nucleotide was detected at approximately the same rate at each random position of the cypher (here the 5′ cyphers were sequenced).
TP53 Exon 4 Library Construction
Briefly, SKOV-3 (human ovarian carcinoma cell line) cells were grown in McCoy's 5a Medium supplemented with 10% Fetal Bovine Serum, 1.5 mM/L-glutamine, 2200 mg/L sodium bicarbonate, and Penicillin/Streptomycin. SKOV-3 cells were harvested and DNA was extracted using a DNeasy Blood and Tissue Kit (Qiagen). PCR primers were designed to amplify exon 4 of human TP53; forward primer sequence: TCTGTCTCCTTCCTCTTCCTACA (SEQ ID NO.:5) and reverse primer sequence: AACCAGCCCTGTCGTCTCT (SEQ ID NO.:6). Thirty cycles of PCR were performed on SKOV-3 DNA using 0.5 μM primers and GoTaq Hot Start Colorless Master Mix (Promega) under the following cycling conditions: 95° C. for 2 minutes; 30 cycles of 95° C. for 30 seconds, 63° C. for 30 seconds, 72° C. for 1 minute; followed by 72° C. for 5 minutes. Each PCR product was then cloned into TOPO vectors (Invitrogen), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen), plated on LB agar media containing 100 μg/mL carbenicillin and incubated overnight at 37° C.
Ten colonies were picked and cultured overnight. The DNA from the overnight LB cultures was purified using the QIAquick Spin Miniprep Kit (Qiagen). Sequencing of the TOPO clones was performed using capillary electrophoresis-based sequencing on an Applied Biosystems 3730xl DNA Analyzer. One TOPO clone containing the appropriate wild type TP53 exon 4 sequence was selected. The DNA was subjected to EcoRI digestion to excise the TP53 exon 4 insert and run on a 1.5% UltraPure Low-Melting Point Agarose gel. The TP53 exon 4 DNA band was then manually excised and purified using the Zymo-Clean gel DNA recovery kit followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. The digested DNA was then blunted and phosphorylated using the Quick Blunting Kit (New England BioLabs) and purified with a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation.
The Cypher Seq vector library was digested with SmaI, treated with Antartic Phosphatase (New England BioLabs), and run on a 1.5% UltraPure Low-Melting Point Agarose gel. The appropriate band was excised and purified using the Zymo-Clean gel DNA recovery kit, followed by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation. Blunt-end ligations of the vector and TP53 exon 4 DNA were then carried out in 20 μl reactions using T4 DNA Ligase HC (Invitrogen) and a 1:10 vector to insert molar ratio. The ligations were incubated at 16° C. overnight, ethanol precipitated, and transformed into ElectroMAX DH10b T1-phage resistant cells. Bacteria were grown overnight at 37° C. in LB containing 100 μg/mL carbenicillin and DNA was purified using the QIAquick Spin Miniprep Kit. The presence of the appropriate insert was verified by diagnostic restriction digest and gel electrophoresis.
The sequencing construct containing the Illumina adapters, barcodes, and TP53 DNA was then amplified using 10 cycles of PCR and primers designed against the adapter ends (forward primer: AATGATACGGCGACCACCGA, SEQ ID NO.:7; and reverse primer: CAAGCAGAAGACGGCATACGA, SEQ ID NO.:8). PCR cycling conditions were as follows: 95° C. for 2 minutes; 10 cycles of 95° C. for 30 seconds, 63° C. for 30 seconds, 72° C. for 1 minute; followed by 72° C. for 5 minutes. The sequencing construct was gel purified (Zymo-Clean gel DNA recovery kit), phenol/chloroform/isoamyl alcohol extracted and ethanol precipitated. The library was quantified using the Quant-iT PicoGreen assay (Invitrogen) before loading onto the Illumina MiSeq® flow cell. Finally, the library was sequenced. Sequencing was performed as instructed by the manufacturer's protocol with MiSeq® at Q30 quality level (Illumina). A Q score is defined as a property that is logarithmically related to the base calling error probabilities (Q=−10 log10P). In the case of an assigned Q score of 30 (Q30) to a base, this means that the probability of an incorrect base call is 1 in 1,000 times—that is, the base call accuracy (i.e., probability of a correct base call) is 99.9% —considered the gold standard for next generation sequencing. Barcodes were used to deconvolute the sequencing data.
Results
TP53 Exon 4 DNA from a dual cypher vector library produced in E. coli was sequenced with a depth of over a million, and all sequencing reads with identical cypher pairs and their reverse complements were grouped into families to create a consensus sequence. As illustrated in FIG. 3B, errors introduced during library preparation (open circle) and during sequencing (gray circle and triangle) were computationally eliminated from the consensus sequence and only mutations present in all reads (black diamonds, FIG. 3B) of a cypher family were counted as true mutations (see bottom of FIG. 3B).
Wild-type TP53 Exon 4 sequence was compared to the actual sequence results and substitutions were plotted before (FIG. 4A) and after correction with Cypher Seq (FIG. 4B). Prior to correction, the detected error frequency was 3.9×10−4/bp (FIG. 4A). In short, the initial error frequency reflects assay-related errors (e.g., PCR, sequencing, and other errors introduced after bar-coding). This means that detecting a rare mutation is difficult due to the noise-to-signal ratio being very high. After Cypher Seq correction, however, the error frequency dropped to 8.8×10−7/bp (FIG. 4B). In other words, the remaining substitutions are most likely biological in nature and most likely reflect errors introduced during replication in E. coli prior to ligation into the barcoded vectors. Thus, true mutations (i.e., those that arise naturally in a cell during replication) are readily detectable using the cypher system of the instant disclosure.
The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. In general, in the following claims, the terms used should not be construed to limit the claims to specific embodiments disclosed in the specification and claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.

Claims (6)

What is claimed is:
1. A double-stranded nucleic acid molecule library, comprising a plurality of target nucleic acid molecules and a plurality of random double-stranded cyphers,
wherein the nucleic acid library comprises nucleic acid molecules having a formula of 5′-RE1-PS1-Xa-PS2-Y-PS2-Xb-PS1-RE2-3′,
wherein RE1 is a first restriction endonuclease recognition sequence, PS1 is a first nucleic acid molecule priming site, PS2 is a second nucleic acid molecule priming site, RE2 is a second restriction endonuclease recognition sequence, Y comprises a target nucleic acid molecule, and Xa and Xb each comprise a first and second random cypher, respectively, wherein each cypher has a length ranging from about 6 nucleotides to about 9 nucleotides or has a length of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides, and
wherein the double-stranded Xa cypher is identical to the Xb cypher for one or more target nucleic acid molecules, provided that the double-stranded cypher for each target nucleic molecule is different.
2. The double-stranded nucleic acid library of claim 1 wherein the plurality of double-stranded random cyphers each have the same number of nucleotides and comprise a length of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 150 nucleotides.
3. The double-stranded nucleic acid library of claim 1 wherein the target nucleic acid molecules comprise a length ranging from about 10 nucleotides to about 10,000nucleotides or a length ranging from about 100 nucleotides to about 1,000 nucleotides.
4. The double-stranded nucleic acid library of claim 1 wherein the first restriction endonuclease recognition sequence RE1 and the second restriction endonuclease recognition sequence RE2 are the same.
5. The double-stranded nucleic acid library of claim 1 wherein the nucleic acid molecules having a formula of 5′-RE1-PS1-Xa-PS2-Y-PS2-Xb-PS1-RE2-3′ are each contained in a self-replicating vector.
6. The double-stranded nucleic acid library of claim 5 wherein the self-replicating vector is a plasmid, cosmid, YAC, or viral vector.
US14/378,870 2012-02-17 2013-02-15 Compositions and methods for accurately identifying mutations Active US10011871B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/378,870 US10011871B2 (en) 2012-02-17 2013-02-15 Compositions and methods for accurately identifying mutations

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201261600535P 2012-02-17 2012-02-17
US14/378,870 US10011871B2 (en) 2012-02-17 2013-02-15 Compositions and methods for accurately identifying mutations
PCT/US2013/026505 WO2013123442A1 (en) 2012-02-17 2013-02-15 Compositions and methods for accurately identifying mutations

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/026505 A-371-Of-International WO2013123442A1 (en) 2012-02-17 2013-02-15 Compositions and methods for accurately identifying mutations

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/199,784 Division US10450606B2 (en) 2012-02-17 2016-06-30 Compositions and methods for accurately identifying mutations

Publications (2)

Publication Number Publication Date
US20150024950A1 US20150024950A1 (en) 2015-01-22
US10011871B2 true US10011871B2 (en) 2018-07-03

Family

ID=47750867

Family Applications (25)

Application Number Title Priority Date Filing Date
US14/378,870 Active US10011871B2 (en) 2012-02-17 2013-02-15 Compositions and methods for accurately identifying mutations
US15/199,784 Active 2034-04-02 US10450606B2 (en) 2012-02-17 2016-06-30 Compositions and methods for accurately identifying mutations
US16/121,559 Abandoned US20180363049A1 (en) 2012-02-17 2018-09-04 Compositions and methods for accurately identifying mutations
US16/121,555 Abandoned US20180363048A1 (en) 2012-02-17 2018-09-04 Compositions and methods for accurately identifying mutations
US16/657,881 Abandoned US20200048706A1 (en) 2012-02-17 2019-10-18 Compositions and methods for accurately identifying mutations
US16/657,898 Abandoned US20200048707A1 (en) 2012-02-17 2019-10-18 Compositions and methods for accurately identifying mutations
US16/898,152 Abandoned US20200299766A1 (en) 2012-02-17 2020-06-10 Compositions and methods for accurately identifying mutations
US16/898,155 Abandoned US20200299767A1 (en) 2012-02-17 2020-06-10 Compositions and methods for accurately identifying mutations
US16/996,682 Abandoned US20200385804A1 (en) 2012-02-17 2020-08-18 Compositions and methods for accurately identifying mutations
US17/091,676 Active US11441180B2 (en) 2012-02-17 2020-11-06 Compositions and methods for accurately identifying mutations
US17/219,543 Pending US20210222243A1 (en) 2012-02-17 2021-03-31 Compositions and methods for accurately identifying mutations
US17/235,750 Abandoned US20210238676A1 (en) 2012-02-17 2021-04-20 Compositions and methods for accurately identifying mutations
US17/235,788 Abandoned US20210238678A1 (en) 2012-02-17 2021-04-20 Compositions and methods for accurately identifying mutations
US17/235,837 Abandoned US20210246504A1 (en) 2012-02-17 2021-04-20 Compositions and methods for accurately identifying mutations
US17/356,293 Pending US20210317526A1 (en) 2012-02-17 2021-06-23 Compositions and methods for accurately identifying mutations
US17/356,288 Abandoned US20210317525A1 (en) 2012-02-17 2021-06-23 Compositions and methods for accurately identifying mutations
US17/374,917 Abandoned US20210340619A1 (en) 2012-02-17 2021-07-13 Compositions and methods for accurately identifying mutations
US17/412,105 Pending US20210388435A1 (en) 2012-02-17 2021-08-25 Compositions and methods for accurately identifying mutations
US17/464,341 Pending US20210395818A1 (en) 2012-02-17 2021-09-01 Compositions and methods for accurately identifying mutations
US17/853,716 Pending US20220349004A1 (en) 2012-02-17 2022-06-29 Compositions and methods for accurately identifying mutations
US17/935,880 Pending US20230193381A1 (en) 2012-02-17 2022-09-27 Compositions and methods for accurately identifying mutations
US18/415,344 Pending US20240200131A1 (en) 2012-02-17 2024-01-17 Compositions and methods for accurately identifying mutations
US18/619,081 Pending US20240409996A1 (en) 2012-02-17 2024-03-27 Compositions and methods for accurately identifying mutations
US18/620,758 Pending US20240417790A1 (en) 2012-02-17 2024-03-28 Compositions and methods for accurately identifying mutations
US18/627,305 Pending US20240401128A1 (en) 2012-02-17 2024-04-04 Compositions and methods for accurately identifying mutations

Family Applications After (24)

Application Number Title Priority Date Filing Date
US15/199,784 Active 2034-04-02 US10450606B2 (en) 2012-02-17 2016-06-30 Compositions and methods for accurately identifying mutations
US16/121,559 Abandoned US20180363049A1 (en) 2012-02-17 2018-09-04 Compositions and methods for accurately identifying mutations
US16/121,555 Abandoned US20180363048A1 (en) 2012-02-17 2018-09-04 Compositions and methods for accurately identifying mutations
US16/657,881 Abandoned US20200048706A1 (en) 2012-02-17 2019-10-18 Compositions and methods for accurately identifying mutations
US16/657,898 Abandoned US20200048707A1 (en) 2012-02-17 2019-10-18 Compositions and methods for accurately identifying mutations
US16/898,152 Abandoned US20200299766A1 (en) 2012-02-17 2020-06-10 Compositions and methods for accurately identifying mutations
US16/898,155 Abandoned US20200299767A1 (en) 2012-02-17 2020-06-10 Compositions and methods for accurately identifying mutations
US16/996,682 Abandoned US20200385804A1 (en) 2012-02-17 2020-08-18 Compositions and methods for accurately identifying mutations
US17/091,676 Active US11441180B2 (en) 2012-02-17 2020-11-06 Compositions and methods for accurately identifying mutations
US17/219,543 Pending US20210222243A1 (en) 2012-02-17 2021-03-31 Compositions and methods for accurately identifying mutations
US17/235,750 Abandoned US20210238676A1 (en) 2012-02-17 2021-04-20 Compositions and methods for accurately identifying mutations
US17/235,788 Abandoned US20210238678A1 (en) 2012-02-17 2021-04-20 Compositions and methods for accurately identifying mutations
US17/235,837 Abandoned US20210246504A1 (en) 2012-02-17 2021-04-20 Compositions and methods for accurately identifying mutations
US17/356,293 Pending US20210317526A1 (en) 2012-02-17 2021-06-23 Compositions and methods for accurately identifying mutations
US17/356,288 Abandoned US20210317525A1 (en) 2012-02-17 2021-06-23 Compositions and methods for accurately identifying mutations
US17/374,917 Abandoned US20210340619A1 (en) 2012-02-17 2021-07-13 Compositions and methods for accurately identifying mutations
US17/412,105 Pending US20210388435A1 (en) 2012-02-17 2021-08-25 Compositions and methods for accurately identifying mutations
US17/464,341 Pending US20210395818A1 (en) 2012-02-17 2021-09-01 Compositions and methods for accurately identifying mutations
US17/853,716 Pending US20220349004A1 (en) 2012-02-17 2022-06-29 Compositions and methods for accurately identifying mutations
US17/935,880 Pending US20230193381A1 (en) 2012-02-17 2022-09-27 Compositions and methods for accurately identifying mutations
US18/415,344 Pending US20240200131A1 (en) 2012-02-17 2024-01-17 Compositions and methods for accurately identifying mutations
US18/619,081 Pending US20240409996A1 (en) 2012-02-17 2024-03-27 Compositions and methods for accurately identifying mutations
US18/620,758 Pending US20240417790A1 (en) 2012-02-17 2024-03-28 Compositions and methods for accurately identifying mutations
US18/627,305 Pending US20240401128A1 (en) 2012-02-17 2024-04-04 Compositions and methods for accurately identifying mutations

Country Status (15)

Country Link
US (25) US10011871B2 (en)
EP (3) EP2814959B1 (en)
CY (1) CY1123973T1 (en)
DK (2) DK3363901T3 (en)
ES (2) ES2855130T3 (en)
HR (1) HRP20210504T1 (en)
HU (1) HUE053360T2 (en)
LT (1) LT3363901T (en)
NO (1) NO2864470T3 (en)
PL (2) PL3363901T3 (en)
PT (2) PT3363901T (en)
RS (1) RS61631B1 (en)
SI (1) SI3363901T1 (en)
SM (1) SMT202100154T1 (en)
WO (1) WO2013123442A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170211140A1 (en) * 2015-12-08 2017-07-27 Twinstrand Biosciences, Inc. Adapters, methods, and compositions for duplex sequencing
US20180363052A1 (en) * 2012-03-20 2018-12-20 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing
US10450606B2 (en) 2012-02-17 2019-10-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US20220205051A1 (en) * 2012-09-04 2022-06-30 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification
US11739367B2 (en) 2017-11-08 2023-08-29 Twinstrand Biosciences, Inc. Reagents and adapters for nucleic acid sequencing and methods for making such reagents and adapters
US11821028B2 (en) 2016-07-12 2023-11-21 QIAGEN Sciences, LLP Single end duplex DNA sequencing
US11845985B2 (en) 2018-07-12 2023-12-19 Twinstrand Biosciences, Inc. Methods and reagents for characterizing genomic editing, clonal expansion, and associated applications

Families Citing this family (143)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2726702T3 (en) 2009-01-15 2019-10-08 Adaptive Biotechnologies Corp Adaptive immunity profiling and methods for the generation of monoclonal antibodies
US9085798B2 (en) 2009-04-30 2015-07-21 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US20190300945A1 (en) 2010-04-05 2019-10-03 Prognosys Biosciences, Inc. Spatially Encoded Biological Assays
WO2011127099A1 (en) 2010-04-05 2011-10-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
WO2012129363A2 (en) 2011-03-24 2012-09-27 President And Fellows Of Harvard College Single cell nucleic acid detection and analysis
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
EP3372694A1 (en) 2012-03-05 2018-09-12 Adaptive Biotechnologies Corporation Determining paired immune receptor chains from frequency matched subunits
HUE029357T2 (en) 2012-05-08 2017-02-28 Adaptive Biotechnologies Corp Compositions and method for measuring and calibrating amplification bias in multiplexed pcr reactions
AU2013267609C1 (en) 2012-05-31 2019-01-03 Board Of Regents, The University Of Texas System Method for accurate sequencing of DNA
AU2013302756C1 (en) 2012-08-14 2018-05-17 10X Genomics, Inc. Microcapsule compositions and methods
US10584381B2 (en) 2012-08-14 2020-03-10 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10323279B2 (en) 2012-08-14 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11591637B2 (en) 2012-08-14 2023-02-28 10X Genomics, Inc. Compositions and methods for sample processing
US9701998B2 (en) 2012-12-14 2017-07-11 10X Genomics, Inc. Methods and systems for processing polynucleotides
US20160040229A1 (en) 2013-08-16 2016-02-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876152B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11913065B2 (en) 2012-09-04 2024-02-27 Guardent Health, Inc. Systems and methods to detect rare mutations and copy number variation
EP4592400A3 (en) 2012-10-17 2025-10-29 10x Genomics Sweden AB Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
WO2015160439A2 (en) 2014-04-17 2015-10-22 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
JP6338221B2 (en) 2012-10-24 2018-06-06 タカラ バイオ ユーエスエー, インコーポレイテッド Template switch based method for producing nucleic acid products
US10533221B2 (en) * 2012-12-14 2020-01-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
KR20200140929A (en) 2013-02-08 2020-12-16 10엑스 제노믹스, 인크. Polynucleotide barcode generation
CN114574581A (en) 2013-03-15 2022-06-03 夸登特健康公司 System and method for detecting rare mutations and copy number variations
CA2916662C (en) 2013-06-25 2022-03-08 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US9708657B2 (en) * 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
JP6602294B2 (en) 2013-10-17 2019-11-06 タカラ バイオ ユーエスエー, インコーポレイテッド Methods for adding adapters to nucleic acids and compositions for performing the methods
WO2015073711A1 (en) * 2013-11-13 2015-05-21 Nugen Technologies, Inc. Compositions and methods for identification of a duplicate sequencing read
ES2693217T3 (en) * 2013-12-02 2018-12-10 Personal Genome Diagnostics Inc. Method to evaluate minority variants in a sample
WO2015094861A1 (en) 2013-12-17 2015-06-25 Clontech Laboratories, Inc. Methods for adding adapters to nucleic acids and compositions for practicing the same
ES2660989T3 (en) 2013-12-28 2018-03-27 Guardant Health, Inc. Methods and systems to detect genetic variants
EP3099820A4 (en) 2014-01-27 2018-01-03 The General Hospital Corporation Methods of preparing nucleic acids for sequencing
US10066265B2 (en) 2014-04-01 2018-09-04 Adaptive Biotechnologies Corp. Determining antigen-specific t-cells
EA035092B1 (en) * 2014-05-14 2020-04-27 Барбара Бурвинкель Synthesis of double-stranded nucleic acids
WO2015200893A2 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Methods of analyzing nucleic acids from individual cells or cell populations
US12312640B2 (en) 2014-06-26 2025-05-27 10X Genomics, Inc. Analysis of nucleic acid sequences
GB201411603D0 (en) * 2014-06-30 2014-08-13 Vela Operations Pte Ltd Compositions for quantitative and/or semiquantitative mutation detection methods
EP3169799B1 (en) 2014-07-15 2019-09-04 Qiagen Sciences, LLC Semi-random barcodes for nucleic acid analysis
CA2966201A1 (en) 2014-10-29 2016-05-06 Adaptive Biotechnologies Corp. Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from many samples
US10000799B2 (en) 2014-11-04 2018-06-19 Boreal Genomics, Inc. Methods of sequencing with linked fragments
US10246701B2 (en) 2014-11-14 2019-04-02 Adaptive Biotechnologies Corp. Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture
CA2976580A1 (en) 2015-02-24 2016-09-01 Adaptive Biotechnologies Corp. Methods for diagnosing infectious disease and determining hla status using immune repertoire sequencing
US20180119214A1 (en) * 2015-03-31 2018-05-03 Fred Hutchinson Cancer Research Center Compositions and methods for target nucleic acid molecule enrichment
EP3277294B1 (en) 2015-04-01 2024-05-15 Adaptive Biotechnologies Corp. Method of identifying human compatible t cell receptors specific for an antigenic target
EP3901282B1 (en) 2015-04-10 2023-06-28 Spatial Transcriptomics AB Spatially distinguished, multiplex nucleic acid analysis of biological specimens
GB201515557D0 (en) * 2015-09-02 2015-10-14 14M Genomics Ltd Method of sequencing
WO2017062970A1 (en) 2015-10-10 2017-04-13 Guardant Health, Inc. Methods and applications of gene fusion detection in cell-free dna analysis
SG11201805119QA (en) 2015-12-17 2018-07-30 Guardant Health Inc Methods to determine tumor gene copy number by analysis of cell-free dna
EP3978627A1 (en) * 2016-03-25 2022-04-06 Karius, Inc. Methods using synthetic nucleic acid spike-ins
US10961573B2 (en) 2016-03-28 2021-03-30 Boreal Genomics, Inc. Linked duplex target capture
WO2017168332A1 (en) 2016-03-28 2017-10-05 Boreal Genomics, Inc. Linked duplex target capture
WO2017176630A1 (en) 2016-04-07 2017-10-12 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnostics by sequencing 5-hydroxymethylated cell-free dna
US11384382B2 (en) 2016-04-14 2022-07-12 Guardant Health, Inc. Methods of attaching adapters to sample nucleic acids
ES3002715T3 (en) 2016-04-14 2025-03-07 Guardant Health Inc Methods for early detection of cancer
EP3452591B1 (en) 2016-05-02 2023-08-16 Encodia, Inc. Macromolecule analysis employing nucleic acid encoding
GB201609221D0 (en) 2016-05-25 2016-07-06 Oxford Nanopore Tech Ltd Method
WO2017217694A2 (en) * 2016-06-16 2017-12-21 한국한의학연구원 Method for measuring mutation rate
KR101915701B1 (en) 2016-06-16 2018-11-07 한국한의학연구원 Method for measuring mutation rate
US10428325B1 (en) 2016-09-21 2019-10-01 Adaptive Biotechnologies Corporation Identification of antigen-specific B cell receptors
EP3461274B1 (en) 2016-09-30 2020-11-04 Guardant Health, Inc. Methods for multi-resolution analysis of cell-free nucleic acids
US20190256928A1 (en) * 2016-10-20 2019-08-22 Fred Hutchinson Cancer Research Center Systems and methods for detecting disseminated or circulating cells or dna
CN110114473A (en) * 2016-11-23 2019-08-09 斯特拉斯堡大学 The series connection bar code of target molecule adds to carry out absolute quantitation to target molecule with single entity resolution ratio
GB201620450D0 (en) 2016-12-01 2017-01-18 Oxford Nanopore Tech Ltd Method
US11268137B2 (en) 2016-12-09 2022-03-08 Boreal Genomics, Inc. Linked ligation
GB201707140D0 (en) 2017-05-04 2017-06-21 Oxford Nanopore Tech Ltd Method
JP7390027B2 (en) 2017-10-31 2023-12-01 エンコディア, インコーポレイテッド Kits for analysis using nucleic acid encoding and/or labeling
US11254980B1 (en) 2017-11-29 2022-02-22 Adaptive Biotechnologies Corporation Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements
WO2019126803A1 (en) 2017-12-22 2019-06-27 Grail, Inc. Error removal using improved library preparation methods
GB201809323D0 (en) 2018-06-06 2018-07-25 Oxford Nanopore Tech Ltd Method
MX2020013994A (en) 2018-06-22 2021-05-27 Bluestar Genomics Inc Hydroxymethylation analysis of cell-free nucleic acid samples for assigning tissue of origin, and related methods of use.
US12098419B2 (en) 2018-08-23 2024-09-24 Ncan Genomics, Inc. Linked target capture and ligation
US11519033B2 (en) 2018-08-28 2022-12-06 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
JP7535998B2 (en) 2018-08-31 2024-08-19 ガーダント ヘルス, インコーポレイテッド Detection of genetic variants based on merged and unmerged reads
EP3853383A1 (en) 2018-09-19 2021-07-28 Bluestar Genomics, Inc. Cell-free dna hydroxymethylation profiles in the evaluation of pancreatic lesions
US10696994B2 (en) 2018-09-28 2020-06-30 Bioo Scientific Corporation Size selection of RNA using poly(A) polymerase
US11104941B2 (en) 2018-09-28 2021-08-31 Bioo Scientific Corporation 5′ adapter comprising an internal 5′-5′ linkage
EP4700161A3 (en) 2018-11-21 2026-03-11 Karius, Inc. Direct-to-library methods, systems, and compositions
WO2020123316A2 (en) 2018-12-10 2020-06-18 10X Genomics, Inc. Methods for determining a location of a biological analyte in a biological sample
EP4538389A3 (en) 2019-01-03 2025-07-30 Ncan Genomics, Inc. Linked target capture
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
WO2020185967A1 (en) * 2019-03-11 2020-09-17 Red Genomics, Inc. Methods and reagents for enhanced next generation sequencing library conversion and insertion of barcodes into nucleic acids.
CN114072499B (en) 2019-04-30 2024-08-06 Encodia公司 Methods and related kits for preparing analytes
WO2020243579A1 (en) 2019-05-30 2020-12-03 10X Genomics, Inc. Methods of detecting spatial heterogeneity of a biological sample
WO2021022237A1 (en) * 2019-08-01 2021-02-04 Twinstrand Biosciences, Inc. Methods and reagents for nucleic acid sequencing and associated applications
GB2627085B (en) 2019-11-06 2024-11-13 Univ Leland Stanford Junior Methods and systems for analysing nucleic acid molecules
WO2021091611A1 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
CN115135984B (en) 2019-12-23 2025-12-23 10X基因组学有限公司 Reversible fixation reagents and their usage
EP4081656A1 (en) 2019-12-23 2022-11-02 10X Genomics, Inc. Compositions and methods for using fixed biological samples in partition-based assays
ES2982420T3 (en) 2019-12-23 2024-10-16 10X Genomics Inc Methods for spatial analysis using RNA-templated ligation
US12365942B2 (en) 2020-01-13 2025-07-22 10X Genomics, Inc. Methods of decreasing background on a spatial array
US12405264B2 (en) 2020-01-17 2025-09-02 10X Genomics, Inc. Electrophoretic system and method for analyte capture
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
US20210230681A1 (en) 2020-01-24 2021-07-29 10X Genomics, Inc. Methods for spatial analysis using proximity ligation
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
US12076701B2 (en) 2020-01-31 2024-09-03 10X Genomics, Inc. Capturing oligonucleotides in spatial transcriptomics
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US12110541B2 (en) 2020-02-03 2024-10-08 10X Genomics, Inc. Methods for preparing high-resolution spatial arrays
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
WO2021158925A1 (en) 2020-02-07 2021-08-12 10X Genomics, Inc. Quantitative and automated permeabilization performance evaluation for spatial transcriptomics
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
US12281357B1 (en) 2020-02-14 2025-04-22 10X Genomics, Inc. In situ spatial barcoding
US12399123B1 (en) 2020-02-14 2025-08-26 10X Genomics, Inc. Spatial targeting of analytes
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11768175B1 (en) 2020-03-04 2023-09-26 10X Genomics, Inc. Electrophoretic methods for spatial analysis
EP4139485B1 (en) 2020-04-22 2023-09-06 10X Genomics, Inc. Methods for spatial analysis using targeted rna depletion
US12416603B2 (en) 2020-05-19 2025-09-16 10X Genomics, Inc. Electrophoresis cassettes and instrumentation
EP4414459B1 (en) 2020-05-22 2025-09-03 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
EP4153776B1 (en) 2020-05-22 2025-03-05 10X Genomics, Inc. Spatial analysis to detect sequence variants
WO2021242834A1 (en) 2020-05-26 2021-12-02 10X Genomics, Inc. Method for resetting an array
US12265079B1 (en) 2020-06-02 2025-04-01 10X Genomics, Inc. Systems and methods for detecting analytes from captured single biological particles
EP4600376A3 (en) 2020-06-02 2025-10-22 10X Genomics, Inc. Spatial transcriptomics for antigen-receptors
AU2021283174A1 (en) 2020-06-02 2023-01-05 10X Genomics, Inc. Nucleic acid library methods
US12031177B1 (en) 2020-06-04 2024-07-09 10X Genomics, Inc. Methods of enhancing spatial resolution of transcripts
EP4421186B1 (en) 2020-06-08 2025-08-13 10X Genomics, Inc. Methods of determining a surgical margin and methods of use thereof
EP4165207B1 (en) 2020-06-10 2024-09-25 10X Genomics, Inc. Methods for determining a location of an analyte in a biological sample
US12435363B1 (en) 2020-06-10 2025-10-07 10X Genomics, Inc. Materials and methods for spatial transcriptomics
WO2021252747A1 (en) 2020-06-10 2021-12-16 1Ox Genomics, Inc. Fluid delivery methods
ES2994976T3 (en) 2020-06-25 2025-02-05 10X Genomics Inc Spatial analysis of dna methylation
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
US12209280B1 (en) 2020-07-06 2025-01-28 10X Genomics, Inc. Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis
US11981960B1 (en) 2020-07-06 2024-05-14 10X Genomics, Inc. Spatial analysis utilizing degradable hydrogels
US12553898B1 (en) 2020-08-10 2026-02-17 10X Genomics, Inc. Fluorescent hybridization of antibody-oligonucleotide for multiplexing and signal amplification
US11981958B1 (en) 2020-08-20 2024-05-14 10X Genomics, Inc. Methods for spatial analysis using DNA capture
WO2022061150A2 (en) 2020-09-18 2022-03-24 10X Geonomics, Inc. Sample handling apparatus and image registration methods
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
EP4729631A2 (en) 2020-12-21 2026-04-22 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
EP4421491A3 (en) 2021-02-19 2024-11-27 10X Genomics, Inc. Method of using a modular assay support device
AU2022238446A1 (en) 2021-03-18 2023-09-07 10X Genomics, Inc. Multiplex capture of gene and protein expression from a biological sample
EP4305196B1 (en) 2021-04-14 2025-04-02 10X Genomics, Inc. Methods of measuring mislocalization of an analyte
US11783912B2 (en) 2021-05-05 2023-10-10 The Board Of Trustees Of The Leland Stanford Junior University Methods and systems for analyzing nucleic acid molecules
EP4320271B1 (en) 2021-05-06 2025-03-19 10X Genomics, Inc. Methods for increasing resolution of spatial analysis
WO2022256503A1 (en) 2021-06-03 2022-12-08 10X Genomics, Inc. Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis
US12553805B2 (en) 2021-08-02 2026-02-17 10X Genomics, Inc. Methods of preserving a biological sample
WO2023034489A1 (en) 2021-09-01 2023-03-09 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
WO2023086880A1 (en) 2021-11-10 2023-05-19 10X Genomics, Inc. Methods, compositions, and kits for determining the location of an analyte in a biological sample
EP4430615A4 (en) * 2021-11-10 2026-01-21 Albert Einstein College Medicine METHOD FOR MEASURING SOMATIC DNA MUTATIONS AND DNA DAMAGE PROFILES AND SUITABLE DIAGNOSTIC KIT FOR THIS PURPOSE
WO2023102118A2 (en) 2021-12-01 2023-06-08 10X Genomics, Inc. Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis
WO2023122033A1 (en) 2021-12-20 2023-06-29 10X Genomics, Inc. Self-test for pathology/histology slide imaging device
EP4482979B1 (en) 2022-11-09 2025-10-01 10X Genomics, Inc. Methods, compositions, and kits for determining the location of multiple analytes in a biological sample

Citations (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5308751A (en) 1992-03-23 1994-05-03 General Atomics Method for sequencing double-stranded DNA
WO1996012039A1 (en) 1994-10-13 1996-04-25 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
WO1998044151A1 (en) 1997-04-01 1998-10-08 Glaxo Group Limited Method of nucleic acid amplification
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
WO2000018957A1 (en) 1998-09-30 2000-04-06 Applied Research Systems Ars Holding N.V. Methods of nucleic acid amplification and sequencing
WO2000060124A2 (en) 1999-04-06 2000-10-12 Yale University Fixed address analysis of sequence tags
US6143496A (en) 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
US6404907B1 (en) 1998-06-26 2002-06-11 Visible Genetics Inc. Method for sequencing nucleic acids with reduced errors
WO2004003136A2 (en) 2002-06-28 2004-01-08 Sention, Inc. Methods of detecting sequence differences
US6833246B2 (en) 1999-09-29 2004-12-21 Solexa, Ltd. Polynucleotide sequencing
US20050019776A1 (en) 2002-06-28 2005-01-27 Callow Matthew James Universal selective genome amplification and universal genotyping system
WO2005042759A2 (en) 2003-09-10 2005-05-12 Althea Technologies, Inc. Expression profiling using microarrays
WO2005068656A1 (en) 2004-01-12 2005-07-28 Solexa Limited Nucleic acid characterisation
WO2006084130A2 (en) 2005-02-03 2006-08-10 Perkinelmer Las, Inc. Ultra-sensitive detection systems using multidimension signals
WO2007073171A2 (en) 2005-12-22 2007-06-28 Keygene N.V. Improved strategies for transcript profiling using high throughput sequencing technologies
US7264929B2 (en) 1999-09-16 2007-09-04 454 Life Sciences Corporation Method of sequencing a nucleic acid
WO2007106509A2 (en) 2006-03-14 2007-09-20 Genizon Biosciences, Inc. Methods and means for nucleic acid sequencing
US20080261204A1 (en) 2004-01-23 2008-10-23 Lingvitae As Polynucleotide Ligation Reactions
WO2009036525A2 (en) 2007-09-21 2009-03-26 Katholieke Universiteit Leuven Tools and methods for genetic tests using next generation sequencing
US20090099041A1 (en) 2006-02-07 2009-04-16 President And Fellows Of Harvard College Methods for making nucleotide probes for sequencing and synthesis
US7537897B2 (en) 2006-01-23 2009-05-26 Population Genetics Technologies, Ltd. Molecular counting
US20090215633A1 (en) * 2006-03-01 2009-08-27 Keygene N.V. High throughput sequence-based detection of snps using ligation assays
DE102008025656A1 (en) 2008-05-28 2009-12-03 Genxpro Gmbh Method for quantitative analysis of nicoleic acids, markers therefor and their use
US7754429B2 (en) 2006-10-06 2010-07-13 Illumina Cambridge Limited Method for pair-wise sequencing a plurity of target polynucleotides
WO2010115100A1 (en) 2009-04-03 2010-10-07 L&C Diagment, Inc. Multiplex nucleic acid detection methods and systems
WO2010115154A1 (en) 2009-04-02 2010-10-07 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
US8168385B2 (en) 2005-02-10 2012-05-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
WO2012106546A2 (en) * 2011-02-02 2012-08-09 University Of Washington Through Its Center For Commercialization Massively parallel continguity mapping
WO2012148477A1 (en) 2010-12-15 2012-11-01 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US20130005585A1 (en) * 2011-05-20 2013-01-03 Fluidigm Corporation Nucleic acid encoding reactions
US8383345B2 (en) 2008-09-12 2013-02-26 University Of Washington Sequence tag directed subassembly of short sequencing reads into long sequencing reads
WO2013123442A1 (en) 2012-02-17 2013-08-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
WO2013142389A1 (en) 2012-03-20 2013-09-26 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing
US8586310B2 (en) 2008-09-05 2013-11-19 Washington University Method for multiplexed nucleic acid patch polymerase chain reaction
US8741606B2 (en) 2010-09-21 2014-06-03 Population Genetics Technologies Ltd. Method of tagging using a split DBR
US20140155274A1 (en) * 2011-03-24 2014-06-05 President And Fellows Of Harvard College Single Cell Nucleic Acid Detection and Analysis
US20150087535A1 (en) 2012-03-13 2015-03-26 Abhijit Ajit Patel Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing
US9085798B2 (en) 2009-04-30 2015-07-21 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US9404156B2 (en) 2010-10-22 2016-08-02 Cold Spring Harbor Laboratory Varietal counting of nucleic acids for obtaining genomic copy number information
US9476095B2 (en) 2011-04-15 2016-10-25 The Johns Hopkins University Safe sequencing system

Family Cites Families (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
AU672760B2 (en) * 1991-09-24 1996-10-17 Keygene N.V. Selective restriction fragment amplification: a general method for DNA fingerprinting
US6818395B1 (en) 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
JP2004523243A (en) 2001-03-12 2004-08-05 カリフォルニア インスティチュート オブ テクノロジー Method and apparatus for analyzing polynucleotide sequences by asynchronous base extension
US7452699B2 (en) 2003-01-15 2008-11-18 Dana-Farber Cancer Institute, Inc. Amplification of DNA in a hairpin structure, and applications
US20060084064A1 (en) 2003-01-22 2006-04-20 Aird William C Endocan compositions and methods for the treatment of neoplasms
US20040209299A1 (en) * 2003-03-07 2004-10-21 Rubicon Genomics, Inc. In vitro DNA immortalization and whole genome amplification using libraries generated from randomly fragmented DNA
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
WO2005063980A1 (en) 2003-12-31 2005-07-14 Toudai Tlo, Ltd. METHOD OF ENZYMATICALLY CONSTRUCTING RNAi LIBRARY
FR2872953B1 (en) 2004-07-09 2006-09-15 Peugeot Citroen Automobiles Sa DISPLAY DEVICE FOR MOTOR VEHICLE
EP1712639B1 (en) 2005-04-06 2008-08-27 Maurice Stroun Method for the diagnosis of cancer by detecting circulating DNA and RNA
DK2302070T3 (en) 2005-06-23 2012-11-26 Keygene Nv Strategies for the identification and detection of high-throughput polymorphisms
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
WO2007037678A2 (en) 2005-09-29 2007-04-05 Keygene N.V. High throughput screening of mutagenized populations
CN103937899B (en) 2005-12-22 2017-09-08 凯津公司 Method for the high flux polymorphic detection based on AFLP
EP3239304B1 (en) 2006-04-04 2020-08-19 Keygene N.V. High throughput detection of molecular markers based on aflp and high troughput sequencing
US7282337B1 (en) 2006-04-14 2007-10-16 Helicos Biosciences Corporation Methods for increasing accuracy of nucleic acid sequencing
US8262900B2 (en) 2006-12-14 2012-09-11 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
GB2457851B (en) 2006-12-14 2011-01-05 Ion Torrent Systems Inc Methods and apparatus for measuring analytes using large scale fet arrays
US8349167B2 (en) 2006-12-14 2013-01-08 Life Technologies Corporation Methods and apparatus for detecting molecular interactions using FET arrays
WO2008093098A2 (en) 2007-02-02 2008-08-07 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple nucleotide templates
US20090156412A1 (en) 2007-12-17 2009-06-18 Helicos Biosciences Corporation Surface-capture of target nucleic acids
US20100041048A1 (en) * 2008-07-31 2010-02-18 The Johns Hopkins University Circulating Mutant DNA to Assess Tumor Dynamics
US20100035252A1 (en) 2008-08-08 2010-02-11 Ion Torrent Systems Incorporated Methods for sequencing individual nucleic acids under tension
US20100137143A1 (en) 2008-10-22 2010-06-03 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
US20100301398A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
US8546128B2 (en) 2008-10-22 2013-10-01 Life Technologies Corporation Fluidics system for sequential delivery of reagents
EP2391732B1 (en) 2009-01-30 2015-05-27 Oxford Nanopore Technologies Limited Methods using adaptors for nucleic acid constructs in transmembrane sequencing
EP2425240A4 (en) 2009-04-30 2012-12-12 Good Start Genetics Inc Methods and compositions for evaluating genetic markers
US8673627B2 (en) 2009-05-29 2014-03-18 Life Technologies Corporation Apparatus and methods for performing electrochemical reactions
US8574835B2 (en) 2009-05-29 2013-11-05 Life Technologies Corporation Scaffolded nucleic acid polymer particles and methods of making and using
US9080210B2 (en) 2010-06-09 2015-07-14 Keygene N.V. High throughput screening using combinatorial sequence barcodes
US9809904B2 (en) 2011-04-21 2017-11-07 University Of Washington Through Its Center For Commercialization Methods for retrieval of sequence-verified DNA constructs
AU2013267609C1 (en) 2012-05-31 2019-01-03 Board Of Regents, The University Of Texas System Method for accurate sequencing of DNA
US20160040229A1 (en) 2013-08-16 2016-02-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
CN104781421B (en) 2012-09-04 2020-06-05 夸登特健康公司 System and method for detecting rare mutations and copy number variations
WO2015094861A1 (en) 2013-12-17 2015-06-25 Clontech Laboratories, Inc. Methods for adding adapters to nucleic acids and compositions for practicing the same
ES2660989T3 (en) 2013-12-28 2018-03-27 Guardant Health, Inc. Methods and systems to detect genetic variants
KR102001554B1 (en) 2014-01-16 2019-07-18 일루미나, 인코포레이티드 Amplicon preparation and sequencing on solid supports
US10017759B2 (en) 2014-06-26 2018-07-10 Illumina, Inc. Library preparation of tagged nucleic acid
US10385387B2 (en) 2015-04-20 2019-08-20 Pacific Biosciences Of California, Inc. Methods for selectively amplifying and tagging nucleic acids
US10844428B2 (en) 2015-04-28 2020-11-24 Illumina, Inc. Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS)
EP4086357A1 (en) 2015-08-28 2022-11-09 Illumina, Inc. Nucleic acid sequence analysis from single cells
EP3377656B1 (en) 2015-11-18 2025-07-02 Pacific Biosciences of California, Inc. Loading nucleic acids onto substrates
CA3006792A1 (en) 2015-12-08 2017-06-15 Twinstrand Biosciences, Inc. Improved adapters, methods, and compositions for duplex sequencing
US11624064B2 (en) 2016-06-13 2023-04-11 Grail, Llc Enrichment of mutated cell free nucleic acids for cancer detection
US11566284B2 (en) 2016-08-10 2023-01-31 Grail, Llc Methods of preparing dual-indexed DNA libraries for bisulfite conversion sequencing
US20210277457A1 (en) 2016-08-12 2021-09-09 Grail, Inc. Method for accurate quantification of genomic copies in cell-free dna

Patent Citations (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5308751A (en) 1992-03-23 1994-05-03 General Atomics Method for sequencing double-stranded DNA
WO1996012039A1 (en) 1994-10-13 1996-04-25 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
WO1998044151A1 (en) 1997-04-01 1998-10-08 Glaxo Group Limited Method of nucleic acid amplification
US6143496A (en) 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
US6404907B1 (en) 1998-06-26 2002-06-11 Visible Genetics Inc. Method for sequencing nucleic acids with reduced errors
WO2000018957A1 (en) 1998-09-30 2000-04-06 Applied Research Systems Ars Holding N.V. Methods of nucleic acid amplification and sequencing
WO2000060124A2 (en) 1999-04-06 2000-10-12 Yale University Fixed address analysis of sequence tags
US7264929B2 (en) 1999-09-16 2007-09-04 454 Life Sciences Corporation Method of sequencing a nucleic acid
US6833246B2 (en) 1999-09-29 2004-12-21 Solexa, Ltd. Polynucleotide sequencing
WO2004003136A2 (en) 2002-06-28 2004-01-08 Sention, Inc. Methods of detecting sequence differences
US20050019776A1 (en) 2002-06-28 2005-01-27 Callow Matthew James Universal selective genome amplification and universal genotyping system
WO2005042759A2 (en) 2003-09-10 2005-05-12 Althea Technologies, Inc. Expression profiling using microarrays
WO2005068656A1 (en) 2004-01-12 2005-07-28 Solexa Limited Nucleic acid characterisation
US20080261204A1 (en) 2004-01-23 2008-10-23 Lingvitae As Polynucleotide Ligation Reactions
WO2006084130A2 (en) 2005-02-03 2006-08-10 Perkinelmer Las, Inc. Ultra-sensitive detection systems using multidimension signals
US8168385B2 (en) 2005-02-10 2012-05-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
WO2007073171A2 (en) 2005-12-22 2007-06-28 Keygene N.V. Improved strategies for transcript profiling using high throughput sequencing technologies
US7537897B2 (en) 2006-01-23 2009-05-26 Population Genetics Technologies, Ltd. Molecular counting
US20090099041A1 (en) 2006-02-07 2009-04-16 President And Fellows Of Harvard College Methods for making nucleotide probes for sequencing and synthesis
US20090215633A1 (en) * 2006-03-01 2009-08-27 Keygene N.V. High throughput sequence-based detection of snps using ligation assays
WO2007106509A2 (en) 2006-03-14 2007-09-20 Genizon Biosciences, Inc. Methods and means for nucleic acid sequencing
US7754429B2 (en) 2006-10-06 2010-07-13 Illumina Cambridge Limited Method for pair-wise sequencing a plurity of target polynucleotides
WO2009036525A2 (en) 2007-09-21 2009-03-26 Katholieke Universiteit Leuven Tools and methods for genetic tests using next generation sequencing
US20100227329A1 (en) 2007-09-21 2010-09-09 Katholieke Universiteit Leuven K.U.Leuven R&D Tools and methods for genetic tests using next generation sequencing
DE102008025656A1 (en) 2008-05-28 2009-12-03 Genxpro Gmbh Method for quantitative analysis of nicoleic acids, markers therefor and their use
WO2009152928A2 (en) 2008-05-28 2009-12-23 Genxpro Gmbh Method for the quantitative analysis of nucleic acids, markers therefor and their use
US8586310B2 (en) 2008-09-05 2013-11-19 Washington University Method for multiplexed nucleic acid patch polymerase chain reaction
US8383345B2 (en) 2008-09-12 2013-02-26 University Of Washington Sequence tag directed subassembly of short sequencing reads into long sequencing reads
WO2010115154A1 (en) 2009-04-02 2010-10-07 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
WO2010115100A1 (en) 2009-04-03 2010-10-07 L&C Diagment, Inc. Multiplex nucleic acid detection methods and systems
US9085798B2 (en) 2009-04-30 2015-07-21 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US8741606B2 (en) 2010-09-21 2014-06-03 Population Genetics Technologies Ltd. Method of tagging using a split DBR
US9404156B2 (en) 2010-10-22 2016-08-02 Cold Spring Harbor Laboratory Varietal counting of nucleic acids for obtaining genomic copy number information
WO2012148477A1 (en) 2010-12-15 2012-11-01 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
WO2012106546A2 (en) * 2011-02-02 2012-08-09 University Of Washington Through Its Center For Commercialization Massively parallel continguity mapping
US20140155274A1 (en) * 2011-03-24 2014-06-05 President And Fellows Of Harvard College Single Cell Nucleic Acid Detection and Analysis
US9476095B2 (en) 2011-04-15 2016-10-25 The Johns Hopkins University Safe sequencing system
US20130005585A1 (en) * 2011-05-20 2013-01-03 Fluidigm Corporation Nucleic acid encoding reactions
WO2013123442A1 (en) 2012-02-17 2013-08-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US20150087535A1 (en) 2012-03-13 2015-03-26 Abhijit Ajit Patel Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing
WO2013142389A1 (en) 2012-03-20 2013-09-26 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing
US20150044687A1 (en) 2012-03-20 2015-02-12 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing
EP2828218A1 (en) 2012-03-20 2015-01-28 University of Washington through its Center for Commercialization Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing
US9752188B2 (en) 2012-03-20 2017-09-05 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing

Non-Patent Citations (46)

* Cited by examiner, † Cited by third party
Title
Bainbridge, et al., "Whole exome capture in solution with 3 Gbp of data," Genome Biology, 2010, 11:R62.
Baird, et al., "Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers," PLoS ONE, 2008, vol. 3, issue 10, e3376, pp. 1-7.
Bielas et al., "Human cancers express a mutator phenotype," Proc. Natl. Acad. Sci. USA 103(48):18238-18242, Nov. 28, 2006.
Bielas et al., "Quantification of random genomic mutations," Nature Methods 2(4):285-290, 2005.
Bowtell, "The genesis and evolution of high-grade serous ovarian cancer," Nat. Rev. Cancer 10(11):803-808, Nov. 2010.
Brandon et al., "Mitochondrial mutations in cancer," Oncogene 25(34):4647-4662, 2006.
Brockman, et al., "Quality scores and SNP detection in sequencing-by-synthesis systems," Genome Research, 2008, 18:763-770.
Cancer Genome Atlas Research Network, "Integrated Genomic Analyses of Ovarian Carcinoma," Nature 474(7353):609-615, 2011.
Chatterjee et al., "Mitochondrial DNA mutations in human cancer," Oncogene 25(34):4663-4674, 2006.
Chmielecki, et al., "Targeted next-generation sequencing of DNA regions proximal to a conserved GXGXXG signaling motif enables systematic discovery of tyrosine kinase fusions in cancer," Nucleic Acids Research, 2010, vol. 38, No. 20, 6985-6996.
Copeland et al., "Mitochondrial DNA Alterations in Cancer," Cancer Invest. 20(4):557-569, 2002.
Fleishmann, et al., "Whole-genome random sequencing and assembly of Haemophilus influenzae Rd," Science, 1995, vol. 269, issue 5223, pp. 496-512.
Fullwood, et al., "Next-generation DNA sequencing of paired-end tags (PET) for transcriptome and genome analyses," Genome Research, 2009, 19:521-532.
Hashimoto, et al., "5′-end SAGE for the analysis of transcriptional start sites," Nature Biotechnology, 2004, 22, 1146-1149.
Hiatt, et al., "Parallel, tag-directed assembly of locally derived short sequence reads," Nature Methods, 2010, 7(2):119-122.
Homer, et al., "Improved variant discovery through local re-alignment of short-read next-generation sequencing data using SRMA," Genome Biology, 2010, 11:R99.
Hug et al., "Measurement of the Number Of Molecules of a Single mRNA Species in a Complex mRNA Preparation," J. theor. Biol. 221(4):615-624, 2003.
Huse, et al., "Accuracy and quality of massively parallel DNA pyrosequencing," Genome Biology, 2007, 8:R143.
Jabara et al., "Accurate sampling and deep sequencing of the HIV-1 protease gene using a Primer ID", Proc Natl Acad Sci U S A, 108(50):20166-20171 (2011).
Jones et al., "Comparative lesion sequencing provides insights into tumor evolution," Proc. Natl. Acad. Sci. USA 105(11):4283-4288, Mar. 18, 2008.
Kinde et al. "Detection and quantification of rare mutations with massively parallel sequencing," Proc. Natl. Acad. Sci. USA 108(23):9530-9535, Jun. 7, 2011.
Kivioja, et al., "Counting absolute numbers of molecules using unique molecular identifiers," Nat Methods, 2011, 9(1):72-4.
Korbel, et al., "Paired-End Mapping Reveals Extensive Structural Variation in the Human Genome," Science, 2007, 318(5849):420-426.
Kou, et al., "Benefits and Challenges with Applying Unique Molecular Identifiers in Next Generation Sequencing to Detect Low Frequency Mutations," PLoS One, 2016, 11(1):e0146638.
Kraytsberg et al., "Single molecule PCR in mtDNA mutational analysis: genuine mutations vs. damage bypass-derived artifacts," Methods 46(4):269-273, 2008.
Li, et al., "A new approach for detecting low-level mutations in next-generation sequence data," Genome Biology, 2012, 13:R34.
Linnarsson, "Recent advances in DNA sequencing methods-general principles of sample preparation," Experimental Cell Research, 2010, vol. 316, issue 8, pp. 1339-1343.
Linnarsson, "Recent advances in DNA sequencing methods—general principles of sample preparation," Experimental Cell Research, 2010, vol. 316, issue 8, pp. 1339-1343.
McCloskey et al., "Encoding PCR products with batch-stamps and barcodes", Biochem Genet., 45(11-12):761-767 (2007).
Metzker, "Sequencing technologies-the next generation," Nature Reviews Genetics, 2010, 11, 31-46.
Metzker, "Sequencing technologies—the next generation," Nature Reviews Genetics, 2010, 11, 31-46.
Ng, et al. "Multiplex sequencing of paired-end ditags (MS-PET): a strategy for the ultra-high-throughput analysis of transcriptomes and genomes," Nucleic Acids Res, 2006, vol. 34, No. 12 pp. 1-10.
Ng, et al., "Gene identification signature (GIS) analysis for transcriptome characterization and genome annotation," Nature Methods, 2005, 2, 105-111.
Niedringhaus et al., "Landscape of Next-Generation Sequencing Technologies," Anal. Chem. 83(12):4327-4341, 2011.
Saha, et al "Using the transcriptome to annotate the genome," Nature Biotechnology, 2002, 20, 508-512.
Schmitt, et al., "Detection of ultra-rare mutations by next-generation sequencing," PNAS, 2012, vol. 109, No. 36, 14508-14513.
Shiroguchi et al., Digital RNA Sequencing Minimizes Sequence-dependent Bias and Amplification Noise with Optimized Single-molecule Barcodes, PNAS 109(4): 1347-1352, 2012.
Srivatsan, et al., "High-Precision, Whole-Genome Sequencing of Laboratory Strains Facilitates Genetic Studies," PLoS Genet, 2008, 4(8) e1000139.
Taylor et al., "Mitochondrial DNA mutations in human disease," Nat. Rev. Genet. 6(5):389-402, May 2005.
Varley, et al., "Bisulfate Patch PCR enables multiplexed sequencing of promoter methylation across cancer samples," Genome Research, 2010, 20:1279-87.
Velculescu, et al., "Serial analysis of gene expression," Science, 1995, 270(5235):484-7.
Walsh, et al., "Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing," PNAS, 2010, vol. 107, No. 28, 12629-12633.
Wei, et al, "5′ Long serial analysis of gene expression (LongSAGE) and 3′ LongSAGE for transcriptome characterization and genome annotation," PNAS, 2004, vol. 101, No. 32, 11701-11706.
Zhang, et al., The impact of next-generation sequencing on genomics, J Genet Genomics, 2011, 38(3): 95-109.
Zheng et al., "Origins of human mitochondrial point mutations as DNA polymerase γ-mediated errors," Mutat. Res. 599(1-2):11-20, 2006.
Zilberman, et al., "Genome-wide analysis of DNA methylation patterns," Development, 2007, 134, 3959-3965.

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10450606B2 (en) 2012-02-17 2019-10-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US11441180B2 (en) 2012-02-17 2022-09-13 Fred Hutchinson Cancer Center Compositions and methods for accurately identifying mutations
US11047006B2 (en) 2012-03-20 2021-06-29 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11555220B2 (en) 2012-03-20 2023-01-17 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10370713B2 (en) 2012-03-20 2019-08-06 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10570451B2 (en) 2012-03-20 2020-02-25 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10604804B2 (en) 2012-03-20 2020-03-31 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10689700B2 (en) 2012-03-20 2020-06-23 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10689699B2 (en) 2012-03-20 2020-06-23 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10711304B2 (en) 2012-03-20 2020-07-14 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10752951B2 (en) 2012-03-20 2020-08-25 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10760127B2 (en) 2012-03-20 2020-09-01 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11970740B2 (en) 2012-03-20 2024-04-30 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11098359B2 (en) 2012-03-20 2021-08-24 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US10385393B2 (en) * 2012-03-20 2019-08-20 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11155869B2 (en) 2012-03-20 2021-10-26 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11118225B2 (en) * 2012-03-20 2021-09-14 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11198907B2 (en) 2012-03-20 2021-12-14 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11242562B2 (en) 2012-03-20 2022-02-08 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US12258629B2 (en) 2012-03-20 2025-03-25 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US12241123B2 (en) 2012-03-20 2025-03-04 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US20180363052A1 (en) * 2012-03-20 2018-12-20 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing
US11549144B2 (en) 2012-03-20 2023-01-10 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11130996B2 (en) 2012-03-20 2021-09-28 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US12006545B2 (en) 2012-03-20 2024-06-11 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11608529B2 (en) 2012-03-20 2023-03-21 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US11993815B2 (en) 2012-03-20 2024-05-28 University Of Washington Through Its Center For Commercialization Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
US20220205051A1 (en) * 2012-09-04 2022-06-30 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12049673B2 (en) 2012-09-04 2024-07-30 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12606874B2 (en) 2012-09-04 2026-04-21 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11879158B2 (en) * 2012-09-04 2024-01-23 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11773453B2 (en) 2012-09-04 2023-10-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12319972B2 (en) 2012-09-04 2025-06-03 Guardent Health, Inc. Methods for monitoring residual disease
US12252749B2 (en) 2012-09-04 2025-03-18 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12110560B2 (en) 2012-09-04 2024-10-08 Guardant Health, Inc. Methods for monitoring residual disease
US12054783B2 (en) 2012-09-04 2024-08-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US20170211140A1 (en) * 2015-12-08 2017-07-27 Twinstrand Biosciences, Inc. Adapters, methods, and compositions for duplex sequencing
US11332784B2 (en) * 2015-12-08 2022-05-17 Twinstrand Biosciences, Inc. Adapters, methods, and compositions for duplex sequencing
US11821028B2 (en) 2016-07-12 2023-11-21 QIAGEN Sciences, LLP Single end duplex DNA sequencing
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification
US11739367B2 (en) 2017-11-08 2023-08-29 Twinstrand Biosciences, Inc. Reagents and adapters for nucleic acid sequencing and methods for making such reagents and adapters
US12529101B2 (en) 2018-07-12 2026-01-20 Twinstrand Biosciences, Inc. Methods and reagents for characterizing genomic editing, clonal expansion, and associated applications
US11845985B2 (en) 2018-07-12 2023-12-19 Twinstrand Biosciences, Inc. Methods and reagents for characterizing genomic editing, clonal expansion, and associated applications

Also Published As

Publication number Publication date
HUE053360T2 (en) 2021-06-28
PL3363901T3 (en) 2021-07-05
RS61631B1 (en) 2021-04-29
US20150024950A1 (en) 2015-01-22
US20180363048A1 (en) 2018-12-20
US20200299767A1 (en) 2020-09-24
US20210246504A1 (en) 2021-08-12
EP2814959B1 (en) 2018-01-17
EP3363901A1 (en) 2018-08-22
US20240417790A1 (en) 2024-12-19
US20200299766A1 (en) 2020-09-24
US20240409996A1 (en) 2024-12-12
SMT202100154T1 (en) 2021-05-07
PT2814959T (en) 2018-04-12
PL2814959T3 (en) 2018-07-31
US20210054455A1 (en) 2021-02-25
US20200385804A1 (en) 2020-12-10
US20200048706A1 (en) 2020-02-13
US20210317525A1 (en) 2021-10-14
HRP20210504T1 (en) 2021-05-14
US20210340619A1 (en) 2021-11-04
US20180363049A1 (en) 2018-12-20
US20240200131A1 (en) 2024-06-20
US20220349004A1 (en) 2022-11-03
US10450606B2 (en) 2019-10-22
LT3363901T (en) 2021-04-12
US20210238676A1 (en) 2021-08-05
DK2814959T3 (en) 2018-04-23
CY1123973T1 (en) 2022-05-27
US20210388435A1 (en) 2021-12-16
US20200048707A1 (en) 2020-02-13
WO2013123442A1 (en) 2013-08-22
ES2855130T3 (en) 2021-09-23
PT3363901T (en) 2021-01-22
US20210317526A1 (en) 2021-10-14
US20160326578A1 (en) 2016-11-10
EP3854873A1 (en) 2021-07-28
US20240401128A1 (en) 2024-12-05
ES2665071T3 (en) 2018-04-24
US20210238678A1 (en) 2021-08-05
DK3363901T3 (en) 2021-02-22
NO2864470T3 (en) 2018-03-03
US20230193381A1 (en) 2023-06-22
EP3363901B1 (en) 2020-12-30
SI3363901T1 (en) 2021-04-30
EP2814959A1 (en) 2014-12-24
US11441180B2 (en) 2022-09-13
US20210222243A1 (en) 2021-07-22
US20210395818A1 (en) 2021-12-23

Similar Documents

Publication Publication Date Title
US20240401128A1 (en) Compositions and methods for accurately identifying mutations
US10954542B2 (en) Size selection of RNA using poly(A) polymerase
WO2024033411A1 (en) Methods for determining the location of a target sequence and uses
HK40058587A (en) Compositions and methods for accurately identifying mutations
HK1259880B (en) Compositions and methods for accurately identifying mutations
HK1259880A1 (en) Compositions and methods for accurately identifying mutations

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4

AS Assignment

Owner name: FRED HUTCHINSON CANCER CENTER, WASHINGTON

Free format text: MERGER AND CHANGE OF NAME;ASSIGNORS:FRED HUTCHINSON CANCER RESEARCH CENTER;SEATTLE CANCER CARE ALLIANCE;REEL/FRAME:060254/0115

Effective date: 20220330

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 8