TWI849962B - Use of composition comprising exosome and biomacromolecules for manufacturing medicament for treating, preventing, or ameliorating arthritis - Google Patents

Abstract

Provided is use of a composition comprising an exosome and biomacromolecules for manufacturing a medicament for treating, preventing, or ameliorating arthritis. The composition can reduce inflammation, reduce damage to chondrocytes, and enhance chondrocyte regeneration. Therefore, the composition of the present invention can be used for treating, preventing, or ameliorating arthritis.

Description

Use of a composition comprising exosomes and biomacromolecules for preparing a drug for treating, preventing or alleviating arthritis

The present invention relates to a composition containing biomacromolecules and also relates to the use of the composition in preparing a drug for treating, preventing or alleviating arthritis.

Arthritis includes osteoarthritis (OA), rheumatic arthritis, rheumatoid arthritis, traumatic arthritis, purulent arthritis, gouty arthritis, tuberculous arthritis, neurogenic arthritis, hemophilic arthritis, etc.

Among them, osteoarthritis is the most common type of arthritis, which has a serious impact on millions of people in the world, especially the elderly. It refers to the breakdown of cartilage tissue in the joint over time, causing the hard bone below the cartilage to begin to change. It can cause pain, joint stiffness, loss of joint flexibility, and joint swelling. It is common in patients' hands, hips, knees, and spine.

Arthritis has a serious impact on the quality of life of patients, so there is an urgent need to develop a new drug that can effectively treat arthritis.

To achieve the aforementioned purpose, the present invention provides a composition for preparing a drug for treating, preventing or alleviating arthritis, wherein the composition comprises an exosome and a biomacromolecule.

Preferably, the biomacromolecule is a polysaccharide, a peptide, a protein, a messenger RNA (mRNA), a small interfering RNA (siRNA) or a microRNA (miRNA).

Preferably, the protein is insulin like growth factor (IGF) or silent mating type information regulation 2 homolog (SIRT).

Preferably, the insulin-like growth factor is IGF-1.

Preferably, the silent mating signal regulator 2 homologous protein is SIRT-1, SIRT-2 or SIRT-6.

Preferably, the exosomes are secreted from immune cells, neural cells, epithelial cells, endothelial cells, embryonic cells or mesenchymal stem cells.

Preferably, the mesenchymal stem cells are derived from umbilical cord, fat cells, placental tissue, dental pulp or bone marrow.

Preferably, the drug further comprises a pharmaceutically acceptable carrier.

Preferably, the drug is in a non-enteral dosage form. More preferably, the non-enteral dosage form is an injection or an external liquid. According to the present invention, the injection may be an injection.

Preferably, the arthritis is osteoarthritis, rheumatic arthritis, rheumatoid arthritis, traumatic arthritis, purulent arthritis, gouty arthritis, tuberculous arthritis, neurogenic arthritis or hemophilic arthritis.

Preferably, the drug is administered by injection into the affected area or intravenously.

The composition of the present invention can reduce the expression of MMP-13 in chondrocyte inflammation induced by IL-1β and promote chondrocyte proliferation, thereby preventing, treating or alleviating arthritis, especially osteoarthritis.

The following is a combination of drawings, preparation examples and experimental examples of the present invention to further illustrate the technical means adopted by the present invention to achieve the intended purpose of the invention.

Preparation example 1 SW1353 Culture of human chondrocyte cell lines

2×10 ⁵ SW1353 human chondrocytes (hereinafter referred to as SW1353 cells) were seeded into 3.5 cm culture dishes or 1×10 ⁶ SW1353 cells were seeded into 10 cm culture dishes. Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin was used as the base culture medium. The culture dishes were placed in a 37°C, 5% carbon dioxide (CO ₂ ) incubator for culture.

Preparation example 2 Preparation of exosomes

Mesenchymal stem cells isolated from the umbilical cord were cultured in complete medium containing α-MEM medium, 5-10% human platelet lysate, 1% L-glutamine, 1% non-essential amino acids, 1% sodium pyruvate, and 1% penicillin-streptomycin. The cells were grown in a culture incubator at 37°C and 5% CO _2. When the cells grew to 80% to 90% of the confluence of the culture dish, the culture medium was replaced with serum-free α-MEM culture medium without other additives, and the mesenchymal stem cells were cultured for 48 hours to induce the release of exosomes. The mesenchymal stem cell culture medium sample was centrifuged by concentrated filtration to obtain the exosomes of the mesenchymal stem cells. The exosomes were labeled with CD9, CD63, and CD81 using a nanoparticle tracking analyzer and the number of exosomes in the sample was analyzed for use in subsequent examples.

Embodiment 1 Exosomes for treating induced inflammation SW1353 Cells

After culturing the SW1353 cells of Preparation Example 1 for one day, 10 ng/ml IL-1β was added to the aforementioned α-MEM medium without other additives to induce inflammatory response indicators; or the following treatments were immediately performed after adding the aforementioned IL-1β: 20×10 ⁸ , 50×10 ⁸ , 100×10 ⁸ exosomes of Preparation Example 2 were added for 24 hours; or proteins: IGF-1, SIRT-1, SIRT-2 or SIRT-6 were added to treat the cells so that the protein concentration of the culture medium in each treatment group was 100 ng/ml and then treated for 24 hours; or 20×10 ⁸ , 50×10 ⁸ exosomes of Preparation Example 2 were added when adding the aforementioned IGF-1, SIRT-1, SIRT-2 or SIRT-6 and treated for 24 hours. After IL-1β induction, the treatment groups were: 20×10 ⁸ exosomes, 50×10 ⁸ exosomes, 100×10 ⁸ exosomes, IGF-1, SIRT-1, SIRT-2, SIRT-6, 20×10 ⁸ exosomes + IGF-1, 20×10 ⁸ exosomes + SIRT-1, 20×10 ⁸ exosomes + SIRT-2, 20×10 ⁸ exosomes + SIRT-6, 50×10 ⁸ exosomes + IGF-1, 50×10 ⁸ exosomes + SIRT-1, 50×10 ⁸ exosomes + SIRT-2, 50×10 ⁸ exosomes + SIRT-6. In addition, there was a control group of SW1353 cells without any treatment, and an IL-1β group of SW1353 cells that were only induced by IL-1β. After extracting total RNA from SW1353 cells in each group, the relative gene expression of human matrix metalloproteinase-13 (hMMP-13) in chondrocytes was determined by real-time PCR, and the housekeeping gene GAPDH was used as the standard for gene expression. The expression of hMMP-13 is an indicator of IL-1β-induced inflammatory response and osteoarthritis response. Current studies have pointed out that hMMP-13 is a key enzyme in the development of inflammatory diseases and arthritis, and will further cause cell damage.

The total RNA extraction of SW1353 cells was performed in the following steps: before preparation, the cells were filmed and recorded, and then the cells in the 10 cm culture dish were washed with PBS solution, and then 300 μl of RNA lysis buffer was added and mixed evenly, and the mixture was transferred to Spin-Away™ Filter (Zymo research) for centrifugation (14000×g, 30 seconds). After centrifugation, the supernatant was retained, and an equal volume of 99.8% alcohol was added, and after even mixing, the mixture was transferred to Zymo-Spin™ IIICG Column (Zymo research) for centrifugation (14000×g, 30 seconds); after centrifugation, the supernatant was removed, and RNA Wash Buffer (Zymo research) and centrifuged (14000×g, 30 seconds); after removing the supernatant, add 80 μL of DNase I and DNA Digestion Buffer (Zymo research) mixture to the center of the inner membrane of the Zymo-Spin™ IIICG Column, let it stand for 15 minutes, then add 400 μL of RNA Prep Buffer (Zymo research) and centrifuge (14000×g, 30 seconds); after removing the supernatant, add 700 μL of RNA Wash Buffer and centrifuge (14000×g, 30 seconds); after removing the supernatant, add 400 μL of RNA Wash Buffer and centrifuge (14000×g, 1 minute) to remove residual reagents. Transfer the Zymo-Spin™ IIICG Column to a new 1.5 mL microcentrifuge tube, add 100 μL of DNase/RNase-Free Water (Zymo research) to the center of the inner membrane of the Zymo-Spin™ IIICG Column, centrifuge (14000 × g, 1 min), and collect the filtrate that flows out, which is the total cell RNA.

The quantitative real-time PCR reaction was performed as follows: 9 μL of total cell RNA was taken, and 0.4 μL of the primers (10 micromolar concentration) shown in Table 1 was added, and then Power SYBR® Green RNA-to-CT™ 1-Step Kit (Applied Biosystems) was added to obtain the sample to be reacted. Then, the sample to be reacted was placed in a polymerase chain reaction reactor, and the reaction conditions were set as follows: a) 48°C, 30 minutes; b) 95°C, 10 minutes; c) 95°C, 15 seconds; 60°C, 60 seconds, and the above steps were performed for 40 cycles; then d) 95°C, 15 seconds; 60°C, 15 seconds; 95°C, 15 seconds. The ratio of the hMMP-13 mRNA content in cells to the hGADPH mRNA content in cells was calculated to obtain the relative hMMP-13 mRNA content in each tissue cell. The relative gene expression was calculated using the 2 ^−ΔΔCt method. Table 1: Primer pairs used in real-time polymerase chain reaction Gene forward primer Reverse primer hMMP-13 CCTTGATGCCATTACCAGTCTCC (SEQ ID NO:1) AAACAGCTCCGCATCAACCTGC (SEQ ID NO:2) hGADPH GCACCAGGTGGTCTCCTCT (SEQ ID NO:3) TGACAAAGTGGTCGTTGAGG (SEQ ID NO:4)

The results of hMMP-13 expression in each group are shown in Figure 1. It can be concluded from the results of the 20×10 ⁸ exosomes, 50×10 ⁸ exosomes, and 100×10 ⁸ exosomes groups that IL-1β-induced exosome treatment can reduce the expression of hMMP-13, and the degree of reduction is correlated with the number of exosomes.

Although adding IGF-1 or SIRT-6 alone can reduce the expression of hMMP-13, the degree of reduction is not as significant as that caused by exosomes. SIRT-1 and SIRT-2 hardly reduce the expression of hMMP-13.

When exosomes are treated with SIRT-1 and SIRT-2, the expression of hMMP-13 is significantly reduced, that is, the inflammatory response is reduced. When exosomes are treated with IGF-1 or SIRT-6, the inflammatory response is reduced even more significantly. In particular, when 20×10 ⁸ exosomes are added with SIRT-1, SIRT-2 or SIRT-6 to treat the inflammatory response of SW1353 cells, it is equivalent to using 100×10 ⁸ exosomes alone. When 20×10 ⁸ exosomes were used alone, the expression of hMMP-13 decreased by 47.1%; when SIRT-1, SIRT-2 or SIRT-6 were used alone, the expression of hMMP-13 decreased by 0.7%, -4.2% or 12%. However, when 20×10 ⁸ exosomes were used together with SIRT-1, SIRT-2 or SIRT-6, the expression of hMMP-13 decreased by 73.7%, 73.2% or 75.8%, respectively, which was better than the sum of the reductions of protein and exosome treatment (47.1% + 0.7%), (47.1% - 4.2%) or (47.1% + 12%), respectively. This indicates that the simultaneous use of 20×10 When ⁸ exosomes were treated with SIRT-1, SIRT-2 or SIRT-6, they had a synergistic effect on reducing the expression of hMMP-13.

When 50×10 ⁸ exosomes were used alone, the expression of hMMP-13 decreased by 66.5%; when SIRT-1, SIRT-2 or SIRT-6 were used alone, the expression of hMMP-13 decreased by 0.7%, -4.2% or 12%, respectively. However, when 50×10 ⁸ exosomes were used at the same time and SIRT-1, SIRT-2 or SIRT-6 were added, the expression of hMMP-13 decreased by 86.1%, 87.1% and 79.3%, respectively, which was better than the sum of the reduction levels of protein and exosome treatment (66.5%+0.7%), (66.5%-4.2%), (66.5%+12%), respectively. This shows that the simultaneous use of 50×10 When ⁸ exosomes were added with SIRT-1, SIRT-2 or SIRT-6 respectively, the expression of hMMP-13 was reduced in a synergistic manner. Therefore, the simultaneous administration of exosomes and the subsequent treatment with SIRT-1, SIRT-2 or SIRT-6 respectively had a synergistic effect in reducing the inflammatory response of cells.

In addition, Figure 2 shows the cell growth recorded before extracting whole cell RNA in the 20×10 ⁸ exosomes, 50×10 ⁸ exosomes, 100×10 ⁸ exosomes, 20×10 ⁸ exosomes + IGF-1, 20×10 ⁸ exosomes + SIRT-1, 20×10 ⁸ exosomes + SIRT-2, 20×10 ⁸ exosomes + SIRT-6, 50×10 ⁸ exosomes + IGF-1, 50×10 ⁸ + SIRT-1, 50×10 ⁸ + SIRT-2, 50×10 ⁸ + SIRT-6 exosomes groups and the control group. As shown in Figure 2, exosomes promote chondrocyte proliferation, and the amount of exosomes is correlated with the proliferation effect. When exosomes are added with SIRT-1 or SIRT-6, cell proliferation is more obvious in SW1353.

Embodiment 2 Induced inflammation SW1353 Cell viability test

The survival rate of SW1353 cells in Preparation Example 1 was analyzed. 2×10 ⁵ SW1353 cells were inoculated in a 3.5 cm culture dish. After 24 hours, the cells were uniformly attached to the bottom of the dish. 10 ng/ml IL-1β was added to induce osteoarthritis reaction indicators; or the following treatments were performed immediately after the addition of the aforementioned IL-1β: 20×10 ⁸ , 50×10 ⁸ , and 100×10 ⁸ exosomes of Preparation Example 2 were added respectively; or IGF-1 was added to make the IGF-1 concentration of the culture medium 100 ng/ml; SIRT-6 was added to make the SIRT-6 concentration of the culture medium 100 ng/ml. The treatment groups were: 20×10 ⁸ exosomes, 50×10 8, and 100×10 8 exosomes, respectively. ⁸ exosomes, 100×10 ⁸ exosomes, 20×10 ⁸ +IGF-1 exosomes, 50×10 ⁸ exosomes + IGF-1, 20×10 ⁸ exosomes + SIRT-6, 50×10 ⁸ exosomes + SIRT-6. In addition, the control group was SW1353 cells without any treatment, and the IL-1β group was SW1353 cells induced only by IL-1β. After 72 hours of reaction, the culture medium was replaced with a culture medium containing MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) cell viability reagent and placed in a 37°C incubator for 2 hours. The color reaction was detected by an enzyme immunoassay at 490 nanometers (nm) to calculate the cell survival rate. The results are shown in Figure 3.

As shown in Figure 3, exosomes can promote SW1353 cell proliferation, and the addition of IGF-1 or SIRT-6 to exosomes can further improve cell survival. The cell survival rate of 20×10 ⁸ exosomes plus IGF-1 or SIRT-6 is equivalent to that of 50×10 ⁸ exosomes alone. Therefore, the composition of the present invention can be used to promote chondrocyte proliferation.

In summary, the composition of the present invention can reduce inflammation, reduce the degree of damage to chondrocytes, and promote chondrocyte proliferation because it contains both exosomes and additional factors. Therefore, it can be used to treat and alleviate arthritis, especially osteoarthritis.

Various modifications and variations that may be made according to the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in certain preferred embodiments, it should be understood that the present invention should not be unduly limited to such specific embodiments. In fact, in terms of the described modes of implementing the present invention, various modifications that are obvious to those skilled in the art are also covered by the following patent applications.

without

Figure 1 shows the relative expression of hMMP-13 in SW1353 human chondrocytes in each group of Example 1; Figure 2 shows the growth of SW1353 cells in each exosome group and each exosome and protein co-treatment group of Example 1 observed under a microscope; Figure 3 shows the relative absorbance percentage of each group in the MTS test of Example 2.

without

TWI849962B_112121231_SEQL.xml

Claims (5)

A use of a composition for preparing a drug for treating, preventing or alleviating arthritis, wherein the composition comprises an exosome and a biomacromolecule, wherein the biomacromolecule is silent mating type information regulation 2 homolog (SIRT)-1 or SIRT-6, and the exosome is secreted from mesenchymal stem cells, and the mesenchymal stem cells are from the umbilical cord. The use as described in claim 1, wherein the drug further comprises a pharmaceutically acceptable carrier. The use as described in claim 2, wherein the dosage form of the drug is a non-parenteral dosage form. The use as described in claim 3, wherein the non-parenteral dosage form is an injection or an external liquid. The use as described in claim 1, wherein the arthritis is osteoarthritis, rheumatic arthritis, rheumatoid arthritis, traumatic arthritis, purulent arthritis, gouty arthritis, tuberculous arthritis, neurogenic arthritis or hemophilic arthritis.