TWI839714B - Use of the composition for preparing a medicament for treating traumatic brain injury - Google Patents

Abstract

The present invention provides a composition for preparing a drug for treating traumatic brain injury. The composition includes CCL5 and is used to regulate the content of reactive oxygen species (ROS) in the hippocampus of the brain.

Description

Use of the composition for preparing a drug for treating traumatic brain injury

The present invention relates to the use of a composition for preparing a drug for treating a disease, and in particular to the use of a composition for preparing a drug for treating traumatic brain injury.

Traumatic brain injury (TBI) refers to brain function damage caused by one or more external impacts to the head, such as car accidents, falls, sports injuries or violent shaking. Some pathological studies have shown that more than millions of people seek medical treatment for traumatic brain injuries every year. The severity of these injuries can be assessed by the Abbreviated Injury Score (AIS) or the Glasgow Coma Scale (GCS). The former is analyzed through images of computed tomography (CT) or magnetic resonance imaging (MRI); the latter is analyzed based on the patient's eyes, speech and motor reactions.

Take GCS as an example: 13-15 points are mild TBI, 9-12 points are moderate TBI, and 3-8 points are severe TBI. In Taiwan, there were more than 90,000 TBI cases in 2007-2008, and more than 50% of them were mild TBI. Some recent studies have also found that mild TBI increases the risk of many neurodegenerative diseases, such as Alzheimer's Disease (AD), Parkinson's Disease (PD), etc. Therefore, mild TBI is a clinical brain disease that needs to be taken seriously.

TBI causes two types of damage to the brain: primary damage and secondary damage. Primary damage refers to direct damage to brain tissue during the process of brain injury, such as tearing of nerve cells and axons, breakdown of the blood-brain barrier (BBB), synaptic injury, and bleeding of brain blood vessels caused by external forces; secondary damage refers to damage caused by changes in the physiological and biochemical levels after the injury. For example, TBI damages the BBB and causes cerebral hemorrhage, which causes tissue hypoxia and increases oxidative stress in cells, causing damage. Alternatively, TBI causes changes in brain pressure and astrocyte swelling, which prevents astrocytes from absorbing excess glutamate in the tissue, causing excitotoxic damage to nerve cells and activating NADPH oxidase to produce a large amount of reactive oxygen species (ROS), causing oxidative damage. Increased cytoplasmic ROS in nerve cells can cause direct damage to cells, which is mainly caused by ROS oxidizing proteins, nucleic acids, and lipids in cells, causing these molecules to lose their normal functions.

There are three sources of intracellular oxidative stress: cytoplasmic, mitochondria, and peroxisome. ROS in the cytoplasm play an important role in signal transmission and disease physiology, and the main ROS producer in the cytoplasm is the NADPH oxidase (NOX) family, especially NOX2. NOX2 is the main producer of superoxide (O ₂ ∙ ⁻ ), and NOX2 transfers the electrons of NADPH to oxygen (O ₂ ) to form O ₂ ∙ ⁻ . NOX2 is involved in different metabolisms and disease processes, such as: activation of neutrophils in inflammatory responses, and phosphofructokinase binds to NOX2 and stimulates inflammatory responses. The activity of NOX changes at different time points after TBI. In the early stage of TBI, the activity of NOX in nerve cells increases, while in the late stage of TBI, the activity of NOX in microglia increases.

In addition to O ₂ ∙ ⁻ , the other two common ROS in cells are Hydrogen peroxide (H ₂ O ₂ ) and Hydroxyl radical ( ^. OH). The main source of H ₂ O ₂ is the decomposition of O ₂ ∙ ⁻ by superoxide dismutase (SOD). Although H ₂ O ₂ can cause less oxidative damage than O ₂ ∙ ⁻ , its half-life is longer than O ₂ ∙ ⁻ and it can easily pass through the cell membrane, so it can also cause oxidative damage to cells. In addition, if too much H ₂ O ₂ accumulates in the cell, it will increase the Fenton reaction to produce the most oxidative ^. OH. The Fenton reaction is a process in which divalent iron ions (Fe ²⁺ ) in cells exchange electrons with H ₂ O ₂ to form trivalent iron (Fe ³⁺ ), ^OH , and OH ^- .

In order to prevent nerve cells from dying due to oxidative stress, nerve cells will increase the expression of antioxidants after TBI. Two main types of ROS are produced after TBI, namely O ₂ ∙ ⁻ and H ₂ O ₂ ; the antioxidants mainly responsible for decomposing these two ROS are superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX). These three enzymes can gradually convert O ₂ ∙ ⁻ and H ₂ O ₂ into non-toxic H ₂ O and O ₂ . SOD is an important detoxification enzyme and the first ROS to be contacted by the three antioxidants. It can catalyze the conversion of O ₂ ∙ ⁻ into two molecules - H ₂ O ₂ and O ₂ . CAT uses iron or manganese ions as cofactors and catalyzes the reduction _{of H2O2} into _H2O and _O2 , but CAT is not very sensitive to oxidative stress in the brain, so CAT activity in the brain is relatively low. GPX is a very important enzyme that breaks _{down H2O2} into _H2O and can also break down lipid peroxides into corresponding alcohols in the brain. The activity of GPX depends on the metabolic pathway related to glutathione (GSH).

The metabolic pathway of GSH includes reduced form of GSH, oxidized form of GSH (Glutathione disulfide, GSSG) and two synergistic enzymes, glutathione reductase (GR) and GPX, to maintain the balance of redox. NADPH is the most important electron donor in GSH electron transfer. In neurons, glucose is oxidized through PPP (pentose phosphate pathway, PPP) to maintain sufficient levels of NADPH for antioxidant activity. In normal cells, the ratio of GSH to GSSG is about 90%, but when cells age, suffer from chronic inflammation and oxidative damage, the ratio of GSH to GSSG may drop to 50% or even lower than 50%.

Therefore, the present invention is to study the regulatory mechanism of ROS generated in the brain after TBI in order to provide effective drugs or therapies for the prevention and treatment of such diseases.

To achieve the above object, the present invention provides a composition for preparing a drug for treating traumatic brain injury, wherein the composition includes CCL5 for regulating the level of reactive oxygen species (ROS) produced after injury to the hippocampus.

In one embodiment of the present invention, the traumatic brain injury is particularly mild traumatic brain injury (mild TBI).

In one embodiment of the present invention, the composition is used to activate glutathione peroxidase 1 (GPX1).

In one embodiment of the present invention, the composition is used to regulate chronic inflammation of the hippocampus.

In one embodiment of the present invention, the composition is administered within 3 days after the brain damage occurs.

In one embodiment of the present invention, the composition is administered within 1 hour after the brain damage occurs.

In one embodiment of the present invention, the composition can alleviate the oxidative stress of neurons in traumatic brain injury and reduce the number of cells damaged by oxidative stress.

The detailed description and technical contents of the present invention are described below with reference to the accompanying drawings. However, the attached drawings are only provided for reference and explanation to help understand the present invention and are not intended to limit the scope of the present invention.

First, the experimental materials and methods of the present invention are described:

1. Animal Experiments on Mild TBI:

Eight-week-old male C57BL/6Jnarl mice (hereinafter referred to as WT) were purchased from the National Animal Center, and CCL5-KO mice (Stock No: 005090, hereinafter referred to as CCL5-KO or CCL5 ^-/- ) were purchased from The Jackson Laboratory and bred and cultured at the National Animal Center. Eight-week-old male CCL5-KO mice were used in the experiment. Mice were housed in groups of 3-5 per cage, with free access to food and water in a 12:12 h light/dark cycle, and the room temperature was set at 25°C. All behavioral tests in the study were also performed at 25°C.

2-3 month old WT or CCL5-KO mice were anesthetized with 2.5% isoflurane (isoflurane, Panion & BF biotech Inc.) at an air flow rate of 1.5–2.0 L/min for 2 min 15 s; then, the mice were placed chest down on a foam sponge (size: 18.5 cm × 7 cm × 8 cm) to support the head and body under a weight drop device. The weight drop device consisted of a hollow cylindrical tube (1.2 cm inner diameter, 100 cm height) and was placed vertically approximately 2 cm above the center of the mouse's head. A 30 g weight (1 cm diameter, 5.2 cm height) was released from the hollow cylindrical tube and hit the mouse to induce mild TBI. The time from when the mouse was hit to when it was able to right itself reflexively was the mouse's "loss of consciousness time".

CCL5-KO mice were treated with NAC (A7250, Sigma-Aldrich) or recombinant mouse CCL5/RANTES protein (478-MR-025, R&D Systems). NAC was dissolved in saline and administered at a dose of 5 mg/kg or 20 mg/kg. CCL5-KO mice were treated by intraperitoneal injection every day one hour after mild TBI until behavioral testing at 4 dpi (days post injury). NAC was injected after the memory retrieval test 2 days after injury (2 dpi) to avoid the effect of NAC on the short-term memory retrieval test. CCL5 recombinant protein was diluted in PBS and administered to CCL5-KO mice at a dose of 300 μg/kg. To track the location of CCL5, recombinant CCL5 protein was labeled using Alexa Fluor™ 594 Micro-Volume Protein Labeling Kit (A30008, Invitrogen). 24 h after mTBI, mice were sacrificed and immunostained with anti-CCL5 antibody (1:100, sc-365826, Santa Cruz biotechnology, Dallas, USA) and donkey anti-rabbit-488 (1:400, Invitrogen, A32790).

2. Behavioral test:

Neurological function included several behavioral tests - modified neurological deficit score (mNSS): mNSS was used to represent global neuronal function in WT and CCL5-KO mice after mild TBI, including movement, sensation, reflexes, and balance. Parameters were scored from 0 to 18 (healthy score: 0; maximum deficit score: 18). Memory function tests included the Novel Object Recognition Test (NOR) and the Barnes maze. All tests were analyzed using EthoVision ® XT software.

1. Novelty Perception Test

The novel object recognition test is an object recognition behavior test that uses the characteristic of mice to be interested in new objects. Mice will tend to contact new objects, and then compare the exploration time of mice on new and old objects to analyze the memory performance of mice. Mice were randomly divided into four groups and tested and analyzed at 4, 7, 14 and 28 days after injury (dpi). On the first day, mice were allowed to adapt to a closed box (57 cm × 57 cm box) for 10 minutes. On the second day, two identical objects were placed in the box at equal distances and mice were allowed to explore for 10 minutes. After 24 hours, one of the objects was replaced with an object of the same size but different shape and color, and the mice were allowed to explore for another 10 minutes and recorded. The experiment used EthoVision® XT software to record and analyze the walking trajectory of mice. Memory performance was defined as the discrimination index percentage (DI%): (novel object exploration time - familiar object exploration time) / total exploration time x 100%. The object combinations were the same in different groups to avoid confusion of object shapes. The apparatus was cleaned with ethanol between trials to avoid odor affecting recognition.

(II) Baders Labyrinth

The maze consisted of a white circular platform (92 cm in diameter) with equally spaced holes at the 3, 6, 9, and 12 o'clock positions. Mice were familiarized in a dark box for 30 min before testing. On day 1, mice were habituated to the escape box for 5 min and the maze for 6 min. On the following 4 days, mice were placed in the center of the maze and allowed to explore freely for 6 min. Testing was stopped when they reached the escape box or explored for more than 6 min. Memory recall tests were also performed as described previously. Short-term and long-term memory recall tests were performed on days 2 and 7 after the last day of training on the Bards maze. Retention period, distance moved, and percentage of target quadrant visits during training and memory recall tests were measured using the above software. Mice were trained and tested for memory recall in the Bards maze before TBI (-11 dpi Bards maze) to confirm their learning and memory abilities. The 2dpi memory recall test (the location of the escape box was the same as the 11 dpi Bards maze) indicated that primary memory was impaired in WT and CCL5-KO mice after TBI. In the post-injury test, the location of the escape box was changed.

Animals were sacrificed for the following cellular and molecular analyses no more than 24 hours after the behavioral analysis. Thus, the molecular analysis results could be linked to the behavioral results.

3. FJC staining

Mice were anesthetized with Zoletil 50 (66F4, Virbac) and Rompum solution (PP1523, Bayer) and then perfused with 4% PFA; the harvested brains were cryostat-sectioned (25 μm thick) and stained with Fluoro-Jade C (FJC) (TR-100-FJ, Biosensis, USA). Brain tissues were mounted on gelatin-coated slides and heated at 57°C for 30 min. The tissues were hydrated with serially diluted ethanol and water and then incubated with 0.06% KMnO ₄ for 10 min in the dark. Afterwards, the tissues were incubated with a solution containing 1 μg/ml DAPI and 0.0001% FJC for 10 min in the dark for staining. Tissues were dehydrated with xylene. Images were acquired using a fluorescence microscope (STP6000, LEICA), and FJC-positive cells were analyzed using Imager J software.

IV. Immunochemical staining:

Hypoxyprobe staining was performed 1 and 7 days after injury to measure oxidative stress (OS) damage in the hippocampus after TBI. Before perfusion, animals were given 60 mg/kg of Hypoxyprobe solution (pimonidazole hydrochloride dissolved in 0.9% NaCl) intraperitoneally. After 60 minutes, mice were perfused with 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer. The obtained brain tissue was frozen and sectioned (thickness 25 μm) and processed for immunohistochemistry. The tissue was placed in 0.1 M phosphate buffer containing 1% sodium bicarbonate for 30 minutes. After treatment with 3% BSA in PBSc/m, tissues were incubated with primary antibodies overnight at 4°C. Rabbit antibodies against NeuN (Novus-NBP1-77686X, 1:200 dilution), Iba-1 (GeneTex, GTX101495, 1:1000 dilution), and GFAP (GeneTex, GTX108711, 1:1000 dilution) were used to measure the number of neurons, microglia, and astrocytes. Anti-pimonidazole-FITC (1:100, Hypoxyprobe™ Plus Kit, Biosensis) was used to visualize Hypoxyprobe signals. Anti-NeuN or GFAP was used for co-staining to mark neurons and astrocytes with oxidative damage. After washing away the primary antibody, the tissues were incubated with donkey anti-rabbit-568 (1:400, Invitrogen, A10042) or donkey anti-rabbit-488 (1:400, Invitrogen, A32790) for 40 min at room temperature. Images were acquired by fluorescence microscopy and analyzed using Image J. The control group consisted of omitting the primary antibody, and counting was performed by a blinded observer.

5. NADPH oxidase activity assay:

The basal ROS value and NADPH oxidase activity in tissues were studied at 4 dpi, 7 dpi, 14 dpi and 28 dpi. 50 µM lucigenin (Sigma-Aldrich, 2315971) was added to 200 μl Krebs buffer (pH 7.4, 118.4 mM NaCl, 25 mM NaHCO ₃ , 11.7 mM glucose, 4.75 mM KCl, 1.2 mM MgSO ₄ , 2.5 mM CaCl ₂ .2H ₂ O, 1.2 mM KH ₂ PO ₄ ) and the ROS generated within 50 seconds was measured as the basal ROS value in tissues. NADPH oxidase activity was then measured by adding 50 µM NADPH. Counts per second (CPS) were measured by Triathler Multilabel Test (425-004, HIDEX, Turku, Finland) and averaged with the wet weight of tissue (µg). NADPH oxidase activity was analyzed as the area under the curve of ROS during the 350-second reaction period. Data from the TBI group were compared with the sham group to measure the fold change in NADPH oxidase activity.

VI. Protein Western Blot Analysis:

Tissues and cells were lysed using RIPA buffer (#20-188, Millipore, USA) containing protease-phosphatase inhibitors (78441, Thermo Scientific™, USA). Protein electrophoresis was performed using 10% Tris-HCl protein gel; 30 μg of total protein was added to each sample. Gels were analyzed using the Trans-Blot ^® Cell system (Bio-Rad) and transferred to PVDF membranes. The stained membrane was incubated with blocking buffer (5% skim milk in Tris-buffered saline containing 0.05% Tween 20, TBST) at room temperature for 1 hour, and then incubated with different primary antibodies (including anti-actin (Millipore, MAB1501), GPX-1 (GeneTex, GTX116040), SOD-1 (GeneTex, GTX100659) and SOD-2 (GeneTex, GTX116093) at 4 °C overnight. The membrane was washed three times with TBST and then incubated with HRP-conjugated secondary antibodies (Goat anti-Mouse IgG-HRP, 115-035-003; Goat anti-Rabbit IgG-HRP, 111-035-003, from Jackson ImmunoResearch) at room temperature for 1 hour. Protein signals were visualized using Clarity Western ECL Substrate reagent (Bio-Rad, 1705061), and protein expression was quantified using Image J software.

VII. RNA Isolation and Real-time Quantitative PCR Analysis:

Tissue RNA was extracted by TRIZOL (15596018, Invitrogen) and reverse transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems™). Quantitative PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) and StepOnePlus™ Real-Time PCR System (4376600, Applied Biosystems™, USA). The primer sequences were:

GPX1: Forward—5'-CGTTTGAGTCCCAACATCTC-3';reverse—5'-CGTTCATCTCGGTGTAGTCC-3', product size: 199 bp. CCL5: Forward—5'-TGCTGCTTTGCCTACCTC-3';reverse—5'-CTTGAACCCACTTCTTCTCT-3', product size: 151 bp. IL-1β: Forward—5'-GCACTACAGGCTCCGAGATGAAC-3';reverse—5'-TTGTCGTTGCTTGGTTCTCCTTGT-3', product size: 147 bp. IL-10: Forward—5'-GCTCTTACTGACTGGCATGAG-3';reverse—5'-CGCAGCTCTAGGAGCATGTG-3', product size: 105 bp. TNF-α: Forward—5'-GGAACTGGCAGAAGAGGCACTC-3';reverse—5'-GCAGGAATGAGAAGAGGCTGAGAC-3', product size: 89 bp. Mouse GADPH: Forward—5'-GTGTTCCTACCCCCAATGTGT-3';reverse—5'-AGAGTGGGAGTTGCTGTTGAAG-3', product size: 176 bp. Human GADPH: Forward—5'- CACAAGAGGAAGAGAGAGA-3';reverse—5'- CACAGGGTACTTTATTGATG -3', product size: 164 bp (for SHSY5Y human blastoma cell line). mRNA expression was normalized with GADPH and calculated using the percentage of 2 ^- ΔCT(TBI)/2-ΔCT(sham).

8. GSH/GSSG activity assay

Glutathione concentration was measured by Glutathione Colorimetric Assay Kit (K261, BioVision Inc, USA). Hippocampal tissues were homogenized with Glutathione Assay Buffer (4 μl/tissue weight (mg)) on ice. 20 μl of sample was mixed with 160 μl of reaction mixture or reduction reaction mixture to detect total GSH and reduced GSH production, respectively. For total GSH production, samples were measured at 415 nm for 30 min using an iMark microplate absorbance reader (Bio-Rad, USA). For reduced GSH, samples were measured at 415 nm and calculated using a standard glutathione standard curve.

IX. Cell culture, transfection, and cell viability assay:

Primary neurons were cultured from gestational day 16.5-17 (E16.5-17) C57BL/6 and CCL5 ^-/- mouse embryos. Embryonic brain tissue was lysed in Dulbecco's Modified Eagle's Buffered Medium (DMEM, 12800-017, Gibco) containing 2 mg/ml papain (Worthington, LS003119) and 0.05% Trypsin-EDTA (Gibco, 25200-072) for 14 min and cultured in neurobasal medium (21103-049, Gibco) containing 10% v/v heat-inactivated fetal bovine serum (FBS, 10437-028, Gibco), 1% v/v antibiotic-antimycotic (15240-062, Gibco) and 2 mM L-glutamine (25030, Gibco). After 2 hours of cell attachment, the culture medium was replaced with "complete medium" (neurobasal medium containing 1% v/v N-2 supplement (17502048, Gibco), 2% v/v B-27 supplement (17504044, Gibco), 1% v/v antibiotic-antimycotic and 2 mM L-glutamine). After that, half of the medium was replaced every 3 days. On the 4th day of culture, the cells were first given 10, 50, 100 and 250 pg/ml of CCL5/RANTES recombinant protein. After 30 minutes, the cells were treated with 25, 50, 100, 250, 500 μM hydrogen peroxide (PanReac AppliChem, 131077) for 24 hours. In the cell line study, CCL5 plasmid and EGFP plasmid (#6084-1, Addgene, MA, USA) were expressed in SHSY5Y cells using Lipofectamine™ 2000 transfection reagent (11668019, Invitrogen). Afterwards, the transfected cells were transferred to 6-well/24-well plates and treated with the above doses of hydrogen peroxide and CCL5 for protein collection and MTT assay.

For cell viability analysis, cells were incubated with MTT solution (10 μg/ml, M6494. Invitrogen™) for 1 hour. Subsequently, 200 μl of DMSO was added to lyse the cells and the signal was read at 550 nm.

10. DCFDA labeling and immunocytochemical staining:

Primary neurons were seeded into 6-well plates at a density of 5 × 10 ⁵ . On the 4th day, 100 pg/ml CCL5 recombinant protein was added, and 0, 250, and 500 μM H ₂ O ₂ were added after 30 minutes. After 24 hours, the medium was removed and washed with PBS. 2 ml of PBS and 20 μl of DCFDA solution (10 mM) were added to each well, and then the DCFDA solution and cells were allowed to act in the incubator for 1 hour. After 1 hour, the PBS containing the DCFDA solution was removed and fixed with 4% PFA for 10 minutes. Then, the cells were treated with a buffer containing 1 μg/ml DAPI for 30 minutes. The cells were incubated with primary antibody against the neuronal cytoskeleton marker Tuj-1 (1:2000, MAB5564, Millipore, USA) at 4°C overnight. The secondary antibody used was Anti-mouse 568 (1:400, Invitrogen, USA). The results were observed under a fluorescent microscope and analyzed using Image J software.

11. CCL5 ELISA assay:

The mouse CCL5/RANTES DuoSet ELISA kit (DY478, R&D System) was used to measure CCL5/RANTES levels in the hippocampus of WT and CCL5-KO. The capture antibody was diluted to 2 μg/ml in PBS, and 100 μl of the diluted capture antibody was added to a 96-well plate and incubated overnight at room temperature. The capture antibody was removed, and PBS containing 1% BSA was added for 2 hours to block non-specific interactions, followed by washing with PBS containing 0.05% Tween 20 (wash buffer). 100 μl of tissue samples or standards were added to a 96-well microtiter plate, incubated for 2 hours at room temperature, and then washed with wash buffer. Next, the sample was incubated with a biotin-conjugated detection antibody for 2 hours, and then with Streptavidin-HRP for 30 minutes to generate a signal. The sample in the microplate was then read at a wavelength of 450 nm using a spectrophotometer. A standard curve was drawn using the absorbance values of CCL5 standards of different concentrations. After obtaining the equation of the standard curve, the absorbance value of the sample was substituted into the equation to calculate the CCL5 content in the hippocampus tissue.

12. Quantification and statistical analysis:

Statistical analysis was performed using GraphPad Prizm 8.0 (GraphPad Software, Dan Diego, CA, USA). Unpaired t- test was used to detect differences between two groups, one-way ANOVA analysis was used to detect differences within the same group with a confidence interval of 95%, and two-way ANOVA analysis was used for multifactorial testing. Bonferroni correction was used for any serial measurements. A p value < 0.05 was considered significant. All results are presented as mean ± SEM.

Experimental results:

1. Delayed memory recovery in CCL5-deficient mice after mild brain injury

WT and CCL5-KO mice were induced with mild brain injury using a heavy-fall model at 2 months of age. After heavy-fall-induced brain injury, the duration of unconsciousness (righting reflex) of both types of mice was increased compared with the anesthetized control group, but there was no difference between the two groups of animals (Figure 1A, A). The modified neurological severity score (mNSS) assessed the degree of neurological injury one day after injury. The mNSS score values of WT and CCL5-KO mice were approximately 3, indicating mild injury (Figure 1A, B).

The object recognition and spatial memory of mice were analyzed using the Novel Object Recognition Test (NOR) and the Barnes maze (A in Figure 1B). Before the injury, there was no difference between the uninjured WT and CCL5-KO groups in their preference for novel objects. After mild brain injury, the preference for novel objects of both mice decreased. The WT group began to recover 7 days after the injury, but the CCL5-KO group began to recover only 14 days after the injury (B in Figure 1B). The motor ability of both groups of mice was not affected by brain injury (C in Figure 1B).

Before injury, the retention of short-term recall memory (SM, 2 days after training) and long-term recall memory (LM, 7 days after training) in the Bards maze was similar in both control and brain injury (mTBI) groups of WT and CCL5-KO mice. Both brain injury groups showed increased retention in the recall test 2 days after injury (2-day recall) (A and B in Figure 1C). A new round of Bards maze learning and memory testing was performed on day 4 (C in Figure 1C) and day 28 (D in Figure 1C) post-injury (dpi). WT mice recovered rapidly from memory impairment caused by brain injury; the retention period of WT mice did not differ between the control and injury groups. In WT mice, there was also no difference in memory retrieval test and walking distance between the control and injury groups (A to D in Figure 1D). In contrast, in a new round of Bards maze 4 days after trauma, the retention period of the CCL5-KO injury group was higher than that of the control group (C in Figure 1C). The retention period of the CCL5-KO injury group was even higher in a second round of a new Bards maze 28 days after trauma (D in Figure 1C). In particular, the retention period on the fourth day of the second training after trauma was higher than that of the first training. In the CCL5-KO TBI group, the retention time and walking distance of short-term memory retrieval were increased (Figure 1D, E-H).

2. After mild trauma, the number of damaged neurons increased in the hippocampus of CCL5-deficient mice

To understand the possible causes of CCL5-KO memory impairment after trauma, the present invention analyzed the neuronal damage and total neuron number in the hippocampus 28 days after trauma. FJC-labeled damaged neurons increased in the hippocampus of both WT and CCL5-KO mouse brain injury groups; compared with the WT brain injury group, there were more FJC-labeled damaged neurons in the KO brain injury group (A, C in Figure 2A). In addition, the number of hippocampal neurons labeled by NeuN was significantly reduced in the CCL5-KO mouse brain injury group (B, D in Figure 2A), but there was no decrease in the number of hippocampal neurons in the WT brain injury group. In addition, one month after mTBI, the inflammation-related cells-astrocytes and microglia in WT mice did not increase, and the number of GFAP or Iba1-positive cells in the hippocampus tissue of the control group and the brain injury group was similar (Figure 2B); however, after mTBI, more astrocytes were found in the hippocampus tissue of CCL5-KO mice, while microglia did not change significantly (A, C and B, D in Figure 2B). It was also found that TNF-α, IL-1β and IL-10 increased in the hippocampus of WT mice after 4-7 dpi, but decreased after 14 days. In contrast, TNF-α and IL-1β were increased in CCL5-KO mice at 14-28 dpi, but IL-10 was not significantly increased compared to WT (Fig. 2B, E-G). These findings suggest that the immune response after trauma in CCL5-KO mice is regulated differently than in WT mice, particularly with respect to IL-10 activation, and that more neurons die and/or are damaged after mild brain trauma and increased astrocytosis in CCL5-KO mice. These findings are consistent with the behavioral data. In summary, hippocampal neurons recover less from mild trauma in mice lacking CCL5.

3. CCL5 content is associated with early neuronal oxidative stress after trauma

To further understand the relationship between CCL5 and neuronal recovery after brain trauma, the content of CCL5 in tissues was analyzed by ELISA. The content of CCL5 in hippocampal tissue increased after 4 dpi and gradually recovered after 14 dpi in WT mice (Figure 3A, A); this is related to the timeline of memory recovery in WT mice. The expression of CCL5 in peripheral blood serum was not significantly correlated with changes in the brain (Figure 3A, B). Oxidative stress is considered to be the main cause of early neuronal damage after brain trauma. Cells under oxidative stress can be labeled with hypoxyproble (green in Figure 3B, A, B) and synchronized with the neuronal marker NeuN (red in Figure 3B, red in Figure 3C, A) or astrocyte marker GFAP (red in Figure 3C, B) to understand the cell types that are damaged by oxidative damage. Hypoxyprobe-labeled cells are mostly NeuN-positive, but not GFAP-positive cells. In WT and CCL5-KO mice, there was no significant difference in the total number of hippocampal neurons between control, 1 dpi, and 7 dpi mice (Figure 3B, A–C, NeuN ⁺ ). In WT mice, the number of Hypoxyprobe-labeled cells increased at 1 dpi and recovered to the same level as the control group at 7 dpi (A, D-hypoxyprobe ⁺ in Figure 3B), and the changes in cells co-labeled with Hypoxyprobe and NeuN ⁺ were similar to those in C (A, E-hypoxyprobe ⁺ ; NeuN ⁺ in Figure 3B). In contrast, in CCL5-KO mice, the number of Hypoxyprobe-labeled cells was higher than that in the control group from 1 dpi to 7 dpi (B, D- hypoxyprobe ⁺ in Figure 3B), especially in neurons co-labeled with NeuN ⁺ (B, E- hypoxyprobe ⁺ ; NeuN ⁺ in Figure 3B). This suggests that more neurons under oxidative stress can be seen in CCL5-KO mice after trauma, because the increased oxidative stress in WT mice at 1 dpi decreased to normal after 7 dpi, but not in KO mice. Therefore, CCL5 may play a key role in the balance of oxidative stress in neurons after trauma.

IV. Increased ROS production and impaired antioxidant activation in the hippocampus of CCK5-KO mice after trauma

Trauma induces NADPH oxidase activation and increases cellular ROS; O ₂ ^- generated by NADPH oxidase can be converted to H ₂ O ₂ by SOD and then cleared by the GPX system (A in FIG. 4A). Therefore, the present invention uses lucigenin to measure ROS generated by NADPH oxidase in mouse hippocampal tissue. There was no significant difference in ROS generated by NADPH oxidase in hippocampal tissue between the control group and WT mice 4 and 7 days after injury, but in CCL5-KO mice, ROS generated by NADPH oxidase increased significantly on days 4 and 7 after injury (B in FIG. 4A).

At 4 and 7 days after injury, the protein level of the antioxidant GPX1 in WT tissues was significantly increased, while the protein levels of SOD1 and SOD2 did not change (Figure 4B, A-D). In contrast, these antioxidant proteins did not increase after hippocampal injury in CCL5-KO mice. (Figure 4B, E-G); The present invention found that SOD1 protein was reduced in the CCL5-KO hippocampus after 4 and 7 dpi (Figure 4B, A, E). Further investigation of the function and activity of GPX1 between WT and CCL5-KO revealed that the rate of GSH production in CCL5-KO hippocampus tissue was lower than that in WT (Fig. 4C, A); the content of reduced GSH in CCL5-KO hippocampus tissue was also lower (Fig. 4C, B); and the mRNA expression of GPX1 in the hippocampus of CCL5-KO mice was also lower (Fig. 4C, C). The expression of GPX1 mRNA in the hippocampus of WT mice increased with the number of days after mTBI; in contrast, GPX1 was not activated in mice lacking CCL5 (Fig. 4C, D). This indicates that under normal circumstances, CCL5 reduces tissue ROS levels by increasing the antioxidant GPX1; conversely, in mice lacking CCL5, ROS accumulation in hippocampal tissue increases.

5. Both intracellular and extracellular CCL5 can protect neurons from ROS-induced cell death

The present invention further tests the protective effect of CCL5 in an in vitro culture system. When WT primary neurons express CCL5 or recombinant CCL5 protein is added to the culture medium of CCL5-KO primary neurons, cell death caused by ROS generated by H ₂ O ₂ can be reduced (Figure 5A). DCFDA was used to mark the apoptosis of CCL5-KO primary neurons caused by ROS. The number of DCFDA-labeled dead cells increased with the concentration of H ₂ O ₂ treatment, and the addition of CCL5 recombinant protein to the culture medium reduced the number of DCFDA-labeled dead cells. High doses (500 μM H ₂ O ₂ ) will kill most neurons, and the addition of CCL5 recombinant protein cannot rescue cell death (Figure 5B). In addition, by transferring the CCL5 gene into SHSY5Y cells, expressing CCL5 in large _quantities (Figure 5C, C) can also increase the survival rate of cells after _H2O2 treatment (Figure 5C, A). When cells are treated with _H2O2 , _GPX1 protein content increases; interestingly, forehead expression of CCL5 increases GPX1 protein expression, and GPX1 content further increases after _H2O2 treatment (Figure _5C , B). Direct administration of recombinant CCL5 protein (10, 100 pg/ml) to CCL5-KO primary neuron culture medium also increases GPX1 protein expression (Figure 5C, D).

6. N -acetyl cysteine (NAC), a GPX pro-promoter, reduces oxidative stress in tissues and prevents memory loss in CCL5-KO mice after mild brain injury

To further clarify the mechanism by which CCL5 protects neurons, CCL5-KO mice were given 5 mg/kg or 20 mg/kg of NAC, a pro-promoter of GPX1, by intraperitoneal injection after heavy falling TBI. Mice in the control group were injected with saline after TBI (Figure 6A). The effect of pre-injury on memory was first tested. The retention time of different groups before trauma was similar, but in the 2-day retrospective memory test, the retention time of CCL5-KO mice (KO-TBI group) given saline after trauma increased. In contrast, mice treated with NAC after trauma had a shorter retention time. In addition, the retention time of the NAC 20 mg/kg group was similar to that of the control group (Figure 6B, A). Compared with the saline-treated TBI group, 5 mg/kg and 20 mg/kg NAC treatment significantly improved new learning and memory training at 4 dpi (Figure 6B, B); 20 mg/kg NAC also significantly improved short-term recall memory (Figure 6B, C). The ROS content in the hippocampal tissue was also reduced in the 5 mg/kg and 20 mg/kg NAC-treated groups (Figure 6B, D). The number of neurons (hypoxyprobe ⁺ and NeuN ⁺ cells) under oxidative stress in the hippocampus of mice treated with NAC after trauma was also reduced (Figure 6C, A, B). In addition, the expression of GPX1 mRNA in the hippocampus of mice was increased after NAC treatment (Figure 6C, C).

VII. CCL5 increases GPX1 mRNA transcription, reduces tissue ROS, and prevents memory loss in CCL5-KO mice after mild brain injury

In vivo treatment experiments were performed using recombinant CCL5 protein. After heavy falling brain trauma, mice were given CCL5 recombinant protein via the intranasal (in) route, and the recombinant protein was able to enter the mouse ventricle via the rostral migratory stream. CCL5 recombinant protein was first co-labeled with Alexa-594 dye to track the distribution of the recombinant protein into the brain after intranasal (in) administration (B in Figure 7A), and mice were given PBS as a control group (A in Figure 7A). The study design is shown in Figure 7B, similar to the NAC study. The retention time before trauma was similar in different groups. In the 2-day retrieval memory test, the retention time of PBS-treated brain-injured KO mice (KO-TBI + PBS group) increased due to brain injury, while mice receiving CCL5 recombinant protein showed a shorter retention period and was similar to that before injury (Figure 7C, A). Compared with the PBS-treated brain-injured group, the CCL5 recombinant protein-treated group performed significantly better in new learning and memory training (Figure 7C, B); the short-term memory retrieval test was also improved (Figure 7C, C). Treatment with recombinant CCL5 significantly reduced the level of ROS in hippocampal tissue (D in Figure 7C); the number of neurons (hypoxyprobe ⁺ and NeuN ⁺ cells) exposed to oxidative stress in the hippocampus of mice treated with recombinant CCL5 after trauma was also reduced (A and B in Figure 7D). Importantly, administration of CCL5 also significantly increased the mRNA expression of GPX1 in the hippocampus of mice after trauma (C in Figure 7D).

In conclusion, the present invention shows that CCL5 is essential for the activation of the antioxidant GPX1, which can reduce H ₂ O ₂ produced by NADPH oxidase and protect hippocampal neurons after mTBI. Neurons lacking CCL5 produce more hydroxyl radicals, which may damage neurons through the Fenton reaction.

The present invention identifies a novel function of CCL5 in activating the antioxidant GPX-1 and protecting neurons from oxidative damage after mild brain trauma. This function of CCL5 can further reduce astrocyte proliferation, ROS generated by NADPH oxidase, neuronal pathological death and significant memory impairment after mild brain trauma.

The GPX enzyme family is key to converting _H2O2 into harmless _H2O and _O2 . 4-7 days after _WT hippocampal tissue injury, the levels of GPX1 protein and CCL5 increased (D in Figure 4B). It was further found that the high expression of CCL5 in SHSY5Y cells and the administration of additional CCL5 recombinant protein to primary neurons, as well as the delivery of CCL5 recombinant protein to the brain of CCL5-KO mice, increased the expression of GPX1 protein. Continuous administration of the GPX prodrug NAC to mice for 3 days after trauma reduced neuronal oxidative stress and damage. Giving mice CCL5 recombinant protein to the mouse brain once within 1 hour after trauma can also reduce oxidative stress and neuronal death in hippocampal tissue. Giving mice NAC and CCL5 both improved hippocampal memory and cognitive function. Therefore, the data of the present invention strongly support the role of CCL5 and GPX1 in anti-oxidative stress and neuroprotection after brain injury, especially the critical time is 1 hour to 3 days after trauma.

The present invention found that immune trend factors were activated after brain injury in WT mice, especially IL-10 was increased, but not in CCL5-KO mice after brain injury. This immune inflammatory response decreased after 7 days, and the behavioral performance of the animals also improved. Although the expression of immune inflammatory response trends in the hippocampus of CCL5-KO mice was lower in the first 7 days, there was more oxidative stress damage; especially 7-14 days after brain injury, the inflammation of CCL5-KO mice increased. These data indicate the importance of the balance between oxidative stress (OS) and inflammatory response, especially from 1 hour to the first 3 days after brain injury, which determines the direction of subsequent neuronal repair. In conclusion, CCL5 plays an important role in regulating oxidative stress and immune response after brain injury.

Therefore, the regulation and activation of CCL5 may be related to the progression and status of brain injury. This study found that CCL5-KO mice had more astrocyte proliferation, oxidative stress and neuronal loss in the hippocampus one month after mild brain injury. Neurons cultured in CCL5-KO mice were more sensitive to _{H2O2 -} induced oxidative stress and prone to death, but when _{the H2O2} concentration was higher than 500 μM, the protective effect of CCL5 was reduced.

Most brain injuries are mild and repetitive, such as traffic accidents, American football, hockey, and bombings during war. In the mild TBI model of the present invention, the protective dose of CCL5 was less than 500 pg/ml, and the CCL5 content in hippocampal tissue and blood was almost not increased; severe TBI may induce the release of higher levels of CCL5, exceeding 1000 pg/ml, which may activate different cell signaling and functions. This also suggests that when the injury is more severe, the role and mechanism of CCL5 in brain injury are very different. This dichotomy may involve different dose-related neuroimmune effects.

Understanding how to treat mild brain injury is crucial and urgent. According to the present invention, injuries of different severity may have different mechanisms of neuronal damage and require different treatments in the clinic. However, the present invention found that the first 1 hour to 3 days after trauma is the key for CCL5 and NAC-antioxidant activation and treatment of mild brain injury.

In conclusion, CCL5 has a unique function in antioxidant GPX-1 activation, which can reduce cellular ROS and inflammation-induced astrocytosis after mild brain injury, and this function can reduce further neuronal degeneration and memory impairment after mild brain injury.

The above description is only the preferred feasible embodiment of the present invention, and does not limit the patent scope of the present invention. All equivalent structural changes made by using the contents of the description and drawings of the present invention are also included in the scope of the present invention.

without.

Figure 1A shows the duration of unconsciousness and mNSS score of WT and CCL5-KO mice after mTBI of the present invention. (A) The duration of unconsciousness of WT and CCL5-KO control groups and mTBI groups caused by heavy objects falling. (B) The modified neurological deficit score (mNSS) was performed 1 day after injury. (*p<0.05;**p<0.01;***p<0.001. ns: no significant difference. Data were analyzed by t test and expressed as mean ± SEM). Figure 1B shows the memory impairment and recovery of WT and CCL5-KO mice after mTBI of the present invention. (A) Timetable for inducing mild TBI and memory cognition experimental design - novel object recognition test (NOR) and Bards maze (BM). (B) Preference index for novel objects in control and mTBI groups of WT and CCL5-KO mice after mild TBI induced by heavy drop. Tests were performed on days 4, 7, 14, and 28 after injury. (a: p < 0.05, aa: p < 0.01, aaa: p < 0.001, compared with control group by t test; b: p < 0.05, WT 28 days compared with 7 days; *: p < 0.05, WT and CCL5-KO were tested by t test at the same time point). (C) Walking distance of WT and KO mice. (ns: not significantly different), data are shown as mean ± SEM (n = 9 per group). The Bards maze uses the light-phobia of mice to test spatial memory behavior. The time required for mice to be released from the center of the maze and find the escape box is defined as the retention period. Figure 1C shows the memory impairment and recovery of WT and CCL5-KO mice of the present invention after mTBI. (A, B) Mice were trained in the Bards maze once before the injury, and a short-term memory recall test (short-term, SM) was performed 2 days after the training, and a long-term memory recall test (long-term, LM) was performed 7 days later. It can be seen that there is no difference between the groups of mice. After that, mTBI was induced by the fall of a heavy object, and a recall memory test was performed two days later. It can be seen that the retention time of the mTBI group was prolonged. (C, D) New learning and memory tests were performed 4 and 28 days after injury. There was no significant difference between the WT mouse mTBI group and the control group in the learning and memory tests 4 and 28 days after injury. However, the retention period of the mTBI group of CCL5-KO mice in both new learning and memory tests was significantly increased. Data were analyzed by two-way ANOVA and presented as mean ± SEM (D panel *, p = 0.0432, compared with CCL5-KO-TBI 4 dpi BM in C panel, by two-way ANOVA; D panel CCL5-KO-TBI 4 dpi compared with CCL5-KO-TBI 4 dpi in C panel, p = 0.0353 by t test) (n = 5 in each group). Figure 1D shows spatial memory performance in Bards maze of WT and CCL5-KO mice after mTBI. (A, B, E, F) Representative walking tracks in Bards maze of WT and CCL5-KO control and mTBI groups 11 days after injury. Retention period and walking distance of WT (C, D) and CCL5-KO (G, H) control and mTBI groups at 11 and 16 dpi. (Data were analyzed by t-test and presented as mean ± SEM). Figure 2A shows neuronal damage and neuron number in hippocampus 28 days after injury. (A) Representative images of FJC labeling (green) in WT and CCL5-KO hippocampus. (C) Quantification of FJC-positive cells in control and mTBI groups of WT and CCL5 KO mice. Increased FJC-positive neurons were found in both mTBI groups, and more neurons were damaged in the CCL5-KO mouse mTBI group than in the WT mouse mTBI group. (n = 3-5 per group). (B) Representative images of NeuN-labeled (red) neurons in the hippocampus of WT and CCL5-KO mice. (D) Quantification of NeuN-positive cells in different groups. The number of NeuN-positive neurons was significantly reduced in the CCL5-KO mTBI group. (Data were analyzed by t-test and expressed as mean ± SEM) (n = 3-5). Scale bar = 100 μm. Figure 2B shows the activation of immune cells and immunoglobulins in the hippocampus of mice after brain injury. (A) Astrocytes were labeled by GFAP staining (green) in control and mTBI WT and CCL5-KO mice. (C) Quantification of GFAP-labeled cells in 3-4 mice per group. (B) Immunostaining of microglia using the specific marker Iba1 (red). (D) Quantification of Iba1-positive cells in 2-3 mice per group. DAPI marked the cell nuclei in blue in A and B. Scale bar = 100 μm. mRNA expression of inflammatory factors TNF-α (E), IL-1β (F), and IL-10 in the hippocampus of WT and CCL5-KO mice after brain injury. (*, p<0.05; **, p<0.01; ***, p<0.001. Data were analyzed by t-test and expressed as mean ± SEM). Figure 3A shows the content of CCL5 in the hippocampal tissue and serum after trauma in WT mice. The concentration of CCL5 in the hippocampal tissue (A) and serum (B) of mice in the control group at 4, 7, 14 and 28 days after mTBI in mice was analyzed by ELISA. (Data were analyzed by t-test between the control group and the post-traumatic group). Figure 3B shows that hypoxic cells labeled with Hypoxyprobe are co-labeled with NeuN-stained positive neurons in WT and CCL5-KO mice at 1 day and 7 days after trauma. Hypoxic cells were labeled with Hypoxyprobe (green) and neurons were labeled with NeuN (red) in WT and CCL5-KO mice at 1 dpi, 7 dpi, and control groups. (AB) Representative images of hypoxylprobe and NeuN labeling in the hippocampal region of WT and CCL5-KO mice. (CE) Quantification of NeuN-positive cells (NeuN+, C), hypoxyprobe-positive cells (hypoxyprobe+, D), and cells positive for both Hypoxyprobe and NeuN (hypoxyprobe+NeuN+, E) in WT and CCL5-KO mice at 1 dpi, 7 dpi, and control groups. (Data were analyzed by t-test and expressed as mean ± SEM) (n = 3 per group). Scale bar = 100 μm. Figure 3C shows double staining with NeuN or GFAP in mouse hippocampus with Hypoxyprobe. (AB) Hypoxic cells in mouse hippocampus were labeled with Hypoxyprobe (green) and co-stained with NeuN (red) in (A) or GFAP (red) in (B). DAPI (blue) marks the nucleus. Scale bar = 100 μm. Figure 4A shows (A) Brain trauma induces cellular ROS generation and related antioxidants in the scavenger pathway. (B) ROS generated by NADPH oxidase in mouse hippocampal tissues were measured at 4 dpi and 7 dpi in WT and CCL5-KO mice compared with control groups. (Data were analyzed by t-test and expressed as mean ± SEM); (n = 6 per group). Figure 4B shows the analysis of the protein content of antioxidants SOD1, SOD2, and GPX1 in the hippocampus of mice at 4 dpi and 7 dpi and control groups. (A) Representative images of protein transfer of SOD1, SOD2, and GPX1 in WT mice and CCL5-KO mice. Quantitative results of SOD1 (B, E), SOD2 (C, F), and GPX1 (D, G) protein expression in WT mice and CCL5-KO mice. (Data were analyzed by One-way ANOVA analysis and expressed as mean ± SEM) (n = 5 per group). Figure 4C (A, B) shows that GSH activity and reduced form of GSH content were lower in CCL5-KO mice compared with WT mice. (A) Data were analyzed by Two-way ANOVA analysis, (B) analyzed by t test, and data are expressed as mean ± SEM. (C) Quantitative PCR of GPX1 gene expression in WT and CCL5-KO mice. (D) Quantitative PCR of GPX1 gene expression in WT and CCL5-KO mice at 4 dpi, 7 dpi and control groups. (Data were analyzed by t test and expressed as mean ± SEM). Figure 5A shows the effect of CCL5 on cell survival after H ₂ O ₂ treatment. (A, B) WT and CCL5-KO cultured primary cortical neurons were treated with CCL5 (10 pg/ml, 50 pg/ml, 100 pg/ml and 250 pg/ml) for 30 minutes and then treated with H ₂ O ₂ (0, 25, 250 and 500 μM). Cell viability was detected by MTT assay after 24 hours (data were analyzed by two-way ANOVA and expressed as mean ± SEM) (n = 5). Figure 5B shows representative images of DCFDA staining (green) and neuronal marker Tuj-1 (red) in CCL5-KO primary cortical neurons treated with CCL5 and H ₂ O ₂ for 24 hours. The bar graph below is the quantification of DCFDA-labeled neurons after CCL5 and H ₂ O ₂ treatment. (Data were analyzed by t-test and expressed as mean ± SEM) (n = 3 per group). Scale bar = 100 μm. (A, B) in Figure 5C are SHSY5Y cells treated with 0, 25, 100, 250 μM H ₂ O ₂ for 24 hours after transfection with EGFP or CCL5 plasmid. (A) The survival rate of EGFP and CCL5 expressing cells was measured by MTT method. (Data were analyzed by t test and expressed as mean ± SEM, N = 3-4); (B) GPX1 and Actin protein transfer results in SHSY5Y cells expressing EGFP and CCL5 after H ₂ O ₂ treatment, and the quantification of GPX1 protein is shown below the protein transfer graph; (C) CCL5 gene expression level after transfection with EGFP or CCL5 plasmid. (D) GPX1 protein content in primary cultured neurons after CCL5 recombinant protein treatment. (Data are expressed as mean ± SEM, N = 3-4). Figure 6A shows the experimental design of intraperitoneal administration of NAC treatment to CCL5-KO mice after inducing mild TBI and Bards maze test. Figure 6B shows that NAC treatment improves memory impairment in CCL5-KO mice after mTBI. (A) Retention period of long-term memory recall (LM) in KO mice before injury, and recall memory test after control, mTBI, and mTBI plus different doses of NAC treatment (5 mg, 20 mg) 2 days after heavy object drop injury. (B) Progress of NeoBards maze learning and memory training in the four groups of mice 4 days after injury. (C) Retention period of short-term recall memory test (SM) among the four groups. (D) ROS content generated by NADPH oxidase in hippocampal tissue of the four groups of mice. Figure 6C shows (A) hypoxyprobe-labeled neurons in the hippocampus exposed to oxidative stress in CCL5-KO mice after control, mTBI, and mTBI plus NAC treatment. (B) Quantification of hypoxyprobe- and NeuN-positive cells (hypoxyprobe+NeuN+) in different groups. (C) Expression of GPX1 mRNA in the four groups of mice 12 days after mTBI. Figure 7A shows the distribution of Alexa-594 and CCL5 antibody staining in the mouse hippocampus. (A) Mice receiving PBS were considered as the control group. (B) Recombinant CCL5 protein was first labeled with Alexa-594 and delivered intranasally to the brain of CCL5-KO mice. CCL5-specific antibodies labeled CCL5 (green) and CCL5 conjugate-Alexa-594 (red) confirmed the expression of CCL5 in the mouse hippocampus by intranasal delivery. Cell nuclei were labeled by DAPI (blue). Scale bar = 100 μm. Fig. 7B shows the experimental design of intranasal administration of CCL5 synthetic protein to CCL5-KO mice after mild TBI and subsequent Bards maze test. Fig. 7C shows (A) Memory recall test in PBS-treated and CCL5-treated (300 μg/kg) mice before and 2 days after trauma. (B) Progress of learning and memory training in the new Bards maze of the two groups of mice 4 days after trauma. (C) Retention period of short-term recall memory test (SM) in two groups of mice. (D) ROS content generated by NADPH oxidase in hippocampal tissue of mice in different groups. Figure 7D shows (A) Oxidative stress in neurons of hippocampus of CCL5-KO mice after mTBI and PBS or CCL5 treatment. (B) Quantification of hypoxyprobe and NeuN positive cells (hypoxyprobe ⁺ NeuN ⁺ ) in different groups. (C) GPX1 mRNA expression in hippocampus of mice in different groups 4 days after mTBI.

without.

Claims (7)

A composition for preparing a drug for treating traumatic brain injury, the composition comprising CCL5, for regulating the level of reactive oxygen species (ROS) in the hippocampus of the brain. The use as described in claim 1, wherein the traumatic brain injury is mild traumatic brain injury (mild TBI). The use as described in claim 2, wherein the composition is used to activate glutathione peroxidase 1 (GPX1). The use as described in claim 2, wherein the composition is used to regulate chronic inflammation of the hippocampus. The use as described in claim 2, wherein the composition is administered within 3 days after the occurrence of brain damage. The use as described in claim 5, wherein the composition is administered within 1 hour after the occurrence of brain damage. The use as described in claim 2, wherein the composition can alleviate the oxidative stress of the neurons in the traumatic brain injury and reduce the number of neurons damaged by the oxidative stress.