TWI829198B - Methods for preparing neural cells, in vitro dental pulp stem cell mixtures, pharmaceutical uses of isolated neural cells, and methods for accelerating the differentiation of dental pulp stem cells into oligodendrocytes - Google Patents

Abstract

The present invention provides a method for preparing nerve cells, which silences the expression of heat shock protein 27 gene of dental pulp stem cells and provides 3-isobutyl-1-methylxanthine to promote rapid differentiation of dental pulp stem cells into oligodendrocytes. The present invention also provides an in vitro dental pulp stem cell mixture, isolated nerve cells and their pharmaceutical uses, as well as a method for accelerating the differentiation of dental pulp stem cells into oligodendrocytes, providing a basis for the application of regenerative medicine in the treatment of multiple sclerosis, and can as a research model.

Description

Nerve cell preparation method, in vitro dental pulp stem cell mixture, isolated Pharmaceutical uses of neural cells and methods to accelerate differentiation of dental pulp stem cells into oligodendrocytes

The present invention relates to a method for preparing nerve cells, particularly a method for accelerating the differentiation of dental pulp stem cells into oligodendrocytes, and the use of isolated nerve cells for preparing drugs for treating multiple sclerosis.

Multiple sclerosis (MS) is a degenerative disease of the central nervous system, accompanied by neuronal demyelination and axonal loss. In addition, the causes of multiple sclerosis include nerve inflammation and lack of nutritional support, and immunomodulatory therapy has been the mainstream treatment method in the past decade.

Since human stem cells are totipotent and can differentiate into neurons, the potential application of regenerative medicine in the treatment of neurodegenerative diseases has been gradually explored in recent years. Since the effective differentiation of human stem cells is the first step in realizing regenerative medicine, it is necessary to develop new methods to promote the differentiation of human stem cells as a basis for the treatment of neurodegenerative diseases.

In order to achieve the above-mentioned purpose of effectively differentiating human stem cells, the present invention provides a method for preparing nerve cells, which includes: preparing a dental pulp stem cell; gene silencing step: silencing the heat shock protein 27 of the dental pulp stem cell. , HSP27) gene expression; and chemical treatment steps: treat the dental pulp stem cells with 3-isobutyl-1-methylxanthine (IBMX) to obtain the nerve cells.

The present invention silences the expression of heat shock protein 27 gene in dental pulp stem cells and provides 3-isobutyl-1-methylxanthine to promote the rapid differentiation of dental pulp stem cells into oligodendrocytes. In addition to providing regenerative medicine for the application of multiple diseases The basis of sclerosis treatment is that dental pulp stem cells are easier to obtain than stem cells from other sources, such as placental stem cells. Therefore, the preparation method of nerve cells of the present invention can also conveniently and quickly provide a research model of oligodendrocytes.

In one embodiment, the present invention specifically silences heat shock protein 27 gene expression through gene silencing technology, that is, the gene silencing step provides ribonucleic acid that silences HSP27 gene expression. Preferably, the ribonucleic acid includes small interfering RNA (siRNA), small molecule ribonucleic acid (microRNA), small hairpin ribonucleic acid (shRNA) or double-stranded RNA (dsRNA).

In one embodiment, the ribonucleic acid is transcribed from an artificial DNA sequence, and the artificial DNA sequence is the sequence shown in SEQ ID NO. 5. The present invention can use lentivirus or other vectors to deliver the DNA sequence corresponding to the ribonucleic acid that generates silent HSP27 gene expression to target cells.

In one embodiment, the gene silencing step takes 3 days to 9 days, such as: 3 days, 4 days, 5 days, 6 days, 7 days, 8 days or 9 days; preferably, the gene silencing step The duration of the steps is 5 to 7 days.

In one implementation, the chemical treatment step is from 3 hours to 24 hours, for example: 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 12 hours, 15 hours, 18 hours, 21 hours or 24 hours; preferably, the chemical treatment step is 5 hours to 7 hours.

In one embodiment, the nerve cell preparation method of the present invention first performs a gene silencing step and then performs a chemical treatment step. In other words, the preparation method of nerve cells of the present invention includes: preparation step: preparing a dental pulp stem cell; gene silencing step: silencing the heat shock protein 27 gene expression of the dental pulp stem cell to obtain gene-silenced dental pulp stem cells; and chemical treatment steps Step: Treat the gene-silenced dental pulp stem cells with 3-isobutyl-1-methylxanthine (IBMX) to obtain the nerve cells.

In one embodiment, the nerve cell preparation method of the present invention first performs a chemical treatment step and then performs a gene silencing step. In other words, the preparation method of nerve cells of the present invention includes: a preparation step: preparing a dental pulp stem cell; a chemical treatment step: treating the dental pulp stem cell with a 3-isobutyl-1-methylxanthine (3- isobutyl-1-methylxanthine (IBMX) to obtain the IBMX-treated dental pulp stem cells; and a gene silencing step: silencing the heat shock protein 27 gene expression of the IBMX-treated dental pulp stem cells to obtain the nerve cells.

The dental pulp stem cells of the present invention are in vitro dental pulp stem cells obtained after separation and purification; preferably, the in vitro dental pulp stem cells are dental pulp stem cells at the 10th to 15th passage of subculture.

In one embodiment, the dental pulp stem cells are human dental pulp stem cells.

In an embodiment, the dental pulp stem cells are cultured in a cell culture medium, and based on the cell culture medium, the concentration of IBMX is 0.05mM to 5mM, for example: 0.05mM, 0.1mM, 0.2mM, 0.3 mM, 0.4mM, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM, 1mM, 2mM, 3mM, 4mM or 5mM; preferably, the concentration of IBMX is 0.3mM to 0.5mM. Specifically, in the chemical treatment step, the dental pulp stem cells or the gene-silenced dental pulp stem cell line are cultured in a cell culture medium, and based on the cell culture medium, the concentration of IBMX is 0.05mM to 5mM. .

Preferably, the cell culture medium contains complete medium; more preferably, the cell culture medium does not contain fetal bovine serum.

In one embodiment, the marker protein of the nerve cell includes: microtubule-associated protein 2 (MAP2), glial fibrillary acidic protein (GFAP), oligodendrocyte transcription factor 2 (Oligodendrocyte transcription factor 2, Olig2), SRY-related HMG-box 10 (SOX10), myelin-related protein (Myelin- associated proteins (MBP), myelin oligodendrocyte glycoprotein (MOG), S100 calcium-binding protein B (S100B) or a combination thereof.

Preferably, the neuronal marker protein includes: glial fibrillary acidic protein, oligodendrocyte transcription factor 2, SRY-related HMG-box 10, myelin-related protein and myelin oligodendrocyte glycoprotein.

In one embodiment, the nerve cells are oligodendrocytes.

In one embodiment, the neural cells are cultured in vitro.

The present invention also provides an in vitro dental pulp stem cell mixture, which contains dental pulp stem cells and 3-isobutyl-1-methylxanthine (IBMX), and the dental pulp stem cells contain silent heat shock RNA expressing heat shock protein 27 (HSP27) gene.

In one embodiment, the ribonucleic acid expressed by the silent heat shock protein 27 gene is an artificial sequence, that is, it is different from the sequence of the mRNA expressed by the silent heat shock protein 27 gene in the human body.

The present invention also provides an isolated nerve cell, which is obtained by treating a dental pulp stem cell with 3-isobutyl-1-methylxanthine (IBMX), wherein the dental pulp stem cell Heat shock protein 27 (HSP27) of myeloid stem cells has silent effector function.

Said "the heat shock protein 27 of the dental pulp stem cells is silent in effector function" means that the expression of heat shock protein 27 in the dental pulp stem cells is in a silent state. For example, these silent states are caused by ribose silencing HSP27 gene expression. The role of nucleic acids.

In one embodiment, the heat shock protein 27 expression level of the dental pulp stem cells is 1% to 50% of normal dental pulp stem cells, such as: 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50%; preferably, the heat shock protein 27 expression level of the dental pulp stem cells is 17% to 23% of that of normal dental pulp stem cells.

The "isolated nerve cells" are the same as the "nerve cells" in the method for preparing nerve cells of the present invention.

The present invention also provides a use of the above-mentioned isolated nerve cells for preparing drugs for treating multiple sclerosis.

The present invention also provides a method for accelerating the differentiation of dental pulp stem cells into oligodendrocytes, including: preparing a dental pulp stem cell; gene silencing step: silencing heat shock protein 27 (HSP27) of the dental pulp stem cell. ) gene expression; and chemical treatment steps: treating the dental pulp stem cells with 3-isobutyl-1-methylxanthine (IBMX) to obtain the oligodendrocytes; wherein, The gene silencing step provides ribonucleic acid that silences HSP27 gene expression, and the ribonucleic acid includes small interfering ribonucleic acid, small molecule ribonucleic acid, small hairpin ribonucleic acid or double-stranded ribonucleic acid; the time of the gene silencing step is from 3 days to 9 days; the chemical treatment step is 3 hours to 24 hours; and the dental pulp stem cells are cultured in a cell culture medium, and based on the cell culture medium, the concentration of IBMX is 0.05mM to 5mM.

In summary, since damage to oligodendrocyte precursor cells is an early symptom of multiple sclerosis, the present invention quickly induces oligodendrocytes and provides a basis for dental pulp stem cells to be used to treat multiple sclerosis. In addition, the present invention combines gene silencing technology and IBMX to obtain oligodendrocytes in a short time, providing a method to quickly obtain a research model of oligodendrocytes, and is conducive to the development of regenerative medicine in the treatment of multiple sclerosis. and clinical applications.

Figures 1A and 1B are photos of the differentiation results of the cells obtained in the control group; Figures 1C and 1D are photos of the differentiation results of the cells obtained in Example 1.

Figures 2A to 2F are immunofluorescent staining photos and cell appearance photos of the cells obtained in Example 1.

Figure 3 is an immunofluorescence staining photo of cells obtained in Comparative Example 1 and a photo of cell appearance.

Figure 4 is an immunofluorescence staining photo of the cells obtained in Comparative Example 2 and a photo of the cell appearance.

Figure 5 is a bar graph showing the relative cell proportions of GFAP-positive cells containing S100B, Olig2, SOX10, MBP and MOG protein markers obtained in Example 1.

Several operating modes are provided below to illustrate the implementation of the present invention; those skilled in the art can easily understand the advantages and effects achieved by the present invention through the content of this description, and can perform various operations without departing from the spirit of the present invention. Modifications and changes to implement or apply the contents of the present invention.

Preparation Example 1: Human dental pulp stem cells

Human dental pulp stem cells (DPSCs) were detected by flow cytometry (PT-5025; Lonza Group, Switzerland) to detect CD105 ⁺ , CD166 ⁺ , CD29 ⁺ , CD90 + , CD73 ^{+ ,} CD133 ^- , CD34 ^- and CD45 ^- was screened and cultured in α-MEM medium (Minimum essential medium), and the α-MEM medium was supplemented with 10% fetal calf serum (catalog number: SH30070.03, Thermo Fisher Scientific, USA) and 100U/ml penicillin. , 100 mg/ml streptomycin (catalog number: SV30010, Thermo Fisher Scientific, USA) and 4 μg/ml L-ascorbic acid (catalog number: A8962, Merck KGaA, Germany). All cells were placed in humidified air containing 5% carbon dioxide, and the temperature was maintained at 37°C. In order to ensure that human dental pulp stem cells have differentiation ability, the present invention uses subculture of human dental pulp stem cells from the 10th to 15th generation.

Experiment 1: Experiment on inducing differentiation of human dental pulp stem cells

(1) This experiment includes Example 1 and a control group, and both use gene silencing technology and chemically induced differentiation methods.

(2) Gene silencing technology:

Gene silencing technology provides shRNA that knocks out HSP27 to silence the gene expression of HSP27, and then infects human dental pulp stem cells with lentivirus containing the shRNA that silences HSP27, and then culture the infected human dental pulp stem cells for 6 days; among them, shLUC (Table of Contents) No.: TRCN72249, Academia Sinica, Taiwan) is an shRNA using pLKO.1-puro plasmid structure to silence luciferase and serves as the control group; the shRNA to silence HSP27 is shHSP27 (Catalog No.: TRCN8753, Academia Sinica, Taiwan) ), and shHSP27 is a transgenic synthetic sequence located on a DNA vector. The transgenic synthetic sequence is CCGATGAGACTGCCGCCAAGT (i.e. SEQ ID NO. 5), and will generate shRNA to silence the expression of the HSP27 gene after infecting human dental pulp stem cells; Among them, shLUC, shHSP27 and the lentivirus containing the shLUC and shHSP27 were purchased from the RNAiCore core facility of Academia Sinica. Finally, puromycin (2 μg/ml, catalog number: 101-58-58-2, Taiwan) was used to select human dental pulp stem cells that could stably express the target shRNA (i.e., shLUC and shHSP27).

In addition, in order to confirm the silencing effect of shHSP27, in this experiment, 6 days after infecting human dental pulp stem cells with lentivirus containing shLUC and shHSP27, TRI reagent (catalog number: T9424, Merck KGaA) was used to obtain the total cellular RNA of the respective cells. , and then quantified using NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). Subsequently, the SuperScript III first-strand synthesis system (Invitrogen, USA) was used to prepare complementary DNA from 4 μg of sample RNA, and the primers shown in Table 1, universal TaqMan probes and TaqMan Master Mix (Roche Diagnostics GmbH, Germany) were used Real-time polymerase chain reaction was used to measure the expression level of HSP27 mRNA and to perform relative quantification of HSP27 expression. Finally, quantitative data were obtained using LightCycler software (v.4.05, Roche Diagnostics GmbH) and normalized by the mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in each sample.

The experimental results showed that the relative expression of HSP27 in human dental pulp stem cells 6 days after infection with shHSP27-containing lentivirus was 0.2 times that of shLUC, indicating that shHSP27 indeed has the effect of silencing HSP27 expression.

(3) Chemical static induction differentiation method:

The chemical static induction differentiation method is to add 0.4mM 3-isobutyl-1-methylxanthine (IBMX) to human dental pulp stem cells that can stably express the target shRNA after the gene silencing treatment is completed. ) and complete culture medium without fetal calf serum for 6 hours respectively. Finally, 6 days after human dental pulp stem cells were infected with lentivirus containing target shRNA in Example 1 and the control group, and then treated with chemical static induction differentiation method for 6 hours, the results are shown in Figures 1A to 1D.

(4) Results: Figure 1A and Figure 1B are the induced differentiation results of the control group, and Figure 1B is an enlarged view of the box in Figure 1A; Figure 1C and Figure 1D are the induced differentiation results of Example 1, and Figure 1D is Figure 1C The middle box is an enlarged view, and the arrows in Figure 1D are used to indicate the dendritic structure of the resulting cells. From the comparison between Figure 1B and Figure 1D, it can be seen that the number of dendritic structures in Figure 1D is significantly larger. It can be seen that silencing the gene expression of HSP27 and providing IBMX can effectively induce human dental pulp stem cells to form dendritic structures.

Experiment 2: Analysis of differentiation of human dental pulp stem cells (1)

This experiment uses immunofluorescent staining analysis, and the Example 1 of this experiment is the same as Example 1 of Experiment 1: After infecting human dental pulp stem cells with shHSP27-containing lentivirus for 6 days, 0.4mM IBMX and fetal bovine-free Serum complete medium was cultured for 6 hours. The marker proteins based on neurons include Microtubule-associated protein 2 (MAP2); and the marker proteins of stellate cells include glial fibrillary acidic protein (GFAP). Therefore, this experiment is based on The cells obtained in Example 1 were immunofluorescently stained with the corresponding primary antibodies to confirm what kind of nerve cells the human dental pulp stem cells differentiated into. The steps were as follows: cells obtained in Example 1 were treated with 4% paraformaldehyde at room temperature. Fix for 10 minutes, and permeabilize the cells with 0.1% immunostaining permeabilization solution (Triton X-100) for 5 minutes at room temperature. Then add the following primary antibodies and react overnight at 4°C: anti-MAP2 antibody (1:200 , catalog number: AB5622, Merck KGaA) and anti-GFAP antibody (1:200, catalog number: MAB3402, Merck KGaA). Subsequently, cells treated with primary antibodies were reacted with secondary antibodies labeled with AlexaFluor 488 or Cy3 for 1 hour at room temperature, and then 4',6-diamidino-2-phenylindole (4',6-diamidino) was added. -Diamidino-2-Phenylindole, DAPI) for nuclear staining. Finally, a fluorescence microscope (OLYMPUS IX70, Olympus, Japan) was used to acquire images.

After image analysis, the cells obtained in Example 1 of this experiment contained a low proportion of MAP2-positive cells, only 6%, and a high proportion of GFAP-positive cells, as high as 44.7%. Therefore, the cells obtained in Example 1 of this experiment were preliminarily determined. They are GFAP positive and similar to stellate cells.

Experiment 3: Analysis of differentiation of human dental pulp stem cells (2)

This experiment adopts immunofluorescence staining analysis, and this experiment includes Example 1, Comparative Example 1 and Comparative Example 2; among them, Example 1 of this experiment is the same as Example 1 of Experiment 1, and human beings are infected with lentivirus containing shHSP27 After 6 days, the dental pulp stem cells were cultured for 6 hours in a complete medium supplemented with 0.4mM IBMX and without fetal bovine serum. In Comparative Example 1, human dental pulp stem cells without gene silencing treatment were used and cultured with 0.4mM IBMX and no fetal bovine serum. Complete medium containing fetal bovine serum was cultured for 6 hours; and Comparative Example 2 was performed after infecting human dental pulp stem cells with lentivirus containing shHSP27 and then waiting for 6 days without IBMX treatment.

First, the cells obtained in Example 1, Comparative Example 1 and Comparative Example 2 of this experiment were also stained with GFAP and DAPI as described in Experiment 2. Second, the marker proteins of oligodendrocytes include: oligodendrocyte transcription factor 2 (Olig2), SRY-related HMG-box 10 (SOX10), myelin-associated protein (Myelin-associated proteins (MBP) and myelin oligodendrocyte glycoprotein (MOG), so the cells obtained in Example 1 of this experiment were also immunofluorescently stained with corresponding primary antibodies, including: anti-Olig2 antibody (1 :100, catalog number: Ab109186, Abcam); anti-SOX10 antibody (1:250, catalog number: Ab155279, Abcam); anti-MBP antibody (1:1000, catalog number: Ab218011, Abcam); and anti-MOG antibody (1:1000, catalog number: Ab218011, Abcam); 1000, catalog number: Ab109746, Abcam). The staining steps are the same as in Experiment 2, and the staining results are shown in Table 2.

The cells obtained in Comparative Examples 1 and 2 of this experiment were also immunofluorescently stained for Olig2, SOX10, MBP and MOG. The antibodies used and their dilution ratios were: anti-Olig2 antibody (1:100); anti-SOX10 antibody (1:100). :25); anti-MBP antibody (1:5000); and anti-MOG antibody (1:1000). The staining steps are the same as in Experiment 2, and the staining results are shown in Table 2.

From Figure 2A to Figure 2D, it can be seen that the cells obtained in Example 1 not only have fluorescent reactions when stained with GFAP and DAPI, but also Olig2, SOX10, MBP and MOG. It can be seen that the cells obtained in Example 1 are not only GFAP-positive cells. , and belong to oligodendrocytes; in comparison, as shown in Figure 3 and Figure 4, when MBP, MOG, Olig2 and SOX10 were used as staining targets, no fluorescent reaction was obtained. It can be seen that providing shHSP27 or IBMX alone cannot promote Human dental pulp stem cells differentiate into oligodendrocytes, and a combination of shHSP27 and IBMX is required to successfully induce the differentiation of human dental pulp stem cells into oligodendrocytes.

Experiment 4: Analysis of differentiation of human dental pulp stem cells (3)

Continuing from Experiment 3, this experiment uses immunofluorescence staining analysis, and the Example 1 of this experiment is the same as Example 1 of Experiment 1: After infecting human dental pulp stem cells with lentivirus containing shHSP27 for 6 days, 0.4mM IBMX and Culture in complete medium without fetal bovine serum for 6 hours.

The marker protein of stellate cells also includes S100 calcium-binding protein B (S100B), so the cells obtained in Example 1 were further subjected to immunofluorescence staining with the corresponding primary antibody: anti-S100B antibody (1:100 , catalog number: Ab52642, Abcam). The staining steps are the same as experiment 2. Based on the fact that the GFAP-positive cells in the cells obtained in Example 1 only contained 4.9% of S100B-positive cells, no additional staining photos are provided for reference.

The staining results of S100B, Olig2, SOX10, MBP and MOG were analyzed with SPSS software (v.20, SPSS IBM, USA), and single-factor independent variance analysis and Ponferroni multiple comparison were used for multiple group comparisons. The data obtained from each independently conducted experiment are presented as the mean ± standard deviation, and p < 0.05 is considered a significant difference. The results are shown in Figure 5.

As can be seen from Figure 5, the relative number of cells expressing the S100B marker is only 4.9%, which is significantly lower than 25.8% of Olig2, 11.0% of SOX10, 11.6% of MBP, and 18.0% of MOG. Therefore, the combination of shHSP27 and IBMX can indeed Specifically and quietly induce human dental pulp stem cells to become oligodendrocytes.

In summary, based on the fact that damage to oligodendrocyte precursor cells is an early symptom of multiple sclerosis, the present invention successfully derives oligodendrocytes quietly and provides a basis for the use of human dental pulp stem cells in the treatment of multiple sclerosis, especially MBP. and MOG are both myelin-related proteins, showing that the combined use of shHSP27 and IBMX can indeed promote human dental pulp stem cells to form myelin, and can be used to treat multiple sclerosis with demyelinating diseases, and has clinical application value. Finally, the present invention can obtain oligodendrocytes within 7 days by combining shHSP27 and IBMX, and can also quickly provide a research model of oligodendrocytes, which is beneficial to the development of regenerative medicine in the treatment of multiple sclerosis.

<110> Cathay Medical Foundation Cathay General Hospital

<120> Methods for preparing nerve cells, in vitro dental pulp stem cell mixtures, pharmaceutical uses of isolated nerve cells, and methods for accelerating the differentiation of dental pulp stem cells into oligodendrocytes

<130> P129075

<140> TW111122351

<141> 2022-06-16

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of HSP27 reverse transcription

<400> 1

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer for HSP27 reverse transcription

<400> 2

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of GAPDH reverse transcription

<400> 3

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer for GAPDH reverse transcription

<400> 4

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Transgenic synthetic sequence to generate shRNA that silences HSP27 gene

<400> 5

Claims (9)

A method for preparing nerve cells, including: preparation step: preparing a dental pulp stem cell; gene silencing step: silencing heat shock protein 27 (HSP27) gene expression of the dental pulp stem cell for 5 to 7 days; and chemistry Processing steps: treat the dental pulp stem cells with 3-isobutyl-1-methylxanthine (IBMX) for 5 hours to 7 hours, and culture the dental pulp stem cells in a cell culture In the liquid, and based on the cell culture medium, the concentration of IBMX is 0.3mM to 0.5mM to obtain the nerve cells; wherein the nerve cells are oligodendrocytes. The preparation method as described in claim 1, wherein the gene silencing step provides ribonucleic acid for silencing HSP27 gene expression, and the ribonucleic acid includes small interfering RNA (siRNA), small molecule ribonucleic acid (microRNA), Small hairpin RNA (shRNA) or double-stranded RNA (dsRNA). The preparation method as described in claim 2, wherein the ribonucleic acid is transcribed from an artificial DNA sequence, and the artificial DNA sequence is the sequence shown in SEQ ID NO.5. The preparation method as described in claim 1, wherein the marker protein of the nerve cell includes: microtubule-associated protein 2 (MAP2), glial fibrillary acidic protein (GFAP), oligodendrocyte Oligodendrocyte transcription factor 2 (Olig2), SRY-related HMG-box 10 (SOX10), myelin-associated proteins (MBP), myelin oligodendrocyte glycoprotein, MOG), S100 calcium-binding protein B (S100 calcium-binding protein B, S100B) or any combination thereof. An in vitro dental pulp stem cell mixture, which contains dental pulp stem cells and 3-isobutyl-1-methylxanthine (IBMX), and the dental pulp stem cells contain silent heat shock protein 27 (Heat shock protein 27, HSP27) gene expression ribonucleic acid. The in vitro dental pulp stem cell mixture of claim 5, wherein the dental pulp stem cells are cultured in a cell culture medium, and based on the cell culture medium, the concentration of IBMX is 0.05mM to 5mM. A use of isolated nerve cells for preparing drugs for the treatment of multiple sclerosis, wherein the isolated nerve cells are treated with a dental pulp stem cell and a 3-isobutyl-1-methylxanthine (3-isobutyl Obtained after treatment with -1-methylxanthine (IBMX), the heat shock protein 27 (HSP27) of the dental pulp stem cells has silent effector function, and the isolated neural cells are oligodendrocytes. The use as described in claim 7, wherein the heat shock protein 27 expression level of the dental pulp stem cells is 1% to 50% of that of normal dental pulp stem cells. A method for accelerating the differentiation of dental pulp stem cells into oligodendrocytes, including: preparing a dental pulp stem cell; gene silencing step: silencing the heat shock protein 27 (HSP27) gene expression of the dental pulp stem cell; And a chemical treatment step: treating the dental pulp stem cells with 3-isobutyl-1-methylxanthine (IBMX) to obtain the oligodendrocytes; wherein, the gene silencing step It is to provide ribonucleic acid that silences HSP27 gene expression, and the ribonucleic acid includes small interfering ribonucleic acid, small molecule ribonucleic acid, small hairpin ribonucleic acid or double-stranded ribonucleic acid; the time of the gene silencing step is 3 days to 9 days; the The chemical treatment step is from 3 hours to 24 hours; and the dental pulp stem cells are cultured in a cell culture medium, and based on the cell culture medium, the concentration of IBMX is 0.05mM to 5mM.