TWI817200B - Method for detecting genotypic variation of a target dna sequence - Google Patents

Abstract

The present invention provides a method for detecting whether the genotype of a target DNA sequence having variation, comprising: (a) providing a target DNA sequence to be detected for variant genotype; (b) providing a first probe; (c) providing a second probe; (d) removing the first probe and the second probe failed to hybridize and ligase simultaneously; and (e) detecting the variant site information of the digital magnetic beads and the label of the probes succeeded in hybridization and ligation, so as to obtain the information of the target DNA sequence having variant genotype or not.

Description

A method for detecting whether the genotype of a target DNA sequence is mutated

The present invention provides a method for detecting whether the genotype of a target DNA sequence varies, so as to obtain information on whether the genotype of the target DNA sequence varies.

Single nucleotide polymorphism (SNP) is a variation of a single base pair in the DNA sequence, that is, changes in A, T, C or G in the DNA sequence cause two or more nuclei to appear at a certain position in the sequence. Situation of possibility of glyceric acid binding. Among currently known SNPs, T (thymin) and C (gytosine) have the highest proportion of single base pair mutations, accounting for approximately two-thirds of known SNP variations. SNP is also the most common form of genetic variation in the human body. The SNP situation that occurs in everyone's DNA is different, making SNP an emerging genetic marker technology.

Therefore, through the analysis method that combines SNP with gene database, it is possible to study the relationship between SNP and human cancer; in addition, the results of SNP genetic testing are integrated with the living status, nutritional status, lifestyle and other factors of the subjects, and then through Big data data analysis can also use SNPs to predict the results of various human disease risks and traits. Therefore, how to effectively detect SNPs has become a future trend.

Currently, the known principles for SNP detection technology are mainly hybridization and polymerase chain reaction (PCR). However, the current SNP detection efficiency based on hybridization reaction or polymerase chain reaction is extremely low. They can only detect a single SNP; there are many technical limitations in the detection of multiple SNPs; and they mostly rely on the use of peptide nucleic acid (PNA) and locked nucleic acid (LNA), which significantly increases the cost of detection. Therefore, how to improve the detection efficiency of SNP and reduce its detection cost has become a major challenge.

In view of this, in order to solve the above problems, the main purpose of the present invention is to provide a method for detecting whether the genotype of a target DNA sequence is mutated, including: (a) providing a target DNA sequence with a genotype to be detected as to whether the genotype is mutated; (a) b) Provide a plurality of first probes, wherein the first probe has a first nucleotide sequence fragment complementary to the target DNA, and the first nucleotide sequence fragment has a 1st end and a 2nd end, and the first The first end of the nucleotide sequence fragment is the mutation site to be detected, and the second end of the first nucleotide sequence fragment is connected to a digital magnetic bead, and each digital magnetic bead corresponds to each first nucleotide sequence. Information on the mutation site to be detected at the first end of the fragment; (c) Provide a plurality of second probes, wherein the second probe has a second nucleotide sequence fragment complementary to the target DNA, the second nucleoside The acid sequence fragment has a 1st end and a 2nd end, the 1st end of the second nucleotide sequence fragment has a label, and the 2nd end of the second nucleotide sequence fragment has a phosphate or the first nucleotide sequence The first end of the fragment has a phosphate group, and the first nucleotide sequence fragment and the second nucleotide sequence fragment are complementary to each other at the position of the target DNA, so hybridization and ligation reactions can be carried out at the same time; (d) Removal cannot be carried out at the same time. The first probe and the second probe of the hybridization and ligation reaction; and (e) detecting the variation site information of the digital magnetic beads of the first probe and the label of the second probe in the successful hybridization and ligation reaction to obtain the target Information on whether the genotype of the DNA sequence varies or not.

According to one or more embodiments of the present invention, the first end of the first nucleotide sequence fragment is the 3' end, the second end is the 5' end, and the first end of the second nucleotide sequence fragment is the 3' end. end, the 2nd end is the 5' end and has a phosphate group.

According to one or more embodiments of the present invention, the first end of the first nucleotide sequence fragment is the 5' end, the second end is the 3' end, and the first end of the second nucleotide sequence fragment is the 5' end. The end has a phosphate group, and the second end is the 3' end.

According to one or more embodiments of the present invention, the length of the first nucleotide sequence fragment and/or the second nucleotide sequence fragment ranges from 20 to 100 bp.

According to one or more embodiments of the present invention, the length of the first nucleotide sequence fragment and/or the second nucleotide sequence fragment ranges from 50 to 100 bp.

According to one or more embodiments of the present invention, the label may be biotinylated to achieve a fluorescent biomarker.

According to one or more embodiments of the present invention, steps (a) to (c) can be performed simultaneously.

According to one or more embodiments of the present invention, the addition ratio of the first probe to the second probe is 1:1.

According to one or more embodiments of the present invention, DNA sequence genotypic variation includes point mutation, insertion mutation, deletion mutation, duplication mutation or frameshift mutation.

According to one or more embodiments of the present invention, the method for detecting whether the genotype of a target DNA sequence varies can be used to perform genotyping analysis of single nucleotide polymorphism (SNP).

Another main object of the present invention is to provide a kit for detecting whether the genotype of a target DNA sequence is mutated, including: (1) a plurality of first probes, wherein the first probe has a first nucleoside complementary to the target DNA Acid sequence fragment, the first nucleotide sequence fragment has a 1st end and a 2nd end, the 1st end of the first nucleotide sequence fragment is the mutation site to be detected, and the 1st end of the first nucleotide sequence fragment is 2 ends are connected with a digital magnetic bead, and each digital magnetic bead corresponds to the mutation site information to be detected at the first end of each first nucleotide sequence fragment; (2) a plurality of second probes, of which the second The probe has a second nucleotide sequence fragment that is complementary to the target DNA. The second nucleotide sequence fragment has a first end and a second end. The first end of the second nucleotide sequence fragment has a label, and the second nucleotide sequence fragment has a first end and a second end. The second end of the dinucleotide sequence fragment has a phosphate group or the first end of the first nucleotide sequence fragment has a phosphate group, and the first nucleotide sequence fragment and the second nucleotide sequence fragment are complementary to the target DNA The position is connected, so that hybridization and ligation reactions can be performed simultaneously; and (3) reaction reagents.

From the above, it can be seen that the present invention has the following advantages compared with the conventional SNP detection method:

1. Multi-point SNP detection can be performed simultaneously, greatly improving the SNP detection efficiency.

2. There is no need to use peptide nucleic acid (PNA) and locked nucleic acid (LNA), significantly reducing detection costs.

3. You can use various types of digital magnetic beads or design your own magnetic beads to reduce detection costs or achieve customization.

4. The method of the present invention is not limited to SNP detection, but can also be applied to the determination of genotypic variations in other DNA sequences, such as point mutations, insertion mutations, deletion mutations, rearrangement mutations or frameshift mutations, with a wide range of applications.

In order to make the technical connotation of the present invention more detailed and complete, the implementation modes and specific examples of the present invention are described below. However, the following description is not the only form of implementing or using the specific embodiments of the present invention. The necessary technical content of this invention can be easily understood through the following description, and this invention can be variously changed and modified to adapt to different uses and conditions without violating the spirit and scope thereof. In this way, other embodiments also belong to the application of this invention. patent scope.

In the terms used in this article, "a" and "the" may also be interpreted as plural unless the context otherwise requires.

In the terms used in this article, unless the context indicates otherwise, "includes", "includes", "has" or "contains" are inclusive or open-ended and do not exclude other unstated elements or method steps.

In the words used in this article, unless the context clearly indicates otherwise, "approximately" or "approximately" refers to a close or allowable error range, which is used to avoid the accuracy or absolute numerical values disclosed in the present invention being affected by unknown factors. Illegal or improper use by third parties. Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in this article are approximate values and may be changed according to needs.

The main purpose of the present invention is to provide a method for detecting whether the genotype of a target DNA sequence is mutated, including: (a) providing a target DNA sequence with a genotype to be detected as to whether the genotype is mutated; (b) providing a plurality of first probes , wherein the first probe has a first nucleotide sequence fragment complementary to the target DNA, and the first nucleotide sequence fragment has a 1st end and a 2nd end, and the 1st end of the first nucleotide sequence fragment is the mutation site to be detected, and the second end of the first nucleotide sequence fragment is connected to a digital magnetic bead, and each digital magnetic bead corresponds to the first end of each first nucleotide sequence fragment to be detected. Variation site information; (c) Provide a plurality of second probes, wherein the second probe has a second nucleotide sequence fragment complementary to the target DNA, and the second nucleotide sequence fragment has a first end and a second 2 ends, the first end of the second nucleotide sequence fragment has a label, and the second end of the second nucleotide sequence fragment has a phosphate group or the first end of the first nucleotide sequence fragment has a phosphate group , the first nucleotide sequence fragment and the second nucleotide sequence fragment are connected at positions complementary to the target DNA, so that hybridization and ligation reactions can be performed simultaneously; (d) remove the first probe that cannot perform hybridization and ligation reactions at the same time. and a second probe; and (e) detecting the variation site information of the digital magnetic beads of the first probe and the label of the second probe in the successful hybridization and ligation reaction, and obtaining whether the genotype variation of the target DNA sequence is information.

Another main object of the present invention is to provide a kit for detecting whether the genotype of a target DNA sequence is mutated, including: (1) a plurality of first probes, wherein the first probe has a first nucleoside complementary to the target DNA Acid sequence fragment, the first nucleotide sequence fragment has a 1st end and a 2nd end, the 1st end of the first nucleotide sequence fragment is the mutation site to be detected, and the 1st end of the first nucleotide sequence fragment is 2 ends are connected with a digital magnetic bead, and each digital magnetic bead corresponds to the mutation site information to be detected at the first end of each first nucleotide sequence fragment; (2) a plurality of second probes, of which the second The probe has a second nucleotide sequence fragment that is complementary to the target DNA. The second nucleotide sequence fragment has a first end and a second end. The first end of the second nucleotide sequence fragment has a label, and the second nucleotide sequence fragment has a first end and a second end. The second end of the dinucleotide sequence fragment has a phosphate group or the first end of the first nucleotide sequence fragment has a phosphate group, and the first nucleotide sequence fragment and the second nucleotide sequence fragment are complementary to the target DNA The position is connected, so that hybridization and ligation reactions can be performed simultaneously; and (3) reaction reagents.

The term "DNA sequence genotype" as used herein refers to all genotypes that make up the DNA sequence in an organism. The organisms include but are not limited to mammals and non-mammals. The aforementioned mammals include but are not limited to: humans, non-human primates, sheep, dogs, murine rodents (such as mice, rats, etc.), guinea pigs , cats, rabbits, cattle, horses; the aforementioned non-mammals include but are not limited to: chickens, amphibians and reptiles.

The term "mutation" used in this article refers to genetic mutations that occur when genes in an organism's cells undergo gene replication errors during cell division, or when genes are replicated by chemical substances, genotoxicity, radiation, viruses, etc. . The mutation may be a point mutation that changes a single base, including synonymous mutation, silent mutation, missense mutation, frameshift mutation, and no mutation. Nonsense mutation; or large mutation of multiple base changes, including deletion, rearrangement and insertion, where rearrangement mutations include duplication, inversion and translocation ( translocation).

The term "single nucleotide polymorphism" as used herein refers to the possibility of the binding of two or more nucleotides at a certain position in the sequence due to a single base pair variation in the DNA sequence, and this The probability of binding two or more nucleotides is defined as being distributed among more than 1% of individuals in a given population.

The term "genotyping analysis" used in this article refers to an analysis method that uses differences in single nucleotide polymorphisms in individuals to classify individuals according to their genotypes.

The term "probe" used herein refers to a nucleotide sequence fragment that is specifically complementary to a target DNA sequence, and the nucleotide sequence fragment has a 1st end and a 2nd end, where the 1st end It can be the mutation site to be detected (that is, its last position is designed to be complementary to the mutation site). The second end can be connected to a digital magnetic bead, and the digital magnetic bead can correspond to the nucleotide sequence fragment. The mutation site information to be detected at the first end; or the first end can be equipped with a label that can produce fluorescence through biotinylation, and the second end can be equipped with a phosphate group, which can be detected by enzymes and other methods. needle for ligation reaction. The first end can be a 3' end or a 5' end; the second end can be a 3' end or a 5' end.

The term "magnetic beads" used in this article refers to magnetic carriers with magnetism that can be separated through magnetic separation technology and have the characteristics of sensing magnetic force and moving accordingly. The magnetic carrier generally refers to particles and magnetic particles. Or thin film type and other magnetically sensitive solid phase carriers. According to one embodiment of the present invention, a magnetic carrier in the form of granules or magnetic particles is a preferred embodiment. Therefore, the magnetic carrier will be generally referred to as "magnetic beads" below, but this is not intended to limit the use of the magnetic separation system of the present invention. Magnetic beads serve as magnetic carriers.

The term "digital magnetic beads" used in this article refers to wafer magnetic beads that are etched with specific marks on the wafer for use as barcode identification. Preferably, those using semiconductor micron levels are used, and the wafer magnetic beads have There is information about the mutation site to be detected corresponding to the first end of each nucleotide sequence fragment, and the information can be scanned with visible light to confirm the mutation site it represents. According to an embodiment of the present invention, the digital magnetic beads can be DMB (Digital Molecular Barcode) produced by Wenyin Technology Co., Ltd., BMB (Barcoded Magnetic Bead) produced by Ruici Biotechnology Co., Ltd., or BoRe Biotechnology Co., Ltd. пCode produced by Technology Co., Ltd.

The term "marker" used herein refers to a highly sensitive and specific biomarker that can be biotinylated. According to an embodiment of the present invention, the label may be biotin.

The term "hybridization" as used herein refers to the complementary formation of the first nucleotide sequence fragment carried by the first probe and the second nucleotide sequence fragment carried by the second probe to the position of the target DNA. Process.

The term "connection" used herein refers to connecting the 1 end (i.e. 3' end) of the first nucleotide sequence fragment carried by the first probe to the second core carried by the second probe. The process of ligating the 2nd end of the nucleotide sequence fragment (i.e., the 5' end with the phosphate group); or the 1st end (i.e., the 1st end of the first nucleotide sequence fragment) carried by the first probe The process of ligation (ligation) between the 5' end (containing phosphate group) and the 2 end (i.e. 3' end) of the second nucleotide sequence fragment carried by the second probe.

The term "biotinylated" as used herein refers to the process of covalently attaching biotin to proteins, nucleic acids or other molecules. According to an embodiment of the present invention, the biotinylation may be a conjugation process of biotin and streptavidin (streptavidin, SA), wherein one end of the streptavidin is fluorescent.

The term "reaction reagent" used herein refers to a reaction reagent that can make the first nucleotide sequence fragment carried by the first probe and the second nucleotide sequence fragment carried by the second probe complementary to each other. A hybridization reagent for the target DNA position; and a reagent for ligation reaction between one end of the first nucleotide sequence fragment carried by the first probe and one end of the second nucleotide sequence fragment carried by the second probe.

The term "enzyme" used herein refers to the enzyme that can combine one end of the first nucleotide sequence fragment carried by the first probe with one end of the second nucleotide sequence fragment carried by the second probe. Enzymes for conjugation reactions. According to one embodiment of the present invention, the enzyme can be a DNA ligase (ligase), which can connect the tail end of the 3' end and the front end of the 5' end of the DNA by forming a phospholipid bond, wherein the DNA ligase Including but not limited to DNA ligases of types I, II, III, and IV of mammalian cells or DNA ligase (T4 DNA ligase) carried by T4 phage.

In embodiments of the present invention, the length of the first nucleotide sequence fragment of the first probe and/or the second nucleotide sequence fragment of the second probe can be 10~100bp, such as 20~100bp, 30~100bp, 40~ 100bp, 50~100bp, 60~100bp, 70~100bp, 80~100bp, 90~100bp. In a preferred embodiment, the length of the first nucleotide sequence fragment of the first probe and/or the second nucleotide sequence fragment of the second probe is 20 to 100 bp, more preferably 50 to 100 bp.

In embodiments of the present invention, the action time of the reaction reagents can be 10 to 60 minutes, such as 10 to 30 minutes, 40 to 60 minutes. In a preferred embodiment, the action time is 20 minutes.

In embodiments of the present invention, the ratio of the first probe to the second probe may be about 1~3:3~1, such as 1:1, 2:1, 3:1, 1:2, 1:3. In a preferred embodiment, the ratio of the first probe to the second probe is approximately 1:1.

In embodiments of the present invention, the volume ratio of the template to the probe can be about 1~3:3~1, such as 1:1, 2:1, 3:1, 1:2, 1:3. In a preferred embodiment, the volume ratio of the template to the probe is approximately 2:1.

Therefore, the present invention hybridizes the first probe and the second probe to the target DNA at the same time. After the two probes hybridize to the target DNA, one of the probes has a phosphate group, and the reaction reagent contains a nucleoside capable of The acid sequence fragment is an enzyme that performs the conjugation reaction, so the successfully hybridized first probe and the second probe can undergo the conjugation reaction without being removed by subsequent cleaning steps; the successfully hybridized and connected first probe carries a digital Magnetic beads, and the second probe is labeled and the label can be further amplified and generate fluorescence, so the digital magnetic beads of the first probe are scanned with visible light, and the second probe is judged by fluorescence to confirm the luminescence, and the visual experiment The fluorescence threshold is determined as a result, and exceeding the threshold means that the variant site carried by the digital magnetic beads has been detected.

The following description of the present invention means that those with ordinary knowledge in the technical field can easily understand the necessary technical content of the invention. If the invention can be variously changed and modified to adapt to different uses and conditions without violating the spirit and scope thereof, so, Other implementation aspects also fall within the patentable scope of the present invention.

Example 1 : Detect single SNP site (single SNP detection)

In this example, the genotype of the SNP site at nucleotide position 94601670 on domestic pig chromosome 6 (NCBI Reference Sequence: NC_010448.4) is detected. The wild type of this site is -type) site is A, mutation site is G, and its SNP combines three types: AA, AG and GG on this alternating locus (allele).

Preparation in advance

Design the probe according to Table 1 below.

Table 1 Probe numbers and detected SNP site types Probe number sequence Digital magnetic bead number blank probe Nucleotide sequence (digital magnetic beads without coupling oligo) 0 First probe (P1A) GCTCAGGGTCAAGGTGGAAAGGCCA (SEQ ID NO. 1) 3551 First probe (P1B) GCTCAGGGTCAAGGTGGAAAGGCCG (SEQ ID NO. 2) 4092 Second probe (P1S) GGTAGACACATGGAA (SEQ ID NO. 3) N/A

Among them, the first probe is designed based on the polymorphism type of the SNP site, so if there are two polymorphisms, the first probe can be designed as A and B; the three polymorphisms can be designed as A, B, and C. ; The four polymorphisms can be designed as A, B, C and D. Here, Embodiment 1 uses two polymorphisms as examples to design the first probe, so the first probes are designed as P1A and P1B. However, the design of the first probe is not limited to this.

The second probe is a sequence that can be connected to the first probe (P1), so the second probe is designed as P1S.

Among them, the blank probe is used as the basic value for calibrating fluorescence.

Prepare the reagents according to Table 2 below.

Table 2 Reaction reagent formula Components Content(μl) Sterile deionized water 12 10X amplification enzyme reaction buffer 2 First probe P1 (P1A+ P1B) 1 Second probe P1S 1 blank probe 1 enzyme 1 Template (PCR product) 2 total 20

Experimental steps

1. Amplify pig chromosome 6 by PCR, and control the size of the amplified PCR product fragment to be between 100-600 bp to be used as a template for detection.

2. Add reaction reagents to the PCR product, allow the template and reaction reagents to hybridize and connect at the same time for 20 minutes, and allow the first probe (P1A and P1B) and the second probe (P1S) in the reagent to hybridize with the template. ; and connecting the first probe (P1 A and P1B) and the second probe (P2S) through an enzyme to produce a digital magnetic bead-nucleic acid-fluorescent labeling product for use in fluorescence analysis.

3. Use buffer solution to remove the first probe (P1 A and P1B) that fails to hybridize to the template and the second probe (P1S) that fails to connect to the first probe P1.

4. Use a fluorescence microscope equipped with a fluorescence analysis system to detect fluorescent markers.

5. Data analysis, read the mutation site information carried by the digital magnetic beads of the first probe (P1).

6. Result judgment, determine whether the genotype of the target DNA sequence is mutated.

Experimental results

Based on the fluorescence analysis detection results of the fluorescence microscope, read the digital magnetic bead mutation site information of the first probe (P1 A and P1B) to interpret the genotype of the target DNA sequence. The experimental results are as follows in Table 3 and Figure 1 shown.

Table 3 Genotype detection results of the single SNP site at nucleotide 94601670 on chromosome 6 of domestic pigs Sample number Digital magnetic bead number Number of magnetic beads Fluorescence intensity (corrected)* Probe genotype Sample genotype 1 3551 423 1247 A A/G 4092 383 1440 G 2 3551 349 0 - GG 4092 438 1617 G 3 3551 430 1570 A AA 4092 462 0 - 4 3551 342 1732 A AA 4092 342 0 - 5 3551 352 1821 A AA 4092 453 0 - 6 3551 360 2277 A A/G 4092 466 1938 G 7 3551 405 0 - GG 4092 448 1706 G 8 3551 396 2225 A AA 4092 410 0 - *: The fluorescence intensity after correction with a blank probe is 0, indicating that no digital magnetic bead information of that specific number was detected.

In the single SNP fluorescence analysis detection photo result in Figure 1, the fluorescence signal intensity of digital magnetic bead No. 0, 3679, is averaged with the signal intensity of other digital magnetic beads No. 0, and used as the fluorescence background correction value, it can be found that The average fluorescence signal intensity of digital magnetic bead No. 3551 is 4923, which is stronger than the average fluorescence signal intensity of 3662 of magnetic bead No. 4092. It can be seen that the hybridization and ligation reaction of the first probe and the second probe of magnetic bead No. 3551 is successful; After all samples are analyzed, the DNA sequence genotypes of samples 1 to 6 can be confirmed.

Example 2 : Detect multiple SNPs site (Multiplex SNPs detection)

In this example, the genotypes of three SNP sites in domestic pigs are detected. Among them, SNP site 1 is located at the 94601670th nucleotide on chromosome 6 of domestic pigs (NCBI Reference Sequence: NC_010448.4). At the acid position, the wild-type site of this site is A, and the mutation site is G. Its SNP has three types of combinations: AA, AG and GG on the alternating locus (allele); SNP site two is located at the 50030058th nucleotide position on domestic pig chromosome 15 (NCBI Reference Sequence: NC_010457.5). The wild-type site at this site is A and the mutation site. It is C, and its SNP has three combinations of AA, AC and CC on the alternating locus (allele); SNP site three is located at nucleotide 117766407 on the domestic pig X chromosome (NCBI Reference Sequence: NC_010461.5) Position, the wild-type site of this site is A, and the mutation site is G. Its SNP has three types of combinations: AA, AG and GG on the alternating locus (allele).

This embodiment also uses two polymorphisms as examples to design the first probe as in Embodiment 1. However, the difference from Embodiment 1 is that this embodiment detects three SNP sites at the same time.

Preparation in advance

Design the probe according to Table 4 below.

Table 4 Probe numbers and detected SNP site types detection site Probe number sequence Digital magnetic bead number without blank probe Nucleotide sequence (digital magnetic beads without coupling oligo) 0 site one First probe (P1A) GCTCAGGGTCAAGGTGGAAAGGCCA (SEQ ID NO. 4) 4090 First probe (P1B) GCTCAGGGTCAAGGTGGAAAGGCCG (SEQ ID NO. 5) 4085 Second probe (P1S) GGTAGACACATGGAA (SEQ ID NO. 6) N/A site two First Probe (P2A) GGACTTGGAAATAGAGAGAATTGGA (SEQ ID NO. 7) 4075 First Probe (P2B) GGACTTGGAAATAGAGAGAATTGGC (SEQ ID NO. 8) 4055 Second Probe (P2S) AGATGTCATTTTTAT (SEQ ID NO. 9) N/A Site three First Probe (P3A) TTTCAAGCTATAATTTCTGAGTATA (SEQ ID NO. 10) 4015 First Probe (P3B) TTTCAAGCTATAATTTCTGAGTATG (SEQ ID NO. 11) 3935 Second probe (P3S) CTTGGCACTCTCTGC (SEQ ID NO. 12) N/A

Here, Example 2 takes the detection of three SNP sites as an example to design the first probe. Therefore, the first probe P1 is designed as P1A and P1B for detecting SNP site one; the first probe P2 is designed as P2A and P2B for detecting SNP site two; the first probe P3 is designed as P3A and P3B for detecting SNP site three. However, the design of the first probe is not limited to this.

In addition, a second probe is designed to detect three SNP sites. The second probe is designed such that P1S is a sequence that can be connected to the first probe P1. Therefore, the second probe P2S is a sequence that can be connected to the first probe P2. The connecting sequence\; the second probe P3S is a sequence that can be connected to the first probe P3.

Among them, the blank probe is used as the basic value for calibrating fluorescence.

Prepare the reagents according to Table 5 below.

Table 5 Reaction reagent formula Components Content (μl) Sterile deionized water 9 10X amplification enzyme reaction buffer 2 First probe P1 (P1A+ P1B) 1 Second probe P1S 1 First probe P2 (P2A+ P2B) 1 Second probe P2S 1 First probe P3 (P3A+ P3B) 1 Second probe P3S 1 enzyme 1 Template (multiplex PCR product) 2 total 20

Experimental steps

1. Amplify domestic pig chromosome 6 (NCBI Reference Sequence: NC_010448.4) using multiplex PCR, and control the amplified PCR product fragment size to be between 100-600 bp to use as a detection template.

2. Add reaction reagents to the PCR product, allow the template and reaction reagents to perform hybridization and conjugation reactions at the same time for 20 minutes, so that the first probe (P1, P2, P3) and the second probe (P1S, P2S, P2S, P3S) hybridizes with multiple templates; and the first probe (P1, P2, P3) and the second probe (P1S, P2S, P3S) are connected through enzymes to produce a digital magnetic bead-nucleic acid-fluorescent labeling product , for use as fluorescence analysis.

3. Use buffer solution to remove the first probes (P1, P2, P3) that fail to hybridize to the template and the second probes (P1S, P2S) that fail to connect to the first probes (P1, P2, P3). , P3S).

4. Use a fluorescence microscope equipped with a fluorescence analysis system to detect fluorescent markers.

5. Data analysis, read the mutation site information carried by the digital magnetic beads of the first probe (P1, P2, P3).

6. Result judgment, determine whether the genotype of the target DNA sequence is mutated.

Experimental results

Based on the fluorescence analysis detection results of the fluorescence microscope, read the digital magnetic bead mutation site information of the first probe (P1, P2, P3), and interpret the genotype of the target DNA sequence. The experimental results are as follows in Table 6 As shown in Figure 2.

Table 6 Genotype detection results of the 94601670 nucleotide multi-SNPs site on chromosome 6 of domestic pigs Sample number Digital magnetic bead number Number of magnetic beads Fluorescence intensity (corrected)* Probe genotype Sample genotype 1 4090 303 1783 A A/G 4085 352 1789 G 4075 355 1278 A AA 4055 342 0 - 4015 345 0 - GG 3935 491 1864 G 2 4090 437 0 - GG 4085 383 1987 G 4075 455 1163 A AA 4055 334 0 - 4015 420 1648 A AG 3935 439 1761 G 3 4090 324 1781 A AG 4085 462 1725 G 4075 468 1314 A AG 4055 389 1631 G 4015 388 1897 A AA 3935 329 0 - 4 4090 306 1879 A AG 4085 380 1720 G 4075 489 1348 A AA 4055 475 0 - 4015 475 0 - GG 3935 315 1419 G 5 4090 405 1650 A AG 4085 451 1820 G 4075 460 1789 A AC 4055 499 1605 G 4015 448 1685 A AG 3935 425 1330 G *: The fluorescence intensity after correction with a blank probe is 0, indicating that no digital magnetic bead information of that specific number was detected.

Figure 2 is a photo of fluorescence analysis and detection of multiple SNPs sites in sample 5 of this embodiment. The fluorescence signal intensity of the blank probe (digital magnetic bead number 0, only shown in Figure 2) is 3627, and After averaging the signal intensities of other digital bead numbers 0 and using them as fluorescence background correction values, it can be found that the fluorescence signal intensities of digital bead numbers 4075, 4055, 3935, and 4015 are stronger, so it can be known that the number of these numbered beads is The hybridization and ligation reaction between one probe and the second probe was successful; the other digital magnetic bead number 4090 has an average fluorescence signal intensity of 5292, which is closer to the background value. It can be seen that the hybridization and ligation reaction of the probe and the reaction between the template It is poor, so it can be used as a reference to determine the genotype, so that the genotype of the DNA sequence of samples 1 to 5 can be confirmed.

In summary, compared with the conventional SNP detection methods, the present invention can detect multiple SNPs at the same time, greatly improving the detection efficiency of SNP; and does not require the use of peptide nucleic acid (PNA) and locked nucleic acid (Locked). nucleic acid, LNA), greatly reducing detection costs; in addition, various types of digital magnetic beads can also be used or self-designed magnetic beads can be used to reduce detection costs or achieve customization; in addition, the method of the present invention is not limited to SNP detection , and can also be applied to the determination of genotypic variation in other DNA sequences, such as point mutations, insertion mutations, deletion mutations, rearrangement mutations or frameshift mutations, with a wide range of applications.

The present invention has been described in detail above, but what is described above is only one of the preferred implementation modes and examples of the present invention, and is not intended to limit the scope of the present invention. That is, any person with common knowledge in the technical field However, equivalent changes and modifications that can be made without departing from the spirit and scope of the invention still fall within the protection scope of the invention.

without

Figure 1 is a photo of a single SNP site detected by fluorescence analysis.

Figure 2 is a photo of fluorescence analysis detection of multiple SNPs sites.

without.

                                  sequence list
          <![CDATA[<110> Chinese Culture University]]>
          <![CDATA[<120> A method to detect whether the target DNA sequence genotype is mutated]]>
          <![CDATA[<160> 12 ]]>
          <![CDATA[<170> PatentIn version 3.5]]>
          <![CDATA[<210> 1]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 1]]>
          gctcagggtc aaggtggaaa ggcca 25
          <![CDATA[<210> 2]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 2]]>
          gctcagggtc aaggtggaaa ggccg 25
          <![CDATA[<210> 3]]>
          <![CDATA[<211> 15]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(15)]]>
          <![CDATA[<400> 3]]>
          ggtagacaca tggaa 15
          <![CDATA[<210> 4]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 4]]>
          gctcagggtc aaggtggaaa ggcca 25
          <![CDATA[<210> 5]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 5]]>
          gctcagggtc aaggtggaaa ggccg 25
          <![CDATA[<210> 6]]>
          <![CDATA[<211> 15]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(15)]]>
          <![CDATA[<400> 6]]>
          ggtagacaca tggaa 15
          <![CDATA[<210> 7]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 7]]>
          ggacttggaa atagagagaa ttgga 25
          <![CDATA[<210> 8]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 8]]>
          ggacttggaa atagagagaa ttggc 25
          <![CDATA[<210> 9]]>
          <![CDATA[<211> 15]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(15)]]>
          <![CDATA[<400> 9]]>
          agatgtcatttttat 15
          <![CDATA[<210> 10]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 10]]>
          tttcaagcta taatttctga gtata 25
          <![CDATA[<210> 11]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(25)]]>
          <![CDATA[<400> 11]]>
          tttcaagcta taatttctga gtatg 25
          <![CDATA[<210> 12]]>
          <![CDATA[<211> 15]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220>]]>
          <![CDATA[<223> probe]]>
          <![CDATA[<220>]]>
          <![CDATA[<221> Unknown_Characteristics]]>
          <![CDATA[<222> (1)..(15)]]>
          <![CDATA[<400> 12]]>
          cttggcactc tctgc 15
          
      

Claims (11)

A method for detecting whether the genotype of a target DNA sequence is mutated, including: (a) providing the target DNA sequence, which has a genotype to be detected as to whether the genotype is mutated; (b) providing a plurality of first probes, wherein The first probe has a first nucleotide sequence fragment that is complementary to the target DNA. The first nucleotide sequence fragment has a first end and a second end. The first nucleotide sequence fragment of the first nucleotide sequence fragment has a first end and a second end. The end is the mutation site to be detected, and the second end of the first nucleotide sequence fragment is connected to a digital magnetic bead, and each digital magnetic bead corresponds to the first end of each first nucleotide sequence fragment. Information on the mutation site to be detected; (c) providing a plurality of second probes, wherein the second probe has a second nucleotide sequence fragment that is complementary to the target DNA, and the second nucleotide sequence fragment Having a 1st end and a 2nd end, the 1st end of the second nucleotide sequence fragment has a label, and the 2nd end of the second nucleotide sequence fragment has a phosphate group or the first nucleoside The first end of the acid sequence fragment has a phosphate group, and the first nucleotide sequence fragment and the second nucleotide sequence fragment are complementary to the position of the target DNA, so that hybridization and ligation reactions can be performed at the same time; (d) removal The first probe and the second probe that cannot perform hybridization and ligation reactions at the same time; and (e) detect the variation site information of the first probe and the second probe’s digital magnetic beads that successfully hybridize and ligate the reaction. Mark to obtain information on whether the genotype of the target DNA sequence varies or not. The method of claim 1, wherein the first end of the first nucleotide sequence fragment is the 3' end, the second end of the first nucleotide sequence fragment is the 5' end, and wherein the second core The first end of the nucleotide sequence fragment is the 3' end, and the second end of the second nucleotide sequence fragment is the 5' end and contains a phosphate group. The method of claim 1, wherein the first end of the first nucleotide sequence fragment is the 5' end, the second end of the first nucleotide sequence fragment is the 3' end, and wherein the second core The first end of the nucleotide sequence fragment is the 5' end and contains a phosphate group, and the second end of the second nucleotide sequence fragment is the 3' end. The method of any one of claims 1 to 3, wherein the length of the first nucleotide sequence fragment and/or the second nucleotide sequence fragment is between 20 and 100 bp. The method of claim 4, wherein the length of the first nucleotide sequence fragment and/or the second nucleotide sequence fragment is between 50 and 100 bp. The method of claim 5, wherein the marker is a biomarker that can be biotinylated to achieve fluorescence. If the method of claim 1 to 3 is any one, the steps (a) ~ (c) can be performed simultaneously. The method of claim 1 to 3, wherein the adding ratio of the first probe to the second probe is 1:1. Please request the method of any one of items 1 to 3, wherein the DNA sequence genotypic variation includes point mutation, insertion mutation, deletion mutation, rearrangement mutation or frameshift mutation. . The method according to any one of claims 1 to 3 can be used to perform genotyping analysis of single nucleotide polymorphism (SNP). A kit for detecting whether the genotype of a target DNA sequence is mutated, which includes: (1) at least one first probe, wherein the first probe has a first nucleotide sequence fragment complementary to the target DNA, and the first probe A nucleotide sequence fragment has a 1st end and a 2nd end, the 1st end of the first nucleotide sequence fragment is the mutation site to be detected, and the 2nd end of the first nucleotide sequence fragment Connected with a digital magnetic bead, each digital magnetic bead corresponds to the mutation site information to be detected at the first end of each first nucleotide sequence fragment; (2) a second probe, wherein the second probe The needle has a second nucleotide sequence fragment that is complementary to the target DNA. The second nucleotide sequence fragment has a 1st end and a 2nd end. The 1st end of the second nucleotide sequence fragment has a label. , and the second end of the second nucleotide sequence fragment has a phosphate group or the first core The first end of the nucleotide sequence fragment has a phosphate group, and the first nucleotide sequence fragment and the second nucleotide sequence fragment are complementary to each other at the position of the target DNA, so that hybridization and ligation reactions can be performed simultaneously; and (3) ) reaction reagent, which contains an enzyme for catalyzing the ligation reaction under appropriate conditions.