TWI806870B - Anti-pd-1 antibodies and uses thereof - Google Patents

Abstract

Provided are anti-PD-1 antibodies or fragments thereof. In various example, the antibodies or fragments thereof includes a heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and a light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are selected from the group consisting of (a) HCDR1: GFTFSSYT (SEQ ID NO: 1), HCDR2: ISHGGGDT (SEQ ID NO: 2), HCDR3: ARHSGYERGYYYVMDY (SEQ ID NO: 3), LCDR1: ESVDYYGFSF (SEQ ID NO: 4), LCDR2: AAS (SEQ ID NO: 5), LCDR3: QQSKEVPW (SEQ ID NO: 6); (b) HCDR1: GYTFTSYT (SEQ ID NO: 7), HCDR2: INPTTGYT (SEQ ID NO: 8), HCDR3: ARDDAYYSGY (SEQ ID NO: 9), LCDR1: ENIYSNL (SEQ ID NO: 10), LCDR2: AAK (SEQ ID NO: 11), LCDR3: QHFWGTPWT (SEQ ID NO: 12); and (c) HCDR1: GFAFSSYD (SEQ ID NO: 13), HCDR2: ITIGGGTT (SEQ ID NO: 14), HCDR3: ARHRYDYFAMDN (SEQ ID NO: 15), LCDR1: ENVDNYGINF (SEQ ID NO: 16), LCDR2: VSS (SEQ ID NO: 17), LCDR3: QQSKDVPW (SEQ ID NO: 18). Methods of using the antibodies or fragments thereof for treating and diagnosing diseases such as cancer, infection or immune disorders are also provided.

Description

Anti-PD-1 antibodies and uses thereof

The present invention relates to isolated antibodies or fragments thereof specific for human programmed cell death protein 1 (PD-L1) and uses thereof.

The programmed cell death 1 (PD-1) cDNA was isolated in 1992 from mouse T-cell fusion tumors and hematopoietic pioneer cell lines undergoing apoptosis. Genetic ablation studies have shown that PD-1 deficiency leads to distinct autoimmune phenotypes in multiple mouse strains. PD-1-deficient allogeneic T cells with transgenic T-cell receptors (TCRs) exhibit enhanced responses to alloantigens, suggesting that PD-1 on T cells negatively regulates responses to antigens.

Several studies have contributed to the discovery of molecules that interact with PD-1. In 1999, B7 homologue 1 (B7 H1, also known as programmed death ligand 1 [PD-L1]), based on its homology to B7 family molecules, was independently identified from PD-1 using molecular colonization and human expressed sequence tag database searches, and showed that B7 H1 acts as an inhibitor of T cell responses in vitro. A year later, these two independent lines of research confirmed each other, when the labs of Freeman, Wood, and Honjo showed that B7 H1 (hereafter referred to as PD-L1) was the binding and functional partner of PD-1. Next, it was determined that PD-L1-deficient mice (PD-L1-KO mice) were susceptible to induction of autoimmune disease, although this mouse strain did not spontaneously develop such disease. Subsequently, the role of PD-L1/PD-1 interaction in suppressing T cell responses in vivo was elucidated Plays a dominant role, especially in the tumor microenvironment.

Preliminary studies have shown that tumor-associated PD-L1 promotes the apoptosis of activated T cells (Dong H. et al., Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nature medicine. 2002; 8(8):793-800), and also stimulates IL-10 production in human peripheral blood T cells (Dong H, et al., B7-H1, a third member of the B7 family, co-stimulates T-cell proliferation and interleukin-10 secretion. Nature medicine. 1999;5(12):1365-9) to mediate immunosuppression. The known role of PD-L1 in immunosuppression is much more complex. In addition to T cell apoptosis and IL-10 induction, PD-L1 can also induce T cell dysfunction through multiple mechanisms. The PD pathway has also been shown to promote T cell anergy both in vitro and in vivo.

Recently, the FDA approved two PD-1 mAbs to treat human cancers, one from Bristol-Myers Squibb (OpDivo, nivolumab, MDx1106, BMS-936558, ONO-4538) and the other from Merck (Keytruda, pembrolizumab, lambrolizumab, MK-3475). In addition, multiple PD-1 or PD-L1 mAbs are under active development in hundreds of clinical trials involving thousands of patients. To date, anti-PD therapy has yielded significant clinical benefit by inducing regression and improving survival of advanced and metastatic tumors. More importantly, anti-PD therapy can have durable effects, with tolerable toxicity, and has been shown to be applicable to a broad spectrum of cancer types, especially solid tumors. These clinical findings further validate the principles of PD pathway blockade and place anti-PD therapy in a unique category distinct from personalized or tumor type-specific therapies. Due to its unique and non-overlapping mechanism with other cancer treatments, anti-PD modalities are being integrated with almost all cancer treatments in an attempt to further expand therapeutic efficacy. Various clinical Trials to combine anti-PD therapy with chemotherapy, radiotherapy and targeted therapy.

Anti-PD therapy is central to the immunotherapy of human cancers, especially solid tumors. This therapy differs from previous immunotherapeutic agents whose main purpose is to enhance the systemic immune response or generate new immunity to cancer; instead, anti-PD therapy modulates the immune response at the tumor site, targets the tumor-induced immune deficiency, and repairs the ongoing immune response. Although the clinical success of anti-PD therapy in the treatment of multiple human cancers has demonstrated this approach, we are still investigating this pathway and the associated immune response, which will help in the discovery and design of new clinically applicable cancer immunotherapies.

The present invention provides an anti-PD-1 antibody, which exhibits good binding and inhibitory activity on PD-1 protein. One of these was tested to show even stronger binding activity than two regulatory-approved anti-PD-1 antibody products.

Therefore, according to a specific embodiment of the present invention, there is provided an isolated antibody or fragment thereof specific to human programmed cell death protein 1 (PD-L1), wherein the antibody or fragment thereof comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3, and the light chain variable region comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3, wherein the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 is selected from the group consisting of: (a) HCDR1: GFTFSSYT (SEQ ID NO: 1), HCDR2: ISHGGGDT (SEQ ID NO: 2), HCDR3: ARHSGYERGYYYVMDY (SEQ ID NO: 3), LCDR1: ESVDYYGFSF (SEQ ID NO: 4), LCDR2: AAS (SEQ ID NO: 5), LCDR3: QQSK EVPW (SEQ ID NO: 6); (b) HCDR1: GYTFTSYT (SEQ ID NO: 7), HCDR2: INPTTGYT (SEQ ID NO: 8), HCDR3: ARDDAYYSGY (SEQ ID NO: 9), LCDR1: ENIYSNL (SEQ ID NO: 10), LCDR2: AAK (SEQ ID NO: 11), LCDR3: QHFWGTPWT (SEQ ID NO: 12); and (c) HCDR1: GFAFSSYD (SEQ ID NO: 13), HCDR2: ITIGGGTT (SEQ ID NO: 14), HCDR3: ARHRYDYFAMDN (SEQ ID NO: 15), LCDR1: ENVDNYGINF (SEQ ID NO: 16), LCDR2: VSS (SEQ ID NO: 17), LCDR3: QQSKDVPW (SEQ ID NO: 18).

In some specific embodiments, the antibody or fragment of the present invention further comprises a heavy chain constant region, a light chain constant region, an Fc region or a combination thereof. In some embodiments, the light chain constant region is a kappa or lambda chain constant region.

In some embodiments, the antibody or fragment thereof may be of an IgG, IgM, IgA, IgE or IgD isotype. In some embodiments, said isotype is IgG1, IgG2, IgG3 or IgG4. In some specific embodiments, the antibody or fragment thereof is a chimeric antibody, a humanized antibody or a fully human antibody.

In some embodiments, the antibody or fragment thereof comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, or an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39. In some embodiments, the antibody or fragment thereof comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, or an amino acid sequence having at least 95% sequence identity to SEQ ID NO:41, SEQ ID NO:43, or SEQ ID NO:45.

In another embodiment, the present invention provides a human programmed cell An isolated antibody or fragment thereof specific for cell death protein 1 (PD-L1), wherein the antibody or fragment thereof comprises a heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and a light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are selected from the group consisting of: (a) HCDR1:GF TFSSYT (SEQ ID NO: 1), HCDR2: ISHGGGDT (SEQ ID NO: 2), HCDR3: ARHSGYERGYYYVMDY (SEQ ID NO: 3), LCDR1: ESVDYYGFSF (SEQ ID NO: 4), LCDR2: AAS (SEQ ID NO: 5), LCDR3: QQSKEVPW (SEQ ID NO: 6); (b) HCDR 1: GYTFTSYT (SEQ ID NO: 7), HCDR2: INPTTGYT (SEQ ID NO: 8), HCDR3: ARDDAYYSGY (SEQ ID NO: 9), LCDR1: ENIYSNL (SEQ ID NO: 10), LCDR2: AAK (SEQ ID NO: 11), LCDR3: QHFWGTPWT (SEQ ID NO: 12); (c) and (d) HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 as shown in (a)-(c), but at least one of them contains one, two or three amino acid additions, deletions, conservative amino acid substitutions or combinations thereof.

In some specific embodiments, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are as shown in any one of (a)-(c), but one of them includes conservative amino acid substitutions. In some specific embodiments, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are as shown in any one of (a)-(c), but Two of these each contain conservative amino acid substitutions. In some specific embodiments, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are as shown in any one of (a)-(c), but each of three of them contains conservative amino acid substitutions.

In a specific embodiment, a composition comprising the antibody or fragment thereof of the present invention and a pharmaceutically acceptable carrier is also provided. In a specific embodiment, there is also provided an isolated cell comprising one or more polynucleotides encoding said antibody or fragment thereof.

The invention also provides uses and methods. In a specific embodiment, a use of the antibody or fragment thereof of the present invention in the preparation of a medicament for treating cancer is provided. The cancer may be selected from the group consisting of bladder cancer, liver cancer, colon cancer, rectal cancer, endometrial cancer, leukemia, lymphoma, pancreatic cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, urinary tract cancer, head and neck cancer, gastrointestinal cancer, gastric cancer, esophageal cancer, ovarian cancer, renal cancer, melanoma, prostate cancer and thyroid cancer. Also provided is a method of treating cancer in a patient in need thereof comprising administering to said patient an antibody or fragment thereof of the invention.

In another embodiment, the invention provides a method of treating cancer or infection in a patient in need thereof, comprising (a) treating cells with an antibody or fragment thereof of the invention ex vivo; and (b) administering the treated cells to the patient. In some embodiments, said cells are T cells.

In another specific embodiment, use of any antibody or fragment thereof of the present invention in the preparation of a medicament for treating infection is provided. In some embodiments, the infection is a viral infection, bacterial infection, fungal infection or parasitic infection.

In another specific embodiment, a use of the antibody or fragment thereof of the present invention in the preparation of a medicament for treating immune disorders is provided. In some embodiments, the immune disorder is selected from infection, endotoxic shock associated with infection, arthritis, rheumatoid arthritis, asthma Asthma, COPD, pelvic inflammatory disease, Alzheimer's disease, inflammatory bowel disease, Crohn's disease, ulcerative colitis, Peyronie's disease, celiac disease, gallbladder disease, Pilonidal disease, peritonitis, psoriasis, vasculitis, surgical adhesions, stroke, type 1 diabetes, Lyme disease, arthritis, meningoencephalitis, autoimmune grapevine Meningitis, immune-mediated central and peripheral nervous system inflammatory diseases, multiple sclerosis, lupus and Guillain-Barr syndrome, atopic dermatitis, autoimmune hepatitis, alveolitis fibrosa, Grave's disease, IgA nephropathy, idiopathic thrombocytopenic purpura, Meniere's disease, pemphigus, primary biliary cirrhosis, sarcoidosis, scleroderma, Weger's disease Granuloma, pancreatitis, trauma, graft-versus-host disease, graft rejection, ischemic disease, myocardial infarction, atherosclerosis, intravascular coagulation, bone resorption, osteoporosis, osteoarthritis, periodontitis, hypochlorhydria, and infertility associated with loss of fetal-maternal immune tolerance.

Figure 1 shows that all five hPD-1 mAb isotypes can bind hPD-1 with high specificity.

Figure 2 shows that anti-hPD-1 does not bind to hB7-1, hPD-L1, hB7-H3, hB7-H4 and hCD137.

Figure 3 shows that hPD-1 mAb can bind to both human and cynomolgus cell PD-1 proteins without showing cross-binding to mPD-1.

Figure 4 shows that hPD-1 mAb has a dose-dependent blocking effect on the binding of hPD-1 to hPD-L1.

Figure 5 shows abrogating and blocking effects of hPD-1 mAb when observed in a competitive binding environment.

Figure 6 shows the results of gel electrophoresis analysis confirming the RACE product.

Figure 7 shows (A) the ability of recombinant DNA antibodies to bind PD-1, and (B) their blocking effect on the ability of PD-1 to bind to PD-L1.

Figure 8 shows that nine humanized antibodies exhibit various binding affinities to PD-1, including higher and lower affinities than the parental antibody.

Figure 9 shows that humanized antibodies can block the binding ability of PD-1 and PD-L1.

Figure 10 shows that humanized antibodies can block the binding ability of PD-1 and PD-L2.

Figure 11 shows that humanized mAbs enhance the in vitro cytotoxicity of allogeneic CD8+ CTL cells against cancer cells.

Figure 12 shows the proliferative response of MLRs to anti-hPD-1 antibodies.

Figure 13 shows the expression of IL-2 and IFNy in MLR culture supernatants.

Figure 14 shows that PD-1 mAb inhibits the expression of PD-L1 in lymphocytes.

Figure 15 shows the in vivo anti-tumor activity of humanized PD-1 antibodies.

Figure 16 shows a comparison of antibody binding affinities and kinetics.

Figure 17 shows a comparison of PD-1 antibodies in PD-1/PD-L1 blockade.

Figure 18 shows a comparison of mAbs in enhancing the in vitro cytotoxicity of allogeneic CD8+ CTL cells against cancer cells.

Figure 19 shows the binding of test articles to hPD-1 or mPD-1 (ELISA assay).

Figure 20 shows binding of test articles against hPD-1- or cPD-1 expressing CHOK1 cells using flow cytometry.

Figure 21 shows the blocking activity of test articles against hPD-L1 (left) and hPD-L2 (right) binding to hPD-1 expressing CHOK1 cells.

Figure 22 shows human IL-2 (left) and IFN-γ (right) concentrations in a human MLR assay.

Figure 23 shows IFN-γ concentrations in engineered tumor and T cell co-culture assays.

Figure 24 shows the results of epitope binding according to ELISA (upper panel) and a summary of the epitope overlap of different test articles (lower panel).

Figures 25(a) to 25(d) show the binding of Nivolumab ((a) and (b)) or TY101-04-T3-05 ((c) and (d)) antibodies to recombinant hPD-1 at low fixed concentrations (60RU, (a) and (c)) and high fixed concentrations (960RU, (b) and (d)).

definition

It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "an antibody" is understood to represent one or more antibodies. Accordingly, the terms "a" (or "an"), "one or more" and "at least one" may be used interchangeably herein.

As used herein, the term "polypeptide" is intended to include both the singular and the plural "polypeptides" and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain or chains of two or more amino acids, without reference to a particular length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein", "amino acid chain" or any other term used to refer to one or more chains of two or more amino acids is included in the definition of "polypeptide", and the term "polypeptide" may replace any of these terms or Used interchangeably with it. The term "polypeptide" also means the products of post-expression modifications of polypeptides, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization of known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. Polypeptides may be derived from natural biological sources or produced by recombinant techniques, but do not necessarily have to be translated from a specified nucleic acid sequence. It can be produced in any way, including by chemical synthesis.

As used herein, the term "isolated" with respect to cells, nucleic acids such as DNA or RNA, refers to a molecule that is separated from other corresponding DNA or RNA present in the natural source of the macromolecule. The term "isolated" as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when produced by chemical synthesis. Furthermore, "isolated nucleic acid" is intended to include nucleic acid fragments that do not occur in nature as fragments and are not found in nature. The term "isolated" is also used to refer to cells or polypeptides that are separated from other cellular proteins or tissues. Isolated polypeptide is intended to encompass both purified and recombinant polypeptides.

As used herein, the term "recombinant" when referring to polypeptides or polynucleotides means forms of polypeptides or polynucleotides that do not occur in nature, non-limiting examples of which may be constructed by combining polynucleotides or polypeptides that do not normally exist together.

"Homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing positions in each sequence, which can be aligned for comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence has less than 40% identity, although preferably less than 25% identity, to one of the sequences of the invention.

A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a particular percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" to another sequence means that, when aligned, that percentage of the bases (or amino groups) are the same in a comparison of the two sequences. Such alignments and percentages of homology or sequence identity can be determined using software programs known in the art, such as those described in Ausubel et al., eds. (2007) Current Protocols in Molecular Biology. Preferably, the alignment uses predetermined parameters. One such alignment program is BLAST, which uses default parameters. In particular, the programs are BLASTN and BLASTP, using the following predetermined parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS trans lations+SwissProtein+SPupdate+PIR. A bioequivalent polynucleotide is one having the above-specified percentages of homology and encoding a polypeptide having the same or similar biological activity.

An "equivalent nucleic acid or polynucleotide" refers to a nucleic acid that has a nucleotide sequence that has a degree of homology or sequence identity to the nucleotide sequence of the nucleic acid or its complement. A homologue of a double-stranded nucleic acid is intended to include a nucleic acid having a nucleotide sequence that shares some degree of homology with it or its complement. In one aspect, a homologue of a nucleic acid is capable of hybridizing to a nucleic acid or its complement. Likewise, an "equivalent polypeptide" refers to a polypeptide having a certain degree of homology or sequence identity with the amino acid sequence of a reference polypeptide. In some aspects, the sequence identity is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%. In some aspects, an equivalent polypeptide or polynucleotide has one, two, three, four, or five additions, deletions, substitutions, and combinations thereof, compared to a reference polypeptide or polynucleotide. In some respects, equivalent sequences retain activity (e.g. epitope binding) or structure (e.g. salt bridges) of the reference sequence.

Hybridization reactions can be performed under conditions of varying "stringency". Typically, low stringency hybridization reactions are performed at about 40°C in a solution of about 10 x SSC, or equivalent ionic strength/temperature. Medium stringency hybridizations are typically performed at about 6 x SSC at about 50°C, and high stringency hybridization reactions are typically performed at about 1 x SSC at about 60°C. Hybridization reactions can also be performed under "physiological conditions," as is well known to those skilled in the art. A non-limiting example of physiological conditions are temperature, ionic strength, pH and concentration of Mg2 ⁺ normally found in cells.

A polynucleotide is composed of a specific sequence of four nucleotide bases, adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U) (replacing thymine when the polynucleotide is RNA). Thus, the term "polynucleotide sequence" is an alphabetic designation for a polynucleotide molecule. The letter designates a database that can be entered into a computer with a central processing unit and used in bioinformatics applications such as functional genomics and homology searches. The term "polymorphism" refers to the coexistence of more than one form of a gene or a portion thereof. A portion of a gene having at least two different forms, ie, two different nucleotide sequences, is called a "polymorphic region of the gene". A polymorphic region can be a single nucleotide, the identity of which differs on different alleles.

The terms "polynucleotide" and "oligonucleotide" are used interchangeably to refer to a polymeric form of nucleotides of any length, which may be deoxyribonucleotides or ribonucleotides or analogs thereof. A polynucleotide can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: genes or gene fragments (such as probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plastids, vectors, isolated DNA of any sequence, any sequence Columns of isolated RNA, nucleic acid probes and primers. A polynucleotide may include modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications in nucleotide structure, if present, can be imparted either before or after assembly of the polynucleotide. Nucleotide sequences can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, for example by conjugation with labeling elements. The term also refers to both double-stranded and single-stranded molecules. Unless otherwise specified or required, any particular embodiment of a polynucleotide of the invention includes both the double-stranded form and either of the two complementary single-stranded forms known or expected to form the double-stranded form.

The term "encoding" as applied to a polynucleotide refers to a polynucleotide which is said to "encode" a polypeptide if in its native state, or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce mRNA for the polypeptide and/or fragments thereof. The antisense strand is the complement of this nucleic acid from which a coding sequence can be deduced.

As used herein, "antibody" or "antigen-binding polypeptide" refers to a polypeptide or polypeptide complex that specifically recognizes and binds an antigen. Antibodies can be whole antibodies and any antigen-binding fragments or single chains thereof. Thus, the term "antibody" includes any protein or peptide-containing molecule comprising at least a portion of an immunoglobulin molecule that is biologically active to bind an antigen. Examples of such include, but are not limited to, complementarity determining regions (CDRs) of heavy or light chains or ligand binding portions thereof, heavy or light chain variable regions, heavy or light chain constant regions, framework (FR) regions or any portion thereof, or at least a portion of a binding protein.

An "antibody fragment" or "antigen-binding fragment" as used herein is a portion of an antibody, such as F(ab') ₂ , F(ab) ₂ , Fab', Fab, Fv, scFv, and the like. Regardless of structure, antibody fragments bind to the same antigens that are recognized by intact antibodies. The term "antibody fragment" includes aptamers, spiegelmers, diabodies. The term "antibody fragment" also includes any synthetic or genetically engineered protein that exerts the effect of an antibody by binding to a specific antigen to form a complex.

"Single-chain variable fragment" or "scFv" refers to a fusion protein of the variable domains of the heavy ( _VH ) and light ( _VL ) chains of an immunoglobulin. In some aspects, these regions are linked with short linker peptides of ten to about 25 amino acids. The linker can be rich in glycine for flexibility, and serine or threonine for solubility, and can link the N-terminus of the _VH to the C-terminus of the _VL , or vice versa. Despite the removal of the constant regions and the introduction of linkers, the protein retains the specificity of the original immunoglobulin. scFv molecules are known in the art and described in, eg, US Patent No. 5892019.

The term "antibody" includes a wide variety of polypeptides that can be distinguished biochemically. Those skilled in the art know that heavy chains are classified as gamma, mu, alpha, delta, or epsilon, with some subclasses (eg, gamma 1 -gamma 4). It is the nature of this chain that determines the antibody's "class" as IgG, IgM, IgA, IgG, or IgE, respectively. Immunoglobulin subclasses (isotypes), such as IgGl, IgG2, IgG3, IgG4, IgG5, etc., are well characterized and known to confer functional specificity. From the perspective of the present invention, modified forms of each of these classes and isoforms are readily discernible by those skilled in the art, and thus, they are also encompassed within the scope of the present invention. All immunoglobulin classes are clearly within the scope of the present invention and the following discussion will generally be directed to the IgG class of immunoglobulin molecules. Regarding IgG, a standard immunoglobulin molecule consists of two identical light chain polypeptides with a molecular weight of approximately 23,000 Daltons, and two identical heavy chain polypeptides with a molecular weight of 53,000-70,000. These four chains are usually disulfide-bonded in a "Y" configuration in which the light chain begins at the mouth of the "Y" and continues sandwiching the heavy chain throughout the variable region.

Antibodies, antigen-binding polypeptides of the invention, variants or derivatives thereof include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized or chimeric antibodies, single chain antibodies, epitope binding fragments such as Fab, Fab ' and F(ab') ₂ , Fd, Fv, single chain Fv (scFv), single chain antibodies, disulfide bonded Fv (sdFv), fragments comprising VK or VH domains, libraries expressed by Fab Fragments and anti-idiotypic (anti-Id) antibodies (including anti-Id antibodies directed against the LIGHT antibodies disclosed herein) were produced. The immunoglobulin or antibody molecule of the invention can be of any type (e.g. IgG, IgE, IgM, IgD, IgA and IgY), class (e.g. IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.

Light chains are classified as either kappa or lambda. Each heavy chain class can be associated with a kappa or lambda light chain. Generally, the light and heavy chains are covalently bonded to each other, and when the immunoglobulin is produced by a fusionoma, B cell, or genetically engineered host cell, the "tail" portions of the two heavy chains are bonded by covalent disulfide bonds or non-covalent bonds. In the heavy chains, the amino acid sequence runs from the N-terminus at the fork of the Y structure to the C-terminus at the bottom of each chain.

Both the light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used functionally. In this regard, it is known that the variable domains of the light (VK) and heavy (VH) chain portions determine antigen recognition and specificity. In contrast, the light chain constant domain (CK) and the heavy chain constant domain (CH1, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement fixation, etc. By convention, the numbering of constant regions increases the further away they are from the antigen binding site or the amino terminus of the antibody. The N-terminal portion is the variable region, while the C-terminal portion is the constant region; the CH3 and CK domains actually comprise the carboxyl termini of the heavy and light chains, respectively.

As noted above, the variable regions allow the antibody to selectively recognize and specifically bind an epitope on an antigen. That is, a subset of the VK and VH domains or complementarity determining regions (CDRs) of an antibody join together to form the variable region that defines the three-dimensional antigen-binding site. This quaternary antibody structure forms an antigen binding site present at the end of each arm of the Y. More specifically, the antigen binding site is defined by the three CDRs (ie, CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3) on each of the VH and VK chains. In some cases, such as certain immunoglobulin molecules derived from camelid species or engineered immunoglobulins based on camelid immunoglobulins, complete immunoglobulin molecules may consist of heavy chains only, with no light chains. See, eg, Hamers-Casterman et al., Nature 363:446-448 (1993).

In naturally occurring antibodies, the six "complementarity determining regions" or "CDRs" present in each antigen-binding domain are short, non-contiguous sequences of amino acids that specifically position to form the antigen-binding domain when the antibody assumes its three-dimensional configuration in an aqueous environment. The remaining amino acids in the antigen-binding domain, known as the "framework" region, show less intermolecular variability. The framework regions mostly form a β-stack conformation, while the CDRs form loops that connect and in some cases form part of the β-stack structure. Thus, the framework regions function to form a scaffold that provides for the orientation of the CDRs in the correct orientation through interchain, non-covalent interactions. The antigen binding domain formed by the positioned CDRs defines a surface that is complementary to an epitope on the immunoreactive antigen. This complementary surface facilitates the non-covalent binding of the antibody to the epitope it recognizes. The amino acids making up the CDR and framework regions, respectively, can be readily identified by those of ordinary skill in the art for any given heavy or light chain variable region, since they are precisely defined (see "Sequences of Proteins of Immunological Interest," Kabat, E. et al., USDepartment of Health and Human Services, (1983); and Chothia and Lesk, J. MoI. Biol. , 196:90 1-917 (1987).

Where there are two or more definitions of a term used and/or accepted in the art, the definition of a term used herein is intended to include all such meanings unless an opposite meaning is expressly indicated. A specific example is the use of "complementarity determining regions"("CDRs") to describe non-linked antigen binding sites found within the variable regions of heavy and light chain polypeptides. This particular region is described by Kabet et al., USDept. of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) and Chothia et al., J. MoI. Biol. 196:901-917 (1987), which are hereby incorporated by reference in their entirety. The definition of a CDR according to Kabat and Couthia includes an overlap of amino acid residues or a subset thereof when comparing them to each other. However, application of either definition to a CDR of an antibody or variant thereof is intended to be encompassed within the scope of the term as defined and used herein. The appropriate amino acid residues covering each of the defined CDRs cited above are listed in the table below for comparison. The exact number of residues encompassing a particular CDR will vary depending on the sequence and size of the CDR. Based on the amino acid sequence of the variable region of an antibody, one skilled in the art can routinely determine which residues constitute a particular CDR.

Kabet et al. also defined a numbering system applicable to the variable domain sequences of any antibody. One of ordinary skill in the art can unambiguously assign this "Kabat numbering" system to any variable domain sequence, without reliance on any experimental data other than the sequence itself. As used herein, "Kabat numbering" refers to the numbering system proposed by Kabat et al., U.S. Dept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983).

In addition to the table above, the Kabat numbering system describes the CDR regions as follows: CDR-H1 begins at approximately amino acid 31 (i.e., approximately 9 residues after the first cysteine residue), includes approximately 5-7 amino acids, and ends at the next tryptophan residue. CDR-H2 begins with The fifteenth residue after the end of CDR-H1 includes approximately 16-19 amino acids and ends at the next arginine or lysine residue. CDR-H3 begins approximately the thirty-third amino acid residue after the end of CDR-H2; contains 3-25 amino acids; and ends at the sequence W-G-X-G, where X is any amino acid. CDR-L1 begins at about residue 24 (ie, after the cysteine residue); includes about 10-17 residues; and ends at the next tryptophan residue. CDR-L2 begins approximately the sixteenth residue after the end of CDR-L1 and consists of approximately 7 residues. CDR-L3 begins about the thirty-third residue after the end of CDR-L2 (ie, the cysteine residue); includes about 7-11 residues and ends at the sequence F or W-G-X-G, where X is any amino acid.

Antibodies disclosed herein may be from any animal source, including birds and mammals. Preferably, the antibody is a human, murine, donkey, rabbit, goat, guinea pig, camel, alpaca, horse or chicken antibody. In another specific embodiment, the variable regions may be of cartilaginous fish origin (eg, from sharks).

As used herein, the term "heavy chain constant region" includes amino acid sequences derived from immunoglobulin heavy chains. A heavy chain constant region-containing polypeptide comprises at least one of a CH1 domain, a hinge (eg, upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. For example, an antigen-binding polypeptide for use in the present invention can include a polypeptide chain comprising a CH1 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH2 domain; a polypeptide chain comprising a CH1 domain and a CH3 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH3 domain, or a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, a CH2 domain, and a CH3 domain. In another specific embodiment, a polypeptide of the invention comprises a polypeptide chain comprising a CH3 domain. In addition, antibodies for use in the invention may lack at least a portion of the CH2 domain (e.g., a portion of the CH2 domain in whole or in part). As noted above, those of ordinary skill in the art will appreciate that heavy chain constant regions can be modified such that they differ in amino acid sequence from naturally occurring immunoglobulin molecules.

The heavy chain constant regions of the antibodies disclosed herein can be derived from different immunoglobulin molecules. For example, the heavy chain constant region of a polypeptide may comprise a CH1 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule. In another example, the heavy chain constant region can comprise a hinge region derived partly from an IgG1 molecule and partly from an IgG3 molecule. In another example, the heavy chain portion can comprise a chimeric hinge partly from an IgG1 molecule and partly from an IgG4 molecule.

As used herein, the term "light chain constant region" includes amino acid sequences derived from antibody light chains. Preferably, the light chain constant region comprises at least one of a constant kappa domain or a constant lambda domain.

A "light chain heavy chain pair" refers to a collection of light chains and heavy chains that can form dimers via disulfide bonds between the CL domain of the light chain and the CH1 domain of the heavy chain.

As mentioned previously, the subunit structures and three-dimensional configurations of the constant regions of various immunoglobulin classes are well known. As used herein, the term "VH domain" includes the amino-terminal variable domain of an immunoglobulin heavy chain and the term "CH1 domain" includes the first (amino-terminal) constant region domain of an immunoglobulin heavy chain. The CH1 domain is adjacent to the VH domain and is located amino-terminal to the hinge region of the immunoglobulin heavy chain molecule.

The term "CH2 domain" as used herein includes that portion of the heavy chain molecule extending approximately from residue 244 to residue 360 of an antibody using the conventional numbering scheme (residues 244 to 360, the Kabat numbering system, and residues 231-340, the EU numbering system; see Kabet et al., U.S. Dept. of Health and Human Services, "Sequences of Proteins of Immunological Interest" (198 3)). The CH2 domain is unique in that it is not tightly Midi pairs with another domain. Instead, two N-linked branched sugar chains are inserted between the two CH2 domains of the intact native IgG molecule. It is well documented that the CH3 domain extends from the CH2 domain to the C-terminus of the IgG molecule and comprises approximately 108 residues.

As used herein, the term "hinge region" includes the portion of the heavy chain molecule that connects the CH1 domain and the CH2 domain. The hinge region comprises approximately 25 residues and is flexible, allowing the two N-terminal antigen-binding regions to move independently. The hinge region can be subdivided into three distinct domains: upper, middle, and lower hinge domains (Roux et al., J. Immunol 161:4043 (1998)).

The term "disulfide bond" as used herein includes a covalent bond formed between two sulfur atoms. The amino acid cysteine includes a thiol group that can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CH1 and CK regions are linked by a disulfide bond, and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 according to the Kabat numbering system (position 226 or 229, EU numbering system).

As used herein, the term "chimeric antibody" will be taken to mean any antibody in which an immunoreactive region or site is obtained or derived from a first species and a constant region (which may be complete, partial or modified according to the invention) is obtained from a second species. In certain embodiments, the target binding region or site will be from a non-human source (eg, mouse or primate) and the constant region will be human.

As used herein, "percent humanization" is calculated by determining the number of framework amino acid differences (i.e., non-CDR differences) between the humanized domain and the germline domain, subtracting that number from the total number of amino acids, and then dividing it by the total number of amino acids times 100.

"Specifically binds" or "specific for" generally means that an antibody binds to an epitope via its antigen-binding domain, and that binding entails a certain complementarity between the antigen-binding domain and the epitope. According to this definition, antibodies are called "specific When binding to an epitope, it binds to that epitope more readily by its antigen-binding domain than it would to a random, unrelated epitope. The term "specificity" is used herein to characterize the relative affinity with which an antibody binds to a certain epitope. For example, antibody A may be said to have a higher specificity for a given epitope than antibody "B," or antibody "A" may be said to bind epitope "C" with higher specificity than a related epitope D.

As used herein, the term "treatment" or "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow down (reduce) an undesired physiological change or condition, such as the progression of cancer. Beneficial or desired clinical outcomes include, but are not limited to, relief of symptoms, reduction of disease extent, stabilization of disease state (i.e., not worsening), delay or slowing of disease progression, amelioration or palliation of disease state, remission (partial or total), whether detectable or undetectable. "Treatment" also means prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to developing the condition or disorder or those in which the condition or disorder is to be prevented.

"Subject" or "individual" or "animal" or "patient" or "mammal" refers to any subject, especially a mammalian subject, for which diagnosis, prognosis or treatment is desired. Mammalian subjects include humans, domestic animals, livestock, zoo animals, sport animals, or pet animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, cows, and the like.

As used herein, phrases such as "patient in need of treatment" or "subject in need of treatment" include subjects, such as mammalian subjects, who would benefit from administration of an antibody or composition of the invention, e.g., for detection, for diagnosis and/or for therapy.

anti-PD-1 antibody

The present invention provides anti-PD-1 antibodies with high affinity for human PD-1 protein. Antibodies tested exhibit potent binding and inhibitory activity and are useful for therapeutic and diagnostic way. Furthermore, one of the tested humanized antibodies (TY101) exhibited significantly higher binding affinity than the two FDA-approved anti-hPD-1 antibodies.

Therefore, a specific embodiment of the present invention provides an anti-PD-1 antibody or a fragment thereof, which can specifically bind to human programmed death 1 (PD-1) protein.

According to a specific embodiment of the present invention, there is provided an antibody comprising a heavy chain and a light chain variable region having a CDR region as one of the CDR groups in Table 1.

For example, in one embodiment, human programmed cell death is provided An isolated antibody or fragment specific to PD-1, wherein the antibody or fragment thereof comprises a heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3, and a light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2 and LCDR3, wherein the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are HCDR1:GFTFSSYT (SEQ ID NO: 1), HCDR2: ISHGGGDT (SEQ ID NO: 2), HCDR3: ARHSGYERGYYYVMDY (SEQ ID NO: 3), LCDR1: ESVDYYGFSF (SEQ ID NO: 4), LCDR2: AAS (SEQ ID NO: 5), LCDR3: QQSKEVPW (SEQ ID NO: 6).

For example, in a specific embodiment, an isolated antibody or fragment specific for human programmed cell death protein 1 (PD-1) is provided, wherein the antibody or fragment thereof comprises a heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3, and a light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2 and LCDR3, wherein HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are HC DR1: GYTFTSYT (SEQ ID NO: 7), HCDR2: INPTTGYT (SEQ ID NO: 8), HCDR3: ARDDAYYSGY (SEQ ID NO: 9), LCDR1: ENIYSNL (SEQ ID NO: 10), LCDR2: AAK (SEQ ID NO: 11), LCDR3: QHFWGTPWT (SEQ ID NO: 12).

For example, in a specific embodiment, an isolated antibody or fragment specific for human programmed cell death protein 1 (PD-1) is provided, wherein the antibody or fragment thereof comprises a heavy chain variable region comprising heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3, and a light chain variable region comprising light chain complementarity determining regions LCDR1, LCDR2 and LCDR3, wherein HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are HCDR1: GFAFSSYD (SEQ ID NO: 13), HCDR2: ITIGGGTT (SEQ ID NO: 14), HCDR3: ARHRYDYFAMDN (SEQ ID NO: 15), LCDR1: ENVDNYGINF (SEQ ID NO: 16), LCDR2: VSS (SEQ ID NO: 17), LCDR3: QQSKDV PW (SEQ ID NO: 18).

As shown in the experimental examples, antibodies containing these CDR regions, whether they are mouse, humanized or chimeric antibodies, have potent PD-1 binding and inhibitory activities. Further computer modeling revealed that certain residues within the CDRs could be modified to preserve or improve antibody properties. In some embodiments, the anti-PD-1 antibodies of the invention comprise the VH and VL CDRs listed in Table 1 with one, two or three further modifications. Such modifications may be additions, deletions or substitutions of amino acids.

In some embodiments, the modification is a substitution at no more than one hotspot position per CDR. In some embodiments, the modification is a substitution at one, two or three such hotspot positions. In a specific embodiment, the modification is a substitution at one of the hotspot positions. In some embodiments, such substitutions are conservative substitutions.

A "conservative amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g. lysine, arginine, histidine), acidic side chains (e.g. aspartic acid, glutamic acid), uncharged polar side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g. alanine, valine, leucine, isoleucine). acid, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan, histidine). Thus, a nonessential amino acid residue in an immunoglobulin polypeptide is preferably replaced with another amino acid residue from the same side chain family. exist In another embodiment, amino acid strings can be replaced with structurally similar strings that differ in the order and/or composition of side chain family members.

Non-limiting examples of conservative amino acid substitutions are provided in the table below, where a similarity score of 0 or higher indicates a conservative substitution between two amino acids.

Amino Acid Similarity Matrix

conservative amino acid substitution

Non-limiting examples of VH are provided in SEQ ID NO:27, SEQ ID NO:31, SEQ ID NO:35, SEQ ID NO:37 and SEQ ID NO:39. SEQ ID NO: 27 is murine VH. SEQ ID NO: 31 is the VH of a chimeric antibody, while SEQ ID NO: 35, SEQ ID NO: 37, and SEQ ID NO: 39 are humanized.

Non-limiting examples of VL are provided in SEQ ID NO:29, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:43 and SEQ ID NO:45. SEQ ID NO: 29 is murine VL. SEQ ID NO: 33 is the VL of a chimeric antibody, while SEQ ID NO: 41, SEQ ID NO: 43, and SEQ ID NO: 45 are humanized.

In some specific embodiments, the anti-PD-1 antibody of the present invention comprises SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 37, or the VH of SEQ ID NO: 39, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 41, SEQ ID NO: 43, or the VL of SEQ ID NO: 45, or their respective biological equivalents. A bioequivalent of a VH or VL is a sequence comprising the specified amino acids while having overall 80%, 85%, 90%, 95%, 98% or 99% sequence identity. For example, a biological equivalent of SEQ ID NO: 27, may be a VH having overall 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 27, but retaining the CDRs.

It will also be appreciated by those of ordinary skill in the art that the antibodies disclosed herein can be modified such that they differ in amino acid sequence from the naturally binding polypeptide from which they are derived. For example, a polypeptide or amino acid sequence derived from a given protein may be similar, e.g., have a certain percentage identity to the starting sequence, e.g., it may be 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the starting sequence.

In certain embodiments, antibodies include one or more portions or amino acid sequences not normally associated with antibodies. Exemplary modifications are described in more detail below. For example, antibodies of the invention may comprise flexible linking sequences, or may be modified to add functional moieties (eg, PEG, drugs, toxins, or tags).

Antibodies, variants or derivatives thereof of the invention include derivatives that are modified, ie, by covalent attachment of any type of molecule to the antibody such that such covalent attachment does not prevent the binding of the antibody to the epitope. For example, and not intended to be limiting, antibodies may be modified, for example, by glycosylation, acetylation, pegylation, phosphorylation, phosphorylation, amidation, derivatization of known protecting/blocking groups, proteolytic cleavage, attachment to cellular ligands or other proteins, and the like. Many chemical modifications can be performed by known techniques, including but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. In addition, antibodies may contain one or A variety of non-classical amino acids.

In some embodiments, an antibody can be conjugated to a therapeutic agent, prodrug, peptide, protein, enzyme, virus, lipid, biological response modifier, pharmaceutical agent, or PEG.

Antibodies can be conjugated or fused to therapeutic agents, which can include detectable labels, such as radiolabels, immunomodulators, hormones, enzymes, oligonucleotides, photoactive therapeutic or diagnostic agents, cytotoxic agents, which may be drugs or toxins, ultrasound enhancers, non-radioactive labels, combinations thereof, and other such agents known in the art.

Antibodies can be detectably labeled by coupling them to chemiluminescent compounds. The presence of the chemiluminescently labeled antigen-binding polypeptide is then determined by detecting the presence of luminescence that occurs during the chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminols, isoluminols, theromatic acridinium esters, imidazoles, acridinium salts and oxalates.

Antibodies can also be detectably labeled with fluorescent emitting metals such ^as152Eu or other lanthanides. These metals can be attached to the antibody using metal chelating groups such as diethylenetriaminoacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).用於將各種部分與抗體結合的技術是眾所周知的，參見，例如，Arnon等人，“Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy”,in Monoclonal Antibodies And Cancer Therapy,Reisfeld等人編，,pp.243-56(Alan R.Liss,Inc.(1985)；Hellstrom等人，“Antibodies For Drug Delivery”,in Controlled Drug Delivery(2nd Ed.)，Robinson等人編，Marcel Dekker,Inc.,pp.623-53(1987)；Thorpe,“Antibody Carriers Of Cytotoxic Agents In Cancer Therapy：A Review”,in Monoclonal Antibodies '84：Biological And Clinical Applications,Pinchera等人編，pp.475-506 (1985)；“Analysis,Results,And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy”,in Monoclonal Antibodies For Cancer Detection And Therapy,Baldwin等人編，Academic Press pp.303-16(1985)，和Thorpe等人，“The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates ”,Immunol.Rev. (52：119-58(1982))。

bifunctional molecule

PD-1 is an immune checkpoint molecule and a tumor antigen. As a tumor antigen targeting molecule, an antibody or antigen-binding fragment specific to PD-1 can be combined with a second antigen-binding fragment specific to immune cells to generate a bispecific antibody.

In certain embodiments, the immune cells are selected from T cells, B cells, monocytes, macrophages, neutrophils, dendritic cells, phagocytes, natural killer cells, eosinophils, basophils and mast cells. Molecules on immune cells that can be targeted include, for example, CD3, CD16, CD19, CD28, and CD64. Other examples include PD-1, CTLA-4, LAG-3 (also known as CD233), CD28, CD122, 4-1BB (also known as CD137), TIM3, OX-40 or OX40L, CD40 or CD40L, LIGHT, ICOS/ICOSL, GITR/GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM or BTLA (also known as CD2 72), killer cell immunoglobulin-like receptor (KIR) and CD47. Specific examples of bispecificity include, but are not limited to, PD-L1/PD-1, PD-1/LAG3, PD-1/TIGIT, and PD-1/CD47.

As an immune checkpoint inhibitor, an antibody or antigen-binding fragment specific to PD-1 can be combined with a second antigen-binding fragment specific to a tumor antigen to generate a bispecific antibody. "Tumor antigen" is an antigenic substance produced in tumor cells, that is, its trigger an immune response. Tumor antigens are useful in identifying tumor cells and are potential candidates for cancer therapy. Normal proteins in the body are not antigenic. However, certain proteins are produced or overexpressed during tumorigenesis and thus appear "foreign" to the body. This may include normal proteins that are well sequestered from the immune system, proteins that are usually produced in very small amounts, proteins that are usually only produced at certain developmental stages, or proteins that have modified structure due to mutations.

Abundant tumor antigens are known in the art, and new tumor antigens can be easily identified by screening. Non-limiting examples of tumor antigens include EGFR, Her2, EpCAM, CD20, CD30, CD33, CD47, CD52, CD133, CD73, CEA, gpA33, mucin, TAG-72, CIX, PSMA, folate binding protein, GD2, GD3, GM2, VEGF, VEGFR, integrins, αVβ3, α5β1, ERBB2, ERBB3, MET , IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, FAP and Tenascin.

In certain aspects, monomeric units are specific for proteins that are overexpressed on tumor cells compared to corresponding non-tumor cells. A "corresponding non-tumor cell" as used herein refers to a non-tumor cell that is of the same cell type as a tumor cell of origin. Notably, this protein is not necessarily distinct from the tumor antigen. Non-limiting examples include carcinoembryonic antigen (CEA), which is overexpressed in most colon, rectal, breast, lung, pancreatic, and gastrointestinal cancers; heregulin receptors (HER-2, neu , or c - erbB -2), which are often overexpressed in breast, ovarian, colon, lung, prostate, and cervical cancers. Epidermal growth factor receptor (EGFR), which is highly expressed in a range of solid tumors, including breast, head and neck, non-small cell lung and prostate cancer; sialoglycoprotein receptor; transferrin receptor; serine protease inhibitor (serpin) enzyme complex receptor, which is expressed on hepatocytes. Fibroblast growth factor receptor (FGFR), which is highly expressed in pancreatic ductal adenocarcinoma cells; vascular endothelial growth factor receptor (VEGFR), which is used in anti-angiogenic gene therapy; folate receptor, which is selectively overexpressed in 90% of non-mucinous ovarian cancers; cell surface glycocalyx; carbohydrate receptors; Non-limiting examples of bispecifics in this regard include PD-1/EGFR, PD-1/HER2, PD-1/CD33, PD-1/CD133, PD-1/CEA, and PD-1/VEGF.

The invention also provides different forms of bispecific antibodies. In some embodiments, each anti-PD-1 fragment and the second fragment are each independently selected from a Fab fragment, a single chain variable fragment (scFv) or a single domain antibody. In some embodiments, the bispecific antibody further comprises an Fc fragment.

The invention also provides bifunctional molecules that include not only antibodies or antigen-binding fragments. As tumor antigen targeting molecules, antibodies or antigen-binding fragments (as described herein) specific for PD-1 can be conjugated to immunocytins or ligands, optionally via peptide linkers. Linked immunocytins or ligands include, but are not limited to, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, GM-CSF, TNF-α, CD40L, OX40L, CD27L, CD30L, 4-1BBL, LIGHT, and GITRL. Such bifunctional molecules could combine the effects of immune checkpoint blockade with local immune modulation at the tumor site.

Antibody-encoding polynucleotides and methods for making antibodies

The invention also provides isolated polynucleotides or nucleic acid molecules (e.g., SEQ ID NOs: 22, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, and 46) encoding the antibodies of the invention, variants or derivatives thereof. The polynucleotides of the invention may encode antigen-binding polypeptides, variants thereof, on the same polynucleotide molecule or on different polynucleotide molecules or derivatives of the entire heavy and light chain variable regions. In addition, the polynucleotides of the invention may encode part of the heavy and light chain variable regions of the antigen-binding polypeptide, variant or derivative thereof, on the same polynucleotide molecule or on different polynucleotide molecules.

Methods of making antibodies are well known in the art and described herein. In certain embodiments, both the variable and constant regions of the antigen binding polypeptides of the invention are fully human. Fully human antibodies can be prepared using techniques described in the art and those described herein. For example, fully human antibodies to a particular antigen can be prepared by administering the antigen to a transgenic animal that has been modified to produce such antibodies in response to antigenic challenge but whose endogenous loci have been disabled. Exemplary techniques that can be used to prepare such antibodies are described in US Patent Nos. 6,150,584; 6,458,592; 6,420,140, the entire contents of which are incorporated herein by reference.

In certain embodiments, antibodies are produced that do not elicit a deleterious immune response in the animal being treated, eg, a human. In a specific embodiment, the antigen binding polypeptides, variants or derivatives thereof of the invention are modified to reduce their immunogenicity using art recognized techniques. For example, antibodies can be humanized, primatized, deimmunized or chimeric antibodies can be prepared. These types of antibodies are derived from nonhuman antibodies, usually murine or primate antibodies, that retain or substantially retain the antigen-binding properties of the parental antibody but are less immunogenic in humans. This can be achieved by various methods, including (a) grafting entire nonhuman variable domains into human constant regions to generate chimeric antibodies; (b) grafting at least part of one or more nonhuman complementarity determining regions (CDRs) into human framework and constant regions, with or without preserving key framework residues; or (c) grafting entire nonhuman variable regions but rendering them "cloaked" by replacing surface residues with human-like segments. Such methods are disclosed in Morrison et al, Proc . 25:489-498 (1991); Padlan, Molec . Immun. 31 :169-217 (1994), and US Patent Nos . 5,585,089, 5,693,761, 5,693,762 and 6,190,370, which are incorporated herein by reference in their entirety.

Deimmunization can also be used to reduce the immunogenicity of antibodies. As used herein, the term "deimmunization" includes altering antibodies to modify T cell epitopes (see, eg, International Application Publication Nos: WO/9852976 Al and WO/0034317 A2). For example, the variable heavy and variable light chain sequences from the starting antibody are analyzed and a human T cell epitope "map" from each V region is constructed that shows the position of the epitope relative to the complementarity determining regions (CDRs) and other key residues within the sequence. Individual T cell epitopes from the T cell epitope map are analyzed to identify other amino acid substitutions that have a lower risk of altering the activity of the final antibody. A series of other variable heavy and variable light chain sequences are designed, which include combinations of amino acid substitutions, and these sequences are then incorporated into a series of binding polypeptides. Typically, 12 to 24 variant antibodies are generated and tested for binding and/or function. The complete heavy and light chain genes containing the modified variable and human constant regions are then cloned into expression vectors and the resulting plastids introduced into cell lines to produce intact antibodies. Antibodies are then compared in appropriate biochemical and biological assays to identify the best variant.

The binding specificity of the antigen-binding polypeptides of the present invention can be determined by in vitro assays, such as immunoprecipitation, radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

Alternatively, techniques described for the production of single-stranded units (U.S. Patent No. 4,694,778; Bird, Science 242:423-442 (1988); Huston et al., Proc. Natl. Acad. Sci. USA 55:5879-5883 (1988); and Ward et al., Nature 334:544-554 (1989)) can be employed to generate the present invention single-chain unit. Single chain units are formed by linking the heavy and light chain fragments of the Fv region via amino acid bridges, resulting in a single chain fusion peptide. The technique of assembling functional Fv fragments in E. coli can also be used (Skerra et al., Science 242:1038-1041 (1988)).

Examples of techniques that can be used to generate single-chain Fv (scFv) and antibodies include those in U.S. Patent Nos. 4,946,778 and 5,258,498, Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., Proc. Natl. Sci. USA 90:1995-1999 (1993); and Skerra The technique described in et al., Science 240: 1038-1040 (1988). For some uses, including the use of antibodies in humans and in vitro assays, it is preferred to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, eg, an antibody with variable regions derived from a mouse monoclonal antibody and constant regions of a human immunoglobulin. Methods for generating chimeric antibodies are known in the art. See, e.g., Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., J. Immunol. Methods 125:191-202 (1989); U.S. Pat. Nos. 5,807,715; 4,816,567 and 4,816,397 No., which is incorporated herein by reference in its entirety.

A humanized antibody is an antibody molecule derived from an antibody of a non-human species, which binds the desired antigen, and has one or more complementarity determining regions (CDRs) from the non-human species, and framework regions from a human immunoglobulin molecule. Typically, framework residues in the human framework regions will be substituted with corresponding residues from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions of CDRs and framework residues to identify framework residues important for antigen binding, and performing sequence comparisons to identify unusual framework residues at particular positions. (See eg, Queen et al., US Patent No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entirety).抗體可以使用本領域已知的多種技術進行人源化，包括例如CDR移植(EP 239400；PCT公開號WO 91/09967；美國專利第5225539；5530101；和5585089號)，貼面(veneering)或重新表面化(resurfacing)(EP 592106；EP 519596；Padlan， Molecular Immunology 28(4/5)：489-498(1991)；Studnicka等， Protein Engineering 7(6)：805-814(1994)；Roguska等， Proc.Natl.Sci.USA 91：969-973(1994))和鏈改組(chain shuffling)(美國專利第5565332號，其全文引用併入本文)。

Fully human antibodies are particularly desirable for the therapeutic treatment of human patients. Human antibodies can be prepared by various methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT Publication Nos. WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.

Human antibodies can also be produced using transgenic mice that do not express functional endogenous immunoglobulins but instead express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Additionally, human variable, constant, and diversity regions, in addition to human heavy and light chain genes, can be introduced into mouse embryonic stem cells. Mouse heavy and light chain immunoglobulin genes can be introduced into human immunoglobulin loci by homologous recombination individually or simultaneously without being functionalized. In particular, homozygous deletion of the JH region prevents endogenous antibody production. Modified embryonic stem cells were expanded and microinjected into blastocysts to generate chimeric mice. The chimeric mice are then bred to produce homozygous offspring expressing human antibodies. Transgenic mice are immunized in the normal manner with the selected antigen, eg, all or a portion of the desired polypeptide of interest. Monoclonal antibodies against the antigen can be obtained from immunized transgenic mice using conventional fusionoma technology. Transgenic mice harbor human immunoglobulin transgenes that rearrange during B-cell differentiation, followed by class switching and somatic mutation. Thus, using this technique, therapeutically useful IgG, IgA, IgM and IgE antibodies can be produced. For an overview of this technique for generating human antibodies, see Lonberg and Huszar Int. Rev. Immunol. 73:65-93 (1995). For a detailed discussion of this technique for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT Publication Nos. WO 98/24893; WO 96/34096; WO 96/33735; U.S. Patent Nos. 5,413,923; ; and 5939598, which is incorporated herein by reference in its entirety. In addition, companies such as Abgenix, Inc. (Freemont, Calif.) and GenPharm (San Jose, Calif.) are available to provide human antibodies against selected antigens using techniques similar to those described above.

Fully human antibodies that recognize selected epitopes can also be generated using a technique known as "guided selection." In this approach, selected non-human monoclonal antibodies, such as mouse antibodies, are used to guide the selection of fully human antibodies that recognize the same epitope. Jespers et al., Bio/Technology 72:899-903 (1988). See also US Patent No. 5,565,332, which is incorporated herein by reference in its entirety.

In another embodiment, DNA encoding the desired monoclonal antibody can be readily isolated and sequenced using conventional procedures (eg, by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). A preferred source of this DNA is isolated and sub-selected fusionoma cells. Once isolated, the DNA can be placed into expression vectors, which are then transfected into prokaryotic or eukaryotic host cells, such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulins. Even In particular, isolated DNA (which may be synthesized as described herein) can be used to colonize constant and variable region sequences for production of antibodies, as described in Newman et al., U.S. Patent No. 5,658,570, filed January 25, 1995, which is incorporated herein by reference. Basically, this entails extracting RNA from selected cells, converting to cDNA, and amplifying by PCR using Ig-specific primers. Suitable primers for this purpose are also described in US Patent No. 5,658,570. As will be discussed in more detail below, transformed cells expressing the desired antibody can be grown in relatively large numbers to provide clinical and commercial supplies of the immunoglobulin.

In addition, using conventional recombinant DNA techniques, one or more CDRs of an antigen-binding polypeptide of the invention can be inserted into framework regions, eg, human framework regions, to humanize non-human antibodies. The framework regions may be naturally occurring or consensus framework regions, preferably human framework regions (see, eg, Chothia et al., J. Mol. Biol. 278:457-479 (1998) for a list of human framework regions). Preferably, the polynucleotide resulting from the combination of the framework regions and CDRs encodes an antibody that specifically binds to at least one epitope of the desired polypeptide (eg, LIGHT). Preferably, one or more amino acid substitutions may be made within the framework regions, and preferably such amino acid substitutions enhance binding of the antibody to its antigen. In addition, these methods can be used to substitute or delete amino acids of one or more variable region cysteine residues that form intrachain disulfide bonds to generate antibody molecules that lack one or more intrachain disulfide bonds. The present invention encompasses other modifications of polynucleotides, which are also within the skill of the art.

In addition, techniques developed for the generation of "chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci. USA : 851-855 (1984); Neuberger et al., Nature 372: 604-608 (1984); Takeda et al., Nature 314: 452-454 (1985)), i.e. splicing of genes with appropriate antigen specificities from mouse antibody molecules, can be used, and genes from human antibody molecules with appropriate biological activity. As used herein, a chimeric antibody is a molecule in which different portions are derived from different animal species, eg, a molecule having variable regions derived from a mouse monoclonal antibody and human immunoglobulin constant regions.

Newman, Biotechnology 10: 1455-1460 (1992) discloses another highly efficient method for producing recombinant antibodies. Specifically, this technique leads to the generation of primatized antibodies comprising monkey variable domains and human constant sequences. This document is incorporated herein by reference. Additionally, this technique is also described in US Patent Nos. 5,658,570, 5,693,780, and 5,756,096, each of which is incorporated herein by reference in its entirety, to the same assignee.

Alternatively, antibody-producing cell lines can be selected and grown using techniques well known to those skilled in the art. This technique is described in various laboratory manuals and primary literature. In this regard, techniques suitable for use in the present invention, as described below, are described in Current Protocols in Immunology , edited by Coligan et al., Green Publishing Associates and Wiley-Interscience, John Wiley and Sons, New York (1991), which is incorporated herein by reference in its entirety including the accompanying text.

Furthermore, standard techniques known to those of skill in the art that can be used to introduce mutations in the nucleotide sequences encoding the antibodies of the invention include, but are not limited to, site-directed mutagenesis and PCR-mediated mutagenesis resulting in amino acid substitutions. Preferably, the variant (including derivatives) encodes less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 20 amino acid substitutions, More than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions. Alternatively, mutations can be introduced randomly along all or part of the coding sequence, eg, by saturation mutagenesis, and the resulting mutants can be screened for biological activity to identify mutants that retain activity.

cancer treatment

As described herein, the antibodies, variants or derivatives of the invention find use in certain therapeutic and diagnostic methods.

The present invention further relates to antibody-based therapy, which involves administering antibodies of the present invention to patients, such as animals, mammals and humans, for the treatment of one or more of the disorders or conditions described herein. Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including variants and derivatives thereof described herein) and nucleic acids or polynucleotides encoding antibodies of the invention (including variants and derivatives thereof described herein).

Antibodies of the invention may also be used to treat or inhibit cancer. PD-1 can be overexpressed in tumor cells. Tumor-derived PD-1 can bind to PD-L1 on immune cells, thereby limiting antitumor T cell immunity. The results of using small molecule inhibitors or monoclonal antibodies targeting PD-1 in mouse tumor models indicate that targeting PD-1 therapy is an important solution and a realistic way to effectively control tumor growth. As shown in the experimental examples, anti-PD-1 antibody initiates adaptive immune response mechanism, which can lead to improved survival rate of cancer patients.

Accordingly, in some embodiments, methods for treating cancer in a patient in need thereof are provided. In a specific embodiment, the method involves administering to a patient an effective amount of an antibody of the invention. In some embodiments, at least one cancer cell (eg, a stromal cell) in the patient expresses, overexpresses, or is induced to express PD-1. For example, induction of PD-1 expression can be accomplished by administering tumor vaccines or radiation therapy.

Tumors expressing PD-1 protein include bladder cancer, non-small cell lung cancer, renal cancer, breast cancer, urethral cancer, colorectal cancer, head and neck cancer, squamous cell carcinoma, Merkel cell carcinoma, gastrointestinal cancer, gastric cancer, esophageal cancer, ovarian cancer, renal cancer and small cell lung cancer. Accordingly, the antibodies of the invention may be used to treat any one or more of such cancers.

The invention also provides cell therapy, such as chimeric antigen receptor (CAR) T cell therapy. Suitable cells can be used, contacted with an anti-PD-1 antibody of the invention (or which are engineered to express an anti-PD-1 antibody of the invention). Following this exposure or engineering, the cells can be introduced into cancer patients in need of treatment. A cancer patient can have any type of cancer disclosed herein. For example, the cells (eg, T cells) may be tumor infiltrating T lymphocytes, CD4+ T cells, CD8+ T cells, or combinations thereof, but are not limited thereto.

In some embodiments, the cells are isolated from the cancer patient himself. In some embodiments, the cells are provided by a donor or a cell bank. Unwanted immune responses can be minimized when the cells are isolated from cancer patients.

Other diseases or conditions associated with increased cell survival that may be treated, prevented, diagnosed and/or prognosed by the antibodies of the invention or variants or derivatives thereof, including but not limited to progression and/or metastasis of malignant tumors, and related disorders such as leukemia (including acute leukemia (such as acute lymphoblastic leukemia, acute myelocytic leukemia (including myeloid blasts, premyeloid cells, myelomonocytes, monocytes, and erythroleukemia) and chronic leukemia (such as chronic myeloid (granulocytic) leukemia) ) leukemia) and chronic lymphocytic leukemia), polycythemia vera, lymphoma (such as Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors, including but not limited to sarcomas and carcinomas, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial Sarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, synovial tumor, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, thyroid cancer, endometrial cancer, melanoma, prostate cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary carcinoma, cystadenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma cancer, hepatocellular Hepatoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroglioma ), meningioma, melanoma, neuroblastoma, and retinoblastoma.

Treatment of infections and immune disorders

As shown in the experimental examples, the antibody of the present invention can initiate an immune response and thus can be used to treat infection.

Infection is the process by which pathogens invade the body tissues of organisms, their proliferation, and the response of host tissues to these organisms and the toxins they produce. Infections can be caused by infectious agents such as viruses, viroids, prions, bacteria, nematodes such as parasitic roundworms and pinworms, arthropods such as ticks, mites, fleas and lice, fungi such as ringworm, and other large parasites such as tapeworms and other helminths. In one aspect, the infectious agent is a bacterium, such as a Gram-negative bacterium. In one aspect, the infectious agent is a virus, such as a DNA virus, RNA virus, and retrovirus. Non-limiting examples of viruses include adenovirus, Coxsackie virus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus-1, herpes simplex virus-2, cytomegalovirus, human herpesvirus-8, HIV, influenza virus, measles virus, mumps virus, human papilloma virus, parainfluenza virus, polio virus, rabies virus, respiratory syncytial virus, rubella virus, varicella virus zoster virus.

In some specific embodiments, methods or uses of antibodies or fragments thereof for treating immune disorders are also provided. Non-limiting examples of immune disorders include infection, infection-related endotoxic shock, arthritis, rheumatoid arthritis, asthma, COPD, pelvic inflammatory disease, Alzheimer's disease, inflammatory bowel disease, Crohn's disease, ulcerative colitis, Peyronie's disease, celiac disease, gallbladder disease, Pilonidal disease, peritonitis, psoriasis, vasculitis, surgical adhesions, stroke, type I diabetes, Lyme disease, arthritis, meningoencephalitis, autoimmune uveitis, immune-mediated inflammatory diseases of the central and peripheral nervous system, multiple sclerosis, lupus and Guillain-Barre syndrome, Atopic dermatitis, autoimmune hepatitis, fibrous alveolitis, Graves' disease, IgA nephropathy, idiopathic thrombocytopenic purpura, Meniere's disease, pemphigus, primary biliary cirrhosis, sarcoidosis, scleroderma, Wegener's granulomatosis, pancreatitis, trauma, graft versus host disease, graft rejection, ischemic disease, myocardial infarction, atherosclerosis, intravascular coagulation, bone resorption, osteoporosis, osteoarthritis inflammation, periodontitis, hypochlorhydria and infertility associated with lack of fetal and maternal tolerance.

Antibodies of the invention can also be used to treat infectious diseases caused by microorganisms, or to kill microorganisms, by targeting microorganisms and immune cells to achieve elimination of microorganisms. In one aspect, the microorganism is a virus including RNA and DNA viruses, Gram positive bacteria, Gram negative bacteria, protozoa or fungi.

The particular dosage and treatment regimen for any particular patient will depend on a variety of factors, including the particular antibody, variant or derivative thereof used, the patient's age, weight, general health, sex and diet, as well as the timing of administration, excretion rate, drug combination, and the severity of the particular disease being treated. The judgment of the healthcare provider on these factors is within the ordinary skill of the art. The amount will also depend on the individual patient to be treated, the route of administration, the type of formulation, the nature of the compound employed, the severity of the disease, and the effect desired. The amount used can be determined by principles of pharmacology and pharmacokinetics well known in the art.

Methods of administration of the antibody, variant include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural and oral routes. The antigen binding polypeptide or composition can be Administration can be by any convenient route, such as by infusion or perfusion (bolus injection), absorption by epithelial or mucocutaneous linings (eg, oral mucosa, rectal and intestinal mucosa, etc.), and can be administered together with other biologically active agents. Accordingly, pharmaceutical compositions containing an antigen-binding polypeptide of the invention can be administered orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (e.g., by powder, ointment, drops, or a transdermal patch), buccally, or orally or as a nasal spray.

The term "parenteral" in this Act refers to administration methods including intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

Administration can be systemic or local. Furthermore, it may be desirable to introduce antibodies of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by a ventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be used, for example, by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

It may be desirable to administer the antibody polypeptide or composition locally to the area in need of treatment; this may be accomplished by, for example, local infusion during surgery, local application, e.g., in conjunction with a post-surgical dressing, by injection, by catheter, by suppository, or by implant (which is a porous, non-porous, or gel-like material, including, but not limited to, membranes such as sialastic membranes or fibers). Preferably, when administering proteins, including antibodies of the invention, care must be taken to use materials that do not absorb the protein.

In another specific embodiment, the antibody or composition can be delivered in a vesicle, particularly a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler eds., Liss, New York, pp. 353-365 (1989); Lopez - Berestein, op. cit., pp. 317-327; see also above for general information.)

In yet another embodiment, the antigen-binding polypeptide or composition can be delivered in a controlled release system. In a specific embodiment, a pump can be used (see Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another specific embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise eds., CRC Press., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball eds., Wiley, New York (1984); Ranger and Peppas, J., 1983, Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled release system can be placed near the target of treatment (ie, the brain), thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (1990, Science 249: 1527-1533).

在本發明的組合物中包含核酸或編碼蛋白質的多核苷酸的具體實施例中，所述核酸可以在活體內施用以促進其編碼的蛋白的表現，即將其構建為適當的核酸表現載體的一部分，使其進入細胞內，例如，藉由使用逆轉錄病毒載體(見美國專利第4980286號)，或藉由直接注射，或藉由使用微粒轟擊(例如，基因槍；生物槍(Biolistic)，Dupont)，或用脂類或細胞表面受體或轉染劑包被，或藉由將其與已知進入細胞核的同源盒樣(homebox-like)肽連接(參見，例如Joliot等，1991, Proc. Natl.Acad.Sci. USA 88：1864-1868)。 Alternatively, the nucleic acid can be introduced into the cell and incorporated into the host cell DNA by homologous recombination for expression.

The amount of an antibody of the invention that will be effective in treating, inhibiting and preventing inflammatory, immune or malignant diseases, disorders or conditions can be determined by standard clinical techniques. In addition, in vitro assays may optionally be used to help identify optimal dosage ranges. The precise dosage to be used in the formulation will also depend on the route of administration, and the severity of the disease, disorder or condition, and should be decided according to the judgment of the practicing physician and each patient's circumstances. Effective doses can be extrapolated from dose-response curves obtained in vitro or in animal model test systems.

As a general recommendation, the dose of the antigen-binding polypeptide of the invention administered to a patient is typically 0.1 mg/kg to 100 mg/kg of patient body weight, 0.1 mg/kg to 20 mg/kg of patient body weight, or 1 mg/kg to 10 mg/kg of patient body weight. In general, human antibodies have a longer half-life in humans than antibodies from other species due to the immune response to the foreign polypeptide. Thus, lower doses of human antibodies and less frequent administration are often possible. In addition, the dose and frequency of administration of the antibodies of the invention can be reduced by enhancing antibody uptake and tissue penetration (eg, into the brain) through modifications such as lipidation.

Methods of treating an infectious or malignant disease, condition or disorder, comprising administering an antibody, variant or derivative thereof, of the invention are typically tested in vitro and then in vivo in acceptable animal models for the desired therapeutic or prophylactic activity prior to use in humans. Suitable animal models include transgenic animals and are well known to those of ordinary skill in the art. For example, in vitro assays demonstrating the therapeutic utility of the antigen-binding polypeptides described herein include the effect of the antigen-binding polypeptides on cell lines or patient tissue samples. The effect of antigen-binding polypeptides on cell lines and/or tissue samples can be determined using techniques known to those skilled in the art, such as assays disclosed elsewhere herein. According to the present invention, it can be used to determine whether it is an indication for administering a specific antigen-binding polypeptide In vitro assays include in vitro culture cell assays in which a patient tissue sample is grown in culture and exposed or otherwise administered to a compound and the effect of the compound on the tissue sample is observed.

A variety of delivery systems are known and can be used to administer the antibodies of the invention or polynucleotides encoding the antibodies of the invention, e.g., entrapment in liposomes, microparticles, microcapsules, recombinant cells capable of expressing compounds, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of nucleic acids as part of retroviruses or other vectors, etc.

diagnosis method

Overexpression of PD-1 has been observed in certain tumor samples, and patients with PD-1 overexpressing cells may respond to treatment with anti-PD-1 antibodies of the invention. Antibodies of the invention are therefore also useful for diagnostic and prognostic purposes.

A sample, preferably comprising cells, can be obtained from a patient, who may be a cancer patient or a patient for whom diagnosis is desired. The cells are cells of tumor tissue or tumor mass, a blood sample, a urine sample, or any sample from a patient. Upon optional pretreatment of the sample, the sample can be incubated with an antibody of the invention under conditions that allow the antibody to interact with PD-1 protein that may be present in the sample. Methods such as ELISA can be used to detect the presence of PD-1 protein in a sample using an anti-PD-1 antibody.

The presence (and, optionally, its amount or concentration) of PD-1 protein in a sample can be used in the diagnosis of cancer, as an indication that the patient is suitable for treatment with the antibody, or as an indication that the patient is responding (or not) to cancer treatment. For a prognostic approach, detection may be performed once, twice, or more at certain stages after initiation of cancer treatment to indicate the progress of the treatment.

combination

The present invention also provides pharmaceutical compositions. Such compositions comprise an effective amount of antibody and acceptable carriers. In some embodiments, the composition also includes a second anti-cancer agent (eg, an immune checkpoint inhibitor).

In particular embodiments, the term "pharmaceutically acceptable" refers to a drug approved by a regulatory agency of the Federal or a state government or listed in the US Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, especially humans. Furthermore, a "pharmaceutically acceptable carrier" will generally be a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.

The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, dry skim milk, glycerol, propylene, glycol, water, ethanol, and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, such as acetates, citrates or phosphates. Also included are agents such as antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and tonicity adjusting agents such as sodium chloride or dextrose. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Examples of suitable pharmaceutical carriers are described by E.W. Martin in Remington's Pharmaceutical Sciences, which is incorporated herein by reference. Such compositions will comprise a therapeutically effective amount of an antigen-binding polypeptide, preferably in purified form, together with an appropriate amount of carrier, in a form suitable for administration to the patient. The preparation should conform to the mode of administration. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

In a particular embodiment, the composition is formulated according to conventional procedures as a pharmaceutical composition suitable for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. If necessary, the composition may also include a solubilizer and a local anesthetic such as lidocaine to relieve pain at the injection site. Generally, the ingredients are supplied alone or mixed together in unit dosage form, eg, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container, such as an ampoule or sachet, indicating the quantity of active agent. Where the composition is administered by infusion, it may be dispensed using an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

The compounds of the present invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions, such as those derived from hydrochloric, phosphoric, acetic, oxalic, and tartaric acids, and the like, and those formed with cations, such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, and the like.

Example Example 1: Generation of human monoclonal antibodies against human PD-1 Cloning of full-length human PD-1 cDNA

Human T lymphocytes were isolated from human peripheral blood lymphocytes (PBMC) using MACS beads (MiltenyiBiotec). Total RNA was extracted from human T cells with RNeasy Mini Kit (QiAGEN), and cDNA was obtained by reverse transcription PCR (SuperScript First-Strand Synthesis System, Invitrogen). Using the sense primer (5'- CTGTCTAGAATGCAGATCCCACAGGCGCC, SEQ ID NO: 47) and an antisense primer (5' GGATCCTCAGAGGGGCCAAGAGCAGT, SEQ ID NO: 48) were used to generate a full-length cDNA encoding hPD-1 from human T cell mRNA by RT-PCR. Sequences were verified by DNA sequencing and comparison with the NCBI database (NM-005018.2).

Establishment of hPD-1 stably expressing cell lines : After digestion with Xbal and BamHI, the hPD-1 PCR fragment was cloned into PCDA3.1(-) vector (Invitrogen). The pcDNA-hPD-1 full-length plastids were then transfected into Chinese hamster ovary (CHO) cells using lipofectamine 2000 (Invitrogen). Cell lines stably expressing hPD-1 (CHO/hPD-1) were selected by G418 and screened by flow cytometry.

Generation of human PD-1 Ig fusion protein : cDNA of hPD-1 mIg and hPD-1 hIg fusion protein containing hPD-1 ectodomain was amplified by PCR from full-length pcDNA-hPD-1 with specific primers. The PCR fragment digested with EcoR I and Bgl II was fused to the CH2-CH3 domains of the mouse IgG2a heavy chain in plastid-expressing pmIgG or to the human IgG1 heavy chain expressing plastid phIgG (H Dong et al. Nat Med. 1999; 5:1365-1369). The protein in the culture supernatant was purified by protein A Sepharose gel column (HiTrap Protein A HP, GE healthcare). The purified protein was confirmed by SDA-PAGE electrophoresis.

Production of monoclonal antibodies : Female Balb/c mice aged 8–10 weeks were immunized subcutaneously (sc) at multiple sites with 200 μL of emulsion containing 100 μg of hPD-1mIg fusion protein and complete Freund’s adjuvant (CFA) (Sigma Aldrich). Three weeks later, mice were immunized subcutaneously (sc) three times with 50-100 μg protein and incomplete Freund's adjuvant (IFA) (Sigma Aldrich). The mice were bled 2 weeks after each immunization for serum titer determination. When the titer was sufficient, mice were boosted by intraperitoneal (ip) injection of 60 μg of protein in PBS. Fusogenic tumors were obtained by fusing splenocytes from immunized mice with the SP2/0-Ag14 myeloma cell line (from ATCC). Immunoboosted mice were sacrificed with carbon dioxide, and spleens were aseptically harvested. Whole spleens were dissociated into a single cell suspension, and erythrocytes were lysed with ACK buffer. Mix SP2/0-Ag14 myeloma and splenocytes in a 1:1 ratio in a 50 mL conical centrifuge tube. After centrifugation, the supernatant was discarded and 50% polyethylene glycol (Roche) was used for cell fusion. The fusion cells were cultured in HAT selection medium for 8-10 days, and the fusion tumor culture supernatant was screened for binding to hPD-1 expressing cells with a high-throughput transfection and screening system (S Yao et al. Immunity. 2011; 34(5):729-40), and the positive strains were confirmed by flow cytometry analysis. Use the limiting dilution technique to subselect positive fusion tumors at least 5 times to achieve pure single plant culture.

Example 2: Characterization of PD-1 monoclonal antibody

Isotyping of mAbs : Isotyping of mAbs was identified using the Mouse Immunoglobutin Isotyping Kit (BD Biosciences). All five PD-1 mAbs were IgG1 isotype and kappa chain type.

Anti-hPD-1 binding specificity : The specificity of PD-1 mAb was determined by flow cytometry using CHO cells expressing hPD-1 on the surface (CHO/hPD-1). CHO/hPD-1 cells were incubated with anti-PD-1 mAb on ice. After incubation, cells were washed and further incubated with anti-mIgG-APC (eBiosciences). Flow cytometric analysis was performed using FACSVerse (BD Biosciences). The data showed that all five hPD-1 mAbs bound hPD-1 with high specificity (Figure 1). To rule out the possibility of hPD-1 mAb binding to other proteins, CHO cells transfected with hB7-1, hPD-L1, hB7-H3, hB7-H4, hCD137 or other protein molecules were stained with anti-hPD-1 mAb by flow cytometric analysis. These cells were also separately stained with their respective positive antibodies as a positive control. The data showed that anti-PD-1 mAbs did not bind the proteins tested (Figure 2).

Species cross-reactivity : To evaluate the species specificity of anti-hPD-1 mAbs, peripheral blood mononuclear cells (PBMCs) of cynomolgus monkeys (from Guangdong landau Biotechnology Company) were isolated from peripheral blood using Ficoll (Sigma Aldrich). PBMCs were suspended in RPMI 1640 medium containing 10% FCS, and placed in 24-well plates precoated with 1 μg/ml anti-hCD3. Cells were cultured for 2 days. Cells were first stained with anti-hPD-1. After washing, cells were stained with anti-mIgG-APC and CD3-FITC; CD8-PerCP for flow cytometric analysis. In addition, the cross-reactivity of mAbs to mouse PD-1 was determined by flow cytometry using mouse PD-1 transfected CHO cells (CHO/mPD-1).

The data showed that the anti-hPD-1 mAb could bind to the PD-1 protein on human and cynomolgus monkey T cells, and no cross-binding was found for mouse PD-1 (Figure 3).

Ligand Blocking : To examine the blocking of ligand binding, 100 ng of hPD1hIg fusion protein was pre-incubated with indicated doses of mAb (400, 300, 200, 100, 50 ng/10ul) or control Ig at 4°C for 30 min and then used to stain CHO/hB7-H1 cells. Cells were washed and further stained with goat anti-hlgG-APC. The blocking effect was detected by flow cytometry.

The results showed that anti-hPD-1 mAbs 1 and 2 (Ab1 and Ab2) had no effect on ligand blockade. Ab3, Ab4 and Ab5 could block the binding of hPD-1 fusion protein to hPD-L1 in a dose-dependent manner (Fig. 4).

Competitive binding assays : Competitive binding assays were performed to investigate whether these mAbs recognized the same or different binding sites of the hPD-1 protein. CHO/hPD-1 cells were pre-incubated with five excess PD-1 mAbs (10 μg) for 30 minutes at 4°C, respectively. After washing, cells were incubated with 50 ng of different biotin-labeled mAbs for 20 min at 4°C. mAb binding was measured using flow cytometry.

Flow cytometric analysis showed that Ab4 and Ab5 completely abolished each other's hPD-1 For protein binding, a saturated dose of Ab3 partially blocked the binding of Ab4 and Ab5, while Ab1 and Ab2 had no blocking effect on the binding of Ab4 and Ab5 to hPD-1 (Figure 5). Therefore, the binding sites of Ab4 and Ab5 on PD-1 may overlap. Ab1 or Ab2 and Ab4 or Ab5 bind to PD-1 through different interfaces, which was also confirmed by ligand blocking experiments.

Example 3: Sequencing and antibody humanization of fusion tumors producing anti-PD-1 antibodies

Sequencing of fusionomas producing anti-PD-1 mAb : 1 × ¹⁰⁷ fusionoma cells were harvested and washed with PBS. Messenger RNA was extracted from fusion tumors using RAeasy Mini Kit (Qiagen). RACE-Ready first-strand cDNA was synthesized using the SMARTer RACE cDNA Amplification Kit (Clontech). After reverse transcription, use the prepared cDNA as a template, the 5' universal primer (UPM) provided by the kit, and the 3' gene-specific primer (GSP1) designed according to the mouse IgG1 heavy chain variable region and κ light chain gene sequence to carry out 5' RACE PCR reaction. RACE products were confirmed by gel electrophoresis analysis (Figure 6). PCR products were cloned into T vectors using Zero Blunt TOPO PCR Cloning Kit (Invitrogen). After transformation, plastids were verified by sequencing analysis. Antibody gene fragments were analyzed using VBASE2 (http://www.vBas2.org). Sequences are disclosed in (Table 2).

Protein expression and function determination of the recombinant antibody : In order to ensure the correctness of the recombinant antibody sequence, the full-length sequences of the heavy chain and light chain of the recombinant antibody were respectively cloned into the pcDNA3.1 vector and temporarily transfected into HEK 293T cells. Proteins from cell culture supernatants were purified using protein G sepharose columns (GE healthcare) for functional evaluation.

Flow cytometry data showed that the recombinant antibody could bind hPD-1 protein and block the binding of hPD-1 fusion protein to PD-L1 protein (Figure 7, panel A, B)

Humanization of anti-human PD-1 antibody : Humanization was performed based on the variable heavy chain (VH) and variable light chain (VL) sequences of the anti-hPD-1 fusion tumor. Briefly, mouse-human chimeric mAbs containing mouse parental VH and VL sequences as well as human IgG4-S228P constant regions and human kappa chains were first constructed. After characterizing the chimeric antibody, three VL and three VL humanized sequences were designed and used to make nine humanized antibodies. Sequences are listed in (Tables 3A and 3B).

Example 4: Characteristics and functions of humanized antibodies

Binding Ability of Humanized Antibodies : CHO/hPD-1 cells were incubated with serially diluted mAbs. Binding of nine humanized antibodies to the PD-1 protein was evaluated by flow cytometry and compared to the chimeric parental antibody.

The results of flow cytometry analysis showed that the binding activity of some mutant combinations was higher than that of the parental antibody, and some were the same as or slightly lower than that of the parental antibody (Figure 8). The mutant combinations are listed in Table 4 below.

Blocking ability of humanized antibody : measure the ability of humanized antibody to block the binding of hPD-1 to hPD-L1. 100 ng of hPD1 mlg were pre-incubated with different doses of humanized antibodies in 10 μL PBS for 30 minutes at 4° C. and then used to stain CHO/hB7-H1 cells. Cells were washed and further stained with goat anti mIgG-APC. The blocking effect was evaluated by flow cytometry. Using a similar approach, the ability of the humanized antibodies to block the binding of hPD-1 to hPD-L2 was measured.

The results showed that all humanized antibodies inhibited the binding of hPD-1mIgG to CHO/hPD-L1 cells in a dose-dependent manner. Some mutant combinations had higher blocking ability than the chimeric parental antibody (Figure 9). The results also showed that the binding of hPD-ImIgG to CHO/hPD-L2 cells was also blocked (Figure 10).

Binding affinity and kinetics determination of humanized antibody : Biacore T100 (GE Healthcare Life Sciences) was used to evaluate the binding affinity and kinetics of humanized PD-1 mAb interaction with hPD-1 protein. The hPD-1mIg protein was immobilized on the sensor chip CM5 by amine coupling. The filtered humanized antibody was diluted with HBS-EP buffer pH 7.4 (GE Healthcare Life Sciences) and then injected on the hPD-ImIg immobilized surface. Nine different concentrations were tested for each sample. Detailed binding kinetic parameters (association rate, Ka, dissociation rate, Kd, and affinity constant, KD) can be determined by total kinetic analysis.

Analysis of the data showed no significant difference in the association rate (Ka) between the mutant combination and the chimeric parental antibody. The three mutant combinations (3,6,9) approached the chimeric parent antibody in terms of off-rate (Kd). All humanized antibodies have strong affinity with KD values in the low nanomolar range (10 ^-10 M). The KD values of the two mutant combinations (3,6) were close to those of the chimeric parent antibody (9.89×10 ^-11 M) (Table 4).

Enhancement of anti-PD-1 on allogeneic CD8+ CTL killing of PD-L1 positive tumor cells in vitro : Based on the anti-tumor mechanism of anti-PD-1 antibodies, this example designed an in vitro model to determine the enhancing effect of anti-PD-1 antibodies on human allogeneic CD8+ cytotoxic lymphocytes (allogeneic CD8 ⁺ CTL) killing tumor cells. First, CD8+ lymphocytes were isolated from human PMBC and cultured with human melanoma cells (624Mel/B7-1) irradiated and transfected with hB7-1 to generate allogeneic CD8 ⁺ cyto CTL. Allogeneic CD8 ⁺ CTLs were then co-cultured with overnight cultured 624 Mel/hPD-L1 tumor cells in 96-well plates for 5 days in the presence of humanized antibody or control Ig. The cells in the wells of the plate were stained with 0.5% crystal violet, and the plate was read at 540 nm with an ELISA reader. Killing activity was calculated based on the survival rate of tumor cells.

% Cytotoxicity = (Absorbance of 100% living cell control well - Absorbance of test well) / Absorbance of 100% living cell control well x 100

The results showed that certain combinations of mutants could enhance the ability of allogeneic CTL cells to kill tumor cells in vitro ( FIG. 11 ).

The best set of mutant combinations (variant 3) was selected, the protein coding sequence was cloned into a suitable expression vector, and transferred into CHO cells to produce anti-hPD-1 antibody, also known as TY101.

Example 5: Characteristics of TY101 in cancer immunotherapy

Cytokines enhance mixed lymphocyte reaction (MRL) in PBMC . Human peripheral blood mononuclear cells (PBMC) from healthy individuals were isolated by density gradient centrifugation using Ficoll-Hypaque. PBMCs from healthy donor 1 were irradiated with X-rays at a dose of 40 Gy as stimulator cells. T lymphocytes were isolated from healthy donor 2 as responder cells using the Human Pan T cell Isolation Kit (MiltenylBiotec). Responder cells and stimulator cells were resuspended in complete RPMI medium containing 10% FCS, and 2.5× ¹⁰⁵ responder cells and 1.25× ¹⁰⁵ stimulator cells (R/S=2) per well were seeded into 96-well plates in the presence of serially diluted TY101 or hIgG control. Cells were cultured at 37 °C for 5 days in a humidified incubator with 5% _CO2 . The proliferative activity of T cells was evaluated on day 5 by Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc). For cytokine detection, culture supernatants were collected on day 3 and day 5. Cytokine analysis was performed using the Human Th1/Th2/Th17 Cytometric Bead Array kit (CBA; BD Biosciences).

The results showed that the proliferative response of T cells to TY101 was similar to hIgG ( FIG. 12 ). Interestingly, the production of cytokines IL-2 and IFNγ was significantly increased in the culture supernatant of TY101-administered MLRs compared with hIgG-administered (Fig. 13).

Block the expression of PD-1 on T lymphocytes . PD-L1 expression on tumor cells can induce PD-1 expression on tumor-infiltrating lymphocytes (TILs) in the tumor microenvironment and trigger PD-1-dependent immune suppression. This example designs an in vitro model to determine whether TY101 can inhibit hPD-1 expression on human lymphocytes when cultured with hPD-L1 transfected tumor cells. Human T lymphocytes isolated from human PBMCs were cultured with hPD-L1-transfected human melanoma (624/hPD-L1) cells in the presence of 10 μg/ml TY101 or control IgG for 4 days. The expression of hPD-1 on lymphocytes was detected by flow cytometry.

The results showed that the addition of TY101 completely inhibited the expression of PD-1 on lymphocytes compared with only medium and hIgG controls ( FIG. 14 ).

In vivo anti-tumor activity of humanized PD-1 antibody : To study the anti-tumor effect of TY101 in vivo. 8-week-old female human PD-1 knock-in (knock-in) mice (purchased from Shanghai Model Organisms Center, Inc.) were subcutaneously (sc) implanted with hPD-L1-transfected MC38 tumor cells (MC38/hPD-L1) on the right flank (1×10 ⁶ /mouse) on day 0. On days 6, 9 and 13, TY101 or control Ig (10 mg/kg) were administered as intraperitoneal (ip) injections. Tumor size and survival were monitored.

All animals initially had detectable tumors (4-5 mm at day 6). However, after treating mice with MC38/hPD-L1 tumors with TY101, a complete response occurred in 100% of the mice. Tumors in all five mice treated with TY101 completely regressed by day 25. In contrast, two of five mice that received control IgG developed persistently growing tumors. In three other mice treated with control IgG, although tumors also regressed at day 32, tumors recurred rapidly in two mice (Fig. 15). The results showed that TY101 could enhance the anti-tumor efficacy in vivo.

Example 6: Comparison of the functions of TY101 and commercially available PD-1 antibodies

In this example, two anti-hPD-1 antibodies currently approved for clinical treatment of cancer patients were selected for comparison with TY101: Merck's Keytruda (pembrolizumab) and Bristol-Myers Squibb's Opdivo (nivolumab).

Antibody binding affinity and kinetics : The affinity and kinetics of TY101 were analyzed with a Biacore T200 instrument (GE Healthcare Life Sciences) and compared with two commercially available antibodies. The hPD-1mIg protein was immobilized at a low concentration (33RU) on the sensor chip CM5, and the interaction was detected using an antibody as an analyte (mobile phase). The data showed that there was no significant difference in the association rate Ka of the three antibodies. TY101 is slightly lower than commercial antibodies. The dissociation rate Kd of TY101 is 1/10 slower than that of the two commercially available antibodies, and the affinity KD of TY101 is 4-7 times stronger than that of the commercially available antibodies. The results showed that TY101 showed stronger binding (Fig. 16).

Comparison of PD-1 Antibodies for PD-1/PD-L1 Blockade : PD-1/PD-L1 Blockade Bioassays were performed using the PD-1/PD-L1 Blockade Bioassays Kit (Promega). Jurkat-PD1 cells at 1×10 ⁵ cells/well were stimulated with overnight cultured CHO-PD-L1 cells (culture started at 5× ^{10 4} cells/well) in an opaque 96-well TC plate in the presence of serial dilutions (0–30 μg/ml) of TY101, pembrolizumab, nivolumab, or negative control hIgG4 for 5 h. After 5 h of incubation, Jurkat-PD-1 cell activation was detected by measuring luciferase activity in relative light units (RLU) with ONE-Glo substrate (Promega) on a SpectraMAX L luminometer.

Analysis data showed that TY101 and two commercially available antibodies could block the PD-1/PD-L1 pathway. The blocking effect of TY101 was similar to that of pembrolizumab, but better than that of nivolumab (Figure 17).

Comparison of tumor cell growth inhibition in vitro : Allogeneic CD8 ⁺ CTL cells were co-cultured in 96-well plates with overnight cultured 624Mel/PD-L1 tumor cells for 5 days in the presence of different mAbs and control IgG as previously described. Cells were stained with 0.5% crystal violet and plates were read at 540nm with an ELISA reader. Killing activity was calculated based on the survival rate of tumor cells.

The results showed that all three anti-PD-1 MAbs enhanced the tumor-killing activity of allogeneic CD8 ⁺ CTLs. The enhancing effect of TY101 was higher than that of two commercially available antibodies (Fig. 18).

Embodiment 7: Development of TY101 selected clone and its activity

The TY101 sequence was cloned into a proprietary expression vector and transfected into CHO cells. Single cell lines were established using ClonePix and/or limiting dilution. Several cloned strains were established, and the antibodies produced by three of these cloned strains (TY101-01-09, TY101-04-T3-05 and TY101-4G1) were characterized.

Test antibody binding to hPD-1 or mPD-1 protein (ELISA)

The binding of the antibody to hPD-1 and the cross-reactivity to mPD-1 protein were detected by ELISA method. Serial dilutions of test antibodies were added to ELISA plates precoated with 1 μg/ml hPD-1 or mPD-1. HRP-conjugated goat anti-human IgG or goat anti-mouse IgG antibody was then added, followed by the substrate tetramethylbenzidine (TMB), and quantified at a wavelength of 450 nm using a SpectraMax Plus 384 Microplate Reader (Molecular Device, LLC., Sunnyvale, CA). The tested TY101 clones TY101-01-09, TY101-04-T3-05 and TY101-4G1 showed good binding to hPD-1 protein, with EC50 in the range of 0.01-0.15nm. Antibodies showed no binding to mPD-1 protein (Figure 19).

Binding of test antibody to CHOK1 cells expressing hPD-1 and cPD-1 (flow cytometry)

Antibody binding to hPD-1 and cross-reactivity to cPD-1 were tested by flow cytometry using cells expressing hPD-1 or CHOK1 of cynomolgus PD-1 (cPD-1). CHOK1-hPD-1, CHOK1-cPD-1, and CHOK1 blank cells (blank) were incubated with serial dilutions of the test article, followed by incubation with Alexa Fluor® 488-conjugated goat anti-human IgG (H+L) antibody, and analyzed using the FACSCanto II (BD Biosciences, San Jose, CA) for analysis. The tested TY101 clones TY101-01-09, TY101-04-T3-05 and TY101-4G1 showed good binding with sub-nanomolar EC50s to CHOK1-hPD-1 and single-digit nanomolar EC50s to CHOK1-cPD-1 cells ( FIG. 20 ).

Antibody blocking activity against hPD-1/hPD-L1 or hPD-1/hPD-L2 binding (flow cytometry)

Further testing of these antibodies for their activity in blocking hPD-1/hPD-L1 as well as hPD-1/hPD-L2 binding will be key to the potential effectiveness of the treatment in cancer patients. CHOK1-hPD-1 cells were incubated with serially diluted test articles mixed with biotin-hPD-L1 or biotin-hPD-L2. Cells were then incubated with Alexa 488-labeled streptavidin and analyzed using the FACSCanto II. Anti-hPD-1 antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1 blocked the binding of hPD-L1 to CHOK1 cells expressing hPD-1 with IC50 in the range of 1.15-1.47nm. It also blocked the binding of hPD-L2 to hPD-1 expressing CHOK1 cells with IC50s in the range of 1.2-2.33nm (Figure 21).

Testing Antibody Effects on T Cells Using Human Mixed Leukocyte Reaction (MLR) Assay

The effect of these antibodies on T cell function was tested in a human MLR assay with T cells isolated from 2 donors. Adherent PBMCs (mainly monocytes, isolated from donor 1 and plated in cell culture dishes to allow adhesion) were cultured in the presence of 100 ng/ml recombinant human (rh)GM-CSF and 50 ng/ml rhIL-4 for 5 days, half the volume of medium was changed after 3 days, and 1 μg/ml LPS was added on day 6. On day 7, the resulting cells (mainly mature DCs) were harvested and treated with mitomycin C. CD3+ T cells were isolated from donors 2 and 3 with EasySep ^™ Human T Cell Isolation Kit (negative selection, STEMCELL Technologies). DCs and T cells were co-cultured for 5 days in the presence of 3 concentrations (5, 0.5, 0.05 μg/ml) of test antibodies. The supernatant was harvested after 3 days, and the concentration of IL-2 was measured, and the concentration of IFN-γ was measured after 5 days (100 μL). Anti-hPD-1 antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1, compared to the isotype control hIgG4, promoted IL-2 and IFN-γ secretion by cells from both donors in a dose-dependent manner ( FIG. 22 ).

Engineered tumor cell-human T cell co-culture method to test the effect of antibody on T cells

The effects of these antibodies on T cell function were tested in engineered tumor cell human-T cell co-culture assays using T cells isolated from 4 different donors. CD3 ⁺ T cells were isolated from PBMCs of 4 donors with EasySep ^TM Human T Cell Isolation Kit. The engineered tumor cell Hep3B-OSC-hPDL1, which is Hep3B cells engineered to stably express OS8 (anti-CD3 single-chain variable fragment (scFv)) and hPD-L1 (KCLB, catalog number: 88064), was treated with mitomycin C and co-cultured with CD3 ⁺ T cells in the presence of three concentrations (5, 0.5, 0.05 μg/ml) of the test antibody for 3 days, and the culture supernatant was harvested to measure IFN- gamma concentration. Anti-hPD-1 antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1 promoted IFN-γ secretion by cells from all 4 donors in a dose-dependent manner when compared to the isotype control hIgG4 ( FIG. 23 ).

Example 8: Compared with FDA-approved anti-hPD-1 antibodies, TY101 strains show better binding affinity Testing for Antibody Epitope Overlap by Competitive ELISA

Whether these antibodies bind to the same epitope as the FDA-approved anti-hPD-1 antibodies nivolumab or pembrolizumab was tested in a competitive ELISA assay. Serial dilutions of competing antibody and biotin-hPD-1 were added to ELISA plates precoated with 1 μg/ml test antibody. HRP-conjugated streptavidin was then added, followed by substrate TMB, and quantified using a SpectraMax Plus 384 Microplate Reader at a wavelength of 450 nm. Anti-hPD-1 antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1 almost completely blocked each other The combination with hPD-1 suggests that it has similar epitopes. These 3 antibodies also almost completely blocked the binding of nivolumab and pembrolizumab to hPD-1 (93% to 94%), whereas nivolumab and pembrolizumab only partially blocked the binding of these antibodies to hPD-1 (77%-78% for nivolumab and 46%-49% for pembrolizumab). These data suggest that the TY101-01-09, TY101-04-T3-05 and TY101-4G1 antibodies bind different epitopes than nivolumab B and pembrolizumab and may have higher affinity for hPD-1 than nivolumab B and pembrolizumab (Figure 24).

Antibody binding affinity to hPD-1 was tested by SPR assay

To obtain an accurate measure of binding affinity for hPD-1, antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1 as well as nivolumab and pembrolizumab were analyzed by SPR. Human PD-1 ECD protein was immobilized on the CM5 sensor wafer for different lengths of time to achieve low immobilization levels (at 60RU) in flow cell 3 and high immobilization levels (960RU) in flow cell 4. Serially diluted (0, 1.5625, 3.125, 6.25, 12.5, 25 and 50 nM) antibodies were injected into the flow cell. The association time was 180s and the dissociation time was 600s (for nivolumab and pembrolizumab) or 1500s (for TY101-01-09, TY101-04-T3-05 and TY101-4G1). Binding kinetics were calculated using BiaCore T200 evaluation software version 1.0 and a 1 : 1 binding model for curve fitting after subtraction of the reference (flow cell 1 ) and zero concentration signals from the samples. Control human IgG4 had no binding to hPD-1. Based on data from low immobilized levels of hPD-1 (~60 RU; Table 3; Figure 23), the anti-hPD-1 antibodies TY101-01-09, TY101-04-T3-05, and TY101-4G1 had slightly lower association rates for human PD-1 than nivolumab and pembrolizumab (2 to 4 times lower). The off-rates of human PD-1 for these 3 antibodies were as much as 12–30 times slower than those of nivolumab and pembrolizumab, resulting in their affinities up to 4–8 times higher than those of nivolumab and pembrolizumab (lower _K corresponds to better affinity and vice versa; Table 3). The binding affinities of anti-hPD-1 antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1 to hPD-1 were also tested on high immobilized levels of hPD-1. Antibodies TY101-01-09, TY101-04-T3-05 and TY101-4G1 showed very slow dissociation rates, almost no dissociation even after a dissociation time of 1500 seconds (Figure 23). The data showed that the binding affinity of TY101-01-09, TY101-04-T3-05 and TY101-4G1 was better than that of nivolumab and pembrolizumab, mainly due to the slow off-rate ( FIG. 25 ).

The scope of the invention is not to be limited by the specific embodiments described, which are intended as single illustrations of various aspects of the invention, and any functionally equivalent compositions or methods are intended to be within the scope of the invention. It will be apparent to those skilled in the art that various modifications and variations can be made in the methods and compositions of the invention without departing from the spirit or scope of the invention. Accordingly, this case is intended to cover modifications and variations of the present invention provided they come within the scope of the appended claims and their equivalents.

All publications and patent applications mentioned in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

<110> TAYU HUAXIA BIOTECH MEDICAL GROUP CO.,LTD.

<120> Anti-PD-1 antibody and its use

<140> TW 107117605

<141> 2018-05-23

<160> 48

<170> PatentIn Version 3.5

<210> 1

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 1

<210> 2

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 2

<210> 3

<211> 16

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 3

<210> 4

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 4

<210> 5

<211> 4

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<220>

<221> Other features

<222> (4)..(4)

<223> Xaa is a space filler, no amino acid required

<400> 5

<210> 6

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 6

<210> 7

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 7

<210> 8

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 8

<210> 9

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 9

<210> 10

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 10

<210> 11

<211> 4

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<220>

<221> Other features

<222> (4)..(4)

<223> Xaa is a space filler, no amino acid required

<400> 11

<210> 12

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 12

<210> 13

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 13

<210> 14

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 14

<210> 15

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 15

<210> 16

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 16

<210> 17

<211> 4

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<220>

<221> Other features

<222> (4)..(4)

<223> Xaa is a space filler, no amino acid required

<400> 17

<210> 18

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 18

<210> 19

<211> 135

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 19

<210> 20

<211> 354

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 20

<210> 21

<211> 108

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 21

<210> 22

<211> 324

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 22

<210> 23

<211> 140

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 23

<210> 24

<211> 357

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 24

<210> 25

<211> 357

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 25

<210> 26

<211> 336

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 26

<210> 27

<211> 123

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 27

<210> 28

<211> 369

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 28

<210> 29

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 29

<210> 30

<211> 336

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 30

<210> 31

<211> 450

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 31

<210> 32

<211> 1357

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 32

<210> 33

<211> 219

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 33

<210> 34

<211> 661

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 34

<210> 35

<211> 124

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 35

<210> 36

<211> 373

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 36

<210> 37

<211> 123

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 37

<210> 38

<211> 373

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 38

<210> 39

<211> 146

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 39

<210> 40

<211> 372

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 40

<210> 41

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 41

<210> 42

<211> 337

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 42

<210> 43

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 43

<210> 44

<211> 337

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 44

<210> 45

<211> 112

<212> PRT

<213> Artificial sequence

<220>

<223> synthesis

<400> 45

<210> 46

<211> 336

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 46

<210> 47

<211> 29

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 47

<210> 48

<211> 26

<212>DNA

<213> Artificial sequence

<220>

<223> synthesis

<400> 48

Claims (16)

An isolated antibody or fragment thereof specific to human programmed cell death protein 1 (PD-L1), wherein the antibody or fragment thereof comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 35, and the light chain variable region comprising the amino acid sequence of SEQ ID NO: 45. The antibody or fragment thereof according to claim 1, further comprising a heavy chain constant region, a light chain constant region, an Fc region or a combination thereof. The antibody or fragment thereof according to claim 2, wherein the light chain constant region is a κ chain or λ chain constant region. The antibody or fragment thereof according to claim 1, wherein the antibody or fragment thereof is an isotype of IgG, IgM, IgA, IgE or IgD. The antibody or fragment thereof according to claim 4, wherein the isotype is IgG1, IgG2, IgG3 or IgG4. The antibody or fragment thereof according to claim 1, wherein the antibody or fragment thereof is a humanized antibody. A composition comprising the antibody or fragment thereof according to any one of claims 1-6 and a pharmaceutically acceptable carrier. An isolated cell comprising one or more polynucleotides encoding the antibody or fragment thereof according to any one of claims 1-6. A use of the antibody or fragment thereof according to any one of claims 1-6, which is used to prepare a drug for treating cancer. Such as the use of claim 9, wherein the cancer is selected from the group consisting of bladder cancer, liver cancer, colon cancer, rectal cancer, endometrial cancer, leukemia, lymphoma, pancreatic cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, urethral cancer, head and neck cancer, gastrointestinal tract cancer, gastric cancer, esophagus cancer, ovarian cancer, kidney cancer, melanoma, prostate cancer and thyroid cancer. The use according to claim 9, wherein the treatment of cancer comprises: (a) treating cells in vitro with the antibody or fragment thereof according to any one of claims 1-6; (b) administering the treated cells to a patient. The use according to claim 11, wherein the cells are T cells. A use of the antibody or fragment thereof according to any one of claims 1-6, which is used to prepare a medicament for treating infection. The use according to claim 13, wherein the infection is a viral infection, a bacterial infection, a fungal infection or a parasitic infection. A use of the antibody or fragment thereof according to any one of claims 1-6, which is used to prepare a drug for treating immune disorders. Use as claimed in claim 15, wherein the immune disorder is selected from the group consisting of infection, infection-related endotoxic shock, arthritis, rheumatoid arthritis, asthma, COPD, pelvic inflammatory disease, Alzheimer's disease, inflammatory bowel disease, Crohn's disease, ulcerative colitis, Peyronie's disease, celiac disease, gallbladder disease, Pilonidal disease ), peritonitis, psoriasis, vasculitis, surgical adhesions, stroke, type 1 diabetes, Lyme disease, arthritis, meningoencephalitis, autoimmune uveitis, immune-mediated central and peripheral nervous system inflammatory diseases, multiple sclerosis, lupus and Guillain-Barr syndrome, atopic dermatitis, autoimmune hepatitis, alveolitis fibrosa, Grave's disease, IgA nephropathy, idiopathic platelets Attenuated purpura, Meniere's disease, pemphigus, primary biliary cirrhosis, sarcoidosis, scleroderma, Wegener's granulomatosis, pancreatitis, trauma, graft-versus-host disease, graft rejection, ischemic disease, myocardial infarction, atherosclerosis, intravascular coagulation, bone resorption, osteoporosis, osteoarthritis, periodontitis, hypochlorhydria, and infertility associated with fetal-maternal immune tolerance deficiency.