TWI776410B - Short synthetic peptide and their uses for treating dry eye disease - Google Patents

Abstract

Disclosed herein are synthetic peptides and pharmaceutical compositions comprising the same for the treatment of dry eye disease (DED). Also disclosed herein are methods of treating DED, by administering to a subject in need of such treatment an effective amount of a pharmaceutical composition containing the synthetic peptide of the present disclosure.

Description

Short synthetic peptide and its use in treating dry eye

The present disclosure pertains to the discovery of a short synthetic peptide that has antagonistic activity against αv integrins, thereby aiding in the treatment or prevention of dry eye disease (DED).

Dry eye disease (DED) is a multifactorial disorder of the ocular surface characterized by discomfort, visual disturbance, decreased tear production, and chronic inflammation. Decreased tear secretion and/or increased tear evaporation results in tear film instability and tear hyperosmolarity, both associated with ocular surface inflammation and corneal epithelial damage in dry eye. At present, steroid anti-inflammatory agents are commonly prescribed by most ophthalmologists. Although steroid anti-inflammatory agents are effective in treating dry eye, the risk of glaucoma and cataract cannot be ignored. Topical cyclosporine takes several months to start working and is effective in only 15 percent of patients. Accordingly, there remains an unmet medical need in the related field of treating dry eye.

Integrins are αβ heterodimeric transmembrane receptors that perform a wide range of functions by interacting with various extracellular ligands (eg, vitronectin (VTN)). In 1984, Pierschbacher and Ruoslahti pointed out that Arg-Gly-Asp (RGD) is a key sequence of the cell attachment domain of fibronectin. Subsequently, the RGD sequence was found to promote cell attachment and migration in other extracellular matrix (ECM) proteins, including VTN, von Willebrand factor, osteopontin ) and laminin. In addition, eight integrins, including αv-RGD integrins (αvβ1, αvβ3, αvβ5, αvβ6, αvβ8), α5β1, α8β1, and platelet receptor αIIbβ3, are considered to be cell surface recognition of small RGD tripeptides receptor. Integrins have also been found to be involved in a variety of different pathogenic mechanisms. For example, integrin αvβ3 is upregulated in new blood vessels to regulate endothelial cell survival, proliferation, and vascular permeability. In addition, αv integrins have also been studied in different disease models. For example, αvβ3 integrin is highly expressed in activated macrophages in atherosclerotic plaques; however, expression of αvβ3 integrin is minimal in quiescent macrophages in normal aorta. Furthermore, depletion of αv integrin in hepatic stellate cells (HSCs) protected mice from liver fibrosis, whereas depletion of the β subunit alone did not.

The inventors unexpectedly discovered that αv integrin is involved in macrophage-related inflammatory response and the pathogenic mechanism of dry eye, so RGD-based peptides were designed and synthesized as antagonists of αv integrin. Accordingly, the novel RGD-based synthetic peptides of the present disclosure have potential to be developed as drug candidates for the treatment of DED.

The present disclosure generally relates to a novel synthetic peptide, a pharmaceutical composition comprising the novel synthetic peptide, and/or for the treatment of dry eyes disease (DED) by using the novel synthetic peptide Methods.

Accordingly, the first aspect of the present disclosure aims to provide a short synthetic peptide capable of antagonizing αv integrins. The synthetic peptide has the amino acid sequence of the general formula (I): RGDX _aa D (I) wherein, R is arginine; G is glycine; D is aspartic acid; and X _aa is a D The amino acid of formula is selected from the group consisting of isoleucine (I) and phenylalanine (F).

According to embodiments of the present disclosure, the synthetic peptides of general formula (I) may be in linear or cyclic form.

In certain embodiments, the synthetic peptide of formula (I) is in linear form, and the amino acid sequence of the synthetic peptide of formula (I) is acetylated at the N-terminus and at the C-terminus of the amino acid sequence. Aminated. In a preferred embodiment, the synthetic peptide of general formula (I) has an amino acid sequence at least 80% identical to that of SEQ ID NO: 10.

In certain embodiments, the synthetic peptide of general formula (I) is in a head-to-tail cyclic form and has a monoamino acid sequence that is at least 85% identical to SEQ ID NO: 16 or 18.

The second aspect of the present disclosure aims to provide a medicament and/or a pharmaceutical composition suitable for treating dry eye. The pharmaceutical or pharmaceutical composition comprises the aforementioned synthetic peptide and a pharmaceutically acceptable carrier.

In certain embodiments, the synthetic peptide is in linear form and has a monoamino acid sequence that is at least 85% identical to SEQ ID NO: 10.

In certain embodiments, the synthetic peptide is in cyclic form and has a monoamino acid sequence that is at least 80% identical to SEQ ID NO: 16 or 18.

Alternatively or optionally, the synthetic peptide may be encapsulated or embedded in a delivery vehicle prior to preparation into a drug and/or a pharmaceutical composition. In various aspects, the delivery vehicle can be liposomes, lysosomes, microcapsules or nanoparticles.

According to embodiments of the present disclosure, the pharmaceutical and/or pharmaceutical composition is in the form of a liquid, gel, cream or ointment.

A third aspect of the present disclosure pertains to a method of treating an individual suffering from dry eye. The method comprises the step of administering to the individual an effective amount of a medicament or pharmaceutical composition of the present disclosure to ameliorate or alleviate symptoms associated with dry eye.

According to embodiments of the present disclosure, the medicaments or pharmaceutical compositions of the present disclosure may be administered orally, enterally, rectally, pulmonary (eg, inhalation), nasally, topically (including transdermal, buccal, and sublingual), Intravesical, intracrystalline, subconjunctival, intraperitoneal, vaginal, cerebral delivery (e.g., intraventricular and intracerebral), central nervous system delivery (e.g., intrathecal, paraspinal, and intraspinal), or parenteral (e.g., subcutaneous, intramuscular, intravenous and intradermal), transmucosal administration, or administration to the subject via transplantation or other delivery routes known in the art.

According to an embodiment of the present disclosure, an amount of the medicament or pharmaceutical composition of the present disclosure is administered to the individual in an amount of 0.001-1500 mg/kg; more preferably, an amount of 0.1-1200 mg/kg; more preferably , is administered to the individual in an amount of 15-500 mg/kg.

In all embodiments, the individual is a human.

The following description sets forth detailed embodiments of the present invention. Other features and advantages of the present invention will become clearer from the following embodiments and claims.

In order to make the description of the present disclosure more detailed and complete, the following provides an illustrative description for the embodiments and specific embodiments of the present invention; but this is not the only form of implementing or using the specific embodiments of the present invention. The features of various specific embodiments as well as method steps and sequences for constructing and operating these specific embodiments are encompassed in the detailed description. However, other embodiments may also be utilized to achieve the same or equivalent function and sequence of steps.

1. Definitions

For convenience, certain terms used in the context of this disclosure are listed here. Unless otherwise defined in this specification, scientific and technical terms used herein have the same meanings as understood and commonly used by those of ordinary skill in the art to which this invention belongs.

The term "peptide" as used herein refers to a polymer of amino acid residues. As used herein, the term "synthetic peptide" refers to a peptide that does not contain an intact native protein molecule. A peptide is "synthetic" because it can be made by human intervention using similar techniques such as chemical synthesis, recombinant genetics techniques, or whole antigen fragmentation. Throughout this disclosure, the position of any particular amino acid residue in a peptide is numbered starting from the N-terminus of the peptide. When the amino acid is not named after a D or L amino acid, the amino acid is an L amino acid or can be a D or L amino acid, unless the context defines a specific isomer . Also, the notations used herein for amino acid residues of polypeptides are abbreviations customary in the art to which the present invention pertains.

% 計算一給定的胺基酸序列A和另一給定的胺基酸序列B的胺基酸序列相似度百分比(也可被表述為一給定的胺基酸序列A具有一相對於一給定胺基酸序列B特定百分比的胺基酸序列相似度)。 其中X係序列比對程式BLAST在該程序對A和B的比對中評分為相同匹配的胺基酸殘基數目，而Y係A或B的胺基酸殘基總數，以較短者為準。 As discussed in this disclosure, minor variations in amino acid sequences of peptides are expected to be encompassed by the present disclosure and claimed inventive concepts, where variations in amino acid sequences are provided that maintain at least 70% similarity, Like maintaining at least 70%, 71%, 72%, 73%, 75%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85% %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% similarity. The percent amino acid sequence similarity (%) (or percent identity) as defined herein relative to the sequence of a synthetic peptide is defined as the amino acid residues of a candidate sequence that are identical to the amines of a particular peptide sequence Percentages of amino acid residues, if necessary, are first aligned and introduced into gaps to achieve maximum percent sequence similarity and do not take into account any conservative substitutions as part of sequence identity. Alignment for the purpose of determining percent sequence similarity can be achieved by various methods known in the relevant art, such as publicly available software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) and the like. Those skilled in the art can determine suitable parameters for use in alignment, including any algorithm needed to achieve maximal alignment results when aligning full-length sequences. For the purposes of this paper, sequence comparisons between two amino acid sequences were performed by the computer program Blastp (protein-protein BLAST) provided by the National Center for Biotechnology Information (NCBI). by the following general formula:

% Calculate the percentage of amino acid sequence similarity between a given amino acid sequence A and another given amino acid sequence B (can also be expressed as a given amino acid sequence A has a relative Amino acid sequence similarity for a given percentage of amino acid sequence B). where the X-line sequence alignment program BLAST scores the number of identically matched amino acid residues in the program's alignment of A and B, and Y-line the total number of amino acid residues in either A or B, whichever is shorter allow.

Synthetic peptides of the present disclosure can be specifically modified to alter peptide characteristics independent of their physiological activity. For example, in the present invention, certain amino acids of the peptide can be altered and/or deleted without affecting its physiological activity (ie, its ability to antagonize αv integrin). Specifically, conservative amino acid substitutions are contemplated. Whether an amino acid change results in a functional peptide can readily be determined by measuring the specific activity of the peptide derivative. Fragments or analogs of peptides can be readily prepared by those of ordinary skill in the art to which the present invention pertains. Preferred fragments or analogs have amine and carboxy termini that occur near the boundaries of the functional domains. In certain embodiments, the amino acid residues of the synthetic peptides of the present disclosure are conservatively replaced with their D-form amino acid residues, eg, L-phenylalanine (F) and L-isoleucine (I ) were replaced with the corresponding D residues, respectively.

The term "treatment" as used herein refers to obtaining the desired pharmaceutical and/or physiological effect; eg, antagonism against αv integrin. The above-mentioned effects refer to being able to partially or completely cure or prevent the symptoms of the disease in an individual. The "treatment" includes preventing, treating or alleviating a disease in a mammal, especially a human. The treatment comprises: (1) preventing (eg, prophylactic medication), treating or alleviating a disease or symptom (eg, retinal degeneration or tissue damage) in an individual who may have the disease but has not been diagnosed; (2) ) inhibits a disease (eg, prevents disease progression); or (3) cures a disease (eg, reduces symptoms associated with the disease).

The term "administered", "administered" or "administration" as used herein refers to a mode of administration that includes, but is not limited to, intravenous (intraveneously), intramuscularly (intramuscularly), A formulation of the present disclosure (eg, a compound or composition) is administered intraperitoneally, intraarterially, intracranially, or subcutaneously. In certain embodiments, the synthetic peptides and/or analogs thereof of the present disclosure can be formulated as eye drops for direct application to the corneal surface. In other embodiments, the synthetic peptides of the present disclosure can be formulated into a skin ointment or lotion for direct application to the skin. In a further embodiment, the synthetic peptides of the present disclosure are formulated as a powder for mixing with a suitable vehicle (eg, buffer solution) prior to use, such as intravenous injection.

As used herein, "an effective amount" refers to the amount, dosage and period of administration of an ingredient sufficient to achieve the desired result in relation to the treatment of the disease. For example, in the treatment of dry eye, a formulation (ie, a compound, a synthetic peptide, or a compound that can encode the present disclosure may reduce, prevent, delay, inhibit, or suppress any symptoms of dry eye) A nucleic acid of a therapeutic peptide) is effective. An effective amount of a formulation does not necessarily cure a disease or condition, but provides treatment of a disease or condition such that the onset of the disease or condition is delayed, blocked or prevented, or the symptoms associated with the disease or condition can be prevented delay. The effective amount may be divided into one, two or more doses in suitable form for one, two or more administrations over a given period.

The terms "subject" or "patient" are used interchangeably herein to refer to a mammal (including a human) that can be treated by the synthetic peptides and/or methods of the present disclosure. The term "mammal" includes all members of the class Mammalia, including humans, primates, domestic and agricultural animals, such as rabbits, pigs, sheep, and cattle; and zoo animals, game animals, or pets; and rodents, Like mice and rats. Furthermore, unless gender is specified, the "individual" or "patient" herein refers to both males and females. Accordingly, the "individual" or "patient" includes any mammal that would benefit from the methods of treatment of the present disclosure. Examples of an "individual" or "patient" include, but are not limited to, humans, rats, mice, guinea pigs, monkeys, pigs, sheep, cattle, horses, dogs, cats, birds, and avian species. In an exemplary embodiment, the patient is a human.

Notwithstanding that the numerical ranges and parameters setting forth the broader scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains the standard deviation resulting from individual testing methods. As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range. Alternatively, the word "about" means that the actual value lies within an acceptable standard error of the mean, as considered by one of ordinary skill in the art to which this invention pertains. Except for the experimental examples, or unless expressly stated otherwise, all ranges, quantities, values and percentages used herein should be understood when used to describe material amounts, time periods, temperatures, operating conditions, quantity ratios and other similar ) are modified by "Covenant". Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in this specification and the accompanying claims are approximate numerical values and may be changed as required. At a minimum, these numerical parameters should be construed to mean the number of significant digits indicated and the numerical values obtained by applying ordinary rounding.

As used herein, the singular forms "a," "and" and "the" include the plural unless the context clearly dictates otherwise.

2. Specific implementation

The present disclosure is based, at least in part, on the discovery that short synthetic peptides can antagonize αv integrins. Accordingly, the present invention provides a method for treating and/or preventing dry eye and a composition comprising the newly identified synthetic peptide.

2.1 Synthetic peptides of the present disclosure

The short synthetic peptides of the present disclosure consist of the amino acid sequence set forth in general formula (I): RGDX _aa D (I) wherein R is arginine; G is glycine; D is aspartic acid; and X _aa is a D-form amino acid, which is selected from the group consisting of isoleucine (I) and phenylalanine (F).

According to embodiments of the present disclosure, the synthetic peptides of general formula (I) may be in linear or head-to-tail cyclic form.

In certain embodiments, the synthetic peptide of general formula (I) is in linear form, and the N-terminal and C-terminal ends of the amino acid sequence of the synthetic peptide of general formula (I) are acetylated and aminated, respectively. In a more preferred embodiment, the synthetic peptide of general formula (I) has the amino acid sequence of SEQ ID NO: 10.

In other embodiments, the synthetic peptide of general formula (I) is in a head-to-tail cyclic form and has the amino acid sequence of SEQ ID NO: 16 or 18.

The synthetic peptides of the present disclosure are detailed in Table 1.

Table 1: Synthetic Peptides Peptide name amino acid sequence serial number linear RGDfD NH ₂ -Arg-Gly-Asp-d(Phe)-Asp-COOH 10 ring C(RGDiD) Cyclic (Arg-Gly-Asp-d(Ile)-Asp) 16 C(RGDfD) Cyclic (Arg-Gly-Asp-d(Phe)-Asp) 18 A lower case letter in any sequence indicates that the particular amino acid is a D-form amino acid.

According to a more preferred embodiment, the fourth amino acid residue of the synthetic peptide of general formula (I) must be a D-form amino acid, otherwise the synthetic peptide will lose its antagonistic activity to αv integrin.

Whether in linear or cyclic form, synthetic peptides of the present disclosure can be synthesized according to any standard peptide synthesis procedures in the art. For example, linear peptides can be readily synthesized by conventional procedures for forming peptide bonds between amino acids. For example, the aforementioned conventional procedures include any of the free alpha amine groups that can tolerate an amino acid residue with a protected carboxyl group and other reactive groups and another with a protected amine group or other reactive group. A solution-phase method with a condensation reaction between the free primary carboxyl groups of an amino acid residue. In a preferred conventional procedure, the peptides of the present disclosure can be synthesized by solid-phase synthesis and purification according to methods well known to those of ordinary skill in the art. Any of several methods well known in the art using a variety of resins and reagents can be used to prepare the peptides of the present disclosure. It can be synthesized by adding each amino acid residue of the desired sequence one at a time to another amino acid residue, or by first synthesizing a peptide fragment of the desired amino acid sequence by conventional procedures, The synthesis of the peptide is carried out by the method of synthesizing the desired peptide by the condensation reaction. Preferably, the synthesis can be performed using a solid phase peptide synthesizer (ABI433A peptide synthesizer; Applied Biosystems Inc.; Life Technologies Corp.; Foster City, CA, USA) according to the manufacturer's standard procedure. In this method, peptide synthesis can be carried out by sequentially incorporating target amino acid residues into an extending peptide chain, one at a time, according to the general principles of solid-phase synthesis.

As for the synthesis of cyclic peptides, a peptide is first synthesized in the above-described manner, and then the peptide is cyclized to produce the cyclic peptides of the present disclosure. Any cyclization method can be used. In certain embodiments, the peptide can be cyclized prior to cleavage from a peptide resin. For cyclization in the presence of a reactive moietiy moiety, the side chain is protected and the peptide is suspended in a suitable solvent with the addition of a cyclization coupling reagent. Examples of suitable solvents include dimethyl formaldehyde (DMF), dichloromethane (DCM) or 1-methyl-2-pyrrolidone (NMP). An example of a suitable cyclization coupling reagent includes 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethylureatetrafluoroboronic acid (2-(1H-benzotriazol-1-yl) )-1,1,3,3-tetramethyluronium tetrafluoroborate, TBTU), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethylurea hexafluorophosphate (2-( 1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, HBTU), benzotriazole-1-yl-oxy-tris(dimethylamino)phosphorus hexafluorophosphate (benzotriazole- 1-yl-oxy-tris(dimethylamino)phosphoniumhexafiuorophosphate, BOP), benzotriazole-1-yl-oxy-tris(pyrrolidino) phosphoniumhexafluorophosphate, PyBOP), 2-(7-aza-1H-benzotriazol-1-yl)-1(2-(7-aza-1H-benzotriazol-1-yl)-1), tetramethylurea tetra 1,3,3-tetramethyturonium tetratluoroborate, TATU, 2-(2-oxy-1(2H)-pyridyl)-N,N,N',N'-tetramethylurea tetrafluoroboric acid (2-(2-oxo-1(2H)-pyridyl)-1,1,3,3-tetramethyluronium tetrafluoroborate, TPTU) or N,N'-dicyclohexylcarbodiimide/hydroxybenzotriazole (N , N'-dicyclohexylcarbodiimide/i-hydroxybenzotriazole, DCCl/HOBt). Coupling is routinely initiated by a suitable base, for example, N,N-diisopropylethylatnine (DIPEA), 2,4,6-collidine (2,4,6- trimethyl pyridine) or N-methylmorpholine (N-methylmorpholine, NMM). The cyclized peptide can then be cleaved from the solid phase using any suitable reagent, such as ethylamine in DCM or a combination of different agents, for example, trifluoroacetic acid (TFA), triiso Propylsilane (tri-isopropylsilane, TIS), dimethoxybenezene (DMB), water and the like. Dry the obtained crude synthetic peptide, if there are residual amino acid side chain protecting groups, any suitable reagent (for example, TFA, TIS, 2-mercaptopethane (ME) and/ or 1,2-ethanedithiol (1,2-ethanedithiol, EDT)) for cleavage. The final product can be collected by precipitation by addition of glacial ether and filtration. Use a suitable column (eg C18 column) for final purification by reverse phase high performance liquid chromatography (RP-HPLC), or other separations or Purification methods such as separation or purification based on the size or charge of the peptides. Once purified, the peptide can be characterized by any method, eg, high performance liquid chromatography (HPLC), amino acid analysis, mass spectrometry, and the like. The peptides prepared according to the above methods can be tested for their activity according to the methods described in the following working examples.

Although the synthesis using solid-phase fluorene methoxycarbonyl (Fmoc) chemical synthesis has been described first, it is understood that other chemistries and synthetic methods can be used to make the cyclic peptides of the present invention, such as by the methods of the Examples But not limited to, tert-butoxycarbonyl (Boc) chemical synthesis method, solution chemical synthesis method and other chemicals and synthesis methods.

The N-terminus or C-terminus of the linear synthetic peptides of the present invention can be modified. Examples of N-terminal modifications include, but are not limited to, N-glycated, N-alkylated, and N-acetylated amino acids. A terminal modification involves pegylation. An example of a C-terminal modification is a C-terminal amidated amino acid. In an optional embodiment, one or more of the peptide linkages can be replaced by a non-peptide chain, and the individual amino acid groups can be modified by treatment with reagents capable of reacting with selected side chains or terminal residues .

Different functional groups can also be added to different positions in the synthetic peptide that are susceptible to chemical modification. Functional groups can be added to the termini of the peptide. In certain embodiments, the functional group improves the activity of one or more properties of the peptide, eg, improves the stability, potency, or selectivity of the synthetic peptide; improves the passage of the synthetic peptide through cell membranes and/or tissue barriers improved penetration efficiency; improved tissue localization; reduced toxicity or clearance; and improved exclusion of cell pumps, among other similar activities. In non-limiting examples, suitable functional groups are those capable of facilitating intracellular transport of a peptide attached to a cell, for example, by reducing the hydrophilicity of the peptide and increasing the Lipophilic to facilitate the aforementioned effects, these functional groups may optionally and preferably be cleaved within living cells, either hydrolytically or enzymatically. Hydrolysis protecting groups include ester, carbonate and carbamate protecting groups. Amine protecting groups include alkoxy groups and aryloxycarbonyl groups. Carboxylic acid protecting groups include aliphatic, benzylic and aryl esters.

Any amino acid residue of the synthetic peptide of the present invention can be replaced by a "peptidomimetic organic moiety" in a conservative or non-conservative substitution manner. In an optional preferred embodiment, the peptidomimetic organic group optionally or preferably has similar steric, electronic or conformational properties as the substituted amino acid, and such a peptidomimetic is used with to substitute amino acids at necessary positions, and similar substitutions are considered conservative substitutions. Optionally, peptides can be mimicked to inhibit the degradation of peptides by enzymes or other degradation processes. In an optional and preferred embodiment, the peptide mimetic can be produced by organic synthesis techniques. In non-limiting examples, suitable peptide mimetics comprise isosteres of amide linkages, 3-amino-2-propenidone-6-carboxylic acid (3-amino-2-propenidone-6 -carboxylic acid), hydroxyl-1,2,3,4-tetrahydroisoquinoline-3-carboxylate (hydroxyl-1,2,3,4-tetrahydro-isoquinoline-3-carboxylate), 1,2, 3,4-tetrahydroisoquinoline-3-carboxylate (1,2,3,4-tetrahydro-isoquinoline-3-carboxylate) and histidine isoquinolone carboxylic acid.

Any portion of the synthetic peptide may optionally be chemically modified, eg, to add functional groups. Such modifications may optionally be accomplished during the synthesis of the peptides of the present invention. Non-limiting exemplary types of modifications include carboxymethylation, acylation, phosphorylation, glycosylation, or fatty acylation. Ether linkages can optionally be used to bind serine or threonine hydroxy groups to the hydroxyl groups of saccharides. Amide linkages can optionally be used to bind glutamate or aspartate carboxy groups to the amine groups of carbohydrates. Acetal and ketal bonds can also optionally be formed between amino acids and carbohydrates.

2.2 Drugs and/or Pharmaceutical Compositions for the Treatment of Dry Eye Syndrome

The synthetic peptides of the present invention are useful in the treatment of an individual suffering from dry eye. Accordingly, another aspect of the present invention is to provide a drug and/or pharmaceutical composition comprising the synthetic peptide of the present invention, which is used for the treatment of dry eye.

The medicament and/or pharmaceutical composition can be prepared by mixing appropriate amounts of the synthetic peptides of the present disclosure and a pharmaceutically acceptable carrier, excipient or stabilizer into the composition. In a specific embodiment, the synthetic peptide of the present invention is selected from the group consisting of the above-mentioned peptides, including but not limited to, RGDfD (SEQ ID NO: 10), c(RGDiD) (SEQ ID NO: 16), c (RGDfD) (SEQ ID NO: 18) and combinations thereof.

In the medicine or pharmaceutical composition, the content of the peptide of the present invention will vary with the peptide used. The content of the peptides present in the pharmaceutical composition is about 0.001% to 10% by weight; for example: 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2., 2.3, 2.4, 2.5, 2.6 , 2.7, 2.8, 2.9, 3.9, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1 , 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6 , 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9 and 10.0% Content; specifically about 0.01% to 5% (weight percent) content, for example: 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 , 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.9, 3.1, 3.2 , 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9 and 5.0 % by weight.

Alternatively or optionally, the synthetic peptide can be encapsulated or embedded in a delivery vehicle prior to preparation into a drug product and/or a pharmaceutical composition. In various aspects, the delivery vehicle can be liposomes, lysosomes, microcapsules or nanoparticles.

Pharmaceutically acceptable carriers, excipients or stabilizers that can be used with synthetic peptides are well known to those of ordinary skill in the art and include, but are not limited to, non-toxic inert solids, semisolids, liquid fillers, Diluents, encapsulants or formulation aids. A typical pharmaceutically acceptable carrier is water or physiological saline. Examples of pharmaceutically acceptable carriers include, but are not limited to, sugars (eg, lactose, glucose, and sucrose); starches (eg, cornstarch); cellulose and derivatives thereof (eg, carboxymethyl cellulose, ethyl cellulose) cellulose acetate); powdered tragacanth; malt; gelatin; talc; excipients (e.g. cocoa butter and suppository waxes); oils (e.g. peanut oil) , cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil); glycols (eg: propylene glycol); esters (eg: ethyl oleate and ethyl laurate ( ethyl laurate); agar; buffers (such as magnesium hydroxide and aluminum hydroxide); alginic acid; and other reagents, such as non-toxic lubricants (such as lauryl sulfate) sulfate) and magnesium stearate), colorants, release agents, flavoring agents, preservatives and antioxidants. The pharmaceutical composition may further comprise an antibiotic or antifungal agent.

Suitable routes of administration for the pharmaceutical or pharmaceutical compositions of the invention are via vascular delivery (eg, injection or infusion), oral, enteral, rectal, pulmonary (eg, inhalation), nasal, topical (including transdermal, buccal) and sublingual), intravesical, intracrystalline, intraperitoneal, vaginal, intracerebral delivery (e.g., intraventricular and intracranial), via CNS (e.g., intramedullary, paravertebral, and intravertebral), or parenteral (e.g., : subcutaneous, intramuscular, intravenous and intradermal), mucosal administration or by transplantation or other conventional routes of administration.

Pharmaceutical compositions suitable for oral administration may be in discrete dosage units such as pills, tablets, lozenges, hard or soft capsules; or as a dispersible powder or granules; or as a solution or suspension, for example : Aqueous or oily suspensions, emulsions, syrups, elixirs or enteral formulations. In a preferred embodiment, the pharmaceutical composition is an eye drop. The compositions may be presented in single-dose or multi-dose forms, eg, sealed vials or ampoules, and stored under lyophilized conditions with the addition of a sterile liquid carrier (eg, water or saline) prior to use.

Pharmaceutical compositions suitable for parenteral administration can be aqueous solutions or by mixing or dispersing the synthetic peptides of the present invention with sterile solvents (eg, water, Ringer's solution, saline, 1,3-butanediol (1, 3-butanediol). , 3-butanediol) and alcohol, etc.) for non-aqueous sterile injection. Alternatively, fixed oils, fatty acids, or synthetic mono- or diglycerides can be used as solvents. The composition can be sterilized by filtration through a filter.

The pharmaceutical compositions for topical or transdermal administration are generally formulated as ointments, pastes, creams, lotions, gels, patches or sprays. Ophthalmic formulations, ear drops and eye drops are included within the scope of the present invention. According to certain embodiments, the compositions of the present invention are applied topically to the eye. According to other embodiments, the pharmaceutical composition is an ointment for use on the skin.

Depending on the type and severity of the disease, the dosage of the synthetic peptide of the present invention to be administered to a patient is about 1 μg/kg to 1,500 mg/kg (eg 0.01-1,200 mg/kg), eg 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990 or 1,000 µg/kg ; or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 , 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350 , 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600 , 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1,000, 1,100, 1,200, 1,300, 1,400 or 1,500 mg/kg. Daily or weekly doses of about 0.1 mg/kg to 1,200 mg/kg or higher, eg: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 , 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 , 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140 , 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390 , 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640 , 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890 , 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1,000, 1,100 or 1,200 mg/kg. Preferably, the daily dose ranges from about 15 mg/kg to 500 mg/kg, eg: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 , 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 , 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120 , 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370 , 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500 mg/kg. Doses for any of the foregoing purposes may be administered one or more times per day, eg, four, six, eight or more times per day.

Pharmaceutical compositions can be formulated in dosage forms suitable for pulmonary administration, such as dusts or mists, which can be delivered by metered dose pressurized aerosols, nebulizers or inflators Insufflator (insufflator) to generate.

The pharmaceutical composition provided by the present invention is preferably a set. It will be appreciated that the kit of the present invention is a product comprising the synthetic peptide product of the present invention and/or other therapeutic compounds, packaged to form the composition for ease of transport, storage and simultaneous or continuous apply. Thus, the kits of the present invention may comprise one or more sealed ampoules each containing the synthetic peptides of the present invention, and the synthetic peptides of the present invention may be formulated in a single dosage form or in multiple dosage forms. The kit may additionally include a carrier suitable for dissolving the synthetic peptide, such as: an aqueous medium, such as: physiological saline, Ringer's solution, dextrose and sodium chloride; an aqueous medium; , such as: ethanol, polyethylene glycol (polyethylene glycol), and propylethylene glycol (PEG); if necessary, a water-insoluble carrier can also be used in the present invention. The other component of the kit may also be an outer package to keep the composition of the present invention within a defined range. Materials suitable for the outer packaging of the present invention include glass, plastics (polyethylene, polypropylene, polycarbonate and the like), bottles, jars, paper, bundle bags and the like.

The kits of the present disclosure may further comprise instructions describing the manner of administration (eg, simultaneous administration, sequential administration, individual administration) of the various formulations of the present invention. Accordingly, a kit of the present disclosure may further comprise instructions on how to administer (eg, simultaneous administration, sequential administration, individual administration) the various components of the present disclosure. The instructions may be in paper form or on readable electronic media such as electronic storage media (magnetic disks, magnetic tapes and the like), optical media (CD-ROM, DVD) and the like. The media may additionally or alternatively include a web page to provide the above-described explanatory information.

2.3 Methods of treating dry eye syndrome

As noted above, the findings provided by the present disclosure can be used to treat and/or prevent individuals suffering from dry eye.

Accordingly, the present disclosure relates to a method of preventing and/or treating dry eye, comprising administering to an individual in need thereof the aforementioned medicament or pharmaceutical composition, the medicament or pharmaceutical composition comprising a synthetic compound of general formula (I) Peptide, RGDX _aa D(I) wherein, R is arginine; G is glycine; D is aspartic acid; and X _aa is a D-form amino acid, which is selected from isoleucine (I ) and the group consisting of phenylalanine (F); and a pharmaceutically acceptable carrier.

According to embodiments of the present disclosure, the synthetic peptide of general formula (I) may be in linear or head-to-tail cyclic form.

Alternatively or optionally, when the synthetic peptide of general formula (I) is in linear form, the N-terminus of the amino acid sequence of the synthetic peptide is acetylated and its C-terminus is aminated . In a more preferred embodiment, the synthetic peptide of general formula (I) has the amino acid sequence of SEQ ID NO: 10.

In other embodiments, the synthetic peptide of general formula (I) is in a head-to-tail cyclic form and has the amino acid sequence of SEQ ID NO: 16 or 18.

The medicament and/or pharmaceutical composition can improve and alleviate symptoms associated with dry eye when administered to the individual.

In a specific embodiment, the synthetic peptide is selected from the group consisting of the aforementioned peptides, including but not limited to: RGDfD (SEQ ID NO: 10), c(RGDiD) (SEQ ID NO: 16), c ( RGDfD) (SEQ ID NO: 18) and combinations thereof.

According to one embodiment of the present disclosure, the present invention is directed to a method of treating dry eye, comprising administering to an individual in need thereof an effective amount of a medicament or pharmaceutical composition of the present invention.

The method comprises the steps of administering to an individual in need thereof a dose of a drug or pharmaceutical composition of the present disclosure ranging from about 1 microgram per kilogram to 1,500 milligrams per kilogram (eg: 0.01-1,200 mg/kg), eg: 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 , 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 , 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740 , 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990 or 1,000 μg/kg; or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 , 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 , 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 , 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340 , 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590 , 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1,000, 1,100, 1,200, 1,300, 1,400 or 1,500 mg/kg. A typical daily or weekly dose is about 0.1 mg/kg to 1,200 mg/kg or higher, eg: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 , 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 , 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140 , 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390 , 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640 , 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890 , 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1,000, 1,100 or 1,200 mg/kg. Preferably, the daily dose is about 15 mg/kg to 500 mg/kg, eg: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500 mg/kg. For any of the foregoing purposes, the dose will typically be administered one or more times, eg, four, six, eight or more times per day.

In all embodiments, the individual suitable for treatment is a human.

The following examples are intended to illustrate certain aspects of the present invention, so as to facilitate the practice of the present invention by those of ordinary skill in the art to which the present invention pertains. These examples should not be construed as limiting the scope of the invention.

Example

Materials and Methods

Material

Commercially available RPMI 1640 medium, fetal bovine serum (FBS), antibiotic-antimycotic solution, and trypsin (purchased from Invitrogen, Carlsbad, CA) were obtained. Recombinant human Vitronectin (140-09) was purchased from PeproTech (Rocky Hill, NJ, USA). A commercially available Hoechst stain (Hoechst 33258) and all chemicals (supplier: Sigma-Aldrich, St. Louis, MO, USA) were obtained. Commercially available integrin αV antibody (ab179475) and F4/80 antibody (ab6640) were obtained from Abcam (Cambridge, MA, USA). The supplier of vitronectin antibody (GTX61399) is GeneTex. c(RGDfK), ATN-161, SB273005, Cilengitide and Tirofiban) were obtained from suppliers (Selleckchem, Houston, TX, USA).

The _NH2 -terminus of the linear RGDVF-based peptide was modified with acetylation, and the COOH-terminus was modified with amination to improve stability. The RGDVF baseline linear and head-to-tail cyclic peptides were synthesized and characterized by mass spectrometry (>90% purity) (supplier: GenScript (Piscataway, NJ, USA)).

cell culture

Human THP-1 monocytic blood cancer cell line was cultured in RPMI 1640 containing 25 mM HEPES buffer (additionally supplemented with 10% FBS, 2 mM glutamic acid, 100 units/mL penicillin, and 100 μg/mL streptavidin tetracycline), cultured at 37°C in an atmosphere containing 5% _CO . THP-1 cell differentiation was induced by resuspending THP-1 cells in fresh 10% FBS medium containing 10 ng/ml PMA for 48 hours, and THP-1 cells were induced to convert into mature cells functionally similar to macrophages . Cells seeded in serum-free RPMI 1640 medium (6-well plates, 5 x 10 ⁵ per well) were treated with VTN (10 μg/ml) and integrin inhibitor (20 μmol, unless otherwise stated). granule cells). Inhibitors were dissolved in DMSO (solvent) and added to the cell culture (final concentration of DMSO was less than 0.05%).

Induced dry eye syndrome and ophthalmic treatment

C57Bl/6 mice (8-week-old dams) were housed in a temperature-controlled (24-25 °C) animal room with a light cycle of 12 h day and 12 h night. Free food and free drinking water. The experimental procedures were approved by the Mackay Memorial Hospital Review Board (Program No.: MMH-A-S-107-41, Dates: January 1, 2019 - December 31, 2021) and complied with national animal welfare regulations. Mice were housed in a controlled environment chamber (CEC) and administered scopolamine to produce maximal ocular surface dryness to induce dry eye. The controlled environmental chamber conditions are controlled to provide a relative humidity of less than 25 % 24 hours a day, an airflow of 10 liters/min, and a temperature of 24-25 ˚C. Mice were housed in a controlled environment room for 12 days, and on day 3 and day 5, mice were injected subcutaneously with scopolamine hydrobromide twice daily (injection volume: 0.375 mg per mouse) dissolved in 0.15 ml PBS). Untreated mice of the same age and sex were used as a control group. For ophthalmic treatment, a balanced salt solution (BSS, Alcon) was used as the vehicle to produce all results. 30 microliters of 100 micromolar peptide or vehicle were administered topically to the eye three times daily.

real-time quantitative polymerase chain reaction (Quantitative Real-time PCR)

Total cellular RNA was extracted with TRIzol (Invitrogen, Carlsbad, CA) and treated with RNase-free DNase I (Qiagen, Santa Clarita, CA) to remove genomic DNA, followed by an RNA purification kit ( Dynabeads, Invitrogen) purified RNA. cDNA was synthesized by a cDNA synthesis kit (Superscript III, Invitrogen). Real-time quantitative polymerase chain reactions were performed using a sequence detection system (GeneAmp 7700, Applied Biosys-tems, Foster City, CA). Amplification reactions were performed in a total volume of 40 microliters containing 3 picomoles (pmol) of primers, serially diluted reverse transcription products, and a dye core reagent (SYBR Green PCR core reagent from Applied Biosystems). The primer pairs used in the experiments are listed in Table 2. The step cycle program was set at 95 °C for 15 seconds of denaturation, followed by 1 minute of adhesion and extension at 62 °C, for a total of 40 cycles. All measurements are triplicates. The sequence detection system software (GeneAmp 7700 SDS) was used to analyze the cycle threshold (Ct) corresponding to the number of PCR cycles, at which the instant fluorescence luminescence reached a threshold value above the baseline luminescence. Circulation thresholds of desired PCR products and control mRNA (GAPDH) were used to calculate relative expression levels between mRNA samples.

Table 2: Primers used for instant polymerase chain reactions target gene Introduction (5'→3') serial number hTNF-α Positive stock AGGACACCATGAGCACTGAA twenty two anti stock CGATCACTCCAAAGTGCAG twenty three hGAPDH Positive stock ACCCAGAAGACTGTGGATGG twenty four anti stock TCAGCTCAGGGATGACCTTG 25 movTN Positive stock CATACTAGCCCCTGGTGGCAT 26 anti stock CCATGAAACCCTGAGTGCAG 27 moNOS2 Positive stock CCTTGTTCAGCTACGCCTTC 28 anti stock CTTCAGAGTCTGCCCATTGC 29 moTNF-α Positive stock CCAAATGGCCTCCCTCTCAT 30 anti stock CACTTGGTGGTTTGCTACGA 31 moIL-1β Positive stock GGCTCATCTGGGATCCTCTC 32 anti stock GTTTGGAAGCAGCCCTTCAT 33 moIL‐6 Positive stock GGAGCCCACCAAGAACGATA 34 anti stock ACCAGCATCAGTCCCAAGAA 35 moMMP9 Positive stock GCAGAGGCATACTTGTACCG 36 anti stock ATGGCCTTTAGTGTCTGGCT 37 mGAPDH Positive stock AACGGATTTGGCCGTATTGG 38 anti stock CATTCTCGGCCTTGACTGTG 39

Corneal Fluorescence Staining in Dry Eye (Corneal fluorescein staining)

To assess the effect of drying pressure on damage to the ocular surface, luciferin (100 mg/ml; Alcon Laboratories, Inc., Texas, USA) was instilled via a micropipette into the lower lateral conjunctival sac (0.6 μl per mouse). 0.5% sodium luciferin in 4.4 μl of PBS). After 15 seconds of fluorescent staining, mouse eyes were washed once with PBS and then observed under cobalt blue light using a slit lamp microscope.

goblet cells (goblet cells) Periodic acid Schiff (Periodic Acid-Schiff, PAS) dyeing

After the animals were sacrificed, the eyes were surgically removed, fixed in 4% paraformaldehyde (PFA), then embedded in paraffin, and cut into 5 micromolar thick sections. The sections were stained with PAS (Sigma-Aldrich) reagent, and goblet cells in the superior and inferior conjunctiva were measured. Photographs were taken using a microscope (model: Nikon Eclipse 80i; supplier: Nikon Corporation, Tokyo, Japan) equipped with a camera (model: Leica DC 500, supplier: Leica Microsystems, Wetzlar, Germany). The number of PAS-positive goblet cells in the conjunctiva was measured in 6 sections from each eye.

Western ink dot method

Cells were scraped into lysis buffer (150 μl/35 mm well) containing 20 mM HEPES (pH 7.4), 1 % SDS, 150 mM NaCl, 1 mM EGTA, and protease inhibitors (Cocktail I, from Merck). ))middle. Samples containing 20 micrograms of protein were analyzed by SDS-PAGE followed by electrotransfer to polyvinylidene difluoride membranes (Immobilon-P; Millipore, Bedford, MA) for immunoblotting analysis. Antibodies used in this experiment were VTN (GeneTex) and β-actin (Sigma). Desired proteins were detected using appropriate immunoglobulin G-horseradish peroxidase (IgG-horseradish peroxidase) secondary antibodies (Santa Cruz Biotechnology) and ECL reagents (Amersham Biosciences). X-ray films were scanned on an image densitometer (GS-700, Bio-Rad) and analyzed using analysis software (Labworks 4.0). For quantification, at least three independent transfection experiments were performed.

immunohistochemistry

The paraformaldehyde (PFA)-fixed and paraffin-embedded dry eye specimens were deparaffinized in xylene and then rehydrated with alcohol at a series of concentrations. Blocking was performed with PBST containing 10 % goat serum and 5 % bovine serum albumin (BSA) (0.5 % Triton X-100 in PBS) for 60 min, followed by anti-VTN (1: 1 ) at 37 °C. 100 dilution) of primary antibodies were co-incubated for 3 hours. Next, the slides were co-incubated with catalase-labeled goat immunoglobulin (1:500 dilution) for 20 minutes, and finally, before counterstaining with hematoxylin, they were mixed with a chromogenic agent matrix (diamine 3,3'-diaminobenzidine) was co-incubated for 2 minutes.

immunofluorescence

Tissue sections were either deparaffinized or blocked in 4% PFA-fixed Bone Marrow Derived Macrophages (BMDMs) for 20 min in PBST containing 10% goat serum and 5% BSA. Stain with primary antibody against F4/80 (1:100 dilution) for 3 hours at 37 °C. Sections used for αv integrin staining (1:100 dilution) were stained overnight at 4 ˚C. Slides loaded with the sections were then incubated with fluorescently labeled, appropriate secondary antibodies (1:500 dilution) at 37°C for 1 hour, counterstained with Hoechst's stain for 6 minutes, and prepared with An epifluorescence microscope (Zeiss Axioplan 2 imaging; Zeiss, Oberkochen, Germany) with a charge-coupled camera (Zeiss AxioCam HRm, Zeiss) was used for observation and analysis software (Axiovert; Zeiss AxioVision Releasr 4.8.2, Zeiss) was used ) to quantify.

mouse VTN enzyme-binding immunosorbent assay (Enzyme-linked immunosorbent assay, ELISA) detect

The concentration of VTN in tears was determined by ELISA. A balanced salt solution (BSS; Alcone) was instilled into the inferior fornix of mice once a week. Eyewashes from the same mouse (5 microliters each; referred to herein as tear specimens) were pooled and stored at -80 °C for ELISA. The pooled tear samples were detected using an ELISA kit (Fine Test; EM0500) for mouse VTN (vitronectin) according to the operating instructions. Fresh serum samples were prepared by centrifugation at 2,000 g for 15 minutes and diluted 1:100 in phosphate buffered saline (PBS). Serum samples were stored at -20 ˚C for ELISA use.

statistics

Data were generated from three independent experiments. The two experimental groups were compared using the Mann-Whitney U test. P<0.05 was considered significant.

Example 1: Increased expression of αv integrin in macrophages of dry eye animals

1.1 The content of vitronectin (VTN) in tears and conjunctival stroma of mice with dry eye increased.

Serum was found to contain high concentrations of soluble VTN, mainly produced in the liver by hepatocytes. VTN is also expressed in various tissues as an extracellular matrix component. It was also observed that induction of VTN expression in microvessels accelerated macrophage infiltration in ischemic hindlimbs. In the human eye, VTN is synthesized in situ from the retinal pigment epithelium-choroid complex, which is involved in the pathogenic mechanism of age-related macular degeneration (AMD). However, limited knowledge is known about the role of VTN in the disease progression of dry eye.

In order to study the expression and distribution of VTN in dry eye, dry eye mice were induced and treated according to the procedure described in "Materials and Methods", in which untreated mice of the same age and sex were used as non-stressed (NS) mice. ) control group. Determination of VTN protein concentration in tears by VTN ELISA showed that compared with NS mice, the VTN concentration in dry eye mice increased slightly after induction of dry eye for 1 week, and after induction for 2 weeks and 3 weeks. There was a nearly 2-fold increase (230±22 and 229±18 versus 114±7 ng/ml, panel 1 (A)). High concentrations of VTN were found in serum, but VTN concentrations were not elevated in the serum of dry eye mice. Immunohistochemical staining of VTN revealed a strong immune response in the conjunctival stroma of dry eye. In contrast, there was no significant immune response in the NS control group (Panel 1 (B)). In addition, the expression of VTN gene and protein in the conjunctiva isolated from dry eye mice was analyzed by real-time quantitative PCR and Western blot analysis. The results showed that the gene expression and protein expression of dry eye mice were 2.3 higher than those of NS mice, respectively. times and 2.9 times (the first panel (C) and the first panel (D)).

The foregoing results show that experimental dry eye animals exhibit increased local biosynthesis of VTN in the conjunctiva.

1.2 Expression of αv integrin in macrophages induced by dry eye in mice.

αv integrins include αvβ1, αvβ3, αvβ5, αvβ6, and αvβ8, all of which are VTN receptors on the cell surface. This example investigates the expression of [alpha]v integrin in macrophages of dry eye animals. Macrophages represent a heterogeneous population of cells (M1 and M2 or more). After 10 days of induction of dry eye, pro-inflammatory M1 macrophages were found to reside mainly in the conjunctiva rather than the cornea in the ocular surface of mice with dry eye (You et al., Arch Immunol Ther Exp. 2015, 63: 299-304). Notably, subconjunctival injection of clodronate resulted in site-specific depletion of conjunctival macrophages, markedly reduced ocular surface damage and the expression of pro-inflammatory factors in dry eye (Schaumburg et al., J. Immunol 2011, 187:3653-3662; Zhou et al., Am J Pathol. 2012, 181:753-760). Therefore, macrophages may represent a novel drug target for patients with dry eye.

Dual-immunofluorescence staining of αv integrin and F4/80 (a marker of macrophages) showed that, 12 days after induction of dry eye, in the conjunctiva of dry eye, compared to NS mice There was a marked increase in the staining intensity of αv integrin in macrophages. In addition, the number of αv integrin-positive macrophages in dry eye mice was approximately 2.3 times higher than in NS mice (Fig. 2 panel (B)). At the same time, the mRNA expression of αv integrin in iNOS (a marker of M1 pro-inflammatory macrophages) and conjunctiva isolated from dry eye was analyzed by real-time quantitative PCR, and the results showed that the mRNA expression level was 2.7±1. 0.6 times and 3.4±0.5 times (panel (C) of Figure 2).

The experimental results show that in animals with dry eye, conjunctival macrophages exhibit results that specifically increase the amount of αv integrin expression.

Example 2: Identification and characterization of synthetic peptides of the present disclosure

2.1 Identification of peptides with antagonistic activity against αv integrin

In this example, a series of short synthetic peptides containing the RGD sequences listed in Table 3 were synthesized, and the pro-inflammatory factor TNF-α gene was determined by the procedure described in the "Materials and Methods" section. Performance in THP-1 macrophages to assess the efficacy of these synthetic peptides against αv integrins. Briefly, THP-1 macrophages were treated with soluble VTN and a specific peptide (any of SEQ ID NOs: 1 to 18) for 3 hours, and gene expression was monitored by real-time quantitative PCR. The experimental results are shown in FIG. 3 .

Table 3 Short synthetic peptides Peptide name amino acid sequence serial number RGD peptide RGDVF NH ₂ -Arg-Gly-Asp-Val-Phe-COOH 1 RGDID NH ₂ -Arg-Gly-Asp-Ile-Asp-COOH 2 RGDFD NH ₂ -Arg-Gly-Asp-Phe-Asp-COOH 3 RGDND NH ₂ -Arg-Gly-Asp-Asn-Asp-COOH 4 RGDPD NH ₂ -Arg-Gly-Asp-Pro-Asp-COOH 5 RGDTD NH ₂ -Arg-Gly-Asp-Thr-Asp-COOH 6 RGDVD NH ₂ -Arg-Gly-Asp-Val-Asp-COOH 7 Linear D-form RGD peptide RGDvF NH ₂ -Arg-Gly-Asp-d(Val)-Phe-COOH 8 RGDiD NH ₂ -Arg-Gly-Asp-d(Ile)-Asp-COOH 9 RGDfD NH ₂ -Arg-Gly-Asp-d(Phe)-Asp-COOH 10 RGDnD NH ₂ -Arg-Gly-Asp-d(Asn)-Asp-COOH 11 RGDpD NH ₂ -Arg-Gly-Asp-d(Pro)-Asp-COOH 12 RGDtD NH ₂ -Arg-Gly-Asp-d(Thr)-Asp-COOH 13 RGDvD NH ₂ -Arg-Gly-Asp-d(Val)-Asp-COOH 14 Head-to-tail cyclic RGD peptide c(RGDID) Cyclic (Arg-Gly-Asp-Ile-Asp) 15 c(RGDiD) Cyclic (Arg-Gly-Asp-d(Ile)-Asp) 16 c(RGDFD) Cyclic (Arg-Gly-Asp-Phe-Asp) 17 c(RGDfD) Cyclic (Arg-Gly-Asp-d(Phe)-Asp) 18 A lower case letter in any sequence indicates that the particular amino acid is a D-form amino acid.

As depicted in Figure 3, soluble VTN-induced TNF-[alpha] mRNA expression was approximately 14.3-fold higher compared to the cells of the solvent-treated control group. Even more surprisingly, neither the linear nor cyclic peptides of RGDVF composed of amino acids in the L-configuration exhibited an effect of inhibiting the expression of TNF-α mRNA (Fig. 3A). The experimental results show that the RGD peptide has no antagonistic effect on αvβ3 integrin, but exhibits some antagonistic effects similar to VTN.

In contrast, cells treated with VTN containing RGDfD, c(RGDfD), or c(RGDiD) peptides independently exhibited reduced TNF-α mRNA performance compared to cells treated with VTN/solvent (10.5±0.9 , 8.3±0.8 or 10.7±0.8 compared to 14.3±0.8, panel 3 (B)). The experimental results indicate that some RGD peptides containing D-amino acids can act as αvβ3 integrin antagonists.

Taken together, RGDfD, c(RGDfD) and c(RGDiD) act as antagonists of αv integrins by restoring the gene expression of VTN-induced TNF-α in THP-1 macrophages.

2.2 Activated RGD peptides inhibited VTN-induced TNF-α gene expression in a dose-dependent manner

The inventors further investigated five known αvβ3 integrin antagonists, including cilengitide, c(RGDfK) (SEQ ID NO: 19), c(RGDyK) (SEQ ID NO: 20), SB273005 ((S)- 2-(8-(2-(6-(Methylamino)pyridinyl-2-yl)ethoxy)-3-oxy-2-(2,2,2-trifluoroethyl)-2 ,3,4,5-Tetrahydro-1H-benzo[c]azepin-4-yl)acetic acid)((S)-2-(8-(2-(6-(methylamino)pyridin-2-yl) )ethoxy)-3-oxo-2-(2,2,2-trifluoroethyl)-2,3,4,5-tetrahydro-1H-benzo[c]azepin-4-yl)acetic acid), ATN-161( Ac-Pro-His-Ser-Cys-Asn-NH ₂ , SEQ ID NO: 21) and Tirofiban (antagonist of platelet receptor αIIbβ3), whether VTN induced in THP-1 macrophages TNF-α gene expression has no inhibitory effect. The inventors found that cells treated with VTN containing cilengitide, c(RGDfK), SB273005 and ATN-161 independently resulted in decreased mRNA expression of TNF-α compared to cells treated with VTN/solvent ( 9.7 ± 1.0, 9.6 ± 1.6, 11.4 ± 0.9 and 10.0 ± 1.1 compared to 14.3 ± 0.8 (control group)); c(RGDyK) and tirofiban had no such effect (Figure 4A).

Next, THP-1 macrophages were treated with different doses (5, 10, or 20 micromolar) of cilengitide, c(RGDfK), RGDfD, c(RGDiD), and c(RGDfD) to evaluate targeting Inhibitory effect of VTN-induced TNF-α mRNA expression. Experimental results are presented as percent inhibition of the VTN/solvent control group (set to 100%). Overall, the five αvβ3 integrin antagonists exhibited a dose-dependent response to VTN-induced TNF-α gene expression, although the dose-dependent response was to a lesser extent for RGDfD and c(RGDiD). When THP-1 macrophages were treated with 10 or 20 micromolar concentrations of cilengitide, c(RGDfK) and c(RGDfD), the percentage inhibition was 65.9/49.4%, 68.8/54.2% and 67.8/51.2, respectively % (panel (B) of Figure 4).

The aforementioned experimental data indicate that the three RGD peptides have similar anti-VTN αvβ3 integrin antagonistic activities.

Example 3: c(RGDfD) and c(RGDiD) individually exhibit beneficial effects in restoring corneal epithelial damage in experimental dry eye

In this example, the effects of c(RGDfD) and c(RGDiD) on dry eye were investigated. The experimental results are shown in FIG. 5 .

As described in Figure 5, panels (A), (B), 8 days after induction of dry eye, damage in the corneal epithelial barrier results in uptake of fluorescent dyes. Mice were classified as moderate/severe dry eye with a score above 2 on fluorescence staining and were then randomly assigned to receive c(RGDfD), c(RGDiD) or vehicle eyedrops. It was found that mice treated with c(RGDfD) or c(RGDiD) for 5 days (day 12) showed a significant reduction in the fraction of fluorescent staining compared to the vehicle-treated group (Panel 5 (C) ; 2.1±0.2 and 2.4±0.3 vs. 3.0±0.0; P values 0.0003 and 0.04, respectively).

Dry eye mice treated with eyedrops were further fed in a low humidity environment, and on day 19, fluorescent staining showed c(RGDfD) or c(RGDiD)-treated mice compared with vehicle-treated groups. Mice had reduced corneal epithelial damage (2.1±0.2 and 2.0±0.2 vs. 2.9±0.1; P values 0.004 and 0.003, respectively).

In total, in the results of this example, it is pointed out that DED mice exhibited significant corneal epithelial damage, however, treatment with eyedrops containing c(RGDfD) or c(RGDiD) peptides alleviated both symptoms in dry eye. Some eye surface damage.

Example 4: Therapeutic effect of the synthetic peptide on dry eye

To further confirm the therapeutic effect of αv integrin antagonists on DED, the synthetic peptides (RGDfD or c(RGDfD)) or four known αvβ3 integrin antagonists (including c(RGDfK) , ATN-161, SB273005 and cilengitide) were used to treat dry eye mice respectively. The eye drops containing tirofiban (an αIIbβ3 inhibitor) were used as the negative control group.

Eight days after induction of dry eye, mice in all groups exhibited significant damage to the corneal epithelium as detected by fluorescent staining (score higher than 2). After 4 days of eyedrop treatment (day 12), c(RGDfK), ATN-161, SB273005, cilengitide, RGDfD and c(RGDfD) exhibited the ability to treat dry eye, while excipient and replacement Rofiban did not have such a therapeutic effect (Table 4 and Figure 6). Furthermore, the inventors noticed that c(RGDfD) exhibited a more pronounced ability to treat dry eye compared to the other groups, even though c(RGDfD), c(RGDfK) and cilengitide independently exhibited similar inhibition of THP -1 Activity expressed by VTN-induced TNF-α mRNA in macrophages.

Table 4 Mean corneal fluorescence staining scores in dry eye groups compound Average score P value Day 8 Day 12 carrier 2.9±0.10 3.0±0.0 0.15 c(RGDfK) 3.0±0.0 1.8±0.24 7.75E-05 ATN-161 2.8±0.11 2.1±0.19 0.0028 SB273005 3.0±0.0 2.7±0.14 0.028 Cilengitide 2.9±0.08 2.4±0.19 0.027 RGDfD 2.8±0.11 2.1±0.19 0.0028 c(RGDfD) 3.0±0.0 1.4±0.14 1.18E-11 Tirofiban 2.8±0.11 2.6±0.19 0.48

Example 5: The synthetic peptide prevents the loss of goblet cells in the conjunctiva during the development of experimental dry eye

Goblet cells are primarily resident on the surface epithelium of the conjunctival fornix and are responsible for the production of mucous tears. PAS staining of goblet cells in NS mice showed a continuous homogeneous pattern on the conjunctival fornix (Figure 7A). However, compared to the NS, c(RGDfD) or c(RGDiD) groups, goblet cells were significantly reduced in vehicle-treated dry eye mice (number/0.1 mm ² : 5 vs. 9, 8 and 7; Fig. 7B).

The experimental results demonstrate that eye drops containing c(RGDfD) or c(RGDiD) can prevent the loss of goblet cells during the development of dry eye.

Example 6: The synthetic peptide inhibits the inflammatory response in experimental dry eye

Reports indicate that pro-inflammatory factors such as TNF-α, IL-1β, IL-6 and matrix metalloproteinase (MMP)-9 are involved in the pathogenesis of dry eye. For example, TNF-α and IL-1β blockers have been shown to improve experimental dry eye. Therefore, the reduction of gene expression of TNF-α , IL-1β , IL-6 and MMP-9 in dry eye is beneficial for the treatment of dry eye.

In this example, the mRNA expression levels of TNF-α , IL-1β , IL-6 and MMP-9 in dry eye were monitored by real-time quantitative PCR, respectively. It was found that the mRNA expression levels of TNF-α, IL-1β, IL-6, and MMP-9 were significantly up-regulated by 1.6, 1.7, 2.3, and 29.6-fold compared with the NS group ( FIG. 8 ). Further, treatment with c(RGDfD) and c(RGDiD) significantly reduced the gene expression of TNF-α , IL-1β and IL-6 , bringing expression levels close to the individual baselines. Furthermore, c(RGDfD) and c(RGDiD) also significantly inhibited the gene expression of MMP-9 by about 1.33 and 1.65-fold compared to the vehicle-treated group.

Taken together, the experimental results indicate that c(RGDfD) and c(RGDiD) can inhibit the gene expression of pro-inflammatory factors (ie, MMP-9 ) in dry eye. The experimental results suggest that αv integrin is involved in the pathogenesis of macrophage-related inflammation and dry eye.

Although the above embodiments disclose specific embodiments of the present invention, they are not intended to limit the present invention. Those with ordinary knowledge in the technical field to which the present invention pertains, without departing from the principle and spirit of the present invention, should Various changes and modifications can be made to it, so the protection scope of the present invention should be defined by the appended claims.

none

In conjunction with the accompanying drawings, the following embodiments of the present disclosure will be more clearly understood, in which:

Figure 1 presents the overexpression of vitronectin (VTN) in the tear fluid and conjunctival stroma in dry eye mice. (A) The concentration of VTN in tears and serum of dry eye mice was analyzed by enzyme-linked immunosorbent assay (ELISA). Experimental data (mean ± SE) were obtained from 10 mice from day 0 to week 3. * indicates P<0.001 compared to day 0. Non-stressed (NS) mice housed in general environmental conditions were used as a control group. (B) Immunohistochemical staining of VTN (coffee color) in conjunctival tissue showing representative photomicrographs from two independent experiments (n=6). Using real-time quantitative polymerase chain reaction (Real-time Quantitative Polymerase Chain Reaction, real-time qPCR) (C) and Western blotting (D) to analyze the conjunctiva of dry eye mice and NS mice (n=6) The performance of VTN. Representative blot results and density analysis from 6 samples are shown. a: P<0.0001 compared to NS mice; b: P<0.0002 compared to NS mice.

Figure 2 shows that in dry eye, the expression of αv integrin is induced in macrophages. (A) Immunofluorescence staining results of αv integrin (red) and F4/80 (green; a macrophage biomarker) in conjunctival tissue on day 12 after induction of dry eye. The small local image is the image before the image image is superimposed. Nuclei (blue) were counterstained with a stain (Hoechst 33258). Asterisks indicate conjunctival epithelial cells. Six sections were taken from each mouse eye of six mice per group as representative images for each group. NS group: Mice were kept in a stress-free environment. (B) Digital image analysis using a Zeiss epifluorescence microscope and Zeiss software, the average of six 1000 magnification fields randomly selected from each section (n=6) for blind analysis Percentage of αv integrin ⁺ macrophages per total macrophage. *: P<0.0001 compared to the NS group. (C) 12 days after induction of dry eye, the mRNA content of iNOS and αv integrin in the conjunctiva was measured by real-time quantitative PCR. Gapdh was used as the control group. Values are expressed as mean ± standard deviation. a: P<0.03 compared to NS mice; b: P<0.002 compared to NS mice.

Figure 3 presents the effect of RGDVF-based peptides on VTN-induced TNF-α mRNA expression in THP-1 macrophages. 5×10 ⁵ THP-1 monocytes were differentiated into macrophages by culturing in complete medium with the addition of 10 ng/ml PMA for 2 days, followed by serum starvation for an additional 16 hours. Next, in fresh serum-free medium, RGDVF-based peptides (consisting of L-configuration amino acids) and (B) a D-form amino acid (lowercase letters) were added at a concentration of 20 micromolar. THP-1 macrophages were treated with RGDVF-based peptides for 10 minutes, followed by the addition of VTN (10 μg/ml) for an additional 3 hours. TNF-α mRNA content was analyzed and determined by real-time quantitative PCR. Gapdh as the loading control group. Experimental data are representative of three independent experiments. * indicates p<0.00007 compared to cells treated with solvent only. a: P<0.03 compared to cells treated with solvent only; b: P<0.03; c: P<0.005.

Figure 4 presents the effect of synthetic peptides of the present disclosure and conventional αvβ3 integrin antagonists, respectively, on VTN-induced TNF-α mRNA expression in THP-1 macrophages. ⁵ x 105 THP-1 macrophages were serum starved for 16 hours, followed by VTN (10 μg/ml) and (A) 20 μmolar or (B) 5–20 μmolar as indicators The macrophages were treated with an integrin inhibitor and cultured in fresh serum-free medium for 3 hours. TNF-α mRNA levels were determined by real-time quantitative PCR analysis. Gapdh as the loading control group. Experimental results are presented as percent inhibition of the VTN/solvent inhibition group (100%). Each bar represents the mean ± standard error (SE) of three independent experiments. *: Indicates p<0.05 compared to cells treated with solvent alone.

Figure 5 presents that synthetic peptides of the present disclosure can improve corneal epithelial damage in dry eye. (A) Time course of induction of dry eye mouse model: To induce dry eye, C57BL/6 mice were fed in a low-humidity controlled environment chamber (CEC), and the Daily subcutaneous injection of scopolamine. Next, mice were topically treated with vehicle (BSS), c(RGDfD) and c(RGDiD) eye drops on days 8-12 and 15-19. The severity of corneal epithelial damage was detected by corneal fluoroscopic staining before treatment (day 8) and after treatment (day 12-19). (B) Representative images of corneal fluorescence staining fractions.

Figure 6 presents the therapeutic effect of αvβ3 integrin antagonists on corneal epithelial damage in experimental dry eye. On day 8, compared with untreated dry eye mice, 100 micromolar concentrations of c(RGDfK), ATN-161, SB273005, RGDfD, c(RGDfD) or cilengitide The corneal epithelial damage in dry eye mice treated with eye drops for 4 days showed a significant decrease (P<0.05). Error bars represent Standard Error (SE).

Figure 7 presents the results of PAS staining of goblet cells in the conjunctival fornices of dry eye mice on day 19. (A) Representative photographs of goblet cells (pink) showing dry eye treated with vehicle, c(RGDfD) and c(RGDiD) eye drops. (B) Using a microscope (Nikon Eclipse 80i) equipped with a camera (Leica DC 500) at a magnification of 200x, the average cell number from 6 fields of view randomly selected from each section was used to blindly count each set of cups The average value of the shape cells. Experimental data show medians/quartiles for individual mice (n=8 per group).

Figure 8 presents the assessment of the level of transcription of TNF-α , IL-1β , IL-6 and MMP-9 in the conjunctiva of dry eye by real-time quantitative PCR analysis . The induction time course and treatment of dry eye mice are shown in Figure 5. Experimental data are presented as mean ± SE. The P value compared to the vehicle-treated group was used as an indicator.

<110> Mackay Memorial Hospital of Taiwan Presbyterian Church Mackay Medical Foundation

<120> Short synthetic peptide and its use for treating dry eye

<140> TW110107250

<141> 2021-03-02

<160> 39

<170> BiSSAP 1.3.6

<210> 1

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 1

<210> 2

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 2

<210> 3

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 3

<210> 4

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 4

<210> 5

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 5

<210> 6

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 6

<210> 7

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<400> 7

<210> 8

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 8

<210> 9

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 9

<210> 10

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 10

<210> 11

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 11

<210> 12

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 12

<210> 13

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 13

<210> 14

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 14

<210> 15

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MUTAGEN

<222> 1...5

<223> Cyclic peptide

<220>

<223> Synthesis

<400> 15

<210> 16

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MUTAGEN

<222> 1...5

<223> Cyclic peptide

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 16

<210> 17

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MUTAGEN

<222> 1...5

<223> Cyclic peptide

<220>

<223> Synthesis

<400> 17

<210> 18

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MUTAGEN

<222> 1...5

<223> Cyclic peptide

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 18

<210> 19

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MUTAGEN

<222> 1...5

<223> Cyclic peptide

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 19

<210> 20

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MUTAGEN

<222> 1...5

<223> Cyclic peptide

<220>

<223> Synthesis

<220>

<221> MUTAGEN

<222> 4

<223> D amino acid

<400> 20

<210> 21

<211> 5

<212> PRT

<213> Artificial sequences

<220>

<221> MOD_RES

<222> 1

<223> ACETYLATION

<220>

<223> Synthesis

<400> 21

<210> 22

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 22

<210> 23

<211> 19

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 23

<210> 24

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 24

<210> 25

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 25

<210> 26

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 26

<210> 27

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 27

<210> 28

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 28

<210> 29

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 29

<210> 30

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 30

<210> 31

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 31

<210> 32

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 32

<210> 33

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 33

<210> 34

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 34

<210> 35

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 35

<210> 36

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 36

<210> 37

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 37

<210> 38

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 38

<210> 39

<211> 20

<212> DNA

<213> Artificial sequences

<220>

<223> Synthesis

<400> 39

Claims (4)

A synthetic peptide of general formula (I): RGDX _aa D (I) wherein the synthetic peptide is in a cyclic form; X _aa is a D-form isoleucine (I). A pharmaceutical composition, comprising the synthetic peptide of claim 1 and a pharmaceutically acceptable carrier. The pharmaceutical composition of claim 2, wherein the pharmaceutical composition is in the form of a liquid, gel, cream or ointment. A use of a synthetic peptide for preparing a medicament for treating dry eye, wherein the synthetic peptide is in a linear form and has the amino acid sequence of SEQ ID NO: 10; or the synthetic peptide is in a cyclic form, and Has the amino acid sequence of SEQ ID NO: 16 or 18.

Images