TWI760999B - Use of atemoya extract for whitening skin, improving skin elasticity, and protecting skin from uv damage - Google Patents

Abstract

The present disclosure relates to a use of Atemoya extract. In particular, the use of Atemoya extract for whitening skin, improving skin elasticity, and protecting skin from UV damage, wherein such Atemoya extract is obtained by an aqueous extract.

Description

Use of pineapple chard extract for the preparation of a composition for skin whitening, protection against UV damage and improving skin elasticity

This case is about the use of an extract of pineapple chard, especially the use of a composition for preparing skin whitening, anti-ultraviolet damage and improving skin elasticity.

Pineapple Sakya ( Annona cherimola × Annona squamosa ), also known as Honey Sakya, Wanglai Sakya and Chimei Sakya, is a hybrid of Annona cherimola and Annona squamosa . It was first introduced in Florida in 1908. Continent bred. Pineapple Sakyamuni is a small perennial tree with a stem height of 3 to 10 meters; leaves are single alternate leaves, petioles about 1.5 to 2 cm long, with smooth leaf margins; 3 petals, 3 angular and long, pale green drooping. The pulp of pineapple sakya is connected, which is different from the petal-shaped pulp of sakya (sweet apple). Generally speaking, pineapple sakya fruit can reach more than 600 grams.

The skin is of indispensable importance for the protection of the human individual, providing the first stage of protection against environmental factors such as UV radiation in the sun, pathogens, friction, etc. Generally, young skin has better support and elasticity, but with age or environmental factors, the skin will gradually age. For example, the skin may be degraded due to collagen breakdown, resulting in decreased skin elasticity or due to the precipitation of melanin, making the overall skin dull and other aging states.

In view of this, it is necessary to research or develop a composition that can improve skin fairness and elasticity to maintain or improve skin appearance.

Therefore, an object of the present invention is to provide the use of a pineapple sacha extract for preparing a composition for skin whitening, skin elasticity improvement, and ultraviolet damage protection.

Specifically, an object of the present invention is to provide a pineapple sacha extract for preparing a composition for inhibiting tyrosinase activity in skin cells, reducing melanin production in skin cells, improving skin cells' resistance to ultraviolet damage, and improving skin elasticity the use of.

In some embodiments, the composition is a pharmaceutical composition.

In some embodiments, the composition is further prepared into a skincare composition, a health food composition, or a cosmetic composition.

In some embodiments, the pineapple custard extract is obtained by extracting a pineapple custard fruit with an aqueous solvent. In some embodiments, the aqueous solvent is pure water. In some embodiments, the aqueous solvent further comprises a glycolytic enzyme. In some embodiments, the concentration of the glycolytic enzyme is 0.1 wt%.

In some embodiments, the pineapple chardonnay extract is formed by a water-containing solvent to form a primary extract, and the primary extract is lysed by saccharifying enzymes to form the pineapple chardonnay extract.

In some embodiments, the pineapple charcoal extract improves skin fairness by inhibiting tyrosinase activity.

In some embodiments, the pineapple charcoal extract improves skin fairness by reducing melanin production in skin cells. In some embodiments, the melanin production is caused by ultraviolet light.

In some embodiments, the Pineapple Shakya extract enhances the ability of cells to resist ultraviolet rays by increasing the expression of mitochondrial activity-related genes in skin cells.

In some embodiments, the mitochondrial activity-related genes are PARP1 gene (Gene ID: 142), PARP2 (Gene ID: 10038) and NADSYN (Gene ID: 55191).

In some embodiments, the Pineapple Shakya extract enhances skin elasticity through the secretion of elastin from skin cells.

In some embodiments, the concentration of the pineapple custard extract is at least 0.25 mg/mL.

In some embodiments, the pineapple custard extract has a Degrees Brix value of 8±0.5.

To sum up, the pineapple sacha extract of any embodiment can be used to prepare a skin whitening composition. The pineapple charcoal extract of any one of the embodiments can be used to prepare a composition for inhibiting tyrosinase activity. The pineapple charcoal extract of any one of the embodiments can be used to prepare a composition for inhibiting melanin production. The pineapple chard extract of any one of the embodiments can be used to prepare a composition for enhancing the ability of skin cells to resist ultraviolet rays. The pineapple sacha extract of any one of the embodiments can be used to prepare a composition for enhancing the expression of genes related to mitochondrial activity in skin cells. The pineapple sacha extract of any one of the embodiments can be used to prepare a composition for increasing the secretion of elastin in skin cells.

Some specific implementation aspects of this case will be described below. Without departing from the spirit of this case, this case can still be practiced in many different forms, and the scope of protection should not be limited to the conditions specifically stated in the description.

The case used Excel software for statistical analysis. Data are presented as mean ± standard deviation (SD), and differences between groups were analyzed by Student's t-test. In the graph, "*" represents a p-value less than 0.05, "**" represents a p-value less than 0.01, and "***" represents a p-value less than 0.001. The more "*", the more significant the statistical difference.

The numerical values used herein are approximate, all experimental data are expressed within the range of plus or minus 10%, and the optimum is within the range of plus or minus 5%.

Herein, "wt%" refers to weight percent, and "vol%" refers to volume percent.

As used herein, the term "extract" refers to a product prepared by extraction. The extract may be presented as a solution in a solvent, or the extract may be presented as a concentrate or essence free or substantially free of solvent.

As used herein, "Pineapple Shakya raw material" generally refers to the fruit of the plant, wherein the fruit may be peeled or unskinned, dried or otherwise physically processed to facilitate handling, which may further include whole, chopped, Fruit that has been diced, milled, ground or otherwise processed to affect the size and physical integrity of the raw material.

Refer to Figure 1. In some embodiments, a pineapple custard extract is obtained by extracting pineapple custard raw material with an aqueous solvent. In some embodiments, the pineapple custard extract is obtained by sequentially performing the crushing process S01 , the heating process S02 , the filtering process S04 , and the concentration process S05 on the pineapple custard raw material.

In some embodiments, the raw pineapple chard may be pineapple chard fruit with or without skin. In some embodiments, the raw material of pineapple can be fresh or dried pineapple fruit.

In some embodiments, the pulverizing procedure S01 refers to whipping the raw material of pineapple chakra until it is broken into pieces. For example, comminution can be performed using a juicer, conditioner or homogenizer.

In some embodiments, the heating procedure S02 refers to mixing the crushed pineapple custard raw material with a water-containing solvent and heating for a fixed period of time. In some embodiments, heating refers to raising the temperature of the pineapple custard raw material and the water-containing solvent to 50°C to 100°C. In some embodiments, a fixed period of time refers to 0.5 hours to 3 hours. For example, the temperature of the pineapple custard raw material and the water-containing solvent is raised to 85° C. for extraction for 1 hour.

In some embodiments, the weight ratio in the heating procedure S02 (a solvent containing water: a raw material of pineapple sago) is 5:1 to 20:1. For example, the solvent containing water: pineapple custard raw material is 10:1.

For example, 90 kg of pineapple custard raw material, 900 kg of water and 0.63 kg of citric acid are used to mix and continue to heat to 100°C, and maintain the temperature at 100°C for 0.5 hours. For example, 90 kg of pineapple custard raw material, 900 kg of water and 0.7 kg of citric acid are used to mix and continue to heat to 85°C and maintain at 85°C for 1 hour.

In some embodiments, the aqueous solvent may be pure water or an organic acid-containing aqueous solvent. In some embodiments, the concentration of organic acid is 0.05% to 1.00%. In some embodiments, the organic acid may be an edible acid. In some embodiments, the edible acid may be citric acid, malic acid, tartaric acid, lactic acid, gluconic acid, acetic acid, etc., but is not limited thereto.

In some embodiments, the aqueous solvent may further comprise amylase. In some embodiments, the heating procedure S02 refers to stirring and mixing the pineapple custard raw material with water and starch saccharifying enzyme sufficiently, and then raising it to 50° C. to 100° C. for a period of time. Among them, the content of active ingredients in the pineapple chardonnay extract can be further increased by the fermentation of enzymes. In some embodiments, the amylase may be at least one of alpha-amylase, beta-amylase, glucoamylase, isoamylase, or a mixture thereof. In some embodiments, the amylinase can be glucoamylase (glucan 1,4-alpha-glucosidase). In some embodiments, the addition amount of amylin is 0.05% to 0.15% of the water-containing solvent. In some embodiments, the water-containing solvent can be water. In some embodiments, the heating procedure S02 is to mix the raw material of pineapple custard with water at a ratio of 1:5, add 0.1% starch saccharification enzyme, and heat it to 55° C. for 1 hour.

In some embodiments, the filtering procedure S04 refers to passing the heated (or cooled) pineapple custard raw material and the solvent through a screen to filter out the solids in the solvent to form a filtrate. For example, the screen may be a 400 mesh screen.

Refer to Figure 2. In some embodiments, a secondary heating procedure S03 is further included between the heating procedure S02 and the filtering procedure S04, and the secondary heating procedure S03 refers to the secondary heating of the pineapple sago raw material after the heating procedure S02, wherein the secondary heating procedure The heating temperature is higher than the temperature of the heating program S02. For example, the temperature of the heating procedure S02 is 65° C. for 30 minutes, and the temperature of the secondary heating procedure S03 is 95° C. for 50 minutes.

In some embodiments, the concentration procedure S05 means that the filtrate obtained in the filtration procedure S04 is concentrated under reduced pressure (brand/model: BUCHI-Rotavapor R-100) to obtain a primary extract. In some embodiments, the primary extract obtained in the concentration process S05 may be the extract of pineapple chard. In some embodiments of the concentration procedure S05, the concentration under reduced pressure is performed between 40°C and 70°C. For example, the pineapple custard extract is obtained by sequentially performing the crushing process S01, the heating process S02, the filtration process S04 and the concentration process S05 on the pineapple custard raw material.

In other embodiments, the concentration procedure S05 is to concentrate the filtrate obtained in the filtration procedure S04 under reduced pressure to obtain a concentrate.

In some embodiments, after the concentration process S05, a re-filtration process S06 is further included, which means passing the concentrated solution through a 400-mesh screen to filter out the solids in the concentrated solution to form the pineapple chardonnay extract. For example, the pineapple custard extract is obtained by performing the crushing procedure S01, the heating procedure S02, the secondary heating procedure S03, the filtration procedure S04, the concentration procedure S05 and the re-filtering procedure S06 in sequence on the pineapple saccharin raw material.

In some embodiments, the use of the pineapple chamomile extract for preparing a skin whitening composition, wherein the pineapple chamomile extract achieves skin enzymatic whitening by inhibiting tyrosinase activity or reducing the production of melanin in cells, and the pineapple chakra extract Extraction is carried out with an aqueous solvent. In some embodiments the cellular melanogenesis is generated from ultraviolet radiation. In some embodiments, the ultraviolet light is UVA.

The darker color of the skin is due to the production of melanin, and in the process of melanin production, tyrosinase plays an important role. Tyrosinase is an oxidase, the rate-limiting enzyme that regulates melanin production. Specifically, tyrosinase is involved in two reactions in melanin synthesis: (1) hydroxylation of monophenols to diphenols and (2) oxidation of ortho-diphenols to ortho-diquinones. Tyrosinase is present in skin melanocytes and is formed by the transcription of TYR gene. Therefore, through the inhibition of tyrosinase activity, the production of melanin can be reduced to achieve the effect of skin whitening.

In some embodiments, the pineapple charcoal extract can inhibit, prevent or slow down the formation of melanin in the skin by inhibiting the formation of tyrosinase, thereby achieving the effect of skin whitening and/or enhancing skin radiance.

In some embodiments, the extract of pineapple chard at a concentration of 0.5 mg/mL or more can be used to enhance skin radiance and/or improve skin fairness.

In some embodiments, pineapple sacha extract with a Degrees Brix value of 8.0 or higher can be used to enhance skin radiance and/or improve skin fairness.

In some embodiments, the pineapple chamomile extract is used to prepare a composition for enhancing the skin's ability to resist ultraviolet rays, wherein the pineapple chardonnay extract achieves the skin's ability to resist ultraviolet rays by enhancing the activity of intracellular mitochondria, and the pineapple chakra extract The material is extracted with an aqueous solvent. In some embodiments, the pineapple chardonnay extract achieves the enhancement of mitochondrial activity by enhancing mitochondrial activity-related genes.

In some embodiments, the mitochondrial activity-related genes are the PARP1 gene (Gene ID: 142), PARP2 (Gene ID: 10038), and NADSYN (Gene ID: 55191).

Among them, the proteins PARP1 and PARP2 transcribed by the PARP1 gene and the PARP2 gene have the function of inhibiting NAD+, so if the expression of these genes is reduced, the content of NAD+ will increase. NAD+ is a molecule that provides cellular energy, which can be used for metabolism, building new cells, resisting free radicals and DNA damage, etc. It also assists the mitochondria to generate the energy needed for the body to maintain functions. Therefore, through the inhibition of PARP1 and PARP2, the mitochondria can maintain a better activity, in addition to increasing the physical strength of the individual, it can also slow down cell senescence or death. While PARP1 is the main component of the PARP family, PARP2 is a more auxiliary role, which can be used as a substitute after PARP1 loses its function.

NADSYN is an important catalytic factor in the NAD synthesis pathway, and its main role is to catalyze NaAD to NAD. As mentioned above, NAD is an important molecule for the body to generate energy. Therefore, by increasing the expression of NADSYN gene, mitochondrial activity will increase, thereby improving cell survival.

In other words, Pineapple Shakya extract can enhance the activity of the skin mitochondria by increasing the expression of the above-mentioned genes, thereby enhancing the ability of the skin to resist ultraviolet rays.

In some embodiments, the extract of pineapple custard at a concentration of more than 0.5 mg/mL can improve the skin's ability to resist ultraviolet rays.

In some embodiments, the pineapple sacha extract with a Degrees Brix value of 8.0 or higher can improve the skin's ability to resist UV rays.

In some embodiments, the extract of pineapple charcoal can be used to improve skin elasticity.

In some embodiments, the Pineapple Shakya extract improves skin elasticity by enhancing the elastin secretion capacity of skin cells.

In some embodiments, the pineapple custard extract at a concentration of more than 0.5 mg/mL can improve skin elasticity, and the pineapple custard extract is extracted with a water-containing solvent.

In some embodiments, the pineapple charcoal extract with a Degrees Brix value of 8.0 or higher can improve skin elasticity.

In some embodiments, the aforementioned compositions may be pharmaceuticals. In other words, this medicinal product contains an effective amount of pineapple chardonnay extract. In other words, this medicinal product contains an effective amount of pineapple chardonnay extract.

In some embodiments, the aforementioned pharmaceutical products can be manufactured into a dosage form suitable for parenteral or oral administration using techniques well known to those skilled in the art. These administration forms include, but are not limited to: tablet, troche, lozenge, pill, capsule, dispersible powder or fine granules ( granule), solution, suspension, emulsion, syrup, elixir, slurry and the like.

In some embodiments, the aforementioned pharmaceutical products can be manufactured into a dosage form suitable for parenterally or topically administration using techniques well known to those skilled in the art, including , but not limited to: injection, sterile powder, external preparation and the like. In some embodiments, the medicinal product may be administered by a parenteral route selected from the group consisting of: subcutaneous injection, intraepidermal injection, Intradermal injection and intralesional injection.

In some embodiments, the medicinal product may further comprise a pharmaceutically acceptable carrier that is widely used in pharmaceutical manufacturing techniques. For example, a pharmaceutically acceptable carrier may contain one or more of the following agents: solvent, buffer, emulsifier, suspending agent, decomposer, disintegrating agent Disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling gelling agents, preservatives, wetting agents, lubricants, absorption delaying agents, liposomes, and the like. The selection and quantity of these reagents are within the scope of the expertise and routine skills of those skilled in the art.

In some embodiments, the pharmaceutically acceptable carrier comprises a solvent selected from the group consisting of water, normal saline, phosphate buffered saline (PBS) , An aqueous solution containing alcohol.

In some embodiments, the aforementioned compositions may be edible compositions. In some embodiments, the edible composition can be made into a food product or can be a food additive, meaning that it is added to the food product by conventional methods during the preparation of the food product, or can be added to the food product added during the production process. Here, the food product may be a product formulated with an edible material for ingestion by humans or animals.

In some embodiments, food products may be, but are not limited to, beverages, fermented foods, bakery products, health foods, and dietary supplements.

[ example 1] Preparation of Pineapple Shakyamuni Extract

The fruit of Pineapple Sakyamuni was crushed (10 speed blender of Osterizer brand) and sieved with a 10-mesh sieve to remove excessively large particles to obtain coarsely crushed Pineapple Sakyamuni fruit. In other embodiments, the mesh number of the screen may be 8 or 12 mesh.

Next, in the heating process, use water as a solvent to mix with the coarsely crushed pineapple custard fruit at a weight ratio of 5:1, add 0.1 wt% starch saccharifying enzyme in the mixture, and extract at 55±5°C for about 60 minutes to form a mixture containing Solid first extract. Here, the commercially available AMG brand 300L enzyme was used.

In other embodiments, the weight ratio of the solvent to the pineapple sakya fruit can also be 10:1-20:1, the soaking temperature can be 45°C-75°C, and the extraction time can be 30-90 minutes. If the solvent is too small or the extraction time is too short, the extraction efficiency will drop significantly; if the extraction time is too long, the active ingredients in the extract may be degraded.

The aforementioned first extraction solution is heated twice, and the heating temperature is 85±5° C. and maintained at this temperature for 60 minutes to form a second extraction solution, wherein the Brix value of the second extraction solution is greater than 2.5.

The aforesaid second extract is filtered to remove larger solids, wherein the sieve used in the filtration is a 400-mesh sieve.

The filtered filtrate was concentrated under reduced pressure with a concentrator (brand/model: BUCHI -Rotavapor R-100) at 60°C ± 5°C until the solution's Brix value (Degrees Brix) was 8 ± 0.5. Concentrated to obtain the Pineapple Shakyamuni extract of this case. In other embodiments, the concentration under reduced pressure can be performed at 45°C-70°C.

[ example 2] Polysaccharide Quantitative Experiment

Standard curve drawing:

First, accurately weigh 10 mg of D-Glucose (purchased from JT Baker, part number: 1916-01), put it in a 10 mL volumetric flask, and quantify it to 10 mL with double distilled water (ddH ₂ O). , configured into a D-glucose solution with a concentration of 1 mg/mL.

Next, the above-mentioned standards were serially diluted to 0, 20, 50, 100, 150, 200 μg/mL of D-glucose solution with double distilled water. The standard solution can be prepared by referring to Table 1 below.

Table 1: D-glucose solution standard solution configuration method Concentration ( μg/mL ) 0 20 50 100 150 200 D- glucose solution ( 1 mg/mL ) 0μL 20μL 50μL 100μL 150μL 200μL ddH ₂ O 1000μL 980μL 950μL 900μL 850μL 800μL

After that, 100 μL of each standard solution was placed in a glass test tube, and 500 μL of 5% phenol solution (Phenol) (purchased from Merck, part number: 1.00206.0250) was added to each.

Then, 2.5 mL of concentrated sulfuric acid solution (H ₂ SO ₄ ) with a concentration of 95.5% and a specific gravity of 1.84 (purchased from Showa, part number: 1970-5250) was slowly added. After ensuring no air bubbles by vortexing, it was left to stand for 20 minutes. Finally, 200 μL of the sample was taken into a 96-well culture plate, and its absorbance value was measured at 490 nm, and a standard curve was drawn.

Sample total polysaccharide quantification experiment:

In addition, dilute the pineapple chamomile extract obtained in Example 1 with water 20 times to 1200 μL and take a volume of 100 μL into a glass test tube, and each group of samples needs to be repeated three times. After that, 500 μL of 5% phenol solution (Phenol) (available from Merck, Cat. No. 1.00206.0250) was added.

Then, 2.5 mL of concentrated sulfuric acid solution (H ₂ SO ₄ ) with a concentration of 95.5% and a specific gravity of 1.84 (purchased from Showa, part number: 1970-5250) was slowly added. After ensuring no air bubbles by vortexing, it was left to stand for 20 minutes. Finally, 200 μL of sample was taken into a 96-well culture plate, and its absorbance value was measured at 490 nm, and the concentration was calculated by interpolation and then multiplied back to the dilution factor to obtain the concentration of the original extract.

Experimental results:

According to the results of the above-mentioned experiments, the content of pineapple polysaccharide in the present invention is 50,000 ppm.

[ Example 3 ] Cell experiment - inhibition of tyrosinase activity

Tyrosinase is the key to melanin synthesis in living organisms. Tyrosinase catalyzes the conversion of tyrosine into L-Dopa, and then produces Dopaquinone to form melanin. Here, the tyrosinase activity was detected to understand the effect of pineapple sacha extract on the ability of melanocytes to produce melanin. When the tyrosinase activity was low, the ability of melanocytes to produce melanin was relatively reduced.

Materials and Instruments 1. Cell line: mouse melanoma cell B16F10, purchased from American Type Culture Collection (American Type CμLture Collection, ATCC ^® , No. 6475), hereinafter referred to as B16F10 cells. 2. Medium: DMEM modified medium (Dulbecco's modified Eagle's medium, DMEM, purchased from Gibco, Cat. 12100-038) was added with additional components to contain 10 vol% FBS (fetal bovine Serum, purchased from Gibco, 10438-026) and 1% penicillin-streptomycin (purchased from Gibco, Cat. 15140122). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. Kojic acid: purchased from Sigma-Aldrich, product number K3125-5G. 5. Full name radioimmunoprecipitation buffer protein lysate (RIPA Lysis Buffer (PMSF)): purchased from Sigma-Aldrich, product number 10837091001. 6. Bio-rad Protein Assay, purchased from Biotek, product number Epoch. 7. 10 mM L-Dopa (L-Dopa): Dissolve 9.8 mg of L-Dopa (purchased from Sigma-Aldrich, product number D9628-5G.) in 5 mL of 0.1 mM PBS, pH 7.0 . 8. Trypsin: 10X Trypsin-EDTA (purchased from Gibco) diluted 10-fold in 1X PBS solution. 9. Pineapple Sakyamuni Extract: prepared by the preparation method of Case 1.

Experimental steps:

2 mL of the above medium was added to each well, and B16F10 cells were seeded in a 6-well dish at a density of 1.5 x 10 ⁵ per well and incubated at 37°C for 24 hours.

The experiment was divided into control group, control group and experimental group. Among them, 2 mL of fresh DMEM medium was added to each group. In the culture medium of the control group, Kojic acid was additionally added to a concentration of 0.5 mg/mL. Kojic acid has been widely recognized as a substance that inhibits cellular tyrosinase activity; the culture medium of the experimental group was additionally added with kojic acid. Pineapple Sakya extract to a concentration of 0.5 mg/mL. Three replicates were performed for each group, and the reaction was incubated for 48 hours.

After incubation, the medium was removed and washed twice with 1x PBS (Gibco). Then trypsin-EDTA was added to act on the cells for 3 minutes, the suspended cells were recovered in a 15 mL centrifuge tube, and the cells were pelleted by centrifugation at 400 xg for 5 minutes.

After the pelleted cells were washed twice with 1x PBS, the cells were suspended with 200 μL of cell lysate, mixed by shaking, and centrifuged at 12,000 x g for 20 minutes.

Remove the supernatant into a 1.5 mL centrifuge tube for protein concentration detection:

First, mix Bio-rad stain with deionized water (1:4 by volume), and dispense 500 μL into microcentrifuge tubes. Then, 10, 8, 6, 4, 2, 1, and 0 μL of 2 mg/mL BSA were added to the aforementioned microcentrifuge tubes to prepare standard protein concentration. Add another 2 μL of test sample for detection. 200 μL of the test sample after the above reaction was taken out in a 96-well plate, and the absorbance at 595 nm was measured with an ELISA reader (BioTek).

Next, 400 μg of protein was added to each well, followed by 90 μL of cell lysate, including control group and control group. In the dark, add 10 μL of 10 M L-Dopa at 37 °C and observe every 10 min until the suspension turns black. The absorbance at 405 nm was then measured.

The analytical formula for tyrosinase content is: tyrosinase inhibition (%) = (sample absorbance value/control group absorbance value) × 100%. The obtained values were then statistically analyzed with Microsoft EXCEL software and Student's t test, and the results are shown in Figure 3.

Experimental results:

It can be seen from the results in FIG. 3 that the effect of inhibiting the activity of tyrosinase can be achieved under the treatment of the pineapple chardonnay extract of the present invention. Specifically, the tyrosinase activity of the control group relative to the control group was 79.66%, and the tyrosinase activity of the experimental group (Pineapple Sakyamuni extract) relative to the control group was 67.88%. It can be seen that the Pineapple Sakyamuni extract in this case is in The effect of inhibiting tyrosine is stronger than that of koji acid. Therefore, the pineapple chamomile extract prepared by the embodiment of the present invention can indeed reduce the activity of tyrosinase, thereby reducing the production of melanin, so it can be applied to reduce skin dark spots, improve skin luster, and whiteness and skin whitening. components of the composition.

[ Example 4 ] Cell Experiment - Pineapple Shakyamuni Extract Reduces Melanin Production

Here, the changes of the melanin content of the melanoma cell line B16F10 after being treated with the extract of pineapple chardonnay were measured by an enzyme-linked immunosorbent assay reader.

Materials and Instruments 1. Cell line: mouse melanoma cell B16F10, purchased from American Type Culture Collection (American Type CμLture Collection, ATCC®, No. 6475), hereinafter referred to as B16F10 cells. 2. Medium: Dulbecco's modified minimal essential medium (DMEM, purchased from Gibco, Cat. 12100-038) was added with additional components to contain 1 vol% of an antibiotic solution (Antibiotic Antimycotic Solution, purchased from Gibco, 15240-062) and 10 vol% of FBS (fetal bovine Serum, available from Gibco, 10437-028). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. Prepare a solution of 1N NaOH (available from Sigma, Prod. No. 221465) in double distilled water. 5. ELISA reader (purchased from BioTek, product number FLx 800). 6. Pineapple Sakyamuni extract: prepared by the preparation method of Case 1.

Experimental procedure

The experiment will be divided into three groups: the experimental group, the control group and the control group. Each group will conduct three replicate experiments: 1. B16F10 cells are inoculated into 6 cells containing 3 ml of medium in each well in the form of 1.5×10 ⁵ cells per well. well in the culture dish. 2. Incubate the plate in 5% CO ₂ at 37°C for 24 hours. 3. Then, without disturbing the attached cells, remove the medium from each well. 4. This experiment is divided into control group, control group and experimental group. Among them, 2 mL of fresh DMEM medium was added to each group. The culture medium of the control group was additionally added with kojic acid to make the concentration of 0.5 mg/mL, among which kojic acid has been widely recognized as a substance that has the effect of reducing melanin production; the culture medium of the experimental group was additionally added with Example 1 Pineapple Shakya extract, so that the concentration is 0.5mg/mL. Groups were replicated in triplicate and incubated at 37°C for 24 hours. 5. Move the experimental group and the control group after the reaction to a blue light box, and let them receive blue light irradiation at room temperature (25±5℃) for 3 hours. Additionally, the control group was moved to a dark room and allowed to stand at room temperature for 3 hours. 6. After the reaction, the cells were incubated at 37°C for 48 hours. 7. Then, remove the medium and wash the cells twice with PBS solution. 8. Add 200 μl trypsin (Trypsin-EDTA (10X), available from Gibco; Product No. 15400-054) to each well for 3 minutes. After the reaction, 6 mL of medium solution was added to stop the reaction. Then, the suspended cells and medium in each well were collected into corresponding 15ml centrifuge tubes, and each centrifuge tube was centrifuged at 400 xg for 5 minutes to pellet the cells. 9. After washing the pelleted cells twice with PBS, resuspend the cells with 200 μL of PBS. 10. Freeze the cell suspension in liquid nitrogen for 10 minutes and allow to thaw completely at room temperature for about 30 minutes. 11. After complete thawing, centrifuge the tube at 12,000g for 3 minutes. 12. Remove the supernatant, resuspend the cell pellet with 120 μL of 1N sodium hydroxide solution, and dry the test tube at 60°C for 1 hour to obtain the sample to be tested. 13. Transfer 100 μL of the sample to be tested into a 96-well plate, and use an ELISA plate reader to measure the absorbance of the cell solution at 450 nm.

Experimental results

The relative expression of melanin in the experimental group and the control group was calculated according to the following formula: relative expression of melanin (%)=(OD ₄₅₀ value of each group/OD ₄₅₀ value of control group)×100%. Since the experiment was performed in triplicate, the results of the triplicate experiments were averaged and shown in Figure 4 .

As shown in FIG. 4 , the effect of reducing the production of melanin can be achieved under the treatment of the Pineapple Sakyamuni extract of the present invention. Specifically, the production of melanin in the control group was 79.32% relative to the control group, and the production of melanin in the experimental group (Pineapple Sakyamuni extract) relative to the control group was 81.01%, that is, the production of melanin in the experimental group was reduced by about 18.99% compared with the control group %, and the effect of the pineapple sacha extract in this case is similar to the effect of kojic acid in reducing the production of melanin. Therefore, the pineapple chamomile extract prepared in the embodiment of the present invention can indeed effectively reduce the melanin produced by melanocytes, so it can be used as an ingredient in a related composition for reducing skin dark spots, enhancing skin radiance, and whitening skin.

[ Example 5 ] Cell Experiment - Anti- UVA Ability of Pineapple Sakya Extract

Here, the ability of human dermal fibroblasts CCD-966sk to resist UVA after treatment with pineapple charcoal extract was determined.

Materials and Instruments 1. Cell line: Human skin fibroblast (Human skin fibroblast) CCD-966sk (Biological Resources Conservation and Research Center (BCRC), No. 60153). 2. Medium: Eagle's minimum essential medium (MEM, MEM, purchased from Gibco, 15188-319) was supplemented with 10 vol% FBS (fetal bovine Serum, purchased from Gibco, 10437-028), 90 vol% 1mM sodium pyruvate (sodium pyruvate, available from Gibco, 11360-070), 1.5g/L sodium bicarbonate (available from Sigma), 0.1mM non-essential amino acid solution (available from Gibco) , 11140-050). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. DMSO solution: purchased from ECHO, product number DA1101-000000-72EC. 5. MTT solution: available from Amresco, product number 0793. 6. UV link box: purchased from Cleaver Scientific, product number CL-508. 7. Epoch ^™ Microplate Spectrophotometer: purchased from BioTek. 8. Inverted microscope equipped with camera system: purchased from ZEISS, product number: Vert.A1. 9. Pineapple Sakyamuni extract of the present invention: The Pineapple Sakyamuni extract used in this experiment was prepared in the manner of Example 1.

Experimental procedure

100% 因實驗係進行三重複，故將三重複實驗之結果平均後，顯示於圖5。The experiment will be divided into three groups: the experimental group, the control group (the group without the addition of pineapple sakya extract, and the group without UV irradiation), and the control group (the group without the addition of pineapple saccharomyces extract, but the group exposed to ultraviolet rays). , each group was carried out in three replicates: 1. CCD-966sk cells were seeded in 96-well culture plates containing 100 ml of medium in each well in the form of 5×10 ³ cells per well. 2. Incubate the plate in 5% CO ₂ at 37°C for 24 hours. 3. Remove the medium. 4. Experimental group: add 0.1 mL of cell culture medium containing 0.625 μL of the pineapple chardonnay extract obtained in Example 1 (that is, the volume percentage of pineapple chardonnay extract in the cell culture medium is 0.625%), and culture at 37°C for 24 hours. Control group: add simple 2 mL cell culture medium (that is, without pineapple extract), and culture at 37°C for 24 hours. Control group: add simple 2 mL cell culture medium (that is, without pineapple sorghum extract), and culture at 37°C for 24 hours. 5. Experimental group: move the culture plate to the UV link box and irradiate it with UVA at 12 J/cm ² for 1 hour. Control group: The culture plate was placed in a dark place and allowed to stand at room temperature for 1 hour. Control group: The culture plate was moved to the UV link box and irradiated with 12 J/cm ² of UVA for 1 hour. 6. Add 15 μl of MTT solution to each well and let it act for 4 hours at 37°C. 7. Remove the culture medium, add 50 μl of DMSO solution to each well, and shake on an orbital shaker for 10 minutes. 8. Measure OD570 with a spectrophotometer. 9. Calculate the cell viability by the following formula: Cell viability (%) = (OD _UVA /OD _{control group} )

100% Since the experiment was carried out in triplicate, the results of the triplicate experiments were averaged and shown in Figure 5.

Experimental results

As shown in FIG. 5 , the results of the control group and the control group showed that the cell death rate increased after ultraviolet irradiation, indicating that ultraviolet light irradiation did reduce the survival rate of cells. On the other hand, according to the results of the control group and the experimental group, when the cells were treated with pineapple chardonnay extract, the cell viability was significantly increased by about 42.26% compared with the control group, indicating that the pineapple chardonnay extract can effectively improve the cell survival rate. The survival rate after exposure to ultraviolet rays can be used to prepare a composition for preventing or resisting ultraviolet rays.

[ Example 6 ] Cell Experiment - Pineapple Shakyamuni Extract Reduces Melanin Production

Here, the changes of the melanin content of the melanoma cell line B16F10 after being treated with the extract of pineapple chardonnay were measured by an enzyme-linked immunosorbent assay reader.

Materials and Instruments 1. Cell line: mouse melanoma cell line B16F10 (ATCC CRL-6475), purchased from American Type Culture Collection (ATCC). 2. Medium: Dulbecco's modified minimal essential medium (DMEM, purchased from Gibco) was added with additional components to contain 1 vol% antibiotic solution (Antibiotic Antimycotic Solution, purchased from Gibco, 15240-062), 10 vol% FBS (fetal bovine Serum, available from Gibco, 10437-028). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. Prepare a solution of 1N NaOH (purchased from Sigma, product number 221465) in double distilled water. 5. ELISA reader (BioTek, FLx 800). 6. Ultraviolet (UVA) link box (VILBER, BLX-254). 7. Pineapple Sakyamuni Extract: The Pineapple Sakyamuni extract used in this experiment was prepared in the manner of Example 1.

Experimental procedure

The experiment will be divided into three groups: the experimental group, the control group (the group without the addition of pineapple chardonnay extract, and the group without UVA irradiation), and the control group (the group without the addition of pineapple chardonnay extract, but UVA irradiated). , each group carried out three replicate experiments: 1. B16F10 cells were inoculated in 6-well culture plates containing 3 ml of medium per well at 1.5×10 ⁵ cells per well. 2. Incubate the plate in 5% CO ₂ at 37°C for 24 hours. 3. Then, without disturbing the attached cells, remove the medium from each well. 4. Add 2 mL of fresh DMEM medium to the control group, control group and experimental group. Among them, the culture medium of the control group and the experimental group was additionally added with the pineapple sacha extract of Example 1, so that the concentration was 0.5 mg/mL. Then, each group was cultured at 37°C for 24 hours. 5. Experimental group: Move the 6-well culture plate that has undergone the step of pineapple sorghum extract medium solution treatment step to the UV link box, and make it receive 10 J/cm ² UVA irradiation at room temperature (25±5℃). Irradiated for 3 hours. Control group: The 6-well culture plate was moved to a dark room and allowed to stand at room temperature for 3 hours. Control group: The 6-well culture plate was moved to a UV link box and exposed to 10 J/cm ² of UVA irradiation for 3 hours at room temperature. 6. After the reaction, the cells were incubated at 37°C for 48 hours. 7. Then, remove the medium and wash the cells twice with PBS solution. 8. Add 200 μl trypsin (Trypsin-EDTA (10X), available from Gibco; Product No. 15400-054) to each well for 3 minutes. After the reaction, 6 mL of medium solution was added to stop the reaction. Then, the suspended cells and medium in each well were collected into corresponding 15ml centrifuge tubes, and each centrifuge tube was centrifuged at 400 xg for 5 minutes to pellet the cells. 9. After washing the pelleted cells twice with PBS, resuspend the cells with 200 μL of PBS. 10. Freeze the cell suspension in liquid nitrogen for 10 minutes and allow to thaw completely at room temperature for about 30 minutes. 11. After complete thawing, centrifuge the tube at 12,000xg for 3 minutes. 12. Remove the supernatant, resuspend the cell pellet with 120 μL of 1N sodium hydroxide solution, and dry the test tube at 60°C for 1 hour to obtain the sample to be tested. 13. Transfer 100 μL of the sample to be tested into a 96-well plate, and use an ELISA plate reader to measure the optical density (OD ₄₅₀ ) of the cell solution at 450 nm as the absorbance.

Experimental results

The relative expression of melanin in the experimental group, the control group, and the control group was calculated according to the following formula: relative expression of melanin (%)=(OD ₄₅₀ value of each group/OD ₄₅₀ value of control group)×100%. Since the experiment was performed in three replicates, the results of the three replicate experiments were averaged and shown in FIG. 6 .

As shown in Figure 6, it can be seen from the results of the control group and the control group that after UVA light irradiation, the expression of melanin in cells will increase significantly, indicating that UVA light irradiation can indeed promote melanoma cells to produce melanin, which will make melanoma cells produce melanin. The skin has spots, or the skin is dull as a whole. Specifically, the melanin after UVA irradiation increased by 12.06% compared with the control group. On the other hand, according to the results of the control group and the experimental group, when the cells were treated with pineapple chardonnay extract, their melanin expression under UVA light was lower than that of the control group without pineapple chardonnay extract treatment (reduced by about 10.08 %), showing that Pineapple Shakya extract can effectively reduce the melanin produced by melanocytes due to UVA.

[ Example 7 ] Cell Experiment - Pineapple Sakyamuni Extract Enhances Elastin Proliferation

Here, the changes of the melanin content of the melanoma cell line B16F10 after being treated with the extract of pineapple chardonnay were measured by an enzyme-linked immunosorbent assay reader.

Materials and Instruments 1. Cell line: Human skin fibroblast (Human skin fibroblast) CCD-966sk (Biological Resources Conservation and Research Center (BCRC), No. 60153). 2. Medium: Eagle's minimum essential medium (MEM, MEM, purchased from Gibco, 15188-319) was supplemented with 10 vol% FBS (fetal bovine Serum, purchased from Gibco, 10437-028), 90 vol% 1mM sodium pyruvate (sodium pyruvate, available from Gibco, 11360-070), 1.5g/L sodium bicarbonate (available from Sigma), 0.1mM non-essential amino acid solution (available from Gibco) , 11140-050). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. ELISA reader (BioTek, FLx 800). 5. Fastin™ Elastin Assay kit (Biocolor). 6. Pineapple Sakyamuni Extract: The Pineapple Sakyamuni extract used in this experiment was prepared in the manner of Example 1.

Experimental procedure

The experiment will be divided into two groups: the experimental group and the control group (the group without the addition of pineapple succulent extract), and each group will carry out three repeated experiments: 1. The CCD-966sk cells are 1×10 ⁵ cells per well. , inoculated in a 6-well culture dish containing 2 ml of medium per well. 2. Incubate the plate in 5% CO ₂ at 37°C for 24 hours. 3. Then, without disturbing the attached cells, remove the medium from each well. 4. Both the control group and the experimental group were added with 2 mL of fresh DMEM medium. Among them, the culture medium of the experimental group was additionally added with the pineapple sacha extract prepared in the manner of Example 1, so that the concentration was 0.5 mg/mL. 5. After the reaction, the cells were incubated at 37°C for 48 hours. 6. Then, remove the medium and wash the cells once with PBS solution. 7. Add 200 μl trypsin (Trypsin-EDTA (10X), available from Gibco; Product No. 15400-054) to each well for 3 minutes. After the reaction, 6 mL of medium solution was added to stop the reaction. Then, the suspended cells and medium in each well were collected into corresponding 1.5 ml centrifuge tubes, and each centrifuge tube was centrifuged at 300 x g for 5 minutes to pellet the cells. 8. After washing the pelleted cells twice with PBS, resuspend the cells with 200 μL of PBS. 9. Pellet the cells by centrifuging each tube again at 300 x g for 5 minutes and resuspend the cells in approximately 300 μL of PBS solution. 10. Next, 100 μL of 1.0 M oxalic acid was added to the cell suspension, followed by incubation at 100° C. for 1 hour. 11. Add an equal volume of Elastin Precipitation Reagent to each tube. Cap the centrifuge tube and vortex briefly to mix. Let stand for 15 minutes to complete the pellet and centrifuge at 10,000 xg for 10 minutes. 12. After removing the liquid from the centrifuge tube, add 1 mL of dye reagent. Place the tube on a mechanical shaker and incubate for 90 minutes. 13. Remove remaining stain. The reddish-brown deposits in the bottom and inner lower wall of the tube are the elastin-dye complexes. 14. Add 250 μl of dye dissociation reagent to each tube. Cap the tube and release the dye into the solution with the help of a vortex mixer. Make sure that all bound dye has gone into solution. 15. Transfer the contents of each tube to a 96-well plate and place the plate in an ELISA reader. Absorbance was measured at 513 nm. 16. Statistical significance of differences between two sample populations was determined by Student's t-test in Microsoft Excel. (*: p <0.05; **: p <0.01; ***: p < 0.001). 17. Transfer 100 μL of the sample to be tested into a 96-well plate, and use an ELISA plate reader to measure the optical density (OD ₄₅₀ ) of the cell solution at 513 nm as the absorbance.

Experimental results

The relative expression of melanin in the experimental group and the control group was calculated according to the following formula: relative expression of melanin (%)=(OD ₄₅₀ value of each group/OD ₄₅₀ value of control group)×100%. Since the experiment was performed in triplicate, the results of the triplicate experiments were averaged and shown in FIG. 7 .

As shown in Figure 7, from the results of the control group and the experimental group, when the cells were treated with pineapple sakya extract, their elastin secretion was increased (about 4.79% higher than that of the control group), indicating that the pineapple sakya extract can increase the secretion of elastin. Effectively increase the secretion of elastin. Elastin is a key protein in the extracellular matrix. It has great elasticity and an important function is to allow many tissues in the body to restore their shape after stretching or contraction. In addition, elastin is an important load-bearing tissue in the body and can also be used to store mechanical energy. At the same time, elastin can also keep the skin elastic. One of the reasons for the loss of skin elasticity with age is the loss of elastin. Therefore, the pineapple charcoal extract of the present invention can be used to prepare a composition for improving skin elasticity, slowing skin aging, or improving the ability of skin to store mechanical energy.

[ Example 8 ] Gene experiment - mitochondrial activity-related genes

In this example, RNA extraction kit, reverse transcriptase, KAPA SYBR® FAST qPCR reagent kit and quantitative PCR instrument are used to determine the amount of human skin fibroblast CCD-966sk treated with the pineapple chardonnay extract of the present invention. Changes in genes associated with mitochondrial activity.

Materials and Instruments 1. Cell line: Human skin fibroblast (Human skin fibroblast) CCD-966sk (Biological Resources Conservation and Research Center (BCRC), No. 60153). 2. Medium: Eagle's minimum essential medium (MEM, MEM, purchased from Gibco, 15188-319) was supplemented with 10 vol% FBS (fetal bovine Serum, purchased from Gibco, 10437-028), 90 Vol% 1mM sodium pyruvate (sodium pyruvate, available from Gibco, 11360-070), 1.5g/L sodium bicarbonate (available from Sigma), 0.1mM non-essential amino acid solution (available from Gibco) , 11140-050). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. RNA extraction reagent kit (purchased from Geneaid, Taiwan, Lot No. FC24015-G). 5. SuperScript® III Reverse Transcriptase (Invitrogen, USA, No. 18080-051). 6. Measure the target gene primers, including HAS2 gene, HAS3 gene, KRT1 gene, KRT14 gene, AQP3 gene, GBA gene and FLG gene, and also include the internal control group (TBP gene). 7. KAPA SYBR® FAST qPCR reagent set (purchased from Sigma, USA, No. 38220000000). 8. ABI StepOnePlusTM real-time PCR system (ABI StepOnePlusTM Real-Time PCR system (Thermo Fisher Scientific, USA)). 9. Pineapple Sakyamuni Extract: Pineapple Sakyamuni extract obtained by the preparation method described in Case 1.

Experimental Procedures The experimental procedure of cell culture is as follows: 1. First, 1×10 ⁵ cells per well were cultured in a six-well culture dish containing 2 mL of the above-mentioned culture medium, and incubated at 37°C for 16 hours, and then the CCD- 966sk cells were divided into experimental group and control group. 2. Experimental group: The ratio of 0.25 mg of the pineapple sorghum extract prepared in the method of Example 1 per ml of culture solution (ie, the concentration is 0.25 mg/mL) to prepare the culture solution containing the extract, and the CCD-966sk cells Continue culturing in medium containing extract. 3. Control group: no treatment, that is, no additional compounds were added to the culture medium containing the cultured CCD-966sk cells. 4. After culturing for 6 hours in the experimental group and the control group, the cells of the experimental group and the control group were cultured with the cell lysate of the RNA extraction reagent kit to break the cell membrane respectively to form the cell solution of the two groups. The experimental procedure of the polymerase chain reaction is as follows: 1. Use the RNA extraction reagent kit to collect RNA from two groups of cell solutions. 2. Next, take 2000 nanograms (ng) of the extracted RNA for each group as a template, and use SuperScript® III reverse transcriptase to reverse transcription with the primers in Table 2 to generate the corresponding cDNA. 3. Subsequent use of ABI StepOnePlusTM Real-Time PCR system and KAPA SYBR FAST to carry out quantitative real-time reverse transcription polymerase chain reaction (quantitative real-time reverse transcription polymerase chain reaction). , to observe the expression level of genes in CCD-966sk cells in the experimental group and the control group. The instrument settings for quantitative real-time reverse transcription polymerase chain reaction were 95 °C for 1 sec and 60 °C for 20 sec, for a total of 40 cycles. 4. Then, use the 2- ^ΔΔCt method to determine the relative expression of the target gene. The so-called relative expression is defined as the fold change of the RNA expression of a target gene in the experimental group relative to the control group or the same gene in the control group. In this method, the cycle threshold of GAPDH gene is used as the cycle threshold (Ct) of the reference gene for internal control, and the fold change is calculated according to the following formula: △Ct = target gene in Ct _{experimental group /} target gene in _{control group or control group} - Ct _GAPDH △ △Ct= △Ct _{experimental group target gene} - △Ct _{control group target gene} fold change = 2 - ^{ΔΔCt average value} 5. Finally, use the STDEV formula of Excel software to calculate the standard deviation, and use the one-tailed Student t in Excel software to calculate the standard deviation -test to analyze whether there is a statistically significant difference (*p-value<0.05;**p-value<0.01;***p-value<0.001). Among them, the primer pairs corresponding to PARP1 gene are PARP1-F and PARP1-R, the primer pairs corresponding to PARP2 gene are PARP2-F and PARP2-R, the primer pairs corresponding to NADSYN gene are NADSYN-F and NADSYN-R, and the corresponding primer pairs of GAPDH gene The primer pairs are GAPDH-F and GAPDH-R. The names, sequence numbers, sequences, gene lengths and gene IDs of relevant primers can be found in Table 2 below.

Table 2 Introductory name serial number sequence length Gene ID PARP1-F SEQ ID NO: 1 AGCGTGTTTCTAGGTCGTGG 20 142 PARP1-R SEQ ID NO: 2 CATCAAACATGGGCGACTGC 20 PARP2-F SEQ ID NO: 3 AGCAAGATGAATCTGTGAAGGC twenty two 10038 PARP2-R SEQ ID NO: 4 CACTGAAGTTCCTCTGGGCA 20 NADSYN-F SEQ ID NO: 5 GCAAAATGTGCAGGCTCGAA 20 55191 NADSYN-R SEQ ID NO: 6 GCACTGGAGCAGTCGTACTT 20 GAPDH-F SEQ ID NO: 7 CTGGGCTACACTGAGCACC 19 2597 GAPDH-R SEQ ID NO: 8 AAGTGGTCGTTGAGGGCAATG twenty one

Experimental results

See Figure 8. Figure 8 is a bar graph of the relative expression levels of PARP1 gene, PARP2 gene and NADSYN gene in the experimental group treated with the pineapple charcoal extract of the present invention and the control group not treated with the pineapple chardonnay extract of the present invention ("*" in the figure represents The p-value is less than 0.05, "**" means the p-value is less than 0.01, and "***" means the p-value is less than 0.001. The more "*", the more statistically significant the difference).

As can be seen from the figure, when the expression levels of PARP1 gene, PARP2 gene and NADSYN gene in the control group are 100%, the expression levels of PARP1 gene, PARP2 gene and NADSYN gene in the experimental group are about 74%, 68% and 113%, respectively. . In other words, compared with the control group, the expression levels of PARP1 gene, PARP2 gene and NADSYN gene in human skin fibroblasts in the experimental group were decreased by 26%, 32% and increased by 13%, respectively, and all reached statistical significance. Significant difference above.

As mentioned above, the proteins PARP1 and PARP2 transcribed by the PARP1 gene and the PARP2 gene each have the function of inhibiting the cellular energy molecule provider NAD+. Therefore, when the expression levels of PARP1 and PARP2 are inhibited, mitochondria can maintain better activity. NADSYN is an important catalytic factor in the NAD synthesis pathway, and its main role is to catalyze NaAD to NAD. When the expression of NADSYN increases, the activity of mitochondria will also increase. Therefore, the pineapple sacha extract of the present invention has the functions of enhancing mitochondrial activity, enhancing individual physical strength, slowing down skin aging, and the like.

none

In the graph, "*" represents a p-value less than 0.05, "**" represents a p-value less than 0.01, and "***" represents a p-value less than 0.001. The more "*", the more significant the statistical difference. FIG. 1 is a flow chart of a method for preparing a pineapple sacha extract according to an embodiment. FIG. 2 is a flow chart of a method for preparing a pineapple sacha extract according to another embodiment. Figure 3 is a graph showing the proportion of tyrosinase inhibition in the experimental group, the control group and the control group in Example 3. Figure 4 is a graph showing the proportion of melanin production in the experimental group, the control group and the control group in Example 4. FIG. 5 is a graph showing the proportion of cells in the experimental group, the control group and the control group after being irradiated with ultraviolet rays in Example 5. FIG. FIG. 6 is a graph showing the proportion of melanin production in the cells of the experimental group, the control group and the control group after being irradiated with ultraviolet light in Example 6. FIG. FIG. 7 is a graph showing the comparison of the amount of elastin secreted by cells in the experimental group and the control group in Example 7. FIG. Figure 8 is a graph showing the proportion of gene expression levels related to mitochondrial activity in the experimental group and the control group in Example 8.

Claims (9)

Use of an pineapple cherimola fruit ( Annona cherimola × Annona squamosa ) extract for preparing a composition for improving skin condition, wherein the pineapple chervil extract is obtained by extracting an pineapple chervil fruit with a water-containing solvent, and the skin condition improvement comprises Improve skin fairness, improve skin elasticity and/or improve skin's ability to resist UV rays. The use as claimed in claim 1, wherein the pineapple charcoal extract achieves the improvement of skin fairness by reducing the production of tyrosinase or inhibiting the production of melanin. The use as claimed in claim 2, wherein the melanin is caused by an ultraviolet light or a blue light. The use as claimed in claim 1, wherein the pineapple saccharomyces extract achieves the ability to enhance the skin's ability to resist ultraviolet rays by enhancing the mitochondrial activity in skin cells. The use as claimed in claim 4, wherein the pineapple sorghum extract achieves the enhancement of mitochondrial activity in skin cells by enhancing mitochondrial activity-related genes. The use according to claim 5, wherein the mitochondrial activity-related gene comprises PARP1 gene, PARP2 gene, and/or NADSYN gene. The use according to claim 1, wherein the total polyphenol content of the composition is more than 50,000 ppm. The use according to claim 1, wherein the composition is further prepared into a skin care product composition, a health food composition, or a cosmetic composition. The use as claimed in claim 1, wherein the liquid-solid ratio of the water-containing solvent to the pineapple chakra fruit is 5:1-20:1, and wherein the extraction is performed at 50°C-100°C, and wherein the water-containing solvent is The solvent contains water and starch saccharification enzyme.

Images