TWI739226B - Aptamers for targeting coagulation factor xiii and uses thereof - Google Patents

Abstract

Provided herein is an aptamer specific to coagulation factor XIII (FXIII) and its uses thereof. Accordingly, the present aptamer is useful as a bio-tool to label thrombi, and/or as a targeting molecule to deliver drugs to thrombotic area. Therefore, the present disclosure also pertains to methods for treating diseases associated with FXIII, such as thrombosis.

Description

Aptamers for target coagulation factor XIII and their uses

The present disclosure is generally about an oligonucleotide aptamer. More specifically, the present disclosure relates to oligonucleotide aptamers for the target blood coagulation factor XIII (FXIII).

An aptamer is an oligonucleotide (for example, DNA, RNA, or XNA) or peptide molecule, which can be fitted to a specific target molecule by its own secondary or tertiary configuration to bind to the target. Generally speaking, aptamers can be generated by the "Systematic Evolution of Ligands by Exponential Enrichment" (SELEX) method, which mainly includes, for the target of interest, in vivo In addition, a large random sequence library (usually containing 10 ¹³ to 10 ¹⁶ nucleic acid molecules) is screened, and these aptamers that can specifically bind to the target are screened out. As far as the target is concerned, oligonucleotide aptamers are more advantageous than antibodies in many aspects. First, oligonucleotide aptamers can be prepared by chemical synthesis, so the cost of preparing oligonucleotide aptamers is relatively cheap, and the quality of each batch can be maintained consistent. Secondly, because it is chemically synthesized, it can avoid the contamination of bacteria, viruses or prion protein. Furthermore, since the essence of oligonucleotide aptamers is nucleic acid, its shelf life is longer than that of antibodies. In addition, oligonucleotide aptamers can be stored at room temperature, and they can remain relatively stable to changes in pH and temperature. When administered to the human body, oligonucleotide aptamers rarely trigger an adverse immune response. These characteristics make oligonucleotide aptamers suitable for basic research and clinical applications.

Some life-threatening cardiovascular syndromes (including myocardial infarction, stroke, and pulmonary embolism) are all clinical manifestations of thrombosis. Thrombus is formed by a blood clot in the blood vessel, wherein the blood clot is formed by the accumulation of both platelets and fibrin triggered by activated clotting factors. One of the coagulation factors is coagulation factor XIII (FXIII). FXIII is a transglutaminase (transglutaminase, TG), a tetrameric form (FXIII- A ₂ B ₂ ), where FXIII-B is used as a carrier protein to stabilize FXIII-A. In late thrombosis, FXIII FXIII transforms into a semi-active state _{(FXIII-A 2 'B 2} ), and then subsequently converted into a fully activated state FXIII _{(FXIIIa; FXIII-A 2'} ), this is due to FXIII- B ₂ separation is produced; then, the fully activated FXIII will catalyze the cross-linking of fibrin by promoting a complex, wherein the complex is composed of proenzyme FXIII (proenzyme FXIII), pre-matrix fibrinogen ( prosubstrate fibrinogen) and activator thrombin (activator thrombin) to stabilize the above blood clot. According to the role of FXIII in thrombosis, FXIII can be used as an appropriate target to develop an antithrombotic drug or thrombus imaging probe, and then optimize the specificity of the antithrombotic drug target to thrombus. Alternatively, FXIII can also be used to develop a detection system to track thrombosis in a body.

In view of this, there is an urgent need for an aptamer that can recognize FXIII and has the desired specificity and affinity.

The following presents a brief summary of the disclosure to facilitate readers to have a basic understanding of the disclosure. This summary is not a comprehensive overview of the content of this disclosure, nor is it used to identify the key/decisive elements of the content of this disclosure, or outline the scope of the content of this disclosure. Its sole purpose is to present some concepts of this disclosure in a simplified form as a prelude to more detailed descriptions later.

As implemented and broadly described herein, one aspect of the present disclosure is about an aptamer that is specific to coagulation factor XIII (FXIII). The aptamer includes a polynucleotide sequence with at least 90% similarity to SEQ ID NO:1. According to some embodiments of the present disclosure, the aptamer has a polynucleotide sequence of SEQ ID NO: 2, or SEQ ID NO: 3. According to a specific embodiment of the present disclosure, the aptamer has a polynucleotide sequence of SEQ ID NO: 4.

According to some embodiments of the present disclosure, the aptamer of the present disclosure further includes a reporter, an imaging agent, a nanoparticle, or an antithrombotic agent compounded therewith.

In some embodiments, the reporter may be acridine orange, acridine yellow, alkaline phosphatase (AP), auramine, benzodiazepine Benzoxadiazole, bilirubin, biotin, blue fluorescent protein (BFP), 6'-carboxyfluorescein (FAM), Caska Cascade blue, cresyl violet, crystal violet, cyan fluorescent protein (CFP), cyanine, eosin, luciferin ( fluorescein, fluorescein isothiocyanate, glutathione-S-transferase (GST), green fluorescence protein (GFP), wasabi peroxidase (horseradish peroxidase, HRP), indocarbocyanine, malachite green, merocyanine, Nile blue, Nile red, nitrobenzo Nitrobenzoxadiazole, orotidine 5'-phosphate decarboxylase, oxacarbocyanine, peridinin chlorophyll, phycoerythrin ( phycoerythrin, phthalocyanine, porphine, proflavine, pyridyloxazole, red fluorescent protein (RFP), rhodamine, thiophene Thiacarbocyanine (thiacarbocyanine), thioredoxin (TRX), or yellow fluorescent protein (YFP).

In some embodiments, the developer is a developer containing barium sulfate, a developer containing gamma, or a developer containing iodine.

In some embodiments, the nanoparticles are aluminum oxide particles, boron particles, calcium particles, carbon nanotubes, and cerium oxide particles. oxide particle, clay particle, copper particle, diamond particle, gold particle, graphene particle, hydroxy acid particle, hydroxyl Hydroxyapatite particle, iron particle, kojic acid particle, liposome, manganese particle, molybdenum particle, palladium particle ), platinum particle, phosphorus particle, potassium particle, silicon dioxide particle, silver particle, sodium silicate particle, titanium dioxide Titanium dioxide particle, ytterbium trifluoride particle, zinc particle, zinc oxide particle, or zirconium dioxide particle.

In some embodiments, the antithrombotic agent is an anticoagulant, an antiplatelet agent, or a thrombolytic agent.

Examples of the anticoagulant include, but are not limited to, Acenocoumarol (Acenocoumarol), antithrombin III (Antithrombin III), Apixaban (Apixaban), Argatroban (Argatroban), shellfish Bemiparin, Betrixaban, Bivalirudin, Certoparin, Clorindione, Coumatetralyl, Dabigatran ), Dalteparin, Danaparoid, Darexaban, Dermatan sulfate, Defibrotide, Desirudin, Dicoumarin (Dicoumarol), Diphenadione (Diphenadione), Tegaserod (Drotrecogin), Edoxaban (Edoxaban), Efegatran (Efegatran), Enoxaparin, Enoxaparin, Ethyl biscoumacetate), Fondaparinux, Heparin, Heparinoid, Hirudin, Idraparinux, Inogatran, Lepirudin, Melagatran, Nadroparin, Otamixaban, Parnaparin, Phenindione, Phenprocoumon, Rematri Ramatroban, Reviparin, Rivaroxaban, Sulodexide, Tinzaparin, Tioclomarol, Warfarin , And Ximelagatran.

Further, exemplary antiplatelet agents are abciximab (Abciximab), acetylsalicylic acid (Acetylsalicylic acid), Aloxiprin (Aloxiprin), Aspirin (Aspirin), Beprost (Beraprost), Kan Cangrelor, Carbasalate calcium, Cilostazol, Clopidogrel, Cloricromen, Dipyridamole, Ditazole Ditazole), Enogrel (Elinogrel), Eptifibatide (Eptifibatide), Iloprost (Iloprost), Indobufen (Indobufen), Orbofiban (Orbofiban), Picotamide (Picotamide), Prasugrel, Prostacyclin, Roxifiban, Sibrafiban, Terbogrel, Terutroban, Thienopyridine ), Ticagrelor, Ticlopidine, Tirofiban, Treprostinil, Triflusal, or Vorapaxar.

In addition, the thrombolytic agent suitable for the aptamer of the present disclosure may be Alteplase, Ancrod, Anistreplase, Brinase, Desmoplase ( Desmoteplase, Fibrinolysin, Monteplase, Reteplase, Saruplase, Streptokinase, Tenecteplase, Or Urokinase.

According to certain embodiments of the present disclosure, the coagulation factor XIII (FXIII) can be derived from various types of cells, such as chondrocytes, dendritic reticulum cells, dendritic cells. ), epithelioid cells, histiocytes, Hofbauer cells, intraglomerular mesangial cells, hepatocytes, Kuffer cells (Kupffer cell), LysoMac, macrophage, megakaryocyte, microglium, monocyte, osteoblast , Osteoclast (osteoclast), bone cell (osteocyte), plasma (plasma), or platelet (platelet).

The present disclosure also covers a method of using the aptamer of the present disclosure to treat an individual's thrombosis-related diseases, wherein the aptamer is compounded with an antithrombotic agent. The method includes at least administering an effective amount of the aforementioned aptamer to the individual.

In some embodiments, the antithrombotic agent compounded with the aptamer of the present disclosure is an anticoagulant, an antiplatelet agent, or a thrombolytic agent.

For example, the anticoagulant is acenocoumarin, antithrombin III, apixaban, argatroban, bemiparin, betrixaban, bivanudine, sertoparin , Chlorindanedione, Rodent, Dabigatran, Dalteparin, Danapaparin, Darexaban, Dermatan Sulfate, Defibrin, Disirudine, Dicoumarin, Diphenindone, Tegaserod, Edoxaban, Efigatran, Enoxaparin, Ethyl Acetate, Fondaparinux, Heparin, Heparin, Hirudin, Idraparin, Inogatron, Lepirudine , Melagatran, nadroparin, omishaban, pannaparin, phenindione, phenprocoumarin, rematriptan, reviparin, rivaroxaban, sulodexide, tin Zaparin, Ticlocoumarin, Shashuling, or Ximejiatran.

In addition, the anti-platelet agent suitable for the method of the present disclosure may be abciximab, acetosalic acid, azlocillin, aspirin, beraprost, cangrelor, carboprin calcium, and silo Tazol, Clopidogrel, Clocromangan, Dipyridox, Ditazole, Enogre, Etibatide, Iloprost, Indobufen, Obofiban, Picotamide, Prasugrel, Prostaglandin, Roxifiban, Cilafiban, Terbogrel, Trutroban, Thienopyridine, Ticagrelor, Ticopidine, Tirofiban, Trironil , Triflurane, or Volapasa.

In addition, examples of the thrombolytic agent include alteplase, anclozyme, aniprase, fibrinase, desmoplase, cellulose lysin, monteplase, rateplase, saru Protease, streptococcal kinase, tenecteplase, or urokinase.

According to some preferred embodiments of the present disclosure, the individual in need is a human.

According to certain embodiments of the present disclosure, the thrombosis-related disease is venous thrombosis or arterial thrombosis.

Exemplary venous thrombosis includes, but is not limited to, branch retinal vein occlusion, Budd-Chiari syndrome, cavernous sinus thrombosis, and central Central retinal vein occlusion, cerebral venous sinus thrombosis, deep vein thrombosis, jugular vein thrombosis, mesenteric vein thrombosis, Paget–Schroetter disease, parodoxical embolism, portal vein thrombosis, pulmonary embolism, renal vein thrombosis, and splenic vein Embolism (splenic vein thrombosis).

And, examples of the arterial thrombosis include, but are not limited to, hepatic artery thrombosis, limb ischemia, myocardial infarction, or stroke.

According to certain embodiments of the present disclosure, the aptamer of the present disclosure can be administered to the individual via any appropriate route, for example, oral, intracranial, intraspinal, intrathecal, intramedullary, intracerebral, ventricle Intravenous, intraarterial, intracardiac, intradermal, subcutaneous, transdermal, intraperitoneal, or intramuscular route.

After referring to the following detailed description and accompanying drawings, many accompanying features and advantages of the present disclosure should be easily understood.

In order to make the description of the present disclosure more detailed and complete, the following provides an illustrative description of the implementation aspects and specific embodiments of the present invention, but this is not the only way to implement or use the specific embodiments of the present invention. The implementation manners cover the characteristics of multiple specific embodiments, and the method steps and sequences used to construct and operate these specific embodiments. However, other specific embodiments can also be used to achieve the same or equal functions and sequence of steps.

I . definition

For convenience, specific terms used in the specification, embodiments, and the scope of the attached patent application are collected here. Unless otherwise defined in this specification, the scientific and technical terms used herein have the same meaning as understood and used by those with ordinary knowledge in the technical field of the present invention. Moreover, as long as there is no conflict with the context, the singular nouns used in this specification cover the plural nouns, and the plural nouns used also cover the singular nouns. Specifically, in this specification and the scope of the patent application, the singular form "one" (a and an) includes plural reference values, unless otherwise indicated based on the context. In addition, in this specification and the scope of the patent application, the expressions "at least one" and "one or more" have the same meaning, and both of them mean that they include one, two, three or more. many. Unless otherwise specified, the implementation of the present disclosure will use conventional techniques of molecular biology, microbiology, recombinant DNA technology, and immunology, all of which fall within the technical scope of the art. These technologies have been fully described in the open literature.

Although the numerical ranges and parameters used to define the broader scope of the present invention are approximate numerical values, the relevant numerical values in the specific embodiments are presented here as accurately as possible. However, any value will inevitably contain standard deviations caused by individual test methods. And, in this article, the term "about" usually refers to the actual value within plus or minus 10%, 5%, 1%, or 0.5% of a given value or range. Or, the word "about" means that the actual value falls within the acceptable standard error of the average value, which will depend on the consideration of a person with ordinary knowledge in the technical field of the present invention. Except for the examples, or unless otherwise clearly stated, all ranges, quantities, values and percentages used herein (for example, used to describe the amount of material, length of time, temperature, operating conditions, quantity ratios and other similar Those) have been modified by "about". Accordingly, unless otherwise stated to the contrary, the numerical parameters disclosed in this specification and the accompanying patent scope are approximate values and can be changed according to requirements. At least these numerical parameters should be understood as the indicated effective number of digits and the value obtained by applying the general carry method.

As used herein, "aptamer" refers to a single-stranded or double-stranded nucleic acid that can bind strongly and specifically to coagulation factor XIII (FXIII). The aptamer of the present disclosure can be composed of a single DNA, a single RNA, or a component containing DNA and RNA. Optionally, the aptamers of the present disclosure may further comprise non-natural nucleotides. The "non-natural nucleotide" (non-natural nucleotide) refers to a nucleotide that is artificially constructed or artificially chemically modified, and its characteristics and/or structure are similar to natural nucleotides. Examples of non-natural nucleotides include abasic nucleoside, arabinonucleoside, 2'-deoxyuridine, α-deoxyribonucleoside (α- deoxyribonucleoside), β-L-deoxyribonucleoside (β-L-deoxyribonucleoside), and other glycosylated nucleoside (glycosylated nucleoside). The glycosylated nucleosides include substituted five carbon sugars (pentose) (2'-O-methylribose (2'-O-methylribose), 2'-deoxy-2'-fluororibose (2' -deoxy-2'-fluororibose), 3'-O-methylribose (3'-O-methylribose), or 1',2'-deoxyribose (1',2'-deoxyribose)), arabinose ( arabinose, substituted arabinose sugar, substituted hexose, or alpha anomer glycosylated nucleosides. The non-natural nucleoside described in the present disclosure may be an artificially constructed base analog or an artificially chemically modified base. Examples of the "base analog" (base analog) include a 2-oxo (1H)-pyridin-3-yl group (2-oxo(1H)-pyridin-3-yl group), a 5 -Substituted 2-side oxy (1H)-pyridin-3-yl group (5-substituted 2-oxo(1H)-pyridin-3-yl group), a 2-amino-6-(2- Thiazolyl) purinyl-9-group (2-amino-6-(2-thiazolyl)purin-9-yl group), and a 2-amino-6-(2-thiazolyl)purin-9-yl group -Group (2-amino-6-(2-oxazolyl)purin-9-yl group). Examples of the "modified base" include modified pyrimidine (e.g., 5-hydroxycytosine, 5-fluorouracil, and 4-thiouracil). 4-thiouracil), modified purines (for example, 6-methyladenine and 6-thioguanosine), and other heterocyclic bases.

The term "sequence identity" as used herein refers to the degree of similarity between any given query sequence and a subject sequence. The "sequence similarity" percentage can be determined by comparing two optimized sequences (one of which is the default sequence) in the comparison window, where it is compared with a reference sequence (which does not include addition) Or deletion (deletion) is compared to obtain the optimal arrangement result of two sequence pairs, the nucleotide sequence fragments in the comparison window may include additions or deletions (for example, gaps or protrusions) ). The percentage is calculated by the following steps: confirm the number of positions where the same nucleic acid base appears in the two sequences to generate the number of paired positions; divide the number of paired positions by the total number of positions in the comparison window; and, The result is multiplied by 100 to produce the percentage of sequence similarity. The output result is the similarity percentage of the query sequence relative to the subject sequence. Among the various methods, the method used to determine the percentage of sequence similarity between two specific polynucleotide sequences is well known to those skilled in the art. For example, one of the methods is to use the Basic Local Alignment Search Tool (BLAST), which searches for regions of local similarity between different sequences (www.ncbi.nlm.nih.gov/BLAST). /).

As used herein, the term "conjugated" or "conjugate" refers to a direct or indirect, covalent or non-covalent interaction between two or more entities. . In some embodiments, the aptamer of the present disclosure is complexed with a reporter (e.g., fluorescent molecule). In other embodiments, the aptamer of the present disclosure is compounded with a developer (for example, a developer containing barium sulfate). In still other embodiments, the aptamer of the present disclosure is compounded with a nanoparticle (eg, gold particle, or liposome). In still other embodiments, the aptamer of the present disclosure is compounded with an antithrombotic agent (for example, an anticoagulant, an antiplatelet agent, or a thrombolytic agent).

The term "treatment" (treatment or treating) as used herein can refer to a curative or alleviating measure. Specifically, the term "treatment" as used herein refers to the administration or administration of an aptamer of the present disclosure to an individual, wherein the aptamer is compounded with an antithrombotic agent, and the individual is suffering from thrombus, Suffering from symptoms related to thrombosis, disease or disorder of thrombosis, in order to partially or completely slow down (alleviate), improve (ameliorate), relieve (relieve), delay onset (delay onset), and inhibit Inhibit progression, reduce severity, and/or reduce the incidence of one or more of the symptoms or features of thrombosis.

The term "subject" (subject) or "patient" (patient) refers to an animal, including humans, that can be treated with the aptamer and/or method of this disclosure. Unless one of the genders is specified, the terms "individual" and "patient" refer to both males and females. Accordingly, the terms "individual" and "patient" include any mammal that can benefit from thrombosis therapy. Examples of "individuals" and "patients" that can be treated with the compositions and/or methods of the present disclosure include, but are not limited to, humans, rats, mice, guinea pigs, monkeys, pigs, goats, cows, horses, and dogs , Cats, birds and chickens. In an exemplary embodiment, the patient is a human.

The term "administered" (administered, administering, or administration) can be used interchangeably here, and refers to directly giving an aptamer to reveal the content.

As used herein, the term "an effective amount" (an effective amount) refers to an effective amount that can achieve the desired result for the aptamer target of the present disclosure to FXIII and/or thrombosis within the necessary dose and time.

II . Detailed description of the invention

The following will describe in detail the practice of the present disclosure, which is about an aptamer for FXIII, and the use of the aptamer in the target FXIII, and/or the treatment of thrombus in an individual. The treatment is adapted by using the present disclosure. The body is achieved by delivering an antithrombotic agent to an embolic area.

1 . Aptamers for this disclosure

As described in the "I. Definition" section above, the aptamer of the present disclosure is a natural nucleic acid, which can be DNA, RNA or a combination thereof. Also, the nucleic acid may partially or completely contain non-natural nucleotides. Preferably, the aptamer of the present disclosure is a single-stranded DNA aptamer.

According to the embodiments of the present disclosure, the aptamer of the present disclosure has a length of about 5 to 80 nucleotides (nucleotide, nt); preferably, a length of 35 to 50 nt; for example, 35, 36, Length of 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nt. However, the area that is in contact with the target in the aptamer is usually 10 to 20 nt. In certain embodiments, the aptamers of the present disclosure may include one or more double-stranded regions within the molecule. The "double-stranded region" refers to a region formed by a continuous base pair (bp) between the nucleotide strands constituting the nucleic acid molecule. The length of the continuous base pair may be 2 to 10 bp, for example, 2 to 5 bp, 2 to 6 bp, 2 to 7 bp, 2 to 8 bp, 2 to 9 bp, or 2 To 10 bp. The aptamer may include two or more double-stranded regions. In this case, between the double-stranded regions, each double-stranded region may be composed of the same or different base pairs. Each double-stranded region can be divided by regions that do not form a base pair with each other (for example, including mismatch sites, gaps, or internal loop structures). Alternatively, each double-stranded area may be continuous.

The aptamer of the present disclosure in a specific embodiment includes a sequence number: 1 having at least 90% (for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, 99%, or 100%) similarity of polynucleotide sequences. In some embodiments, the aptamer of the present disclosure includes an aptamer that has at least 94% (for example, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) similarity to the sequence number: 1. The polynucleotide sequence. In a more specific embodiment, the aptamer of the present disclosure has a polynucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. Alternatively, the aptamer of the present disclosure has a polynucleotide sequence of SEQ ID NO: 4. According to the embodiments of the present disclosure, the dissociation constant (K _d value) of the aptamer of the present disclosure to FXIII is within the range of nanomolar.

According to certain embodiments of the present disclosure, the aptamer of the present disclosure can be compounded with a reporter, an imaging agent, a nanoparticle, or an antithrombotic agent. In some embodiments, the aptamer of the present disclosure is compounded with a reporter. According to one embodiment, the reporter is a fluorescent dye. In another embodiment, the reporter is a ligand. To achieve the purpose of compounding, it can be achieved by methods well known to those skilled in the art. For example, during the chemical synthesis of nucleic acids, 3'or 5'primary amines can be coupled to different molecules; or, it can be via typical carbodiimide, aldehyde, Diazonium (diazonium), or other methods to achieve the purpose of compounding, the other method is to use the nucleotide itself with a more chemically reactive primary hydrocarbon amine tag to attack the aromatic amine.

Exemplary reporters include, but are not limited to, acridine orange, acridine yellow, alkaline phosphatase (AP), auramine, benzodiazole, bilirubin, biotin, blue fluorescent protein (BFP) ), 6'-Carboxyfluorescein (FAM), Cascade Blue, Blue Violet, Crystal Violet, Cyan Fluorescent Protein (CFP), Cyanine, Eosin, Luciferin, Fluorescent Isothiocyanate Salt, glutathione-S-transferase (GST), green fluorescent protein (GFP), wasabi peroxidase (HRP), indocarbocyanine, malachite green, merocyanine, Nile blue, Nile Red, nitrobenzodiazole, orotidine-5'-phosphate decarboxylase, carbocyanine, dinophyllin, chlorophyll, phycoerythrin, phthalocyanin, porphine, proflavin, pyridine Gizazole, red fluorescent protein (RFP), rose bengal, thiocarbocyanine, thioredoxin (TRX), and yellow fluorescent protein (YFP). In a preferred embodiment, the reporter is FAM. In another preferred embodiment, the reporter is biotin. In yet another preferred embodiment, the reporter is cyanine.

Alternatively, the aptamer of the present disclosure can be compounded with a developer; such a developer is a developer containing barium sulfate, a developer containing gamma, or a developer containing iodine.

In other embodiments, the aptamer of the present disclosure can be compounded with a nanoparticle. The nano particles include, but are not limited to, alumina particles, boron particles, calcium particles, carbon nanotubes, cerium oxide particles, clay particles, copper particles, diamond particles, gold particles, graphene particles, hydroxy acid particles, Hydroxyapatite particles, iron particles, kojic acid particles, liposomes, manganese particles, molybdenum particles, palladium particles, platinum particles, phosphorus particles, potassium particles, silicon dioxide particles, silver particles, silicon sodium particles, titanium dioxide particles, three Ytterbium fluoride particles, zinc particles, zinc oxide particles, and zirconium dioxide particles.

In still other embodiments, the aptamer of the present disclosure can be compounded with an antithrombotic agent. There are currently three types of antithrombotic agents known, one is anticoagulant, the other is antiplatelet agent, and thrombolytic agent.

For anticoagulants, examples thereof include, but are not limited to, acenocoumarin, antithrombin III, apixaban, argatroban, bemiparin, betrixaban, bivanu Dine, sertoparin, chlorindane, rodentidin, dabigatran, dalteparin, danapaparin, darexaban, dermatan sulfate, defibrin, disirudin, dicoumarin, Diphenindone, tegaserod, edoxaban, efegatran, enoxaparin, diethyl ethyl acetate, fondaparinux, heparin, heparin, hirudin, idraparin, enoxatran , Lepirudine, Melagatran, Nadraparin, Omishaban, Parnaparin, Phenindione, Phenprocoumarin, Rematripban, Reviparin, Rivaroxaban, Shu Lodide, tinzaparin, ticlocoumarin, warfarin, and simegatran.

Exemplary anti-platelet agents are abciximab, acetosalic acid, azlocillin, aspirin, beraprost, cangrelor, carboprin calcium, cilostazol, clopidogrel, clorox Romon, Dipyridamole, Ditazole, Enogrel, Etibatide, Iloprost, Indobufen, Obofiban, Picostatamide, Prasugrel, Prostaglandin, Ro Syfiban, sidiafiban, terbogrel, terutroban, thienopyridine, ticagrelor, ticopidine, tirofiban, traroneil, triflurane, or vorapa sand.

As for the thrombolytic agents that can be used in the present disclosure are alteplase, anclozyme, aniprase, fibrinase, desmoplase, cellulolysin, monteplase, rateplase, Sarrapase, streptococcal kinase, tenecteplase, or urokinase.

According to certain embodiments of the present disclosure, the coagulation factor XIII (FXIII) can be derived from chondrocytes, dendritic reticulum cells, dendritic cells, epithelioid cells, histiocytes, Hofbauer cells, renal cells Intrasphere mesangial cells, hepatocytes, Kuffer cells, Peyer's lymphatic plexus macrophages, macrophages, megakaryocytes, microglia cells, monocytes, osteoblasts, osteoclasts, bone cells, plasma , Or platelets.

2 . Methods used to treat blood clots

In another aspect, the present disclosure relates to a method of using the aptamer of the present invention to treat an individual's thrombosis-related diseases, especially for treating an individual whose thrombus has FXIII manifestations. The method includes administering an effective amount of an aptamer of the present disclosure to the individual, wherein the aptamer is compounded with a therapeutic agent, preferably, with an antithrombotic agent.

Preferably, the individual that can be treated by the method of the present disclosure is a mammal. In one embodiment, the individual is a mouse. In another embodiment, the individual is a human.

Furthermore, the thrombosis-related diseases that can be treated by the method of the present disclosure may be venous thrombosis or arterial thrombosis.

Examples of the foregoing venous thrombosis include, but are not limited to, branch retinal vein occlusion, Bard-Chiar syndrome, sponge sinus thrombosis, central retinal vein occlusion, intracranial venous sinus thrombosis, deep vein thrombosis, internal jugular vein Embolism, mesenteric vein thrombosis, Pekit-Schroeter disease, paradoxical thrombosis, hepatic portal vein thrombosis, pulmonary embolism, renal vein thrombosis, and splenic vein thrombosis. Also, examples of the aforementioned arterial thrombosis include, but are not limited to, hepatic artery embolism, limb ischemia, myocardial infarction, stroke and the like.

In the methods of the present disclosure, the aptamer of the present disclosure can be formulated into an appropriate formulation so that those skilled in the art can administer it according to the appropriate route known to them, including oral, intracranial, intraspinal, Intrathecal, intramedullary, intracerebral, intraventricular, intravenous, intraarterial, intracardiac, intradermal, subcutaneous, percutaneous, intraperitoneal, or intramuscular routes. Generally speaking, the most appropriate route of administration will vary with various factors, such as the nature of the drug (for example, its stability in the blood circulation), and/or the individual's physiological conditions (for example, the Whether the individual has tolerance for intraperitoneal administration or intravenous administration) and other factors.

The antithrombotic agent compounded with the aptamer of the present disclosure may be an anticoagulant, an antiplatelet agent, or a thrombolytic agent.

The anticoagulant includes, but is not limited to, acenocoumarin, antithrombin III, apixaban, argatroban, bemiparin, betrixaban, bivanudine, serto Heparin, Chlorindanedione, Rodent, Dabigatran, Dalteparin, Danaparin, Darexaban, Dermatan Sulfate, Defibrin, Disirudine, Dicoumarin, Diphenindone , Tegaserod, edoxaban, efigatran, enoxaparin, diethyl ethyl acetate, fondaparinux, heparin, heparinoid, hirudin, idraparin, inoxaban, lepiru Dine, melagatran, nadraparin, omishaban, pannaparin, phenindione, phenprocoumarin, rematriptan, reviparin, rivaroxaban, sulodexide, Tinzaparin, Ticlocoumarin, Shashuling, or Ximejiatran.

Examples of the antiplatelet agents are abciximab, acetosic acid, azlocillin, aspirin, beraprost, cangrelor, carbopirin calcium, cilostazol, clopidogrel, clopidogrel Cromer, Dipyridox, Ditazole, Enogre, Etibatide, Iloprost, Indobufen, Obofiban, Picotamide, Prasugrel, Prostaglandin, Roxifiban, Cilafiban, Terbogrel, Trutroban, Thienopyridine, Ticagrelor, Ticopidine, Tirofiban, Trironil, Triflurane, or Vola Pasha.

As for the thrombolytic agent, for example, it may be alteplase, anclotase, aniprase, fibrinase, desmoplase, cellulolysin, monteplase, rateplase , Sarrup enzyme, streptococcal kinase, tenecteplase, or urokinase.

3 . Methods to track blood clots

Yet another aspect of the present disclosure provides a method for tracking a blood clot in a body in vitro or in vivo. The method uses the aptamer of the present disclosure as a probe for thrombus imaging. The method for tracking thrombus in vitro includes the following steps: (a) Provide a biological sample isolated from the individual; (b) Make a sufficient amount of aptamers of the present disclosure react with the separated biological sample; and (c) In the separated biological sample, detect whether the aptamer of this disclosure exists; Among them, the aptamer of the present disclosure is compounded with a reporter, a developer, or a nanoparticle.

In step (a), the separated biological sample may be a mucus sample, a plasma sample, a saliva sample, a serum sample, a sputum sample, a tissue sample, a urine sample, or a whole blood sample . In a specific embodiment, the separated biological sample is a plasma sample. The separated biological sample can be further processed, for example, treated with calcium chloride, and/or coated on a glass slide, and then proceed to step (b).

In step (b), the reaction conditions (for example, the amount of the aptamer of the present disclosure, and/or time, temperature, pH, and necessary buffer system, so as to achieve the combination of the aptamer of the present disclosure and the biological sample Purpose) is well known to those skilled in the art.

In some preferred embodiments, the aptamer of the present disclosure is complexed with a reporter (for example, FAM or biotin).

The amount of the aptamer of the present disclosure, that is, the amount of the aptamer of the present disclosure sufficient to bind to the biological sample containing FXIII thrombus, will vary with the type of reporter compounded with the aptamer, or used to detect the report The method of the child is different. Generally speaking, when the reaction is performed in vitro, the dosage of the aptamer of the present disclosure is about 100-1000 nanomolar by volume; for example, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550 , 600, 650, 700, 750, 800, 850, 900, 950, or 1,000 nanomolar by volume. In some in vitro embodiments, in step (b), the dosage of the aptamer of the present disclosure is about 300-500 nanomolar by volume.

In step (c), different methods can be used to detect the aptamer of the present disclosure that has been bound to the biological sample containing FXIII thrombus, depending on the type of reporter compounded with the aptamer . For example, when a fluorescent dye (for example, FAM) is compounded with the aptamer of the present disclosure, the aptamer-FXIII complex can be detected by fluorescence microscopy or flow cytometry. Or, when the aptamer is complexed with a ligand (for example, biotin), the aptamer can be detected by reacting with HRP-complexed streptavidin and reacting with the HRP coloring substrate -FXIII complex.

As for the method for tracking thrombus in vivo, it includes the following steps: (a) A sufficient amount of this disclosure content aptamer is cast to the individual; and (b) In the individual, detect whether the aptamer of this disclosure exists; Among them, the aptamer of the present disclosure is compounded with a reporter, a developer, or a nanoparticle.

In step (a), the amount of the aptamer of the present disclosure, that is, the amount of the aptamer of the present disclosure that is sufficient to bind to the FXIII-containing thrombus in the living body is about 0.1-10 mg/kg, for example, 0.1, 0.2 , 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5 , 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 mg/kg. Preferably, the dosage is about 0.5-2.0 mg/kg. In a specific embodiment, the aptamer of the present disclosure is administered to the individual to detect the FXIII-containing thrombus in an amount of about 1.2 mg/kg.

As for the detection step (or step (b)), an appropriate detection method can be selected according to the type of reporter compounded with the aptamer of the present disclosure. For example, when a fluorescent dye (for example, Cy5.5) is compounded with the aptamer, the FXIII-aptamer complex can be detected by in vivo fluorescence imaging technology.

A number of embodiments are presented below to illustrate certain aspects of the present disclosure, so as to facilitate those skilled in the art to which the present invention belongs to practice the present invention. These embodiments should not be regarded as limiting the scope of the present invention. It is believed that those with ordinary knowledge in the art to which the present invention pertains can fully utilize and practice the content of this disclosure without excessive interpretation after reading the description presented here. All publications cited herein are hereby incorporated by reference in their entirety.

Example

Materials and methods

1 . Blood sample

Collect human whole blood from healthy blood donors (20 to 35 years old) by venipuncture, and use the whole blood with 3.2% sodium citrate, and the ratio of 1 part anticoagulant to 9 parts whole blood Do anticoagulant treatment.

2 . Conjugate Focus Microscopy

In this experiment, a conjugate focus fluorescence microscope was used to obtain cell images. In short, plasma mixed with calcium chloride was added to a fibrin-coated glass slide and reacted for 5 minutes. After the reaction, the glass slide was washed with phosphate-buffered saline (PBS), and the aptamer compounded with FAM was added to the glass slide and reacted for 30 minutes. The slide is cleaned and mounted, and then the fluorescence image of the slide is obtained under a conjugate focus fluorescence microscope.

3 . Flow cytometry

The whole blood was centrifuged several times to separate the non-activated platelets, and then PBS and thrombin receptor activating peptide (TRAP) were added to activate them. The aptamer complexed with FAM was added to the activated platelet and reacted for 30 minutes. Use a flow cytometer and count 10,000 events to determine the fluorescence intensity.

4 . Spot method analyze

The purified FXIII was spot-dipped on a nitrocellulose (NC) membrane and air-dried for 1 hour. Next, a mixture containing BSA, PBS and polyoxyethylene (20) sorbitan monolaurate (TWEEN™ 20) was added to the NC membrane and reacted for 1 hour, then the aptamer complexed with biotin Add to NC membrane and react for 1 hour. The NC membrane was washed three times with a washing buffer containing PBS and TWEEN™ 20, and then streptavidin complexed with horseradish peroxidase (HRP) was added to the NC membrane and reacted for 1 hour. For color development, the HRP matrix is added to the NC film after washing, and an X-ray film processor is used to obtain an image of the NC film.

5 . Animal pattern

In this experiment, a male Shi-Dauer rat was used. All animals are kept in animal facilities, and provide temperature control (21-24°C), humidity (45-70%), and 12 hours/12 hours light/dark cycle, and allow them to eat food at will And water. In the part of the microvascular circulation embolization mode, rats (330±7 g, n=26) were anesthetized with sec-butylthiobarbital (INACTIN ^® ; 100 mg/kg; intraperitoneal injection). The testicles are then removed and the bladder can be intubated. There will be T-shaped blood vessels formed by the intersection of the pudic epigastric artery, the femoral artery, and the iliac artery of the abdomen, and will not reach the cremaster vascular plexus. vasculature) is cut off. The femoral artery is then cannulated, and infusion is performed through the cannula. The levator muscle was left in situ, and rose bengal dye (50 mg/kg; intravenous injection) was applied. Then, 540nm (3mW) laser is used for 10-15 minutes to induce endothelial damage and thrombus formation. VIEWORKS In Vivo Elite is used to detect perfusion, aptamer retention, and blood flow in tissues. During the experiment, the Cy5.5-labeled control group aptamer, Cy5.5-labeled FXIII-conjugated aptamer, and Cy5.5-labeled thrombin-conjugated aptamers TBA15/29 and NU172 (1.2 mg/kg) were given to the animals , In order to evaluate the ability of the aptamer to target thrombus in rats.

6 . Statistical Analysis

Use descriptive statistics (mean, standard deviation [SD], standard error of the mean [SEM]) to assess normality. The binding power of the FXIII binding body to platelets obtained by flow cytometry was tested using the statistical software Statistica (StatSoft, Tulsa, OK, USA) for the two-factor variance and Duncan's post-hoc test. P>0.05 is considered to have significant statistical significance.

Example 1 Characteristic analysis of the present disclosure aptamer

The aptamers of the present disclosure were synthesized and named FAT1 (sequence number: 2), FAT2 (sequence number: 3), and FAT4 (sequence number: 4); the related descriptions of these aptamers are summarized in Table 1. In this example, the specificity of each aptamer was evaluated, and the experimental results are shown in Figures 1 to 3. Table 1 The aptamers of the present disclosure name Serial number Sequence (5'-3') FAT1 2 CAGCACGACGGGATTCGGGTCGGCAAGGGGTGTGCGGGGGCGTGCTG FAT2 3 CGCAGCATCATTCGGGTCGGGAAGGGGTGTACGGGGCTGCG FAT4 4 CAGCAGGGAGTCCAGTAGGGTCGGTGTGGGTCGTAAGTTGGGTGCTG FAT2-19 1 TCGGGTCGGGAAGGGGTGT

As shown in the panel (A) of Figure 1, FAT2 exhibits good affinity and specificity for fibrin and activated platelets, and the surface of these factors contains FXIII. On the contrary, the signal of random aptamer N-DNA cannot be detected on the same sample (Figure 1 (B) panel). These experimental results prove that only the FXIII specific aptamer FAT2 can specifically bind to its target FXIII.

The specificity of the aptamer of the present disclosure to FXIII was further evaluated by flow cytometry. The experimental data is presented as a bar graph, illustrating the binding activity of each specific aptamer to non-activated platelets (named PLT) or activated platelets (named PLTa). As shown in Figure 2, none of the aptamers (ie, N-DNA (negative control group aptamers), FAT1, FAT2, and FAT4) exhibited significant binding activity to non-activated platelets. In contrast, compared to the control group (ie, N-DNA), all aptamers (including FAT1, FAT2, and FAT4) exhibited significant binding activity to activated platelets. Summarizing the above, the experimental data of this example confirms that the aptamer of the present disclosure can specifically bind to activated platelets, but not to non-activated platelets.

In order to further characterize the binding conditions of the disclosed aptamer to FXIII, this experiment was carried out to analyze the spotting method.

Referring to Figure 3, the left column shows the combined results under natural conditions, and the right column shows the combined results under degeneration conditions. In the left column of Figure 3, only FAT2 exhibits binding activity to FXIII (not BSA), and N-DNA does not bind to FXIII, indicating that under natural conditions, FAT2 can be specifically labeled to FXIII, and Will not cross-react to off-target BSA. In addition, in the right column of Figure 3, FAT2 can still exhibit a strong binding activity to FXIII. In contrast, N-DNA only shows a slight binding activity, and FAT2 still does not bind to BSA. This result shows that under denaturing conditions, FAT2 can still be specifically targeted to FXIII, and it will not cross-react to BSA that deviates from the target. Summarizing the above, these experimental results confirm that FAT2 can be labeled to FXIII under natural conditions and denatured conditions.

It should be understood that the above descriptions of the embodiments are only exemplary embodiments, and those with ordinary knowledge in the technical field to which the present invention pertains can make various changes and modifications. The above specification, examples and experimental data provide a complete description of the structure and usage of the present disclosure as an exemplary embodiment. Although the various embodiments in the present disclosure have been described above as having certain characteristics, or with reference to one or more individual embodiments, those with ordinary knowledge in the art to which the present invention pertains can still do not depart from the spirit of the present disclosure. Under the circumstances of the scope and scope, many modifications have been made to the disclosed embodiments.

without

After referring to the following detailed description, the scope of patent application and accompanying drawings, the content of this disclosure and other features, aspects and advantages will be more obvious and understandable, among which:

FIG. 1 is an image diagram of a conjugate focus laser scanning microscope according to an embodiment of the present disclosure. (A) Small image: FAT2 target fibrin and activated platelets in complex with 6'-carboxy luciferin (FAM). (B) Small image: N-DNA complexed with FAM (a random aptamer, as a negative control group) target fibrin and activated platelets. All photos are combined images of FAM (green, excitation wavelength 495nm, emission wavelength 517nm) and visible light (showing fibrin and activated platelets).

Figure 2 is a histogram of the results of a flow cytometry experiment according to an embodiment of the present disclosure, used to illustrate the platelets (named PLT) in the inactive state of a specific aptamer compounded with FAM. And activated platelets (named PLTa). MFI: average fluorescence intensity; *: P>0.05 for PLT, #: P>0.05 for N-DNA.

Figure 3 shows the experimental results of the spotting method according to an embodiment of the present disclosure. It is used to illustrate that under natural conditions (left column) or denatured conditions (right column), specific and biotin The ability of the compound aptamer to bind to FXIII or bovine serum albumin (BSA).

                        Sequence Listing
          <![CDATA[<110> Chang Gung University]]>
          <![CDATA[<120> Aptamers for target coagulation factor XIII and their uses]]>
          <![CDATA[<130> P4077-TW]]>
          <![CDATA[<140> TW108143991]]>
          <![CDATA[<141> 2019-12-02]]>
          <![CDATA[<160> 4]]>
          <![CDATA[<170> BiSSAP 1.3.6]]>
          <![CDATA[<210> 1]]>
          <![CDATA[<211> 19]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> Manual Sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> Synthesis sequence]]>
          <![CDATA[<400> 1]]>
          tcgggtcggg aaggggtgt 19
          <![CDATA[<210> 2]]>
          <![CDATA[<211> 47]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> Manual Sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> Synthesis sequence]]>
          <![CDATA[<400> 2]]>
          cagcacgacg ggattcgggt cggcaagggg tgtgcggggg cgtgctg 47
          <![CDATA[<210> 3]]>
          <![CDATA[<211> 41]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> Manual Sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> Synthesis sequence]]>
          <![CDATA[<400> 3]]>
          cgcagcatca ttcgggtcgg gaaggggtgt acggggctgc g 41
          <![CDATA[<210> 4]]>
          <![CDATA[<211> 47]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> Manual Sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> Synthesis sequence]]>
          <![CDATA[<400> 4]]>
          cagcagggag tccagtaggg tcggtgtggg tcgtaagttg ggtgctg 47
          
      

Claims (17)

An aptamer specific for coagulation factor XIII (FXIII), wherein the aptamer has a polynucleotide sequence of sequence number: 3. The aptamer according to claim 1, wherein the aptamer further comprises a reporter, an imaging agent, a nanoparticle, or an antithrombotic agent combined with the aptamer. The aptamer according to claim 2, wherein the reporter is acridine orange, acridine yellow, alkaline phosphatase, auramine, benzo

Diazole, Bilirubin, Biotin, Blue Fluorescent Protein, 6'-Carboxy Fluorescein, Cascade Blue, Blue Cholesterol Violet, Crystal Violet, Cyan Fluorescent Protein, Cyanine, Eosin, Fluorescence Fluorescent isothiocyanate, glutathione-S-transferase, green fluorescent protein, wasabi peroxidase, indocarbocyanine, malachite green, merocyanine, Nile blue, Nile red Nitrobenzo

Diazole, orotidine-5'-phosphate decarboxylase,

Carbocyanine, dinoflavin, chlorophyll, phycoerythrin, phthalocyanin, porphin, proflavin, pyridyl

Azole, red fluorescent protein, rose bengal, thiocarbocyanine, thioredoxin, or yellow fluorescent protein. The aptamer according to claim 2, wherein the developer is a developer containing barium sulfate, a developer containing gamma, or a developer containing iodine. The aptamer according to claim 2, wherein the nano particles are alumina particles, boron particles, calcium particles, carbon nanotubes, cerium oxide particles, clay particles, copper particles, diamond particles, gold particles, graphene particles , Hydroxy acid particles, hydroxyapatite particles, iron particles, koji acid particles, liposomes, manganese particles, molybdenum particles, palladium particles, platinum particles, phosphorus particles, potassium particles, silicon dioxide particles, silver particles, silicon sodium particles , Titanium dioxide particles, Ytterbium trifluoride particles, zinc particles, zinc oxide particles, or zirconium dioxide particles. The aptamer according to claim 2, wherein the antithrombotic agent is an anticoagulant, an antiplatelet agent, or a thrombolytic agent. The aptamer according to claim 6, wherein the anticoagulant is selected from the group consisting of acenocoumarin, antithrombin III, apixaban, argatroban, bemiparin, betrixaban, Bivanudine, Sertoparin, Chlorindione, Rodentine, Dabigatran, Dalteparin, Danapaparin, Darexaban, Dermatan Sulfate, Defibrin, Disiludine, Shuangxiang Bean, diphenindone, tegaserod, edoxaban, efigaltran, enoxaparin, ethyl diethylacetate, fondaparinux, heparin, heparin, hirudin, idraparin, idraparin Nogatren, Lepirudine, Melagatrine, Nadraparin, Omishaban, Parnaparin, Phenidinedione, Phenprocoumarin, Rematripban, Reviparin, Rivaroxa A group consisting of ban, sulodexide, tinzaparin, ticlocoumarin, warfarin, and simegatran. The aptamer according to claim 6, wherein the antiplatelet agent is selected from the group consisting of abciximab, acetosalic acid, azlocillin, aspirin, beraprost, cangrelor, carbachol calcium, Cilostazol, Clopidogrel, Clocromangan, Dipyridox, Ditazole, Enogre, Etibatide, Iloprost, Indobufen, Obofiban, Picostat Amine, Prasugrel, Prostaglandin, Roxifiban, Cilafiban, Terbogrel, Trutroban, Thienopyridine, Ticagrelor, Ticopidine, Tirofiban, Tirofiban Neil, Triflurane, and Volapasa. The aptamer according to claim 6, wherein the thrombolytic agent is selected from alteplase, anclotase, aniprase, fibrinase, desmoplase, cellulolysin, monteplase , Raperplase, saruplase, streptococcal kinase, tenecteplase, and urokinase. A use of the aptamer according to claim 6 in the preparation of a medicine, wherein the medicine is used to treat thrombosis-related diseases of an individual. The use according to claim 10, wherein the anticoagulant is selected from the group consisting of acenocoumarin, antithrombin III, apixaban, argatroban, bemiparin, betrixaban, and Varnudine, Sertoparin, Chlorindione, Rodentine, Dabigatran, Dalteparin, Danapaparin, Darexaban, Dermatan Sulfate, Defibrin, Disirudine, Coumadin Heparin, Diphenindone, Tegaserod, Edoxaban, Efigatran, Enoxaparin, Ethyl Acetate, Fondaparinux, Heparin, Heparin, Hirudin, Idraparin, Inox Gatran, Lepirudine, Melagatran, Nadraparin, Omishaban, Parnaparin, Phenidinedione, Phenprocoumarin, Rematripban, Reviparin, Rivaroxaban , Sulodexide, tinzaparin, ticlocoumarin, warfarin, and Ximeijiaqun. The use according to claim 10, wherein the antiplatelet agent is selected from the group consisting of abciximab, acetylsalicylic acid, azlocillin, aspirin, beraprost, cangrelor, carboprin calcium, and Lostazol, Clopidogrel, Clocromangan, Dipyridox, Ditazole, Enogrel, Etibatide, Iloprost, Indobufen, Obofiban, Picostatamide , Prasugrel, Prostaglandin, Roxifiban, Cilafiban, Terbogrel, Trutroban, Thienopyridine, Ticagrelor, Ticopidine, Tirofiban, Trarone The group consisting of Er, Triflurane, and Volapasa. The use according to claim 10, wherein the thrombolytic agent is selected from the group consisting of alteplase, anclozyme, aniprase, fibrinase, desmoplase, cellulolysin, monteplase, The group consisting of rapadase, saruplase, streptococcal kinase, tenecteplase, and urokinase. The use according to claim 10, wherein the individual is a human. The use according to claim 10, wherein the thrombosis-related disease is venous thrombosis or arterial thrombosis. The use according to claim 15, wherein the venous thrombosis is branch retinal vein occlusion, Bard-Siari syndrome, sponge sinus thrombosis, central retinal vein occlusion, intracranial venous sinus thrombosis, deep vein thrombosis, Internal jugular vein thrombosis, mesenteric vein thrombosis, Pekit-Schroeter disease, paradoxical thrombosis, hepatic portal vein thrombosis, pulmonary embolism, renal vein thrombosis, or splenic vein thrombosis. The use according to claim 15, wherein the arterial thrombus is hepatic artery embolism, limb ischemia, myocardial infarction, or stroke.

Images