TWI722352B - Detective molecule, kit and method for predicting fragrance production in an orchid - Google Patents

Abstract

The invention relates to a detective molecule, and more particularly to a detective molecule and a kit for detecting a target molecule, a method for predicting fragrance production in an orchid, and a method for breeding a scented orchid.

Description

Detection molecules, kits and methods for predicting orchid fragrance production

The present invention relates to a detection molecule, in particular to a detection molecule and a kit for detecting a target molecule, a method for predicting the production of orchid fragrance, and a method for breeding orchids with fragrance.

Phalaenopsis species are widely distributed in tropical Asia and include about 56 native species (Christenson, 2001, Phalaenopsis: A Monograph. Portland, OR: Timber Press.). Through breeding, many Phalaenopsis cultivars with different flower colors have been obtained, and they are widely popular due to their excellent flower color performance and longevity (Hsiao et al., 2011, Plant Cell Physiol. 52, 1467-1486). In addition, in the flower market, some Phalaenopsis cultivars with a pleasant fragrance have increased their ornamental value. However, under traditional breeding, it is more difficult to cultivate scented orchid cultivars than other advantageous traits (Yeh et al., 2014, Agric.Policy Agric.Situation 267,97), and the bottleneck of breeding includes longer generations. Time (Hsiao et al., 2011, Plant Cell Physiol. 52, 1467-1486), hybrid incompatibility due to differences in genome size and chromosome size between species (Hsiao et al., 2011, Plant Cell Physiol. 52, 1467) -1486; Hsiao et al., 2011, Orchid Biotechnology II , edited by WHChen and HHChen (Singapore: World Scientific), 145-180; Yeh et al., 2014, Agric.Policy Agric.Situation 267,97.), and floral fragrance and The negative correlation between other favorable traits (Hsiao et al., 2011, Orchid Biotechnology II , editors WHChen and HHChen (Singapore: World Scientific), 145-180), which also occurs in other modern flower varieties (Vainstein et al., 2001 , Plant Physiol. 127, 1383-1389.; Dudareva and Negre, 2005, Curr. Opin. Plant Biol. 8, 113-118). Under these circumstances, other alternative methods must be developed to promote the breeding of fragranced orchids.

Most Phalaenopsis have no fragrance, but some do emit volatile organic compounds (VOCs) (Kaiser, 1993, The Scent of Orchids: Olfactory and Chemical Investigations. Amsterdam: Elsevier). These scented species have been widely used as breeding parents for the production of scented cultivars, such as Amman Phalaenopsis ( P.amboinensis ), Borneo Purple Phalaenopsis ( P.bellina ), Java Phalaenopsis ( P.javanica) ), Philippine Phalaenopsis ( P.lueddemanniana ), Variegated Phalaenopsis (P.schilleriana ), Stuartiana ( P.stuartiana ), Multi-veined Phalaenopsis ( P.venosa ) and Purple Phalaenopsis ( P.violace) ) (Hsiao et al., 2011b, Orchid Biotechnology II , edited by WHChen and HHChen (Singapore: World Scientific), 145-180.; Yeh et al., 2014, Agric. Policy Agric. Situation 267, 97). Borneo purple phalaenopsis and purple phalaenopsis are two very close species, and both are commonly used to cultivate scented phenotypes. The VOCs emitted by the two are similar but different. Borneo purple phalaenopsis mainly emits monoterpenoids, including citronellol, vanillyl alcohol, linalool, myrcene, nerol and radix terpenes (Hsiao et al., 2006, BMC Plant Biol. 6: 14; 2011) , Orchid Biotechnology II , edited by WHChen and HHChen (Singapore: World Scientific), 145-180), while the purple phalaenopsis exudes monoterpenoids accompanied by phenylpropanol and cinnamyl alcohol (Kaiser, 1993, The Scent of Orchids: Olfactory and Chemical Investigations. Amsterdam: Elsevier). The VOCs of the flower of variegated phalaenopsis also contain monoterpenes, including citronellol, nerol and neryl acetate (Awano et al., 1997, Flav. Frag. J. 12, 341-344).

Monoterpenes are the most abundant components of volatile terpenes (Knudsen and Gershenzon, 2006, Biology of Floral Scent , editors N. Dudareva and E. Pichersky (Boca Raton, FL: CRC Press), 27-52; Nagegowda et al. , 2010, The Chloroplast: Basics and Application , edited by CARebeiz, C. Benning, HJ Bohnert, H. Daniell, JK Hoober, HKLichtenthaler, etc. (Dordrecht: Springer), 139-154), which will be involved in other organisms and the surrounding environment (Tholl, 2015, Biotechnology of Isoprenoids , editors J. Schrader and J. Bohlmann (Cham: Springer), 63-106). In addition to their role in nature, monoterpenoids are widely used in perfumery, cosmetics and perfume industries due to their unique and pleasant fragrance characteristics (Schwab et al., 2008, Plant J.54, 712-732).

The monoterpenoid precursor IDP and its isomer DMADP are produced by the methylerythritol phosphate (MEP) pathway in the plastids. The short-chain isopentenyl transferase GDPS is responsible for the head-to-tail condensation of IDP and DMADP to produce the direct substrate GDP for monoterpene synthase (Dudareva et al., 2004, Plant Physiol. 135, 1893-1902). In phalaenopsis, PbGDPS is a key enzyme of Borneo phalaenopsis phalaenopsis , which can provide a precursor for the biosynthesis of monoterpenes (Hsiao et al., 2008, Plant J. 55, 719-733). Studies have found that recombinant PbGDPS has dual isopentenyl transferase activity for the production of monoterpenoid precursors GDP and farnesyl diphosphate (FDP), as well as sesquiterpenes (Hsiao et al., 2008, Plant J. 55, 719-733). During flower development, the performance of PbGDPS occurs concurrently with the emission of monoterpenoids, and it peaks on day 5 (D+5) after flowering (Hsiao et al., 2008, Plant J. 55, 719-733). Therefore, it is necessary to study the effects of gene expression of the promoter GDPS GDPS gene.

The invention provides a detection molecule, a kit and a method for predicting the production of orchid fragrance.

An object of the present invention is to provide a detection molecule for detecting a target molecule, wherein the target molecule is selected from the group consisting of: (i) a nucleic acid molecule, which has the structure shown in SEQ ID NO:1 (Ii) a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2; and (iii) a nucleic acid molecule having the meaning defined in (i) or (ii) The similarity of the nucleic acid molecules is more than 95% of the nucleotide sequences.

Another object of the present invention is to provide a kit for detecting a target molecule, including the aforementioned detecting molecule.

Another object of the present invention is to provide a method for predicting orchid fragrance production, including detecting whether a target molecule exists in the orchid genome, wherein the target molecule is selected from the group consisting of: (i) a nucleic acid Molecule, which has the nucleotide sequence shown in SEQ ID NO: 1; (ii) a nucleic acid molecule, which has the nucleotide sequence shown in SEQ ID NO: 2; and (iii) a nucleic acid molecule, which A nucleotide sequence that has a similarity of more than 95% to the nucleic acid molecule defined in (i) or (ii).

Another object of the present invention is to provide a method for breeding scented orchids, which includes predicting the production of scent in an orchid by the aforementioned method.

Figure 1: The promoter structure of GDPS. The promoter structure of GDPS was revealed by comparing the three sequences of PbGDPS p, PaGDPS pA and PaGDPS pB. The two repetitive sequences located at -859 bp to -710 bp in PbGDPS p are named R1 and R2. Based on the 11-bp deletion located in the center of R1, the repetitive sequence is further divided into three subunits. This 11-bp deletion is called R1-b, and the sequences before and after R1-b are R1-a and R1-c, respectively. R2 is divided into R2-a, R2-b and R2-c. TSS indicates the translation start site (ATG). The black gradient in PaGDPS pB indicates its many substitutions compared to PbGDPS p.

Figure 2: Sequence alignment results of PbGDPS p, PaGDPS pA and PaGDPS pB. The two units R1 and R2 of the double repeat sequence are marked with a thick color bar above the alignment result. The sub-units of R1 and R2 are marked with color lines below the comparison result. The sequence alignment was generated with Clustal Omega and displayed as BOXSHADE.

Figure 3: Analysis of volatiles and double repeat sequences of flowers in 7 species of Phalaenopsis. (A) The relative amount of flower volatiles is indicated by a black gradient. A square with diagonal lines indicates that no monoterpenes have been identified in this orchid. (B) The double repeat structure of the GDPS promoter.

Figure 4: PCR amplification results of GDPS gene, its 1-kb promoter fragment and double repeat sequence in the genomic DNA of 7 species of Phalaenopsis, with actin as the control group. The amplification results of 1-kb promoter and double repeat sequence showed its polymorphism.

Figure 5: The cut points PbGDPS promoter luciferase activity - by particle bombardment P. PbGDPS promoter Venus in series with the I-Hsin deletion, to analyze putative cis elements (cis -element ). Tukey's honestly significant difference test (Tukey's honestly significant difference test) was used for statistical testing under a=0.05.

An object of the present invention is to provide a detection molecule for detecting a target molecule, wherein the target molecule is selected from the group consisting of: (i) a nucleic acid molecule, which has the structure shown in SEQ ID NO:1 (Ii) a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2; and (iii) a nucleic acid molecule having the meaning defined in (i) or (ii) The similarity of the nucleic acid molecules is more than 95% of the nucleotide sequences.

Unless otherwise specified, the following terms used in this article should be understood to have the following meanings:

As used herein, "polynucleotide" refers to a single-stranded or double-stranded nucleic acid polymer with a length of at least 10 bases. In some aspects, the polynucleotide may be ribonucleic acid or deoxyribonucleic acid or a modified form thereof. These modifications include: bromouridine and inosine derivatives, such as 2',3'-dideoxyribose (2',3'-dideoxyribose) ribose (ribose) modifications, such as phosphorus Internucleotide bond modifiers of phosphorodiselenoate, phosphoroanilothioate, phosphoranilatate or phosphoramidate and their analogs. "Polynucleotide" as used herein may include single-stranded or double-stranded DNA.

In a preferred embodiment of the present invention, the target molecule of (i) is a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO:1, which is derived from Borneo Purple Phalaenopsis (Orchidaceae) Geranyl diphosphate synthase (GDPS) gene promoter of -859 to -710 150-bp polynucleotide.

The target molecule in (i) is a double-repeat cis element, that is, it includes two 75-bp units with the same nucleotide sequence (ie, SEQ ID NO: 2). The first and second 75-bp units are denoted as "R1" and "R2" respectively, and the directions of the R1 and R2 units are the same.

Therefore, in another preferred embodiment of the present invention, the target molecule of (ii) is a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2, which is derived from the GDPS gene promoter from -859 to -785 75-bp polynucleotide (R1 unit), or -784 to -710 75-bp polynucleotide (R2 unit) derived from the GDPS gene promoter.

Although not wishing to be bound by any theory, it is believed that the R1 and/or R2 units are critical to the activity of the GDPS promoter in orchids. For example, a GDPS promoter containing both R1 and R2 units has an approximately three-fold increase in activity compared to a GDPS promoter containing only R2 units , and its activity is compared to GDPS promoters that do not contain R1 and R2 units. Increased by about five times.

In a preferred embodiment of the present invention, the target molecule of (iii) is a nucleic acid molecule having a nucleotide sequence that is more than 95% similar to the nucleic acid molecule defined in (i) or (ii). As described herein, a nucleic acid molecule having a nucleotide sequence that is more than 95% similar to a reference nucleic acid molecule (such as SEQ ID NO: 1 or 2) refers to a nucleic acid molecule due to substitution, deletion, or insertion. The reference nucleic acid molecule is different. For example, one or more nucleic acid residues are replaced by other nucleic acid residues. The similarity between the nucleic acid molecule (iii) and a reference nucleic acid molecule (such as SEQ ID NO: 1 or 2) can be measured by any known sequence identity algorithm, such as FASTA, BLAST or Gap.

In a preferred embodiment of the present invention, the target molecule of (iii) is a nucleic acid molecule having a nucleotide sequence whose similarity to the nucleic acid molecule defined in (i) or (ii) is 95% or more. In a more preferred embodiment of the present invention, the target molecule of (iii) is a nucleic acid molecule having a nucleotide sequence that is more than 99% similar to the nucleic acid molecule defined in (i) or (ii).

In a preferred embodiment of the present invention, the target molecule is located in an orchid. Preferably, the orchid is Phalaenopsis spp.

In a preferred embodiment of the present invention, the target molecule is located in the promoter of the geranyl diphosphate synthase gene, such as the upstream promoter of the GDPS gene.

In a preferred embodiment of the present invention, the detection molecule is a primer for specifically amplifying the target molecule. For example, the primer can be specific for a part of the GDPS promoter other than the R1 and R2 units. Preferably, the primer is selected from a forward primer having the nucleotide sequence shown in SEQ ID NO: 3 (TTGCCTCGAGATTTGTTTCGGAGGATGGA) and a nucleotide sequence shown in SEQ ID NO: 4 (ACCTAAGGATGCATGGGCCATACTAG) Back primer.

In another preferred embodiment of the present invention, the detection molecule can be a nucleic acid probe, which can hybridize with the target molecule.

Another object of the present invention is to provide a kit for detecting a target molecule, including the aforementioned detecting molecule. In a preferred embodiment of the present invention, the kit further includes deoxynucleoside triphosphate, DNA polymerase and buffer.

Another object of the present invention is to provide a method for predicting fragrance production in an orchid, which includes detecting whether a target molecule exists in the genome of the orchid, wherein the target molecule is selected from the group consisting of: (i ) A nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1; (ii) a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2; and (iii) a nucleic acid A molecule, which has a nucleotide sequence that is more than 95% similar to the nucleic acid molecule defined in (i) or (ii).

For example, the target molecule can be detected by hybridization, PCR amplification and/or DNA sequencing.

In a preferred embodiment of the present invention, the orchid is a Phalaenopsis.

In a preferred embodiment of the present invention, the method includes detecting whether the target molecule is present in the promoter of the geranyl diphosphate synthase gene.

In a preferred embodiment of the present invention, the method includes using a detection molecule to detect the target molecule, such as the aforementioned detection molecule.

In a preferred embodiment of the present invention, the method includes the following steps: (a) obtaining a nucleic acid fragment from the orchid; (b) using the nucleic acid fragment as a template for amplification to obtain a product containing the target molecule; and (b) Analyze the amplified product.

The genomic DNA of the orchid can be extracted by any known method, for example, by the Plant Genomic DNA Purification Kit (Bio-GPD50, Biokit, Taiwan). Then, it can be amplified by polymerase chain reaction (PCR).

In a preferred embodiment of the present invention, step (b) includes performing a polymerase chain reaction with a primer selected from a forward primer having the nucleotide sequence shown in SEQ ID NO: 3 and a A reverse primer having the nucleotide sequence shown in SEQ ID NO:4.

In a preferred embodiment of the present invention, step (c) includes analyzing the amplified product by gel electrophoresis.

Agarose gel electrophoresis is based on a highly purified form of agar in a matrix that separates DNA based on different sizes. In the presence of an electric field, nucleic acids tend to be oriented toward the end of a position and migrate through the gel matrix at a rate that is inversely proportional to the log10 value of the number of base pairs.

Alternatively, step (c) includes sequencing the amplified products.

For example, the sequencing process involves determining the position of each of the four main nucleotide bases adenine (A), cytosine (C), guanine (G), and thymine (T) along the organism’s DNA molecule . The short sequence of DNA is usually determined by creating nested sets of DNA fragments, which start at a unique site and terminate at a plurality of positions composed of specific bases. Then according to the molecular size The fragments that terminate at each of the four natural nucleic acid bases (A, T, G, and C) are small isolated to determine the position of each of the four bases relative to the unique site. The pattern of fragment length produced by strands that terminate at a specific base is called the "sequencing ladder". As a result of an experiment on DNA molecules, the interpretation of base positions is called "reading." There are different methods of creating and separating nested sets of terminated DNA molecules.

In one example, the forward primer having the nucleotide sequence shown in SEQ ID NO: 3 and the reverse primer having the nucleotide sequence shown in SEQ ID NO: 4 were used for amplification for comparison. The GDPS promoter region in the genome of scented orchids (such as Borneo purple phalaenopsis, Philippine phalaenopsis, P. I-Hsin Venus and P. Meidarland Bellina Age) and unscented orchids (such as Amman phalaenopsis, variegated leaf The GDPS promoter in the genome of Phalaenopsis and Horned Phalaenopsis (P. cornu-cervi). As shown in the electrophoresis results (Figure 4), schematic diagram (Figure 3B) and monoterpenoid production (Figure 3A), monoterpene production is related to the presence of the target molecule in the orchid genome.

In addition, continue to study the effect of target molecules on the performance of structural genes. In P. I-Hsin Venus flowers, dual luciferase detection is used to evaluate PbG p-859 (containing R1 and R2 units), PbG p-784 (R1 unit is missing) and PbG p-710 (R1 and R2 units are two Those are missing) the activity. The results show that the GDPS promoter containing both R1 and R2 units has about three times the activity compared to the GDPS promoter containing only the R2 unit, and its activity is about three times higher than that of the GDPS promoter without R1 and R2 units. The activity increased approximately five-fold (Figure 5).

Another object of the present invention is to provide a method for breeding scented orchids, which includes predicting the production of scent in an orchid by the aforementioned method.

The following examples are only used to illustrate the present invention, but the scope of the present invention is not limited thereto.

Examples: Materials and methods

Plant materials and growing conditions

Five native and two cultivated hybrids were used in this study, including P.amboinensis var. yellow (abbreviated as Amman Phalaenopsis), Borneo Purple Phalaenopsis, and Horned Phalaenopsis Red Var. body (P.cornucervi var. red) (abbreviated as there are angular Phalaenopsis), Philippines Phalaenopsis, the moth orchid leaf spot, P .I-Hsin Venus "KHM2212" (abbreviated as P .I-Hsin Venus) and P. Meidarland Bellina Age "LM128" (abbreviated as P. Meidarland Bellina Age). These individual plant lines were collected from various orchid gardens in Taiwan (see Table 1 below for details).

All plant materials are grown in the greenhouse of the National Cheng Kung University under natural light, an ambient temperature of 27 to 30°C in spring and summer, and a humidity of 75-85%.

Gas chromatography analysis of flower volatiles

According to previous studies (Hsiao et al., 2006, BMC Plant Biol. 6: 14; Chuang et al., 2017, Bot. Stud. 58: 50), the VOCs of 7 species of Phalaenopsis flowers were analyzed. By using the solid-phase extraction system (DSC-Si and DCS-18, Supelco, United States) as described in (Chuang et al., 2017, Bot.Stud.58:50.) during the period when the most fragrance is emitted (10: 00 to 16:00) collect VOCs, and then use gas chromatography/high resolution mass spectrometry (GC/HRMS) to identify compounds in the Instrument Center of National Cheng Kung University (Hsiao et al., 2006, BMC Plant Biol. 6:14). To evaluate the amount of each compound, 1 mg ethyl myristate was used as an internal standard (Fluka, Honeywell, United States).

Detection of GDPS gene sequence, upstream regulatory fragments and double repeat regions in 7 orchid genomes

In order to detect the GDPS gene and its upstream regulatory fragments, the Plant Genomic DNA Purification Kit (Bio-GPD50, Biokit, Taiwan) was used to extract the genomic DNA of 7 species of Phalaenopsis. Since PbGDPS is an intron-free gene (Hsiao et al., 2008, Plant J.55, 719-733), primers designed based on the PbGDPS genome sequence are used (all primers used here and thereafter are listed in Table 2 below) Middle), using standard PCR to amplify the N-terminal region (~400-bp) of GDPS. In addition, a primer designed based on the genomic DNA of Borneo purple phalaenopsis was used to isolate the 1-kb upstream promoter fragment of GDPS from 7 species of phalaenopsis (Chuang et al., 2017, Bot.Stud. 58:50). Then, the ZeroBack Fast Ligation Kit (TIANGEN, China) was used to amplify and select double repeat regions. Six to eight communities were randomly selected for sequencing. PlantPAN (Chow et al., 2015, Nucleic Acids Res. 44, D1154-D1160) was used to predict the presence of cis elements in the double repeat sequence, and the similarity score of 100% was used as the prediction result.

Plastid construction

A series of deletion fragments (PbGp-859, PbGp-784, PbGp-710) (PbGp-859, PbGp-784, PbGp-710) of the promoter fragment upstream of the translation start site of PbGDPS were amplified from the genomic DNA of Borneo phalaenopsis phalaenopsis (Figure 5). Design specific primers with restriction endonuclease sites of BamH I and Nco I to amplify these truncated fragments. The amplified fragment was double-cut with restriction enzymes BamH I and Nco I, and cloned in the corresponding enzyme cutting site in pJD301(f) to drive the luciferase gene (Hsu) of the firefly (Photinus pyralis) Et al., 2014, PLoS One 9: e106033). All constructs were checked by DNA sequencing. The promoter-LUC construct is shown schematically in FIG. 5.

Detection of reversal activation of PbGDPS promoter fragments in plants

The promoter-LUC construct and the internal control plastid pJD301(R) were transformed into the floral tissue of P. I-Hsin Venus by bombardment. The internal control plastid pJD301(R) contained the cauliflower mosaic virus (CaMV). ) Renilla luciferase gene driven by 35S promoter. For normalization, the luciferase activity of the reporter construct was divided by the luciferase activity of the internal control. The use of internal controls can reduce the experimental variability caused by the difference in bombardment efficiency and conversion efficiency in different experimental groups. The amounts of plastids and internal controls are reported to be 10 mg and 0.1 mg, respectively. At least six individual flowers of P. I-Hsin Venus were used for repeated experiments to measure the luciferase activity of each sample (Hsu et al., 2014, PLoS One 9: e106033). For the statistical analysis between the two groups, pairwise comparisons were made at a=0.05 by using Dukai’s true significance difference test.

result

Separation of Double Repeats in the Upstream Promoter of GDPS

Previously, two separate 1-kb fragments of the GDPS promoter, PaGDPS pA and PaGDPS pB, have been isolated from the fragrance-free white butterfly orchid ( P.Aphrodite). Compared with the GDPS promoter of the scented Borneo purple phalaenopsis (PbGDPS p) , the two GDPS identified from the white phalaenopsis phalaenopsis , namely the PaGDPS pA and PaGDPS pB promoters contain 11-bp deletion and 75 -bp deletion (Figure 1). In addition to multiple nucleotide substitutions, PaGDPS pB also has two 14-bp insertions. By detecting the luciferase promoter in plants, PaGDPS pA showed similar promoter activity to PbGDPS p in both scented and unscented flowers, and even in the scented Borneo purple pattern. PaGDPS pB in Phalaenopsis orchid tissue also exhibits very low promoter activity. These results indicate that the lack of the 75-bp region in PaGDPS pB is detrimental to its activity. Further sequence analysis of the PbGDPS promoter showed that the second 75-bp repeat sequence appeared downstream of the original 75-bp repeat sequence and formed a double repeat sequence composed of two 75-bp units. Continue to denote the first and second 75-bp units as "R1" and "R2" respectively, which are located at -859 to -710 nt upstream of the ATG (Figure 1).

PaGDPS pB lacks the entire R1 unit, and PaGDPS pA contains an 11-bp deletion in the center of R1, which is defined as the R1-b subunit (Figure 1). The region before R1-b (25-bp) is denoted as R1-a, the region after (39-bp) is denoted as R1-c, and the corresponding parts in R2 are denoted as R2-a, R2-b, and R2-c (figure 1). The structure of the double repeat sequence is schematically shown in FIG. 1, and the sequence of the double repeat sequence is shown in FIG. 2. The difference between the GDPS promoter of scented Borneo purple phalaenopsis and unscented white phalaenopsis phalaenopsis lies in the double repeat sequence, and it is closely related to the monoterpene phenotype.

Complete double repeat sequence accompanied by monoterpene production

According to the analysis results of the promoters of PaGDPS and PbGDPS from scented and unscented Phalaenopsis , it is assumed that the double repeat sequence is related to monoterpene production. To confirm this, seven commonly used Phalaenopsis breeding parents (Table 1) were used to analyze the correlation between double repeat sequences and monoterpene production.

Firstly, the fragrance characteristics of the flowers were detected, and four kinds of orchids were found to emit monoterpenoids, including P. Meidarland Bellina Age, Borneo Purple Phalaenopsis, P. I-Hsin Venus and Philippine Phalaenopsis. In contrast, the main VOCs of Amman Phalaenopsis are sesquiterpenes and benzenes. Variegated Phalaenopsis emits trace amounts of benzene. Since no scented compounds were detected, the horn-shaped Phalaenopsis was considered to be "scentless". In short, the relative amounts of monoterpenes emitted from these Phalaenopsis are represented by symbols in Figure 3A.

Then, the existence of GDPS gene and its promoter sequence in 7 species of Phalaenopsis were analyzed (Figure 4). Interestingly, the GDPS gene is present in all these orchids, regardless of their fragranced or unscented phenotype (Figure 4). It seems reasonable to have a defect in the promoter region ( GDPS p, Figure 4). Then, the double-repeat sequence on GDPS p was amplified, and the polymorphism of the double-repeat fragment length was detected in 7 species of Phalaenopsis (Figure 4). The four scented orchids with monoterpene production contain complete double repeat sequences (Figure 4, black arrow). In contrast, the amplified double repeat fragments of other orchids are reduced to varying degrees, and there are various deletions in the double repeat region. These 7 fragments were selected and sequenced, and the deletion of the double repeat sequence was detected in the R1 unit, which seemed to lead to the defect of GDPS promoter activity in orchids without monoterpene production (Figure 3A, 3B).

In summary, it can be concluded that the integrity of the double repeat in the GDPS promoter is closely related to its increased performance and thus increased monoterpene production.

The double repeat sequence is essential for the activity of the GDPS promoter.

In order to study the effect of the double repeat sequence on the activity of the GDPS promoter, a ~2-kb promoter fragment (denoted as PbG p-2010) was isolated from the upstream of the PbGDPS start site, and it had a series of deletions. Pb Gp-859 (including R1 and R2 units), Pb Gp-784 (R1 unit missing) and Pb Gp-710 (R1 and R1 and R2 units are missing) in P. I-Hsin Venus flowers were evaluated by particle bombardment and dual luciferase detection. Both R2 units are missing) activity. In addition, the activity of the PBGDPS promoter in the original species of Borneo purple phalaenopsis should be tested, but because Borneo purple phalaenopsis usually produces only one flower every 20 days, the flower supply is not enough to meet the experimental needs. Therefore, replacing it with P. I-Hsin Venus, the descendant of Borneo Purple Phalaenopsis, which emits a similar scent, and carrying out a large number of micro-propagation under the same genetic background, which helps to reduce variation.

Observation shows that Pb Gp-859 has the highest luciferase activity, which is about three times higher than that of Pb Gp-784 and five times higher than that of Pb Gp-710. (Figure 5). Therefore, the cis element leading to high promoter activity is located between nucleotides (nt)-859 and nt-710 (150-bp), and the double repeat sequence is located therein. These results confirmed the key role of the double repeat sequence on the PbGDPS promoter activity.

The above-mentioned embodiments only illustrate the principles and effects of the present invention, but do not limit the present invention. Therefore, modifications and changes made by those skilled in the art to the above-mentioned embodiments still do not violate the spirit of the present invention. The scope of rights of the present invention should be listed in the scope of patent application described later.

<110> National Cheng Kung University

<120> Detection molecules, kits and methods for predicting orchid fragrance production

<140> 107145432

<141> 2018-12-17

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 150

<212> DNA

<213> Borneo Purple Phalaenopsis

<400> 1

<210> 2

<211> 75

<212> DNA

<213> Borneo Purple Phalaenopsis

<400> 2

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of double repeat sequence

<400> 3

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer for double repeat sequence

<400> 4

<210> 5

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of GDPS gene

<400> 5

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer of GDPS gene

<400> 6

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of promoter

<400> 7

<210> 8

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of promoter

<400> 8

<210> 9

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of PbGp-859

<400> 9

<210> 10

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> PbGp-859 reverse primer

<400> 10

<210> 11

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of PbGp-784

<400> 11

<210> 12

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> PbGp-784 reverse primer

<400> 12

<210> 13

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer of PbGp-710

<400> 13

<210> 14

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> PbGp-710 reverse primer

<400> 14

Claims (15)

A detection molecule for detecting a target molecule, wherein the target molecule is selected from the group consisting of: (i) a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:1; (ii) a nucleic acid molecule, which has the nucleotide sequence shown in SEQ ID NO: 2; and (iii) a nucleic acid molecule, which has the similarity to the nucleic acid molecule defined in (i) or (ii): More than 95% of the nucleotide sequence; wherein the detection molecule is a nucleic acid molecule that can hybridize with the target molecule. Such as the detection molecule of claim 1, wherein the target molecule is located in an orchid. Such as the detection molecule of claim 1, wherein the target molecule is located in the promoter of a geranyl diphosphate synthase gene. Such as the detection molecule of any one of claims 1 to 3, which is a primer for specifically amplifying the target molecule. The detection molecule of claim 4, wherein the primer is selected from a forward primer having a nucleotide sequence as shown in SEQ ID NO: 3 and a nucleotide sequence as shown in SEQ ID NO: 4 Back primer. A method for predicting the production of orchid fragrance, comprising detecting whether a target molecule exists in the genome of the orchid, wherein the target molecule is selected from the group consisting of: (i) a nucleic acid molecule, which has SEQ ID NO :1; (ii) a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2; and (iii) a nucleic acid molecule having the same as (i) or (ii) Nucleotide sequences whose similarity of nucleic acid molecules defined by) is more than 95%. Such as the method of claim 6, wherein the orchid is Phalaenopsis spp. The method of claim 6, which comprises detecting whether the target molecule is present in the promoter of the geranyl diphosphate synthase gene. Such as the method of any one of claims 6 to 8, which comprises using a detection molecule to detect the target molecule. The method of claim 9, wherein the detection molecule includes a primer for specifically amplifying the target molecule. The method of claim 10, wherein the primer is selected from a forward primer having the nucleotide sequence shown in SEQ ID NO: 3 and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 4 Xiang Yinzi. Such as the method of claim 6, which includes the following steps: (a) Obtain a nucleic acid fragment from the orchid; (b) Amplify the nucleic acid fragment as a template to obtain a product containing the target molecule; and (c) analyze the amplified product. The method of claim 12, wherein step (b) comprises performing a polymerase chain reaction with a primer selected from a forward primer having the nucleotide sequence shown in SEQ ID NO: 3 and a The reverse primer of the nucleotide sequence shown in SEQ ID NO:4. The method of claim 12 or 13, wherein step (c) comprises analyzing the amplified product by gel electrophoresis. The method of claim 12 or 13, wherein step (c) comprises sequencing the amplified product.

Images