TWI706038B - Human Anti-Enterovirus Type 71 Monoclonal Antibody - Google Patents

Abstract

The present invention is a human anti-Enterovirus 71 monoclonal antibody. By obtaining the peripheral blood of human patients naturally infected by Enterovirus 71, the secretion of Enterovirus 71-specific immunoglobulin G induced by infection is screened. B cells, then the immunoglobulin G variable region genes of the B cells are selected and transfected into human cell lines for expression, thereby obtaining human anti-enterovirus 71 monoclonal antibodies, using the above-mentioned human anti-enterovirus 71 Monoclonal antibodies can specifically and powerfully neutralize Enterovirus 71 of multiple genotypes, especially those Enterovirus 71 genotypes B4, C4 and B5, which are popular in Taiwan and China in recent years.

Description

Human anti-Enterovirus 71 monoclonal antibody

The present invention is a monoclonal antibody, especially a human anti-enterovirus 71 monoclonal antibody.

An effective level of antibody protection is the key to immunity against Enterovirus 71. However, the current understanding of the specificity and functional properties of antibodies induced by natural human infection with Enterovirus 71 is quite limited.

Enterovirus 71 (EV71) is a virus with single-stranded RNA without mantle as the genetic material. It is also the main pathogen causing hand-mouth-foot and herpetic angina in children in Europe and Asia Pacific. In an outbreak of Enterovirus 71, there may be cases of aseptic meningitis that invades the central nervous system, polio-like neurological disorders, encephalitis with heart and lung failure, and even death. In 2011, a severe epidemic broke out in Vietnam, resulting in 174,67 infections and 200 deaths. The 2012 epidemic in China had more than two million cases and hundreds of deaths. In 2016, the Spanish epidemic had 109 severe cases confirmed. Although the epidemic of Enterovirus 71 is so severe, in most countries where the epidemic still occurs, there are no approved vaccines and specific treatments that can be used to combat Enterovirus 71.

Enterovirus 71 outbreaks occur in endemic areas about every 2-3 years. Sometimes the genotypes that have appeared in the past will reappear, and sometimes new genotypes will appear to replace the genotypes that were popular in the past. The virus strains of past Enterovirus 71 outbreaks can be found, with high mutation rate and inheritance The recombination rate is one of the characteristics of Enterovirus 71. It has been repeatedly found that Enterovirus 71 has gene recombination, which can exchange genes between the same genotype and heterogenotype.

The emergence of new enterovirus 71 strains or new genotypes may be due to the pressure of the host's immunity. The mutant virus has a survival advantage because it can evade the host's immune system and thus infect more people. When Taiwan's infection with Enterovirus 71 genotype C2 broke out in 1998, there were more than 120,000 cases of infection and 78 deaths. After ethnic serological analysis, the results show that the lack of protective antibodies is one of the main reasons for the high infection rate and high risk of severe illness in children. In 2012, the outbreak analysis of Enterovirus 71 genotype B5 in Thailand showed similar results.

In addition, studies have shown that in some children infected with Enterovirus 71, although their antibody response shows neutralization titers across genotypes, the neutralization titers for certain genotypes are very low, or the resulting Antibodies are particularly biased for certain genotypes. Many studies in the past have also shown that the host’s neutralizing antibodies promoted the evolution of the virus. Recent studies have shown that in the anti-Enterovirus 71 monoclonal antibody group produced by mice infected with Enterovirus 71, there are also differences in the identification of different virus strains or different genotyping strains. However, we are still unclear about the content of the antigen identification of human anti-Enterovirus 71 neutralizing antibodies. This topic has a very important relevance to vaccine design and future policies for using vaccines to control the epidemic. More and more evidence shows that the currently developed enterovirus 71 vaccine still cannot cross-protect all the prevailing genotypes and virus strains.

The protein coat of Enterovirus 71 is composed of its 4 gene products VP1-4. VP1, VP2, and VP3 appear on the outside of the virus shell, while VP4 is deeply buried inside. Using mouse monoclonal antibodies, several linear neutralizing epitopes of enterovirus 71 can be identified, such as on the GH loop of VP1 (215-220 amino acid sequence), and on VP2. On the EF loop (141-146 amino acid sequence) and in the Knob region of VP3. Studies have also shown that mouse monoclonal antibodies can identify the antibody determinant of a specific Enterovirus 71 strain (located at the 145th amino acid of VP1). In any case, the content of the Enterovirus 71 antigen recognition content of the mouse monoclonal antibody cannot represent the antigen recognition content of the potent enterovirus 71 antibody in human children. At least so far, there has not been any monoclonal antibody produced by humans under acute enterovirus 71 infection, and the (neutralizing) epitope identified by the antibody has not been reported in detail.

Generally in children with acute enterovirus 71 infection, in the first week of infection, enterovirus 71-specific immunoglobulin G-secreting B cells (plasmablasts) are induced in large numbers, and the antibody-secreting cells react The peak period is 4-7 days after the appearance of clinical signs. In addition, the study also found that the content of the serum response after infection has a neutralizing titre that crosses against Enterovirus 71 genotype B and C. However, some sera after infection have relatively low antibodies against Enterovirus 71 genotype C. potency.

The prior art monoclonal antibody is derived from BALB/c mice, after being administrated with the C4 vaccine of the inactivated enterovirus 71 genotype subtype, followed by the hybridoma cell line fusion technology, the hybridoma cell The mouse monoclonal antibody produced by strain fusion technology only targets Enterovirus 71 genotype C4, and its antigen has only a single target, and does not include other Enterovirus 71 genotypes B4 and B5 that are circulating in Taiwan and China.

At present, there are also technologies to select the expression gene of the anti-Enterovirus 71 antibody in a yeast vector, and express and purify the monoclonal antibody produced in the yeast, or to immunize mice by synthesizing the Enterovirus 71 VP1 peptide Later, the VP1 specific antibody immune gene was selected and expressed in humanized cells to produce a monoclonal antibody of this gene product, but the heavy and light chain variable regions of the monoclonal antibody were still murine origin In addition, mouse-derived antibodies do not work well in humans. The monoclonal antibody does not clearly indicate that it acts on the epitope region of Enterovirus 71.

The present invention provides a human anti-Enterovirus 71 monoclonal antibody. The human anti-Enterovirus 71 monoclonal antibody system is modified according to the following method: (1) Isolated from human blood samples infected with Enterovirus 71 Enterovirus 71-specific immunoglobulin G-secreting B cells; (2) clone the immunoglobulin variable region genes of the above-mentioned immunoglobulin G-secreting B cells for recombinant cloning, and then recombine the recombinant cloned immunoglobulin G gene is transfected into HEK293T human cell line, immunoglobulin G is expressed and purified, and then human anti-enterovirus 71 monoclonal antibody can be obtained.

The above-mentioned human anti-Enterovirus 71 monoclonal antibody is selected from the immunoglobulin G human B cell immunoglobulin variable region gene of patients infected with Enterovirus 71; the heavy chain of the above-mentioned antibody variable region gene and its corresponding The light chain expressed sequence is 16-2-8C (heavy chain SEQ ID NO: 2, light chain SEQ ID NO: 14), 16-2-9D (heavy chain SEQ ID NO: 3, light chain SEQ ID NO: 15) Or 16-2-12D (heavy chain SEQ ID NO: 6, light chain SEQ ID NO: 18).

The advantages of the present invention are:

(1) The human anti-Enterovirus 71 monoclonal antibody of the present invention is a human antibody. It is a monoclonal antibody derived from human B cells induced by Enterovirus 71 infection. Compared with the existing mouse-derived monoclonal antibody Antibodies have 10-100 times stronger neutralizing ability.

(2) The human-derived anti-enterovirus 71 monoclonal antibody produced by the present invention can specifically and powerfully fight against enterovirus 71 of different genotypes, such as genotype B4, genotype B4, which are mainly popular in China and Taiwan Virus strains such as B5 and C4.

(3) The present invention utilizes the technology of screening antibody escape mutants (escape mutant selection) to act on the 12 human anti-enteriovirus type 71 monoclonal antibodies of the present invention. The epitope on the shell structure of Type 71 has been analyzed. The human anti-Enterovirus 71 monoclonal antibody originally had the ability to neutralize Enterovirus 71, but it lost the ability to neutralize the escaped virus strain, indicating that the escaped virus strain is being human-derived against Enterovirus 71 Mutations occur in specific areas of the coat attacked by the monoclonal antibody. Through sequencing and comparison with the parent strain virus, the key mutation points that escape the virus coat genes can be defined. In this way, the 12 human anti-enterovirus 71 monoclonal antibodies specifically attacked (neutralized) specific areas of the virus.

(4) Through the present invention, the epitope map of the virus shell identified by the human anti-enterovirus 71 monoclonal antibody can be drawn, including the canyon northern rim, the canyon floor, and the southern edge of the canyon There are five major regions: canyon southern rim, 3-fold plateau, and 2-fold plateau. The epitopes identified by the 12 human anti-enterovirus 71 monoclonal antibodies of the present invention are quite conserved among different genotypes, indicating that the 12 human anti-enterovirus 71 monoclonal antibodies of the present invention are capable of recognizing intestines. The pervasiveness and cross-complementarity of virus type 71; the animal model of enterovirus type 71 infection in the brain of mice showed that human anti-entovirus type 71 monoclonal antibody 16-2-9D (identified the bottom area of the canyon) and 17-2-2B (identify the edge of the canyon) can effectively prevent neuropathy and growth retardation caused by enterovirus 71 genotype B5 and C4 brain infection in mice.

(5) The genes of the human anti-enterovirus 71 monoclonal antibody of the present invention can be cloned into E. coli vectors or other host cells to facilitate the analysis, modification and permanent storage of the gene sequence.

(6) The human-derived anti-Enterovirus 71 monoclonal antibody of the present invention can be used to manufacture targeted kits, reagents or medicaments according to Enterovirus 71 genotype B4, B5 or C4. The above kits, reagents or medicaments can be Neutralize Enterovirus Enterovirus 71 genotype B4, B5 or C4.

(7) The human-derived anti-enterovirus 71 monoclonal antibody of the present invention can be made into a test kit, wherein the test kit is verified by enzyme-linked immunosorbent assay, immunoprecipitation or western blotting method Infected with Enterovirus 71.

(8) The ability of the prepared human anti-enterovirus 71 monoclonal antibody to specifically protect against Enterovirus 71 in vivo can be verified. The method is as follows: (a) Infect the intestines with multiple mice with brain challenge Virus type 71; (b) Divide the above-mentioned mice into two halves and name them the control group and the experimental group respectively. The experimental group was given human anti-enterovirus 71 monoclonal antibody, and the control group was given the same volume of buffer (C) After 2~5 days, the control group will obviously produce neurological symptoms of severe motor disability compared with the experimental group, so it can be proved that the implementation of human anti-enterovirus 71 monoclonal antibody can significantly protect Mice are protected from motor disability caused by Enterovirus 71 infection.

Fig. 1 is a block diagram of the process of manufacturing human anti-enterovirus type 71 monoclonal antibodies of the present invention

Figure 2 shows the neutralization reaction of human anti-enterovirus 71 monoclonal antibody against Enterovirus 71 clinical strains from 1998 to 2016; *Human anti-enterovirus 71 monoclonal antibody (representative mAb) The symbol of the lowest concentration for completely neutralizing the virus is as follows: ++++: <100ng/ml; +++: 0.1-1μg/ml; ++: 1-10μg/ml; +: 10-50μg/ml;- : No neutralizing ability; Control group#: Using human-derived anti-Enterovirus 71 monoclonal antibodies without neutralizing ability, 17-1-10B and 16-2-1A, and human serum after Enterovirus 71 infection For the control group.

Fig. 3 shows the immunoprecipitation of virus coat protein by the human anti-enterovirus 71 monoclonal antibody of the present invention; uninfected RD cell culture supernatant is used as the antigen control group (mock), human anti-influenza virus monoclonal antibody 2 -12C was used as an antibody control group.

Figure 4 shows the key amino acid positions of the virus coat identified by the human anti-enterovirus 71 monoclonal antibody of the present invention. This locus is conserved among enterovirus 71 types (including A, B1, B2, B3, B4, B5, C1, C2, C3, C4 and C5).

Figure 5A shows the key amino acid sites of the virus coat identified by the human anti-enterovirus type 71 monoclonal antibody of the present invention, based on the epitope map of the enterovirus type 71 coat structure of the RCSB Protein Data Bank 3ZFF and 3VBS. This figure uses PyMOL to draw a cartoon of the side of the virus shell. Coat protein VP1: black; VP2: gray; VP3: white. The meanings of the numbers are 5 means 5 times axis; 3 means three times axis; 2 means 2 times axis.

Figure 5B shows the key amino acid positions of the virus coat identified by the human anti-enterovirus type 71 monoclonal antibody of the present invention, based on the epitope map of the enterovirus type 71 coat structure of the RCSB Protein Data Bank 3ZFF and 3VBS. The graph uses PyMOL to draw a 5 times apex area as the center of the pentamer surface view. Coat protein VP1: black; VP2: gray; VP3: white. The meanings of the numbers are 5 means 5 times axis; 3 means three times axis; 2 means 2 times axis.

0.05；**：P

0.01；***：P

0.001)。縮寫的d.p.i.；days post-infection。 Figure 6A shows the in vivo protective ability of the human anti-enterovirus 71 monoclonal antibody of the present invention. Two-week-old mice of hSCARB2 strain were tested for motor deficit scores (motor deficit scores) within 0 to 14 days after infection with Enterovirus 71. The performance of motor deficits can be based on severity There are 7 levels. Starting from the first level of disability, each additional level represents an increase in the severity of the disability. Therefore, a higher number means the more severe the disability. The asterisk indicates a significant difference in Enterovirus 71 infection with and without human anti-enterovirus 71 monoclonal antibody. Upright triangles and inverted triangles represent: [Enterovirus 71 12-96015 + buffer PBS] vs [Enterovirus 71 12-96015 + human anti-enterovirus 71 monoclonal antibody]. Gray squares and gray circles represent: [Enterovirus 71 11-96023 + buffer PBS] vs [Enterovirus 71 11-96023 + human anti-enterovirus 71 monoclonal antibody]. *: P

0.05; **: P

0.01; ***: P

0.001). Abbreviated dpi; days post-infection.

0.05；**：P

0.01；***：P

0.001)。縮寫的d.p.i.；days post-infection。 Figure 6B shows the in vivo protective ability of the human anti-enterovirus 71 monoclonal antibody of the present invention. After two-week-old hSCARB2 strain mice were infected with Enterovirus 71, the weight of the mice was measured at the indicated time within 0 to 14 days. Error bars represent the standard error of the mean. The asterisk indicates a significant difference in the infection of Enterovirus 71 with and without human anti-enterovirus 71 monoclonal antibody. Upright triangles and inverted triangles represent: [Enterovirus 71 12-96015 + buffer PBS] vs [Enterovirus 71 12-96015 + human anti-enterovirus 71 monoclonal antibody]. Gray squares and gray circles represent: [Enterovirus 71 11-96023 + buffer PBS] vs [Enterovirus 71 11-96023 + human anti-enterovirus 71 monoclonal antibody]. *: P

0.05; **: P

0.01; ***: P

0.001). Abbreviated dpi; days post-infection.

Referring to Figure 1, the present invention discloses a method for preparing human anti-enterovirus 71 monoclonal antibody, which is modified according to the following method:

(1) Collect peripheral blood mononuclear cells (PBMCs) from patients who have been diagnosed with Enterovirus 71 infection in the laboratory. Firstly label Plasmablast B cells in PBMCs (cell number: 1×10 ⁶ ), which can be labeled with cell surface marker antibodies, including PB anti-CD3 (5μg/ml, UCHT1 clone, Becton, Dickinson and Company, USA), FITC anti-CD19 (1:10 dilution, used in 100μL experimental sample, HIB19 clone, Becton, Dickinson and Company, USA), PE-Cy7 anti-CD27 (1:20 dilution, used in 100μL experimental sample, M-T271 Clone, Becton, Dickinson and Company, USA), APC-H7 anti-CD20 (5μg/ml, L27 clone, Becton, Dickinson and Company, USA), and PE-Cy5 anti-CD38 (1:10 dilution, used in 100μL Among the experimental samples, the HIT2 clone, Becton, Dickinson and Company, USA, was used to confirm and screen Plasmablast B cells by flow cytometry and collect single cells into 96-well micro-well plates.

(2) Afterwards, the immunoglobulin G heavy chain and light chain variable region genes of a single Plasmablast B cell were cloned into the immunoglobulin G heavy chain expression vector (IgG-AbVec expression vector [FJ475055]) and kappa or lambda immunoglobulin free light chain expression vector (Igκ-AbVec expression vector [FJ475056] or Igλ-AbVec expression vector [FJ517647]), and transfection of the selected heavy chain and light chain gene vectors into 293T In the cell line (ATCC code: ATCC CRL-3216), the serum-free culture system is used to express monoclonal antibodies. After culturing for 5 days, remove the cell debris by centrifugation (400g [gravity], room temperature, 10 minutes), and collect the supernatant to obtain recombinant human anti-enterovirus 71 secreted out of the cell after gene expression Type monoclonal antibody.

From Plasmablast B cells provided by patients infected with Enterovirus 71, a total of 191 human anti-enterovirus 71 monoclonal antibodies were obtained in this experiment. By enzyme-linked immunosorbent assay (ELISA) method, a standard curve prepared by serially diluting known concentrations of human immunoglobulin can be used to estimate the human anti-enterovirus 71 in the supernatant. The relative concentration of type monoclonal antibody. The antigen-specific recognition ability (or titer) of this human anti-enterovirus 71 monoclonal antibody will be determined by methods such as antigen binding test analysis and neutralization test. In the experiment of the present invention, there are a total of 84 human anti-enterovirus 71 monoclonal antibodies that can specifically identify the virus outer shell. It can be seen from Figure 2 that these human anti-enterovirus 71 monoclonal antibodies can immunoprecipitate the virus outer shell. Proteins, but cannot identify denatured proteins. These results indicate that The human-derived anti-enterovirus 71 monoclonal antibody of the present invention is mainly used to specifically identify the structural antigen structure of the virus shell, which will be introduced one by one below.

Viruses used in the experiment of the present invention:

Experiments used to test the ability of human anti-Enterovirus 71 monoclonal antibodies to bind or neutralize the virus: from the Enterovirus 71 clinical virus strains isolated from 1998 to 2016 (including 98-2086, 98-4215, 99-1691 , 99-3351, 00-2278, 01-1437, 02-2792, 03-70576, 04-72232, 05-1956, 07-72043, 08-96016, 10-96018, 11-96023, 12-96015, 14 -51389, 15-921, 16-50444 and 16-50555).

Viruses required in the experimental control group: other types of enteroviruses, including 12-50891 (Coxsackie virus A2), 14-2060 (Coxsackie virus A16), 15-50909 (Coxsackie virus A16) and 14 -2795 (Enterovirus D68).

Operation: Enterovirus 71 or other enteroviruses are cultured using the commonly used enterovirus growth medium (Dulbecco's Modified Eagles Medium[DMEM]/2% fetal bovine serum/penicillin 100μg/ml and streptomycin 100μg/ml) and RD cells (ATCC code: ATCC CCL-136), the cells will produce cytopathic effect (CPE) due to the proliferation of the virus. At this time, they will be repeatedly frozen and thawed three times, and then centrifuged (400g, room Warm, 10 minutes) to remove cell debris, and collect the supernatant of virus. On the other hand, for the two enterovirus 71 types 12-96015 and 11-96023, RD cells are used here to produce a large amount of purified virus liquid. In order to collect the virus particles in the supernatant, NaCl (sodium chloride, 250mM) and PEG 6000 (10% polyethylene glycol, Sigma®, USA) were added, then treated at 4°C for 12 to 16 hours, and then subjected to high-speed centrifugation (100,000 g, 5 hours), to precipitate virus particles. The precipitate containing virus particles was re-dissolved with PBS (containing 0.01% Triton X-100 and 10% protease inhibitor mixture [Roche, Switzerland]). After that, RNase-free DNase (0.05mg/ml, RQ1, Promega, USA) was added and treated at 37°C for 30 minutes to remove residual DNA; and EDTA (ethylenediaminetetraacetic acid, 10mM) was added to stop the reaction. In order to further purify the virus, a 10-35% potassium tartrate gradient [10-35%, w/v] was used to dissolve in 250mM HEPES(4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 250mM NaCl [pH 7.5]) was purified by ultra-high-speed centrifugation (159,382 g, 4°C, 2 hours). Finally, the virus concentration is estimated with BCA protein analysis reagent (The Thermo Scientific Pierce ^TM BCA Protein Assay Kit, Thermo Fisher Scientific, USA). For the virus supernatant and purified virus liquid, the Reed-Muench method was used to determine the virus titer (50% tissue culture infective dose, TCID ₅₀ ) that can cause 50% of the cultured tissue infection with RD cells.

For all Enterovirus 71 used in the experiment, detect the gene sequence (P1 gene region) of the viral coat proteins VP1, VP2, VP3 and VP4, that is, use specific primers to amplify Enterovirus 71 by polymerase chain reaction P1 area, and sequence the area.

For Enterovirus 71 strain of genotype B:

VP1_F: GCGGCGGCCCAGAAGAA, VP1_R: GAGGTTTGCCCAGTCGTTA;

VP2_F: ACAGAGCCTCAAACAAGAC, VP2_R: GAAATTTGGGAGAATGGGTGC;

VP3_F: TTTGACCAAGGGGCAACCC, VP3_R: GTCCTGTGGGTGCCGGCAG;

VP4_F: ATCCGGTGTGCAATAGAGC, VP4_R: CATTCACCATAACCGACTATG.

For Enterovirus 71 strain of genotype C:

VP1_F: GCGGCAGCCCAAAAGAA, VP1_R: AAGATTTGCCCAATCATTGTG;

VP2_F: ACAGAGTCTCAAGCAGGAT, VP2_R: GAAGTTTGGTAGAATAGGTGC;

VP3_F: TACGACCAAGGAGCGACGC, VP3_R: CTGTGGGTGCTGGTAGAGC;

VP4_F: ATCCGGTGTGCAACAGAGC, VP4_R: CACTCACCATAACCGACTATG.

Results: 84 strains in this experiment can specifically identify enterovirus 71 human anti-enterovirus 71 monoclonal antibodies, 38 strains have the ability to strongly neutralize Enterovirus 71. These viruses neutralize human anti-enterovirus type 71 monoclonal antibodies, based on the analysis of the protein coding sequence of their heavy and light chain variable regions (VDJ and VJ), which can be divided into 12 groups. Therefore, the characteristics of these 12 representative viruses in neutralizing human anti-enterovirus 71 monoclonal antibodies were further analyzed. The human anti-enterovirus 71 monoclonal antibodies are 16-3-10B [heavy chain SEQ ID NO:1, light chain SEQ ID NO: 13], 16-2-8C [heavy chain SEQ ID NO: 2 , Light chain SEQ ID NO: 14], 16-2-9D [heavy chain SEQ ID NO: 3, light chain SEQ ID NO: 15], 16-2-11B [heavy chain SEQ ID NO: 4, light chain SEQ ID NO: 16], 17-2-2B [heavy chain SEQ ID NO: 5, light chain SEQ ID NO: 17], 16-2-12D [heavy chain SEQ ID NO: 6, light chain SEQ ID NO: 18 ], 16-3-3C[heavy chain SEQ ID NO: 7, light chain SEQ ID NO: 19], 16-2-2D [heavy chain SEQ ID NO: 8, light chain SEQ ID NO: 20], 17- 1-12A [heavy chain SEQ ID NO: 9, light chain SEQ ID NO: 21], 34-1-6D [heavy chain SEQ ID NO: 10, light chain SEQ ID NO: 22], 16-3-4D [heavy chain SEQ ID NO: 11, light chain SEQ ID NO: 23] and 17-2-12A [heavy chain SEQ ID NO: 12, Light chain SEQ ID NO: 24], the sequences of the above 12 representative human anti-enterovirus 71 monoclonal antibodies have been stored in the gene bank (codes: KY354551-KY354562, and KY354565-KY354576).

In Figure 2, in order to analyze the breadth of representative human anti-Enterovirus 71 monoclonal antibodies to identify different genotypes of Enterovirus 71, clinical strains from different genotypes of Enterovirus 71 isolated from 1998 to 2016 were included. Neutralization test test. 10 strains were found (16-3-10B, 16-2-8C, 16-2-11B, 17-2-2B, 16-2-9D, 16-2-12D, 16-3-3C, 16- 2-2D, 34-1-6D, and 17-1-12A) can broadly and strongly neutralize enterovirus 71 of multiple genotypes, including genotypes B (including B4 and B5) and C (including C1) , C4 and C5). However, the above-mentioned human anti-enterovirus 71 monoclonal antibody has a poor effect against the enterovirus 71 of genotype C2, and even the concentration is as high as 50 μg/ml, it cannot effectively neutralize the virus. It is worth noting that there are six human anti-Enterovirus 71 monoclonal antibodies (16-3-10B, 16-2-8C, 16-2-11B, 17-2-2B, 16-2-9D, and 16-2-12D) At low concentrations (<1μg/ml), it still has a strong neutralizing effect on Enterovirus 71 genotypes B4, B5 and C4; especially 16-3-10B and 16-2- 8C still has a strong neutralizing effect at lower concentrations (<100ng/ml). In other words, 16-3-10B and 16-2-8C are compared with other 10 human anti-enterovirus 71 monoclonal antibodies Has better protection capabilities. In addition, it was also found that human anti-Enterovirus 71 monoclonal antibodies 16-3-4D and 17-2-12A can usually only fight Enterovirus 71 of genotype B, and higher concentrations (>10μg/ml) are required. , It has the effect of neutralizing the virus.

The experiment of the present invention uses a flow cytometry-based combined test analysis method:

The experiment of the present invention uses a flow cytometer to test the human anti-enterovirus 71 of the present invention The method for analyzing the binding of monoclonal antibodies to Enterovirus 71 antigen is as follows:

On the first day, RD cells were infected with an appropriate amount of Enterovirus 71.

The next day, these cells were collected, washed and re-dissolved. Then the cells were fixed with freshly prepared 2% formaldehyde (10 minutes, 37°C) and permeabilizing the cells with 0.1% Triton X-100 (15 minutes, 37°C). Then the background area was covered with sapoinin-3% bovine serum albumin (BSA). These cell samples are then used with primary and secondary antibodies. The primary antibody includes the human anti-Enterovirus 71 monoclonal antibody of the present invention (5μg/ml, diluted in BD Perm/Wash ^TM buffer [Thermo Fisher Scientific, USA]), or human serum after Enterovirus 71 infection (1:125 diluted in BD Perm/Wash ^TM buffer [Thermo Fisher Scientific, USA]), and mouse-derived anti-Enterovirus 71 3C monoclonal antibody (1μg/ml, anti-Enterovirus 71 3C antibody, GeneTex, USA ). The secondary antibody is a goat-derived anti-human immunoglobulin G antibody (2.5μg/ml) containing fluorescence conjugated calibration, or a goat-derived anti-mouse immunoglobulin G antibody (1.5μg/ml, Thermo Fisher Scientific, USA). Use the BD FACSCanto ^TM II flow cytometer to analyze the cells affected by the primary antibody and the secondary antibody, that is, analyze 10,000 collected enterovirus 71 infection (enterovirus 71 3C positive) cell events, human-derived anti-intestinal The percentage of cells identified by the virus 71 monoclonal antibody. When performing the binding test analysis method, uninfected RD cells were used as the antigen control group. In addition, human anti-influenza virus monoclonal antibody 2-12C and murine anti-enterovirus 71 VP2 monoclonal antibody MAB979 (EMD Millipore, Germany) served as the antibody control group for each experiment.

The experiment of the present invention uses Enzyme-linked immunosorbent assay:

In the experiment of the present invention, the purified enterovirus 71 is first adsorbed on a 96-hole micro porous disc. To avoid non-specific binding reactions, the background area was covered with 3% bovine serum albumin. Add primary antibodies, including human anti-Enterovirus 71 monoclonal antibody supernatant (5μg/ml), purified human anti-Enterovirus 71 monoclonal antibody (5μg/ml), or human serum after Enterovirus 71 infection (1:125 dilution), and these human-derived anti-enterovirus 71 monoclonal antibodies that bind to the adsorbed virus can carry horseradish peroxidase (HRP, Invitrogen, USA) conjugated antibodies. Immunoglobulin G antibody (0.5μg/ml, Rockland, USA) is used as a secondary antibody for detection, and the secondary antibody connected to it is detected with 3',3',5',5',-tetramethylbenzidine The color reagent (TMB substrate reagent, BD Biosciences, USA) was reacted with it, and then the reaction was terminated with 2M sulfuric acid, and the absorbance (OD450 minus OD570) of each experimental sample was obtained and averaged. PBS, human anti-influenza virus monoclonal antibody 2-12C, and murine anti-enterovirus 71 VP2 monoclonal antibody MAB979 (EMD Millipore, Germany) were used as the primary antibody control group for each experiment.

Before judging the result, the average absorbance of all samples and the positive control group MAB979 must be corrected. The corrected absorbance value is equal to the sample and the positive control group MAB979 minus the negative control group 2-12C, and the difference is greater than or equal to 0.30. The source anti-Enterovirus 71 monoclonal antibody sample is positive for the binding ability of the Enterovirus 71.

The experiment of the present invention uses immunoprecipitation and Western blotting analysis methods:

The immunoprecipitation analysis method uses protein G conjugated with magnetic beads (Dynabeads®, Thermo Fisher Scientific, USA) to hold the immunoglobulin G antibodies firmly to facilitate the precipitation of magnetic beads while carrying the invention The human anti-Enterovirus 71 monoclonal antibody to be tested, and this human anti-Enterovirus 71 monoclonal antibody can specifically bind to the desired Enterovirus 71 tested. Then, according to the standard method of Dynabeads®, the human anti-enterovirus 71 monoclonal antibody bound to the magnetic beads and the enterovirus 71 antigen specifically bound by the human anti-enterovirus 71 monoclonal antibody were combined wash. Out. The protein contained in the eluate was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and silver staining method (Pierce Silver Stain Kit, Thermo Fisher Scientific, USA) stained protein bands on the colloid. The immunoblotting method was used to detect the Enterovirus 71 antigen contained in the colloid that was specifically bound by the human anti-enterovirus 71 monoclonal antibody. Figure 3 uses the mouse anti-enterovirus 71 VP2 monoclonal antibody MAB979 (1:1000 dilution, EMD Millipore, Germany) and the mouse anti-enterovirus 71 VP1 monoclonal antibody MAB1255-M05 (1:1000 dilution, Abnova, Taiwan) was used as the primary antibody, and then the goat-derived anti-murine immunoglobulin G antibody (1:5000 dilution, Thermo Fisher Scientific, USA) conjugated with HRP was used as the secondary antibody. Afterwards, a qualitative chemical luminescence method (Pierce enhanced chemiluminescence western blotting substrate, Thermo Fisher Scientific, USA) was used to detect the coat protein of enterovirus 71. The viral supernatant collected after enterovirus 71 12-96025 infects RD cells is used as an antigen to react with the human anti-enterovirus 71 monoclonal antibody of the present invention for immunoprecipitation. The uninfected RD cell culture supernatant was used as the antigen control group (mock), and the human anti-influenza virus monoclonal antibody 2-12C was used as the antibody control group.

Neutralization assay used in the experiment of the present invention:

Principle: Use human anti-enterovirus 71 monoclonal antibody supernatant, purified human anti-enterovirus 71 monoclonal antibody, and control serum to perform neutralization test to confirm the human antibody of the present invention Whether the enterovirus 71 monoclonal antibody can neutralize the enterovirus 71 clinical strain or the enterovirus 71 escape strain to infect RD cells.

Serum samples will be pre-treated at 56°C for 30 minutes. Then, prepare a mixture of human anti-enterovirus 71 monoclonal antibody (50 μl) and the same amount of virus (100 TCID ₅₀ , 50 μl) (100 μl per hole) in a 96-well plate, and act at 37°C for 2 hours . Next, 100 μl of a suspension containing 8×10 ⁴ RD cells was added and cultured at 37° C. for 5 days. The settings for each experiment include the cell control group, the post-infection serum control group, and the virus serial dilution group. Each sample has three replicates. At the end of the infection, the cells were fixed with 5% glutaraldehyde and stained with 0.1% crystal violet. Observe the lowest concentration of human anti-enteriovirus 71 monoclonal antibody that can completely inhibit the occurrence of cytopathic changes, and the lowest neutralization concentration is determined if it reaches a consistent result under the triple-repeat dilution.

The production of the enterovirus 71 escape strain in the experiment of the present invention:

In order to analyze the specific identification of the epitope located on the enterovirus type 71 coat protein by the neutralizing human anti-enterovirus type 71 monoclonal antibody, the experiment used two enterovirus type 71 12-96015 genotype B5 ( The serial number registered in the gene bank [https://www.ncbi.nlm.nih.gov/genbank/]: KX267854) and the genotype C4 of 11-96023 (the serial number registered in the gene bank: KX267855), As the mother strain virus for screening the escaped virus mutant strains, they were respectively treated with the human anti-enterovirus type 71 monoclonal antibody produced by the present invention for 1 hour, and then inoculated into a monolayer of RD cells. After the inoculated cells were cultured at 37°C for 4 days, and after repeated freezing and thawing three times, the cell debris was removed by centrifugation (400g, room temperature, 10 minutes), and the supernatant was collected before inoculation again To a single layer of RD cells. After that, if the cells are cultured at 37°C for 4 days if cytopathic changes occur, they can be frozen and thawed repeatedly three times, then centrifuged (400g, room temperature, 10 minutes) to remove the cell debris, and collect the virus supernatant But if there is no cytopathic effect, the collected supernatant is again inoculated to the monolayer of RD cells.

When the virus escape strain screening experiment is carried out, it is necessary to set up a non-human anti-enterovirus In the control group of type 71 monoclonal antibody, in general, the production of virus escape strains requires two to three repeated inoculations. For the collected supernatant of the virus escape strain, the human anti-Enterovirus 71 monoclonal antibody must be used to verify the virus escape strain. The human anti-Enterovirus 71 monoclonal antibody will be lost or significant Reduce the ability to bind and neutralize the escape strain of the virus. The P1 gene sequence of the escape virus was further analyzed and compared with the P1 gene sequence of the parent strain 12-96015 or 11-96023 of the control group to obtain the point mutation position on the virus coat protein encoding.

As shown in Figure 4, 12-96015 of enterovirus type 71 genotype B5 and 11-96023 of genotype C4 are escaped viruses screened by the 12 representative human anti-enterovirus type 71 monoclonal antibodies of the present invention Mutant strains (Escape mutant, E), 35 strains of escape virus that can avoid being neutralized by human anti-enterovirus 71 monoclonal antibody were screened out. After sequence analysis, it was found that most of them had a single Coat amino acid mutation point; however, two escape virus mutant strains were found to have two mutation points each (such as escape △12 screened by human anti-enterovirus 71 monoclonal antibody 17-2-12A) -96015 Enterovirus 71 [with VP3 K144E and VP3 T148A] and human anti-enterovirus 71 monoclonal antibody 16-3-10B screened escape △11-96023 Enterovirus 71 [with VP2 T141M and VP1 S283F]). After analyzing the amino acid mutation sites of these 35 escaped viruses, it was found that there were a total of 25 amino acid substitutions, which occurred on the amino acids of the coat protein at 19 positions, which are human anti-enteroviruses. The type 71 monoclonal antibody neutralizes the critical recognition sites of Enterovirus 71. These sites are located on the coat proteins VP1 to VP3, and are marked with fonts and boxes. Among them, 17 are conserved in various genotypes of Enterovirus 71 Type coat protein sequence. In addition, because human anti-enterovirus 71 monoclonal antibodies 16-3-4D and 17-2-12A cannot neutralize Enterovirus 71 genotype C, no further screening for the escape of Enterovirus 71 11-96023 was conducted. Virus strain.

Next, referring to Figure 5A and Figure 5B, the 19 antigenic determinations defined by the present invention Positions are the 19 key amino acid substitution sites located in the enterovirus 71 coat protein (VP1 to VP3). We have mapped the five major amino acid substitution sites on the viral protein coat of these human anti-enterovirus 71 monoclonal antibodies. Regional location (including canyon northern rim, canyon floor, canyon southern rim, 3-fold plateau, and 2-fold plateau (2-fold plateau) and other five major regions). The 12 representative human-derived anti-enterovirus 71 monoclonal antibodies can be distinguished as 16-2-11B (heavy chain SEQ ID NO : 4, light chain SEQ ID NO: 16), 16-3-3C (heavy chain SEQ ID NO: 7, light chain SEQ ID NO: 19) and 16-2-2D (heavy chain SEQ ID NO: 8, light Chain SEQ ID NO: 20), located at the bottom of the canyon are 16-2-8C (heavy chain SEQ ID NO: 2, light chain SEQ ID NO: 14), 16-2-9D (heavy chain SEQ ID NO: 3, The light chain SEQ ID NO: 15) and 16-2-12D (heavy chain SEQ ID NO: 6, light chain SEQ ID NO: 18), located in the northern edge of the canyon are 16-3-10B (heavy chain SEQ ID NO: 1, light chain SEQ ID NO: 13) and 17-2-2B (heavy chain SEQ ID NO: 5, light chain SEQ ID NO: 17), located in the plateau region of the triple axis is 34-1-6D (heavy chain SEQ ID NO: ID NO: 10, light chain SEQ ID NO: 22) and 16-3-4D (heavy chain SEQ ID NO: 11, light chain SEQ ID NO: 23), located in the plateau region of the 2-fold axis is 17-1-12A ( Heavy chain SEQ ID NO: 9, light chain SEQ ID NO: 21) and 17-2-12A (heavy chain SEQ ID NO: 12, light chain SEQ ID NO: 24).

Statistical analysis used in the experiment of the present invention:

The statistical analysis of the TCID ₅₀ value of virus-infected RD cells is based on the Reed-Muench calculation method in the SPSS software. The difference in neutralization concentration between the two groups was analyzed by the Mann-Whitney method of GraphPad Prism software. When the p value is less than 0.05, it is considered statistically significant. The graphics are made with software such as Microsoft Excel and GraphPad Prism.

The human anti-Enterovirus 71 monoclonal antibody can be used to define the epitope of the recognized Enterovirus 71 shell structure region, and the method is as follows: (1) Using human anti-Enterovirus 71 monoclonal antibody and intestinal The role of the parent strain of virus type 71 is to screen out the enterovirus type 71 that cannot be neutralized, and name it as the escape virus strain; (2) sequence the above escape virus strain and the original enterovirus type 71 parent strain to define Escaping the key amino acid substitution site of the shell of the virus strain, this amino acid is a crucial recognition site for human anti-Enterovirus 71 monoclonal antibody to neutralize Enterovirus 71, which is the epitope of the Enterovirus 71 shell .

The experiment of the present invention has the protective effect of human anti-enterovirus 71 monoclonal antibody in mice:

Referring to Figure 6A and Figure 6B, in order to determine whether human anti-Enterovirus 71 monoclonal antibodies have the ability to protect mice against Enterovirus 71 in vivo, we established an animal model of mouse brain infection with Enterovirus 71. Two-week-old hSCARB2 (human scavenger receptor class B member 2) transgenic mice (c57BL/6 mice) were used to establish an animal model of enterovirus 71 infection in the mouse brain, and the virus used for infection was Enterovirus 71 type clinical virus strain (virus strain 12-96015 of genotype B5 or virus strain 11-96023 of genotype C4) was used. Next, we selected a human-derived anti-enterovirus 71 monoclonal antibody 17-2-2B (500μg/ml) that acts on the southern edge of the Virus Shell Canyon, and another human-derived anti-intestinal antibody that acts on the bottom of the Virus Shell Canyon. Virus type 71 monoclonal antibody 16-2-9D (500μg/ml) was tested to protect mice from infection. In the antibody experimental group, enterovirus 71 (virus strain 12-96015 of genotype B5 or strain 11-96023 of genotype C4) with human anti-Enterovirus 71 monoclonal antibody was also administered to the brain Infection; in the buffer control group, enterovirus 71 with the same volume of PBS was injected into the brain; in addition, there was no Enterovirus 71 infection but only the same total volume of PBS was administered to the mouse brain (N=4 to 8 mice per group). Enterovirus 71 infects the brains of mice with a dose of 4×10 ⁶ TCID ₅₀ (50% tissue culture infective dose). After 2 to 5 days of infection, the mice will begin to show neurological symptoms of severe motor disability. And lasting until about 14 days after infection (shown in Figure 6A and Figure 6B), the symptoms of severe motor disability can be measured using a seven-level measurement scoring system. The higher the score, the more severe the symptoms. The results show that Simultaneous administration of virus type 71 monoclonal antibody and enterovirus type 71 can indeed significantly avoid growth retardation in mice due to enterovirus type 71 infection, and achieve the effect of preventing severe motor disability and growth delay after brain infection Compared with the control group where no human anti-enterovirus 71 monoclonal antibody is added, there is a significant difference (shown in Figure 6A and Figure 6B).

<110> Linkou Chang Gung Memorial Hospital

<120> Preparation method, product and application of human anti-enterovirus 71 monoclonal antibody

<130>

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(354)

<223> The heavy chain variant region of human monoclonal antibody 16-3-1OB immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354551.

<400> 1

<210> 2

<211> 402

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(402)

<223> The heavy chain variant region of human monoclonal antibody 16-2-8C immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354552.

<400> 2

<210> 3

<211> 402

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(402)

<223> The heavy chain variant region of human monoclonal antibody 16-2-9D immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354553.

<400> 3

<210> 4

<211> 372

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(372)

<223> The heavy chain variant region of human monoclonal antibody 16-2-11B immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354554.

<400> 4

<210> 5

<211> 369

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(369)

<223> The heavy chain variant region of human monoclonal antibody 17-2-2B immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354555.

<400> 5

<210> 6

<211> 402

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(402)

<223> The heavy chain variant region of human monoclonal antibody 16-2-12D immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354556.

<400> 6

<210> 7

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(381)

<223> The heavy chain variant region of human monoclonal antibody 16-3-3C immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354557.

<400> 7

<210> 8

<211> 396

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(396)

<223> The heavy chain variant region of human monoclonal antibody 16-2-2D immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354558.

<400> 8

<210> 9

<211> 375

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(375)

<223> The heavy chain variant region of human monoclonal antibody 17-1-12A immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354559.

<400> 9

<210> 10

<211> 360

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(360)

<223> The heavy chain variant region of human monoclonal antibody 34-1-6D immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354560.

<400> 10

<210> 11

<211> 378

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(378)

<223> The heavy chain variant region of human monoclonal antibody 16-3-4D immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354561.

<400> 11

<210> 12

<211> 372

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(372)

<223> The heavy chain variant region of human monoclonal antibody 17-2-12A immunoglobulin IgG. The selection of the heavy chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354562.

<400> 12

<210> 13

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-3-10B immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354565.

<400> 13

<210> 14

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-2-8C immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354566.

<400> 14

<210> 15

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-2-9D immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354567.

<400> 15

<210> 16

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-2-11B immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354568.

<400> 16

<210> 17

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 17-2-2B immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354569.

<400> 17

<210> 18

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-2-12D immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354570.

<400> 18

<210> 19

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-3-3C immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354571.

<400> 19

<210> 20

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-2-2D immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354572.

<400> 20

<210> 21

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(336)

<223> Light chain variant region of human monoclonal antibody 17-1-12A immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354573.

<400> 21

<210> 22

<211> 321

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(321)

<223> The light chain variant region of human monoclonal antibody 34-1-6D immunoglobulin IgG. Human immunoglobulin The selection of the light chain variant region of IgG is based on the "human monoclonal antibody production" unit based on the implementation method. This artificial sequence has been stored in the gene bank, and its number is KY354574.

<400> 22

<210> 23

<211> 330

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(330)

<223> The light chain variant region of human monoclonal antibody 16-3-4D immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354575.

<400> 23

<210> 24

<211> 333

<212> DNA

<213> Artificial sequence

<220>

<222> (1)..(333)

<223> The light chain variant region of human monoclonal antibody 17-2-12A immunoglobulin IgG. The selection of the light chain variant region of human immunoglobulin IgG is completed according to the method described in the "Production of Human Monoclonal Antibody" unit of the method. This artificial sequence has been stored in the gene bank, and its number is KY354576.

<400> 24

Claims (4)

A human anti-Enterovirus 71 monoclonal antibody, selected from the immunoglobulin G human B cell immunoglobulin variable region gene of patients infected with Enterovirus 71; the heavy chain of the antibody variable region gene and the corresponding light The chain expression sequence is 16-2-2D (heavy chain SEQ ID NO: 8, light chain SEQ ID NO: 20). The human anti-Enterovirus 71 monoclonal antibody of claim 1, wherein the sequence 16-2-2D can neutralize the enterovirus 71 genotype of B4, B5, C4 or C5. The human anti-Enterovirus 71 monoclonal antibody of claim 1, wherein the sequence 16-2-2D can identify the canyon northern rim of the enterovirus 71 virus shell. The human anti-Enterovirus 71 monoclonal antibody of claim 1, wherein the gene of the human anti-Enterovirus 71 monoclonal antibody can be cloned into a vector or host cell of Escherichia coli.

Images