TWI694153B - Method and kit for visualization molecular diagnostic - Google Patents

Abstract

The present invention provides a method for visualization molecular diagnostic, comprising the steps of: (a) mixing a first solution containing a target DNA sequence and a first reagent for amplifying the target DNA sequence by recombinase polymerase amplification, wherein the first reagent comprises a pair of primers which uses the target DNA sequence as an amplifying target sequence; (b) adding a second reagent containing a gold nanoparticle probe (AuNP probe) to the first solution such that the amplified target sequence and the AuNP probe are hybridization, wherein the AuNP probe has a sequence complementing to an internal region of the target sequence; and (c) adding a third reagent to the first solution to trigger the aggregation of the AuNP probe in the first solution and to visualize a color, and identifying the concentration of the target DNA sequence by visual discriminating between the different colors. A kit for visualization molecular diagnostic also provided.

Description

Visualized molecular diagnosis method and test set

The invention relates to a molecular diagnosis method and a test set, in particular to a visualized molecular diagnosis method and a test set.

Visual inspection of plant tissue symptoms is the most direct way of disease diagnosis. However, this traditional method must rely on an experienced pathologist, and cannot be diagnosed visually at the early stage of infection without symptoms. In view of the fact that early detection is particularly important in the management of plant disease risks, especially plant quarantine and healthy seedling cultivation (Miller et al., 2009). Many molecular biotechnological methods have been widely used in the diagnosis of plant diseases, including immunology (nucleic acid) method and nucleic acid (nucleic acid) method, to detect the pathogen protein and nucleic acid in plants, to replace the traditional methods of observation and cultivation of pathogens (López et al., 2003).

Immunological methods, such as enzyme-linked immunosorbent assay (ELISA) and lateral flow (LF), can be used to detect pathogenic antigens and have been developed into portable equipment. These methods rely on the specificity of monoclonal antibodies, so the sensitivity often varies with different races (Nolasco et al., 2002).

The nucleic acid method generally refers to polymerase chain reaction (PCR), which first amplifies pathogen-specific gene fragments, and then observes the amplified fragments by gel electrophoresis. Due to its high sensitivity, various nucleic acid methods have been widely used for the detection of plant pathogens (Lievens et al., 2006; López et al., 2003; Schaad and Frederick, 2002).

Overall, nucleic acid methods have higher accuracy, specificity, and sensitivity than immunological methods, but the operation of nucleic acid methods needs to completely rely on the laboratory's professional technology and instruments, becoming a limiting factor for the development of portable molecular diagnostics (Fang and Ramasamy, 2015; Khater et al., 2017).

Although the combination of isothermal nucleic acid amplification technology and biosensor can solve the respective drawbacks of immunological methods and nucleic acid methods, however, the current relatively simple implementation of recombinase polymerase amplification ( Recombinase polymerase amplification (RPA) technology as an example, if the RPA amplicon (amplicon) is not first purified by PCR cleanup column, it is not suitable for agarose (agarose) gel electrophoresis for detection, or additional design Probes, enzymes, lateral flow strips and more operations are required to detect RPA amplicons. Therefore, how to detect RPA amplicons simply and effectively is the current goal of developing rapid and sensitive diagnostic techniques.

In view of this, in order to solve the above problems, the main object of the present invention is to provide a visual molecular diagnostic method, the steps of which include: (a) a first solution containing a target DNA sequence and a recombinase polymerase amplification reaction (RPA) a first reagent is mixed to amplify the target DNA sequence, wherein the first reagent includes a primer pair of a forward primer and a reverse primer, and the primer pair uses the target DNA sequence as a Target sequence; (b) add a second reagent with a nanogold probe to the first solution, the nanogold probe has a sequence complementary to an internal region of the target sequence, so that A hybrid reaction occurs between the target sequence after amplification and the nano gold probe; and (c) adding a third reagent to the first solution to trigger the nano gold probe in the first solution The needles gather and show a color visible to the naked eye, and the concentration of the target DNA sequence is judged by the color.

In a preferred embodiment, the third reagent is a mixture of hydroxylamine (NH ₂ OH) and tetrachloroauric acid (HAuCl ₄ ).

In a preferred embodiment, the mixing ratio of the hydroxylamine (NH ₂ OH) and the tetrachloroauric acid (HAuCl ₄ ) is 1:0.5 to 1:2.

In a preferred embodiment, the target DNA sequence is a highly reserved sequence.

In a preferred embodiment, the nano gold probe carries a 5'-modified sulfhydryl group (C ₆ SH).

In a preferred embodiment, the color exhibits a gradual change of pink, magenta, purple, indigo, navy blue, or dark blue according to the concentration of the target DNA sequence from low to high.

In a preferred embodiment, a step of pre-colorimetric concentration establishment is performed before step (a): (a-1) The nanometer is added to a solution of single-stranded DNA containing different specific concentrations of the target DNA sequence Gold probe, which causes the hybridization reaction between the nanometer gold probe and the single stranded DNA, and further adding hydroxylamine (NH ₂ OH) and tetrachloroauric acid (HAuCl ₄ ) to the solution to make the nanometer gold probe The needles gather and exhibit a color that is visible to the naked eye to establish a colorimetric gradient system with a target DNA sequence series concentration and one of the nanogold probe aggregation colors.

In a preferred embodiment, the recombinase polymerase amplification reaction (RPA) in step (a) is performed in an environment greater than 30°C for more than 5 minutes and less than 50 minutes.

In a preferred embodiment, the recombinase polymerase amplification reaction (RPA) in step (a) is performed at 33°C for 10 minutes.

Another object of the present invention is to provide a visual molecular diagnostic test kit, which includes: a first reagent, a primer pair including a forward primer and a reverse primer, and an RPA reagent, the primer pair is a target DNA As a target sequence, a recombinase polymerase amplification reaction (RPA) is performed; a second reagent with a nanogold probe, the nanogold particle carries a sequence complementary to an internal region of the target sequence, the The color of the nano gold probe in a solution is gradually changed from pink to blue according to the degree of aggregation, and a third reagent is used to trigger the nano gold probe Aggregation reaction.

The visual molecular diagnosis method and test set of the present invention can not only shorten the reaction time of molecular diagnosis and simplify the operation steps, use combined recombinase polymerase amplification (RPA) and optical nanometer probe to detect pathogenic DNA, and further The optimization of the reaction conditions of the visual molecular diagnosis method allows the operator to directly observe the results as a qualitative and quantitative analysis of the pathogen without the assistance of colorimetric instruments under the condition of low equipment requirements, which is fast and simple, and can be widely Applied to the diagnosis and prediction of diseases.

The detailed description and technical content of the present invention will now be described in conjunction with the drawings. Furthermore, the drawings in the present invention are not necessarily drawn according to actual proportions for the convenience of explanation. The drawings and their proportions are not intended to limit the scope of the present invention, and will be described here first.

As referred to herein, "comprising or including" means not excluding the presence or addition of one or more other components, steps, operations, and/or elements. "About", "close" or "essentially" means having a value or range close to the allowable specified error to avoid being used by any unreasonable third party, illegal or unfair to understand the accuracy or absoluteness of the disclosure Value. "One" means that the grammatical object of the thing is one or more (ie, at least one).

The disclosure herein relates to a visual molecular diagnostic method. The steps include: (a) mixing a first solution containing a target DNA sequence with a first reagent for recombinase polymerase amplification reaction (RPA) to expand Increase the target DNA sequence, wherein the first reagent includes a primer pair of a forward primer and a reverse primer, and the primer pair uses the target DNA sequence as a target sequence; (b) will have a nano The second reagent of the gold probe is added to the first solution. The nano gold probe carries a sequence complementary to an internal region of the target sequence, so that the target sequence and the nano A hybrid reaction of the rice gold probe occurs; and (c) A third reagent is added to the first solution to trigger the nanometer probe in the first solution to gather and display a color visible to the naked eye, and to The color determines the concentration of the target DNA sequence.

The disclosure herein also relates to a visual molecular diagnostic test kit, which includes: a first reagent, a primer pair including a forward primer and a reverse primer, and an RPA reagent, the primer pair is targeted to a target DNA Sequence, a recombinase polymerase amplification reaction (RPA); a second reagent with a nanogold probe, the nanogold particle carries a sequence complementary to an internal region of the target sequence, the nanogold The color of the probe in a solution changes gradually from pink to blue according to the degree of aggregation, and a third reagent is used to trigger the aggregation reaction of the nanometer probe.

The term "visualization" as used herein refers to the qualitative or quantitative analysis of molecular diagnostics that can be directly performed by visual inspection (ie, naked eye interpretation and naked vision). Specifically, it does not require direct or indirect dependence on instruments, equipment, or auxiliary tools. The qualitative and quantitative analysis of molecular diagnosis can be carried out, etc. The aforementioned instruments especially refer to spectrophotometric instruments. However, it should be noted that the present invention is not limited to the need to exclude the use of instruments. In a preferred embodiment, the present invention can be further used in conjunction with instruments, for example, in combination with the present invention and an instrument for further analysis and identification.

The "gold nanoparticle probe (AuNP probe)" described in this article is a kind of biosensor, which can be used to distinguish the complementary DNA (cNDA) of wrong sequence pairing. It is composed of a DNA probe (that is, a sequence complementary to an internal region complementary to the target sequence) and a nano-gold particle, which is different from the conventional nano-gold particle system and antibody binding. The advantage of the present invention is that the nano gold probe of the present invention can achieve the effect of not responding as long as the two base pairs are different, which can greatly reduce the false positive rate of diagnosis. On the other hand, the optical properties of nano gold probes can not only identify DNA fragment sequences, but also can semi-quantitatively explain DNA concentration. The colorimetric detection of conventional nano gold probes mostly uses laminar flow strips or nano gold particles. It can be realized by the way of aggregation. Although the results can be observed with the naked eye without the need for additional equipment, there are still shortcomings such as accuracy, sensitivity and quantitative interpretation. The visual molecular diagnostic method of the present invention is different from the conventional nanometer gold Probe colorimetric method to further enhance the color rendering effect. In a preferred embodiment, the third reagent is used to trigger the aggregation of the nanoprobe in the solution. The third reagent is a mixture of hydroxylamine (NH ₂ OH) and tetrachloroauric acid (HAuCl ₄ ). The hydroxylamine is, for example but not limited to, hydroxylamine hydrochloride (H ₂ NOH). In another preferred embodiment, the third reagent is a mixture of hydroxylamine (NH ₂ OH) and tetrachloroauric acid (HAuCl ₄ ), and the hydroxylamine (NH ₂ OH) and the tetrachloroauric acid (HAuCl ₄ ) The mixing ratio is 1:0.5 to 1:2, such as but not limited to: 1:0.5, 1:0.6, 1:0.7, 1:0.8, 1:0.9, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2. In another preferred embodiment, the nano gold probe carries a 5'-modified sulfhydryl group (C ₆ SH).

The optical properties of the aforementioned nano-gold probe can make it exhibit a gradual color change according to the degree of aggregation of nano-gold particles. In a preferred embodiment, the degree of aggregation of the nanogold probe of the present invention (with nanogold particles) is affected by the hybridization reaction between it and the target sequence after amplification, according to the target The concentration of the DNA sequence changes from low to high, and the color shows a gradual change of pink, magenta, purple, indigo (or blue-violet), navy blue, or dark blue (as shown in Figure 2C). In a preferred embodiment, the target DNA sequence of the present invention is a highly reserved sequence.

The "recombinase polymerase amplification (RPA)" described in this article is a constant temperature amplification technique. In a preferred embodiment, the recombinase polymerase amplification reaction (RPA) in step (a) is performed in an environment greater than 30°C for more than 5 minutes and less than 50 minutes; the aforementioned temperature environment is, for example but not limited to, ：30.5℃, 31℃, 31.5℃, 32℃, 32.5℃, 33℃, 33.5℃, 34℃, 34.5℃, 35℃, 35.5℃, 36℃, 36.5℃, 37℃, 37.5℃, 38℃, 38.5 ℃, 39℃, 39.5℃, 40℃, 40.5℃, 41℃, 41.5℃, 42℃, 42.5℃, 43℃, 43.5℃, 44℃, 44.5℃, 45℃, 46℃, 47℃, 48℃, 49 ℃, 50 ℃, 51 ℃, 52 ℃, 53 ℃, 54 ℃ or 55 ℃; the foregoing action time is, for example and not limited to: 5 minutes, 7 minutes, 10 minutes, 12 minutes, 15 minutes, 17 minutes, 20 minutes, 22 minutes, 25 minutes, 27 minutes, 30 minutes, 32 minutes, 35 minutes, 37 minutes, 40 minutes, 42 minutes, 45 minutes, 47 minutes or 50 minutes. In a more preferred embodiment, the recombinase polymerase amplification reaction (RPA) in step (a) is performed at an environment of 31°C to 40°C for 5 to 35 minutes; the aforementioned temperature environment is, for example but not limited to: 31℃, 31.1℃, 31.2℃, 31.3℃, 31.4℃, 31.5℃, 31.6℃, 31.7℃, 31.8℃, 31.9℃, 32℃, 32.1℃, 32.2℃, 32.3℃, 32.4℃, 32.5℃, 32.6℃ 、32.7℃、32.8℃、32.9℃、33℃、33.1℃、33.2℃、33.3℃、33.4℃、33.5℃、33.6℃、33.7℃、33.8℃、33.9℃、34℃、34.1℃、34.2℃、34.3 ℃、34.4℃、34.5℃、34.6℃、34.7℃、34.8℃、34.9℃、35℃、35.1℃、35.2℃、35.3℃、35.4℃、35.5℃、35.6℃、35.7℃、35.8℃、35.9℃、 36℃、36.1℃、36.2℃、36.3℃、36.4℃、36.5℃、36.6℃、36.7℃、36.8℃、36.9℃、37℃、37.1℃、37.2℃、37.3℃、37.4℃、37.5℃、37.6℃ 、37.7℃、37.8℃、37.9℃、38℃、38.1℃、38.2℃、38.3℃、38.4℃、38.5℃、38.6℃、38.7℃、38.8℃、38.9℃、39℃、39.1℃、39.2℃、39.3 ℃, 39.4 ℃, 39.5 ℃, 39.6 ℃, 39.7 ℃, 39.8 ℃, 39.9 ℃ or 40 ℃; the foregoing action time is for example but not limited to: 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 Minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes or 35 minutes. In a more preferred embodiment, the recombinase polymerase amplification reaction (RPA) in step (a) is performed at 33°C for 10 minutes.

The "colorimetric gradient system" described herein is a step for establishing a colorimetric concentration, and refers to a step independent of the visual molecular diagnostic method of the present invention, which can be established before, after, or simultaneously with the operation of the visual molecular diagnostic method. In a preferred embodiment, a pre-colorimetric concentration establishment step is performed before step (a) of the visual molecular diagnostic method of the present invention: (a-1) a single strand containing the target DNA sequence at different specific concentrations Add the nano gold probe to the DNA solution to make the nano gold probe hybridize with the single strand of DNA, and further add hydroxylamine (NH ₂ OH) and tetrachloroauric acid (HAuCl ₄ ) to the solution ) To make the nanogold probe aggregate and display a color that is visible to the naked eye, so as to establish a colorimetric gradient system of the target DNA sequence series concentration and one of the nanogold probe aggregate colors.

Hereinafter, the present invention will be further described with detailed descriptions and implementations. However, it should be understood that these implementations are only used to help understand the present invention more easily, not to limit the scope of the present invention. Please refer to "Figure 1" to "Figure 7" below. [Example]

In order to achieve the goal of shortening the reaction time and simplifying the operation steps to detect various types of pathogenic DNA, the present invention uses the technology of combining recombinase polymerase amplification (RPA) and optical nanometer probes, and achieves low equipment requirements The results can be directly observed with the naked eye to optimize the reaction conditions of the visual molecular diagnostic technology. A. Materials and methods (1) Target DNA extraction

The pathogen used in this embodiment is Tomato yellow leaf-curl virus (TYLCV), which can infect tomatoes and Solanum plants and cause serious economic losses, to carry out the visual molecular diagnosis method and visualization of the present invention Molecular diagnostic kit test.

Healthy tomato seedlings are planted in an insect-free net room, and then put into silver leaffly ( Bemisia tabaci biotype B) with TYLCV for a week. Viral DNA was extracted from tomato leaves infected with TYLCV through the Plant DNA Extraction Reagent Kit (Gene-Spin ^TM Genomic DNA Isolation Kit, supplier: Post Biotech Co., Ltd., Taipei, Taiwan). Plasma DNA was extracted from E. coli (TOP10 strain, supplier: Thermo Fisher Scientific Inc., Massachusetts, USA) containing liquid fragments of TYLCV isolates 82-2-1 and 57-2 DNA fragments. (2) Primer pair design and traditional PCR analysis

Using 56 Taiwan TYLCV isolates collected by Tsai et al. (2011) , multiple sequence alignment analysis was performed using software JalView version 2.10.3 (Waterhouse et al., 2009). Based on the results of multiple sequence alignment analysis, a highly reserved sequence region was identified as the target DNA sequence and designed to identify the TYLCV specific primer pair 1/2R (5'-GGATTAGAGGCATGAGTACA-3' (SEQ ID NO: 1) / 5 '-GGATTAGAGGCATGAGTACATGCCATATA-3' (SEQ ID NO: 2)) to serve as a primer pair using the target DNA sequence as a target sequence, and the primer pair includes a forward primer and a reverse primer, and entrusted Taipei, Taiwan Synthesized by Mingxin Biotechnology Co., Ltd.

10 μL of conventional PCR contains 5 ng to extract the target DNA sequence, a thermostable polymerase premix set (1x Taq DNA Polymerase Master Mix RED, supplier: Ampliqon, Odens, Denmark) and 0.1 μM of the primer pair 1/2R, Perform the thermal cycling procedure in the thermal cycler Labcycler (supplier: SensoQuest, Göttingen, Germany), first perform DNA denaturation at 95 °C for 5 minutes, and then enter 95 °C for 30 seconds and 55 °C for 30 seconds And 30 cycles of 72 °C for 30 seconds, and finally extended 72 °C for 10 minutes. In order to analyze its sensitivity, various prepared DNA concentrations of TYLCV isolate 82-2-1 were sequentially subjected to PCR reactions, from ¹⁰⁹ viruses to 1 virus per microliter. Finally, 10 μL of amplicon was analyzed by 1.5% agarose gel electrophoresis. (4) Sequencing of gene fragments and design of nano gold probes

Conjugate traditional PCR amplicons into pCR ^TM 2.1-TOPO ^® vector (TOPO ^® TA Cloning ^® Kit; supplier: Thermo Fisher Scientific Inc., Massachusetts, USA) and send to sequencing (Mingxin Biotechnology Co., Ltd. Company, Taipei, Taiwan). It was found that traditional PCR amplicons from different samples and TYLCV isolates contained the target DNA sequence, and the target DNA sequence had a highly preserved sequence.

The above-mentioned traditional PCR amplicon with a highly preserved sequence is designed to have a sequence complementary to an internal region of the target sequence, and this sequence is a DNA probe conjugated to nano gold to form a nano gold probe needle. The nano gold probe has a 5'-terminal modified thiol group (C ₆ SH, 5'-thiol-(TATCGTGTTAATAATTATGT)-3', SEQ ID NO: 3). At the same time, an artificial cDNA complementary to the DNA probe (5'-ATGGTTCTCGTACTTCCCAGCTTCCTGGTGATTGTAAACTACATAATTATTAACACGATA-3' (SEQ ID NO: 4), Mingxin Biotechnology Co., Ltd., Taipei, Taiwan) was designed and synthesized. (5) Preparation of nanometer gold probe and establishment of colorimetric assay method

Nano gold solution was purchased from a supplier (TANBead ^® NanoGold-13, Taiwan Dot Nano Technology Development Co., Ltd., Taoyuan, Taiwan), and the particle size used in this example was 13 nm. Adjust the concentration of the nanometer gold probe to 50 nM with pure water, then store in a refrigerator at 4 °C until use.

Add 1 μL of 50 nM nanometer gold probe (ie the second reagent) to 100 μL of the first solution containing the target DNA sequence in 15 μL of 3M sodium chloride (NaCl) for colorimetric detection. 50 pM to 10 μM artificial complementary ssDNA solution. After the mixture of the DNA sample and the nano gold probe was allowed to act at 95 °C for 5 minutes, a third reagent was added. The third reagent included 1.5 μL of 400 mM hydroxylamine hydrochloride (H ₂ NOH) and 1.5 μL. 25 mM tetrachloroaurate III (hydrogen tetrachloroaurate III, HAuCl ₄ , supplier: Sigma-Aldrich, USA), and thoroughly mixed. After about 30 seconds of reaction, the nano-gold particles can grow into various visible colors. Finally, the UV/vis spectra of the nanoparticle solution was analyzed with a spectrophotometer (Nano-Drop 2000, supplier: Thermo Fisher Scientific Inc., Massachusetts, USA). (5) Recombinase polymerase amplification (RPA) and nanometer colorimetric detection

Recombinase polymerase amplification (recombinase polymerase amplification, RPA) reaction is to use the reagent set TwistAmp ^® Basic Kit (TwistDX, Cambridge, UK), and make some adjustments according to the manufacturer's recommendations; contains 5 ng to extract the target DNA sequence and 480 nM The 20 μL RPA reactant of the primer pair was allowed to act at 39 °C for 30 minutes. The aforementioned mixture containing the primer pair and the RPA reagent group is called the first reagent. In order to establish the best conditions for RPA DNA detection, RPA reactants were reacted at 33 °C, 35 °C, 37 °C and 39 °C for 5 minutes, 10 minutes, 20 minutes and 30 minutes, respectively. In order to analyze the sensitivity of RPA, various DNA concentrations of TYLCV isolate 82-2-1 were sequentially subjected to RPA amplification reaction, from ¹⁰⁹ viruses to 1 virus per microliter, and then acted at 33 °C for 10 minute. Finally, by 1.5% agarose gel electrophoresis, it was verified that 4 μL of the RPA amplicon had the target DNA sequence, and the remaining 10 μL of the RPA amplicon was used for the subsequent nanometer colorimetric detection.

Mix 3.5 μL of 50 nM nanoprobe (ie the second reagent) in 10 μL of RPA amplicon, which is the first solution containing the target DNA sequence, and then act at 95 °C for 5 minutes for visualization Molecular diagnosis. Subsequently, a third reagent was added, which contained 1 μL of 200 mM hydroxylamine hydrochloride (H ₂ NOH) and 1 μL of 25 mM tetrachloroauric acid (HAuCl ₄ , supplier: Sigma-Aldrich, USA) and mixed thoroughly. After about 30 seconds, you can see the nano gold particles grow into various visible colors. Finally, record the image and UV/Vis spectrum of the nanoparticle solution. B. Results (1) Visual molecular diagnostic design

In addition to the extraction step of total DNA, the visual molecular diagnostic method can be divided into three steps to perform three-stage reaction, namely (a) recombinase polymerase amplification, (b) nanoprobe hybridization reaction And (c) Visualize DNA signal amplification and observation.

The reaction in step (a) is the first-stage reaction, which is to add a first solution of 1 μL tomato full-extracted DNA containing the target DNA sequence to 9 μL of the first reagent, which is used to proceed RPA amplifies the target DNA sequence, and the first reagent contains a TYLCV specific amplification primer pair. The primer pair includes a forward primer and a reverse primer with the target DNA sequence as the target sequence. In a good reaction environment, that is, at a constant temperature of 33 °C for 10 minutes, the TYLCV gene fragment was specifically amplified. The use of specific amplification primer pairs can not only detect the presence or absence of pathogens, but also separate different isolates. In fact, at a constant and lower temperature and less reaction time, RPA is as effective as traditional PCR. Using RPA not only saves time and effort, but also has low requirements for equipment and expertise.

The reaction in step (b) is a second-stage reaction, which is to directly add the second reagent of 3.5 μL of the nanometer gold probe to the first solution that completes the reaction of the aforementioned step (a) and mix it thoroughly, the nanometer gold The probe carries a sequence complementary to an internal region of the target sequence, and the target DNA sequence (i.e. the target sequence) is specifically amplified by the nanometer probe and TYLCV at 95 °C for 5 minutes. )'S high stringency hybridization.

Subsequently, the reaction in step (c) is a third-stage reaction. A third reagent is added to the first solution that completes the reaction in step (b) above, and the third reagent includes hydroxylamine (NH ₂ OH, 200 mM) and 1 μL each of tetrachloroauric acid (HAuCl ₄ , 12.5 mM), after being thoroughly mixed, triggers the aggregation of the nanoprobe in the first solution and presents a color visible to the naked eye.

In the second-stage reaction of the aforementioned step (b), after the target DNA sequence amplified fragment is denatured at 95 °C, a single-stranded DNA (ssDNA) is formed first; When the sequence (DNA) is a complementary nucleic acid sequence, the single-stranded DNA that amplifies the target DNA sequence recombines with the sequence DNA fragment on the nanoprobe to form a double-stranded helix DNA. After recombination with the complementary single-stranded DNA (complementary ssDNA) with different amplification amounts and different sequence similarities, the nanometer gold probe will generate (or call for aggregation) nanometer gold particles of different sizes and shapes, and have different colors and UV/Visible spectrophotometry, this feature shows that although it can be judged by the naked eye whether the target DNA is present, that is, the qualitative diagnosis of the initial screening of the pathogen, the color change of the nanoparticles at this stage is not obvious, and it depends on the colorimetric instrument (For example, spectrophotometer) Only with assistance can quantitative interpretation of cDNA concentration be achieved. Then, by triggering the aggregation of the nanometer gold probe through step (c) to amplify the visualized DNA signal, without the assistance of colorimetric instruments, the qualitative and quantitative analysis of the pathogen can be performed simultaneously by direct observation of the naked eye, which is fast and simple.

Further, the visual molecular diagnosis method of the present invention can also combine different analysis steps and equipment, and can perform molecular diagnosis quickly and simply without the need of precise instruments and special medicines; it can also be applied to field, field, hospital and other first Line disease diagnosis. (2) The applicability of nanometer probes for visualizing molecular diagnosis

The visual molecular diagnosis method and test set of the present invention can design and identify amplicons and nanoprobes for different diseases (or detection targets) according to needs. FIG. 1 shows a comparison of the specificity of TYLCV DNA markers according to a preferred embodiment of the present invention, wherein the trace P in FIGS. 1B and 1C is the reference isolate 82-2-1 of TYLCV, and traces 1 to 6 are each TYLCV Infect plants (or specimens 1 to 6). In this embodiment, a novel identification TYLCV primer pair is designed to meet the needs of RPA response. Compared with traditional primer pairs, its length is short, with high sensitivity and high accuracy (as shown in FIG. 1A). Based on the amplified nucleotide sequences of different susceptible tomato plants and TYLCV isolates, a DNA probe sequence that binds to nanoparticles was designed (as shown in Figure 2B). At the same time, design and synthesize the complementary ssDNA of the same nucleotide sequence as the TYLCV identification amplicon to verify the hybridization effect of the target amplified fragment and the nanoprobe (as shown in FIGS. 2A to C).

In order to establish the effectiveness and sensitivity of the nano gold probe to detect the target DNA sequence, cDNAs of different concentrations were sequentially hybridized with the nano gold probe. The color of the nanogold probe (including nanogold particles) solution obviously changed from pink to dark blue, navy blue, indigo, purple, purple and light purple, representing cDNA concentrations of 10, 5, 1, 0.5 respectively , 0.1 μM to 50 nM. When the cDNA concentration is lower than 10 nM, the color of the nano-gold particles is not obvious, and even precipitates appear in the reaction below 0.5 nM (as shown in FIG. 2C). The foregoing results show that TYLCV identification is feasible using the visual molecular diagnostic method and test kit of the present invention for visual colorimetric detection. In addition, the color change of the nanometer probe in the present invention can be used as a quantitative interpretation of cDNA concentration. In addition, unlike the prior art, the target DNA sequence of this example uses a long cDNA (60 nt) that is similar to the actual DNA identification and the nanoprobe (20 nt) for hybridization. It is worth noting that the results of this example show that a longer cDNA can affect the aggregation of nano gold probes, which in turn produces a larger amount of color change. Due to the better linear distribution relationship between color and cDNA concentration, the nanogold probe aggregation reaction is more suitable for visual observation. (3) Optimized conditions for recombinase polymerase amplification reaction

According to the recommendations of the manufacturer of the reagent kit TwistAmp ^® Basic Kit, the optimal conditions for the RPA reaction are 20 to 40 minutes at a constant temperature (37-39 °C), and the RPA amplification products at 39 °C for 40 minutes are obvious More than traditional PCR (as shown in Figure 3A). However, in general, RPA can still operate normally at 25 to 45 °C, and the reaction time varies more. Therefore, in order to save time and manpower, the present invention further seeks the best RPA reaction conditions for visualizing molecular diagnosis.

In this example, the RPA reactants were placed in an environment of 33°C, 35°C, 37°C, or 39°C for 5 minutes, 10 minutes, 20 minutes, and 30 minutes, respectively, that is, repeating the foregoing with different reaction conditions. Step (a). According to the analysis results of gel electrophoresis, the 30-minute RPA amplification reaction has the maximum yield at 37 °C and the minimum yield at 33 °C. In addition, according to the effects of various times, it was shown that under the action of 10 minutes, the RPA amplification reaction can reach the lower limit of electrophoretic detection (as shown in FIG. 3B).

Subsequently, a nanogold colorimetric test (ie, the aforementioned steps (b) and (c)) is performed to understand whether the lowest detectable condition of the RPA reaction is suitable for binding to the nanogold probe. The colors of nanogold solutions hybridized with various RPA reactions are purple, blue-purple, and navy blue, respectively, representing reaction temperatures of 33, 35, 37 to 39 °C. Even the electrophoretic analysis of the RPA amplicon showed that the colorimetric detection results of low-level electrophoretic bands (10 minutes) and unclear electrophoretic bands (5 minutes) were purple. Overall, the color of the nanoparticles detected by various RPA reactions is similar to artificial ssDNA of various concentrations (see Figure 3C). The above results show that the effective detection condition of the RPA reaction is that it can be used for 10 minutes at 33 °C, which can only change the TYLCV template with only 1 copy/μL from the pink nanoparticle probe solution to a pale purple. . (4) Sensitivity detection of visual molecular diagnosis

In order to further clarify the operational limit of the visual molecular diagnosis method and the test kit of the present invention, the sensitivity of detecting the molecular diagnosis of pathogens is of great significance. In this embodiment, by detecting different DNA template concentrations of the isolate 82-2-1, a colorimetric gradient system of a series concentration of the target DNA sequence and one of the aggregation colors of the nanometer probe is established to compare the sensitivity of RPA and traditional PCR .

Fig. 4 shows the molecular (DNA) diagnostic sensitivity test of TYLCV by conventional PCR and RPA of the present invention. According to the results of gel electrophoresis analysis, the amplification effects of PCR and RPA are positively correlated with the template concentration (R ² = 0.9438 and 0.8909). Evident from the results found, RPA (1 copy / μL) of the present invention, the ratio of PCR (10 ⁶ copies / μL) sensitivity 100 times (shown in FIG. 4A to 4D), as shown in FIG. 5 through quantitative PCR ( quantitative PCR, qPCR) TYLCV molecular (DNA) diagnostic sensitivity test, the results show that the detection time of the method of the present invention is also shorter than qPCR (as shown in Figure 5A and Figure 5B), and in 20 minutes equivalent to 20 After the cycle program, TYLCV of 1 copy/μL can be detected.

Then, through the color and ultraviolet/visible spectrum of the nano gold probe solution to understand the sensitivity of the nano gold probe to detect the RPA amplicon (including the target DNA sequence). As shown in FIG. 6A, at a specific range of template concentrations, the color of the nanoprobe detected by the RPA amplicon obviously changed from pink (NTC) to purple (1-10 ³ copies /μL), purple (10 ⁴ -10 ⁵ copies/μL), blue-purple (10 ⁶ -10 ⁷ copies/μL) and navy blue (10 ⁸ -10 ⁹ copies/μL). As shown in FIG. 6B, the color and spectral absorption peak of the nano-gold probe changed from pink (530 nm, A530) to blue (570 nm, A570), showing a blue shift phenomenon. The absorbance ratio R (A570/A530) collected by the nanometer gold probe accurately clarifies the relationship between the color and the concentration of the series (ie, template concentration). The results showed that there was a linear distribution relationship between the absorbance ratio R and the concentration of the series (R ² = 0.9239). As shown in Figure 6C, the visual molecular diagnosis could detect 1 copy/μL of TYLCV. When the amount of virus reached 10 ⁶ copies/μL At this time, the nano gold probe gathers and exhibits a rich color. (5) Reliability assessment of visual molecular diagnosis

Pathogen nucleic acid extraction is often accompanied by a large amount of host genomic DNA (gDNA), because the concentration of pathogen nucleic acid is diluted by a large amount of host gDNA, which affects the molecular diagnosis of the pathogen. For this reason, this embodiment verifies the reliability of visual molecular diagnosis by examining tomato disease plants with different symptoms.

First, seven plants infected with TYLCV were confirmed by conventional PCR (see Figure 1B and Figure 1C) and nucleotide sequencing (see Figure 1A). The RPA reactions of these infected specimens were then tested by gel electrophoresis, colorimetric detection, and absorbance ratio R (A570/A530). The results are shown in FIGS. 7A to C.

The results of gel electrophoresis showed the amount of virus in the sample, but there was no significant difference between the samples with higher virus amount. Specifically, the nano-gold color of the healthy-looking specimen 1 is purple, while the severely ill specimens 2 to 7 and the reference isolate 57-2 are purple-blue or blue-purple.

The results show that specimens 2 to 6 have been severely damaged, and the NTC absorbance ratio R (A570/A530) is 0.79. The absorbance ratio R can clearly indicate that the virus content of specimen 1 ( R = 0.95) has 10 copies /μL ( R = 0.94), while the amount of virus in sample 2 ( R = 1.55) was 10 ⁹ copies/μL ( R = 1.31). All the test results showed that the aggregation of the nano-probe with the high amount of virus showed a rich color, namely blue or blue-violet, and a high absorbance ratio R (> 1). The sample 7 exhibits an extremely high absorbance ratio, which may be due to the phenomenon of nano-gold particle precipitation, which further interferes with the absorbance. In addition, the discrimination isolate 57-2 (single nucleotide polymorphism, SNP) containing single nucleotide polymorphism (SNP) (as shown in Figure 2A) under high template concentration ( ¹⁰⁹ copies/μL) conditions Although the color and absorbance ratio R of the needle solution is weak, the diagnostic result of the SNP specimen is still discriminatory. Overall, the colorimetric measurement diagnosis results and absorbance ratio of the visual molecular diagnostic method and test kit of the present invention are consistent, showing that the visual molecular diagnostic method and test kit of the present invention can indeed be applied to the diagnosis and quantification of pathogenic DNA The detection is particularly applicable to the molecular (DNA) diagnosis of TYLCV and the quantitative detection of the amount of virus.

This example demonstrates that the visual molecular diagnostic method and test kit of the present invention can amplify and detect DNA by a quick and simple procedure, and still maintain high sensitivity. The invention realizes the RPA reaction operating at a low temperature and a short time to achieve a time-saving and labor-saving DNA amplification method, and distinguishes RPA amplicons through a biosensor nano-gold probe to produce nano-gold probe solutions of various colors. , Namely fuchsia, purple, blue-purple and navy blue. The overall operation process takes only 20 minutes, and the equipment requirements are extremely low. The results using TYLCV as a preferred embodiment show that the visual molecular diagnostic method of the present invention is faster and more sensitive than traditional PCR and qPCR. In particular, the virus volume of 1 copy/μL and the disease-free strains with virus can still be detected, which improves the traditional lack of visual diagnosis of diseases; meanwhile, the qualitative and quantitative analysis of viruses can be performed by observing the color of the solution. In addition, according to the reliability evaluation results in the examples, it is known that the visual molecular diagnosis method and test kit of the present invention are not interfered by plant genomic DNA, and can clearly detect viruses in susceptible plants. Based on the above advantages, the present invention can be directly applied to health monitoring in the field, in the field, in hospitals, etc. Since only simple operation procedures and medicines are needed, the present invention can also be combined with a microfluidic system to realize multiplex and singleplex diagnosis.

In summary, the visual molecular diagnosis method and test kit of the present invention can not only shorten the reaction time of molecular diagnosis and simplify the operation steps, but also use a combination of recombinase polymerase amplification (RPA) and optical nanometer probe to detect the pathogen DNA, and further optimize the reaction conditions of the visual molecular diagnosis method, so that the operator can directly observe the results as a qualitative and quantitative analysis of the pathogen with the naked eye without the assistance of colorimetric instruments under the condition of low equipment requirements, fast and simple , And can be widely used in the diagnosis and prediction of diseases.

The present invention has been described in detail above, but the above mentioned is only one of the preferred embodiments of the present invention, which cannot be used to limit the scope of implementation of the present invention, that is, any equivalent made according to the patent application scope of the present invention Changes and modifications should still fall within the scope of the patent of the present invention.

no.

Fig. 1 is a comparison of the specificity of TYLCV DNA markers according to a preferred embodiment of the present invention: A is a schematic diagram of the TYLCV genome structure, amplicons and the position of the nanoprobe; B is the traditional identification primer pair PAR1c715H/TH1978, The length of the amplified fragment is 1280 bp; and C is the novel identification primer pair 1/2R of the present invention, and the length of the amplified fragment is 158 bp.

FIG. 2 is a design of a nanometer probe according to a preferred embodiment of the present invention: A is a sequence diagram of target sequences amplified from different TYCLV-infected plants and reference isolates, wherein the reference isolate 57-2 is located at the 61st A single nucleotide polymorphism (SNP) (A/G) is carried at each base; B is the DNA ratio through the nano-probe that complementary hybridizes with the complementary amplicon containing the target sequence Schematic diagram of color diagnosis; and C is a colorimetric chart of sensitivity test of nanometer probe hybridized with specific human sex cDNA.

Figure 3 is a test result of RPA optimization conditions of a preferred embodiment of the present invention: A is a comparison diagram of traditional PCR and RPA products; B is an amplification effect of 30 minutes of reaction at different RPA temperatures, and different at 33 ℃ The amplification effect of the RPA amplification time; C is the coloring result of the visual molecular diagnosis of the present invention reacting at different RPA temperatures for 30 minutes and at 33°C for different RPA amplification times.

FIG. 4 is a preferred embodiment of the present invention for performing the molecular (DNA) diagnostic sensitivity test of TYLCV through traditional PCR and RPA: A is a correlation analysis diagram between the amount of traditional PCR amplicons and template concentration; B is 10 Gel electrophoresis of conventional PCR amplicons with a loading volume of μL; C is a correlation analysis diagram between the amount of RPA amplicons and template concentration; D is a gel electrophoresis diagram of RPA amplicons with a loading volume of 4 μL ; In the figure, NTC means no template control, the error bar represents ± SE, and the number of samples n = 4.

Fig. 5 is a preferred embodiment of the present invention to perform molecular diagnostic sensitivity test of TYLCV through qPCR: A is the amplification curve of different template concentrations; B is the correlation between threshold cycle ( C _T ) and template concentration diagram.

FIG. 6 is a preferred embodiment of the present invention using a reference isolate to perform the sensitivity test of the visual molecular (DNA) diagnostic method of the present invention: A is a colorimetric chart; B is derived from an RPA amplicon at a series of template concentrations The absorption spectrum of the nano gold probe aggregation solution, q in the figure represents the absorption peak of each nano gold probe aggregation solution; C is the correlation analysis chart between the absorption rate R (A570/A530) and the template concentration; in the figure, NTC means no template control, the error bar represents ± SE, and the number of samples n = 4.

7 is a preferred embodiment of the present invention using an infected plant to perform the reliability assessment of the visual molecular diagnostic method of the present invention: A is a gel electrophoresis diagram of the RPA reaction; B is a colorimetric diagram using the method of the present invention; C is a bar graph of the absorption rate R (A570/A530) of the aggregation solution of nanometer gold probes derived from different TYLCV infected plants and the reference isolate 57-2.

no.

no.

Claims (9)

A visual molecular diagnostic method, the steps of which include: (a) mixing a first solution containing a target DNA sequence with a first reagent for recombinase polymerase amplification reaction (RPA) to amplify the target DNA Sequence, wherein the first reagent includes a primer pair of a forward primer and a reverse primer, and the primer pair uses the target DNA sequence as a target sequence; (b) a nano-probe The second reagent is added to the first solution, and the nano gold probe carries a sequence complementary to an internal region of the target sequence, so that the amplified target sequence and the nano gold probe A hybrid reaction occurs; and (c) a third reagent is added to the first solution to trigger the nanoprobe in the first solution to gather and display a color visible to the naked eye, and the color is used to distinguish the The concentration of the target DNA sequence; wherein, the nano gold probe carries a 5'-modified sulfhydryl group (C ₆ SH). The visual molecular diagnostic method as described in item 1 of the patent application scope, wherein the third reagent is a mixture of hydroxylamine (NH ₂ OH) and tetrachloroauric acid (HAuCl ₄ ). The visual molecular diagnosis method as described in item 2 of the patent application range, wherein the mixing ratio of the hydroxylamine (NH ₂ OH) and the tetrachloroauric acid (HAuCl ₄ ) is 1:0.5 to 1:2. The visual molecular diagnosis method according to any one of the items 1 to 3 of the patent application range, wherein the target DNA sequence is a highly reserved sequence. The visual molecular diagnostic method as described in item 1 of the patent application range, wherein the color exhibits a gradual change of pink, purple, purple, indigo, navy blue or dark blue from low to high according to the concentration of the target DNA sequence. The visual molecular diagnosis method as described in item 1 of the patent application scope, wherein a pre-colorimetric concentration establishment step is performed before step (a): (a-1) at a target DNA sequence containing different specific concentrations Add the nano-gold probe to the solution of single-stranded DNA to make the nano-gold probe hybridize with the single-stranded DNA, and further add hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) to the solution To make the nanogold probe aggregate and display a color that is visible to the naked eye, so as to establish a colorimetric gradient system of the target DNA sequence series concentration and one of the nanogold probe aggregate colors. The visual molecular diagnosis method as described in item 1 of the patent application scope, wherein the recombinase polymerase amplification reaction (RPA) in the step (a) is operated in an environment greater than 30°C for more than 5 minutes and less than 50 minutes . The visual molecular diagnostic method as described in item 7 of the patent application scope, wherein the recombinase polymerase amplification reaction (RPA) in the step (a) is performed at 33°C for 10 minutes. A visual molecular diagnostic test kit, including: a first reagent, a primer pair including a forward primer and a reverse primer, and an RPA reagent, the primer pair uses a target DNA as a target sequence, and performs a recombinase Polymerase amplification reaction (RPA); a second reagent with a nanogold probe, the nanogold particles carry a sequence complementary to an internal region of the target sequence, the nanogold probe in a solution The color in shows a gradual change from pink to blue according to the degree of aggregation, and a third reagent is used to trigger the aggregation reaction of the nanometer probe.

Images