TWI568853B - Method for genetic characteristics and individual identification in geese - Google Patents

Description

Genetic identification and individual identification method of goose

The present invention generally relates to a method for genetic characterization and individual identification of a goose. In particular, the invention relates to a method for the identification and individual identification of goose genetic traits using a microsatellite marker primer set.

Goose industry is one of the important agriculture in Taiwan. In the face of external competition, in addition to strengthening its own breeding management technology, it is necessary to strengthen breeding skills to cultivate more products that meet market demand. In terms of line breeding, with the continuous advancement of molecular biology, DNA molecular marker technology has been widely used as an important means of genetic analysis and breeding assistance.

The microsatellite marker is a molecular marker that has been applied in many genetic studies, including gene mapping construction, ethnic structure analysis, individual identification and paternity identification, or traceability of biological invasion. . The microsatellite marker is a DNA sequence which is formed by concatenating a different number of units, and the unit size of the repeat may be a mononucleotide, a dinucleotide, or It consists of five pentanucleotides and is widely distributed in the genome (Powell et al ., 1996, Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1:215-222.). Microsatellite markers are widely present in the genome of eukaryotic nuclei, and their repetitive fragments are numerous and variable in number of repeats. Therefore, they are highly polymorphic. In addition, the flanking regions at both ends of the microsatellite marker have homologous properties and high sequence retention (Oliveira et al ., 2006, Origin, evolution and genome distribution of microsatellites.Genet.Mol.Biol). .29:294-307.), applicable to polymorphism analysis of genus species (Jia et al ., 2013, Characterization and cross-species amplification of 11 polymorphic microsatellite loci in Liobagrus marginatoides. Conserv.Genet .Resour.5:1087-1089;Parine et al .,2013,Characterization and cross-species amplification of microsatellite markers in African Silverbill ( Lonchura cantans).Genet.Mol.Res.12:5634-5639.), even just Family species (Kryger et al ., 2002, Isolation and characterization of six polymorphic microsatellite loci in South African hares ( Lepus saxatilis F. Cuvier, 1823 and Lepus capensis Linnaeus, 1758). Mol. Ecol. Notes 2: 422-424.).

At present, there is no suitable commercial set of goose microsatellite logos in Taiwan for individual genetic analysis or ethnic genetic structure analysis of goose breeding grounds. Therefore, there is an urgent need to develop microsatellite markers for the goose population in Taiwan.

The invention provides a novel microsatellite marker primer pair group for the genetic characterization and individual identification of goose. The microsatellite marker introduces a high polymorphism of the microsatellite markers selected by the group and can be used as an analysis of the genetic characteristics of different ethnic groups of geese, for example, distinguishing ethnic genetic structure differences, individual discrimination rates or parental exclusion Analysis of the rate.

In one aspect, the present invention provides a method for genetic characterization and individual identification of goose, the method comprising: (i) providing a blood sample of a goose to be detected, and extracting the genomic DNA in the blood sample; (ii) detecting the genomic DNA of the goose with at least one set of microsatellite primer primer pairs; wherein the microsatellite primer primer pair is selected from the group consisting of: (1) a nucleoside having SEQ ID NOS: 1 and 2, respectively a first primer pair of the acid sequence; (2) a second primer pair having the nucleotide sequences of SEQ ID NOS: 3 and 4, respectively; (3) a nucleotide sequence having SEQ ID NOS: 5 and 6, respectively a third primer pair; (4) a fourth primer pair having the nucleotide sequences of SEQ ID NOS: 7 and 8, respectively; (5) a nucleotide sequence having SEQ ID NOS: 9 and 10, respectively. a fifth primer pair; (6) a sixth primer pair having the nucleotide sequences of SEQ ID NOS: 11 and 12, respectively; (7) a seventh primer having the nucleotide sequences of SEQ ID NOS: 13 and 14, respectively. (8) an eighth primer pair having the nucleotide sequences of SEQ ID NOS: 15 and 16, respectively; (9) a ninth primer pair having the nucleotide sequences of SEQ ID NOS: 17 and 18, respectively; (10) a tenth primer pair having the nucleotide sequences of SEQ ID NOS: 19 and 20, respectively; (11) an eleventh pair of primers having the nucleotide sequences of SEQ ID NOS: 21 and 22, respectively; 12) A core having SEQ ID NOS: 23 and 24, respectively a twelfth primer pair of the acid sequence; (13) a thirteenth primer pair having the nucleotide sequences of SEQ ID NOS: 25 and 26, respectively; (14) a nucleoside having SEQ ID NOS: 27 and 28, respectively a fourteenth primer pair of the acid sequence; and a group consisting of the combinations; (iii) analyzing the genotype of the goose according to the test result of the step (ii) to evaluate the genetic characteristics and individual identification.

In some embodiments of the invention, the genotype DNA of the goose is detected with at least 8 sets of microsatellite primer pairs. In a particular embodiment, wherein the microsatellite marker pair is from a first primer pair to an eighth primer pair, a first primer pair to a ninth primer pair, or a first primer pair Fourteen pairs of pairs.

In one aspect, the present invention provides a kit for genetic characterization and individual identification of goose, comprising one or more sets of microsatellite markers introduced to detect the genomic DNA of the goose to obtain the goose to be detected. a genotype; wherein the microsatellite primer pair is selected from the group consisting of a first primer pair to a fourteen primer pair, and a combination thereof.

In a specific embodiment of the present invention, the microsatellite marker primer pair for the genetic characterization and individual identification of the goose is a pair of first primer pairs to a fourteenth primer pair.

In another aspect, the present invention provides a microsatellite marker primer pair for genetic identification and individual identification of a goose, wherein the microsatellite primer pair is a pair of first primer pairs to a fourteenth primer pair.

In some embodiments, the microsatellite primer of the present invention has a fluorescent reagent attached to the 5' end of the microsatellite forward primer or the microsatellite reverse primer.

Detailed descriptions of various specific examples of the invention are given below. Other features of the present invention will be apparent from the following detailed description and claims.

Without further elaboration, it is believed that those of ordinary skill in the art of Therefore, it is to be understood that the following description is for illustrative purposes only and is not intended to limit the disclosure.

The reading of the drawings together with the accompanying drawings will be able to aid the understanding of the foregoing invention and the detailed description of the invention. The preferred figures and embodiments presented herein are for the purpose of illustrating the invention. It should be understood that the invention is not limited to the precise arrangements and manner shown.

Figure 1 shows the kinship of the ortho-joining method (NJ) obtained by each goose population using 14 sets of new microsatellite markers. Tie the tree. WR: White Roman Goose; WC: White Chinese Goose; BC: Brown Chinese Goose; H: Cross Goose; BS: Black Swan.

Figure 2 shows a principal component analysis (PCA) 3D plot of each goose population grouped with 14 new microsatellite markers. WR: White Roman; WC: White Chinese Goose; BC: Brown Chinese Goose; H: Cross Goose; BS: Black Swan.

Figure 3 shows a STRUCTURE cluster analysis (K=2~7) drawn by individual goose individuals using 14 new microsatellite markers. The K value is the number of clusters preset in the STRUCTURE analysis, representing different clusters in different colors. The vertical axis is the proportion of the individual's genes from the cluster, and each bar represents an individual. 1: White Roman; 2: White Chinese Goose; 3: Brown Chinese Goose; 4: Cross Goose; 5: Black Swan.

Figure 4 shows the phylogenetic tree of the orthodontic linkage (NJ) obtained by each individual goose using 14 new microsatellite markers. ●: White Roman Goose; : hybrid goose; △: white Chinese goose; : brown Chinese goose; :Black Swan.

Figure 5 shows a line graph of the individual identification rate (P _(ID) ) of each species of goose on the number of microsatellite markers.

Figure 6 shows a line graph of the number of close relatives (P _{(ID) sib} ) of various species of geese to the number of microsatellite markers.

Figure 7 shows the phylogenetic tree of the ortho-joining method (NJ) obtained by each individual goose using 5 sets of microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175). ●: White Roman Goose; : hybrid goose; △: white Chinese goose; : brown Chinese goose; :Black Swan.

Figure 8 shows the phylogenetic tree of the ortho-joining method (NJ) obtained by each individual goose individual using 7 sets of microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175, 5A26254, 5A5305-1). ●: White Roman Goose; : hybrid goose; : White Chinese Goose; : brown Chinese goose; :Black Swan.

Figure 9 shows the phylogenetic tree of the ortho-joining method (NJ) obtained by each individual goose individual using 8 sets of new microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175, 5A26254, 5A5305-1, 5A265141). ●: White Roman Goose; : hybrid goose; △: white Chinese goose; : brown Chinese goose; :Black Swan.

Figure 10 shows the phylogenetic tree of the ortho-ligation method (NJ) obtained by each individual goose individual using 9 sets of new microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175, 5A26254, 5A5305-1, 5A265141, 5A265151). ●: White Roman Goose; : hybrid goose; △: white Chinese goose; : brown Chinese goose; :Black Swan.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as the ones of ordinary skill in the art.

The singular forms "a", "an", "the" and "the" are used in the plural. Thus, for example, reference to "a component" includes a plurality of such elements and equivalents to those of ordinary skill in the art.

The "goose" used in this article is a human domesticated poultry, which originates from the wild Anser anser or Anser cygnoides . Anser anser domesticus includes, but is not limited to, White Roman, White Chinese, Brown Chinese, Embdem goose, Toulouse goose ), Shi Tou goose, Grimaud geese and hybrid geese.

The microsatellite markers for individual genetic analysis or ethnic genetic structure analysis of Taiwanese geese have not yet been fully elucidated. In the present invention, novel microsatellite markers are used to analyze genotype polymorphisms of goose, including white roman goose, white Genetic variation of Chinese geese, brown geese, hybrid geese and black swan Genetic characteristics such as heterosexuality, genetic distance, grouping, and individual discrimination rate.

In a specific embodiment of the present invention, the average expected heterogeneity, the observed heterogeneity, and the polymorphism information content of the genetic variation analysis results of the microsatellite markers all belong to a high polymorphism range, and the microsatellite markers are displayed. The analysis of the goose population is highly applicable. In another embodiment of the present invention, the genetic distance analysis results of the microsatellite markers clearly group the goose breeds, indicating that the microsatellite markers have good resolution in the difference detection of goose breeds. In addition, the microsatellite marker provided by the present invention also has a high individual discrimination rate.

Accordingly, the present invention provides a method for genetic characterization and individual identification of goose, the method comprising: (i) providing a blood sample of a goose to be detected, and extracting the genomic DNA in the blood sample; (ii) At least one set of microsatellite primer pairs detects the genomic DNA of the goose; wherein the microsatellite primer pair is selected from the group consisting of: (1) a nucleotide sequence having SEQ ID NOS: 1 and 2, respectively a pair of primers; (2) a second primer pair having the nucleotide sequences of SEQ ID NOS: 3 and 4, respectively; (3) a third primer having the nucleotide sequences of SEQ ID NOS: 5 and 6, respectively (4) a fourth primer pair having the nucleotide sequences of SEQ ID NOS: 7 and 8, respectively; (5) a fifth primer pair having the nucleotide sequences of SEQ ID NOS: 9 and 10, respectively; (6) a sixth primer pair having the nucleotide sequences of SEQ ID NOS: 11 and 12, respectively; (7) a seventh primer pair having the nucleotide sequences of SEQ ID NOS: 13 and 14, respectively; a ninth primer pair having the nucleotide sequences of SEQ ID NOS: 15 and 16, respectively; (9) a ninth primer pair having the nucleotide sequences of SEQ ID NOS: 17 and 18, respectively; (10) Minute Having SEQ ID NO: 20 and a tenth of the 19 nucleotide primer sequence pair; (11) an eleventh pair of primers having the nucleotide sequences of SEQ ID NOS: 21 and 22, respectively; (12) a twelfth pair of primers having the nucleotide sequences of SEQ ID NOS: 23 and 24, respectively; (13) a thirteenth primer pair having the nucleotide sequences of SEQ ID NOS: 25 and 26, respectively; (14) a fourteenth primer pair having the nucleotide sequences of SEQ ID NOS: 27 and 28, respectively; And a combination of the combinations; (iii) analyzing the genotype of the goose according to the test result of step (ii) to evaluate its genetic characteristics and individual identification.

In some embodiments of the invention, the genomic DNA of the goose is detected by at least 8 sets of microsatellite primer pairs. In a particular embodiment, the microsatellite marker pair is a pair of first to eighth, a first to a ninth, or a first to a fourteen.

In addition, the present invention provides a kit for genetic characterization and individual identification of goose, comprising one or more sets of microsatellite markers introduced to detect the genomic DNA of the goose to obtain the gene of the goose to be detected. And wherein the microsatellite marker primer pair is selected from the group consisting of a first primer pair to a fourteenth primer pair, and a combination thereof. In a particular embodiment, the microsatellite marker primer pair is a first primer pair to a fourteenth primer pair.

In addition, the microsatellite index introduction pair provided by the present invention includes a microsatellite flag forward primer and a microsatellite flag reverse primer, wherein the microsatellite flag forward or backward reference 5' end A fluorescent reagent is attached to the system.

In another aspect, the present invention provides a microsatellite marker primer pair for genetic identification and individual identification of a goose, wherein the microsatellite primer pair is a pair of first primer pairs to a fourteenth primer pair.

The invention is further illustrated by the following examples, which are not to be construed as limiting in any respect. The contents of all cited documents (including literature references, issued patents and published patents, which are hereby incorporated by reference in their entireties in the entireties in

Example 1 Screening of Microsatellite Signs and Design of Its Primer Pairs

Test animal

The white roman varieties of Changhua breeding farms were selected, and one male, one female and two geese were single, and the numbers were 5A5 and 5A26 respectively. Blood samples were collected and genomic DNA (gDNA) was extracted from whole blood using Genomic DNA Isolation Reagent (GenePure Tech. Co., LTD., Taiwan) according to the kit instructions. The obtained gDNA concentration was measured by NanoDrop 2000c (Thermo Fisher Scientific Inc., USA), and it was confirmed that the OD260/280 values were all 1.8 to 2.0, and stored in a refrigerator at -20 ° C for use.

2. Restriction enzyme digestion

Take 10 μL (100 ng/μL) of each gDNA of 5A5 and 5A26, and decompose with Rsa I (catalog #R0167S, NEB, USA) and Xmn I (catalog #R0194S, NEB, USA) restriction enzymes. The total volume was 25 μL, including 1X NEB ligase buffer (1 X BSA, 50 mM NaCl, Xmn I and Rsa I 1 μL each), and reacted in a water bath at 37 ° C for 1 hour, using a 1% agarose gel. It was confirmed by electrophoresis whether the digested product has a band length region of an optimum DNA fragment length of 300 to 1000 bp.

3. Engagement of DNA fragments with linkers

The preparation of the linker was carried out by adding an equal volume of Super SNX24 forward primer (5'GTTTAAGGCCTAGCTAGCAGAATC3') and Super SNX24+4P reverse primer (5'pGATTCTGCTAGCTAGGCCTTAAACAAAA3') to the NaCl solution. The final concentration was 100 mM and the mixture was preheated to 95 ° C and then slowly cooled to room temperature to form double-stranded linkers (ds Super SNX linkers). Next, a total volume of 10 μL of the ligation reaction solution containing 7 μM double stranded linker, 1X ligation buffer, and 800 units of T4 DNA ligase (catalog #M0202S, NEB, USA) was prepared.

The ligation reaction solution was mixed with the enzyme-cut product, and reacted at 16 ° C for 12 hours or more, and subjected to a PCR reaction using a single-strand Super SNX24 forward primer to confirm whether the ligation reaction was complete. The total volume of the PCR reaction was 25 μL, including 1X PCR buffer, 25 μg/mL BSA, 0.5 μM Super SNX24 forward primer, 2.0 mM MgCl ₂ , 0.15 mM dNTP, 1 U Taq DNA polymerase (TAKARA Co., Japan). And joining reaction products. The PCR reaction was carried out using a Veriti® 96-well Thermal Cycler (ABI PRISM, USA) at a reaction temperature of 95 ° C for 2 minutes; at 95 ° C for 20 seconds, at 60 ° C for 20 seconds, 72 The °C extension was 1.5 minutes, the cycle was repeated 20 times, and finally cooled to 15 °C. The PCR product was electrophoresed on a 1% agarose gel to detect whether the PCR product was successfully increased.

4. Magnetic beads enriched microsatellite DNA fragments (dynabead enrichment for microsatellite DNA fragments)

The enrichment system utilizes biotinylated-oligos to hybridize with DNA fragments in the gene bank; and reuses the affinity between streptavidin and biotin to carry The magnetic beads of the avidin separate the DNA fragment which is hybridized with the repeating sequence probe of the labeled biotin, and the fragment containing the repeat sequence can be separated by magnetic force to establish a gene bank rich in the DNA fragment of the two to four nucleotide repeats. (library). The present invention is based on the repeat species suggested by Glenn et al. (Glenn, et al., 2005, Isolating microsatellite DNA loci. Meth. Enzymol. 395: 202-222) Class design probes, adjusted according to similar chain temperature into three combinations, each containing four probes, respectively

Probe combination one: (TG) ₁₂ , (ACT) ₁₂ , (ACTG) ₆ , (ACAG) ₆ .

Probe combination two: (AG) ₁₂ , (ACAT) ₈ , (AACT) ₈ , (AAGT) ₈ .

Probe combination three: (AAG) ₈ , (AAAC) ₆ , (AATC) ₆ , (AGAT) ₆ .

(1) Probe hybridization

Take 10 μL of the gDNA fragment containing the zygote, add the reaction solution to make the total volume 50 μL, and include 25 μL of 2X hybrid solution (12 X SSC and 0.2% SDS) and any combination of the above probes, each probe concentration is 1 μM. The hybrid reaction was then carried out using a Veriti® 96-well Thermal Cycler (ABI PRISM, USA), first heated to 95 ° C for 5 minutes, then 0.2 ° C to 50 ° C every 5 seconds from 70 ° C, and then stopped at 50 ° C. The reaction was carried out for 10 minutes, then down to 0.5 ° C every 5 seconds until 40 ° C, and finally cooled to 15 ° C.

(2) cleaning and polishing magnetic beads

In parallel hybrid reaction, washed and purified to prepare magnetic beads (Dynabeads® M-280 Streptavidin, catalog # 11205D, Invitrogen TM, CA, USA). Take 50 μL of magnetic beads and add 250 μL of TE buffer (10 mM Tris pH8, 2 mM EDTA), mix well, then adsorb the magnetic beads with a magnet through a microcentrifuge tube and remove the supernatant, then add 250 μL of TE buffer and 250 μL of 1X hybrid solution. (6X SSC, 0.1% SDS) The purified magnetic beads were washed, and finally the magnetic beads were resuspended in 150 μL of 1X hybrid solution.

(3) Purification of gDNA fragments containing repeat sequences

All the hybrid products were added to the purified magnetic beads, and the mixture was slowly mixed at room temperature for 45 minutes with a shaker to bind the magnetic beads to the gDNA fragment containing the probe. Then, using magnet adsorption Magnetic beads, and then remove the supernatant. Wash the magnetic beads with 400 μL of Wash Solution 2 (2 X SSC and 0.1% SDS) and 400 μL of Wash Solution 1 (1 X SSC, 0.1% SDS) to wash the gDNA fragments and excess probes that are not hybridized with the probe. except. Finally, 200 μL of TLE buffer (0.01 M Tris-HCl and 0.2 mM EDTA) was added, and after heating at 95 ° C for 5 minutes, the supernatant was taken out, and 22 μL of NaOAc/EDTA solution (1.5 M NaOAc, 0.25 M EDTA) was added to the supernatant. After adding 444 μL of 95% ethanol, the mixture was mixed and placed at -20 ° C for 15 minutes, and then centrifuged at 16,000 g for 10 minutes to remove the supernatant. Next, the product was washed with 500 μL of 70% ethanol, and after the hybrid product was completely air-dried, it was re-dissolved in 25 μL of deionized water, and the amplified gDNA fragment containing the repeat sequence was confirmed by the PCR conditions of the above-mentioned ligation reaction for subsequent experiments.

4. Enrich the junction of DNA fragments and plastids

In order to select a DNA fragment containing the repeat sequence, the enriched and amplified DNA fragment was inserted into the pGEM-T vector (pGEM®-T Easy Vector system, Promega, USA), and the DNA fragment and the vector were carried out in a ratio of 3:1. The ligation reaction, the total volume of the reaction was 10 μL, and contained 50 ng of pGEM-T vector, 3 units of T4 DNA ligase, 1X rapid ligation buffer, and enriched amplified DNA fragment, and reacted at 4 ° C for 12 hours or more.

5. plasmid transformation and positive colonies selection

The reaction of the recombinant vector added 10μL 100μL HIT complete engagement competent cells ^{TM (Competent Cells TM) -DH5α (} Real Biotech Co., Taiwan), the reaction on ice for 1-10 minutes. The bacterial solution was divided into four equal portions, and 8 μL of IPTG and 40 μL of 2% X-Gal were mixed for each aliquot and the bacterial solution was applied to an LB (Luria-Broth) solid containing ampicillin (100 μg/mL). The medium was cultured at 37 ° C for 16 to 18 hours, and white colonies were picked, and the PCR conditions of the ligation reaction were confirmed as described above to confirm whether or not the DNA fragment was successfully ligated to the carrier. According to the results of the PCR, a total of 230 positive colonies containing only a single fragment were picked and transferred to a centrifuge tube containing 3 mL of LB medium containing ampicillin (100 μg/mL), followed by shaking at 37 ° C for 16 to 18 hours. .

7. Sequencing and primer design

The plastid DNA was extracted by alkaline lysis (Green and Sambrook, 2012), and nucleic acid sequencing was performed using an A7 3730XL DNA analyzer (ABI PRISM, USA) using a T7 primer. In the screening sequence fragment, the number of repeats of the two repeats is more than 8 or the number of repeats of the four repeats is 6 or more, as the minimum standard for possible polymorphism. A total of 65 colonies were found in the sequenced results, followed by primer design for the sequences on both sides of the repeat unit using the Primer 3 Plus program (Rozen and Skaletsky, 2000), and CAG at the 5' end of the forward primer. Mark (5'CAGTCGGGCGTATCA3') and use the CAG marker that has been calibrated by FAM (ABI PRISM, USA) as the second forward primer for all primer pairs to avoid the need to calibrate all primers.

Example 2 PCR amplification of microsatellite markers and polymorphism detection of various ethnic groups

Test animal

Sixteen white roman geese were selected for preliminary PCR detection to select polymorphic microsatellite markers. Subsequently, white roman geese, white geese, brown geese, hybrid geese and foreign groups (outgroup) were used in Changhua breeding farms. The black swan, a total of 254 geese, 5 ethnic groups for genotypic analysis, including 99 white Romanes, 40 white geese, 63 brown Chinese geese, 36 hybrid geese and 16 black swan (Table 1) . The blood samples of 254 goose tested were subjected to gDNA extraction according to the method of extracting and purifying gDNA.

2. The increase of microsatellite markers and the polymorphism detection of various ethnic groups

PCR can be used to detect whether the microsatellite marker primer can successfully increase the microsatellite marker, and the total reaction volume is 20 μL, including 30 ng gDNA, 0.04 μM forward primer, 0.2 μM reverse primer, 0.16 μM CAG marker, 1X PCR buffer, 0.2 mM dNTP and 0.025 U Taq DNA polymerase. The reaction conditions were denaturation at 95 ° C for 4 minutes; denaturation at 95 ° C for 50 seconds, 60 ° C for 50 seconds, 72 ° C for 1 minute, 35 cycles; and finally 72 ° C for 7 minutes. After the completion of the reaction, electrophoresis was carried out with a 1% agarose colloid to confirm whether or not the growth was successful.

The sample tray was prepared by mixing Hi-Di formamide and 600 Liz molecular weight standard (GeneScan Size Standard GeneScan-600 LIZ) (Applied Biosystems, Foster City, CA, USA) in a ratio of 120:1. 10 μL was added to a 96-well sample plate, and 1 μL of the diluted PCR product was added, and analyzed by capillary electrophoresis on an ABI 3730 DNA analyzer (ABI PRISM, USA) to determine the fragment size of the amplified DNA. The results of the segment size were then genotyped using the Peak scanner 1.0 (ABI PRISM, USA) software.

After the polymorphism test, 14 groups of microsatellite markers with the number of alternating genes greater than or equal to 2 were selected to carry out genotype detection of goose individuals. Differentiating the size of different microsatellite product fragments, and using different fluorescence to label the 14 sets of microsatellite primer pairs obtained by the above polymorphism test, the locus, motif, and primer pair sequence As shown in table 2.

The microsatellite marker primer pair comprises 14 pairs of microsatellite marker primer pairs, comprising: (1) a first primer pair having the nucleotide sequences of SEQ ID NO: 1 and 2, respectively; (2) a difference a second primer pair having the nucleotide sequences of SEQ ID NOS: 3 and 4; (3) a third primer pair having the nucleotide sequences of SEQ ID NOS: 5 and 6, respectively; (4) one having SEQ, respectively ID NO: a fourth primer pair of the nucleotide sequences of 7 and 8; (5) a fifth primer pair having the nucleotide sequences of SEQ ID NOS: 9 and 10, respectively; (6) one having SEQ ID NO, respectively a sixth primer pair of nucleotide sequences of 11 and 12; (7) a seventh primer pair having the nucleotide sequences of SEQ ID NOS: 13 and 14, respectively; (8) one having SEQ ID NO: 15 respectively And an eighth primer pair of the nucleotide sequence of 16. (9) a ninth primer pair having the nucleotide sequences of SEQ ID NOS: 17 and 18, respectively; (10) a tenth primer pair having the nucleotide sequences of SEQ ID NOS: 19 and 20, respectively; An eleventh pair of primers having the nucleotide sequences of SEQ ID NOS: 21 and 22, respectively; (12) a twelfth primer pair having the nucleotide sequences of SEQ ID NOS: 23 and 24, respectively; (13) a thirteenth primer pair having the nucleotide sequences of SEQ ID NOS: 25 and 26, respectively; (14) A fourteenth primer pair having the nucleotide sequences of SEQ ID NOS: 27 and 28, respectively.

Example 3 Analysis of genetic characteristics

1. Microsatellite flag applicability assessment

The microsatellite suitability evaluation system uses the Microsoft Toolkit (Park, 2001, Trypanotolerance in West African cattle and the population genetic effects of selection) to calculate the number of alternating genes (N _a ), Alternating gene frequency, observed heterogeneity (H _O ), expected heterogeneity (H _E ), and polymorphism message content (PIC) are described as follows:

1. number of alleles (N _a ): the average number of alternate genes per locus, ie the ratio of the number of alternating genes at all loci in the population to the total number of loci.

Where n _i : the number of all altering genes on locus i .

m : number of all loci.

2. Observed heterozygosity (H _O ): The observed heterogeneity of each locus, representing the actual proportion of heterozygous individuals in the population.

Where p _ij : the frequency of the genotype A _i A _{j at} the locus.

n : number of all altering genes at the locus.

A _i and A _j are the i- th and j -alternating genes at the locus, respectively, and i is not equal to j .

3. Expected heterozygosity (H _E ): The expected heterogeneity of each locus, and the expected value of heterogeneity in the population is calculated according to Harmon's law.

Where p _i : the frequency of the alternating gene A _{i at} the locus.

n : number of all altering genes at the locus.

A _i is the i- th alternating gene at the locus.

When the number of ethnic groups is less than 50, the expected heterogeneity equation must be corrected as:

Where N : the number of individuals in the group as a whole.

4. Polymorphic information content (PIC): The degree of polymorphism at each locus.

Where p _i : the frequency of the alternating gene A _{i at} the locus.

p _j : the frequency of the alternating gene A _{j at} the locus.

n : number of all altering genes at the locus.

A _i and A _j are the i- th and j -alternating genes at the locus, respectively, and i is not equal to j .

Another analysis of the HWE test and the GENEPOP 4.0 (Rousset, 2007; GENEPOP'007: a complete re-implementation of the GENEPOP software for Windows and Linux, Mol. Ecol. Res, 8: 103-106) Wright's F-statistics, which is described as follows:

1. Hardy-Weinberg equilibrium test (HWE test): with Markov chain The Fisher's exact test was performed by Markov Chain Monte Carlo (MCMC) (Guo and Thompson, 1992, Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48: 361-372) .

2. Wright's F-statistics: A fixed exponential extension is applied to explore the structure of subpopulations in the overall population. For example, in the case of a single locus containing the double alternation genes A _p and A _q , three heterogeneities must be established, including H _I , H _S and H _T , where: H _I : is the average of the observed heterogeneity of all subgroups, Also represents the probability that any individual is heterozygous.

among them : The observed heterogeneity within the subgroup i .

n : The number of all sub-groups.

H _S : refers to the average of the expected heterogeneity of all sub-groups under the assumption that the sub-groups are all Harvard equilibrium.

Where p _i : the frequency of the alternating gene A _{p in} the subgroup i .

q _i : the frequency of the alternating gene A _{q in} the subgroup i .

n : The number of all sub-groups.

H _T: equivalent to the binding alternately Gene A _p A _q and all sub-groups to form a large group, then p and q allele frequency obtained the desired degree of heterogeneity in the overall group.

among them : All sub-groups alternating frequency average gene A _p.

: Average of the frequency of all sub-group alternation genes A _q .

When considering the different alternate gene frequencies between non-family mate and sub-group, the corresponding adjustments should be made to the fixed index by the above three heterogeneities (H _I , H _S and H _T ), which are adjusted as follows:

1. F _IS : Compare the average of the individual observed heterogeneity in all sub-groups and the expected heterogeneity of all sub-groups in accordance with the Harvard equilibrium; that is, replace the items in the original fixed-index formula with the average of the sub-group parameter.

F _IS =(H _S -H _I )/H _S

I and S represent individuals and subpopulations, respectively. F _IS heterozygous for the positive value indicates the proportion of individuals in each sub-population of fewer than expected proportion of every machine mating environment.

2. F _ST : Compares the average expected heterogeneity of all sub-groups in accordance with the Harvard equilibrium, and the expected heterogeneity of the overall population; an estimate of the degree of differentiation of all sub-groups.

F _ST =(H _T -H _S )/H _T

S and T represent subpopulations and total population, respectively. A positive value of F _ST indicates a decrease in heterogeneity due to a difference in frequency of alternate genes between subgroups, and a heterozygous individual is absent.

3. F _IT : Compare the average heterogeneity of observations in all sub-groups with the expected heterogeneity of the overall population, and comprehensively evaluate the different gene frequencies between the non-family mate and the sub-group within the sub-group, and the expected genes for the Harvard equilibrium The deviation caused by the frequency.

F _IT =H _T -H _I /H _T

A positive value of F _IT indicates that the proportion of homozygous individuals in the overall population is higher than that of an ideal random mating, and has the same alternate gene frequency.

In addition, effective alternating gene number (N _e ) and linkage disequilibrium (LD) assays were analyzed using POPGENE 1.32 (Yeh et al., 1999, POPGENE, version 1.32: the user friendly software for population genetic analysis). Among them, N _e is the average degree of alternation gene distribution at each locus, which means the number of alternation genes that can provide the same heterogeneity when the frequencies of all the alternate genes are the same.

Where p _i : the frequency of the alternating gene A _{i at} the locus.

n : number of all altering genes at the locus.

2. Calculation of genetic distance and mapping of kinship trees

Calculation of genetic distance between individuals using Microsatellite Analyser (MSA) (Dieringer and Schlötterer, 2003, MICROSELLITE ANALYSER (MSA): a platform independent analysis tool for large microsatellite data sets. Mol. Ecol. Notes 3: 167-169) (Saitou and Nei , 1987, The Neighbor-joining method: a method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.), and using the PHYLIP suite software (Felsenstein, 2002, Phylogeny Inference Package (PHYLIP)) in the ortho position Neighbor Joining (NJ) and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) draw a phylogenetic tree. In addition, the STRUCTURE 2.3.1 software is used for simulation, and Markov Chain Monte Carlo (MCMC) is used to analyze the probability of grouping. According to the calculation of 50,000 simulations after 5,000 times, it is possible to group (K=2~7). Each K value is repeated 20 times and then the cluster analysis map is drawn; and the ^ΔK value is calculated (Evanno et al., 2005, Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol. 14:2611-2620 And L(K) values (Rosenberg et al., 2001, Empirical evaluation of genetic clustering methods using multilocus genotypes from 20 chicken breeds. Genetics 159: 699-713). Principal Coordinate Analysis (PCoA), also drawn by GeneAlEx (Peakall and Smoothe, 2012, Gene AlEx ver 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 28: 2537-2539) The 3D map confirmation experiment detected the grouping situation of the five goose populations in the Changhua breeding farm and the ethnic relationship.

3. Individual identification rate and parental exclusion rate

Using the results of analysis of ethnic genetic polymorphisms, the individual discrimination rate (P _(ID) ) was calculated (Paetkau and Strobeck, 1994, Microsatellite analysis of genetic variation in black bear population. Mol. Ecol. 3: 489-495) and close relatives. Identification rate (P _{(ID) sib} ) (Evett and Weir, 1998, Interpreting DNA evidence: statistical genetics for forensic scientists. 1st ed), and based on the combined individual identification rate generated by combining different numbers of microsatellite loci A line chart, which is described as follows:

1. probability of identity (P _(ID) ): is the probability that two individuals are randomly selected from a population, and the genotypes of the two are identical at a single locus.

Where p _i : the frequency of the alternating gene A _{i at} the locus.

p _j : the frequency of the alternating gene A _{j at} the locus.

n : number of all altering genes at the locus.

2. Probability of identity among sibs, P _{(ID) sib} : used when the identified individuals have close kinship.

Where p _j : the frequency of the alternating gene A _{j at} the locus.

n : number of all altering genes at the locus.

The calculation of the power of exclusion (PE) is also calculated according to the formula mentioned by Jamieson (Jamieson, 1965, The genetics of transferrin in cattle. Heredity 20: 419-441), wherein the parent-child exclusion rate refers to Three-person parent-child identification The genotype and probability of mother and child and non-father.

Where p _i : the frequency of the alternating gene A _{i at} the locus.

p _j : the frequency of the alternating gene A _{j at} the locus.

n : number of all altering genes at the locus.

result

1. Microsatellite markers and genetic variability

The invention utilizes 14 sets of novel microsatellite markers to carry out genotypic analysis on a total of 254 goose samples for five goose groups - white roman goose, white goose, brown goose, hybrid goose and black swan in Changhua breeding farm. . In addition to the black swan, the genetic test results of the entire goose population using the obtained genotypic analysis data are shown in Table 3. As Table 3 shows the number of genes alternately each locus (N _a) in the range between 4 (5A265164) to 38 (5A26681), and the average value of 12 N _a. The effective number of alternate genes (N _e ) is between 1.746 (5A266113) and 9.155 (5A26648), and the average value of N _e is 3.625. The expected heterogeneity (H _E ) of the 14 sets of microsatellite markers is between 0.384 (5A266113) and 0.895 (5A26648) with an average of 0.613. On the other hand, the observed heterogeneity (H _O ) ranged from 0.336 (5A265164) to 0.908 (5A26648) with an average of 0.609. The polymorphism message content (PIC) ranged from 0.351 (5A266113) to 0.876 (5A26648) with an average of 0.613 (Table 3). In terms of genetic structure analysis, F _IS ranged from -0.116 (5A265151) to 0.32 (5A265164) with an average of 0.015. The average value is positive, and the subpopulation in the whole goose population is also known. That is, the proportion of heterozygotes within the variety is less than expected. In the HWE test, a total of 9 loci significantly deviated from the Hawar equilibrium ( P <0.01), loci 5A5111, 5A5397, 5A26216, 5A26261, 5A265151, 5A265164, 5A265175, 5A26648, and 5A26681, respectively.

2. Evaluation results of genetic variability within each goose population

In the experiment, the four geese of white roman geese, white geese, brown geese and hybrid geese were tested in 14 groups of new microsatellite markers. The genetic variability is shown in Tables 4 to 7. The average value of the genetic variability of the four species of geese was the highest among the hybrid geese. The values of white geese and brown geese were lower, and the value of white roman geese was between the two. The average value of N _{a for} each variety ranged from 5.714 to 7.286, and the average value of N _e ranged from 3.035 to 4.633 (Table 8). The highest average values of H _E and H _O were found in hybrid geese, 0.735 and 0.829, respectively, indicating high genetic variability. The lowest average values of H _E and H _O are in brown geese and white geese, 0.543 and 0.518, respectively, so the degree of genetic variability is low. The average value of H _E and H _{O of} white roman goose is between the two, 0.622 and 0.591 respectively. In terms of the average value of PIC, the average value of white roman goose is 0.569; the average value of white Chinese goose is 0.491; the average value of brown Chinese goose is 0.5; the average value of hybrid goose is 0.683. In terms of mean value F _IS, Roman white geese, Chinese white geese, brown Chinese goose value hybridization goose, 0.045,0.065,0.052 and -0.142 respectively. There are six or eight loci in which the white roman goose and the hybrid goose deviate from the Harvard equilibrium, respectively, while the white Chinese goose and the brown Chinese goose have two or one loci that deviate from the Harvard equilibrium.

N _a : Number of allele; N _e : Number of effective allele; H _O : Observed heterozygosity; H _E : Expected heterozygosity; PIC: Polymorphism Information Content; F _IS : Wright's F-statistics; HWE: Hardy-Weinberg Equilibrium; * P <0.01, NS: non-significant.

Heterozygosity); PIC: Polymorphism Information Content; F _IS : Wright's F-statistics; HWE: Hardy-Weinberg Equilibrium; * P <0.01, NS: Not significant.

3. Genetic distance and grouping

The main purpose of genetic analysis of microsatellite markers is cultivar analysis and individual identification. Variety analysis hopes to distinguish the different species of geese at the molecular level, avoiding hybrid geese as breeding geese, and making the quality of the geese inconsistent. The invention uses the white roman goose, the white Chinese goose, the brown Chinese goose and the hybrid goose as the reference in the core species of the goose farm Changhua breeding farm, and the 14 sets of microsatellite markers detect the alternating gene frequency results of all the loci of each goose. Further calculate the genetic distance between the ethnic groups and the F _ST between the ethnic groups (Table 9). As shown in Table 9, in addition to the black swan, the white Romance group and the brown Chinese goose group have the largest genetic distance (0.703), while the white Chinese goose group and the brown Chinese goose group have the smallest genetic distance (0.184), and ethnic differentiation. The results of the index F _ST values are similar, corresponding to the maximum (0.362) and the minimum (0.089), respectively. Furthermore, the genetic distance was used to map the geese tree in the goose population (Fig. 1). The closest white geese and brown geese formed a group, and the hybrid geese were in Chinese goose and white roman. Between the geese, as expected.

Above the diagonal is the F _ST value; below the diagonal is the genetic distance. WR: White Roman; WC: White Chinese Goose; BC: Brown Chinese Goose; H: Cross Goose; BS: Black Swan.

Using the main coordinate analysis (PCoA) method to draw a 3D perspective (Fig. 2), the results show that the first coordinate axis (PC1), the second coordinate axis (PC2) and the third coordinate axis (PC3) can explain 61.06, 32.62 and 4.66 respectively. % of genetic variation. By the variation of the three main coordinate axes to distinguish the genetic distance between the ethnic groups, it can also be found that the black swan can be clearly separated from other geese in the first principal component (PC1), while the white geese and brown geese are It can be separated when it comes to the third component (PC3). The hybrid goose is also between the Chinese goose and the white roman goose.

In addition, using the STRUCTURE software analysis group structure (Fig. 3), in the K values (K=2~7) of possible hypotheses, when K=2, it is mainly divided into white roman goose group and other ethnic groups. It is obviously composed of two components; when K=3, the black swan group is separated. When K=4, the white and brown geese are separated; when K=5, the hybrid geese are grouped into a group, which is just the test five. Ethnic group; when K=6~7, only hybridization is subdivided.

Based on 14 new genotypes with other known microsatellite markers Saitou and Nei (1987) calculated the genetic distance between individuals, and then used the ortho-joining method (NJ) to map the phylogenetic tree of the goose individual, as shown in Figure 4. The results show that the individuals of the five ethnic groups can be completely divided into five clusters in this picture. In the future, when testing other ethnic groups, the population points of the ethnic group can determine whether the individuals of this ethnic group have been crossed.

4. Evaluation of individual identification rate of goose

The analysis of individual identification is divided into four geese species and all ethnic groups, and the individual identification rate (P _(ID) ) of 14 new microsatellite markers, the identification rate of close relatives (P _{(ID) sib} ) and comprehensive all 14 are calculated respectively. The P _(ID) and P _{(ID) sib of the} new microsatellite set are shown in Table 10 and Table 11. As shown in Table 10, the P _{(ID) of the} 14 groups of new microsatellite loci in the white roman geese ranged from 0.019 (5A26681) to 0.419 (5A26261), and the integrated P _(ID) was 1.2×10 ^-11 . The P _(ID) range of White Hua Goose ranges from 0.028 (5A5279) to 0.538 (5A5111), and the integrated P _(ID) is 4.3×10 ^-10 . The P _(ID) range of brown geese is 0.024 (5A26648) to 0.606 (5A265141), the integrated P _(ID) is 1.81×10 ^-10 , and the P _(ID) range of hybrid goose is 0.012 (5A26648) to 0.293 ( 5A5111), the integrated P _(ID) is 2.73 × 10 ^-15 .

In addition, when the ethnic groups to be explored have close relatives, such as full-sib or half-sib, it is more appropriate to correct the P _{(ID) sib} when calculating the individual discrimination rate. This test also calculates P _{(ID) sib} when it is assumed that the detected population has a close relationship. As shown in Table 11, the P _{(ID) sib of the} 14 groups of new microsatellite loci in the white roman geese ranged from 0.306 (5A26681) to 0.668 (5A266113), and the integrated P _{(ID) sib} was 3.79 × 10 ^-5 . The P _{(ID) sib of the} white Chinese goose ranges from 0.32 (5A5279) to 743 (5A5111), and the integrated P _{(ID) sib} is 1.51×10 ^-4 . The P _{(ID) sib} range of the brown geese is 0.313 (5A26648) to 0.808 (5A266113), and the integrated P _{(ID) sib} is 1.39 × 10 ^-4 . The P _{(ID) sib} range of the hybrid goose ranged from 0.293 (5A26648) to 0.64 (5A266113), and the integrated P _{(ID) sib} was 1.39 × 10 ^-6 . In addition, among the various geese and all ethnic groups, the integrated P _(ID ) and integrated P _{(ID) sib of} different numbers of new microsatellite markers were also calculated and plotted as line charts (Figures 5 and 6). From the line graphs drawn by the composite P _(ID) and the integrated P _{(ID) sib of} different numbers of new microsatellites, it is also possible to estimate the number of individuals in all ethnic groups if the number of goose populations is known. , the minimum number of new microsatellite markers required.

5. The minimum number of microsatellite markers for effective grouping and individual identification

It can be seen from the above results that the 14 sets of microsatellite markers successfully clustered the main geese in Taiwan in the individual kinship tree, and the individual identification rate far exceeds the average annual number of geese feeding in Taiwan 1.95×10 ⁶ or slaughtering geese The number is 5.16×10 ⁶ (Agricultural Statistics Annual Report of the Executive Yuan Agricultural Committee, 2013). Therefore, theoretically less than 14 sets of microsatellite markers can be obtained. In order to find the minimum number of effective microsatellite markers, five groups, seven groups, eight groups, and nine groups of microsatellite markers are randomly selected and calculated. An individual kinship tree (Figures 7, 8, 9 and 10). As a result, it was found that when five sets of microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175) were used, the other three groups could not be separated except for the white roman goose (Fig. 7). When using seven sets of microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175, 5A26254, 5A5305-1), only a few brown geese could not be separated from other ethnic groups (Figure 8). Using eight sets of microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175, 5A26254, 5A5305-1, 5A265141) above, the grouping effect can be achieved (Figures 9, 10). Therefore, when the microsatellite marker of the present invention is used for the original identification of the main geese in Taiwan, only eight groups can achieve the effect of grouping, and each additional microsatellite marker is detected, and the grouping effect is more accurate.

In addition, the individual discrimination rates (P _(ID) ) and the identification rate of close relatives (P _(ID) ) were calculated using the above 8 sets of microsatellite markers (5A26648, 5A26681, 5A5279, 5A5397, 5A265175, 5A26254, 5A5305-1, 5A265141) _{. Sib} ) and P _(ID) and P _{(ID) sib of} all 8 sets of microsatellite markers. As shown in Table 12 and Table 13, the comprehensive P _(ID) of the 8 groups of new microsatellite loci in the white roman geese is 1.24 × 10 ^-8 . The integrated P _(ID) of White Hua Goose is 7.05×10 ^-8 . The integrated P _(ID) of brown geese is 4.89×10 ^-8 , and the integrated P _(ID) of hybrid geese is 5.12×10 ^-11 . The comprehensive individual identification rate of each variety exceeded the above average number of geese in the above-mentioned Taiwan, 1.95×10 ⁶ or the number of slaughtered geese 5.16×10 ⁶ . Therefore, the microsatellite marker of the present invention can be used for the identification of individual geese in Taiwan, and only needs eight groups to achieve the effect of individual identification. Each additional micro-satellite marker is detected, and the individual identification effect is better.

In summary, the 14 sets of microsatellite markers provided by the present invention analyze the results of the Taiwanese goose population, and the results show that the average expected heterogeneity, the observed heterogeneity and the polymorphism information content are all in a high polymorphism range, indicating The microsatellite markers are highly applicable to the analysis population; and the individual phylogenetic tree of the goose drawn by the ortho-connect method can be observed that the ethnic distribution can be clearly distinguished, and the results show that the microsatellite markers It is applied to the difference detection of goose varieties and has good resolution.

In addition, the test results show that the 14 sets of microsatellite markers provided by the present invention have the effect of comprehensive individual identification rate of goose or comprehensive identification rate of close relatives, which may cover the average number of geese or slaughter geese in Taiwan per year.

<110> Wang, Peihua

<120> Genetic identification and individual identification methods of goose

<130> 0593/WPH0003TW

<160> 28

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 1

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 2

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 3

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 4

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 5

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 6

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 7

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 8

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 9

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 10

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 11

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 12

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 13

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 14

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 15

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 16

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 17

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 18

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 19

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 21

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 22

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 23

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 24

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 25

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 26

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward introduction

<400> 27

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Reverse primer

<400> 28

Claims (10)

A method for genetic characterization and individual identification of geese, the method comprising: (i) providing a blood sample of a goose to be detected, and extracting genomic DNA in the blood sample; (ii) at least 7 sets of microsatellites The primer pair detects the genomic DNA of the goose; wherein the microsatellite primer pair is selected from the group consisting of: (1) a first primer pair having the nucleotide sequences of SEQ ID NOS: 1 and 2, respectively; 2) a second primer pair having the nucleotide sequences of SEQ ID NOS: 3 and 4, respectively; (3) a third primer pair having the nucleotide sequences of SEQ ID NOS: 5 and 6, respectively; (4) a fourth primer pair having the nucleotide sequences of SEQ ID NOS: 7 and 8, respectively; (5) a fifth primer pair having the nucleotide sequences of SEQ ID NOS: 9 and 10, respectively; (6) a difference a sixth primer pair having the nucleotide sequences of SEQ ID NOS: 11 and 12; (7) a seventh primer pair having the nucleotide sequences of SEQ ID NOS: 13 and 14, respectively; (8) one having SEQ, respectively ID NO: an eighth primer pair of the nucleotide sequences of 15 and 16; (9) a ninth primer pair having the nucleotide sequences of SEQ ID NOS: 17 and 18, respectively; (10) one having SEQ ID NO, respectively :19 a tenth primer pair of the nucleotide sequence of 20; (11) an eleventh pair of primers having the nucleotide sequences of SEQ ID NOS: 21 and 22, respectively; (12) one having SEQ ID NOS: 23 and 24, respectively a twelfth primer pair of the nucleotide sequence; (13) a thirteenth primer pair having the nucleotide sequences of SEQ ID NOS: 25 and 26, respectively; (14) one having SEQ ID NOS: 27 and 28, respectively a fourteenth primer pair of the nucleotide sequence; a group consisting of the combinations thereof; (iii) analyzing the genotype of the goose according to the test result of the step (ii) to evaluate its genetic characteristics and individual identification. The method of claim 1, wherein the step (ii) detects the genomic DNA of the goose with at least 8 sets of microsatellite primer pairs. The method of claim 1, wherein the microsatellite flag pair is a pair of first to eighth pairs. The method of claim 1, wherein the microsatellite marker pair is a pair of first primer pairs to a ninth primer pair. The method of claim 1, wherein the microsatellite flag pair is a pair of first to fourteen pairs. A kit for genetic characterization and individual identification of goose, comprising at least 7 sets of microsatellite markers introduced to detect the genotype DNA of the goose to obtain the genotype of the goose to be detected; wherein the micro The satellite flag primer pair is selected from the group consisting of a first primer pair to a fourteenth primer pair as defined in the first paragraph of the patent application, and a combination thereof. For example, the kit of claim 6 of the patent scope, wherein the microsatellite flag primer pair is the first primer pair to the fourteenth primer pair as defined in claim 1 of the patent application scope. For example, in the kit of claim 6, the microsatellite flag pair includes a microsatellite flag forward primer and a microsatellite flag reverse primer. For example, the kit of claim 8 includes a fluorescent reagent attached to the 5' end of the microsatellite forward primer or the microsatellite reverse primer. A pair of microsatellite markers for the genetic characterization and individual identification of geese, wherein the microsatellite primer pair is the first primer pair to the fourteenth pair defined in the first application of the patent scope.