TWI568852B - A colorectal cancer screening kit - Google Patents

Description

Colorectal cancer screening kit

The present invention relates to a colorectal cancer screening kit.

Colorectal cancer is one of the most common malignant tumors. It ranks fifth in the incidence of cancer in the United States and fourth in the incidence of Chinese cancer. It is the third most common cancer in Europe. When colorectal cancer is in the early stage, its cure rate is high. Early screening of colorectal cancer is the key to successful treatment and patient survival, and it is also a major challenge in the field of public health.

Traditional methods of detection include fecal occult blood test, sigmoidoscopy, colonoscopy, double contrast barium examination, and digital rectal examination. These examinations have low patient compliance and complex procedures. It is necessary to find ways to ensure patient compliance and ease of operation.

Finding biomarkers in peripheral blood and detecting colorectal cancer is a popular method in recent years. Han et al. compared the gene expression profiles of 101 cases of colorectal cancer and 110 controls, and constructed a prediction model based on 5 genes. The sensitivity and specificity of the model were 88% and 64%, respectively (Han M, Liew CT, Zhang HW). , et al. Novel blood-based, five-gene biomarker set for the detection of colorectal cancer [J]. Clin Cancer Res, 2008, 14(2): 455-460.). Marshall et al found 7 significant genes from 314 cases of colorectal cancer and 328 normal control studies. The sensitivity and specificity of the prediction model were 72% and 70% (Marshall KW, Mohr S, Khettabi FE, et al. A blood-based biomarker panel for stratifying current risk for colorectal cancer [J]. Int J Cancer, 2010, 126(5): 1177-1186) Rosenthal et al. compared the peripheral blood gene expression profiles of 314 colorectal cancers and 328 normal controls, and constructed a prediction model of 202 significant genes with sensitivity and specificity of 90% and 88%, respectively (Rosenthal A, Nuernberg D , Pross M, et al. Detector-C: A blood-based IVD with high sensitivity and specificity for early detection of colorectal cancer [J]. J Clin Oncol 28:15s, 2010 (suppl; abstr 3580). When the number of detection genes is small, the sensitivity and specificity are low, and when the sensitivity and specificity are high, the number of detection genes is too large and the cost is high.

In order to solve the above problems, the present invention provides a novel colorectal cancer screening kit.

A colorectal cancer screening kit comprising a reagent for detecting the expression level of any one or more of the following 18 genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as SEQ ID NO: 2 MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as SEQ ID NO: 9 SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as SEQ ID NO: 32 or As indicated by 33; FKBP5, as set forth in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as SEQ ID NO: 39 Shown; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41.

Wherein the reagent is an agent that detects the amount of RNA, particularly mRNA, transcribed by the gene.

Wherein the reagent is an agent that detects the amount of cDNA complementary to the mRNA.

Wherein the reagent is an agent that detects the amount of cRNA complementary to the cDNA.

Wherein the reagent is a probe.

Wherein the reagent is an agent that detects the amount of the polypeptide encoded by the gene.

Wherein the reagent is an antibody, an antibody fragment or an affinity protein.

The invention also provides the use of any one or any of the following 18 genes in the preparation of a colorectal cancer screening reagent: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as set forth in SEQ ID NO: 3 or 4; ITGAM, as set forth in SEQ ID NO: 5 or 6; P2RY10, as set forth in SEQ ID NO: 7 or 8; GZMB, as set forth in SEQ ID NO: 9. SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as SEQ ID NO : 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as shown in SEQ ID NO: 37; IL1B , as shown in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41.

Wherein the reagent is a related reagent for detecting the expression level of any one or more of the 18 genes.

Wherein, the reagent further comprises a colorectal cancer positive sample and a colorectal cancer negative sample.

Wherein the reagent is an agent that detects the amount of RNA, particularly mRNA, transcribed by the gene.

Wherein the reagent is an agent that detects the amount of cDNA complementary to the mRNA.

Wherein the reagent is an agent that detects the amount of cRNA complementary to the cDNA.

Wherein the reagent is a probe.

Wherein the reagent is an agent that detects the amount of the polypeptide encoded by the gene.

Wherein the reagent is an antibody or an affinity protein.

The method for detecting gene expression in a human blood sample, particularly a human blood sample, comprises: (1) determining the level of RNA transcribed by any one or any of a plurality of genes in a genome of a blood sample of the subject, the genome comprising the following genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, such as SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as SEQ ID NO: 26 Shown; CD36, as set forth in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as set forth in SEQ ID NO: 32 or 33; FKBP5, as set forth in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as SEQ ID NO: :41; (2) detecting gene expression in the blood sample of the subject.

Preferably, said step (1) is to determine the level of RNA transcribed from any of the six genes in the genome. The six genes are NEAT1, FAM198B, ITGAM, MYBL1, PDZK1TP1, and VSIG10.

Preferably, said step (1) is to determine the level of RNA transcribed from 18 genes in the genome.

Among them, the sample is a positive sample of colorectal cancer.

Wherein the sample is a negative sample of colorectal cancer.

Wherein said step (1) uses at least one oligonucleotide.

Among them, one oligonucleotide hybridizes only to one gene-transcribed RNA, and/or can hybridize to a cDNA complementary to the RNA transcribed by the gene.

Wherein, the step (1) comprises the steps of: a, amplifying the RNA transcribed by the gene to obtain an amplification product; b, detecting the amount of the amplification product obtained in the step a using at least one primer.

Wherein, the step (1) comprises the steps of: i. hybridizing with a cDNA complementary to the RNA transcribed by the gene to obtain a hybridization product; ii, detecting the amount of the hybridization product obtained in the step i.

Wherein said step (1) comprises a method of amplifying RNA transcribed by said gene.

Wherein the step (1) comprises a method of detecting the amount of cDNA complementary to the RNA transcribed by the gene.

Wherein the step (1) uses at least one probe.

Wherein the step (1) uses at least one primer.

An oligonucleotide of the present invention which hybridizes only to RNA transcribed from one gene and/or which can hybridize to a cDNA complementary to the RNA transcribed by said gene, said gene belonging to a genome consisting of the following genes: DUSP2, such as SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as SEQ ID NO: 14, 15, 16, 17, 18 , 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as shown in SEQ ID NO: 37; IL1B, as SEQ ID NO: 38; DHRS13, as shown in SEQ ID NO: 39; PDZK1IP1, as shown in SEQ ID NO: 40; VSIG10, such as SEQ ID NO: 41.

The oligonucleotide is selected from the nucleotide sequences set forth in SEQ ID NOS. 42-77.

The invention relates to a kit for detecting gene expression in a human body sample, in particular a human blood sample, comprising a specific partner of 18 expression products of 18 genes, each partner specifically cooperating with each gene, and the 18 genes are as follows Show: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as set forth in SEQ ID NO: 7 or 8; GZMB, as set forth in SEQ ID NO: 9; SH2D2A, as set forth in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as SEQ ID NO : 27, 28, 30, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37 IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41.

Wherein the specific partner is an oligonucleotide, in particular a probe and/or a primer.

Wherein the specific partner is selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS. 42-77.

Wherein the specific partner comprises an antibody and/or an affinity protein.

The invention discloses a method for screening the risk of human colorectal cancer by blood sample in vitro, which comprises the following steps: a) taking a blood sample and detecting the amount of the expression product of any one or any of the following 18 genes: DUSP2, such as SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as SEQ ID NO: 14, 15, 16, 17 , 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as shown in SEQ ID NO: 37; IL1B, eg SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO: 41; b) expression product obtained in step a) Amount Comparison of the amount of expression product of a colorectal cancer positive sample from a confirmed colorectal cancer patient, and a positive colorectal cancer negative sample from a confirmed non-colorectal cancer individual; c) according to step b The analysis result is judged: if the amount of the expression product obtained in step a) is similar to or the same as the amount of the expression product of the colorectal cancer positive sample, it is diagnosed as a colorectal cancer patient; if the amount of the expression product obtained in step a) is negative for colorectal cancer Sample expression If the amount of product is similar or the same, it is diagnosed as a non-colorectal cancer patient.

Preferably, said step a) is the detection of the amount of expression product of any of the 18 genes. The six genes are NEAT1, FAM198B, ITGAM, MYBL1, PDZK1TP1, and VSIG10.

Preferably, said step a) is the detection of the amount of expression product of each of the 18 genes.

Wherein in the step a), the amount of the expression product of the at least one gene is detected by contacting the expression product of the gene with the specific partner of the expression product.

Wherein, in step a), the amount of the expression product of the gene is detected, and the nucleic acid sequence of the gene is selected from the sequence set shown by SEQ ID NOS: 1 to 41.

Wherein the expression product of step a) comprises at least one RNA transcript or a polypeptide.

Wherein the expression product comprises at least one mRNA.

Wherein, the RNA transcript is detected and quantified by hybridization, amplification or sequencing.

Wherein the RNA transcript is contacted with at least one probe and/or at least one primer under predetermined conditions, and the probe and/or primer may hybridize to the RNA transcript under predetermined conditions.

Wherein, the cDNA of the RNA transcript is contacted with at least one probe and/or at least one primer under predetermined conditions, and the probe and/or primer may hybridize to the cDNA under predetermined conditions.

Wherein the detection of the polypeptide is detected by contacting the polypeptide with at least one specific ligand, in particular with an antibody or an affinity protein.

Wherein the polypeptide is contacted with at least two specific ligands, in particular with two antibodies, two affinity proteins or one antibody and one affinity protein.

The invention relates to a kit for screening the risk of human colorectal cancer by blood sample in vitro, comprising a specific partner of any one of 18 genes or any plurality of gene expression products, each partner specifically cooperating with each gene, The 18 genes are as follows: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, SEQ ID NO: 5 Or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, such as SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36 , as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, such as SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO: 41 The partner specifically binding to a specific gene expression product; nucleic acid sequence of the 18 genes selected from SEQ ID NO: 1 set of 41 sequences.

Preferably, the kit comprises a specific partner of an expression product of any six of the 18 genes. The six genes are NEAT1, FAM198B, ITGAM, MYBL1, PDZK1TP1, and VSIG10.

Preferably, a specific partner comprising an expression product of each of the 18 genes is included.

Wherein the specific partner comprises at least one hybridization probe.

Wherein the specific partner comprises at least one hybridization probe and at least one primer.

Wherein the specific partner comprises at least one hybridization probe and two primers.

Wherein the specific partner comprises at least one specific ligand, in particular an antibody or an affinity protein.

Wherein the specific partner comprises at least two specific ligands, in particular two antibodies, two affinity proteins or one antibody and one affinity protein.

The use of the specific partner of the expression product of the 18 genes of the nucleic acid sequences of the present invention as shown in SEQ ID NOS: 1 to 41 for the preparation of an agent for screening for the risk of colorectal cancer in vitro, the specific partner and 18 genes The expression product specifically binds.

Preferably, the specific partner is a specific partner of an expression product of any six of the 18 genes. The six genes are NEAT1, FAM198B, ITGAM, MYBL1, PDZK1TP1, and VSIG10.

Preferably, the specific partner is a specific partner of an expression product of each of the 18 genes. Wherein the specific partner comprises at least one hybridization probe.

Wherein the specific partner comprises at least one hybridization probe and at least one primer.

Wherein the specific partner comprises at least one hybridization probe and two primers.

Wherein the specific partner comprises at least one specific ligand, in particular an antibody or an affinity protein.

Wherein the specific partner comprises at least two specific ligands, in particular two antibodies, two affinity proteins or one antibody and one affinity protein.

Detection of the level of gene expression of the invention can be achieved by detecting RNA transcripts.

The term "RNA transcript" refers to total RNA, ie, coding or non-coding RNA, including directly from a peripheral blood sample, as well as RNA indirectly from a blood sample after cell lysis. The method of cell lysis can be carried out by the magnetic and mechanical lysis method disclosed in the patent application No. WO 99/05338, or the magnetic lysis method disclosed in the patent application No. WO 99/53340, or the application number: WO 99/ The mechanical cracking method disclosed in the patent application of 15321, of course, can also be carried out by methods well known in the art, such as thermal cracking, high osmotic pressure cracking or chemical cracking using a lysate such as a cerium salt. After cell lysis, the nucleic acid needs to be separated from other cellular components produced by the lysis step. Generally, the nucleic acid can be purified by centrifugation. The total RNA comprises tRNA, mRNA and rRNA, wherein the mRNA includes mRNA transcribed from the target gene, and also mRNA derived from other non-target genes.

In the present invention, RNA transcripts can be detected and quantified by hybridization, amplification or sequencing. For example, an RNA transcript is hybridized to a probe or primer.

The term "hybridization" refers to the process by which two nucleic acid fragments bind to a double helix complex by stable and specific hydrogen bonding under appropriate conditions. The hydrogen bond is present in complementary adenine A and thymine T (or uracil). Between U), referred to as the AT bond, or between the complementary guanine G and cytosine C, referred to as the GC bond.

Hybridization of two nucleic acid fragments may be complete (ie, form a fully complementary nucleotide fragment or sequence), and the double helix complex formed during the hybridization process only contains AT and GC bonds; it may also be local (ie, form a fully complementary The nucleotide fragment or sequence), the double helix complex formed during hybridization comprises an AT bond and a GC bond such that it can form a double helix structure and also contains bases that are not bound to the double helix complex.

The degree of hybridization of the two nucleic acid fragments depends on the reaction conditions of the hybridization, particularly the degree of stringency. The degree of stringency refers to the base composition function of two nucleic acid fragments and also the degree of mismatch between the two nucleic acid fragments. The degree of stringency depends on the reaction conditions, such as the concentration and type of ions in the hybridization solution, the nature and concentration of the denaturant, and/or the hybridization temperature. These conditions are conventional conditions, and those skilled in the art can determine suitable conditions. Generally, depending on the length of the nucleic acid fragment to be hybridized, the hybridization temperature is between 20 and 70 ° C, preferably between 35 and 65 ° C, and the concentration of physiological saline is between 0.5 and 1 M.

The term "amplification primer" refers to a nucleic acid fragment comprising 5 to 100 nucleotides, preferably 15 to 30 nucleotides which are capable of initiating an enzymatic reaction (for example, an enzymatic amplification reaction).

The term "enzymatic amplification reaction" refers to the process of producing multiple copies of a nucleic acid fragment by the action of at least one enzyme. The amplification reaction is well known in the art Common knowledge, and is mentioned in the following technology: PCR (polymerase chain reaction) described in U.S. Patent No. 4,683,195, U.S. Patent No. 4,683,202, and U.S. Patent No. 4,800,159, the entire disclosure of The LCR (Ligation Chain Reaction) disclosed in the patent application No. WO 90/01069, the RSR (Repair Chain Reaction), the application number is: 3SR (the patent application described in WO 90/06995) Autonomous sequence replication), NASBA (Nucleic Acid Sequence-Dependent Amplification Technique) described in the patent application of WO 91/02818, TMA (Transscription-Mediated Amplification) described in U.S. Patent No. 5,399,491.

When the enzymatic amplification reaction is PCR, at least two target gene-specific primers are required to amplify a target gene, and the amplification product is specifically aligned with the target gene. For example, the amplification product may be a complementary DNA (cDNA) prepared by reverse transcription of the target gene mRNA, or a complementary RNA (cRNA) to the cDNA. When the enzymatic amplification reaction is reverse transcriptase-mediated PCR, it is RT-PCR.

The term "hybridization probe" refers to a nucleic acid sequence comprising at least 5 nucleotides, for example, comprising 5 to 100 nucleotides, which are capable of expressing an expression product of a target gene or an amplification product of the expression product under specified conditions. Hybridization forms a complex. In the present invention, the expression product of the target gene comprises a target gene mRNA, and the amplification product of the target expression product includes a DNA cDNA complementary to the target product mRNA or a cDNA complementary to the cDNA. A marker for detection is also included on the hybridization probe.

The term "detection" refers to an indirect detection method such as a direct detection method such as a counting method and a method using a marker. Currently, there are many methods for nucleic acid detection (eg, Kricka et al., Clinical Chemistry, 1999, no 45(4), p.453-458 or Keller G.H. et al., DNA Probes, 2nd Ed., Stockton Press, 1993, Sections 5 and 6, methods described in p. 173-249).

The term "marker" refers to a tracer that produces a signal that can be detected. Tracer list: Includes enzymes that produce signals that can be detected, such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, glucose-6-phosphate or dehydrogenase, Colorimetric, fluorescent or luminescent detection; chromophores, such as fluorescent, luminescent, dye compounds; electron density groups, by electron microscopy or by electrical conductivity, etc., by amperometric, voltammetric or impedance measurements Method detection; groups, detected by optical methods such as diffraction, surface plasmon resonance, or contact angle changes, or atomic force spectral tunneling; physical molecules such as ³² P, ³⁵ S or ¹²⁵ I.

The above hybridization probe is a detection probe. The probe is labeled with a probe labeled with a marker, as described by Tyagi & Kramer (Nature biotech, 1996, 14: 303-308), and the detection probe specifically refers to a "molecular beacon" detection probe. "Molecular beacon" has a stem-loop structure comprising a fluorescent group and a quenching group, and when the "molecular beacon" specific loop sequence is combined with its complementary target gene, the stem will unfold and be appropriate Fluorescence is emitted during the excitation of the wavelength. Specific detection probe further comprises, as shown in "reporter probe" NanoString ^TM 's technique, comprising a "color-coded bar code."

The detection probe comprises a fluorophore and a quencher, such as 6-carboxy-luciferin or 6-carboxy-X-rhodamine, and a quencher at the 3' end: 4-dimethylaminophenyl azobenzene Sulfonyl chloride.

In order to detect the hybridization reaction, the target sequence needs to be labeled, and may be a direct label, specifically, a marker is added inside the target sequence, or an indirect label is used, that is, a detection probe is used. Specifically before the hybridization, the implementation includes The step of labeling and/or cleavage of the target sequence, for example, the use of labeled deoxyribose triphosphates in an enzymatic amplification reaction. Imidazole or manganese chloride can achieve shearing action. The target sequence can also be labeled after the amplification step, for example, by hybridizing a detection probe by the sandwich hybridization technique described in the patent application no. WO 91/19812. A further preferred method is the method of labeling a nucleic acid sequence as described in the patent application of FR 2,780,059.

The hybridization probe described above is also a "capture" probe. The "capture" probe can be immobilized directly or indirectly on a solid substrate by any suitable method, such as by covalent bonding or adsorption. The solid substrate may be a synthetic material, or may be a chemically modified or non-chemically modified natural material, and may specifically be a polysaccharide such as a cellulose-based material, a dextran, a copolymer, and a polymer, based on cellulose. The material comprises paper, cellulose derivative, cellulose derivative comprises cellulose acetate, cellulose nitrate; may be natural fiber such as styrene type single or cotton or synthetic fiber; may be inorganic material, such as ceria, quartz , glass or ceramic; it can also be latex, magnetic particles, metal derivatives, gels, etc. The solid substrate may be a microtiter plate, which may be a fixed film in the patent application file of WO-A-94/12670, or may be a granule. For each target gene, different capture probes can also be immobilized on the substrate. Specifically, a gene wafer capable of immobilizing a large number of probes can be realized as a substrate. "Gene wafer" refers to a solid substrate that is very small but has a number of capture probes that are fixed at a predetermined location.

The concept of a genetic wafer, or DNA wafer, dates back to the early 1990s. It is based on multidisciplinary technology that combines microelectronics, nucleic acid chemistry, image analysis and information technology. Its working principle is the basis of molecular biology Basis: Hybridization, ie, complementary pairing of two DNA or RNA sequences. The method of gene chip is based on a capture probe immobilized on a solid substrate, and a sample of a target nucleic acid fragment directly or indirectly luciferin-labeled can interact with the probe. The capture probes are specifically immobilized on a substrate or wafer, and each hybridization gives a specific information related to the target gene. The collection of specific information makes it possible to measure the expression levels of one or more target genes. In order to analyze the expression level of a target gene, it is necessary to prepare a matrix containing a large number of probes which are associated with all or part of the target gene transcribed into mRNA. Among them, "low-density matrix" refers to a matrix containing less than 50 probes, "medium-density matrix" refers to a matrix containing 50 to 10,000 probes, and "high-density matrix" refers to more than 10,000 substrates. The matrix of the probe.

After the cRNA or cDNA of the target gene is hybridized with a specific capture probe, the wafer or matrix is washed, and the labeled cDNA or the complex of the cRNA and the capture probe can be displayed by a high affinity ligand bound to the fluorescent tag. And through the analysis of information technology to produce fluorescence, the results. For molecular diagnostics, Affymetrix DNA wafers ("Accessing Genetic Information with High-Density DNA arrays", M. Chee et al., Science, 1996, 274, 610-614." Light-generated ligonucleotide arrays for Rapid DNA sequence analysis", A. Cavani Pease et al., Proc. Natl. Acad. Sci. USA, 1994, 91, 5022-5026), in which the capture probe is often small, containing about 25 Nucleotides. Other biochips are disclosed in G. Ramsay, Nature Biotechnology, 1998, No. 16, p. 40-44; F. Ginot, Human Mutation, 1997, No. 10, p. -10;J.Cheng et al, Molecular diagnosis, 1996, No. 1 (3), p. 183-200; T. Livache et al, Nucleic Acids Research, 1994, No. 22 (15), p. 2915-2921 J. Cheng et al, Nature Biotechnology , 1998, No. 16, p. 541-546, or in U.S. Patent No. 4,981,783, U.S. Patent No. 5,700,637, U.S. Patent No. 5,445,934, U.S. Patent No. 5,744,305, and U.S. Patent No. 5,807,522. The main feature of a solid substrate is the hybridization of a conserved capture probe to a target nucleic acid fragment, but with minimal background noise.

There are three main ways in which the capture probe is attached to the substrate:

1. Place the pre-synthesized probe on the slide carrier. Such probes can be attached directly to the wafer by means of a micro, micro or ink jet device. This technique allows attached probes to have a range of bases ranging in size from a few bases (5 to 10) to a larger size of 60 bases (printing) to hundreds of bases ( Micro-printing).

The printing is similar to that of a printer, based on the small sphere fluid propelling at 4000 rpm. The microprinting involves attaching a long probe containing tens to hundreds of bases to the surface of a glass slide. These probes are usually from a database and are the product of amplification and purification. The DNA can be in an area of less than 4 cm ^{2 in} size to produce a microarray wafer that can carry about 10,000 spots of the identified area. A nylon membrane with a diameter of 0.5 to 1 mm is used to carry the amplified product (usually PCR amplified), referred to as a giant array, with a maximum density of 25 spots/cm ² . Many laboratories use this technology. In the present invention, the micro-printing technique is a bio-wafer, as shown in the patent application filed in WO-A-00/71750 or FR 00/14896, a certain volume of sample can be deposited on the bottom of the microtiter plate, or According to the patent application file of the application number: FR 00/14691, a certain number of other droplets can be deposited on the bottom of the microtiter plate or the Petri dish.

2. The second method of attaching wafers to substrates and wafers is in situ hybridization. This technique produces short probes directly on the surface of the wafer. This technique is based on in situ oligonucleotide synthesis (see application number: WO 89/10977 and application number WO 90/03382) and oligonucleotide synthesis procedures. It includes a moving reaction chamber in which the oligonucleotide derivatization reaction can be carried out along the surface of the glass.

3. The third technique is called lithography, a program developed by Affymetrix for gene chips. It is also an in situ hybridization technique derived from microprocessor technology. Specifically, the surface of the wafer is activated by an adherent which is an unstable chemical group capable of being photoactivated. These groups, once activated, can react with the 3' end of the oligonucleotide sequence. The wafer region can be selectively activated and activated by masking the surface of the wafer with a predetermined shape mask in which one or the other of the four nucleotides can be combined. The successful use of different masks allows the protection/reaction to alternately loop, thus producing oligonucleotide probes at spots of a size of on the order of tens of square microns. This method can produce hundreds of spots on a surface area of a few square centimeters. Advantages of lithography: N-mers wafers can be produced by 4 times N loops.

Amplification of the expression level of the target gene includes the following steps: (1) extraction of total RNA (including tRNAs, rRNAs, and mRNAs) of whole blood, and reverse transcription to obtain cDNA of the mRNAs. The reverse transcription reaction is achieved by reverse transcriptase, for example, from avian myeloblastoma virus AMV or from Moloney murine leukemia virus MMLV reverse transcriptase. If you want to get only the cDNA of mRNAs, you should reverse-transcribe thymine, thymine and polyA. The mRNA sequence hybridizes to form a polyA-polyT complex, which serves as a starting point for reverse transcription to obtain target gene-specific cDNAs and non-target gene-specific cDNAs. (2) Mixing the primer of the target gene with the cDNAs obtained in the step (1). The primers will hybridize with the target gene cDNAs, and the cDNAs from the target gene will be specifically amplified, and the non-target cDNAs will not be amplified, thereby obtaining a large number of target gene-specific cDNAs. For the purpose of the present invention, cDNAs of target gene-specific cDNAs are derived from mRNAs derived from the gene of interest. This step can be achieved by PCR amplification or other amplification methods as defined above. If PCR is used for amplification, multiple pairs of primer multiplex PCR can be used to simultaneously amplify multiple target genes. (3) Detecting or quantifying the target gene cDNAs obtained in the step (2) to determine the expression level of the target gene. The electrophoresis distances of the specific target gene cDNAs obtained can be detected according to their molecular weights. During electrophoresis detection, the migrated gel and medium include ethidium bromide. After a period of migration, the electrophoresis bands can be detected under ultraviolet light to directly determine the expression of target gene-specific cDNAs. The higher the expression level of cDNAs, the brighter the electrophoresis band. Electrophoresis techniques are well known in the art. It can also be determined by the range of expression levels. Considering the diversity of enzyme efficiencies in each step, the expression of the target gene can be corrected by the "housekeeping" gene, and the "housekeeping" gene is also expressed in normal people. By determining the ratio of the target gene to the housekeeping gene, that is, the ratio of the expression level of the target gene-specific cDNAs to the expression level of the housekeeping gene-specific cDNAs, the diversity between experiments can be corrected. Such techniques known to those skilled in the art are described in the publications by Bustin SA, J Mol Endocrinol, 2002, 29: 23-39; Giulietti A Methods, 2001, 25: 386-401.

The method for detecting the expression of the target gene by hybridization is as follows: (1) extracting total RNA of whole blood by step (1) of the above method, and performing reverse transcription to obtain cDNAs of the mRNAs, the mRNAs including mRNAs of the target gene, and non-target genes. mRNAs. (2) Mixing cDNAs with a substrate immobilized with a target gene-specific capture probe, the target gene-specific capture probe will hybridize with the target gene-specific cDNAs, while the non-target gene-specific cDNAs are not A hybridization reaction occurs. The hybridization reaction can be carried out on a solid substrate comprising all of the materials mentioned above. In a preferred embodiment of the invention, the substrate is a low, medium or high density substrate as defined above. Prior to the hybridization reaction, the cDNA of the target gene-specific cDNAs can be amplified by the aforementioned method to increase the possibility of hybridization. It is also possible to label and/or cleave the cDNA-specific cDNAs prior to the hybridization reaction as described above, for example, using labeled deoxynucleoside triphosphates in the amplification reaction. Imidazole and manganese chloride can be used for shearing. Target gene-specific cDNAs can also be labeled after completion of the amplification step, for example, by hybridizing a labeled probe by the sandwich hybridization technique described in WO-A-91/19812. A further preferred method of labeling and/or cleavage of nucleic acids is shown in the patent application Ser. No. WO 99/65926, WO 01/44507, WO 01/44506, WO 02/090584 or WO 02/090319. (3) The result of detecting the hybridization reaction. The detection is carried out by mixing a substrate with a labeled detection probe, and detecting a signal emitted by the label, the substrate carrying a target gene-specific capture probe, and the probe can be related to the target gene-specific cDNAs. Hybrid. If the target gene-specific cDNAs have been previously labeled, they can be directly detected.

Hybridization detection of target gene expression can also use the following methods: (1) with the above method step (1), extract total RNA from whole blood, reverse transcription to obtain the cDNAs of the material mRNAs. Using T7 polymerase, the complementary RNA of the cDNA is polymerized by the promoter to obtain a complementary RNA (cRNA) using a DNA template. A mixture comprising cRNAs specific for the target gene-specific cRNAs and non-target genes is obtained. (2) mixing cRNAs with a substrate immobilized with a target gene-specific capture probe, the target gene-specific capture probe will hybridize with the target gene-specific cRNAs, and the non-target gene-specific cRNAs are not A hybridization reaction occurs. By simultaneously immobilizing different capture probes on the substrate (one probe corresponding to one target gene), the expression levels of different target genes can be simultaneously detected. The cRNAs specific for the target gene may also be labeled and/or cleaved as described above prior to the hybridization reaction. (3) The result of detecting the hybridization reaction. Detection is achieved by mixing the matrix with a labeled detection probe that detects the signal emitted by the tag with a target gene-specific capture probe that can be associated with the target gene-specific cRNAs. Hybrid. If the target gene-specific cRNAs have been previously labeled, they can be directly detected. The advantages of cRNA are especially pronounced when there are a large number of probes on the substrate.

Detection of the level of gene expression of the invention can be achieved by detecting the polypeptide. Specifically, the polypeptide is combined with at least one specific ligand. The aforementioned reagent is an agent that detects the amount of the polypeptide encoded by the gene.

Preferably, the agent is an antibody or an affinity protein.

In a preferred embodiment of the invention, the expressed polypeptide is combined with at least two specific ligands. A particular ligand of the invention may be an antibody or an affinity protein designated "NanofitinTM."

The "antibody" includes polyclonal antibodies, monoclonal antibodies, humanized antibodies, and recombinant antibodies, and methods for their preparation are well known in the art.

The kit provided by the invention can accurately detect the possibility of colorectal cancer of the sample to be tested, and is simple to operate, only requires blood examination, and the patient has high compliance, which provides a new choice for screening of colorectal cancer, and has good selection. Industrial application prospects.

It is apparent that various other modifications, substitutions and changes can be made in the form of the above-described embodiments of the present invention without departing from the spirit and scope of the invention.

The above content of the present invention will be further described in detail below by way of specific embodiments in the form of embodiments. However, the scope of the above-mentioned subject matter of the present invention should not be construed as being limited to the following examples. Any technique implemented based on the above description of the present invention is within the scope of the present invention.

Figure 1. ROC curves for simultaneous detection of six genes.

Figure 2 Test results of 18 gene markers in the test set samples.

Figure 3 ROC curves of 18 genes simultaneously detected.

Example 1 Sample Collection

After informed consent, peripheral blood samples were obtained from 187 patients with colorectal cancer (CRC) diagnosed by clinical pathology and 173 patients with negative colonoscopy (CNC), collected between 2006 and 2010.

CRC was recruited from the Department of Colorectal Surgery, Shanghai Cancer Center, Fudan University, China, and was staged according to the TNM staging system recommended by the International Union Against Cancer (UICC). None of the patients received preoperative chemotherapy or radiation therapy. Patients with hereditary colorectal cancer or inflammatory bowel disease (Corhn disease or ulcerative colitis) are excluded from the present invention. CNCs were recruited at Shanghai Community Hospital and passed colonoscopy without any symptoms of colorectal cancer or polyps. The demographic characteristics and clinical characteristics of the test samples are shown in Table 1:

Blood samples were collected: take 2.5ml of each participant in the PAXgene ^TM Peripheral Blood RNA Tubes (PreAnalytix GmbH, Hombrechtikon, CH) , and processed according to the manufacturer's instruction method. At the Shanghai Cancer Center of Fudan University in China, blood samples of CRCs were collected one week after microscopy and before surgery. Shanghai Community Hospital, a week before the microscopic examination, collected blood samples from CNCs.

Grouping: Group 1: Includes 100 CRCs and 100 CNCs; Group 2: Includes 87 CRCs and 73 CNCs.

Example 2 Detection of expression levels of 18 genes such as DUSP2

1. Experimental method

(1) Selection of housekeeping genes

The geometric mean of the expression levels of CSNK1G2, DECR1, and FARP1 was referred to as the "meta housekeeping gene" as a correction factor for real-time quantitative PCR data.

(2) RNA extraction and real-time quantitative PCR detection

Whole blood were drawn: take 2.5ml of each participant in the PAXgene ^TM Peripheral Blood RNA Tubes (PreAnalytix GmbH, Hombrechtikon, CH) , press processing instructions; Extraction of total RNA: accordance with the instructions, with the PAXgene ^TM Blood RNA System (PreAnalytix) Total RNA was extracted; total RNA was measured with a spectrophotometer at an OD of 260 nm, and total RNA was detected using an RNA6000 Nano LabChip® kit (Agilent Technologies, Palo Alto, CA, USA) on an Agilent Bioanalyzer. RNA with a complete value above 7.0 was used for analysis; reverse transcription: primer pairs of the target genes listed below were used as primers, using the QuantiTect® reverse transcription kit (Qiagen GmbH, Hilden, Germany), according to the standard procedure of the instructions 320 ng of total RNA was reverse transcribed to obtain cDNA; cDNA amplification: Primer pairs of the target genes listed below were used as primers, using SYBR Premix Dimer Eraser kit (Takara biotechnology, Dalian, China) according to the manufacturer's standard Flow, Amplification of cDNA; cDNA Detection: Amplification was performed in real time using the Biosystems 7900HT Fast Real-Time PCR System (Life Technologies, Carlsbad, CA, USA), root The expression level of housekeeping gene expression of a target gene, the relative expression of a target gene is calculated: △ Ct (relative gene expression level) = Ct (target gene) - Ct (housekeeping gene), the relative expression of the gene of interest is calculated. A negative expression indicates that the Ct value of the target gene is lower than the Ct value of the housekeeping gene; positive expression indicates that the Ct value of the target gene is higher than the Ct value of the housekeeping gene.

Primer pair of housekeeping genes:

1, CSNK1G2

F: 5'-GCCGCAGTGATGTTCTAGC-3’

R: 3'-TCTGCTGCCGTGCAAATC-5’

2, DECR1:

F: 5'-CGATGCTACCACCTAATAGT-3’

R: 3'-TAGGCTGGACAGAAGAGT-5’

3. FARP1:

F: 5'-ACCTGTCGTTATTCCTATATCC-3’

R: 3'-GAAACCGTGTTCCCTGTG-5’

Primer pair of target gene:

1, DUSP2:

F: 5'-AACAAGCTGTGACAACCA-3’

R: 3'-CTGAGCACAAATAATTTTCCA-5’

2, NEAT1:

F: 5'-CAGAGACACAGGCATTCA-3’

R: 3'-GACTACACTCCTTGGTAACT-5';

3. MYBL1:

F: 5’TAATTGACACACTCTCTCCCTCTC-3’

R: 3'-TGGTGGTCGCTCTTTCCTTC-5’

4. ITGAM:

F: 5'ATCCAACCTACGGCAGCAG-3’

R: 3'-TCAAGAAGGCAATGTCACTATCC-5’

5, P2RY10:

F: 5’-TGTCCGAATCGCACTGTAT-3’

R: 3'-CATTGATGAACCACTCTCCTT-5’

6, GZMB 8

F: 5’-GAATCTGACTTACGCCATTATTA-3’

R: 3'-GCCATTGTTTCGTCCATAG-5’

7, SH2D2A 9

F: 5'CTAAGACAGCAAAGAAGTG-3’

R: 3'-AACCATTCCTCAGACAAC5’

8, PDE4D 10

F: 5'-TAAACGCAAAGGTGGGTTGATGTC-3’

R: 3'-TGATTCAAGGGCTGGGCAAG-5’

9, FAM198B

F: 5'-CGAGTGTCTCCCTCTGCTTCT-3’

R: 3'-CAAGTCAGTGGCTCAAAGTAGGAT-5’

10, GLT25D2

F: 5’-GACAGACAACCGTGACATC-3’

R: 3'-CCTGAATGAACCGCAAGC-5’

11, CD36

F: 5’ACTGGATTCACTTTACAATTTGC3

R: 3'-TGCCTTCTCATCACCAATG-5’

12, VSIG10

F: 5’TCTGACTTGAATTTGTACTCTTT3’

R: 3'-GCTCTGATATGCTTAGTTTAGTT-5’

13, NUDT16

F: 5'ACATAGACTGGAGGAGGTAATC-3’

R: 3'-GCATAGTCCGCTTTCTGTC-5’

14, PDZK1IP1

F: 5'-CTTCTCTGTGGCTCCAAC-3’

R: 3'-CTGGCTATACTTCAAGGG-5’

15, FKBP5

F: 5'-AGTTGTGAAAGAGTTGAAGACA-3’

R: 3'-TTAGGCTGAGGGAATAGAGAG-5’

16, ITPRIPL2

F: 5'-TCACCTTCTCGCTTCACA-3’

R: 3'-GTCTCCTGTTGGATGTCTTC-5’

17, IL1B

F: 5'-CCTGTCCTGCGTGTTGAAAG-3’

R: 3'-CTGCTTGAGAGGTGCTGATG-5’

18, DHRS13

F: 5'-GCTCACCAGATTTGTCTAAGAT-3’

R: 3'-AAACCCGTCAGTGTCCAG-5’

Example 3 Correlation between gene expression and colorectal cancer

1. Correlation between single gene expression and colorectal cancer

According to the method of Example 2, the expression levels of 18 genes in the blood samples of 200 participants (100 CRCs, 100 CNCs) of Group 1 in Example 1 were respectively detected, and the T-test was used to calculate the control group. And the average relative expression of the tumor group, establish the ROC curve, calculate the area under the curve of the ROC curve AUC, AUC can reflect the correlation between the gene and colorectal cancer.

(1) DUSP2 (dual specificity phosphatase 2):

The correlation between the expression level of DUSP2 gene and colorectal cancer was 0.75, and the average expression level of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(2) NEAT1 (nuclear paraspeckle assembly transcript 1):

The correlation between the expression of NEAT1 gene and colorectal cancer was 0.74, and the average expression of the control group and the tumor group was significantly different, P<0.01. The high expression of this gene can significantly increase the risk of colorectal cancer.

(3) MYBL1 (v-myb myeloblastosis viral oncogene homolog (avian)-like 1):

The correlation between the expression of MYBL1 gene and colorectal cancer was 0.73, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(4) ITGAM (integrin, alpha M):

The correlation between the expression of ITGAM gene and colorectal cancer was 0.74, and the average expression of the control group and the tumor group was significantly different, P<0.01. The high expression of this gene can significantly increase the risk of colorectal cancer.

(5) P2RY10 (purinergic receptor P2Y, G-protein coupled, 10):

The correlation between the expression of P2RY10 gene and colorectal cancer was 0.73, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene could significantly increase the risk of colorectal cancer.

(6) GZMB (granzyme B):

The correlation between the expression of GZMB gene and colorectal cancer was 0.73, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(7) SH2D2A (SH2 domain containing 2A):

The correlation between the expression of SH2D2A gene and colorectal cancer was 0.72, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(8) PDE4D (phosphodiesterase 4D, cAMP-specific):

The correlation between the expression level of PDE4D gene and colorectal cancer was 0.72, and the average expression level of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(9) FAM198B (family with sequence similarity 198, member B):

The correlation between the expression of FAM198B gene and colorectal cancer was 0.72, and the average expression of the control group and the tumor group was significantly different, P<0.01. The high expression of this gene can significantly increase the risk of colorectal cancer.

(10) GLT25D2 (glycosyltransferase 25 domain containing 2):

The correlation between the expression of GLT25D2 gene and colorectal cancer was 0.70, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(11) CD36 (thrombospondin receptor):

The correlation between the expression of CD36 gene and colorectal cancer was 0.69, and the average expression of the control group and the tumor group was significantly different, P<0.01. The high expression of this gene can significantly increase the risk of colorectal cancer.

(12) VSIG10 (V-set and immunoglobulin domain containing 10):

The correlation between the expression level of VSIG10 gene and colorectal cancer was 0.70, and the average expression level of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene could significantly increase the risk of colorectal cancer.

(13) NUDT16 (Nucleoside diphosphate-linked moiety X motif 16):

The correlation between the expression of NUDT16 gene and colorectal cancer was 0.68, and the average expression of the control group and the tumor group was significantly different, P<0.01. The high expression of this gene can significantly increase the risk of colorectal cancer.

(14) PDZK1IP1 (PDZK1 interacting protein 1):

The correlation between the expression of PDZK1IP1 gene and colorectal cancer was 0.68, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(15) FKBP5 (FK506 binding protein 5):

The correlation between the expression of FKBP5 gene and colorectal cancer was 0.65, and the average expression of the control group and the tumor group was significantly different, P<0.01. The high expression of this gene can significantly increase the risk of colorectal cancer.

(16) ITPRIPL2 (inositol 1,4,5-trisphosphate receptor interacting protein-like 2):

The correlation between the expression of ITPRIPL2 gene and colorectal cancer was 0.67, and the average expression of the control group and the tumor group was significantly different, P<0.01. Significantly increase the risk of colorectal cancer.

(17) IL1B (interleukin 1, beta):

The correlation between the expression of IL1B gene and colorectal cancer was 0.67, and the average expression of the control group and the tumor group was significantly different, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

(18) DHRS13 (dehydrogenase/reductase (SDR family) member 13):

The correlation between the expression of DHRS13 gene and colorectal cancer was 0.69. The average expression of DHRS13 gene was significantly different between the control group and the tumor group, P<0.01. The low expression of this gene can significantly increase the risk of colorectal cancer.

2. Correlation between 6 gene expression levels and colorectal cancer

The expression levels of the following 6 genes in 200 samples were statistically analyzed: NEAT1, FAM198B, ITGAM, MYBL1, PDZK1TP1, VSIG10. The relative expression is input into the statistical analysis software, and the program runs the support vector machine to establish a classification model and calculate the risk coefficient. The risk factor is a minimum of 0 and a maximum of 100%. The dotted line indicates the threshold of the control group and colorectal cancer patients. If the risk factor of the sample is greater than 50%, it is classified as a colorectal cancer patient; if the risk factor of the sample is less than 50%, it is classified as a non-colorectal cancer patient. According to the classification model, the risk factor of colorectal cancer in each sample to be tested can be calculated.

Detecting 160 participants in Group 2 of Example 1 according to the method of Example 2 The expression levels of the above six genes in blood samples (87 CRCs, 73 CNCs) were classified according to the expression levels of the six genes, and the ROC curve was established to calculate the area under the curve.

The 6 gene detection ROC curves are shown in Figure 1, and the area under the curve AUC is 0.86. When the threshold is 0.5, the accuracy of the classification model is 77.5% (95% confidence is 0.70-0.84), sensitivity is 72.4% (95% confidence is 0.62-0.81), and specificity is 83.6% ( 95% confidence is 0.73-0.91).

It indicated that the expression of 6 genes was correlated with colorectal cancer by 0.86, and the accuracy, sensitivity and specificity of detection were higher.

Correlation between 3, 18 gene expression levels and colorectal cancer

Statistical analysis was performed on the expression levels of 18 genes in the above 200 samples: the relative expression was input into the statistical analysis software, and the program was run by the support vector machine to establish a classification model and calculate the risk factor (as shown in Figure 2). The risk factor is a minimum of 0 and a maximum of 100%. The dotted line indicates the threshold of the control group and colorectal cancer patients. If the risk factor of the sample is greater than 50%, it is classified as a colorectal cancer patient; if the risk factor of the sample is less than 50%, it is classified as a non-colorectal cancer patient. According to the classification model, the risk factor of colorectal cancer in each sample to be tested can be calculated.

The expression levels of 18 genes in blood samples of 160 participants (87 CRCs, 73 CNCs) in Group 1 of Example 1 were tested according to the method of Example 3. According to the expression levels of 18 genes, the above classification was used. Model classification, establish ROC curve, calculate the area under the curve.

The ROC curve is shown in Figure 2. The area under the curve is AUC of 0.94. When the threshold is 0.5, the accuracy of the classification model is 85.6% (95% confidence is 0.79-0.90), and the sensitivity is 83.9% (95% confidence is 0.74-0.90). The opposite sex was 87.7% (95% confidence is 0.77-0.94).

It indicated that when 18 genes were detected simultaneously, the correlation between the expression level and colorectal cancer was 0.94, and the accuracy, sensitivity and specificity of detection were high.

In summary, the 18 genes of the present invention are highly correlated with colorectal cancer, and their high/low expression can significantly increase the possibility of colorectal cancer, and can be screened by separately detecting the expression levels of these 18 genes. The sample is likely to have colorectal cancer. Simultaneous detection of the expression levels of multiple genes can significantly improve the accuracy of colorectal cancer screening compared to the detection of a single gene.

Example 4 Composition of the kit of the present invention and detection of a sample to be tested

1, the composition of the kit

Real-time quantitative PCR detection kit (50 people):

(1) Total RNA extraction reagent

PAXgeneTM Blood RNA System.

Colorectal cancer negative samples and colorectal cancer positive samples.

(2) Reverse transcription reagent

Reverse transcriptase (50 ul); reverse transcription buffer (200 ul); genomic DNA removal buffer (100 ul); primer (50 ul); enzyme-free water (1.9 ml); PCR reaction plate: containing forward primer solution and 384-well plate of reverse primer solution.

Primer pair of housekeeping genes:

1, CSNK1G2

F: 5'-GCCGCAGTGATGTTCTAGC-3’

R: 3'-TCTGCTGCCGTGCAAATC-5’

2, DECR1:

F: 5'-CGATGCTACCACCTAATAGT-3’

R: 3'-TAGGCTGGACAGAAGAGT-5’

3. FARP1:

F: 5'-ACCTGTCGTTATTCCTATATCC-3’

R: 3'-GAAACCGTGTTCCCTGTG-5’

Primer pair of target gene:

1, DUSP2:

F: 5'-AACAAGCTGTGACAACCA-3’

R: 3'CTGAGCACAAATAATTTTCCA-5’

and / or

2, NEAT1:

F: 5'-CAGAGACACAGGCATTCA-3’

R: 3'-GACTACACTCCTTGGTAACT-5';

and / or

3. MYBL1:

F: 5’TAATTGACACACTCTCTCCCTCTC-3’

R: 3'-TGGTGGTCGCTCTTTCCTTC-5’

and / or

4. ITGAM:

F: 5'ATCCAACCTACGGCAGCAG-3’

R: 3'-TCAAGAAGGCAATGTCACTATCC-5’

and / or

5, P2RY10:

F: 5’-TGTCCGAATCGCACTGTAT-3’

R: 3'-CATTGATGAACCACTCTCCTT-5’

and / or

6, GZMB 8

F: 5’-GAATCTGACTTACGCCATTATTA-3’

R: 3'-GCCATTGTTTCGTCCATAG-5’

and / or

7, SH2D2A 9

F: 5'CTAAGACAGCAAAGAAGTG-3’

R: 3'-AACCATTCCTCAGACAAC-5’

and / or

8, PDE4D 10

F: 5'-TAAACGCAAAGGTGGGTTGATGTC-3’

R: 3'-TGATTCAAGGGCTGGGCAAG-5’

and / or

9, FAM198B

F: 5'-CGAGTGTCTCCCTCTGCTTCT-3’

R: 3'-CAAGTCAGTGGCTCAAAGTAGGAT-5’

and / or

10, GLT25D2

F: 5’-GACAGACAACCGTGACATC-3’

R: 3'-CCTGAATGAACCGCAAGC-5’

and / or

11, CD36

F: 5’ACTGGATTCACTTTACAATTTGC3

R: 3'-TGCCTTCTCATCACCAATG-5’

and / or

12, VSIG10

F: 5’TCTGACTTGAATTTGTACTCTTT3’

R: 3'-GCTCTGATATGCTTAGTTTAGTT-5’

and / or

13, NUDT16

F: 5'ACATAGACTGGAGGAGGTAATC-3’

R: 3'-GCATAGTCCGCTTTCTGTC-5’

and / or

14, PDZK1IP1

F: 5'-CTTCTCTGTGGCTCCAAC-3’

R: 3'-CTGGCTATACTTCAAGGG-5’

and / or

15, FKBP5

F: 5'-AGTTGTGAAAGAGTTGAAGACA-3’

R: 3'-TTAGGCTGAGGGAATAGAGAG-5’

and / or

16, ITPRIPL2

F: 5'-TCACCTTCTCGCTTCACA-3’

R: 3'-GTCTCCTGTTGGATGTCTTC-5’

and / or

17, IL1B

F: 5'-CCTGTCCTGCGTGTTGAAAG-3’

R: 3'-CTGCTTGAGAGGTGCTGATG-5’

and / or

18, DHRS13

F: 5'-GCTCACCAGATTTGTCTAAGAT-3’

R: 3'-AAACCCGTCAGTGTCCAG-5’

(3) cDNA amplification reagent

Mixing buffer containing reaction enzyme and fluorescent dye (20 ml); ROX reference dye (800 ul) PCR reaction plate: PCR reaction plate: PCR reaction plate in the same reverse transcription reagent.

2. How to use the kit

(1) 2.5 ml peripheral blood of the participants to be tested was collected from a PAXgeneTM blood RNA tube (PreAnalytix GmbH, Hombrechtikon, CH) and processed according to the manufacturer's instructions; according to the manufacturer's instructions, the PAXgeneTM blood RNA system (PreAnalytix) The total RNA of the sample to be tested, the colorectal cancer negative sample, and the colorectal cancer positive sample is extracted.

(2) Reverse transcription

Using the total RNA of the step (1) as a template, the above target reverse transcription reagent was used to obtain cDNAs of 18 target genes and housekeeping genes.

(3) cDNA amplification

The cDNA obtained in the step (2) was taken as a template, amplified with the above cDNA amplification reagent, and the amount of cDNA was detected using a Biosystems 7900HT Fast Real-Time PCR system.

(4) Compare the expression levels of 18 genes of the samples to be tested, colorectal cancer negative samples and colorectal cancer positive samples, and judge the risk of colorectal cancer in the samples to be tested.

Remark: In the kit of the present invention, the number of target gene primer pairs can be arbitrarily selected one or more pairs as needed.

In summary, the 18 genes such as DUSP2 of the present invention are closely related to colorectal cancer, and the high/low expression of these genes can significantly increase the risk of colorectal cancer, and the samples to be tested can be determined by detecting the expression levels of these 18 genes individually or simultaneously. The possibility of colorectal cancer. The kit of the invention has high accuracy, sensitivity and specificity, and has good application prospects.

references:

1. Stamova BS, Apperson M, Walker WL, Tian Y, Xu H, et al. (2009), Identification and validation of suitable endogenous reference genes for gene expression studies in human peripheral blood. BMC Med Genomics 2:49.

2. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, et al. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3: H34 .

3. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression Data using real-time quantitative PCR and the 2(-Delta Delta C(T)) ethod. Methods 25: 402-408.

4. Peng H, Long F, Ding C (2005) Feature selection based on mutual Information: criteria of max-dependency, max-relevance, and min-redundancy. IEEE Trans Pattern Anal Mach Intell 27: 1226-1238.

5. Guyon I, Weston J, Barnhill S, Vapnik V (2002) Gene selection for cancer classification using support vector machines. Machine learning 46: 389-422.

<110> BioMerieux AG

<120> A colorectal cancer screening kit

<130> GY224-12P1207

<160> 83

<170> PatentIn version 3.5

<210> 1

<211> 1708

<212> DNA

<213> Nucleotide sequence of DUSP2 gene

<400> 1

<210> 2

<211> 22743

<212> DNA

<213> Nucleotide sequence of the NEAT1 gene

<400> 2

<210> 3

<211> 5188

<212> DNA

<213> Nucleotide sequence of MYBL1 gene

<400> 3

<210> 4

<211> 5008

<212> DNA

<213> Nucleotide sequence II of MYBL1 gene

<400> 4

<210> 5

<211> 4745

<212> DNA

<213> The nucleotide sequence of the ITGAM gene

<400> 5

<210> 6

<211> 4742

<212> DNA

<213> The nucleotide sequence of the ITGAM gene

<400> 6

<210> 7

<211> 1871

<212> DNA

<213> Nucleotide sequence of P2RY10 gene

<400> 7

<210> 8

<211> 1679

<212> DNA

<213> Nucleotide sequence 2 of P2RY10 gene

<400> 8

<210> 9

<211> 941

<212> DNA

<213> Nucleotide sequence of GZMB gene

<400> 9

<210> 10

<211> 1691

<212> DNA

<213> Nucleotide sequence of SH2D2A gene

<400> 10

<210> 11

<211> 1661

<212> DNA

<213> Nucleotide sequence II of SH2D2A gene

<400> 11

<210> 12

<211> 1630

<212> DNA

<213> Nucleotide sequence of SH2D2A gene

<400> 12

<210> 13

<211> 1540

<212> DNA

<213> Nucleotide sequence of SH2D2A gene

<400> 13

<210> 14

<211> 8240

<212> DNA

<213> Nucleotide sequence of PDE4D gene

<400> 14

<210> 15

<211> 7783

<212> DNA

<213> Nucleotide sequence 2 of PDE4D gene

<400> 15

<210> 16

<211> 8130

<212> DNA

<213> Nucleotide sequence 3 of PDE4D gene

<400> 16

<210> 17

<211> 7979

<212> DNA

<213> The nucleotide sequence of the PDE4D gene

<400> 17

<210> 18

<211> 7757

<212> DNA

<213> Nucleotide sequence of PDE4D gene

<400> 18

<210> 19

<211> 8395

<212> DNA

<213> The nucleotide sequence of the PDE4D gene

<400> 19

<210> 20

<211> 7715

<212> DNA

<213> Nucleotide sequence of the PDE4D gene

<400> 20

<210> 21

<211> 7801

<212> DNA

<213> Nucleotide sequence of PDE4D gene

<400> 21

<210> 22

<211> 7591

<212> DNA

<213> Nine nucleotide sequence of PDE4D gene

<400> 22

<210> 23

<211> 4833

<212> DNA

<213> Nucleotide sequence of FAM198B gene

<400> 23

<210> 24

<211> 4854

<212> DNA

<213> Nucleotide sequence II of FAM198B gene

<400> 24

<210> 25

<211> 4809

<212> DNA

<213> Nucleotide sequence of FAM198B gene

<400> 25

<210> 26

<211> 5182

<212> DNA

<213> Nucleotide sequence of GLT25D2 gene

<400> 26

<210> 27

<211> 4727

<212> DNA

<213> Nucleotide sequence of CD36 gene

<400> 27

<210> 28

<211> 2069

<212> DNA

<213> Nucleotide sequence II of CD36 gene

<400> 28

<210> 29

<211> 2108

<212> DNA

<213> Nucleotide sequence III of CD36 gene

<400> 29

<210> 30

<211> 1814

<212> DNA

<213> Nucleotide sequence of CD36 gene

<400> 30

<210> 31

<211> 1989

<212> DNA

<213> Nucleotide sequence of CD36 gene

<400> 31

<210> 32

<211> 6117

<212> DNA

<213> Nucleotide sequence of NUDT16 gene

<400> 32

<210> 33

<211> 5943

<212> DNA

<213> Nucleotide sequence III of NUDT16 gene

<400> 33

<210> 34

<211> 3793

<212> DNA

<213> Nucleotide sequence of FKBP5 gene

<400> 34

<210> 35

<211> 3951

<212> DNA

<213> Nucleotide sequence of FKBP5 gene

<400> 35

<210> 36

<211> 3838

<212> DNA

<213> Nucleotide sequence of FKBP5 gene

<400> 36

<210> 37

<211> 7722

<212> DNA

<213> Nucleotide sequence of ITPRIPL2 gene

<400> 37

<210> 38

<211> 1498

<212> DNA

<213> Nucleotide sequence of IL1B gene

<400> 38

<210> 39

<211> 1939

<212> DNA

<213> Nucleotide sequence of DHRS13 gene

<400> 39

<210> 40

<211> 894

<212> DNA

<213> Nucleotide sequence of PDZK1IP1 gene

<400> 40

<210> 41

<211> 5003

<212> DNA

<213> Nucleotide sequence of VSIG10 gene

<400> 41

<210> 42

<211> 18

<212> DNA

<213> Reverse transcription of the DUSP2 gene transcribed mRNA forward amplification primer

<400> 42

<210> 43

<211> 21

<212> DNA

<213> Reverse Transcription Reverse Amplification Primer of DUSP2 Gene Transcribed mRNA

<400> 43

<210> 44

<211> 18

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from the NEAT1 gene

<400> 44

<210> 45

<211> 20

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from the NEAT1 gene

<400> 45

<210> 46

<211> 24

<212> DNA

<213> Reverse transcription forward amplification primers for MYBL1 gene transcribed mRNA

<400> 46

<210> 47

<211> 20

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for mRNA Transcribed by MYBL1 Gene

<400> 47

<210> 48

<211> 19

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from ITGAM gene

<400> 48

<210> 49

<211> 23

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from ITGAM gene

<400> 49

<210> 50

<211> 19

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from the P2RY10 gene

<400> 50

<210> 51

<211> 21

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for P2RY10 Gene Transcribed mRNA

<400> 51

<210> 52

<211> 23

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from GZMB gene

<400> 52

<210> 53

<211> 19

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from GZMB gene

<400> 53

<210> 54

<211> 19

<212> DNA

<213> Reverse Transcription Forward Amplification Primer of SH2D2A Gene Transcribed mRNA

<400> 54

<210> 55

<211> 18

<212> DNA

<213> Reverse Transcription Reverse Amplification Primer of SH2D2A Gene Transcribed mRNA

<400> 55

<210> 56

<211> 24

<212> DNA

<213> Reverse Transcription Forward Amplification Primers for PDE4D Gene Transcribed mRNA

<400> 56

<210> 57

<211> 20

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for PDE4D Gene Transcribed mRNA

<400> 57

<210> 58

<211> 21

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from FAM198B gene

<400> 58

<210> 59

<211> 24

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from the FAM198B gene

<400> 59

<210> 60

<211> 19

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from the GLT25D2 gene

<400> 60

<210> 61

<211> 18

<212> DNA

<213> Reverse transcription amplification primers for mRNA transcribed from the GLT25D2 gene

<400> 61

<210> 62

<211> 23

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from CD36 valency gene

<400> 62

<210> 63

<211> 19

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for mRNA Transcribed by CD36 Gene

<400> 63

<210> 64

<211> 22

<212> DNA

<213> Reverse transcription forward amplification primers for NUDT16 gene transcribed mRNA

<400> 64

<210> 65

<211> 19

<212> DNA

<213> Reverse transcription reverse amplification primers for NUDT16 gene transcribed mRNA

<400> 65

<210> 66

<211> 22

<212> DNA

<213> Reverse transcription of the FKBP5 gene transcribed mRNA forward amplification primer

<400> 66

<210> 67

<211> 21

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from the FKBP5 gene

<400> 67

<210> 68

<211> 18

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from ITPRIPL2 gene

<400> 68

<210> 69

<211> 20

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from ITPRIPL2 gene

<400> 69

<210> 70

<211> 20

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from the IIL1B gene

<400> 70

<210> 71

<211> 20

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for mRNA Transcribed by IL1B Gene

<400> 71

<210> 72

<211> 22

<212> DNA

<213> Reverse Transcription Forward Amplification Primers for DHRS13 Gene Transcribed mRNA

<400> 72

<210> 73

<211> 18

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for DHRS13 Gene Transcribed mRNA

<400> 73

<210> 74

<211> 18

<212> DNA

<213> Reverse Transcription Forward Amplification Primer of PDZK1IP1 Gene Transcribed mRNA

<400> 74

<210> 75

<211> 18

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from PDZK1IP1 gene

<400> 75

<210> 76

<211> 23

<212> DNA

<213> Reverse Transcription Forward Amplification Primers for VSIG10 Gene Transcribed mRNA

<400> 76

<210> 77

<211> 23

<212> DNA

<213> Reverse Transcription Reverse Amplification Primers for VSIG10 Gene Transcribed mRNA

<400> 77

<210> 78

<211> 19

<212> DNA

<213> Reverse transcription of the CSNK1G2 gene transcribed mRNA forward amplification primer

<400> 78

<210> 79

<211> 18

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from the CSNK1G2 gene

<400> 79

<210> 80

<211> 20

<212> DNA

<213> Reverse transcription forward amplification primers for mRNA transcribed from the DECR1 gene

<400> 80

<210> 81

<211> 18

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from the DECR1 gene

<400> 81

<210> 82

<211> 22

<212> DNA

<213> Reverse Transcription Positive Amplification Primers for FARP1 Gene Transcribed mRNA

<400> 82

<210> 83

<211> 18

<212> DNA

<213> Reverse transcription reverse amplification primers for mRNA transcribed from FARP1 gene

<400> 83

Claims (178)

A colorectal cancer screening kit, characterized in that it comprises a related reagent for detecting the expression levels of at least the genes NEAT1 and MYBL1: NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4. Also included are colorectal cancer positive samples and colorectal cancer negative samples. The screening kit according to claim 1, characterized in that it further comprises a related reagent for detecting the expression level of at least one or any of the following genes: DUSP2, as shown in SEQ ID NO: ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, such as SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, As shown in SEQ ID NO:41. The screening kit according to claim 2, characterized in that the reagent further included is a related reagent for detecting the expression level of the gene DUSP2, wherein the gene DUSP2 is represented by SEQ ID NO: 1. The screening kit according to claim 3, characterized in that it further comprises a related reagent for detecting the expression level of the gene ITGAM, wherein Since ITGAM is as shown in SEQ ID NO: 5 or 6. The screening kit according to claim 4, characterized in that it further comprises a related reagent for detecting the expression level of the gene P2RY10, wherein the gene P2RY10 is as shown in SEQ ID NO: 7 or 8. The screening kit according to claim 5, characterized in that it further comprises a related reagent for detecting the expression level of the gene GZMB, wherein the gene GZMB is as shown in SEQ ID NO: 9. The screening kit according to claim 6, characterized in that it further comprises a related reagent for detecting the expression level of the gene SH2D2A, wherein the gene SH2D2A is as shown in SEQ ID NO: 10, 11, 12 or 13. . The screening kit according to claim 7, characterized in that it further comprises a related reagent for detecting the expression level of the gene PDE4D, wherein the gene PDE4D is SEQ ID NO: 14, 15, 16, 17, 18 , 19, 20, 21 or 22. The screening kit according to claim 8 is characterized in that it further comprises a related reagent for detecting the expression level of the gene FAM198B, wherein the gene FAM198B is represented by SEQ ID NO: 23, 24 or 25. The screening kit according to claim 9, characterized in that it further comprises a related reagent for detecting the expression level of the gene GLT25D2, wherein the gene GLT25D2 is represented by SEQ ID NO: 26. The screening kit according to claim 10, characterized in that it further comprises a related reagent for detecting the expression level of the gene CD36, wherein the gene CD36 is SEQ ID NO: 27, 28, 29, 30 or 31. Shown. The screening kit of claim 11, wherein: It also includes a related reagent for detecting the expression level of the gene VSIG10, wherein the gene VSIG10 is shown as SEQ ID NO:41. The screening kit according to claim 12, characterized in that it further comprises a related reagent for detecting the expression level of the gene NUDT16, wherein the gene NUDT16 is as shown in SEQ ID NO: 32 or 33. The screening kit according to claim 13 is characterized in that it further comprises a related reagent for detecting the expression level of the gene PDZK1IP1, wherein the gene PDZK1IP1 is represented by SEQ ID NO:40. A screening kit according to claim 14, which further comprises a related reagent for detecting the expression level of the gene FKBP5, wherein the gene FKBP5 is represented by SEQ ID NO: 34, 35 or 36. The screening kit according to claim 15 is characterized in that it further comprises a related reagent for detecting the expression level of the gene ITPIPPL2, wherein the gene ITPPIPL2 is represented by SEQ ID NO:37. The screening kit according to claim 16, which further comprises a related reagent for detecting the expression level of the gene IL1B, wherein the gene IL1B is represented by SEQ ID NO:38. The screening kit according to claim 17, which further comprises a related reagent for detecting the expression level of the gene DHRS13, wherein the gene DHRS13 is represented by SEQ ID NO:39. A screening kit according to claim 2, characterized in that it comprises a related reagent for detecting the expression level of the following gene: FAM198B, as shown in SEQ ID NO: 23, 24 or 25; ITGAM, such as SEQ ID NO: 5 or 6; PDZK1IP1, as shown in SEQ ID NO: 40; VSIG10, As shown in SEQ ID NO:41. The screening kit according to any one of claims 1 to 19, wherein the reagent is a reagent for detecting the amount of RNA transcribed by the gene. A screening kit according to claim 20, wherein the RNA is mRNA. A screening kit according to claim 20, wherein the reagent is a probe. The screening kit according to claim 21, wherein the reagent is an agent that detects the amount of cDNA complementary to the mRNA. The screening kit according to claim 23, wherein the reagent is an agent that detects the amount of cRNA complementary to the cDNA. A screening kit according to claim 23 or 24, wherein the reagent is a probe. The screening kit according to any one of claims 1 to 19, wherein the reagent is an agent that detects the amount of the polypeptide encoded by the gene. The screening kit according to claim 26, wherein the reagent is an antibody, an antibody fragment or an affinity protein. Use of a gene for the preparation of a colorectal cancer screening reagent comprising NEAT1 and MYBL1, wherein NEAT1 is set forth in SEQ ID NO: 2; MYBL1 is set forth in SEQ ID NO: 3 or 4. The use according to claim 28, wherein the gene further comprises at least one or any of the following genes: DUSP2, such as SEQ ID NO: 1; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, eg SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as SEQ ID NO: 40; VSIG10, as shown in SEQ ID NO:41. The use according to claim 29, characterized in that the gene further included is DUSP2, and DUSP2 is represented by SEQ ID NO: 1. The use according to claim 30, wherein the gene further comprises ITGAM, and ITGAM is as shown in SEQ ID NO: 5 or 6. The use according to claim 31, wherein the gene further comprises P2RY10, and P2RY10 is represented by SEQ ID NO: 7 or 8. The use according to claim 32, wherein the gene further comprises GZMB, and the GZMB is represented by SEQ ID NO: 9. The use according to claim 33, wherein the gene further comprises SH2D2A, and SH2D2A is represented by SEQ ID NO: 10, 11, 12 or 13. The use according to claim 34, wherein the gene further comprises PDE4D, and PDE4D is represented by SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22. The use according to claim 35, wherein the gene further comprises FAM198B, and FAM198B is represented by SEQ ID NO: 23, 24 or 25. The use according to claim 36, wherein the gene further comprises GLT25D2, and GLT25D2 is represented by SEQ ID NO: 26. The use according to claim 37, wherein the gene further comprises CD36, and CD36 is represented by SEQ ID NO: 27, 28, 29, 30 or 31. The use according to claim 38, wherein the gene further comprises VSIG10, and VSIG10 is represented by SEQ ID NO:41. The use according to claim 39, wherein the gene further comprises NUDT16, and NUDT16 is represented by SEQ ID NO: 32 or 33. The use according to claim 40, wherein the gene further comprises PDZK1IP1, and PDZK1IP1 is represented by SEQ ID NO:40. The use according to claim 41, wherein the gene further comprises FKBP5, and FKBP5 is represented by SEQ ID NO: 34, 35 or 36. The use according to claim 42 is characterized in that the gene further comprises ITPRIPL2, and ITPRIPL2 is represented by SEQ ID NO:37. The use according to claim 43, wherein the gene further comprises IL1B, and IL1B is represented by SEQ ID NO:38. The use according to claim 44, wherein the gene further comprises DHRS13, and DHRS13 is represented by SEQ ID NO:39. The use according to claim 29, characterized in that the genes further included are FAM198B, ITGAM, PDZK1IP1 and VSIG10, wherein FAM198B is represented by SEQ ID NO: 23, 24 or 25; ITGAM is SEQ. ID NO: 5 or 6; PDZK1IP1 is shown in SEQ ID NO: 40; VSIG10 is shown in SEQ ID NO: 41. The use according to any one of claims 28 to 46, wherein the reagent is a related reagent for detecting a gene expression level. The use according to any one of claims 28 to 46, wherein the reagent comprises a colorectal cancer positive sample and a colorectal cancer negative sample. The use according to any one of claims 28 to 46, wherein the reagent is an RNA that detects transcription of the gene. The use according to claim 49, characterized in that the RNA is mRNA. The use according to claim 49, wherein the reagent is a probe. The use according to claim 50, wherein the reagent is an agent that detects the amount of cDNA complementary to the mRNA. The use according to claim 52, wherein the reagent is an agent that detects the amount of cRNA complementary to the cDNA. The use according to claim 52, wherein the reagent is a probe. The use of any one of claims 28 to 46, characterized in that The reagent is an agent that detects the amount of the polypeptide encoded by the gene. The use according to claim 55, wherein the reagent is an antibody or an affinity protein. Use of an agent for detecting gene expression in a human sample for preparing a colorectal cancer screening kit, the detection reagent comprising an agent for detecting an amount of an expression product of at least a gene in the genome: NEAT1, as shown in SEQ ID NO: MYBL1, as shown in SEQ ID NO: 3 or 4; wherein the detection reagent is used in the following manner: (1) determining the level of gene-transcribed RNA in the genome of the blood sample of the subject; (2) detecting the subject Gene expression in blood samples. The use of claim 57, wherein the human sample is a human blood sample. The use according to claim 57, wherein the genome further comprises at least one or any of the following genes: DUSP2, as shown in SEQ ID NO: 1; ITGAM, SEQ ID NO: 5 Or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, such as SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36 , as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, such as SEQ ID NO: 37 Shown; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The use according to claim 59, wherein the genome further comprises a gene of DUSP2, and the DUSP2 is represented by SEQ ID NO: 1. The use according to claim 60, wherein the genome further comprises the gene ITGAM, and the ITGAM is as shown in SEQ ID NO: 5 or 6. The use according to claim 61, wherein the genome further comprises the gene P2RY10, and the P2RY10 is as shown in SEQ ID NO: 7 or 8. The use according to claim 62, wherein the genome further comprises the gene GZMB, and the GZMB is as shown in SEQ ID NO: 9. The use according to claim 63, wherein the genome further comprises the gene SH2D2A, and the SH2D2A is as shown in SEQ ID NO: 10, 11, 12 or 13. The use according to claim 64, wherein the genome further comprises the gene PDE4D, and the PDE4D is as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22. The use according to claim 65, wherein the genome further comprises the gene FAM198B, and the FAM198B is represented by SEQ ID NO: 23, 24 or 25. The use according to claim 66, wherein the genome further comprises the gene GLT25D2, and the GLT25D2 is represented by SEQ ID NO: 26. The use according to claim 67, wherein the genome further comprises the gene CD36, and the CD36 is as shown in SEQ ID NO: 27, 28, 29, 30 or 31. The use according to claim 68, wherein the genome further comprises the gene VSIG10, and the VSIG10 is represented by SEQ ID NO:41. The use according to claim 69, wherein the genome further comprises the gene NUDT16, and the NUDT16 is represented by SEQ ID NO: 32 or 33. The use according to claim 70, wherein the genome further comprises the gene PDZK1IP1, and the PDZK1IP1 is represented by SEQ ID NO:40. The use according to claim 71, wherein the genome further comprises the gene FKBP5, and the FKBP5 is represented by SEQ ID NO: 34, 35 or 36. The use according to claim 72, wherein the genome further comprises the gene ITPRIPL2, and the ITPRIPL2 is represented by SEQ ID NO:37. The use according to claim 73, wherein the genome further comprises the gene IL1B, and the IL1B is represented by SEQ ID NO:38. The use according to claim 74, wherein the genome further comprises the gene DHRS13, and the DHRS13 is set forth in SEQ ID NO:39. The use according to claim 59, wherein the genome comprises the following six genes: NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; FAM198B As shown in SEQ ID NO: 23, 24 or 25; ITGAM is shown in SEQ ID NO: 5 or 6; PDZK1IP1 is shown in SEQ ID NO: 40; VSIG10 is shown in SEQ ID NO: 41. The use according to claim 59, wherein the genome comprises the following 18 genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, such as SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, eg SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5 , as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, eg SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The use according to any one of claims 57 to 76, wherein the sample is a colorectal cancer positive sample. The use according to any one of claims 57 to 76, wherein the sample is a colorectal cancer negative sample. The use according to any one of claims 57 to 76, wherein the step (1) uses at least one oligonucleotide. The use according to claim 80, wherein one oligonucleotide hybridizes only to one gene-transcribed RNA, and/or can hybridize to a cDNA complementary to the RNA transcribed by the gene. The use according to claim 81, characterized in that the step (1) comprises the steps of: a, amplifying the RNA transcribed by the gene to obtain an amplification product; b, using at least one primer detection step The amount of amplification product obtained in a. The use according to claim 82, wherein the step (1) comprises the steps of: i. hybridizing a cDNA complementary to the RNA transcribed by the gene with at least one probe to obtain a hybrid product; And detecting the amount of the hybridization product obtained in the step i. The use according to any one of claims 57 to 76, wherein the step (1) comprises a method of amplifying RNA transcribed by the gene. The use according to any one of claims 57 to 76, wherein the step (1) comprises a method of detecting the amount of cDNA complementary to the RNA transcribed by the gene. The use according to any one of claims 57 to 76, characterized in that the step (1) uses at least one probe. The use according to any one of claims 57 to 76, wherein the step (1) uses at least one primer. A kit for detecting gene expression in a human sample for screening colorectal cancer, comprising: a specific partner comprising 18 expression products of 18 genes, each partner specifically cooperating with each gene, the 18 genes As shown below: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as in SEQ ID NO: 5 or 6. P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, such as SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as shown in SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The kit according to claim 88, wherein the kit is a kit for detecting gene expression in a human blood sample. The kit of claim 88, wherein the specific partner is an oligonucleotide. The kit of claim 90, wherein the specific partner is a probe and/or a primer. The kit according to claim 90, wherein the specific partner is selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS. 42-77. The kit of claim 90 or 91, wherein the specific partner comprises an antibody and/or an affinity protein. A method for screening the risk of human colorectal cancer by in vitro screening of a blood sample, characterized in that it comprises the steps of: a) taking a blood sample, detecting the NEAT1 gene as shown in SEQ ID NO: 2 and SEQ ID NO: 3 Or the amount of the expression product of the MYBL1 gene shown in 4; b) comparing the amount of the expression product obtained in step a) with the amount of the expression product of the colorectal cancer positive sample and the colorectal cancer negative sample from the confirmed diagnosis a colorectal cancer patient, the colorectal cancer negative sample is from a confirmed non-colorectal cancer individual; c) is judged according to the analysis result of step b): if the amount of the expression product obtained in step a) and the expression product of the colorectal cancer positive sample If the amount is similar or the same, it is diagnosed as a colorectal cancer patient; if the amount of the expression product obtained in step a) is similar to or the same as the amount of the expression product of the colorectal cancer negative sample, it is diagnosed as a non-colorectal cancer patient. The method of claim 94, wherein the detecting further comprises detecting an amount of an expression product of at least one or any of a plurality of genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, Such as SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, such as SEQ ID NO: 9; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22. FAM198B, as shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, such as SEQ ID NO: 32 or 33; FKBP5, as shown in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as shown in SEQ ID NO: 37; IL1B, as shown in SEQ ID NO: 38; DHRS13, such as SEQ ID NO: 39; PDZK1IP1, as shown in SEQ ID NO: 40; VSIG10, as shown in SEQ ID NO: 41. The method of claim 95, wherein the method further comprises detecting the amount of the expression product of the detection gene DUSP2, wherein the gene DUSP2 is as shown in SEQ ID NO: 1. The method of claim 96, which further comprises detecting the amount of the expression product of the gene ITGAM, wherein the gene ITGAM is as shown in SEQ ID NO: 5 or 6. The method according to claim 97, characterized in that it further comprises detecting the amount of the expression product of the gene P2RY10, wherein the gene P2RY10 is as shown in SEQ ID NO: 7 or 8. The method of claim 98, which further comprises detecting the amount of the expression product of the gene GZMB, wherein the gene GZMB is as shown in SEQ ID NO: 9. The method according to claim 99, characterized in that it further comprises detecting the amount of the expression product of the gene SH2D2A, wherein the gene SH2D2A is as shown in SEQ ID NO: 10, 11, 12 or 13. The method of claim 100, characterized in that it further comprises detecting the amount of the expression product of the gene PDE4D, wherein the gene PDE4D is as SEQ ID NO: 14, 15, 16, 17, 18, 19, 20 , 21 or 22 is shown. The method of claim 101, which further comprises detecting the amount of the expression product of the gene FAM198B, wherein the gene FAM198B is as set forth in SEQ ID NO: 23, 24 or 25. The method of claim 102, which further comprises detecting the amount of the expression product of the gene GLT25D2, wherein the gene GLT25D2 is represented by SEQ ID NO: 26. The method of claim 103, characterized in that it further comprises detecting the amount of the expression product of the gene CD36, wherein the gene CD36 is as shown in SEQ ID NO: 27, 28, 29, 30 or 31. The method of claim 104, characterized in that it further comprises detecting the amount of the expression product of the gene VSIG10, wherein the gene VSIG10 is as shown in SEQ ID NO:41. The method of claim 105, which further comprises detecting the amount of the expression product of the gene NUDT16, wherein the gene NUDT16 is as shown in SEQ ID NO: 32 or 33. The method of claim 106, characterized in that it further comprises detecting the amount of the expression product of the gene PDZK1IP1, wherein the gene PDZK1IP1 is shown as SEQ ID NO:40. The method of claim 107, which further comprises detecting the amount of the expression product of the gene FKBP5, wherein the gene FKBP5 is represented by SEQ ID NO: 34, 35 or 36. The method of claim 108, which further comprises detecting the amount of the expression product of the gene ITPPIPL2, wherein the gene ITPPIPL2 is represented by SEQ ID NO:37. The method of claim 109, characterized in that it further comprises detecting the amount of the expression product of the gene IL1B, wherein the gene IL1B is represented by SEQ ID NO:38. The method of claim 110, which further comprises detecting the amount of the expression product of the gene DHRS13, wherein the gene DHRS13 is represented by SEQ ID NO:39. The method of claim 95, wherein the step a) comprises detecting the amount of the expression product of the following six genes: NEAT1, as shown in SEQ ID NO: 2; MYBL1, such as SEQ ID NO : 3 or 4; FAM198B, as shown in SEQ ID NO: 23, 24 or 25; ITGAM, as shown in SEQ ID NO: 5 or 6; PDZK1IP1, as shown in SEQ ID NO: 40; VSIG10, such as SEQ ID NO: 41. The method of claim 95, wherein the step a) comprises detecting an amount of an expression product of the following 18 genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, such as SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as set forth in SEQ ID NO: 9; SH2D2A, as set forth in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 Or 22; FAM198B, as set forth in SEQ ID NO: 23, 24 or 25; GLT25D2, as set forth in SEQ ID NO: 26; CD36, as set forth in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as set forth in SEQ ID NO: 32 or 33; FKBP5, as set forth in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The method according to any one of claims 94 to 113, wherein in the step a), detecting an expression product of the at least one gene is an expression product of the gene and the expression product Specific partner contact. The method according to any one of claims 94 to 113, wherein in step a), the amount of the expression product of the gene is detected, and the nucleic acid sequence of the gene is selected from the group consisting of SEQ ID NO: 1 to 41; Show a collection of sequences. The method of any one of claims 94 to 113, wherein the expression product of step a) comprises at least one RNA transcript or a polypeptide. The method of any one of claims 94 to 113, wherein the expression product comprises at least one mRNA. The method of claim 116, wherein the RNA transcript is detected and determined by hybridization, amplification or sequencing. the amount. The method of claim 118, wherein the RNA transcript is contacted with at least one probe and/or at least one primer under predetermined conditions, under predetermined conditions, the probe and / or primers can hybridize to RNA transcripts. The method of claim 119, wherein the cDNA of the RNA transcript is contacted with at least one probe and/or at least one primer under predetermined conditions, under predetermined conditions, Probes and/or primers can hybridize to the cDNA. The method of claim 116, wherein the detecting of the polypeptide is detected by contacting the polypeptide with at least one specific ligand. The method of claim 121, wherein the detecting of the polypeptide is detected by contacting the polypeptide with an antibody or an affinity protein. The method of claim 121, wherein the polypeptide is contacted with at least two specific ligands. The method of claim 123, wherein the polypeptide is contacted with two antibodies, two affinity proteins or one antibody and one affinity protein. A kit for screening a human prostate cancer risk by in vitro screening of a blood sample, comprising: a specific partner comprising an expression product of a gene, each partner specifically binding each gene, the gene being as follows: NEAT1, as set forth in SEQ ID NO: 2; and MYBL1, as set forth in SEQ ID NO: 3 or 4; the specific partner specifically binds to the expression product of the gene. The kit according to claim 162, wherein the gene further comprises at least one or any of the following genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, such as SEQ ID NO: 2; MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as SEQ ID NO: 9 is shown; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, As shown in SEQ ID NO: 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as SEQ ID NO: 32 or 33; FKBP5, as set forth in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as SEQ ID NO: Shown at 39; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The kit according to claim 126, wherein the gene further included is DUSP2, and the DUSP2 is represented by SEQ ID NO: 1. The kit according to claim 127, wherein the gene further comprises ITGAM, and ITGAM is as shown in SEQ ID NO: 5 or 6. The kit according to claim 128, wherein the gene further comprises P2RY10, and P2RY10 is represented by SEQ ID NO: 7 or 8. The kit according to claim 129, wherein the gene further comprises GZMB, and the GZMB is represented by SEQ ID NO: 9. The kit according to claim 130, wherein the gene further comprises SH2D2A, and SH2D2A is represented by SEQ ID NO: 10, 11, 12 or 13. The kit of claim 131, wherein the gene further comprises PDE4D, and PDE4D is represented by SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22. The kit of claim 132, wherein the gene further comprises FAM198B, and FAM198B is set forth in SEQ ID NO: 23, 24 or 25. The kit according to claim 133, wherein the gene further comprises GLT25D2, and GLT25D2 is represented by SEQ ID NO: 26. The kit according to claim 134, wherein the gene further comprises CD36, and CD36 is represented by SEQ ID NO: 27, 28, 29, 30 or 31. The kit according to claim 135, wherein the gene further comprises VSIG10, and VSIG10 is represented by SEQ ID NO:41. The kit of claim 136, wherein the gene further comprises NUDT16, NUDT16 is SEQ ID NO: 32 or 33 is shown. The kit according to claim 137, wherein the gene further comprises PDZK1IP1, and PDZK1IP1 is represented by SEQ ID NO:40. The kit according to claim 138, wherein the gene further comprises FKBP5, and FKBP5 is represented by SEQ ID NO: 34, 35 or 36. The kit according to claim 139, wherein the gene further comprises the gene ITPRIPL2, and the ITPRIPL2 is represented by SEQ ID NO:37. The kit of claim 140, wherein the gene further comprises IL1B, and IL1B is represented by SEQ ID NO:38. The kit according to claim 141, wherein the gene further comprises DHRS13, and DHRS13 is represented by SEQ ID NO:39. The kit according to claim 126, wherein the genes further included are FAM198B, ITGAM, PDZK1IP1 and VSIG10, wherein FAM198B is represented by SEQ ID NO: 23, 24 or 25; SEQ ID NO: 5 or 6; PDZK1IP1 is set forth in SEQ ID NO: 40; VSIG10 is set forth in SEQ ID NO:41. The kit according to claim 126, which is characterized in that it comprises a specific partner of the following gene: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, As shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9. SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as SEQ ID NO : 23, 24 or 25; GLT25D2, as shown in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as in SEQ ID NO: 32 or 33 FKBP5, as set forth in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZKIIPI, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The kit of any one of claims 125 to 144, wherein the specific partner comprises at least one hybridization probe. The kit of claim 145, wherein the specific partner comprises at least one hybridization probe and at least one primer. The kit of claim 146, wherein the specific partner comprises at least one hybridization probe and two primers. The kit according to any one of claims 125 to 144, wherein the specific partner comprises at least one specific ligand. The kit of claim 148, wherein the specific partner comprises an antibody or an affinity protein. The kit of claim 148, wherein the specific partner comprises at least two specific ligands. The kit of claim 150, wherein the specific partner comprises two antibodies, two affinity proteins or one antibody and one affinity protein. Use of a specific partner for the expression product of a gene for the preparation of an agent for screening for the risk of colorectal cancer in vitro, said gene comprising NEAT1 and MYBL1, wherein NEAT1 is represented by SEQ ID NO: 2; MYBL1, such as SEQ ID NO: 3 or 4. The use according to claim 152, wherein the gene further comprises at least one or any of the following genes: DUSP2, as shown in SEQ ID NO: 1; NEAT1, such as SEQ ID NO: 2. MYBL1, as shown in SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as SEQ ID NO: 9 Shown; SH2D2A, as shown in SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, eg SEQ ID NO: 23, 24 or 25; GLT25D2, as set forth in SEQ ID NO: 26; CD36, as shown in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as SEQ ID NO: 32 Or shown as 33; FKBP5, as set forth in SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as SEQ ID NO: 39 Shown; PDZK1IP1, as set forth in SEQ ID NO: 40; VSIG10, as set forth in SEQ ID NO:41. The use according to claim 153, characterized in that the gene further included is DUSP2, and DUSP2 is represented by SEQ ID NO: 1. The use according to claim 154, wherein the gene is ITGAM, and ITGAM is as shown in SEQ ID NO: 5 or 6. The use as claimed in claim 155, characterized in that: The gene also includes P2RY10, and P2RY10 is set forth in SEQ ID NO: 7 or 8. The use according to claim 156, wherein the gene further comprises GZMB, and the GZMB is represented by SEQ ID NO: 9. The use according to claim 157, wherein the gene further comprises SH2D2A, and SH2D2A is represented by SEQ ID NO: 10, 11, 12 or 13. The use according to claim 158, characterized in that the gene further comprises PDE4D, and PDE4D is as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22. The use according to claim 159, wherein the gene further comprises FAM198B, and FAM198B is represented by SEQ ID NO: 23, 24 or 25. The use according to claim 160, wherein the gene further comprises GLT25D2, and GLT25D2 is represented by SEQ ID NO: 26. The use according to claim 161, wherein the gene further comprises CD36, and CD36 is represented by SEQ ID NO: 27, 28, 29, 30 or 31. The use according to claim 162, wherein the gene further comprises VSIG10, and VSIG10 is represented by SEQ ID NO:41. The use according to claim 163, wherein the gene further comprises NUDT16, and NUDT16 is represented by SEQ ID NO: 32 or 33. The use as described in claim 164, characterized in that: The gene also includes PDZK1IP1, and PDZK1IP1 is set forth in SEQ ID NO:40. The use according to claim 165, wherein the gene further comprises FKBP5, and FKBP5 is represented by SEQ ID NO: 34, 35 or 36. The use according to claim 166, wherein the gene further comprises ITPRIPL2, and ITPRIPL2 is represented by SEQ ID NO:37. The use according to claim 167, wherein the gene further comprises IL1B, and IL1B is represented by SEQ ID NO:38. The use according to claim 168, wherein the gene further comprises DHRS13, and DHRS13 is represented by SEQ ID NO:39. The use according to claim 153, characterized in that the genes further included are FAM198B, ITGAM, PDZK1IP1 and VSIG10, wherein FAM198B is represented by SEQ ID NO: 23, 24 or 25; ITGAM is SEQ. ID NO: 5 or 6; PDZK1IP1 is shown in SEQ ID NO: 40; VSIG10 is shown in SEQ ID NO: 41. The use according to claim 152, wherein the gene is as follows: DUSP2, as shown in SEQ ID NO: 1; NEAT1, as shown in SEQ ID NO: 2; MYBL1, as SEQ ID NO: 3 or 4; ITGAM, as shown in SEQ ID NO: 5 or 6; P2RY10, as shown in SEQ ID NO: 7 or 8; GZMB, as shown in SEQ ID NO: 9; SH2D2A, as SEQ ID NO: 10, 11, 12 or 13; PDE4D, as shown in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21 or 22; FAM198B, as SEQ ID NO: 23, 24 or 25 is shown; GLT25D2, as set forth in SEQ ID NO: 26; CD36, as set forth in SEQ ID NO: 27, 28, 29, 30 or 31; NUDT16, as set forth in SEQ ID NO: 32 or 33; FKBP5, as SEQ ID NO: 34, 35 or 36; ITPRIPL2, as set forth in SEQ ID NO: 37; IL1B, as set forth in SEQ ID NO: 38; DHRS13, as set forth in SEQ ID NO: 39; PDZK1IP1, as set forth in SEQ ID NO: 40 VSIG10 is shown as SEQ ID NO:41. The use according to any one of claims 152 to 171, wherein the specific partner comprises at least one hybridization probe. The use of claim 172, wherein the specific partner comprises at least one hybridization probe and at least one primer. The use according to claim 173, characterized in that the specific partner comprises at least one hybridization probe and two primers. The use according to any one of claims 152 to 171, wherein the specific partner comprises at least one specific ligand. The use according to any one of claims 175, characterized in that the specific partner comprises an antibody or an affinity protein. The use according to claim 175, characterized in that the specific partner comprises at least two specific ligands. The use according to claim 177, characterized in that the specific partner comprises two antibodies, two affinity proteins or one antibody and one affinity protein.