TWI546075B - Microrna-based method for anti-colorectal cancer effects and prognosis of colorectal cancer - Google Patents

Description

Method for preventing prognosis of colorectal cancer and colorectal cancer based on micro-deoxyribonucleic acid

The present invention relates to a method for providing an anticancer effect in a colorectal cancer patient; the present invention further relates to a method for screening a drug for colorectal cancer; and the present invention further relates to a method for determining the prognosis of a colorectal cancer patient.

Micro-deoxyribonucleic acid (microRNA, miR) is a non-coding micro-deoxyribonucleic acid containing 17-25 nucleotides. The miR can be transcribed by directly binding to the 3' non-translated region (3'UTR) of the gene. Post-regulation of the performance of multiple target genes. Binding of miR to mRNA inhibits protein translation, but sometimes promotes cleavage of mRNA. The regulation of miR on its target genes has been considered to play an important role in cancer carcinogenesis, canceration and recurrence. Although miR has attracted much attention in the biomedical field in the past few years, most of them have been highlighted. The role of miR in disease progression has not been confirmed.

Colorectal cancer (CRC) is one of the most common cancers, with a very high recurrence rate and mortality. Patients who can effectively distinguish poor prognosis will help patients follow up and treat, but it has not been ideal yet. The biomarker can reliably predict recurrence of colorectal cancer.

US Patent Application No. 12/398,852 discloses methods and compositions for identifying miRNA profiles of a particular condition, such as colorectal cancer, and using the map as a diagnosis and/or prognosis of the condition (eg, colorectal cancer and colorectal cancer recurrence) Or response to treatment). This U.S. patent application uses microarray for large-scale screening by hybridization methods, but microarray data obtained from hybrid experiments are prone to false positive results and therefore require more confidence. Methods and more functional studies to confirm the association between miR and colorectal cancer recurrence. There is a continuing need for finding alternative or other alternatives to anti-tumorigenesis or anti-relapse, and the present invention discloses a method for recurrence of colorectal cancer or anti-colorectal cancer, and a method for screening for colorectal rectal cancer. The method of drug and a method for judging the prognosis of patients with colorectal cancer to solve these problems.

At present, nearly one million new cases of colorectal cancer (CRC) are diagnosed every year in the world, and about half of them will die. For decades, the American Joint Committee on Cancer (AJCC) and the International Union Against Cancer (UICC) staging system used depth of tumor invasion, regional lymph node metastasis (regional lymph node metastasis (regional lymph node metastasis) The presence or absence of node involvement and distant metastasis is the main prognostic indicator for predicting postoperative recurrence in CRC patients. Although surgical resection is a very effective method for local diseases, 25% to 40% of patients will relapse after surgery, one third of which is local recurrence, and the other two thirds will develop distally. Metastasis, CRC recurrence mostly has a time-limited phenomenon, 40-50% of recurrences occur within one year after the initial resection. Current studies show that the time from initial treatment to recurrence is highly correlated with patient survival. , especially within one year after surgical resection. In order to provide appropriate and effective treatment for patients to improve the prognosis of patients, researchers continue to develop methods for improving early detection of tumors, and currently there is no ideal biological indicators or indicators to distinguish early relapsed diseases. In patients with non-early recurrence, simple and reliable biomarkers that detect early postoperative recurrence can help doctors perform more aggressive treatments and help patients plan their lives.

Tumor development of CRC involves multiple steps of genomic variation, including oncogene activation and tumor suppressor gene inactivation. In recent years, there has been increasing evidence that CRC pathogenesis is associated with a lack of regulatory function of miR, and many studies have reported a link between miR and CRC development, but few studies have focused on the association between miR and early recurrence of CRC.

The present invention uses a miR array to compare miR profiles between CRC tissues with early recurrence and non-early recurrence, and the demarcation point defining early or non-early recurrence is based on recurrence within 12 months after radical surgery resection, The effect of miR-93 was then confirmed with tissue samples and a series of in vitro and in vivo examples were performed to confirm and demonstrate the role of miR-93 in CRC recurrence. There was a significant difference in the amount of MiR-93 between early CRC (recurrence within 12 months after surgery) and non-early recurrence; further examples included 35 early relapses and 42 non-early recurrence samples, confirming non-early The expression of miR-93 in relapsed samples was higher than that of early relapsed samples; cell experiments showed that overexpression of miR-93 inhibited colon cancer cell proliferation and migration without inhibiting its invasion (invasion) The cell cycle results showed that miR-93 caused a large accumulation of G2 phase cell population, whereas miR-93 did not induce apoptosis or necrosis; functional results showed that miR-93 can inhibit CCNB1 (cell cycle) Protein B1, cyclin B1) protein expression, causing cell cycle arrest in G2 phase; in addition, miR-93 inhibits the expression of ERBB2, p21 and VEGF, all of which are involved in cell proliferation; MiR-93 also inhibits tumors in nude mice Cell growth. Looking at the above results, the present invention shows that miR-93 can inhibit tumorigenesis and reduce early recurrence of CRC, and has clinical application value for prediction and treatment of CRC patients.

The anti-cancer effects referred to in the present invention include inhibition of cancer cell proliferation, migration, angiogenesis, and tumor growth.

The term "anti-colorectal cancer" as used herein means inhibiting the growth of cancer cells and/or inhibiting metastasis of cancer cells or inhibiting early relapse, which means any inhibition of tumorigenesis or prolonged cancer remission by administration of an anti-rectal cancer drug or Reduce recurrence behavior.

Accordingly, the present invention provides a pharmaceutical composition for providing an anticancer effect of a colorectal cancer patient comprising a miR-93 or miR-93 mimetic having a pharmacologically effective dose, wherein the patient's cancer cells are miR-93 The performance was lower than the control group. In a preferred embodiment, the patient is an early relapse patient and the control group is a non-early relapse patient; miR-93 negatively regulates CCNB1, ERBB2, P21, and VEGF genes. In a more preferred embodiment, the patient is a human.

As used herein, the term "mime" refers to any nucleic acid that mimics an endogenous mature miRNA molecule.

The present invention also provides a method for screening an anti-colorectal cancer drug, comprising treating a cell with a test drug and measuring an amount of at least one microdeoxyribonucleic acid having a reduced expression in the colorectal cancer cell, wherein the test An increase in the amount of micro-deoxyribonucleic acid expression of the drug-treated cells relative to the control group cells indicates that the test drug is an anti-colorectal cancer drug. In a preferred embodiment, the mini-deoxyribonucleic acid is miR-93.

The present invention further provides a method for determining the prognosis of a colorectal cancer patient, comprising measuring an amount of expression of at least one microdeoxyribonucleic acid in the sample of the patient, wherein the at least one microdeoxyribonucleic acid expression amount is relative to the control group sample The corresponding change in the amount of micro-deoxyribonucleic acid is an indicator for predicting recurrence of colorectal cancer. In a preferred embodiment, the mini-deoxyribonucleic acid is miR-93; the control group sample is from a patient who is not early relapsed. In a more preferred embodiment, the patient is a human.

The following examples are presented to illustrate and not to limit the various aspects and features of the invention.

Patient and tumor sample

Two groups of CRC patients were enrolled. The first group included 77 primary CRC patients with UICC stage I to III (35 postoperative non-early recurrences and 42 postoperative early relapses). The development of new postoperative recurrence or lesion metastasis was defined as postoperative recurrence; early recurrence was defined as local recurrence within 1 year after radical resection (in areas where tumor growth was limited to anastomosis or primary surgery) or distal metastasis ( Distal metastasis or diffuse peritoneal seeding. The first group was used to reveal that miR is associated with early recurrence. To test whether the possible miR was also differentially expressed in the paired tumor and non-tumor colorectal samples of the same patient, a second group was further enrolled for the experiment, consisting of 45 CRC patients. In order to avoid the potential impact of neoadjuvant therapy on miR performance, patients who received chemotherapy or radiation therapy prior to surgery were excluded. All patients were Chinese living in non-specific ethnic groups in Taiwan. Human tissues were rapidly frozen in liquid nitrogen after surgical resection. All clinical samples were obtained with the informed consent of the patients, and the experimental plan was also passed by the local human trial committee (Institutional Review Board) approved.

Statistical Analysis

Continuous variables are expressed as mean ± standard deviation (SD), while dichotomous variables are expressed as numbers and percentages. The ANCOVA statistical method was performed using JMP software (version 7.0.1, SAS Institute Inc., USA) to compare the mean of miR performance between early and non-early relapse patients under different conditions (age, gender, cancer stage of CRC patients) . The p-value of the two-tailed assay was statistically significant when it was less than 0.05.

Result: Demographic data

The first group of 77 independent CRC patients (35 non-early recurrences and 42 early relapses) were characterized in Table 1. The mean age was 66.4 years, ranging from 24 to 86 years. This group had early recurrence. The degree is shown in Table 2. The second group contained 45 patients for comparing differences in miR-93 performance between paired tumors and non-tumor colorectal samples from the same individual (consolidated in Table 3). The average age of the second group was 65.8 years, ranging from 37 to 84 years. The tumor stage of patients with early recurrence was later than that of patients with non-early recurrence, but their age and gender distribution were not significantly different.

RNA extraction and cDNA preparation

About 100 mg of each tissue was added to 1 mL of TRIzol reagent (Invitrogen, USA) according to the instructions for use, and homogenized using a desktop tissue homogenizer (Polytron PT1600E, Kinematica AG, Switzerland). Total RNA (total RNA) containing mRNA and miR was purified using a Qiagen RNAeasy column (Qiagen, Germany). In the miR array, cDNA synthesis of miR was performed using Megaplex reverse transcription human primer library A and B (Applied Biosystems Inc.). In individual miR assays, individual miR cDNAs were synthesized using 20 ng total RNA and unique primers (Applied Biosystems Inc.). In the mRNA quantitative analysis, cDNA was synthesized using 1 μg of total RNA, a random hexamer primer, and reverse transcriptase (Applied Biosystems Inc.).

miR array

Three samples of patients with primary CRC (a non-early recurrence and two early relapses) were screened using a miR array containing 667 human miRs (Applied Biosystems Inc., USA) to confirm early recurrence and non-early CRC Difference in miR performance between relapses. Each array contains a mammalian U6 (U6b, SEQ ID NO: 2) as an internal control. Real-time quantitative PCR (RT-qPCR) was performed using an Applied Biosystems 7900HT Real-Time PCR System and the thermal cycling conditions were preset using the ABI 7900 Sequence Detection System (Real-Time PCR System, software version 2.4).

Individual miR detection

For each candidate miR, miR quantitative analysis was performed using TaqMan miR RT-qPCR (Applied Biosystems Inc.). The relative performance of miR is based on the internal control group U6b, normalized by the equation log ₁₀ (2 ^-ΔCt ) ( ^ΔCt =(CT _{miR-93 -CT U6b} )), and calculated among log ₁₀ (2 ^-ΔCt ) Number of digits, average and standard deviation (SD).

Results of the miR array and subsequent confirmation

The miR array was used to confirm a number of differentially expressed miRs between early recurrence of CRC and non-early recurrence. Among these candidate miRs, the performance of miR-93 was 3.5-fold lower in early relapsed samples than in non-early relapsed samples. To further confirm whether miR-93 performance was different between early recurrence and non-early relapse patients, 77 human CRC tumor samples were also tested. The results showed that the early relapsed samples in the non-early relapsed group had a 6.1-fold decrease in miR-93 performance, and the median log ₁₀ (2- ^ΔCt ) was 2.323 in the non-early recurrent group, whereas in the early relapse group In the group is 1.383 (adjustment p <0.0001, Figure 1A). Analysis of miR-93 performance in different stages of CRC tumor samples revealed a correlation between miR-93 performance and CRC staging (adjusted p = 0.0325, Figure 1B), early CRC pre- UICC staging and miR-93 The high performance was correlated (the median of log ₁₀ (2 ^-ΔCt ) for Phase I, Phase II, and Phase III was ^{2.077, 1.788} , and ^1.6649 , respectively). These independent samples demonstrate the utility of miR-93 in predicting recurrence of colorectal cancer after surgery and also ensure that miR-93 is suitable for further functional testing.

Paired samples of miR-93

The expression of miR-93 in 45 tumor tissues was 1.66 times higher than that of the corresponding normal colorectal rectal tissue ( p = 0.03 in paired t test), between these paired samples, 62.22% (28/45) The CRC sample had a higher miR-93 performance relative to its corresponding normal tissue (Fig. 4A).

Target forecast

To study the biological function of miR-93, the miR target prediction programs miRDB, miRanda, miRWalk and TargetScanS were used to search for the target gene, and the KEGG pathway program was used to predict the pathway of miR regulation of the target gene.

Constructing a large number of plastids of miR-93

This example uses the pCDH vector (System Biosciences, USA) as a miR-93 (SEQ ID NO: 1) mass expression system to evaluate the functional results of miR-93 mass expression. The multi-cloning sites (MCS) of the miR-93 PCR product (including the native flank sequence of the upstream and downstream ends of the 100 bp microRNA stem loop) in the 5' end to the 3' end are inserted into the pCDH vector. Construction of pCDH-miR-93 plastids. The forward primer sequence of miR-93 is TCCTGAATTCAACCTTCACTGAGAGGGTGGTTG, the reverse primer is CTAGGCGGCCGCGGGAGACCAGACCCTTTTGAAC, and the forward primer is extended from the 5' end and contains the GAATTC sequence to generate the EcoR1 restriction enzyme cleavage site, while the reverse primer It is extended from the 3' end and contains the GCGGCCGC sequence to generate a Not1 restriction enzyme cleavage site, which is confirmed by direct DNA sequencing.

Cell culture

Human colorectal cancer cell line Caco2 (ATCC, USA) was cultured in DMEM (Gibco-BRL, USA) and 10% fetal bovine serum (fetal calf serum, FCS, Gibco-BRL, USA) was added with 100 U/ml penicillin ( Penicillin), the cells were maintained at 37 ° C in an environment containing 5% CO ₂ .

Stable cell line

Caco2 (5×10 ⁵ ) was inoculated to a 6-well plate and cultured overnight, followed by Lipofectamine 2000 (Invitrogen Inc., USA) with 400 ng of constructed plastid (negative scrambled pCDH vector (SEQ ID NO) : 5) or pCDH-miR-93 plastid), screened for 4 weeks in standard medium supplemented with 12 μg/mL puromycin (puromycin, Sigma-Aldrich Co, USA), and screened for pCDH-NC containing plastids ( The negative control group) or the pCDH-miR-93 plastid was stably transfected into the Caco2 cell line and confirmed by qR-PCR of miR.

fine Cell proliferation analysis

Cell proliferation was measured by the WST-1 method (Roche Diagnostics, USA): cells were seeded in 96-well plates and cultured for 22 hours, followed by incubation with 1/10 volume of WST-1 reagent at 37 ° C for 2 hours, using spectrophotometry The absorbance at 450 nm was measured and quantified.

Cell cycle analysis

Cell cycle was detected by flow cytometry after staining with propidium iodide (PI, Sigma-Aldrich Co.): cells were harvested after 36 hours of culture, washed with PBS and taken at 10 ⁵ /ml. The cell density was suspended in PBS containing 0.1% triton X-100, 0.02 mg/ml RNase and 0.05 mg/ml PI, followed by washing with PBS to remove excess PI staining and suspension in PBS, directly to the FACScan flow cytometer. CellQuest software (BD biosciences) analysis was used in (FACScan cytofluorimeter, Becton Dickinson, USA).

Apoptosis analysis

The cells were fixed in cold methanol, washed with cold PBS and cultured in annexin V-FITC (BD Biopharmingen) and PI (Sigma) according to the instructions. The stained cells were flow cytometry within 1 hour. Analysis was performed in a FACScan cytofluorimeter (Becton Dickinson, USA).

Results: The effect of miR-93 on cell proliferation and cell cycle

To examine the role of miR-93 in tumorigenesis, the effect of miR-93 on Caco2 cells was first evaluated. As shown in Fig. 1C, the proliferation rate of the miR-93 large-scale selection strain (OmiR-93) cultured for 24 hours was only 60% of the negative control group (NC) ( p = 0.012). Since the predicted target gene of miR-93 is related to cell cycle and cell growth, the effect of miR-93 on cell cycle was evaluated by flow cytometry. The results showed that miR-93 showed a significant increase in the accumulation of G2 cell population in the selected strains. (miR-93 showed a large number of selected strains of 19.8%, and the negative control group was 14.7%, Figure 1D, p = 0.013). According to the results of annexin V-FITC/PI analysis, a large amount of miR-93 did not induce apoptosis or necrosis (Fig. 4B). The above results show that miR-93 can inhibit the growth of colorectal cancer cells by stopping cells in the G2 phase, but it cannot induce apoptosis induced by miR-93.

Cell mobility analysis

Cell viability assays were performed in 24-well cell culture dishes using Transwell polycarbonate membranes (polycarbonate membrane inserts, Millipore, Germany) according to the instructions for use, with cells at a density of 2 x 10 ⁴ (cells/well). It was applied to a 24-well culture chamber (millicell) and cultured at 37 ° C for 24 hours. Cells with better mobility were taken out from the culture chamber to the outside of the chamber, and then the insertion dish was rinsed with 1×PBS. 1% trypsin removes cells from the outer membrane layer, lyses the cells with cell culture lysis reagent (Promega, USA), and finally quantifies the green fluorescence of the stable transfectants with a spectrophotometer.

Wound healing analysis

The cells were plated on a 6-well plate at a density of 3 × 10 ⁵ . After the cells were formed into a monolayer, the wound was manually drawn using a 200 μl micropipette tip, and then the medium was changed and cultured at 37 ° C. The closure of the wound was observed under a microscope at different time points (0 hours, 24 hours, and 48 hours) and photographed.

Results: The effect of miR-93 on cell movement

The results of Transwell assay (Fig. 1E) showed that the cell migration of miR-93 in a large number of stable transgenic plants was slower than that of the control group, and the proportion of cell migration was 63.3% of the control group ( p < 0.001). The results of wound healing analysis also inhibited cell migration. The gap distance between the control group and the miR-93 large-scale transgenic plants was 0.43 mm and 0.64 mm (24 hours), 0.08 mm and 0.34 mm (48 hours), respectively. It showed that miR-93 showed a large number of transgenic strains whose mobility was inhibited, which was 65% of the negative control group. The above results consistently showed that after a large amount of miR-93 was expressed, the cell migration ability was significantly decreased (Fig. 1G).

Matrigel invasion assay

The cell invasion ability was measured using a 24-well suspension cell culture insert (Transwell permeable supports, BD biosciences, USA) and an 8-μm pore size polycarbonate membrane insert, and the cells were coated at a density of 1×10 ⁴ cells according to the instructions. In the upper chamber, cells that did not move through the membrane layer were removed after incubation at 37 ° C for 24 hours, cells moving to the lower surface of the membrane were fixed and stained with crystal violet, and the number of moving through cells was counted and photographed under a microscope. The experimental group and the control group were subjected to three repeated experiments, and then photographed and the number of mobile cells was calculated.

RESULTS: The effect of miR-93 on tumor cell invasion

Matrigel invasion experiments showed that miR-93 showed a large number of stable transgenic plants (Omir-93) and control group transgenic plants (NC), as shown in Figure 1F, the results showed that miR-93 a large number of performance does not affect cells The ability to invade ( p = 0.825).

In vivo animal embodiment

The four-week large Balb/c nude mice (body weight 12.6 to 15.6 g) used in this example were purchased from Lesco Biotechnology Co., Ltd. (Taiwan) and were raised in a specific pathogen free (SPF) environment. (Qualification No. 26-99S029). After feeding to six weeks old, 1×10 ⁷ Caco2 (NC or OmiR-93) cells were injected subcutaneously into Balb/c nude mice (four in each group), and the tumor diameter was measured daily and volume = width The tumor volume (cm ³ ) was calculated by the expression of ×length × height/2, and the animals were sacrificed three weeks after inoculation of the tumor cells, the tumor size was observed, photographed and the tumor was removed for further detection.

RESULTS: The effect of miR-93 on tumor cells in nude mice

To further examine the role of miR-93 in tumorigenesis, the effect of miR-93 on a large number of tumor growth in vivo was evaluated. Caco2 cells stably expressing miR-93 (OmiR-93) and Caco2 cells with scrambled pCDH-NC (negative control group, NC) were injected subcutaneously into nude mice to grow tumors, and were touched after 7 days of inoculation. The tumor was detected and allowed to grow to the third week (Figs. 2A and 2C), and the tumor lump of the nude mice inoculated with OmiR-93 cells was significantly smaller than the nude mice inoculated with NC cells ( p = 0.005, Table 4, Figure 2B and 2C). In vivo results further confirmed that a large amount of miR-93 expression in cancer cells caused a decrease in cell proliferation of cancer lumps in experimental animals.

Tumor size = (height x width x length)/2

RESULTS: The effect of miR-93 on tumor cells in nude mice

mRNA transcript quantification was performed using reverse transcriptase PCR followed by real-time PCR with SYBR Green fluorescent dye (Applied Biosystems Inc.). cDNA was synthesized using 1 μg of total RNA, random hexamer primer and reverse transcriptase (Applied Biosystems Inc.), and the primers used in the PCR reaction are listed in Table 5.

Result: constructor reporter plasmid

Using pMIR-REPORT ^TM miRNA reported vector system (Reporter Vector System) (Applied Biosystems Inc.) as an assessment of the impact performance of miR-93 protein of the reporting system. The full length of the 3'UTR double-stranded oligonucleotides of each gene was synthesized using the primer pairs listed in Table 5. The PCR product of the 3'UTR was inserted into the multiple selection position (MCS) of the pMIR vector to construct the reporter plastid (Fig. 3A).

Transient transfection and luciferase detection

The pMIR construct (200 ng) was transfected into cells using Lipofectamine 2000 (Invitrogen), cells were lysed 24 hours after transfection and luciferase activity was measured according to the instructions of the luciferase assay system (Promega). Repeated three times independently and each sample was tested twice.

Protein separation and western blotting

Cells were treated with lysis buffer (Cell Signaling, USA) and whole proteins were prepared from cell lysates. Protein lysates were quantified using Bio-Rad protein analysis, separated in 10% SDS-PAGE colloids, transferred to PVDF membranes and blocked with Tris buffered saline containing 0.1% Tween 20, 5% skim milk protein. The protein was mixed overnight with a primary antibody at 4 ° C, and the secondary antibody was incubated with horseradish peroxidase (HRP) and western blotting matrix (Western Blotting Substrate). (Millipore, USA) imaging, exposure to ECL X-ray medical film (Konica Minolta, Canada) to visualize the band, using the band strength of the GAPDH protein as the amount of protein added Indicators used to determine the amount of protein added is equal.

antibody

Anti-GAPDH antibody (anti-GAPDH) was purchased from Sigma-Aldrich Co; anti-cyclin B1 antibody, anti-p21 (anti-p21) antibody, anti-ERBB2 (anti-ERBB2) antibody and Alexa Fluor 594 conjugated anti-rabbit IgG was purchased from Cell Signaling Technology; horseradish peroxidase conjugated goat secondary antibody was purchased from Promega.

Immunofluorescence staining

Immunofluorescence staining was performed according to the instructions for use (Cell Signaling), the cells were fixed in cold methanol solution for 20 minutes, rinsed with cold PBS, and immersed in blocking solution (3% BSA dissolved in TBS) for 1 hour. It is saturated. After penetrating for 5 minutes with 0.3% Triton X-100, the cells were mixed with the primary antibody for 1 hour. After washing, the sections were mixed with Alexa Fluor 594, anti-rabbit immunoglobulin G, and stained with DAPI (Cell Signaling). Immunostaining of Caco2 The sections were placed in a FluoView FV1000 conjugated focus microscope (Olympus, Germany) for imaging.

Results: The role of miR-93 was mediated through CCNB1, ERBB2, P21 and VEGF.

The above examples show that miR-93 inhibits cell proliferation and migration in Caco2 and leaves cancer cells in the G2 phase. Next, the miR-93 target gene can be identified to clarify the anticancer effect of miR-93. Bioinformatic analysis was used to predict multiple possible miR-93 target genes: CCNB1 and p21 are related to cell cycle, and ERBB2 and VEGF are involved in cell migration and proliferation, and angiogenesis. The mRNA expression of ERBB2 ( p <0.0001), p21 ( p = 0.0002) and VEGF ( p = 0.025) in OmiR-93 cells was significantly lower than that in the negative control group (NC) (Fig. 2D), while CCNB1 Although there was no significant difference in mRNA expression between the two Caco2 transgenic plants (Fig. 2D, p = 0.167), miR-93 caused a significant decrease in the amount of CCNB1 protein (Fig. 3D). These results indicate that miR-93 can inhibit the mRNA of CCNB1 by post-transcriptional regulation, but does not degrade its mRNA.

It has been shown that p21 and VEGF are miR-93 target genes. In this example, luciferase reporter assay was used to confirm that CCNB1 and ERBB2 are direct target genes of miR-93: constructing the same miR-93 predicted binding sequence (CACUUU) The pLuc-CCNB1 and pLucERBB2 plastids (Fig. 3A and 3B), according to luciferase activity, it was confirmed that miR-93 can directly act on the 3'UTR of CCNB1 and ERBB2 and down-regulate the expression of CCNB1 and ERBB2 . (Fig. 3C), Western blotting also showed a decrease in the amount of CCNB1 , ERBB2 and p21 protein (Fig. 3D). Immunofluorescence staining of Caco2 with an anti-CCNB1 antibody revealed that miR-93 negatively regulates Caco2 intracellular CCNB1 (Fig. 5), particularly at the nucleus.

The above-mentioned embodiments are merely examples for convenience of description, and the scope of the claims is intended to be limited to the above embodiments. The present invention has been described and illustrated in detail, and can be implemented by those skilled in the art. Various changes, modifications, and improvements are intended to be included within the scope of the invention.

<110> Kaohsiung Medical University

<120> Method for antiprognosis of colorectal cancer and colorectal cancer based on micro-deoxyribonucleic acid

<130> 1390-KMU-US

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> RNA

<213> Homo sapiens

<220>

<221> misc_RNA

<222> (1)..(23)

<400> 1

<210> 2

<211> 42

<212> RNA

<213> Homo sapiens

<220>

<221> snRNA

<222> (1)..(42)

<400> 2

<210> 3

<211> 33

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(33)

<220>

<221> mRNA

<222> (1)..(33)

<400> 3

<210> 4

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(34)

<400> 4

<210> 5

<211> 8189

<212> DNA

<213> Synthetic sequence

<220>

<223> Carrier

<220>

<221> misc_feature

<222> (1)..(8189)

<400> 5

<210> 6

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(20)

<400> 6

<210> 7

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(20)

<400> 7

<210> 8

<211> 23

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(23)

<400> 8

<210> 9

<211> 23

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(23)

<400> 9

<210> 10

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(20)

<400> 10

<210> 11

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(20)

<400> 11

<210> 12

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(20)

<400> 12

<210> 13

<211> 20

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(20)

<400> 13

<210> 14

<211> 21

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(21)

<400> 14

<210> 15

<211> 21

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(21)

<400> 15

<210> 16

<211> 33

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(33)

<400> 16

<210> 17

<211> 38

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc-feature

<222> (1)..(38)

<400> 17

<210> 18

<211> 28

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc-feature

<222> (1)..(28)

<400> 18

<210> 19

<211> 34

<212> DNA

<213> Synthetic sequence

<220>

<223> Introduction

<220>

<221> misc_feature

<222> (1)..(34)

<400> 19

Figure 1. (A) MiR-93 expression in 35 non-early recurrence and 42 early recurrent CRC samples: miR-93 relative performance is log ₁₀ (2 ^-ΔCt ), ^ΔCt = (CT _{miR-93 -CT U6b} And U6b is a standardized internal control group, the performance of early recurrence samples is significantly reduced ( p <0.0001, adjusting the age, gender and stage of CRC tumors); (B) miR-93 performance of different stages of CRC samples The average (I phase: n=10, phase II: n=35, phase III: n=32): the evolutionary performance of the CRC stage has a monotonously decreasing phenomenon ( p = 0.0325 to adjust the age and gender of the CRC tumor); (C) Analysis of miR-93 inhibition of tumor cell proliferation according to WST-1, p = 0.012: OmiR-93 indicates a large number of stable miR-93 transgenic plants, NC indicates a negative control group stable transgenic strain; (D) miR-93 A large number of cells caused significant accumulation of cells in the G2 phase, p = 0.013 (black: G0 phase, light gray: S phase, dark gray: G2 phase); (E) According to Transwell analysis, miR-93 showed a large amount of inhibition of tumor cell movement , p <0.001; (F) miR-93 a large number of performance does not affect tumor cell invasion, p = 0.825; (G) photo of tumor cell movement from wound healing analysis, There was a wide gap between 24 hours and 48 hours, indicating that the cell migration ability of miR-93 was significantly reduced.

Figure 2. The effect of miR-93 on tumor growth and the mRNA expression of miR-93 target gene in animal model. OmiR-93 indicates a large number of stable miR-93 transgenic strains, and NC indicates a negative control group stable transgenic strain: A) photographs taken on day 21 of nude mice subcutaneously injected with OmiR-93 cells (n=4, top) and NC cells (n=4, lower); (B) Day 21 OmiR-93 group ( The cancer mass in the upper part was significantly reduced compared with the NC group (below); (C) the tumor growth curve (cm ³ ) of OmiR-93 (---) and NC (-) cells within 21 days ( p = 0.005) (D) mRNA expression levels of ERBB2 , p21 , CCNB1 and VEGF as determined by qPCR. Compared with NC (grey), mRNA expression of ERBB2 , P21 and VEGF of OmiR-93 (black) was significantly lower (27.9%, 26.8% and 55.5% of NC group, respectively), and CCNB1 (93.39%). .

Figure 3. miR-93 binds to the 3'-UTR of CCNB1 and ERBB2 and affects the protein expression: (A) Schematic representation of the 3'-UTR reporter construct: embedding the 3'UTR of the target gene into the pMIR plastid The 3' end of the prime enzyme gene is analyzed for luciferase activity; (B) the predicted miR-93 binding sequence between aligning miR-93 and the 3'UTR of CCNB1 and ERBB2 ; (C) OmiR -93 indicates a large number of stable transgenic strains of miR-93, and NC indicates a stable transgenic strain of the negative control group. When pLuc-UTR (400 ng) was transfected into OmiR-93 or NC, the luciferase activity of OmiR-93 with pLuc-CCNB1 plastid (66.9%) was significantly lower than that of NC with pLuc-CCNB1 plastid, p = 0.005. Similarly, the luciferase activity of OmiR-93 with pLuc-ERBB2 plastid (48.43%) was also significantly lower than that of pLuc-ERBB2 plastid, p = 0.003; (D) Western blot analysis of protein expression : The protein amount of miR-93 target gene of OmiR-93 is lower than that of NC.

Figure 4. MiR-93 loses its ability to regulate colorectal cancer in human colorectal cancer, while miR-93 can affect CCNB1 protein expression but not induce apoptosis: (A) use qPCR to detect 45 composition of human CRC patients with miR -93 relative performance, miR-93 relative performance is calculated as log ₁₀ (2 ^-ΔCt ), light gray is general (non-tumor) tissue miR-93 performance, dark gray is tumor tissue miR-93 performance; (B Apoptosis of Caco2 cells transiently transfected with messy miR (left) and miR mimics (right) using annexin V-FITC/PI staining and flow cytometry, x-axis (FL1 logarithmic scale) ) indicates that annexin V-FITC fluorescence, y-axis (logarithmic scale of FL3) indicates PI fluorescence, and early apoptosis (Annexin V-FITC-positive/PI-negative) cells appear in a dot plot. In the lower right quadrant (A4), late apoptotic (Annexin V-FITC-positive/PI-positive) cells appear in the upper right quadrant of the dot plot (A2), and Figure 4B is from three independent experiments. The typical result is that the number of total populations that appear in the right half of the scatter plot does not increase (A2/A4), indicating that a large number of miR-93 expression does not induce apoptosis.

Figure 5. Immunofluorescence staining using CCNB1 antibody. The results obtained by conjugated focus microscopy showed that the expression of CCNB1 protein (red fluorescence) of OmiR-93 was lower than that of NC, and the blue part indicated the nucleus stained with DAPI, OmiR. -93 indicates a large number of stable miR-93 transgenic strains, NC indicates a negative control group stable transgenic strain, and the reduced CCNB1 protein is mainly located in the nucleus of OmiR-93, and the cells will remain in the G2 phase.

Claims (3)

Use of a miR-93 for the preparation of a pharmaceutical composition for providing an anticancer effect in an early recurrent colorectal cancer patient, comprising a pharmacologically effective dose of miR-93, wherein the miR- in the cancer cell of the patient with early recurrent colorectal cancer The performance of 93 was lower than that of patients with non-early recurrence. According to the use of the first aspect of the patent application, the miR-93 negatively regulates the CCNB1 , ERBB2 , P21 and VEGF genes. According to the use of the first aspect of the patent application, wherein the patient is a human.