TWI507414B - Recombinant ricin a chain protein system for conditional toxicity expression - Google Patents

Description

Conditional expression of recombinant ricin A chain protein system

The present invention relates to a recombinant ricin A chain protein system, and more particularly to a recombinant ricin A chain protein system having a conditional expression.

Ricin is a toxin extracted from a plant called Ricinus communis , also known as ricin. Ricin is a heterodimeric glycoprotein. It comprises two protein chains with different amino acid sequences, A chain and B chain, each weighing 30k DA, and the two protein chains are connected by a disulfide bond.

The A chain contains 267 amino acids, an N-glycoside hydrolase that cleaves a covalent bond on the 28S rRNA and removes an adenine. Since rRNA is the main substance that constitutes ribosomes, and ribosomes are required for the synthesis of proteins, when rRNA is destroyed, protein synthesis is inhibited, resulting in cytotoxicity; B chain is a lectin. The 262th residue and the A chain are bonded by a disulfide bond. The B chain binds to a galactose residue or a mannose residue on the cell surface, assisting the A chain to pass through the cell membrane and enter the cell to function.

The lethal dose of ricin to the human body is about 1μg/kg. In addition to early use in military applications as a biochemical weapon, the potential of ricin in biotechnology and medical care has gradually been discovered in recent years. Such immunotoxins (immunotoxins), because they bind to specific molecules on the cell membrane, can enter the cell to inhibit protein synthesis, and are thought to recognize and kill specific cells (such as cancer cells) and even treat viral or parasitic infections. Possible. It has been found that ricin itself is quite effective in binding to monoclonal antibodies, and the composition of both can enhance the specificity of specific types of cells and exhibit medical activity against various types of lymphomas and leukemias.

However, when ricin is actually applied, scientists often need to biochemically modify ricin in various ways to achieve selective poisoning. For example, in the prior art, mutations are often made in the complete ricin A chain protein to produce an attenuated protein for vaccine use, or otherwise combined with an immunoprotein to act at a specific site. However, there has been no technique for disassembling the ricin A-chain protein fragment after it has been ligated without affecting its activity.

It is an object of the present invention to provide a conditional expression recombinant ricin A chain protein system which selectively controls the activity of ricin A chain protein by the recombinant ricin A chain protein system of the present invention.

The present invention firstly uses a technique in which a ricin A chain protein fragment after disassembly is used to bind the ricin A chain protein fragment, and the activity of the ricin A chain protein is tested to be retained. Specifically, the disassembled ricin A-chain protein fragments are not toxic, only correct. When combined, the original enzymatic activity of the ricin A chain protein can be exhibited. Through this method of selective ligation, it can be widely used, for example, to detect a specific protein expression pattern, or to label a molecule to kill a specific target cell or individual.

The ability to recombine with a conditional gene can be conferred by the appropriate form of biological modification, such as the action of RNA splicing or transposon. However, since the above-mentioned conjugation often causes the original peptide sequence to change or insert additional exogenous residues due to a specific reaction mechanism, how to select an appropriate cutting and joining position on the ricin A chain protein will be to retain the castor. An important consideration for the original biological activity of the toxin A chain protein. The ricin A chain protein can be divided into two separate units in the protein structure, namely a first unit comprising amino acids 1 to 118 and a second unit comprising amino acids 122 to 270. The present invention finds that three amino acids between the first unit and the second unit can be used in the modified region of the exogenous residue. This modification allows the ricin A chain protein to be appropriately recombinantly engineered without excessive spatial interference. Accordingly, a recombinant ricin A chain protein system is proposed which is modified to control the amino acid residue between the first unit and the second unit of the ricin A chain protein to selectively control the ricin A chain. The effect of the activity of the protein.

To achieve the above object, a recombinant ricin A chain protein system according to the present invention, which comprises a recombinant ricin A chain protein, comprises: a first polypeptide having 75% or more with SEQ ID NO: 1. Consistency; a second polypeptide having greater than 75% identity to SEQ ID NO: 2; and a plurality of exogenous residues interposed in the first polypeptide and the second plurality Between peptides.

A recombinant ricin A chain protein system according to an embodiment of the invention, wherein the first polypeptide is more than 95% identical to SEQ ID NO: 1.

A recombinant ricin A chain protein system according to another embodiment of the present invention, wherein the second polypeptide is more than 95% identical to SEQ ID NO: 2.

In conventional genetic recombination, the amino acid sequence encoded by the original gene product is often altered such that the amino acid sequence loses its originally assigned activity or function. It has been found in the present invention that when the original phenylalanine-glycine-Glycine residue at positions 119 to 121 is modified for the ricin A chain protein, since it is in this region Recombination of the protein does not cause excessive spatial interference, so the amino acid sequence modification caused by the modification in this position will not cause the loss of activity or function of the ricin A chain protein originally, and it can still inhibit the true The function of protein synthesis in nuclear cells.

In other words, in the present invention, the exogenous residue is for modifying a ricin A chain fusion protein comprising the first polypeptide and the second polypeptide.

The term "modification" as used above means the modification or addition of a new amino acid residue (ie, an exogenous residue) to the original full length ricin A chain protein protein. In particular, with respect to the exogenous residue, it is possible to change the structure of the ricin A chain protein by considering that the inserted exogenous residue is too large. Thus, for example, in one embodiment of the invention, the exogenous residue may be replaced by a substituent. The ricin A chain protein is composed of two residues in the original phenylalanine-glycine-glycine (N- ¹¹⁹ Phe- ¹²⁰ Gly- ¹²¹ Gly) at positions 119 to 121, such as N- ¹¹⁹ Glu- ¹²⁰ Gly- ¹²¹ Gln-C; or through the insertion of additional amino acids consisting of two, such as ^{N- 119 Phe- 120 Glu- 121 Gly- 122} Gln- 123 Gly-C, however, the present invention is not limited thereto.

A vector is often used as a vehicle in gene manipulation to transfer a gene of interest to a host cell, and the vector can be autonomously replicated or incorporated into a host DNA, such as a plastid, a viral vector or the like, which is commonly used in the prior art. The above vector may also include, for example, a promoter, a fortifier, or other control unit depending on the host cell type, the degree of expression of the desired protein, or the like. The recombinant ricin A chain protein system of the present invention can also express the recombinant ricin A chain protein through various vectors, in particular, in the present invention, as long as the desired recombinant ramie can be smoothly expressed in the host cell. The carrier of the toxin A chain protein can be used without any limitation. For example, the prokaryotic expression vector pET-30a (Novagen, Medison, WI) commonly used in conventional biotechnology can be used, or the cell infection can be carried out with a virus using the eukaryotic expression vector pBacFast 1 (Life technologies, Carlsbad, CA), or Biotransformation was performed using the PiggyBac hopping gene system. In one embodiment of the present invention, the recombinant ricin A chain protein required for biological activity analysis is expressed in prokaryotic cells using pET-30a as a vector, but the present invention is not limited thereto.

As described above, the recombinant ricin A chain protein system of the present invention can be expressed by prokaryotic organisms or by eukaryotes without any other limitation. Specifically, prokaryotes such as E. coli; and eukaryotes For example, plant cells, insect cells, yeast, fruit flies, or mammalian cells. In one embodiment of the present invention, the prokaryomic activity of the recombinant ricin A chain protein is tested in the oriental fruit fly, but the invention is not limited thereto.

In terms of conditional expression, for example, the oriental fruit fly can be used to have the property of active TRA/TRA2 protein only in females. When TRA/TRA2 protein binds to the binding region of the oriental fruit fly bisexual gene, it can borrow RNA selective splicing is produced by sequence specificity. Through the regulation of female-specific RNA splicing, the third intron removal of the bisexual gene occurs only in the female (as shown in Figure 1: the slanted segment is the biallerin exon part; The white segment is the ricin A chain gene; the black segment is the third intron of the oriental fruit fly bisexual gene; the dotted line region is the bisexual gene 3 terminal untranslated region; and the white oval is the TRA/TRA2 protein binding. Area). Using this property, in combination with the recombinant ricin A chain protein system of the present invention, an oriental fruit fly-specific lethal system can be developed in which the exogenous residue is based on the third intron of the sex gene ( Bddsx intron 3) Designed for residues encoded by the outer exon sequence. Specifically, the external source may be designed such residues, N-terminus ^{- 119 Glu- 120 Gly- 121 Gln-} C terminal and the N terminal ^{- 119 Phe- 120 Glu- 121 Gly- 122} Gln- 123 Gly-C terminal.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic illustration of the application of the recombinant ricin A chain protein system to the female specific lethal system of the oriental fruit fly in a preferred embodiment of the present invention.

2A and 2B are protein expressions of the wild-type ricin A-chain protoxin Ricin-WT and the recombinant ricin A chain protein Ricin-FEGQ and Ricin-LERQ according to a preferred embodiment of the present invention, wherein 2A is purified Electrophoretic analysis of proteins; 2B is a Western blot analysis.

Figure 3 is a comparison of the recombinant ricin A chain protein Ricin-FEGQ and Ricin-LERQ protein synthesis inhibitory effect with wild type ricin A chain protoxin (Ricin-WT) according to a preferred embodiment of the present invention.

Figure 4 is a schematic representation of the RTA - Bddsx hybrid sequence constructed by the gene sequence encoding the ricin A chain ( RTA ) and the bismuth gene ( Bddsx ) sequence of the oriental fruit fly Bactrocera dorsalis in a preferred embodiment of the present invention. .

Hereinafter, specific embodiments of the present invention will be described in detail. The technical features, advantages, and objectives of the present invention will become more apparent to those skilled in the art from this description.

In order to assess the toxicity of the modified ricin A chain protein expressed by the recombinant ricin A chain protein system of the present invention, plastids must first be constructed to express these recombinant ricin A chain proteins.

Construction of wild-type ricin A chain protein (Ricin-WT) gene

First, the meat on the back of an animal using a conventional polymerization chain reaction (Polymerase Chain Reaction, PCR), primers complementary to the sequence of the Ricin ClaI-XbaI (5'-AA ATCGAT ATACATTCGCCTTTGGCGGTAATTATGAT C G T CT A GAACAACTTGCTGG-3, SEQ ID NO: 4) and ricin univ-R (5'-GT TCTAGA CGATCATAATT-3 ', SEQ ID NO: 5), for amplifying amplification reaction to produce ricin a chain containing silent mutations (silence mutation, three mutations bottom filling position) of ( The RTA fragment can be subsequently constructed using additional artificial XbaI enzyme cuts.

The complete RTA sequence was inserted into pET-30a (+) (Novagen, Madison, WI) using NcoI and SacI, and this construct was called Ricin-WT.

Construction of modified ricin A chain protein expression gene (Ricin-FEGQ)

The remainder of the experimental procedure was the same as Ricin-WT described above, except that the Ricin ClaI-XbaI primer used in the Ricin-WT construct was replaced by the primer Ricin FEGQ-F (5'-AAATCGATATACATTCGCCGAAGGCCAAAATTATGATCGTCTAGAAC-3', SEQ ID NO: 6). The gene product clipped by Ricin FEGQ-F and Ricin univ-R was amplified by PCR, and the ClaI-XbaI relative fragment in Ricin-WT was replaced by a conventional biotechnology. This construct was called Ricin-FEGQ.

Construction of modified ricin A chain protein expression gene (Ricin-LERQ)

Except that the Ricin ClaI-XbaI primer used in the Ricin-WT construct was replaced by the primer RicinLERQ-F (5'-AAATCGATATACATTCGCCTTT GAAGGCCAA GGTAATTATGATCGTCTAGAAC-3', SEQ ID NO: 7), the remaining experimental steps were constructed in the same manner as Ricin-WT described above. The gene product clipped by the primers RicinLERQ-F and Ricin univ-R was amplified by PCR, and the ClaI-XbaI relative fragment in Ricin-WT was replaced by a conventional biotechnology, and the construct was called Ricin-LERQ.

The above-mentioned Ricin-WT, Ricin-FEGQ and Ricin-LERQ were constructed and transformed into the competent cell E. coli DH 5α by a conventional technique. Thereafter, the plastid DNA was separately extracted and sequenced to confirm the correctness of the above construction.

In order to confirm the pET-30a (+) Zhi body of recombinant ricin A-chain of protein expression, the aforementioned Ricin-WT, Ricin-FEGQ and Ricin-LERQ plasmid construct transformation into competent cells E.Coli C43 (DE3 In the case, each obtains a clone. The pure line was cultured in 5 mL of LB medium, and 50 μg/mL of kanamycin was added to the LB medium, and cultured in a 37 ° C shaking incubator. When the OD ₆₀₀ of the bacterial solution reached 0.6, 1 mM of IPTG was added to the bacterial solution, and incubation was continued at 25 ° C for 2 hours.

Subsequently, the bacterial solution was centrifuged at 8000 x g for 10 minutes at 4 ° C and the supernatant was discarded, and the remaining cells (i.e., the precipitate) were subjected to ultrasonication treatment and then centrifuged at 12,000 x g for 10 minutes. Since the protein product of the recombinant ricin A chain protein system including pET-30a(+) as a vector will include His-tag, affinity purification can be performed using a Ni-NTA column (Promega, Medison, WI). ). After elution with 250 mM imidazole, the recombinant ricin A chain protein sample was dialyzed against 10 mM Tris-HCL (pH 7.6) for further analysis.

Protein samples (2 μg) were analyzed by conventional sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and CBR staining (Coomassie Brilliant Blue R-250). To confirm recombinant ricin A chain protein Qualitative performance, Western blot, and goat ricin A-chain protein antibody (rcE-19, Santa Cruz Biotechnology, Santa Cruz, CA), and alkaline phosphatase-labeled sputum Goat IgG is used as a secondary antibody to detect protein signals.

As shown in FIG. 2A, the recombinant ricin A chain proteins Ricin-WT, Ricin-FEGQ, and Ricin-LERQ purified by the above experimental steps showed the expected molecular weight of 35 kDa on SDS-PAGE, and in FIG. 2B. Through the Western blot method, it was confirmed that the above three recombinant ricin A chain proteins can be successfully expressed in the prokaryotic pET-30a system.

Protein synthesis inhibition test

Through in vivo translation system ^{(Retic lysate IVT TM kit, life} Technologies Carlsbad, CA) to test the recombinant ricin A chain protein of the present invention Ricin-WT, Ricin-FEGQ, Ricin-LERQ and the protein synthesis inhibitory effect. Among them, commercially available luciferase RNA (1 mg/mL, Promega, Medison, WI) was used as a normal translation reaction control group. The 5 μL reaction setup was as follows: 0.25 μL 20X translation mixture (without methionine), 0.2 μL ²⁵ S-methionine (Izotope, Hungary), 0.1 μL luciferase RNA, 3.4 μL lysate, and water to 4 μL . After the start of the reaction, 20 ng of the recombinant ricin A chain protein of the present invention Ricin-WT, Ricin-FEGQ, and Ricin-LERQ (which is dissolved in 1 μL of 10 mM Tris-HCl buffer, pH 7.6) were added at 30 ° C. The reaction was carried out for 90 minutes. Only buffer was added to the control group and no recombinant ricin A chain protein was included. After 90 minutes, the mixture was decolorized and TCA precipitation was carried out according to the manual procedure provided by the manufacturer.

In this test, based translation of luciferase RNA according to the amount of the incorporated ²⁵ S- methionine obtained, not the ²⁵ S- methionine incorporated by TCA precipitation will be removed, and the The degree of incorporation of ²⁵ S-methionine into the newly synthesized protein was compared to the sample group excluding the recombinant ricin A chain protein to determine the relative protein inhibition rate. The results of six independent experiments showed that the protein synthesis inhibition rate of Ricin-WT purified protein was 90.4%, the protein synthesis inhibition rate of Ricin-FEGQ purified protein was 58.04%, and the protein synthesis inhibition rate of Ricin-LERQ purified protein was 71.28%. As shown in Figure 3, it was shown that the recombinant ricin A chain protein still retains most of the enzyme activity.

Embryo microinjection of oriental fruit fly worms - testing the in vivo performance of RTA-Bddsx third intron (Bddsx-intron 3) mixed gene and its effect on adult sex ratio

In the following exemplary embodiments, the recombinant ricin A chain protein system of the present invention will be further applied to the Oriental Fruit Fly Female Specific Lethal System to provide a strategy for future pest control.

Since the oriental fruit fly only removes the third intron of the bisexual gene in the female, the present example uses a recombinant ricin A chain protein construct ( RTA - Bddsx construct) as an example, combining one A suitable vector to express the conditional expression of the recombinant ricin A chain protein is shown in FIG. The recombinant ricin A chain protein adds the third intron of the bisexual gene of Bactrocera dorsalis ( Bddsx intron 3, SEQ ID NO: 3) to the two- sided exon sequence: N-terminal - ¹¹⁹ Phe- ¹²⁰ Glu- ¹²¹ G-( Bddsx intron 3)-ly- ¹²² Gln- ¹²³ Gly-C terminal, inserted between the first polypeptide of the recombinant ricin A chain protein of the present invention and the second polypeptide, ricin The original amino acid position of the A chain (RTA) protein sequence 119-121.

In collaboration with the unique protein factor (TRA/TRA2 protein) in the oriental fruit fly female, specific RNA splicing is performed and the third intron of the amphoteric gene is removed ( Bddsx - Intron 3, SEQ ID NO: 3) By this action, the RTA - Bddsx gene can produce the complete ricin A chain protein gene by the above specific splicing action. Because only females can produce a specific effect of the activated RTA toxin, it will only cause female death, and achieve the purpose of selectively controlling the activity of ricin A chain protein.

Conversely, no alternative splicing specific to the female occurs in the male, so the third intron of the amphoteric gene ( Bddsx- intron 3, SEQ ID NO: 3) is retained. In this case, the recombinant ricin A chain protein will encounter a stop signal during transcription, resulting in the male body only synthesizing the anterior segment of the ricin A chain protein. Since this synthetic ricin A chain protein is incomplete and not toxic, it does not cause male death.

In the next experiment, embryos of the oriental fruit fly were microinjected to test the in vivo performance of the RTA-Bddsx third intron (Bddsx-intron 3) mixed gene and its effect on the adult sex ratio.

Specifically, in order to prepare a RTA - Bddsx third intron hybrid sequence constructed by the ricin A chain (RTA) and the oriental fruit fly B. dosalis bisexual gene ( Bddsx ), the conventional polymerization chain is utilized. Reaction (Polymerase Chain Reaction, PCR), using the Bddsx third intron ( Bddsx intron 3, SEQ ID NO: 3) as a template, and carrying out the following primer pair.

(A) for constructing Ricin-WT (in3), using primer pair Ricin-In3A-F (5'-AATCGATATACATTCGCCTTTGGTAAGTGTGTATTTCAGC-3', SEQ ID NO: 8), Ricin-In3D-R (5'-TTCTAGACGATCATAATTACCGCCTAAAATATTTTAATTATTG-3', SEQ ID NO: 9).

(B) To construct Ricin-LE(in3)RQ, use primer pair Ricin-In3C-F (5-AATCGATATACATTCGCCTTTGAAGGTAAGTGTGTATTTCAGC-3', SEQ ID NO: 10), Ricin-In3F-R (5'-TTCTAGACGATCATAATTACCTTGGCCTAAAATATTTTAATTATTG-3', SEQ ID NO: 11).

After the DNA fragment clipped by the above primer pair was amplified by PCR, the subsequent gene recombination experiment in the pGEMT-easy system was completed by cleavage of ClaI and XbaI contained in the primer.

Since the binding region of the TRA/TRA2 protein is involved in the female-specific RNA splicing of the oriental fruit fly, the female Bddsx cDNA is used as a template, and the primer group dsx-STOP-F (5'-TCACTAGTGATAATTTTTAACG-3', SEQ ID NO: 12 CDS (5-CCgATATCTgCAgTCgACTCgAgTTTTTTTTTTTTTTTTTTTTTTTTT-3', SEQ ID NO: 13) completes DNA fragment replication. The SpeI and PstI are nicked into the above expression vector pGEMT-esay (Promega) as the fourth exon of Bddsx ( Bddsx exon4) The portion of the untranslated region at the 3 end after the stop codon (SEQ ID NO: 15).

In order to complete the expression in eukaryotic cells, the above-described construction of the Bddsx- containing third intron ( Bddsx intron 3, SEQ ID NO: 3) was added to the oriental fruit fly actin by using NaeI and HindIII cleavage on pGEMT-easy. The promoter of the 5C gene ( Bdactin 5C promoter; SEQ ID NO: 14) is referred to as Ricin-WT (in3) and Ricin-LE (in3) RQ, respectively, as shown in FIG.

As a positive control group for embryo microinjection, the entire Ricin-WT cDNA is also added with the promoter of the actin 5C gene as described above. The constructed plastid is called Ricin-WT-5Cp, and no RNA splicing step is required. To directly observe the performance and toxicity of the gene.

As a negative control group for embryo microinjection, Ricin-WT (in3) was also added with the promoter of actin 5C gene as described above, and the quality of this construct lacks both sides of the Bddsx third intron. The exon sequence is unable to perform the RNA splicing step, and can be used as a negative control group for RTA-Bddsx heterozygous gene function.

The oriental fruit fly Bactrocera dorsalis , which has been cultured for more than 11 years in the laboratory, was used as experimental material. The oriental fruit fly is cultured at 28 ° C, and its sunshine: dark light cycle is 12:12 hours.

Mature oriental fruit flies mate and lay eggs in cages and regularly cultivate hatched larvae with fresh food. Embryo microinjection was performed within 2 hours after the female flies lay eggs using a Zeiss V12 stereomicroscope with a fine micromanipulator and an electric microsurgical syringe. Prior to injection, to prepare plasmid DNA (1 μ g / μ L ). Next, 0.2 nL of the solution was injected into the ventral side of the abdomen of each embryo.

The feathering rate was recorded in the experiment to evaluate the recombinant ricin A chain. Protein toxicity and ratio of male to female.

Specifically, 0.2 ng of recombinant ricin A chain protein Ricin-WT-5Cp, Ricin-WT (in3) and Ricin-LE (in3) RQ DNA were separately injected into the embryo of Oriental fruit fly to observe the emergence rate and male and female The ratio was changed in 4 independent experiments. The results of the experiment of injecting 1165 eggs from the three combinations showed that the emergence rate of the spliced ricin A chain protein gene (Ricin-WT-5Cp) group was 3.65%. The emergence rate of the Ricin-WT (in3) group was 6.70%; and the emergence rate of the Ricin-LE (in3) RQ group was 5.25%.

As for the male-female ratio of the oriental fruit fly after emergence, as shown in Table 1.

From the above results, it can be seen that the part that died due to the injection process was removed, and the Ricin-WT-5Cp group and the Ricin-LE (in3) RQ group were higher in the worm than the Ricin-WT (in3) group. Toxicity, it was confirmed that the injected ricin A chain protein gene can express active toxin protein. More importantly, in the Ricin-LE (in3) RQ group, the number of females was small, and the ratio of male to female was significantly decreased (35%), showing a trend of female-specific death; In the Ricin-WT-5Cp and Ricin-WT (in3) groups, the ratio of male to female was observed to be close to 1:1, and no gender-specific lethality was observed.

The above embodiment combines the recombinant ricin A chain protein system and the oriental fruit fly double gene alternative splicing mechanism, so that the toxicity of the ricin A chain is only produced in the female body, and is not toxic to the male. This effect can change the proportion of the oriental fruit fly population, resulting in less male and female, and thus can achieve the effect of prevention and treatment. Furthermore, it was confirmed by the above-described protein synthesis inhibition assay and embryo injection activity analysis that the modified ricin A chain protein obtained by the recombinant ricin A chain protein system of the present invention still has biological toxicity; ricin is also confirmed. The 119th to 121th amino acid segment of the A-chain protein is a very suitable place for the design of the toxin of the ricin A chain protein.

The use of the recombinant ricin A chain protein system of the present invention is not limited to the above examples, and can also be applied to the detection of specific protein expression patterns, and can also be used as a marker molecule to poison specific target cells.

The embodiments of the present invention are described above by way of specific embodiments, and those skilled in the art can readily understand the other advantages and functions of the present invention from the disclosure of the present disclosure. The present invention may be embodied or applied in various other specific embodiments, and various modifications and changes can be made without departing from the spirit and scope of the invention.

<110> National Chung Hsing University

<120> Conditional Recombinant Ricin A chain protein system for conditional toxicity expression

<130> S6859

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 118

<212> PRT

<213> Ricinus communis

<400> 1

<210> 2

<211> 149

<212> PRT

<213> Ricinus communis

<400> 2

<210> 3

<211> 128

<212> DNA

<213> Bactrocera dorsalis

<400> 3

<210> 4

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 4

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 5

<210> 6

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 6

<210> 7

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 7

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 8

<210> 9

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 9

<210> 10

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 10

<210> 11

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 11

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 12

<210> 13

<211> 48

<212> DNA

<213> Artificial Sequence

<220>

<223>synthetic primer

<400> 13

<210> 14

<211> 388

<212> DNA

<213> Bactrocera dorsalis

<400> 14

<210> 15

<211> 636

<212> DNA

<213> Bactrocera dorsalis

<400> 15

Claims (6)

A conditional expression of a recombinant ricin A chain protein system, which comprises a recombinant ricin A chain protein comprising: a first polypeptide having a 95% identity to SEQ ID NO: a second polypeptide having a 95% or more identity with SEQ ID NO: 2; and a foreign residue inserted into the first polypeptide and the second polypeptide Room; wherein the exogenous residue at the N-terminus of a ^{- 119 Glu- 120 Gly- 121 Gln-} C terminal, or an N-terminal ^{- 119 Phe- 120 Glu- 121 Gly- 122} Gln- 123 Gly-C of the terminal Polypeptide sequence. A recombinant ricin A chain protein system according to the conditional expression of claim 1, wherein the exogenous residue is used for biologically binding to modify the first of the recombinant ricin A chain protein a peptide and the second polypeptide. A recombinant ricin A chain protein system according to the conditional expression of claim 1, wherein the recombinant ricin A chain protein system is expressed by a prokaryote. A recombinant ricin A chain protein system according to the conditional expression of claim 1, wherein the recombinant ricin A chain protein system is expressed by eukaryotes. An oriental fruit fly-specific lethal system comprising a recombinant ricin A chain protein system as described in the conditional expression of claim 1. The oriental fruit fly-specific lethal system according to claim 5, wherein the exogenous residue further comprises a protein encoded by a third intron of the amphoteric gene as shown in SEQ ID NO: 3. .