TWI428136B - Pharmaceutical composition for inhibiting inflammation or growth of tumor cells, and uses of au nanoparticles - Google Patents

Description

Medicinal composition for inhibiting inflammatory reaction or growth of tumor cells, and use of gold nanoparticles

The present invention relates to a pharmaceutical composition for inhibiting inflammatory reaction or tumor cell growth, and to the use of a gold nanoparticle, in particular to a use of a nanometer particle having an average particle diameter of 4 nm, and a use of the particle size of Chennai. The rice particles reach a pharmaceutical composition that inhibits the inflammatory response or the growth of tumor cells.

In the immune response, macrophages play a very important role, which is a phagocytic antigen-presenting cell. In general, when stimulated by the outside world, macrophages can release a variety of pathogen-recognition receptors (PRRs) to identify and phagocytose microorganisms, induce biohormone production, and then present antigens to T cells. Inducing a suitable immune response. Among them, the toll-like receptor (TLR) system is one of the most important pathogen recognition receptors, which can recognize various external stimuli and directly activate antigen to present cells.

Although macrophages can phagocytose the pathogens invading the organism to stimulate the lymphocytes or other immune cells to respond to the pathogen, triggering an immune response. However, macrophages are thought to help the proliferation of tumor cells because macrophages are attracted to hypoxic (hypoxic) tumor cells and promote chronic inflammatory responses. The tumor necrosis gene-α (TNF-α) released by macrophages is an inflammatory substance that activates the NF-κB gene. Thereafter, NF-κB enters the tumor nucleus and initiates a variety of cells to stop the cell. Death and promotion of cell proliferation and inflammation of protein production.

Therefore, if the ability or mechanism of macrophage release of biological hormones can be modulated, inflammation reaction and tumor cell growth can be inhibited. Accordingly, it is extremely necessary to develop a molecule or composition that is not biologically toxic, which can inhibit the inflammatory reaction and the growth of tumor cells by adjusting the ability or mechanism of macrophages.

The main object of the present invention is to provide a pharmaceutical composition for inhibiting an inflammatory response or tumor cell growth.

Another object of the present invention is to provide a drug for inhibiting an inflammatory reaction or tumor cell growth by using the gold nanoparticle of the present invention.

In order to achieve the above object, the present invention provides a pharmaceutical composition for inhibiting an inflammatory reaction caused by excessive production of cytokines, comprising: a therapeutically effective dose of gold nanoparticles, wherein the particle size of the gold nanoparticles is 2.5. And 40 nm; and at least one selected from the group consisting of pharmaceutically acceptable diluents, solvents, carriers, excipients, adjuvants, salts thereof, and precursors thereof.

In addition, the present invention also provides a pharmaceutical composition for inhibiting tumor cell growth, comprising: a therapeutically effective dose of a gold nanoparticle, wherein the particle size of the gold nanoparticle is 2.5-40 nm, and the gold nanoparticle system Concentrating on macrophage lysosomes to inhibit growth of tumor cells; and at least one selected from the group consisting of pharmaceutically acceptable diluents, solvents, carriers, excipients, adjuvants, salts thereof, and precursors thereof The group that makes up.

The present invention further provides a use of a gold nanoparticle for preparing a medicament for inhibiting an inflammatory reaction caused by excessive production of a cytokine, wherein the particle size of the gold nanoparticle is 2.5-40 nm.

In addition, the present invention also provides a use of a gold nanoparticle for preparing a drug for inhibiting the growth of tumor cells, wherein the particle size of the gold nanoparticles is 2.5-40 nm, and the gold nanoparticles are concentrated in the giant A lytic body of phagocytes to inhibit the growth of tumor cells.

In the present invention, the gold nanoparticles used do not undergo any surface modification, and the effect of inhibiting the inflammatory reaction or the growth of tumor cells can be achieved without toxic to the library cells. Further, the gold nanoparticles used in the present invention do not cause toxicity to macrophages and do not affect macrophage phagocytic ability. Furthermore, since the nano-particles are easy to manufacture, low in cost and extremely safe, they are extremely helpful for treating human immune diseases.

Therefore, the use of the gold nanoparticle of the present invention and the pharmaceutical composition containing the golden nanoparticle can achieve an effect of suppressing the inflammatory reaction by changing the cellular effect of macrophages, particularly inhibiting the production of cytokines. Further, the use of the gold nanoparticle of the present invention and the pharmaceutical composition comprising the golden nanoparticle also inhibit the growth of the tumor cell by changing the cellular effect of the macrophage.

In the use of the pharmaceutical composition of the present invention and the gold nanoparticles, the particle size of the gold nanoparticles is preferably from 2.5 to 20 nm, more preferably from 3 to 5 nm. Most preferably, the average particle size of the gold nanoparticles is 4 nm.

Further, in the pharmaceutical composition of the present invention, the therapeutically effective dose may be 2-50 mg/kg, preferably 2-30 mg/kg, and more preferably 5-10 mg/kg. Here, the term "effective dose" means the amount of the gold nanoparticle or pharmaceutical composition of the present invention which is required for the therapeutic effect of the disease to be treated. The effective dose is determined by the composition, the route of administration, the type of disease, the age of the patient, and the body weight.

In the use of the pharmaceutical composition of the present invention for inhibiting an inflammatory reaction caused by excessive production of cytokines, and the use of a gold nanoparticle, the cytokine may be tumor necrosis factor-α (TNF-α) or interleukin-6 ( IL-6), or interleukin-12p40 (IL-12p40); and the cytokine is preferably tumor necrosis factor-α (TNF-α). Further, the inflammatory response may be any physiological inflammatory response, and is preferably hepatitis.

Further, in the use of the pharmaceutical composition for inhibiting the growth of tumor cells of the present invention and the gold nanoparticles, the tumor cells may be any tumor cells, and preferably liver tumor cells.

The medicament prepared by the pharmaceutical composition of the present invention and the gold nanoparticles can be administered orally, parenterally or in the form of an inhalant. Preferably, parenteral forms are used, such as subcutaneous, intradermal, intrapulmonary (eg, intravenous), intramuscular, intrathecal, intracranial, and other infusion techniques; and more preferably injections. The form of intravenous injection.

Further, in the pharmaceutical composition of the present invention, the carrier must be "acceptable", meaning that it is compatible with the active ingredient in the composition (and preferably stabilizes the formulation) and is not deleterious to the patient being treated. One or more stabilizers can be used as excipients to deliver the gold nanoparticles. Examples of other carriers may be colloidal cerium oxide, magnesium stearate, cellulose, sodium lauryl sulfate, and D&C Yellow No. 10.

Preparation of gold nanoparticles

Here, the glassware of the gold nano-particle (GNP) is washed with aqua regia (3 parts by weight of hydrochloric acid, and 1 part by weight of nitric acid), and all solutions are 18-ΩM-deionized. And 0.22-mm filtered water (DIF H ₂ O) was prepared.

<Preparation of gold nanoparticles at 19 nm, 35 nm, and 45 nm>

The 1 ml of 12.7 mM chloroauric acid of (chloroauric acid, Sigma-Aldrich) was added to 54 ml of the DIF H ₂ O, and the solution was heated to boiling. Next, 940 ml, 670 ml, and 470 ml of 38.8 mM trisodium citrate (Merck) solution were separately added to prepare gold nanoparticles of 19 nm, 35 nm, and 45 nm, respectively. Finally, the prepared gold nanoparticles were washed with DIF H ₂ O and concentrated by centrifugation to remove impurities.

After TEM analysis, the average particle diameters of the above-mentioned gold nanoparticles were 45.0±4.3 nm, 35.4±5.6 nm, and 9.2±2.1 nm, respectively.

<Preparation of 11 nm gold nanoparticles>

4 ml of 12.7 mM chloroauric acid was added to 49 ml of DIF H ₂ O and the solution was heated to boiling. Next, 5 ml of a 38.8 mM trisodium citrate solution was added to prepare 11 nm gold nanoparticles. Finally, the prepared gold nanoparticles were washed with DIF H ₂ O and concentrated by centrifugation to remove impurities.

After TEM analysis (Hitachi 7000, Japan), the average particle diameter of the gold nanoparticles prepared above was 11.3 ± 1.3 nm.

<Preparation of 4 nm gold nanoparticles>

The 4 nm gold nanoparticle particles were prepared by borohydride reduction of gold salts. First, the added 1.968 ml of 12.7 mM chloroauric acid to 96.432 ml of the DIF H ₂ O, and chloroauric acid solution was placed in ice for 10 minutes. Then, before the reduction reaction, 0.6 ml of 0.5 M ice borohydride (borohydride, Sigma-Aldrich) solution was added to the above solution, and then 1 ml of 50 mM trisodium citrate solution was added to prepare 4 nm gold nanoparticle. Finally, the prepared gold nanoparticles were washed with DIF H ₂ O and concentrated by centrifugation to remove impurities.

After TEM analysis, the average particle diameter of the gold nanoparticles prepared above was 3.8 ± 0.6 nm.

<Preparation of 4 nm Fluorescent Gold Nanoparticles>

First, the 4 nm gold nanoparticles prepared above were modified with S-PEG3000-NH ₂ and then co-operated with NHS-fluorescent agent (NHS-Fluorescein, Thermo Fisher Scientific Inc., Rockford, IL). The yoke reaction produces fluorescent gold nanoparticles. Finally, centrifugation was performed to purify the fluorescent gold nanoparticles (F-GNP).

Detection of the ability of macrophages to phagocytose gold nanoparticles <macrophage culture>

Here, mouse macrophages (Raw264.7 cells) were placed in DMEM medium containing 10% fetal calf serum and L-glutamine at 37 ° C in 5% CO 2 The cultivation was carried out under a humid atmosphere.

<Honey test of gold nanoparticles on macrophages>

Raw264.7 cells were treated with 40 μg/ml of different particle size of gold nanoparticles for 24 hours. Then, Raw264.7 cells treated with gold nanoparticles were stained with propidium iodide (PI), and cell viability was measured by flow cytometry, and the calculation was as follows.

Cell viability (%) = 100% - PI - positive cell ratio (%)

The test results are shown in Figure 1A, which shows that treatment with gold nanoparticles (represented by "-") and treatment with various particle size of gold nanoparticles showed similar cell viability. This result indicates that the gold nanoparticles of various particle sizes are not cytotoxic at a dose of 40 μg/ml.

<Test of phagocytic ability of macrophages to Jinnai particles>

Raw264.7 cells were treated with different particle size of gold nanoparticles for 24 hours, and the gold content was analyzed by inductively coupled plasma atomic emission spectroscopy (ICP-AES). The test results are shown in Figure 1B, which shows that the 35 nm gold nanoparticles are most likely to be swallowed by macrophages.

<Analysis of aggregation of gold nanoparticles to macrophages>

Raw264.7 cells (5 x 10 ⁴ ) were seeded on a 24-well plate of cover glass and reacted with 40 μg/ml of 4 nm fluorescent gold nanoparticles at 37 ° C for 15, 30, 60, or 240 minutes. After the reaction, the cells were fixed with 4% of pH 7.4 paraformaldehyde for 10 minutes at room temperature, and then washed three times with a PBS solution. Endosome and lysosome were stained with anti-EEA1 and anti-LAMP1 primary antibodies followed by Alexa 594-labeled secondary antibody (Invitrogen Corp., Carlsbad, CA). Finally, a conjugated focus microscope (Olympus FV1000) was used for the analysis. Further, after 24 hours of reaction, the cells were fixed with 4% glutaraldehyde, post-fixed with 1% OsO ₄ , and observed by TEM (Hitachi 7000, Japan).

The above experimental results showed that macrophages were fed with 4 nm fluorescent gold nanoparticles, and at 15 minutes, the gold nanoparticles were mainly located in the endosome (with anti-EEA-1 antibody to calibrate the endosomes); and at 30 After 60 and 240 minutes, the gold nanoparticles will accumulate in the lysate (the anti-LAMP-1 antibody is used to calibrate the lysate). In addition, macroscopic observation of macrophages by TEM revealed that the gold nanoparticles were aggregated in a high electron density lysate.

Detection of the regulation of the gold nanoparticles and the cellular effects associated with the lysate <Effect of Jinnai Particles on Cytokine Production>

LTA (steroid-like receptor-2), Imiquimod (R837) (steroid-like receptor-7), and polyinosinic-polycytidylic acid (poly I:C) -3) was purchased from InvivoGen Corp. (San Diego, CA); CpG-polynucleotide (CpG-ODN) (铎-like receptor-9) (sequence: TCCATGACGTTCCTGACGTT) was purchased from Invivogen Corp. (San Diego, CA); and LPS (Eryrichia coli serotype 055: B5) was purchased from Sigma-Aldrich Co. (St. Louis, MO).

Raw264.7 cells (control group) treated with gold nanoparticles and Raw264.7 cells treated with 4 nm gold nanoparticles were stimulated with different concentrations of the above five types of purine receptor stimulators. Thereafter, the reaction medium was collected and detected using ELISA (R&D Systems Inc., Minneapolis, MN), and the results of the detection were as shown in Figs. 2A and 2B. Among them, "N.D." in Fig. 2B indicates that it cannot be measured.

As shown in Fig. 2A, the gold nanoparticles can effectively inhibit the production of tumor necrosis factor-α (TNF-α) produced by CpG-ODN-induced steroid-related steroid receptor-9. In addition, as shown in FIG. 2B, the gold nanoparticles can also effectively inhibit the production of interleukin-6 (IL-6) and interleukin-12p40 (IL-12p40).

<Effects of particle size and dosage of Jinnai particles on TNF-α>

Raw264.7 cells treated with gold nanoparticles were irradiated with 0.2 μM of CpG-ODN and treated with gold nanoparticles of various particle sizes, and detected for 3 hours. As shown in Fig. 3A, 4 nm, 11 nm, 19 nm, 35 nm, and 45 nm gold nanoparticles all inhibit TNF-α produced by CpG-ODN-induced steroid receptor-9, and have doses. With size dependence, especially 4 nm Jinnai works best.

In addition, if the number of nanoparticles etched by each cell and the relative total surface area are considered, it can be found that the 4 nm gold nanoparticles have the largest particle number and total nano surface area in macrophages, as shown in Figures 3B and 3C. Show. Therefore, Jinnai inhibits the production of TNF-α induced by CpG-ODN-stimulated steroid receptor-9, and its size dependence should be related to the maximum total surface area of 4 nm gold nanoparticles.

<The Jinnai particle system affects the downstream message transmission of the terpenoid receptor-9>

Raw264.7 cells were treated with 40 μg/ml of 4 nm gold nanoparticles for 24 hours, and then Raw264.7 cells were stimulated with 0.5 mM CpG-ODN. Cell lysates were analyzed using Western blotting at various time points after stimulation.

Western blot testing was conducted in the following manner. The Raw264.7 cell line was lysed with cell lysis buffer (Cell Signaling Technology, Inc., Danvers, MA), placed on ice for 30 minutes, and centrifuged at 12,000 rpm for 30 minutes. Supernatants were collected and the total protein concentration was set using Bio-Rad Protein Quantitative Analysis (Bio-Rad Laboratories, Inc., Hercules, CA). Equal amounts of cell lysate (50 μg) were taken and separated by 12% SDS-PAGE. The protein is then transferred to a PVDF film. After appropriate primary antibody reaction, the appropriate secondary antibody HRP-conjugated antibody (Cell Signaling Technology, Inc., Danvers, MA) was stained. It was detected using an increased chemiluminescence detection reagent (PerkinElmer Life Sciences, Boston, MA). Here, the primary anti-system used includes: mouse pAb anti-p-IκB, IκB, p-NFκB, NFκB, p-JNK, JNK, p-ERK1/2, ERK1/2, p-p38, and p38, And purchased from Cell Signaling Technology Inc. (Beverly, MA).

Western blot test results show that Raw264.7 cells treated with Jinnai particles will cause IκB to be phosphorylated under the stimulation of CpG-ODN compared to Raw264.7 cells treated with no gold nanoparticles. Time extension (15 and 30 minutes processing time) and reduction (120 minutes processing time). In contrast, in Raw264.7 cells treated with gold nanoparticles, the time for NFκB to be phosphorylated and decomposed is also prolonged (120 minutes treatment time). In addition, in the MAPK pathway, Jinnai can effectively inhibit the phosphorylation of JNK. Furthermore, the gold nanoparticles that accumulate in the macrophage lysosomes increase the degree of phosphorylation of Erk and p38 associated with cell growth prior to unstimulated CpG-ODN.

Since phosphorylation of IκB in the IκB/NFκB message delivery pathway will result in isolation from NFκB and is decomposed and causes NFκB to be phosphorylated, allowing it to enter the nucleus to regulate gene duplication. Therefore, the results of this experiment confirmed that the gold nanoparticles did affect the downstream signaling factor of the terpenoid receptor-9, and the IκB/NFκB and JNK pathways were dominant.

<Gold nanoparticle inhibits the transfer of active C-terminal quinone receptor-9 to phagosomes>

Raw264.7 cells treated with gold nanoparticles were reacted with polystyrene particles (F-beads, 0.75 mm, Polysciences, Inc.) for 30 minutes and then analyzed by flow cytometry. Among them, the fluorescence particle/cell ratio is 10. The experimental results are shown in Figure 4, which shows that when macrophages undergo phagocytosis, the gold nanoparticles accumulated in the lysate do not cause a decrease in phagocytosis.

In addition, Raw264.7 cells treated with gold nanoparticles were also reacted with magnetic particles containing phagosomes, and the particles were collected by a magnetic field. The results show that when macrophages undergo phagocytosis, the gold nanoparticles that accumulate in the lysate cause inhibition of the active C-terminal steroid receptor-9 to be transported into the phagosome.

<Ginamid particles can increase the content and activity of Cathepsins in lysates>

As shown in Fig. 5, in the macrophages treated with the gold nanoparticles, the gold nanoparticles are aggregated in the macrophages as compared with the macrophages treated with the gold nanoparticles (represented by "-"). The lysosomes will increase the production and activity of autolysin B, K, L and S and have a size effect, and the enzyme synthesis by 4 nm gold nanoparticles is the highest.

<Jinnaite particles and DNA detection protein HMGB-1 binding test>

3×10 ⁷ Raw264.7 cell line with 2 ml of digitonin (50 μg/ml) in ice 0.25 M sucrose Hepes buffered saline (containing protease inhibitor mixture) at 4 ° C The dialysis was carried out for 30 minutes, and then centrifuged at 12,000 rpm for 30 minutes at 4 °C. The supernatant containing the cytoplasmic protein was collected and filtered using a 100 kD, Amicon Ultra-4 Centrifugal Filter Unit (Millipore Corp., Billerica, MA) to remove cell debris. The filtered cytoplasmic protein was further concentrated using a 10 kD, Amicon Ultra-4 Centrifugal Filter Unit (Millipore Corp., Billerica, MA) to remove the agent, sucrose, and salts. Finally, the cytoplasmic protein was concentrated and stored in PB buffer. The total protein concentration in the samples was quantified using Bio-Rad protein. 1.2 mg of cytoplasmic protein and different amounts of (0.5, 1, 2, and 4 mg) of gold nanoparticles were reacted overnight at 4 °C. The DTT rushing gold nanoparticle particles were used. Thereafter, the anti-HMGB1 antibody was used for analysis by Western blot test.

The gold nanoparticles collected in macrophage lysates were separated and run for electrophoresis and silver staining was used to detect that the gold nanoparticles inhibit proteins related to steroid-like receptor-9, including high-mobility group box protein. -1 (HMGB-1), cell autolysin-L (cathepsin L), and terpenoid receptor-9 itself.

After testing by western ink spots, it was found that the gold nanoparticles can be combined with HMGB-1 and cellular autolysin-L in the lysate, and there is a dose effect, but there is no significant difference between the terpenoid receptors-9, LAMP- 1 is used as an indicator of no lytic body protein interference. In addition, it was found that the gold nanoparticles can be effectively combined with HMGB-1, and the HMGB-1 complex on the surface of the gold nanoparticles can also be separated by the DTT-treated gold nanoparticle-HMGB-1 complex.

Effect of Golden Nanoparticles in Live Animal Experiments <Gold Nanoparticles Can Be Engulfed by Liver Bank Cells>

A 5 mg/kg dose of 4 nm gold nanoparticles and a 15 mg/kg macrophage remover, cadmium chloride (GdCl ₃ ), were injected into B6 mice via the tail vein. After 24 hours, the frozen liver cell lines were stained with anti-F4/80 antibody; while the gold nanoparticles were stained with a silver enhancement kit (Sigma).

The experimental results confirmed that there was no decrease in the library cells in the liver treated with the gold nanoparticles. Therefore, the gold nanoparticles are not toxic to library cells.

In addition, 5 nm/kg dose of 4 nm gold nanoparticles was injected into B6 mice through the tail vein. After 30 minutes, the mice were sacrificed and the liver was sacrificed. Fluorescent immunostaining with anti-CD68 antibody was performed and observed by dark field microscope. .

The experimental results confirmed that the gold nanoparticles were concentrated in the CD68-positive library cells, and in the group treated with the gold nanoparticles and treated with the gold nanoparticles, the library There was no significant change in the number of cells.

<4 nm gold nanoparticles can inhibit hepatitis response>

Here, the acute hepatitis pattern of the immunogenic mice was induced using concanavalin (Con A) to confirm whether the gold nanoparticles inhibited the hepatitis response.

PBS, 5 mg/kg dose of 4 nm gold nanoparticles (dissolved in PBS buffer), and 15 mg/kg dose of macrophage remover (GdCl ₃ ) were injected into the tail vein by 10 mg. /kg of Con A injected B6 mice. After 24 hours, liver tissue staining was performed with H&E.

The experimental results showed that 5 mg/kg of 4 nm gold nanoparticles and 15 mg/kg of GdCl ₃ could effectively reduce the pathological necrosis of liver.

In addition, after 1, 3, 10, 24, and 48 hours of Con A injection, the mouse sinus sinus serum was taken for bran acetone transaminase (ALT) analysis. The experimental results are shown in Fig. 6, which shows that both the gold nanoparticles and GdCl ₃ can inhibit liver damage.

From the above experimental results, it was confirmed that 4 nm gold nanoparticles can inhibit acute hepatitis after calibrating macrophages. The reason is that since the excessive production of cytokines causes an inflammatory reaction, and the gold nanoparticles can inhibit the production of macrophage hormones, the effect of suppressing the inflammatory reaction can be achieved.

<4 nm gold nanoparticles inhibit tumor cell growth>

Here, a mouse orthotopic liver cancer model was used to confirm whether the gold nanoparticles inhibit tumor cell growth.

Seven days after inoculation of ML-1 _4a tumor cells, mice were pre-injected with 10 mg/kg of 4 nm gold nanoparticles (dissolved in water) and water (as control group) via the tail vein. After 28 days, the mice were sacrificed and the appearance of the liver was observed and the number of tumors was calculated. Here, 6 mice were used for the test. The experimental results are shown in Fig. 7A, which shows that the gold nanoparticles can effectively inhibit the increase in the number of tumors in the liver.

In addition, the survival rate of mice injecting 10 mg/kg of 4 nm gold nanoparticles (dissolved in water) and water (as control group) was more statistically determined, and 15 mice were used for the test. The statistical results are shown in Figure 7B, which shows that the gold nanoparticles do extend the lifespan of the mice.

It was confirmed by the above experimental results that after the macrophages were calibrated by the 4 nm gold nanoparticles, the tumor growth was inhibited and the survival rate of the mice was improved in the mouse liver tumor model. The reason is that macrophages can regulate the cell effect of macrophages after being calibrated by gold nanoparticles, inhibit macrophage to promote the proliferation of tumor cells, and thereby inhibit the growth of tumor cells.

The above-mentioned embodiments are merely examples for convenience of description, and the scope of the claims is intended to be limited to the above embodiments.

Fig. 1A is a graph showing the results of macrophage toxicity test of the gold nanoparticles of the present invention.

Fig. 1B is a graph showing the results of testing of the gold nanoparticles of the present invention phagocytized by macrophages.

2A to 2B are graphs showing the effects of the gold nanoparticles of the present invention on the secretion of cytokines.

3A to 3C are graphs showing the results of an experiment for inhibiting the production of TNF-α by the gold nanoparticles of the present invention.

Fig. 4 is a graph showing the results of the phagocytic ability of the gold nanoparticles of the present invention to phagosomes.

Figure 5 is a graph showing the effect of the gold nanoparticles of the present invention on the activity of CTSL enzyme, wherein ** indicates P < 0.01 and *** indicates P < 0.001.

Fig. 6 is a graph showing the results of an experiment of the acute hepatitis mode of the gold nanoparticles of the present invention in a concanavalin-induced immune mouse.

Figure 7A is a graph showing the results of the test of the gold nanoparticles of the present invention in a mouse orthotopic liver cancer model, wherein "<1 mm" means that the tumor size is less than 1 mm, and "1~4 mm" means that the tumor size is between 1 mm and 4 Between mm, and ">4 mm" means that the tumor size is greater than 4 mm.

Fig. 7B is a graph showing the statistical results of the survival rate of the gold nanoparticles of the present invention against liver cancer-bearing mice.

Claims (5)

A use of a gold nanoparticle for preparing a drug for inhibiting hepatitis caused by excessive production of a cytokine, wherein the particle size of the gold nanoparticles is 3-5 nm. The use according to claim 1, wherein the cytokine is tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), or interleukin-12p40 (IL-12p40). ). The use of claim 1, wherein the drug is an injection. The use of a gold nanoparticle for preparing a drug for inhibiting growth of a liver tumor cell, wherein the particle size of the gold nanoparticle is 3-5 nm, and the gold nanoparticle is concentrated in macrophage The corpuscle inhibits the growth of tumor cells. The use of claim 4, wherein the drug is an injection.