TWI412593B - Method and tool for detecting genetic mutation - Google Patents

Abstract

Methods for detecting genetic mutation allowing detection of very low frequency mutation are described. The methods comprise treating RNA: DNA heteroduplexes of interest with ribonuclease treatment coupled with DNA polymerase treatment. RNA: DNA heteroduplexes of interest are preferentially targeted by ribonuclease and subsequent sequence extension by RNA-primed DNA polymerase. The methods may be carried out partially or entirely manually, automatically, and combinations thereof. The methods may be performed wholly or partially in solution, on solid phase media, in large scale, adapted for high throughput analysis, and any combinations thereof. Apparatus and products for detecting genetic mutation are described.

Description

Detection method and tool set of genetic variation sample

The present invention relates to a detection method; in particular, to a highly sensitive and widely used genetic variation test. Through the characteristics of its operation on the solid interface, the inspection procedure is simplified, and the inspection operation is fully automated or semi-automated, and even the feasibility of simultaneously detecting multiple different gene mutations in a plurality of different samples can be achieved. In addition, the present invention also discloses construction blueprints for instruments for constructing a method for automatically operating a genetically modified sample.

Gene mutations play a very important role in the initiation of carcinogenesis, and in the subsequent evolution of a series of cells, even the transfer of malignant cells and the resistance of the last cancer cells to treatment. There are many assays for genetic variation available to clinicians and researchers, such as single-stranded deoxyribonucleic acid structural polymorphism (SSCP) assays, and Heteroduplex Formation assays for deoxyribonucleic acid. , high performance liquid chromatography (HPLC) screening, Ribonuclease Protection assay, and DNA Sequencing. However, the sensitivity of these assays is only about 10%, and it is impossible to detect a small number of mutant cells in thousands of normal cells. Therefore, it is still a great challenge for researchers or clinicians to detect a small number of malignant cells that have just appeared in the early stage or a few cancer cells that remain after treatment.

In addition to the sensitivity limitations, detection efficiency is another problem. Eye For example, in the most advanced microarray technologies, in order to detect a mutation in a gene, it is necessary to use thousands of different sequences of deoxyribonucleic acid as a probe. By analogy, if you want to detect mutations in multiple genes at the same time, the number of probes required will be difficult to count. Therefore, it is even more difficult to simultaneously test mutations in multiple genes in many different samples. In addition, the current technology cannot observe the cell morphology on the one hand under the microscope or in situ, and on the other hand, detect the mutation of the intracellular gene. In other words, in the current technology, even if the presence of a gene mutation is known, the source of the mutant cell cannot be identified.

Therefore, it is necessary to propose a method, apparatus and related products to overcome the above difficulties and bottlenecks, and to detect a very small number of abnormal cells with mutant genes in millions of normal cells.

The following is only a general brief description, and its purpose is to give the reader a basic understanding of the gene mutation detection method, the detector, and related products disclosed in the present invention, and does not cover a comprehensive review of all possible applications and operations. It is not intended to disclose or delineate key elements of the invention, but to limit the scope of the invention. This brief description only briefly describes the basic concepts of the invention and is a prelude to a more detailed description.

The invention provides a detection method for a wide range of genetically modified samples. In short, the detection method of this genetic variant sample includes the following main steps: (1) using the single-stranded wild-type DNA of the normal wild-type reverse sequence as a probe With it To detect ribonucleic acid (RNA) hybridization in a sample, a ribonucleic acid: DNA heteroduplex is formed. Therefore, two different types of mixed double strands may be formed: first, the sequence of the ribonucleic acid is completely different from the probe, and the sequence of the ribonucleic acid is not completely matched with the probe, and at least one of the bands is not matched. Differences; (2) hydrolysis of the above mixed double strands by ribonuclease, resulting in hydrolysis of the ribonucleotides that are not matched, and releasing a tri-terminal hydroxyl group (3'-OH group); The perfectly paired mixed double strands are protected intact; (3) the addition of RNA-primed DNA polymerase, which uses the tri-terminal hydroxyl of the ribonucleic acid as a primer, is newly released. The tri-terminal hydroxyl group begins to synthesize a new deoxyribonucleic acid strand along the probe of the deoxyribonucleic acid; (4) the newly synthesized mixed double strand produces a triplet with specificity and adhesion. (3' sticky end); (5) use this new adhesive end to engage the adapter carrying the tag. Since the normal mixed double strand does not have a new sequence extension, the mutant mixed double strand is extended by the new sequence by being hydrolyzed to generate a gap and release the tri-terminal new hydroxyl group. This difference is referred to in the present invention as a differential sequence extension (or DSE). Since only the mutant mixed double strand can generate an extension of the new sequence and engage with the adapter carrying the label, the sample containing the mutant can be detected simply and specifically. In addition, a small amount of mutant-adaptive strand hybrids in a sample can be replicated and amplified using a polymerase chain reaction, and can be detected sensitively.

Based on the above detection method of genetically modified samples, in order to simplify the In the foreland operation procedure, the present invention discloses an unrestricted application embodiment, that is, the detection method of the genetic variant sample is established on a solid interface. Briefly, a probe that occludes a single-stranded deoxyribonucleic acid with a restriction enzyme sequence is first immobilized on a solid interface, so that a series of subsequent reactions can be easily performed at the solid interface. The method comprises the following steps: (1) hybridizing with a ribonucleic acid of a sample to be detected to form a ribonucleic acid: a deoxyribonucleic acid mixed double strand; (2) ribonuclease hydrolyzing a non-matching paired ribonucleotide, thereby causing the mutant ribonucleic acid to be hydrolyzed. Release the tri-terminal hydroxyl group at the gap; (3) start synthesizing the sequence of the extended new deoxyribonucleic acid starting from the newly released tri-terminal hydroxyl group, thereby causing the hidden restriction enzyme sequence to be revealed; (4) using the The restriction enzyme cuts the mutant mixed double strand away from the solid interface while producing an uneven and specific triplet. Finally, it is combined with the adaptor link, and then the polymerase chain reaction is used to replicate and sensitively detect the trace mutant-adaptive strand hybrid in the sample. Alternatively, the single-stranded probe described above does not necessarily have to be embedded with a restriction enzyme sequence, and by differential sequence extension, the mutant mixed double-strand produces an uneven and specific triplet, and at the solid interface Directly combined with the labeled adaptor link; in addition, the mutant-adaptive strand hybrid can be detached from the solid interface by any known method, and then the polymerase chain reaction can be performed to replicate, amplify and detect Measurement.

The present invention also provides another non-limiting application embodiment, that is, a set or a set of genetic variation detecting tool combinations for operating the detection method of the genetic variation sample disclosed in the present invention. In general, these kits or sets of reagent combinations comprise probes of single-stranded deoxyribonucleic acid with single or multiple reverse sequences. These probes are soluble in liquids, can be made into powders, or Fixed to the solid interface. The ranges covered by each probe each represent a sequence or a sequence of a region gene. Each probe can be used alone in a single sample or distributed to multiple different samples as desired. Each probe may also be fixed to a certain point on the solid interface, or may be fixed to the solid interface after mixing. These kits or sets of kits may also contain all or part of the reagents required for the detection method of the genetically modified sample associated with the operation of the present invention. In addition, a user guide for explaining and executing the detection method of the genetically modified sample disclosed in the present invention may be included.

The present invention also provides another non-limiting application embodiment, namely a fully automatic or semi-automatic instrument to operate the detection method of the genetically modified sample disclosed in the present invention. Briefly, the instrument consists of at least one reaction chamber provided with at least one movable device and a wall, a roof and a floor, at least one of which is provided. The instrument also has a temperature regulator to control the temperature of the reaction chamber and reagents. The instrument also has a liquid dispensing and sucking device to add the necessary reagents, washes and discharges unused solutions and reagents to each sample. If the probe is attached to a magnetically solid interface, the instrument can also be provided with an electromagnetic structure that is required to react with the power source and react with the reagent, making it magnetically absent. Alternatively, by transporting on the arm or track, the specimen is viewed as needed, and in or out of the magnetic or non-magnetic environment or reaction chamber. In addition, the above temperature controller, electromagnetic structure and liquid dispensing sucking device can be controlled by the arm, depending on the reaction, or close to, or removed from the sample to be detected. If you want to use the fluorescence detection method, a fluorometer can be set in the reaction chamber of the instrument to detect the change of fluorescence in each sample. Similarly, if other methods are used for detection, the reaction chamber of the instrument can be Set a suitable detector to detect changes in each specimen.

The drawings, which are set forth below, briefly depict some embodiments, application examples, and concepts of the invention. These drawings have not exhaustively summarized the scope of all possible aspects of the present invention, and merely briefly depict the key elements related to the present invention. Therefore, in order to have a thorough understanding of the concepts and applications disclosed herein, the following description of the embodiments of the present invention must be read and referenced to the accompanying drawings. The figures are numbered sequentially, and each represents a different key element, embodiment, or application example than those disclosed herein.

15 is a flow chart showing a method for detecting a genetically modified sample according to a preferred embodiment of the present invention. Referring to Figure 15, the method for detecting a genetically modified sample disclosed in this embodiment requires first performing a ribonucleic acid 50 in an assay and a normal wild-type reverse sequence of single-stranded deoxyribose. The probes of nucleic acids 61, 62 are hybridized. Thus, a ribonucleic acid: a first mixed double strand 71 of deoxyribonucleic acid and a second mixed double strand 72 are formed. Wherein, the first mixed double strand 71 is formed by hybridization of the inverted first deoxyribonucleic acid probe 61 to the forward first ribonucleic acid 51. The first ribonucleic acid 51 carries a mutation point (indicated by a solid triangle in the figure). Further, the second mixed double strand 72 is formed by hybridization of the inverted second deoxyribonucleic acid probe 62 to the forward second ribonucleic acid 52.

After hybridization, the normal ribonucleic acid (second ribonucleic acid) 52 in the assay forms a second mixed double strand 72 that is perfectly matched to the probe of the deoxyribonucleic acid (second deoxyribonucleic acid probe) 62. That is, the second mixed double chain 72 The plurality of second nucleotides of the dinucleotidase 52 can be paired with the probe 62 that binds the second deoxyribonucleic acid.

Conversely, the mutated sequence (first ribonucleic acid) 51 and the probe 61 produce a first mixed double strand 71 that does not match. That is, the first mixed double strand 71, that is, a mutant mixed double strand 71, whose first ribonucleic acid 51 has at least one first ribonucleotide 51a unable to pair with the first deoxyribonucleic acid probe 61.

Thereafter, the first ribonucleotide 51a which is not mismatched on the mutant mixed double strand 71 is hydrolyzed by the ribonuclease hydrolysis reaction to generate the notch 71a, and a tri-terminal hydroxyl group is released (3' -OH group). Conversely, the normal second ribonucleic acid 52 in the test body is completely protected by a complete anastomosis pairing.

Continuing to refer to Figure 15, after the hydrolysis treatment with ribonuclease, the differential sequence extension referred to in the present invention is carried out. In detail, the difference of the claimed form is carried out by using RNA-primed DNA polymerase with the first ribonucleic acid 51 as a primer and the first deoxyribonucleic acid probe 61 as a template. Differential sequence extension (DSE). Here, polymerases which can be used include, but are not limited to, Klenow enzyme of Escherichia coli, Klenow exo-enzyme lacking exonuclease properties, and the like. These polymerases can use the gap 71a produced by ribonuclease hydrolysis on the mutant mixed double strand 71 and its tri-terminal hydroxyl group as a starting point, starting with the probe 61 of the first deoxyribonucleic acid as a template. Probe 61 of the first deoxyribonucleic acid, to replicate the sequence of the extended deoxyribonucleic acid Oxygen ribonucleic acid chain).

Since the normal mixed double strand 72 has no new sequence extension, the mutant mixed double strand 71 is extended to a new sequence by being hydrolyzed to generate the gap 71a and release the tri-terminal new hydroxyl group. This difference is referred to in the present invention as a differential sequence extension.

In addition, in view of the limited length of the sequence that Klenow enzyme or Klenow exo-enzyme can extend, in order to extend the sequence further, the Klenow enzyme or Klenow exo-enzyme can be first extended from the gap 71a produced by ribonuclease hydrolysis. A short sequence of DNA, followed by a more active Taq DNA polymerase to lengthen the extension of the sequence. Combinations of such dual enzymes include, without limitation, Klenow enzyme or Klenow exo-enzyme plus Taq DNA polymerase. Since the extension of the sequence is more long-term, the combination of the two enzymes allows the nucleic acid sequence detectable by the detection method of the genetically modified sample disclosed by the present invention to be greatly increased. The range covered by the assay can be multiplied by three or four hundred nucleotide sequences to thousands of nucleotide sequences.

In general, in order to facilitate the binding of the mutant mixed double strand 71 to the adaptor strand, the differential sequence extension induced by ribonuclease hydrolysis must be able to produce an uneven and specific triple-adhesive end ( Triple end; 3' sticky end) 80. The resulting triplet 80 is also different depending on the RNA-primed DNA polymerase, polymerase combination or method employed. For example, when performing differential sequence extension, the Klenow enzyme and the dideoxyrinucleotide are used to block the forward ribonucleic acid strand, since the extension of the sequence is limited to a single nucleotide, resulting in a biased pair of A single-stranded probe of the adenine nucleotide overhang (5' "AA" dinucleotide overhang) becomes a penta-end with only a single adenine nucleotide overhang (5' single Nucleotide "A" overhang). In the case of a positive strand, it is a recessed single adenine nucleotide (3' single nucleotide "A" recessive end). For example, if Klenow enzyme and Taq DNA polymerase are combined to perform differential sequence extension, since Taq DNA polymerase has a terminal-like deoxyribonucleotide transferase (TdT) activity, it will be in deoxyribose The triplet 80 of the nucleic acid adds more than one deoxyadenosine nucleotide, thus producing a triplet single nucleotide "A" overhang in the positive strand. Furthermore, if the restriction enzyme sequence of one or more than one stretch is buried in the probe 61 of the single-stranded reverse sequence, the restriction enzyme sequence can be visualized on the mutant mixed double strand 71 via differential sequence extension. The restriction enzyme is then used to cleave the newly synthesized restriction enzyme sequence such that the mutant mixed double strand 71 produces an uneven adhesion end 80 characteristic of the restriction enzyme. By the so-called differential sequence extension of the present invention, a method for causing a mutant mixed double strand to produce an adhesive end includes, but is not limited to, the above-described methods that can be utilized.

Continuing to refer to Figure 15, after the uneven adhesive end 80 is formed on the mutant mixed double strand 71, the appropriate adapter 81 can be joined using currently known molecular biology or other techniques. Since the normal type mixed double strands 72 are blunt ends or have different sequences of partial ends, they cannot be joined to the added adaptor chain 81. By virtue of this highly specific ligation reaction, the mutant-adaptive strand hybrid 91 obtained by the reaction can be easily and specifically detected and quantified. In general, the adaptor strand 81 used in the method for detecting a genetically modified sample disclosed in the present invention has a length of at least ten nucleotides, however It can also be as long as hundreds of nucleotides as needed. In an unrestricted application, it is approximately 18 to 30 nucleotides in length.

There are a number of different methods that can be used to detect the mutant-aptaming strand hybrid 91 formed after the ligation reaction. One of the precise and sensitive methods is to use a polymerase chain reaction, with a probe 61 derived from deoxyribonucleic acid and the sequence of the adaptor strand 81 as a combination of forward and reverse primers. Come on. This method allows the mutant-adaptor chain hybrid to be highly selective, equal to the efficiency of the number of stages, and is replicated to amplify more than 10 million copies. Therefore, even if there are only a very small number of mutant types in the millions of normal cells in the test, they can be detected very sensitively.

The adapter chain 81 can also carry indicia, such as markers that are embedded or labeled for identification, for detection and quantification. The so-called labels herein include any detectable molecule, atom or group. Such markers can be labeled on ribonucleic acids, deoxyribonucleic acids, proteins or any molecule or atom known in the biochemical art. Any known label can be used, including, without limitation, fluorescent dyes, general stains, radioisotopes, chemiluminescent substrates, luciferase substrates, or the like. Different combinations of tags. These markers can be detected using a variety of different methods or instruments, including, without limitation, fluorescent detectors, color detectors, autoradiography, any optical or digital camera, illumination, chemical enzyme reactions, etc. .

The mutant-adaptive strand hybrid 91 formed after the ligation reaction can be further analyzed and identified by techniques of genetic engineering recombination or other molecular biology techniques, such as DNA sequence identification.

Any of the currently known techniques can be used to make the ribonucleic acid referred to herein as the deoxyribonucleic acid double strands 71,72. These include, but are not limited to, an example described below, in which a DNA probe containing a ribonucleotide sample with a gene sequence to be detected and a wild-type single-stranded reverse sequence is paired under appropriate hybridization conditions and conditions. And produce ribonucleic acid: DNA mixed double strands.

The single-stranded ribonucleic acids 51, 52 described above can be directly derived from any sample, cell, body fluid or culture medium. It can also be replicated and amplified using any known biochemical or molecular biological technique to reduce the required sample and enhance the sensitivity of the assay. Methods for replicating amplified single-stranded ribonucleic acids 51, 52, including, but not limited to, in vitro transcription, transcription-mediated amplification, or polymerase chain reaction with test tubes Kernel nucleic acid transcription. Such single-stranded ribonucleic acids 51, 52 may be derived from fragments of a particular gene, fragments or full length of full length or multiple different genes. The single-stranded ribonucleic acid may represent a fragment of the particular gene, a full-length or a plurality of fragments of different genes or a full-length sequence.

A single-stranded ribonucleic acid amplification amplification method suitable for use in the present invention is described herein by way of example, using a polymerase chain reaction and a test tube ribonucleotide transcription. First, the ribonucleic acids 51 and 52 in the sample are synthesized by reverse transcriptase to synthesize complementary deoxyribonucleic acid (cDNA), and then the polymerase chain reaction is used to copy and amplify the gene sequence to be detected. Since the forward primer used contains a sequence with a T7 RNA transcriptase promoter, the product after the chain reaction of the polymerase is also caused by A sequence with a T7 RNA transcriptase promoting factor. Therefore, by using T7 RNA transcriptase as a template, the single-stranded ribonucleic acids 51 and 52 containing the gene sequence to be detected can be replicated and amplified. Using the same principles and methods, there are still other sequences of RNA transcriptase and promoters available, such as, but not limited to, sequences of T3 RNA transcriptase and its facilitator, sequences of SP6 RNA transcriptase and its promoters. and many more. After replicating the amplified single-stranded ribonucleic acids 51, 52, they should be treated with DNase to eliminate unnecessary DNA in the assay.

The single-stranded reverse sequence wild-type probes 61, 62 required by the present invention can be synthesized by a number of different methods including, but not limited to, by using the reverse sequence of the gene to be detected as a primer and the product of the above-described polymerase chain reaction. The template is generated by replicating the polymerase chain reaction again. In general, the length of probes 61, 62 can be as short as two or thirty nucleotides and as long as several thousand nucleotides. The optimal length is from a few hundred to a thousand nucleotides.

If the above-described polymerase chain reaction method is used to synthesize the wild-type probes 61, 62 of the single-stranded reverse sequence, it must be considered that the polymerase chain reaction produces some unnecessary double-stranded products. Therefore, it must be processed and purified before it can be used.

The method for purifying and blocking background noise depicted in FIG. 1 is directed to a wild-type probe 61, 62 (Fig. 15) of a single-stranded reverse sequence, each of which has a segment or more than a Res restriction enzyme sequence. Words. One of the methods is not limited to this method, that is, using one or several different cleavage restriction enzymes (such as Hha I, Hpa II and Mbo I, etc.), plus the Res restriction enzyme to cleave the double-stranded product. Then, add Klenow enzyme and dideoxynucleotide to block exposure. The tri-terminal hydroxyl group is deactivated and the overhang sequence exposed by the Res restriction enzyme is engineered. The above blocking method is also carried out by terminal deoxynucleotidyl transferase and dideoxynucleotide, or by Klenow enzyme, deoxynucleotidyl transferase and dideoxynucleotide. Finally, the cleaved fragments and the unnecessary dideoxynucleotides are removed and purified, while the wild-type probes 51, 52 of the purified single-stranded reverse sequence are retained. Such pure disposal avoids the occurrence of non-specific sequence extensions in the case of differential sequence extensions in the future, which helps to eliminate the detected noise.

Another method for attenuating the detection of noise is to design a Kendow enzyme and Taq DNA polymerase to perform overhangs of the tri-terminal single deoxyadenosine nucleotides produced by differential sequence extension. As depicted in Figure 2, prior to performing the differential sequence extension, some of the non-specific single deoxyadenosine nucleotides that are added by the polymerase chain reaction in the assay must be referred to by the present invention. The blocking adapter 63 is blocked to block. The purpose is to prevent such triad overhangs containing a non-specific single deoxyadenosine nucleotide from binding to the adaptor strand 81 for detection (Fig. 15). As depicted in Figure 1, this reverses the triplet of the adaptor strand, with a single deoxythymidine (3' single nucleotide "T" overhang), which can be carried with the triplet The single deoxyadenosine nucleotides are in an anastomosis pairing. Thus, the overhanging of all non-specific single deoxyadenosine nucleotides can be blocked prior to differential sequence extension. It must be mentioned that in order for this blocking ligand 63 to bind to the overhang of a single deoxyadenosine nucleotide, the pentagonal end of the forward chain needs to be first phosphorylated to facilitate the splicing. reaction. In addition, in order to make this block The distribution chain 63 completely loses the possibility of being extended by the sequence, and the hydroxyl group of the forward chain triple-bias must also be first citrated. In addition to decanoylation, the trimer can also be bonded to any other chemically inactive blunt molecule, atom or group to block the hydroxy group. If the differential sequence extension is made to limit the other uneven trimines formed after the enzyme is cleaved, then the above-described blocking treatment is not required.

There is also a method for attenuating the detection of noise, which is used to block incompletely transcribed ribonucleic acid (transcript-insensitive ribonucleic acid 55; Figure 3) and any other factors that cause free exposed tri-terminal hydroxyl groups. Lost activity. As depicted in Figure 3, after hybridization to form ribonucleic acid: deoxyribonucleic acid mixed double strands 71, 72, Klenow enzyme or Klenow exo-enzyme and dideoxynucleotide can be added to block free exposed tri-terminal hydroxyl groups. 76. In this blocking treatment, any known RNA-primed DNA polymerase may be employed, such as, but not limited to, the Klenow enzyme or the Klenow exo-enzyme described above or the Klenow enzyme and Taq DNA polymerase. After such blocking treatment, the ribonuclease hydrolysis reaction ensures the tri-terminal hydroxyl group (-OH; Figure 15) utilized for the subsequent differential sequence extension, which is derived from the unmatched mutant double-stranded 71. It was released and cut. Such blocking of the completeness of the treatment is an important key to the specificity of the subsequent extended sequence extension.

There are also some noise reduction measures available for application. They are suitable for the adhesive end caused by restriction enzyme cleavage. First, the restriction enzyme used in the treatment of the aforementioned single-strand probes 61, 62 (Fig. 15) specifically includes a restriction enzyme to be used after the extension of the differential sequence. In this way, the adhesive end of the restriction enzyme is exposed in advance, and is allowed to be performed before the differential sequence extension is performed. Klenow enzyme and dideoxynucleotide modification and blocking. Second, after the ribonucleic acid: deoxyribonucleic acid mixed double strands 71, 72 are formed, the restriction enzyme is treated before the ribonuclease hydrolysis reaction. Such treatment can expose any restriction enzyme adhesion end that is hidden in the background due to incomplete restriction enzyme cleavage treatment or any other factor. At this point, Klenow enzyme and double deoxynucleotides were used to modify and block. To confirm the completeness and modification of these adhesive ends, a small portion of the blocked reaction product can be used to match the fluorescent or any detectable label for identification. If it is a positive reaction, it means that the background noise is incompletely eliminated, and there is a false positive. This pre-tested measure helps to confirm the elimination of background noise, but it is not absolutely necessary.

The probes 61 and 62 of the above-described reverse wild-type DNA may be derived from a single gene, a fragment of a single gene, a plurality of genes or a fragment of a plurality of genes. The reverse wild-type deoxyribonucleic acid probes 61 and 62 each represent a sequence of the single gene, a single gene fragment, a plurality of genes or a plurality of gene fragments. For example, probe A is a fragment directed against methyl or methyl, probe B is a fragment directed against a B gene or a B gene, probe C is a fragment directed against a C gene or a C gene, and the like. Thus, the formed ribonucleic acid: a mixed double strand of deoxyribonucleic acid, has different mixed double strands such as methyl, ethyl and propyl. And each mixed double strand may have one or more different mutations, for example, methyl group has A1, A2, A3, etc., and B gene has B1, B2, B3, etc., C There are C1, C2, C3, etc. on the gene. And any mutation can come from a different cell, sample, or individual. Each different cell, specimen, or individual may also carry two or more genes from the same gene. Or mutations in different genes. Furthermore, the DNA probes 61, 62 may be sequences derived from mutated genes, genetic recombination, or genetic polymorphism.

Figure 4 depicts a method for detecting an unrestricted genetic variant of the invention disclosed herein. As shown in Fig. 4, in an unrestricted application, a sample contains a normal ribonucleic acid 52 and a mutant ribonucleic acid 51 carrying a mutation point (indicated by a solid triangle in the figure). . After hybridization of the sample to the reverse wild-type DNA probe 62, the normal ribonucleic acid 52 forms a fully matched paired ribonucleic acid with the probe 62: a mixed double strand 72 of deoxyribonucleic acid. On the contrary, the mutant mixed double strand 71 showed a ribonucleotide 51a which could not be matched with the mutation at the mutation. Through hydrolysis of the ribonucleic acid, this does not allow the aligned ribonucleotide 51a to be hydrolyzed, while creating a gap 71a on the ribonucleic acid 51 chain and releasing a new tri-terminal hydroxyl group (-OH). The ribonucleic acid 51, which is cleaved and has a tri-terminal hydroxyl group, can be used as a primer for the RNA-primed DNA polymerase, and the probe 61 of the deoxyribonucleic acid is used as a template to start sequence extension and replicate a new deoxyribonucleic acid. The chain, in turn, produces a specific adhesive triplet 80. Conversely, normal ribonucleic acid 52 is completely protected by a complete match with probe 62. Therefore, it cannot be utilized by RNA-primed DNA polymerase for sequence extension while maintaining the originally flattened triplet. Thereafter, an identical adaptor strand 81 is added to selectively engage the adhesive end 80 on the mutant mixed double strand 71 to produce a mutant-aptile strand hybrid 91. Conversely, the normal mixed double chain 72 cannot be engaged with the adapter chain 81. The mutant-adaptive strand hybrid 91 thus formed can be recombined via a polymerase chain reaction It is amplified and sensitively detected and quantified. If the adaptor chain 81 carries a mark that can be identified, it can also be directly detected and quantified by the mark.

In order to make the above series of molecular biochemical reactions easy to operate, even fully automatic, or semi-automated, the present invention further constructs the detection method of the genetic variant sample on a solid interface. The so-called solid interface herein includes, without limitation, a film, slide, multiwell microplate, test tube, granule, wafer, and various combinations that can be fixed. The method for immobilizing deoxyribonucleic acid or ribonucleic acid at a solid interface may be any known method including, but not limited to, streptavidin, silicane, magnetic, or other methods of bonding for wafers and microarrays.

Figure 5 depicts an unrestricted application of a solid interface. This method can be used to detect a certain gene or sequence fragment in a single sample, and can also be used to detect multiple different genes or sequence fragments in multiple different samples. In general, a DNA probe that immobilizes a single-stranded wild-type reverse sequence is first placed on a solid interface, for example, using a probe carrying a biotin, firmly immobilized on the magnetic particles of streptavidin by a covalent bond. Or fixed to a multi-well plate with streptavidin. It is then hybridized with the ribonucleic acid in the assay to form a ribonucleic acid: deoxyribonucleic acid mixed double strand. After the above-described blocking purification treatment, the ribonucleic acid is hydrolyzed and differential sequence extension is performed. Due to the probe immobilized on the solid interface, the sequence of the endo-restriction enzyme is pre-buried, and the mixed double-strand with the mutant type is thus extended by the differential sequence, so that the buried restriction enzyme sequence appears. Since the above series of biochemical reactions and steps are operated on the solid interface, it is only simple and easy to wash and The necessary reagents can be replaced and the application can be carried out smoothly. Until the mutant mixed double-stranded restriction enzyme sequence is finally rendered due to the extension of the differential sequence, the restriction enzyme is used to easily cleave the mutant mixed double-strand from the solid interface and produce the binding end peculiar to the restriction enzyme. At this point, it can be easily sucked out and combined with the matching adapter to form a mutant-adaptive strand hybrid. Then, by the replication amplification of the polymerase chain reaction, the gene variation in the band contained in the quantitative assay can be sensitively detected.

As depicted in Figure 6, the present invention further discloses another non-limiting assay for application to a solid interface. This method amplifies the coverage that can be detected by the present invention, that is, synchronously detecting variations of a plurality of different gene sequences or fragments in a plurality of different samples in a highly efficient and automated manner. This method follows the method depicted in Figure 5, but is slightly modified. Briefly, as depicted in Figure 5, the assay uses a magnetic streptavidin particle or a multi-well plate with streptavidin as the solid interface. In contrast to the method depicted in Figure 5, the most significant difference is that the biased sequence of the wild type reverse sequence probe used for detection has a reverse sequence of T7 and M13. By such modification, the mutant-adaptive strand hybrid produced by differential sequence extension, restriction enzyme cleavage of the solid interface, and adaptor linkage, regardless of the source of the genetic variation, is in the forward strand of the five The apical end contains a sequence with T7-M13, and the three partial ends each have an adaptor strand sequence. Therefore, all genetic variants in the body, regardless of the source, can be detected sensitively by the replication and amplification of the polymerase chain reaction using the sequence of T7 and the adapter strand as primers and the sequence of M13 as a probe. Since the sample may contain ribonucleic acid with a similar gene, it may be confused with the sequence of the gene to be detected. Therefore, the implementation of this base Before the detection method of the mutant sample, if the ribonucleic acid of the gene to be detected is copied and amplified, background noise caused by the presence of a similar ribonucleic acid can be avoided.

As depicted in Figures 7a and 7b, the present invention further discloses another non-limiting assay that can be applied to solid interfaces or to general liquid solutions. This method can avoid the background noise caused by similar genes, and it is not necessary to copy and amplify the ribonucleic acid of a plurality of different genes to be detected before the detection, so that the original ribonucleic acid can be directly used in the test; or in order to enhance the sensitivity of the detection, it is necessary to first All of the ribonucleic acids in the specimen are replicated in a holistic manner in a simple manner. This method is characterized by the use of dual adaptive links, one for blocking the adaptation chain and the other for the detectable, labeled adaptation chain. The drawing depicted in Fig. 7a and Fig. 7b is only an example, and the execution thereof is not limited to this example. Briefly, a variety of inverted wild-type probes with "TT" double thymidine deoxynucleotides, which can be immobilized on a solid interface or suspended in a liquid, as described above, are prepared. These probes are hybridized with the ribonucleic acid in the sample to form a plurality of different ribonucleic acids: after the DNA double-stranded double-stranded, the Klenow enzyme, Taq DNase and deoxyadenosine nucleotides are used for sequence extension. The overhangs of the different mixed double strands are each provided with a single adenine nucleotide suspension. At this time, the aforementioned blocking adapter strand was added to block the single adenine nucleotide overhang on the mixed double-stranded triplet, and then hydrolyzed by ribonuclease. There are three types of mixed double-stranded-blocking adaptor strands after hydrolysis: one, a complete anastomosis pairing with a normal wild type mixed double-stranded-blocking adaptor strand hybrid; two, multiple and polynucleosides Similar gene sequences hydrolyzed by acid mismatching and normal wild type probes a mixed double-stranded-blocking adaptor strand hybrid formed; a hybrid double-stranded-blocking adaptor strand hybrid formed by a mutant sequence in which a single nucleotide does not match and is hydrolyzed . If a probe that is suspended in a liquid is used, the mixed double-stranded-blocking adapter hybrid after hydrolysis should be divided into four; if the solid interface detection method is used, the sample should be pre-treated. Divided into four and then hybridized to the probe on the solid interface. The purpose of dividing into four is to perform a single sequence extension with deoxyadenosine nucleotides, deoxyguanosine nucleotides, deoxycytidine nucleotides, deoxythymidine nucleotides, and Klenow enzyme, respectively. If the hydrolyzed mutant sequence is a guanine nucleotide, the hydrolyzed gap can be filled by the single sequence of the deoxyadenosine nucleotide, while the sequence of other deoxynucleotides still has a gap due to the inability to extend. In addition, mixed double-stranded-blocking adaptor strands that are hydrolyzed by multiple and non-matching pairings, after a single deoxynucleotide sequence has been extended, cannot be fully filled with multiple gaps. . At this point, a single-stranded S1 nuclease was added and the mixed double-stranded-intervening chain hybrid was cleaved at the gap. There are four major types of mixed double-strand-blocking adapter strand hybrids after single deoxynucleotide complement filling and S1 nuclease treatment: one, complete anastomosis pairing, normal wild type mixed double strand-blocking Adaptation chain hybrids, which cannot be extended by sequence without the tri-terminal hydroxyl group available; and second, multiple similar hydrolyzed, cleaved gene sequences and normal wild type probes Hybrid double-stranded-adaptive chain hybrids, which are also unable to sequence extension because they do not have a tri-terminal hydroxyl group that can be utilized; and third, a mutant-shaped mixed double-strand-blocking adaptor chain that is not properly filled Hybrids, cut off without the use of tri-terminal hydroxyl groups, and can not be extended in sequence; The mutated mixed double-stranded-blocking adaptor strand hybrid that is protected and contained, contains a utilizable tri-terminal hydroxyl group at the filling, thereby allowing sequence extension. At this time, by adding four kinds of deoxynucleotides and Taq DNA polymerase (or Klenow enzyme, or Klenow/Taq DNase in combination), the wild type which blocks the adaptor chain can be joined by using the filling site as a starting point. The probe is a template to replicate the new deoxyribidic acid strand. This newly synthesized deoxyribonucleic acid chain not only replaces the blocking adapter chain, but also causes a single deoxyadenosine nucleotide overhang at the triplet. Thus, after binding to the labeled adaptor link, a mutant-double adaptor strand hybrid that is detectable quantitatively is formed. This double-ligand hybrid has high specificity and can be formed only in the mutation of a single nucleotide gene sequence. This double-adaptor hybrid is also extensive, and the junction of the double-ligand is consistent regardless of the source of the gene mutation. Therefore, the sequence can be used as a primer and a probe to perform a polymerase chain reaction to replicate, amplify, detect and quantify.

The invention also discloses another detection method applied to a solid interface. As depicted in Figure 8, this method includes, but is not limited to, immobilizing probes of different single-stranded wild-type inverted sequences in different positions on the solid interface in a microarray format. In order to confirm the reliability of the detection, the same probe may be repeatedly fixed to two or more than two different positions. For example, A1 and B1; A2 and B2; A3 and B3; A4 and B4; and even An and Bn are each paired. If the ribonucleic acid with a mutation is hybridized at the positions of A1 (B1), A3 (B3), and A4 (B4), it can be made uneven and adhesive by hydrolysis of ribonuclease and differential sequence extension. Sexually biased, thus capable of engaging with a labeled adaptor strand; conversely, mixed double strands at other positions are not hydrolyzed, have no sequence extension, and thus are incompatible with labeled adaptor chains Engage. In this case, by means of an appropriate detector or detection method, a hybrid having a mutant type can be easily detected at the positions of A1 (B1), A3 (B3) and A4 (B4). If the same probes at these different positions exhibit consistent results, the reliability of the assay is more certain. It is worth mentioning that if the Klenow enzyme and Taq DNA polymerase are used for differential sequence extension, a single deoxygenated gland is formed to avoid the addition of a single deoxyadenosine nucleotide to the triplet of the probe at the solid interface. The overhang of the purine nucleotides, the triplet of these probes should be preceded by 2', 3'-dideoxyguanidine 5'-triphosphate, and dideoxycytidine nucleotides (2' , 3'-dideoxycytidine 5'-triphosphate) or 2', 3'-dideoxythymidine 5'-triphosphate to block. In addition, the noise attenuation measures as described in the first, second and third figures can also be applied here. As described above, before performing this assay, if a plurality of different ribonucleic acid sequences to be detected are first amplified and then hybridized with a probe immobilized on a solid interface, noises caused by similar gene sequences can be avoided.

The invention also discloses another detection method applied to a solid interface. As depicted in Fig. 9, this method combines the principles of the dual adaptive link combination of Fig. 7a and Fig. 7b with the format of a plurality of different wild type probes for the microarray of Fig. 8. The flow of the operation and the biochemical reaction of the application are the same as those depicted in Fig. 7a and Fig. 7b, and the description thereof will not be repeated here. The difference is that the probes used are immobilized on the solid interface in a microarray format; in addition, each sample is divided into four, and individual cells are filled with different single deoxynucleotides. As depicted in Fig. 8, in order to confirm the reliability of the detection, the same probe can be repeatedly fixed to two or more than two different positions. Compared to the assay depicted in Figure 8, this method simplifies the complex manipulation of replication of a variety of different RNAs to be detected. Therefore, it is possible to easily and extensively replicate all the ribonucleic acids in the sample, or directly hybridize the ribonucleic acid in the sample to the probe immobilized on the microarray without causing noise due to the presence of a similar gene sequence.

The invention further discloses another detection method applied to a solid interface. As depicted in Figure 10, this method first fixes the cells or tissue sections to be examined on a slide. At this point, the ribonucleic acid is located within the cell or within the tissue section. In the process of fixation, the morphology of the cells and the integrity of the cellular nucleus nucleic acids are intentionally preserved. To enhance the signal of detection, any known ribonucleic acid transcription can be used to replicate the ribonucleic acid of the gene or sequence fragment to be detected. For example, including, without limitation, feedback-type RNA recording magnification. Thereafter, the probe of the single-stranded wild-type reverse sequence is placed on the slide to hybridize with the ribonucleic acid in the cell to form a ribonucleic acid: deoxyribonucleic acid mixed double strand. As described above, after the necessary blocking treatment, ribonucleic acid hydrolysis, differential sequence extension, and ligation with the labeled adaptor strand are then performed on the slide. Since, only cells containing a mixed double-stranded strand can be ligated to the labeled adaptor strand, the mutant cells can be observed under the microscope or by microphotography, and the cell morphology is also detected in situ. To the variation of the gene. Furthermore, if several different probes are used in combination, and each probe has a different label and its unique adhesive end, the variation of two or more different genes can be detected simultaneously in the cell. For example, the probe "A" buryes the "A" restriction enzyme sequence and carries the "A" fluorescent agent, the probe "B" to bury the "B" restriction enzyme sequence and carries the "B" fluorescent agent, probe "C" buryes the "C" restriction enzyme sequence and carries a "C" fluorescent agent and the like. In this way, whether the mutations of these genes occur in the same cell, or different combinations of mutations on different cells can be recognized at a glance.

Figures 11 and 12 representatively depict a bird's eye view of two automated genetic variation detectors. An apparatus for automatically operating a detection method of a genetically modified sample on a solid interface by a similar principle, including but not limited to the two design devices. Here, only the magnetic streptavidin particles are taken as an example, and the biochemical reactions of the regulation and operation are as shown in Fig. 5 and Fig. 6. The detector depicted in Figure 11 is provided with two reaction chambers, one of which is provided with at least one magnetic device. The detector depicted in Fig. 10 has only one reaction chamber, and at least one magnetic device is provided therein; and the magnetic device can be made magnetic or sometimes by other means, so that the magnetic device can be made Close to or separate from the specimen. In a magnetic environment, probes, ribonucleic acid double-stranded chains, etc., which are fixed at the solid interface, are closely adsorbed on the tube wall or the well wall, so that the sample is not lost even if the reagent is repeatedly washed and replaced. Its product. Conversely, when the magnetic properties disappear, the probe, the sample, its products, and the like at the interface between the reagent and the solid can be thoroughly mixed to operate a series of biochemical reactions required by the present invention.

In the instrument "10" depicted in Fig. 11, two reaction chambers labeled "13" and "14" are provided. The two chambers are connected and the two chambers are separated by a door labeled "15". The door can be opened and closed as the reaction is detected. When closed, the two reaction chambers labeled "13" and "14" can be prevented from communicating with each other, and each becomes an independent reaction chamber. In addition, a temperature controller and a fluorescent measuring device "19" are provided in the reaction chamber "14", which can change the temperature according to the requirements of the sample reaction. It can track the accumulation and change of fluorescence in the detection body. In general, since the sample washing and replacement reagents can be carried out at room temperature, the reaction chamber "13" may not be provided with a temperature controller. Labeled as "12" is a sample container, including but not limited to, a multi-well plate, a micro-tube, a small water bottle, or other suitable container. In general, if a container such as a micro-tube or a small water bottle is used, it is placed on a support, a platform or a panel to form a unit so as to be moved together at the same time. If the container used is a multi-well plate, several multi-well plates can be placed together on the same platform or board. The above arrangement is designed to synchronously and efficiently detect multiple different samples in a timely and efficient manner. In addition, the two reaction chambers of "13" and "14" may be provided with a track labeled "16" for the purpose of reaction, washing and reagent replacement, and is driven by a motor labeled "17". The body enters and exits between the two rooms. If the above-mentioned track is not used, the arm can be placed in the door frame "15" between the two chambers, and the body can be moved in and out between the two chambers by the swing of the arm. The reaction chamber labeled "13" has at least one magnetic device labeled "11". The number of the magnetic devices is not limited as long as it can be properly brought into contact with the sample container labeled "12". The magnetic device labeled "11" can be of any shape, but must be in proper contact with the specimen labeled "12". The reaction chamber "13" depicted in Fig. 9 is provided with three magnetic rods. When the specimen is moved closer to the magnetic rod, the probe, the ribonucleic acid mixed double strand, etc. fixed at the solid interface are closely adsorbed. The wall of the container labeled "12" allows for easy handling and reagent replacement without loss. The reaction chamber labeled "14" has no magnetic device. The reaction chamber is designed for performing various biochemical reactions and scanning detection samples required by the present invention. Finally, the top wall of the reaction chamber "13" or other location should be equipped with a robotic arm to push the multi-chamber suction device "18". In order to timely move the sample container labeled "12", the probe and the sample fixed to the solid interface are washed and the necessary reagents are replaced. The multi-lumen suction device labeled "18" and the temperature controller and fluorescent measuring device labeled "19" are not specifically delineated in Figure 9, and are only represented by text.

In the instrument "20" depicted in Figure 12, there is a reaction chamber with a door labeled "25". When the door is closed, the reaction chamber labeled "23" can be isolated from the outside. As with the instrument "10" depicted in Figure 9, the instrument "20" has a sample container labeled "22". Such containers include, without limitation, multi-well disks, micro-tubes, vials, or other suitable containers. In addition, the instrument "20" is provided with an electromagnetic device labeled "21", and with the switching of the current, there is sometimes no magnetic. The electromagnetic device can be of any shape as long as it can be properly contacted with the specimen labeled "22". The upper half of Fig. 12 depicts the case where the reaction chamber is magnetic (labeled "23"), while the lower half depicts the case where the reaction chamber is non-magnetic (labeled "24"). In general, probes on the solid interface with magnetic, ribonucleic acid mixed double strands, etc., are all closely adhered to the wall of the container labeled "22" for washing and reagent replacement. On the contrary, the probe on the solid interface at the time of non-magnetic, the mixed double-stranded ribonucleic acid and the like can be sufficiently uniformly mixed with the reagent, so that the necessary biochemical reaction can be carried out simply and efficiently under the most suitable conditions. If the solid interface used is not magnetic, such as, but not limited to, a multi-well plate with a layer of streptavidin, the instrument "20" depicted in Figure 12 may also be free of magnetic means. Although not depicted in Figure 12, there is an arm labeled "28" in the instrument "20" to push the multi-lumen suction device. Like the instrument "10" in Figure 11, it is used to move the sample container to facilitate Wash the probe and sample on the solid interface and replace the necessary reagents. In addition, it is not specifically delineated in Figure 12, and only the text description is represented by the "29" temperature controller and the fluorescence measuring device, so as to change the temperature and tracking with the requirements of the sample reaction. Detect the accumulation and change of fluorescence.

The temperature controllers "19" and "29" provided in the instrument "10" and the instrument "20" may be, without limitation, a temperature regulating plate cover that can be moved by the arm. As the reaction needs to be detected, the sample container can be moved in time to cover the sample container, so that the sample can change or maintain the temperature required for the reaction; when the sample is washed and the reagent is replaced, the temperature control plate is removed, so that the tube can be removed. The cavity suction device is moved closer to the sample. In general, the temperature of this temperature control plate can be as low as zero degrees Celsius and as high as one hundred degrees Celsius. In addition, the devices "19" and "29" also have a fluorescent detection function to track changes in the recorded fluorescence. In other words, if a probe with a fluorescent agent and an appropriate primer are added to the body after the differential sequence extension and the adaptive link reaction, the so-called "" in the instrument "10" or the instrument "20" can be performed directly. Real-time polymerase chain reaction (realtime PCR) "to detect mutant-adaptor chain hybrids. The so-called temperature controllers and fluorescent meters of "19" and "29" can be combined into one or two separate devices.

The present invention also encompasses another non-limiting application embodiment, that is, a product related to the detection method of the genetic variant sample disclosed in the present invention. Briefly, it is a guide to the use of a kit of parts or semi-packages and a method of detecting how to operate a genetically modified sample disclosed herein. This guide can be printed, or any media interpreted by a computer, or both. This combination of sets or semi-packages can be tailored to detect specific diseases or diseases, depending on specific needs. a variation in one or more genetic sequences associated with a lesion; or a selection of one or more common diseases or lesions in response to a wide range of needs, and a combination to detect mutations in one or more of the relevant gene sequences; or Regardless of the lesion, only all or part of the reagents required to perform the detection method of the genetically modified sample disclosed in the present invention are broadly combined. In general, the kit of parts or semi-packages contains some or all of the reagents required for the method of detecting the genetically modified sample disclosed in the present invention, and the primers and enzymes required for performing the polymerase chain reaction. The probe is synthesized by a method for synthesizing a single-stranded reverse wild-type DNA probe, and can also be produced by any currently known method of molecular biology, artificial or mechanical biochemical synthesis. As mentioned above, these probes are attached to the mark for detection and identification. These probes can be powders, solutions dissolved in liquids, or immobilized on solid interfaces. These powder or liquid probes may be used singly or in combination with each other. Similarly, the probes immobilized on the solid interface may each be fixed to a specific point on the solid interface, or may be fixed to a specific point on the solid interface after mixing. So-called solid interfaces herein include, without limitation, slides, films, microtubes, multi-well plates, and the like, which immobilize ribonucleic acid or deoxyribonucleic acid. And its fixed form includes, without limitation, a microarray or any other arrangement. The immobilization method is not limited to the aforementioned covalent bond formed between Streptavidin and biotin, and any known method for immobilizing ribonucleic acid or deoxyribonucleic acid is currently applicable. The ribonucleic acid to be detected can be directly detected from the sample or copied and amplified by the various ribonucleic acid replication methods described above. In general, this set of kits can be used to detect at least one, one, or none of the following Variations in syngeneic or gene sequences, including but not limited to: (1) a set of reagents for detecting oncogenes variants, including, without limitation, K-ras, N-ras, H-ras, Src, BCR -ABL, c-myc, etc.; (2) a set of reagents for detecting tumor suppressor genes, including but not limited to, TP53, P16, Rb1, NF1, etc.; (3) a set of A combination of reagents that measure mismatch repair genes, including, but not limited to, MLH1, MSH2, MDM2, ATM, BRCA1, etc.; (4) a set of tyrosine kinase genes that detect tyrosine kinase genes , collectively referred to as kinome) variant reagent combinations, including but not limited to, NTRK2, NTRK3, FES, KDR, EPHA3, MLK4, GUCY2F, c-kit, FLT3, JAK2, etc.; (5) a set of detection growth factor acceptance a combination of reagents for variation of growth factor receptor genes, including but not limited to, EGFR, PDGFR, PDGFR, VEGFR1, VEGFR2, TGF1, TGF 2, etc.; (6) a set of deoxyribose in the glandular gland A combination of reagents for nucleic acid (mitochondria DNA) variation, including, without limitation, D-loop of granular glandular DNA, or non-D-loop Sequence; (7) a set of reagents for detecting single nucleotide polymorphism (SNP), including but not limited to, various polymorphic differences currently known; (8) one set A combination of reagents for detecting microsatellite polymorphism, including, but not limited to, various known single nucleotide polymorphism differences; (8) a set of immunoglobulin gene groups (immunoglobulin) Genes or T-cell receptors, monoclonal combination of reagents, including, without limitation, Immunoglobulin heavy chain gene, immunoglobulin light chain genes, T-cell receptor (α, β and γ genes), etc.; A combination of agents that detect genetic mutations in pathogenic microorganisms or virions, including, but not limited to, resistance to bacterial or virion gene mutations, such as mutations in the first human immunodeficiency virus (HIV-1) pol gene, tuberculosis Mutation of the Rpo gene of the bacillus, resistance to mutation of the Thymidine Kinase gene of the second type of herpes simplex virus HSV2, and the like.

In addition to the probe and instructions for use, the kit or set of kits may also comprise at least one pair of primers, the sequence of each pair of primers being derived from the sequence of the gene to be detected. In addition, reverse transcriptase and its buffer, RNA polymerase and its buffer, Taq DNA polymerase and its buffer, Klenow enzyme or Klenow exo-enzyme are also included. And its buffer, ribonucleotides and deoxyribonucleotides, deoxyribonuclease (DNase) and its buffer, etc., some or all of the above reagents, in order to replicate the ribonucleic acid in the amplified sample. In addition, the kit of combinations of the present invention may also provide the background noise attenuation blocking reagent disclosed in the present invention, including, but not limited to, Klenow enzyme or Klenow exo-enzyme, buffer, dideoxyribonucleotide (ddNTP), Partial deoxyribonucleotidyl transferase (TdT) and its buffer, and the like. Further, the kit or combination of the kits may further comprise an adaptor strand, a blocking adaptor strand, a ligase, a buffer thereof and the like which are required for the detection method of the genetic variant specimen disclosed in the present invention.

The present invention also discloses other non-limiting application embodiments, including using the device to operate the above-mentioned one in a fully automated or semi-automated manner. One step, some steps, or all of the reaction steps in the string reaction. In addition, it is also included in a plurality of samples, and the necessary reaction steps are synchronized in a single holistic manner. This includes any fully automated or semi-automated instrument suitable for operating the above reaction steps, including, without limitation, a motorized arm that moves the specimen, a multi-lumen suction that is driven by the arm, and a temperature regulator. The reaction chamber, the electromagnetic device, the support carrying the sample, and the like. The fully automated or semi-automated operation described above is aimed at achieving the purpose of simultaneously detecting many different samples in a highly efficient, high-capacity, synchronous detection manner.

Instance

Example: Detection of mutations in the BCR/abl gene using magnetic Streptavidin particles as a solid interface

This example demonstrates the implementation of a series of molecular biochemical reactions by using a wild-type single-stranded reverse sequence probe immobilized on Streptavidin magnetic particles as a support point to achieve the differential sequence extensions depicted in the present invention. Further, the mutant mixed double strand is cleaved from the solid interface by a newly synthesized dicer sequence on the mutant mixed double strand, and is ligated to the adaptor. The hybrid thus produced is amplified and amplified by the polymerase chain reaction, and the trace BCR/abl mutant sequence is detected sensitively.

First, a complementary deoxyribonucleic acid covering the field of normal wild-type c-abl tyrosine kinase (or TK) was used as a template, and a reverse primer with Biotin and Bam H1 restriction enzyme sequences was added [biotinylated] ABL7-Bam(-) reverse primer], a single-stranded reverse sequence wild-type probe was synthesized by a polymerase chain reaction. After the above-mentioned blocking purification treatment, The product of the polymerase chain reaction was converted to a single strand using zero molarity of sodium hydroxide (0.1 M NaOH). Next, a reverse wild-type probe with a single-stranded Biotin and embedded Bam H1 restriction enzyme sequence was allowed to mix with magnetic Streptavidin particles in a microcentrifuge tube or in a multi-well plate at room temperature. After about fifteen minutes, the probe can be firmly attached to the magnetic Streptavidin particles by the force of a covalent bond. At this time, a microcentrifuge tube or a multi-well plate carrying a probe and Streptavidin magnetic particles is placed on a magnetic frame or a magnetic device, and the Streptavidin magnetic particles containing the probe are closely adsorbed on the tube wall or the well wall. on. Therefore, it is easy to repeatedly wash with a low-salt neutral washing solvent without losing it.

After that, the ribonucleic acid in the sample and the wild type probe immobilized on the Streptavidin magnetic particles can be mixed and hybridized in a non-magnetic environment. In order to enhance the sensitivity of the assay, the ribonucleic acid in the sample needs to be first converted into complementary deoxyribonucleic acid (cDNA), and then replicated by polymerase chain reaction to amplify the band containing T7 RNA polymerase facilitating factor and covering the field of tyrosine kinase. Deoxyribonucleic acid. At this time, T7 RNA polymerase is used to replicate the ribonucleic acid encompassing the tyrosine kinase domain in the amplified sample. More specifically, the ribonucleic acid in the assay is first converted to a complementary deoxyribonucleic acid, and the two-fold polymerase chain reaction is used to replicate and amplify the deoxyribonucleic acid encompassing the c-abl tyrosine kinase domain. In the first round of the polymerase chain reaction, the forward primers BCR2(+), 5'-CATTCCGCTGACCATCAAT-3', and the reverse primers ABL7 Bam(-), 5'-TAGGGGAACTTGGATCCAGC-3' were used from BCR The second exon and the seventh exon of ABL. In addition, the reverse primer ABL7 Bam(-) A Bam H1 restriction enzyme sequence was also embedded. In fact, it is identical to the sequence of the reverse primer ABL7 Bam(-) used to make the probe described above, with the only difference being that without Biotin. In the second round of the polymerase chain reaction, ABL7 Bam(-) was still used as the reverse primer, except that the forward primer used T7ABL3(+), 5'-TAATACGACTCACTATAGGGATCATTCAACGGTGGCCGAC-3' from the third exon of ABL. It must be noted that the penta-terminal of T7ABL3(+) carries the sequence of the T7 RNA polymerase facilitator. The amplified product thus replicated was approximately 650 bp in length. After purification, T7 RNA polymerase and ribonucleotides (rATP, rCTP, rGTP, and rUTP) can be utilized to replicate ribonucleic acids encompassing the tyrosine kinase domain. Thereafter, the deoxyribonuclease in the sample is hydrolyzed using DNase, and only the ribonucleic acid encompassing the field of c-abl tyrosine kinase is retained. Next, hybridize to a wild-type probe immobilized on Streptavidin magnetic particles in a non-magnetic environment. The hybridization reaction was carried out in a buffer solution containing 1.25 M NaCl and 10 mM Tris pH 7.5 at a temperature of 70 ° C for one hour.

Then, the sample is put back on the magnetic frame, so that the hybridized ribonucleic acid, probe, and Streptavidin magnetic particle mixture are closely adsorbed on the tube wall or the well wall. After washing with a low-salt neutral flushing solvent, the specimen is removed from the magnetic rack. Additional Klenow exo-enzyme and dideoxynucleotide were added for treatment for four hours at 37 ° C to block the free tri-terminal hydroxyl groups in the assay. Thereafter, the TdT enzyme and the dideoxynucleotide can be further treated, so that the blocking of the free terminal hydroxyl group is more perfect.

Place the specimen on the magnetic rack to make the blocked ribonucleic acid, probe, The Streptavidin magnetic particle mixture is intimately adsorbed to the tube wall or well wall. After repeated washing with a low-salt neutral washing solvent, the sample is removed from the magnetic rack and RNase is added to hydrolyze at 37 ° C for one hour to hydrolyze the ribonucleotides that do not match the mutant pair. Free free tri-terminal hydroxyl groups are released.

After hydrolysis, the sample is placed back on the magnetic frame, so that the mixture fixed on the Streptavidin magnetic particles is closely adsorbed to the tube wall or the well wall. After washing with a low-salt neutral washing solvent, the sample was removed from the magnetic rack and mixed with Klenow enzyme, Taq DNA polymerase and deoxyribonucleotide. The treatment was carried out for 30 minutes at 37 ° C in order to enable the hydrolyzed mutant ribonucleic acid to start sequence extension using the probe as a template by the characteristics of the RNA-primed DNA polymerase possessed by the Klenow enzyme. The reaction temperature was raised to 70 ° C for thirty minutes to extend the sequence further by Taq DNA polymerase. At this time, due to the effect of differential sequence extension, the ribonucleic acid strand on the mutant mixed double strand is replaced by a deoxyribonucleic acid strand from the hydrolysis gap. Therefore, the Bam H1 restriction enzyme sequence embedded in the probe is completely visualized. Conversely, the normal wild-type mixed double strand retains the original ribonucleic acid strand because it cannot extend in sequence. Therefore, the Bam H1 restriction enzyme sequence in the probe is still buried and protected.

After the differential sequence is extended, the sample is placed on the magnetic frame so that the mixture fixed on the Streptavidin magnetic particles is closely adsorbed to the tube wall or the well wall. After repeated washing with a low-salt neutral washing solvent, the sample was removed from the magnetic rack and Bam H1 restriction enzyme was added to cut the mutant mixed double strand away from the magnetic hybrid. Bam H1 limits the time required for enzyme treatment, end-view The activity of the restriction enzyme is not uniform. It takes only five to ten minutes for the quick, and several hours for the slower.

After the Bam H1 restriction enzyme treatment, the sample is placed on the magnetic rack. At this point, the normal wild-type mixed double strands are still immobilized on the Streptavidin magnetic particles and are closely attached to the tube wall or well wall. Conversely, the mutant mixed double strands are easily sucked out by being separated from the magnetically mixed mixture, and then joined to the previously prepared Bgl II adapter strand.

The Bgl II adapter strand is formed by hybridization of two oligodeoxyribonucleotides complementary to the sequence, which is first cleaved with a Bgl II restriction enzyme and then desulfonated. The oligodeoxyribonucleotide chain of this forward sequence is referred to as Adp Bgl(+), and its sequence is as follows: 5'-GAGATCTTGCTGCCCGAAACTGCCT-3'. The reverse sequence strand is called Adp Bgl(-), and its sequence is as follows: 5'-AGGCAGTTTCGGGCAGCAAGATCTC-3'. In 50 mM NaCl and 10 mM Tris, pH 8.3, after mixing for 30 minutes with Adp Bgl(+) and Adp Bgl(-) at 65 ° C, the temperature was lowered to 37 ° C. Bgl II restriction enzyme was added for treatment for four hours. At this time, the pentagonal overhang of the cut-off point carries four nucleotide sequences of "GATC". This sequence is compatible with the viscous ends formed by the cleavage of the BamHII restriction enzyme.

The mutant-adaptor strand hybrid formed after ligation is detected by replication amplification using a two-fold polymerase chain reaction. The forward and reverse primers used in the first round were: TKF1(+), 5'-GAGAACCACTTGGTGAAGGT-3', and AdpR(-), 5'-AGGCAGTTTCGGGCAGCAAGATC-3'. The sequence of the forward primer TKF1(+) is derived from abl TK; the sequence of the reverse primer AdpR(-) is identical to the above Adp Bgl(-), but the two deoxyribonucleotides of "TC" are shortened at the triplet . This design is due to the fact that the two deoxyribonucleotides "TC" have been excised and lost after the Bgl II adapter strand has been cleaved by the Bgl II restriction enzyme. The second round of the polymerase chain reaction was carried out in a real-time polymerase chain reactor containing a fluorescent tester. In addition to using the reverse primer AdpR(-), there are forward primers TKF2(+), 5'-TGAGCAGGTTGATGACAGG-3', and probes with double fluorescent label ABLTKR, 5'-(6-FAM )-GCATGGGCTGTGTAGGTGTC-(TAMRA)-3'. In addition, a positive sample known to contain one hundred percent of Philadelphia chromosome (Ph chromosome) and E355G mutation was diluted by a factor of ten to form a set of 1:10. 1:10 ² , 1:10 ³ , 1:10 ⁴ , or even 1:10 ⁵ positive samples of different concentrations were used as reference standards to determine the sensitivity of the BCR/abl TK mutation assay. This set of positive samples of different concentrations can also be used to compare with the sample to be detected, and it is presumed that the quantitative test contains a concentration of the mutant.

As shown in Figure 13a, five positive samples of different concentrations exhibited a clear cumulative fluorescence amplification pattern with intensity that weakened as the positive concentration decreased. Expressed in another way, as the positive concentration decreases, the number of cycles required for the polymerase chain reaction increases, which is sufficient to be detected by the fluorescent detector. Taking this experiment as an example, even at a positive concentration of 1:10 ⁵ , the fluorescence cumulative enlargement map is clearly legible. On the contrary, all of the twelve specimens in the negative control group could not form a smooth and recognizable magnified pattern.

Figure 13b shows three different concentrations of positive samples (1:10, 1:10 ³ and 1:10 ⁵ ), a test substance resistant to Imatinib (labeled "A"), an Imatinib treatment after Philadelphia The chromosome disappears but the specimen containing the BCR/abl TK mutation (labeled "B") can still be detected by the detection method disclosed in the present invention, and the specimen in which the Philadelphia chromosome disappears after the Imatinib treatment and the experiment is negative ( Marked as "C"), and the specimens of the three negative control groups (labeled "D", "E", and "F").

A total of twenty-eight samples were tested in this experiment, four of which were resistant to Imatinib and contained more than 35 percent of the Philadelphia chromosome. The four samples were positive in this experiment, and their concentrations were 9 x 10 ^-2 , 2.76 x 10 ^-1 , 1.71 x 10 ^-1 , and 4.89 x 10 ^-1 , respectively, compared with the above positive control group. . These samples were subjected to deoxyribonucleic acid sequence analysis, as shown in Fig. 13c, and the mutations were further determined to be Y253D, E255V, T351I, and F317L, respectively.

In addition, there are twelve specimens that disappeared from the Philadelphia chromosome after Imatinib treatment. Since the sensitivity of DNA sequence analysis is only about 10%, these twelve samples cannot detect mutations by sequence analysis. However, by the detection method disclosed in the present invention, two of them are positive, and their concentrations are negative at 7.65 x 10 ^-3 and 1.36 x 10 ^{-2 , respectively} . Finally, as shown in Figure 13a, the twelve samples in the negative control group were all negative in this experiment.

In the example, a multi-well plate with Streptavidin was used as a solid interface to fix the K-ras and TP53 probes that bind the T7M13 sequence to detect mutations in the K-ras and TP53 genes.

This example demonstrates a series of probes by using a plurality of different wild-type reverse sequence probes attached to a Streptavidin multi-well plate as support points. Molecular biochemical reactions achieve the differential sequence extensions depicted in the present invention. In addition to this, the present example is characterized in that the wild type probes used are all joined to the sequence of T7M13. Therefore, after the mutant mixed double strand is cleaved from the solid interface by the restriction enzyme, the hybrid formed by the adaptor linkage has a common characteristic regardless of the source of the mutant gene, that is, the pentagonal end thereof has The sequence of T7M13, while the triplet has a sequence of the adaptor strand. Therefore, the sequence of T7 and the adaptor strand is a forward-reverse primer, and the sequence of M13 is used as a probe, and then amplified by a polymerase chain reaction, and the mutation of the gene to be detected in the sample is detected easily and sensitively.

First, a polymerase chain reaction was carried out with a forward primer carrying a sequence of T7M13 and a reverse primer carrying a Bam H1 restriction enzyme sequence to replicate a DNA encoding normal wild type Abl TK, K-ras and TP53. The sequences of these primers are: T7M13K-ras(+), 5'-TAATACGACTCACTATAGGGAATTCGTTTTCCCAGTCACGACGGCCTGCTGAAAATGACT GAA-3' and K-ras Bam(-), 5'-GTCCTCATGTACTGGATCCCTCATTG-3'; T7M13TP53(+), 5'-TAATACGACTCACTATAGGGAATTCGTTTTCCCAGTCACGACGTCTGGGCTTCTTGCATTCTG- 3' and TP53 Bam(-), 5'-TCTGAGTCAGGATCCTTCTGTC-3'. Using such a product as a template, each using a reverse primer with Biotin [biotinylated K-ras Bam (-) and biotinylated TP53 Bam (-)], a single chain with Biotin can be synthesized by polymerase chain reaction. Probes for normal wild type K-ras and TP53. After the above-mentioned blocking purification treatment, the zero-point concentration is utilized. Sodium hydroxide (0.1 M NaOH) turns the product of the polymerase chain reaction into a single strand. Next, a reverse wild-type probe with a single-stranded Biotin and embedded Bam H1 restriction enzyme sequence was ligated to the Streptavidin-coated multi-well plate for 15 minutes at room temperature. The probe can be firmly fixed to the multi-well plate by the force of the covalent bond. After that, it is easy to rinse the solvent with a low-salt neutral solvent and wash it over the automated multi-well washer without losing it.

After the rinsing agent is sucked, the sample to be detected can be individually added to the well on the multi-well plate to hybridize the ribonucleic acid in the sample to the wild type probe immobilized on the multi-well plate. In order to enhance the sensitivity of the assay, the ribonucleic acid in the sample needs to be first converted into complementary deoxyribonucleic acid, and then replicated by polymerase chain reaction to amplify the band-containing T7 RNA polymerase facilitating factor and the K-ras-containing and T7-containing RNA. Enzyme-promoting factors and deoxyribonucleic acids encompassing TP53. At this time, T7 RNA polymerase was used to replicate the ribonucleic acid covering K-ras and TP53 in the amplified sample. More specifically, the ribonucleic acid in the test body is first converted into complementary deoxyribonucleic acid, and the above-mentioned T7M13K-ras(+) and K-ras Bam(-), T7M13TP53(+) and TP53 Bam (- As a primer, a polymerase chain reaction is performed to replicate the DNA that covers K-ras and TP53 in a magnified sample. Since the five-terminal end of these products carries the sequence of the T7 RNA polymerase-promoting factor, T7 RNA polymerase and ribonucleotides (rATP, rCTP, rGTP, and rUTP) can be used to replicate the sample after purification treatment. Covers ribonucleic acids of K-ras and TP53. Thereafter, the deoxyribonuclease in the sample is hydrolyzed using DNase, and only the ribonucleic acid covering K-ras and TP53 is retained. Then, make it with a single-chain wild type fixed on a multi-well plate with Streptavidin. Hybridization of K-ras and TP53 probes. The hybridization reaction was carried out in a buffer solution containing 1.25 M NaCl, 30% formamide and 10 mM Tris pH 7.5 at a temperature of 50 ° C for two hours.

Then, the sample in the multi-well plate is placed on the multi-well plate washer, and the washing is repeated with a low-salt neutral rinsing agent. Additional Klenow exo-enzyme and dideoxynucleotide were added for two hours at 37 ° C to block the free tri-terminal hydroxyl groups in the assay. Thereafter, the specimen is returned to the multi-well plate washer and washed repeatedly with a low-salt neutral rinsing agent. Thereafter, treatment with TdT enzyme and dideoxynucleotide further completes the blocking of the free hydroxyl group of the tri-terminal. After washing with a low-salt neutral rinsing agent on a multi-well plate washer, ribonuclease is added to hydrolyze at 37 ° C for one hour to hydrolyze the ribonucleotides that do not match the paired mutants. Free tri-terminal hydroxyl group.

After hydrolysis, the mixture is washed with a low-salt neutral rinsing agent, followed by Klenow exo-enzyme, Taq DNA polymerase and deoxyribonucleotides. The treatment was carried out for 30 minutes at 37 ° C to enable the hydrolyzed mutant ribonucleic acid to start sequence extension using the probe as a template by the characteristics of the RNA-primed DNA polymerase possessed by the Klenow exo-enzyme. The reaction temperature was raised to 65 ° C for thirty minutes to extend the sequence further by Taq DNA polymerase. At this time, the ribonucleic acid strand on the mutant mixed double strand is converted into a deoxyribonucleic acid strand from the hydrolysis gap due to the effect of differential sequence extension. Therefore, the Bam H1 restriction enzyme sequence embedded in the probe is completely visualized. Conversely, the normal wild-type mixed double strand retains the original ribonucleic acid strand because it cannot extend in sequence. Therefore, the Bam H1 restriction enzyme sequence in the probe is still buried and protected.

After the differential sequence is extended, the sample is placed on a multi-well plate washer, washed repeatedly with a low-salt neutral rinsing agent, and then the Bam H1 restriction enzyme is added to cut the mutant mixed double-strand away from the multi-well plate. Conversely, the normal wild type mixed double chain is still fixed to the multi-well plate. Therefore, the mutant mixed double strand can be easily sucked out and reacted with the previously prepared Bgl II adapter strand.

The synthesis of the Bgl II adapter strand used herein was carried out by cleavage of the Abl TK cDNA containing the Bgl II sequence by Bgl II restriction enzyme, followed by desulfonation. The Bgl II adapter chain is approximately ~180 bp long, and the penta-end overhang at the cut-off point carries four nucleotide sequences of "GATC", which are compatible with the sticky ends formed by BamHII restriction enzyme cleavage. And can be joined.

The mutant-adaptor strand hybrid formed after ligation is detected by replication amplification using a two-fold polymerase chain reaction. The forward and reverse primers used in the first round were: T7M(+), 5'-ATACGACTCACTATAGGGAATTC-3', and Abl7D(-), 5'-TCAGCTACCTTCACCAAGTG-3'. The sequence of the forward primer T7M(+) was derived from the above T7M13K-ras(+) and T7M13TP53(+); and the sequence of the reverse primer Abl7D(-) was derived from the above Bgl II adapter strand. The second round of the polymerase chain reaction was carried out in a real-time polymerase chain reactor containing a fluorescent tester. In addition to using the forward primer T7M(+), the reverse primer AdpR(-) described above, and the probe M13R with double fluorescent label, 5'-(6-FAM)-GTCGTGACTGGGAAAACGAATTCC-(TAMRA) )-3'. In addition, a positive sample of a colorectal cancer cell line SW480 containing 100% K-ras G012V mutation was diluted by a factor of ten to form a set of 1:10, 1:10 ² . 1:10 ³ , 1:10 ⁴ , and even 1:10 ⁵ positive samples of different concentrations were used as reference standards to determine the sensitivity of the detection method for the genetically modified samples of the T7M13 sequence.

As shown in Figure 14a, five positive samples of different concentrations exhibited a clear cumulative fluorescence amplification pattern with intensity that weakened as the positive concentration decreased. Taking this experiment as an example, even at a positive concentration of 1:10 ⁵ , the fluorescence cumulative enlargement map is clearly legible. On the contrary, the two specimens in the negative control group could not form a smooth enlarged graph.

Figure 14b shows three different positive samples SW480 colorectal cancer cell line, Hct-15 colorectal cancer cell line and Ryan lymphoma cell line, and two negative control group samples.

The three positive samples were subjected to deoxyribonucleic acid sequence analysis, as shown in Fig. 14c, and the mutations were further determined to be: SW480 colorectal cancer cell line with K-ras G012V and TP53 R273H; Hct-15 large intestine The cancer cell line carries K-ras G013D and TP53 S241F; the K-ras of the Ryan lymphoma cell line carries both W019F and T020S, while the TP53 carries D281Y. It is worth mentioning that the K-ras gene mutation in the Ryan lymphoma cell line occurs in the rare 19th and 20th codons. Although these two variants are rare, the presence of these two variants was found by two different primers and different polymerase chain reactions for gene sequence identification.

Since the cell strain is only used as a sample in this experiment, the concentration of the mutant is not critical to the quantification. However, as described in Example 系列, a serial dilution of the above positive samples was used as a comparison standard, and the concentration or copy number of the quantitative mutant was presumed.

The apparatus, methods, and related products disclosed herein can be used to detect mutations in one or more different genes. The term "gene variation" as used herein includes all changes in various ribonucleic acid sequences and deoxyribonucleic acid sequences in the biological, chemical, and pharmaceutical fields, including but not limited to, point mutations, single nucleotides. Single nucleotide polymorphism (SNP), deletion of nucleic acid sequence, insertion of nucleic acid sequences, microsatellite instability, translocation of chromosomes , and combinations of one or two different variations, and the like. Regardless of size or length, variation can occur anywhere in the gene or region. It can occur in deoxyribonucleic acid (DNA) or in ribonucleic acid (RNA). Variations in these genes may be directly or indirectly related to one or some medical conditions or conditions, such as cancer or other pathologies. In a non-limiting example, mutations in certain genes can contribute to malignant transformation of cells, development into malignant tumors, metastasis and drug resistance caused by treatment, or a feature of different stages of disease progression. In addition to this, it includes, but is not limited to, polymorphic differences in single nucleotide sequences found between normal humans and polysatellite sequence polymorphism differences and the like. Changes in the polymorphism of these nucleotide sequences can be widely used to detect intracellular chromosome deletions and to identify the source of cells after blood or bone marrow stem cell transplantation. Accordingly, the apparatus, methods, and related products disclosed herein may be applied to, but not limited to, any of the above, any, or many other different situations not mentioned.

The apparatus, method and related products disclosed by the present invention can be used to detect any A source of ribonucleic acid with a sample of DNA. Such samples may be taken from an individual or organ, more individuals or organs, and may be any cell, tissue or fluid. Including, without limitation, samples of plasma, serum, spinal fluid, lymph, joint fluid, urine, tears, blood cells, tumors, biopsies. Including, without limitation, cells of any morphological form, as well as any cells, tissues or components derived from culture or recombination, replication, differentiation. Such samples may be derived from any molecular biology, microbiology or genetic engineering recombinant ribonucleic acid and deoxyribonucleic acid.

The apparatus, method and related products disclosed in the present invention are capable of detecting a very small number of mutant cells with gene mutations in millions of normal cells. Sensitivity is tens to hundreds of times higher than the current detection methods for various genetically modified samples. The apparatus, method and related products disclosed by the present invention enable the detection of genetic variation in a plurality of different samples, simultaneously or sequentially, respectively, to examine a plurality of different genes or fragments of genes, or any combination of the above.

The method disclosed in the present invention has the specificity that is not found in other gene detection methods, that is, the combination of ribonuclease treatment and the differential sequence extension referred to in the present invention, resulting in the unevenness and specificity of the mutant sequence. Sexual adhesions are biased to fit the matching adapter. The presence of such mutant adaptor strand hybrids can be readily detected if the adaptor strand is labeled. It is even possible to utilize the polymerase chain reaction to replicate a small amount of mutant-adapticle-chain hybrids in a "equal ratio" efficiency, thereby enhancing the sensitivity of the assay. In addition, the present invention also discloses the feasibility of operating the assay on a solid interface. Furthermore, automation or half is achieved Automated simultaneous detection of multiple different genetic variants in different assays.

The various applications described herein are not to be construed as limiting the scope and nature of the invention. After studying the patent specification of the present invention, many different modifications and changes can be made and made. For example, substitutions using similar reagents, reactions of the same function, and the like, for example, may be deduced from the attached drawings to make other different modifications and changes. Any modifications and alterations that are not comprehensive are considered to be within the scope of this patent.

50‧‧‧ ribonucleic acid

51‧‧‧First ribonucleic acid (mutant ribonucleic acid)

52‧‧‧Secondary ribonucleic acid (normal ribonucleic acid)

61‧‧‧First Deoxyribonucleic Acid Probe

62‧‧‧Secondary DNA probe

71‧‧‧First mixed double strand (mutant mixed double strand)

72‧‧‧Second mixed double chain (normal mixed double chain)

51a‧‧‧First ribonucleotide

71a‧‧ ‧ gap

80‧‧‧Three-adhesive end (tripolar)

81‧‧‧ Adapter chain

91‧‧‧ Adapter chain hybrid

76‧‧‧Free exposed tri-terminal hydroxyl groups

55‧‧‧ transcribed ribonucleic acid

63‧‧‧Blocking the adaptation chain

10‧‧‧Double Reaction Chamber Tester

11‧‧‧ Magnetic device

12‧‧‧Check container

13‧‧‧With magnetic reaction chamber

14‧‧‧No magnetic reaction chamber

15‧‧‧

16‧‧‧Check transport track

17‧‧‧Check container transport motor

18‧‧‧ Arm control multi-lumen suction device

19‧‧‧ Temperature controller and fluorescent measuring device

20‧‧‧Single Reaction Chamber Tester

21‧‧‧Electromagnetic devices

22‧‧‧Check container

23‧‧‧With magnetic environment

24‧‧‧No magnetic environment

25‧‧‧

28‧‧‧ Arm control multi-chamber suction device

29‧‧‧Temperature Controller and Fluorometer

Figure 1 depicts an unrestricted method for attenuating the noise of the detection methods of the genetically modified samples disclosed herein. Above Figure 1, the single-stranded reverse-sequence DNA probe is interspersed with the background noise of the double-stranded deoxyribonucleic acid. This double-stranded background noise carries the Res restriction enzyme sequence. The arrow above the first graph indicates that the double-stranded background noise is cleaved by the frequency-cut restriction enzyme and the Res restriction enzyme.

In the center of Figure 1, the double-stranded background noise is cleaved and the Res restriction enzyme sequence is revealed.

The arrows at the bottom of Figure 1 indicate blocking with Klenow exo-enzyme and double deoxyribonucleotide.

Below Figure 1, the double-stranded background noise reveals that the Res restriction enzyme sequence overhang is blocked and the single-stranded reverse-sequence DNA probe is unaffected.

Figure 2 depicts another non-limiting method for attenuating the present invention. The noise of the detection method of the genetic variant specimen disclosed. Above Figure 2, the probe of the single-stranded reverse sequence deoxyribonucleic acid is mixed with the background noise of the double-stranded deoxyribonucleic acid. This double-stranded background noise comes from the product of the polymerase chain reaction and therefore carries a triple-ended single guanine overhang. The arrow above the second graph indicates that the double-stranded deoxyribonucleic acid is cleaved by a frequency-cutting restriction enzyme.

The center of Figure 2 shows the blocking of the adaptation chain. Among them, the pentagonal end and the triplet end of the forward chain are both phosphorylated. And wherein the background noise of the single thymidine-suspended double-stranded at the triplet end of the reverse strand is cleaved and the Res restriction enzyme sequence is revealed.

The arrow below the second figure indicates the bonding reaction.

Below Figure 2, the double-stranded background noise is blocked by binding to the blocking adapter chain. Probes for single-stranded reverse sequence deoxyribonucleic acid are unaffected.

Figure 3 depicts another non-limiting method for attenuating the noise of the detection methods of the genetically modified samples disclosed herein.

The arrow above the third graph indicates the probe with the single-stranded reverse sequence ( ) hybridization. After hybridization, as shown in the center of Fig. 3, a ribonucleic acid: deoxyribonucleic acid mixed double strand is formed.

The arrow at the bottom of Figure 3 indicates blocking with Klenow exo-enzyme and double deoxyribonucleotide. At this time, as shown in the lower part of Fig. 3, the tri-terminal hydroxyl group of the transcribed ribonucleic acid was blocked by the double deoxyribonucleotide.

Figure 4 simply depicts an unrestricted method for detecting the genetic variation using the normal wild-type probe to perform the detection of the genetically modified sample disclosed herein. Figure 4 has seven arrows from top to bottom. The first arrow indicates the probe with the reverse sequence of the normal wild type ( ) hybridization.

The second and third arrows indicate hydrolysis by ribonuclease. At this time, the unpaired nucleotides are hydrolyzed to release the tri-terminal hydroxyl groups.

The fourth and fifth arrows indicate differential sequence extension with RNA-primed DNA polymerase; at this point the mutant mixed strand produces a specific triple-adhesion.

The sixth arrow indicates a Tagged Adapter 81 labeled with a mark; . After conjugation, a mutant-type ligand-hybrid that can be detected is formed, as shown on the left side of Figure 4 below.

The seventh arrow indicates that a PCR reaction (polymerase chain reaction) is carried out. As shown at the bottom right of Figure 4, polymerase chain reaction (PCR) replication amplification enhances detection sensitivity.

Figure 5 simply depicts an unrestricted method for allowing the detection method of the genetically modified sample disclosed herein to operate on a magnetically charged solid interface.

Figure 5 is from top to bottom and can be divided into seven blocks. Figure 5 is from top to bottom with eight arrows.

Figure 5 shows the left field of the first block with magnetic Streptvidin particles to hold the normal field probe. These probes carry a biotin (biotinalted) reverse sequence wild type probe (Antisense Wild Type Probe). Each probe occludes a restriction enzyme (Res) sequence.

Figure 5 is the upper right and lower right of the first block, which are normal ribonucleic acid and mutant ribonucleic acid, respectively.

The first arrow in Fig. 5 indicates that the sample and the probe are mixed and hybridized. After hybridization, a mutant mixed double strand adsorbed to the magnetic particles is formed, and adsorbed to the magnetic particles The normal mixed chains are formed as shown on the left and right sides of the second block, respectively.

The second arrow in Fig. 5 indicates that the magnetic frame is placed and the specimen is attracted to the wall of the tube for washing.

The third arrow in Figure 5 shows the removal of the magnetic frame, mixing, and ribonuclease hydrolysis. After hydrolysis, the mutant mixed double chain releases the tri-terminal hydroxyl group, and the normal mixed chain is completely protected, as shown on the left and right sides of the third block, respectively.

The fifth arrow in Figure 5 shows differential sequence extension in a non-magnetic environment. After extension, as shown to the left of the fourth block, the mutant mixed strand reveals the Res sequence. As for the Res sequence of the normal mixed chain, it is still buried, as shown on the right side of the fourth block.

The fifth arrow in Fig. 5 indicates that the magnetic frame is placed, the specimen is adsorbed on the wall of the tube for washing, and the sixth arrow indicates that the magnetic frame is removed, mixed, and Res restricts enzymatic hydrolysis. After hydrolysis, the mutant mixed strand is cleaved away from the magnetic particles as shown to the left of the fifth block. As for the normal mixed chain, it is still fixed, as shown on the right side of the fifth block.

The seventh arrow in Fig. 5 indicates that the magnetic frame is placed and the mutant mixed chain that is cut away is sucked out. The eighth arrow indicates the combination with the adapter. After binding, as shown to the left of the sixth block, a mutant-adaptor strand hybrid is formed which is amplified by polymerase chain reaction (PCR) replication. As for the normal mixed strand, it does not bind to the adaptor strand and cannot be amplified by the polymerase chain reaction.

Figure 6 simply depicts an unrestricted method which not only allows the detection method of the genetically modified sample disclosed in the present invention to be operated at a solid interface, but also simultaneously detects a plurality of different genes in a plurality of different samples. mutation. Before performing this test, if the gene sequence to be detected is first copied Amplification can avoid confusion between similar sequences and mutant sequences.

Figure 6 is from top to bottom and can be divided into six blocks. Figure 6 is from top to bottom with six arrows.

The left side of the first block in Figure 6 indicates that a plurality of different reverse sequence wild type probes are immobilized on the solid interface. The three biases of each probe were ligated to the T7M13 sequence. The Res sequence is buried in the pentagonal end of each probe.

The right side of the first block in Fig. 6 is the ribonucleic acid of the gene to be detected.

The first arrow in Fig. 6 indicates that the sample and the probe hybridize on the solid interface. After hybridization, a mutant mixed chain adsorbed on the solid interface (to the left of the second block) and a normal mixed chain adsorbed to the magnetic particles (to the right of the second block) are formed.

The second arrow in Fig. 6 shows the washing of the solid interface and the ribonuclease hydrolysis. After hydrolysis, the mutant mixed double chain releases the tri-terminal hydroxyl group, as shown to the left of the third block, the normal mixed chain is completely protected, as shown on the right side of the third block.

The third arrow in Fig. 6 indicates washing on a solid interface and performing differential sequence extension. After extension, the mutant mixed strand reveals the Res sequence (left of the fourth block), and the Res sequence of the normal mixed strand is still buried (right of the fourth block).

The fourth arrow in Fig. 6 indicates that the solid interface is washed and subjected to Res restriction enzyme hydrolysis. After hydrolysis, the mutant mixed strand is cleaved off the solid interface (left of the fifth block) and the normal mixed strand is still fixed (right of the fifth block).

The fifth arrow in Fig. 6 shows the mutant mixed chain which is sucked and excised, and the sixth arrow indicates that the mutant mixed chain is bound to the adaptor chain (Adaptor). After binding, a mutant-adaptive strand hybrid (left of the sixth block) is formed, and the sequence of T7 and the adaptor strand is used as a primer regardless of the source of the mutant gene. The sequence of M13 is a probe, and an instant polymerase chain reaction replication amplification is performed to detect the presence of a mutant. As for the normal mixed chain, it does not combine with the adaptor chain and is not copied and amplified.

Figures 7a and 7b simply depict another non-limiting method that avoids confusion between similar sequences and mutant sequences. Therefore, it is not necessary to copy and amplify the gene sequence to be detected first, and it is possible to directly detect mutations of a plurality of different genes; or, in advance, a simple transcriptional replication method can comprehensively replicate and amplify all ribonucleic acids in the sample, and is not similar to The presence of a sequence causes noise.

Figure 7a is top-down and can be divided into six blocks. Figure 7a is from top to bottom with 6 arrows.

Figure 7b is from top to bottom and can be divided into three blocks. Figure 7b is from top to bottom with 4 arrows.

The three patterns on the right side of the first block of Fig. 7a show normal transcripts, homologous transcripts, and mutant transcripts from top to bottom.

The first arrow in Figure 7a indicates that the transcript hybridizes to a variety of inverted wild-type probes with a five-terminally biased "TT" dinucleotide. After hybridization, a ribonucleic acid: deoxyribonucleic acid mixed double strand is formed, as shown in the second block.

The second arrow in Figure 7a shows sequence extension with Klenow/Taq DNase and deoxyadenine nucleotides. After extension, the triplet ends of the mixed double strands produce a single adenine nucleotide overhang, as shown in the third block.

The third arrow in Figure 7a indicates binding to the blocking adapter.

The fourth arrow in Figure 7a indicates the ribonuclease hydrolysis.

The fifth arrow in Figure 7a indicates that the sample is divided into four equal parts; Adenine, guanine, cytosine, and thymine filling (depicted below by deoxy adenine nucleotide filling as an example).

The sixth arrow in Figure 7a indicates the hydrolysis of the single-stranded S1 nuclease. The situation after hydrolysis is shown in the first block of Figure 7b.

The first to third arrows of Figure 7b indicate the elimination of small fragments hydrolyzed by S1 nuclease and sequence extension using Klenow/Taq DNase or Taq DNase alone. At this point, the blocking strand on the mutant is substituted; and a single adenine nucleotide overhang is produced. As for the normal wild type mixed double strands and mixed double strands of similar sequences, block blocking is still blocked, as shown in the second block.

The fourth arrow in Figure 7b indicates the combination with the labeled adapter chain. After binding, a mutant double-ligand hybrid (as shown in the third block) is formed for direct detection or polymerase chain reaction replication amplification and re-assay quantification.

Figure 8 simply depicts an unrestricted method for simultaneously detecting variations in a plurality of different genes in a microarray format. Before performing the detection method, if the gene sequence to be detected is copied and amplified first, the noise caused by the similar sequence can be avoided.

Figure 8 is from top to bottom and can be divided into four blocks. Figure 8 is from top to bottom with 7 arrows.

Figure 8 is to the left of the first block and is a normal specimen. Figure 8 is to the right of the first block and contains a mutant sample.

The first to third arrows of Fig. 8 indicate that the ribonucleic acid which amplifies a plurality of different genes is selectively replicated. After hybridization with a single-stranded reverse sequence wild-type probe of a plurality of different genes immobilized in a microarray format, the situation is as shown below the second block.

The fourth arrow in Figure 8 shows the formation of mixed double strands at different locations on the microarray.

The fifth arrow in Fig. 8 indicates the ribonuclease hydrolysis. After hydrolysis, the positions of A1 (B1), A3 (B3) and A4 (B4) on the microarray release the tri-terminal hydroxyl group due to the mixed double-stranded chain containing the mutant, as shown in the third block.

The sixth arrow in Fig. 8 indicates that the differential sequence extends and produces a three-terminal adhesive end.

The seventh arrow in Fig. 8 shows the adapter chain labeled with the mark. After the conjugation, as indicated by the fourth block, the positions of A1 (B1), A3 (B3) and A4 (B4) were detected by containing the labeled mutant-adaptive strand hybrid.

Figure 9 simply depicts another non-limiting method for simultaneously detecting variations in a variety of different genes in a microarray format. This method follows the dual adaptive link principle depicted in Figure 7 to eliminate noise caused by similar sequences.

Figure 9 is from top to bottom and can be divided into four blocks. Figure 9 is from top to bottom with 8 arrows.

Figure 9 shows the left side of the first block, indicating the various ribonucleic acids in the body. The right side of the first block in Fig. 9 shows the reverse field probe with the five-terminal end band "TT" fixed in the microarray format.

The first arrow in Figure 9 shows the formation of mixed double strands at different locations on the microarray.

The second arrow in Figure 9 shows sequence extension with Klenow/Taq DNase and deoxyadenine nucleotides.

The third arrow in Figure 9 indicates binding to the blocking adapter chain. After combining, a set of four copies, as shown in the second block.

Figure 4 is a fourth arrow showing the ribonuclease hydrolysis; a set of four isoforms.

The fifth arrow in Fig. 9 indicates that each fraction is filled with deoxyadenosine, guanine, cytosine, and thymidine, respectively.

The sixth arrow in Fig. 9 indicates the hydrolysis of the single-stranded S1 nuclease; the small fragment which is hydrolyzed is removed.

The seventh arrow in Figure 9 indicates the differential sequence extension using Klenow/Taq DNase or Taq DNase alone. After extension, at the position with the mutation, the blocking strand is substituted and a single adenine nucleotide overhang is produced; at the position with normal wild type and similar sequences, the mixed double strand is still blocked by the blocking strand, As shown in the third block.

The eighth arrow in Figure 9 indicates the combination with the labeled adapter chain. After binding, the positions of A1 (B1), A3 (B3) and A4 (B4) were detected with a labeled mutant-double-adaptive double-stranded hybrid, as shown in the fourth block.

Figure 10 simply depicts an unrestricted method for observing cell morphology and detecting intracellular gene variation under the microscope, in situ.

Figure 10 is from top to bottom and can be divided into six blocks. Figure 10 is from top to bottom with six arrows.

On the left side of the first block, there are normal cells. On the right side of the first block, there are mutant cells.

The first arrow in Figure 10 indicates that the cells are fixed on the slide.

The second arrow in Fig. 10 indicates the transcription of the ribonucleic acid of the gene to be detected.

The third arrow in Figure 10 indicates hybridization to the slide on the slide with the reverse sequence wild type probe. After hybridization, the cells form a ribonucleic acid nucleic acid hybrid duplex in situ, as shown in the third block.

The fourth arrow in Fig. 10 shows the ribonuclease hydrolysis on the slide. After hydrolysis, the mutant ribonucleic acid is hydrolyzed to release the tri-terminal hydroxyl group as shown to the right of the fourth block; the ribonucleic acid of the normal cell is protected, as shown by the left side of the fourth block.

The fifth arrow in Fig. 10 indicates the differential sequence extension. After extension, the mixed strand of the mutant cell produces an adhesive triplet, as shown by the right side of the fifth block; the normal intracellular mixed double strand is still blunt, as shown by the left side of the fifth block.

The sixth arrow in Fig. 10 indicates the combination with the labeled adapter chain. After binding, the mutant cells are detected by the labeled mutant-adaptor hybrid, as shown in the right of the sixth block; normal cells cannot bind to the labeled adaptor chain, such as the left side of the sixth block. Shown.

Figure 11 simply depicts an unrestricted automated instrument blueprint for operating the detection method of the genetically modified sample disclosed herein at a magnetically charged solid interface.

Above the eleventh figure, a reaction chamber equipped with a magnetic bar is attached to adsorb the magnetic particles carrying ribonucleic acid on the wall of the container for washing and replacing reagents and buffers with a multi-chamber pipette controlled by an arm. .

Below Figure 11, there is a non-magnetic reaction chamber with temperature-controlled equipment and a polymerase chain reactor equipped with a fluorescence detector for ribose Hybridization of nucleic acids, various reactions associated with the present invention, and immediate polymerase chain reactions.

Figure 12 simply depicts another non-limiting automated instrument blueprint to operate the detection method of the genetically modified sample disclosed herein at a magnetically charged solid interface.

Above the 12th figure, it is energized to generate electromagnetic, and in the case of a magnetic condition, the multi-chamber pipette controlled by the arm is used to wash and replace the reagent and the buffer.

Below Figure 12, there is none (interruption of the current causes the electromagnetic to disappear, in the absence of magnetic conditions) for hybridization of the ribonucleic acid, various reactions associated with the present invention, and an instant polymerase chain reaction.

Figures 13a, 13b and 13c show an example of detection of ABL TK variation in the specimen using the present invention.

Figure 13a is an enlarged view of the tyrosine kinase mutation assay using the Streptavidin particles as a support point for differential sequence extension reactions. The horizontal axis represents the number of cycles, and the vertical axis represents the change in brightness of the fluorescent light. The detector: ABL, the threshold value is 0.55053897.

Figure 13b is an enlarged view of the tyrosine kinase mutation assay using differential sequence extension reactions. The horizontal axis represents the number of cycles, and the vertical axis represents the change in brightness of the fluorescent light. The detector: ABL, the threshold value is 1.521371.

There is a set of patterns on the top of Figure 13c. There are two sets of patterns on the left and right sides of the center. There are two sets of patterns on the left and right sides.

On the left side of Figure 13c, the left side is the positive control group and the right side is the wild type. As for the picture on the right side of the 13c picture, the right side of each group is wild type.

Figures 14a, 14b and 14c show an example of detection of K-ras and TP53 gene variants in vivo using the present invention.

Figure 14a shows the use of Streptavidin particles as a support point, and the gene mutation detection method performed by the known sequence of T7M13 is used to enlarge the pattern. The curve below Figure 14a does not form a smooth magnified pattern and is a negative control group.

The horizontal axis of Fig. 14a indicates the number of cycles, and the vertical axis indicates the change value of the brightness of the fluorescent light. The detector: M13, the threshold value is 0.35351305.

Figure 14b shows three different positive samples SW480 colon cancer cell line, Hct-15 colon cancer cell line and Ryan lymphoma cancer cell line (B-cell), and two negative control control groups. The specimen.

Figure 14b uses Streptavidin particles as a support point to amplify the pattern using the gene mutation detection method performed by successive known sequences of T7M13.

The horizontal axis of Fig. 14b indicates the number of cycles, and the vertical axis indicates the change value of the brightness of the fluorescent light. The detector: M13, the threshold value is 0.35351305.

There is a set of patterns on the top of Figure 14c. There are two sets of patterns on the left and right sides of the center. There are two sets of patterns on the left and right sides.

Fig. 14c is a diagram showing the deoxyribonucleic acid sequence analysis of the K-Ras and TP53 genes. Fig. 15 is a flow chart showing the method for detecting a genetically modified sample according to a preferred embodiment of the present invention.

50‧‧‧ ribonucleic acid

51‧‧‧First ribonucleic acid

52‧‧‧Second RNA

61‧‧‧First Deoxyribonucleic Acid Probe

62‧‧‧Secondary DNA probe

71‧‧‧First mixed double strand (mutant mixed double strand)

72‧‧‧Second mixed double chain (normal mixed double chain)

51a‧‧‧First ribonucleotide

71a‧‧ ‧ gap

80‧‧‧Three-adhesive end (tripolar)

81‧‧‧ Adapter chain

91‧‧‧ Adapter chain hybrid

Claims (10)

A method for detecting a genetically modified sample, wherein a reverse first DNA probe is hybridized with a forward first ribonucleic acid to form a first mixed double strand, and the first mixed double strand The first ribonucleotide has a first ribonucleotide that is unable to pair with the first deoxyribonucleic acid probe, and wherein the sample has a reversed second deoxyribonucleic acid probe hybridized with the positive second ribonucleic acid And forming a second mixed double strand, wherein the second mixed double strand of the second nucleotidic acid of the second ribonucleic acid can be paired with the second deoxyribonucleic acid probe, and the method for detecting the mutant sample of the gene The method comprises: hydrolyzing the first ribonucleotide of the first ribonucleic acid to release a hydroxyl group; using the first deoxyribonucleic acid probe as a template, using a polymerase, performing the first deoxyribose sugar from the hydroxyl group The sequence of the nucleic acid is extended such that the first deoxyribonucleic acid produces a triplet; and the first mixed double link is integrated into the adaptor chain by the trimer to form an adaptor strand hybrid for Detecting, wherein the second mixed double chain is absent Close links with the adaptation. The method for detecting a genetically modified sample according to claim 1, wherein the adaptor chain carries a label. The method for detecting a genetically modified sample according to claim 1, further comprising performing a polymerase chain reaction to replicate and amplify the adaptor strand hybrid. The method for detecting a genetically modified sample according to claim 1, wherein the first deoxyribonucleic acid probe and the first ribonucleic acid, Is derived from a plurality of different genes or gene fragments, and the first deoxyribonucleic acid probe and the first ribonucleic acid each represent a sequence of the gene or the gene fragment. The method for detecting a genetically modified sample according to claim 1, wherein the first deoxyribonucleic acid probe and the second deoxyribonucleic acid probe are normal wild type probes. The method for detecting a genetically modified sample according to claim 1, wherein the first deoxyribonucleic acid probe and the first ribonucleic acid are derived from a mutant gene, a genetic recombination, or a polymorphism difference. the sequence of. The method for detecting a genetically modified sample according to claim 1, wherein the first deoxyribonucleic acid probe and the second deoxyribonucleic acid probe each bury a restriction enzyme sequence of one or more than one segment . The method for detecting a genetically modified sample according to claim 1, wherein the first ribonucleic acid and the second ribonucleic acid are located in an intracellular, tissue section or solid interface. The method for detecting a genetically modified sample according to the third aspect of the invention, wherein the polymerase chain reaction is derived from the sequence of the adaptor chain as a reverse primer, and is derived from the first deoxyribonucleic acid probe. The sequence of the needle is performed as a forward primer. An apparatus group for performing the method for detecting a genetically modified sample according to claim 1, wherein the kit comprises: the first deoxyribonucleic acid probe and the second deoxyribonucleic acid probe, Placed in solution, placed in a powder, or fixed to a solid interface; A user guide for describing a method for detecting a genetically modified sample as described in claim 1 of the patent application.