TWI410251B - Vaccine - Google Patents

Abstract

A vaccine, which is a subunit vaccine, includes recombination surface antigen one (rSao) of Streptococcus suis, with the recombination surface antigen one providing an efficiency of protection from kinds of Streptococcus suis with different serotype.

Description

vaccine

The present invention relates to a vaccine, and more particularly to a vaccine comprising a recombinant surface antigen protein (rSao) of Streptococcus suis.

Streptococcus suis (S. suis ) is a widely and important source of pigs, which can exist in the tonsils and nasal cavity of young pigs, and can be spread by close-mouth foam between pigs. Pigs cause symptoms such as arthritis, meningitis, sepsis and sudden death. Streptococcus suis is also a common infectious disease of humans and animals. It can enter the human body through damaged human skin, causing human meningitis, endocarditis and sepsis. Symptoms, severe cases may cause death, and meningitis is the most common. The serotypes of the S. suis capsular surface polysaccharides have been subdivided into 35 different serotypes, and the 35 serotypes are 1 to 34 and 1/2, with types 1 and 2 More aggressive.

At present, the prevention of Streptococcus suis infection in the market is mainly based on the use of non-activated vaccines, but the use of non-activated vaccines to prevent infection with Streptococcus suis has the disadvantage of poor preventive effect. The non-activated vaccine can not cause cell type immune response, and pigs Streptococcus has a large number of serotypes. Different serotypes of Streptococcus suis have different specificity and toxicity to the host. This inactivated vaccine can only protect a few serotypes of Streptococcus suis infection, so it is used to prevent pig chains. The use of inactivated vaccines for cocci infection cannot achieve the purpose of cross-protecting different S. suis serotype infections, so that the conventional S. suis non-activated vaccine cannot provide a complete preventive effect.

The main object of the present invention is to provide a vaccine which is effective in preventing an animal from being infected with Streptococcus suis. Another object of the present invention is to provide a vaccine which is effective in preventing an animal from being infected with S. suis type 1 and 2 serotypes.

In order to achieve the foregoing object, the technical means utilized by the present invention and the effects achievable by the technical means include: a vaccine comprising a subunit vaccine comprising a recombinant surface protein Sao of Streptococcus suis ( rSao), the protein Sao is a common surface antigen of 35 serotypes of Streptococcus suis, making the vaccine cross-protecting the infection of different serotypes of Streptococcus suis.

Unless otherwise defined, all terms used herein have the same meaning as those of ordinary skill in the art.

The latest research indicates that the surface antigen one of S. suis is an important antigen, which is a common antigen of many serotypes of Streptococcus suis. The surface antigen Sao is a typical Gram-positive membrane chimeric surface protein. The molecular weight of the surface antigen Sao has a membrane protein LPVTG chimeric modification, and can be recognized by the serum of the pig after infection with Streptococcus suis and in rehabilitation.

The invention has the disadvantages of improving the preventive effect and high cost of improving the conventional S. suis non-activated vaccine, and the invention is the colonization and sequencing of the pig chain ball. The surface protein Sao gene is sent to the prokaryotic expression system to express the recombinant surface protein Sao(rSao) of Streptococcus suis, and the common antigen rSao of the different serotypes of Streptococcus suis is applied. The use of vaccines to achieve cross-protection of different serotypes of Streptococcus suis infection in animals.

The above and other objects, features and advantages of the present invention will become more <RTIgt;

Preparation of vaccine of the invention

The first step of preparing the vaccine of the present invention is to collect samples from the nasal cavity of pigs suspected to be infected in livestock farms in various regions of Taiwan, and culture them on a screening medium to initially screen S. suis in the nasal cavity of infected pigs.

The second step of preparing the vaccine of the present invention is to extract the DNA of Streptococcus suis by a Blood & Tissue Genomic DNA Extraction Miniprep System, and use the extracted S. suis DNA as a polymerase chain reaction ( polymerase chain reaction; PCR) of the template; and further using oligonucleotide primers Sao group (Sao-F: GCG GGATCC ATGAATACTAAGAAATGGAG ; Sao-R: CAG AAGCTT GAACTAATTTACGTTTACGTG) of Streptococcus suis with a DNA polymerase chain reaction to increase The Sao protein gene of Streptococcus suis.

A third step in the preparation of the vaccine of the present invention is to construct the amplified S. suis strain Sao protein gene in a performance vector. The Sao nucleic acid fragment is ligated with a pET-32 expression vector (having an antibiotic screening gene) cleaved with the same restriction enzyme BamH I/Hind III, and is introduced by transformation Escherichia coli strain BL21 (DE3), the transformed E. coli strain was screened by antibiotics, and the successfully transformed E. coli strain was cultured in large amount to express a large amount of S. suis recombination surface protein Sao (rSao); and the present invention The E. coli strain which has been successfully transformed and can express the recombinant surface protein Sao (rSao) of Streptococcus suis is deposited in the Hsinchu Food Industry Development Research Institute of Taiwan under the registration number BCRC 940565. The recombinant surface protein rSao was subjected to protein electrophoresis analysis, and it was confirmed that the molecular weight of the recombinant surface protein rSao was 110 kDa.

After confirming that the correct Sao recombinant surface protein, the present invention further diluted Sao recombinant surface protein vaccine of the present invention a water-soluble solvent, the concentration is preferably diluted to 150 μ g / mL. The vaccine of the present invention is a subunit vaccine containing only a fragment of Streptococcus suis (recombinant surface protein Sao), which does not cause infection itself, has high safety; and can directly induce a protective immune response.

The present invention further inoculates the vaccine to experimental animals for animal immunoassay, and the experimental animals used in the present invention are ICR mice and pigs of three to four weeks old age.

Mouse safety efficacy test of the present invention

In the mouse safety efficacy test of the present invention, 20 three-week-old ICR mice were randomly divided into 4 groups of experimental mice, so that each group contained 5 experimental mice, and 3 of the 4 experimental mice were made. For the immunization group, the three groups of immunization groups were injected with a commercially available inactivated vaccine, a vaccine of the present invention and a mixed vaccine (including the vaccine of the present invention and a vaccine for inactivated use), and one group of experimental mice was kept without any injection. The preparation was used as a control group. Each of the three groups of immunizations was inoculated by subcutaneous injection. The amount of the inoculation was 0.2 mL, and one dose was given every two weeks. The challenge test was conducted four weeks after the first injection. The challenge test was to inoculate the pig chain. The cocci in the three groups of the immunized group and the control group were infected with S. suis, wherein the S. suis solution contained the first and second serotypes of Streptococcus suis; and after the first injection The second, fourth and fifth weeks of blood collection were tested by enzyme-binding immunosorbent assay (ELISA) for antibody titers at OD ₄₅₀ in each group of experimental mice.

As a result of the mouse safety efficacy test, as shown in Fig. 1, it was found that the antibody titer in the serum of the experimental mice injected with the vaccine of the present invention was significantly higher than that in the serum of the experimental mice injected with the inactivated vaccine. The price of the antibody in the control group which was not injected with any preparation after the challenge test was significantly decreased, indicating that it had obvious lesions; and the experimental mice injected with the vaccine of the present invention, the inactivated vaccine and the mixed vaccine were subjected to the test. After the challenge test, the antibody valence increased, and the antibody in the serum of the experimental mice injected with the vaccine of the present invention was the highest, and the antibody titer in the serum of the experimental mice injected with the mixed vaccine was second. The vaccine of the invention can reduce the threat of Streptococcus suis strain, and can effectively increase the antibody titer in the serum of the experimental mice, and prove that the vaccine of the invention can provide the better anti-septic effect of Streptococcus suis infection in mice than the conventional non-activated vaccine. The present invention further carries out an immunoassay for pigs to verify that the vaccine of the present invention can also provide a better effect of preventing pig Streptococcus infection in pigs.

Pig immunity test of the present invention

The pig immunoassay of the present invention selects 20 healthy pigs of three to four weeks old, and randomly divides into four groups of experimental pigs, so that each group contains 5 experimental pigs, and 3 of the 4 experimental pigs are made. For the immunization group, the three groups of immunization groups were injected with a commercially available inactivated vaccine, a vaccine of the present invention and a mixed vaccine (including the vaccine of the present invention and a vaccine for inactivated use), and one group of experimental pigs was kept without any injection. The preparation was used as a control group. The three groups of immunization groups were inoculated into the experimental pigs by intramuscular injection of the neck, and the inoculation amount was 0.2 mL, and one dose was given every two weeks, and the challenge test was performed on the fifth week after the first injection. The challenge test was inoculated with Streptococcus suis in the experimental groups of the three groups of immunized groups and the control group, all of which were infected with Streptococcus suis, wherein the Streptococcus suis serogroup contained the pigs of the first and second serotypes. Cocci, and the serum of each experimental pig was collected for the second, fourth and fifth weeks after the first injection for the pig safety efficacy test. The enzyme-binding immunosorbent assay (ELISA) was used to detect the OD in the serum of each group of experimental pigs. The antibody price of ₄₅₀ was used, and all the pigs tested were weighed on the 0th, 2nd, 5th, 6th and 7th week after the first injection to record the difference in the weight gain rate of each group of pigs. The ear temperature of each group of experimental pigs was measured for 12 consecutive days after the toxicity test to record the difference in body temperature of each group of experimental pigs.

The results of the pig safety efficacy test are shown in Fig. 2. In the fifth week after the first injection, it was found that the serum valence of the antibody in the experimental pigs injected with the vaccine of the present invention was significantly different, which was significantly higher than that of the injection. In the serum of the experimental pigs that did not activate the vaccine, the mixed vaccine, and the control group, the antibody titer of the pigs injected with the vaccine of the present invention increased two weeks after the challenge test (ie, the seventh week after the first injection). The trend is the lowest, and it is further confirmed that the vaccine of the present invention has a better protective effect on pigs.

The difference in weight gain rate is shown in Fig. 3, which is shown in the second week after the first injection. The weight of the experimental pigs injected with the vaccine of the present invention is comparable to that of the injection-inactivated vaccine, the mixed vaccine, and the control. The experimental pigs in the group had a significant increase in body weight. And the fifth, sixth and seventh after the first injection The experimental pigs injected with the vaccine of the present invention only had a significant increase in body weight compared to the control group.

The results of the difference in body temperature after the challenge were as shown in Fig. 4. The results on days 1 to 12 showed that the body temperature of the control group was significantly higher than that of the experimental pigs of the other three groups of immunization groups; The body temperature of the experimental pigs in the vaccine was kept at a minimum relative to the other three groups for a long time. After the challenge test, the clinical symptoms of each group of experimental pigs were observed. The control group continued to have fever symptoms, and there were clinical symptoms such as anorexia, hypoactivity and joint swelling, and only the experimental pigs injected with the vaccine of the present invention. The clinical symptoms were significantly reduced relative to the control group.

According to the above results, in the animal test of the present invention, after the challenge test of the experimental animal, the mouse injected with the vaccine of the present invention has a higher antibody titer in the serum than the mouse serum which is inactivated by the inactivated vaccine. In the pigs injected with the vaccine of the present invention, the antibody titer in the serum is higher than the antibody titer in the pig serum injected with the conventional inactivated vaccine, and the injection is only in this case. The experimental pigs of the invention have the lowest body temperature and the heaviest weight, and have the best feeding efficiency; it is confirmed that the vaccination of the vaccine of the invention can effectively protect the pig against the invasion of different serotypes of Streptococcus suis, and It has a perfect resistance to the first and second serotypes of Streptococcus suis, and provides a more complete effect of preventing pig infection with Streptococcus suis.

While the invention has been described in connection with the preferred embodiments described above, it is not intended to limit the scope of the invention. The technical scope of the invention is protected, and therefore the scope of protection of the present invention is attached The scope of the patent application is subject to change.

Fig. 1 is a graph showing the results of measuring the antibody titer in the serum of each group of experimental mice by an enzyme-binding immunosorbent assay according to the present invention.

Fig. 2 is a graph showing the results of measuring the antibody titer in the serum of each group of experimental pigs by enzyme-binding immunosorbent assay according to the present invention.

Fig. 3 is a histogram showing the difference in weight gain rate of each group of experimental pigs of the present invention.

Fig. 4 is a bar graph showing the difference in body temperature of each group of experimental pigs of the present invention.

<110> National Pingtung University of Science and Technology

<120> Vaccine

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 2013

<212> DNA

<213> Streptococcus suis

<220>

<221> CDS

<222> (1)..(2013)

<400> 1

<210> 2

<211> 671

<212> PRT

<213> Streptococcus suis

<400> 2

Claims (4)

A vaccine comprising a recombinant surface protein Sao of Streptococcus suis at a concentration of 150 μg/mL, wherein the recombinant surface protein Sao of Streptococcus suis consists of the amino acid sequence of SEQ ID NO: 2 to prevent an animal from being affected Streptococcus suis infection of type 1 and type 2 serotypes. The vaccine according to claim 1, wherein the vaccine is inoculated by the injection method. The vaccine according to claim 1, wherein the vaccine is a sub-unit vaccine. The vaccine according to claim 1, wherein the animal is a mouse or a pig.