TWI392504B - An antigen polypeptide for the diagnosis and/or treatment of ovarian cancer - Google Patents

Description

Antigenic polypeptide for diagnosing and/or treating ovarian cancer

The present invention provides an isolated antigenic polypeptide that can be expressed in an individual with ovarian cancer. The present invention also provides a method for diagnosing or treating ovarian cancer by using the diagnostic method of the antigen polypeptide of the present invention and by inhibiting the gene of the antigen polypeptide of the present invention.

Ovarian cancer is the leading cause of cancer death in women worldwide, and it is more likely to die than all other gynecologic malignancies. All women are at risk for ovarian cancer, and older women are more likely to develop the disease than younger women. About 90% of women with ovarian cancer are over 40 years old, and the largest number is 55 years or older. Although ovarian cancer is still the number one killer of women with gynecological malignant cell proliferation, if the early detection of ovarian cancer, the treatment effect is significant. However, ovarian cancer does not show many symptoms early, so cancer cases usually spread when ovarian cancer cases are found. Early (I/II) ovarian cancer is difficult to diagnose, and it is easier to diagnose when it spreads and develops into advanced (III/IV) ovarian cancer. The reason is that most of the common symptoms are not specific. About 75% of women diagnosed with ovarian cancer have advanced (III and IV) ovarian cancer at the time of initial diagnosis.

Women with a pregnancy likelihood should measure serum BHCG levels (Christoph Steinmeyer, Tumor Biol 2003; 24: 13-22). Furthermore, serum alpha-fetoprotein (AFP) and lactate dehydrogenase (LDH) levels in young women and adolescents with suspected ovarian cancer should be measured, as the younger the patient, the more likely they are to have malignant germ cell tumors. However, in addition to the foregoing, there has been a considerable lack of antigens useful for diagnosis and monitoring. Gynecological malignancies (especially ovarian cancer, which usually spread to the entire pelvic cavity before diagnosis) have confirmed this fact. Many of these cancers exhibit a very aggressive pattern of growth, and chemotherapy usually works better for them. Therefore, an accurate method is urgently needed to diagnose these diseases at an early stage.

Bast, et al., N. Engl. J. Med. 309: 883 (1983) revealed that serous cystadenoma ovarian antigen CA-125 is of significant value in monitoring patients with ovarian cancer. This antigen was isolated using a monoclonal antibody OC125 (prepared by stimulating a mouse having ovarian cancer cell line OVCA 433). It recognizes the cell surface antigen of OVCA 433 cells and 13 of the 14 other ovarian cancer cell lines. The antigen is a high molecular weight (>200,000 auricular) glycoprotein that is partially purified from tissue culture medium (Masuko, et al., Cancer Res. 44:2813, 1984). Furthermore, US 4,921,790 is a 40 kDa subunit of the serous cystadenoma ovarian tumor antigen CA-125, which is useful for diagnosing and monitoring ovarian cancer. Although blood test results claim that CA-125 is useful for differential diagnosis and tracking of the disease, it has not been shown to be effective in screening early ovarian cancer because its sensitivity and specificity are too low. However, serum CA-125 or other known indicators have not clearly diagnosed malignant tumors or particularly serious malignant tumors (such as ovarian cancer).

In recent years, research has focused on combining tumor marker proteomics with other indicators to improve accuracy. The challenge of this approach is that the prevalence of ovarian cancer is very low, which means that even if the test method is highly sensitive and specific, it may lead to some false positive results (ie surgery for patients without cancer). However, the contribution of proteomics is still in its early stages and it needs to be further improved. Recent studies in proteomics have marked the beginning of personalized tailor-made therapies. In recent years, no significant improvement has been made in either the patient's diagnosis or the 5-year survival rate. This is actually because of the high rate of this disease, which was found to be in the advanced stage at the time of initial diagnosis. Therefore, there are still challenges in developing new detection technologies to improve early diagnosis and reduce advanced-stage initial diagnosis.

The present invention provides an isolated antigenic polypeptide expressed in an individual of ovarian cancer, which is selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having at least 85% sequence identity to SEQ ID NO: (b) a polypeptide encoded by a polynucleotide that hybridizes to SEQ ID NO: 1 under stringent conditions or a full length complement of SEQ ID NO: 1; (c) comprises at least 85% of the sequence with SEQ ID NO: a polypeptide encoded by a polynucleotide of a nucleotide sequence of identity; and (d) an amino acid fragment encoded by the polynucleotide of SEQ ID NO: 4 or comprising an amino group of SEQ ID NO: A polypeptide of an acid fragment; the restriction is that the polypeptide sequence is contained in (a), (b) or (c).

The invention also provides a polynucleotide encoding an isolated antigenic polypeptide of the invention.

The invention further provides an antibody that specifically binds to a sequence comprising at least a consensus sequence X ₁ -PHX ₂ -YX ₃ -X ₄ at the C-terminus of the antigenic polypeptide of the invention.

The invention further provides a kit for detecting ovarian cancer in an individual comprising the antibody of the invention.

The invention further provides a method for diagnosing an individual suffering from ovarian cancer, comprising: detecting the expression of an antigenic polypeptide of the invention in a biological sample taken from an individual under conditions and time sufficient to detect the expression, wherein the antigenic polypeptide is expressed It represents ovarian cancer, and the overexpression of the antigenic polypeptide means that it not only suffers from ovarian cancer but also has metastasized ovarian cancer.

The invention further provides a method for diagnosing an individual suffering from ovarian cancer, comprising: contacting a biological sample taken from an individual with an antibody of the invention under conditions and for a time sufficient to detect binding of the antibody to the consensus sequence to determine the Whether or not the antigenic polypeptide of the present invention is present in the biological specimen, wherein the binding represents ovarian cancer. The invention also provides a method of preventing and/or treating ovarian cancer comprising the step of inhibiting the expression of an antigenic polypeptide of the invention.

One of the reasons for the low survival rate of patients with ovarian cancer is the lack of a good diagnostic marker for early detection of this disease. Failure to effectively treat ovarian cancer makes early diagnosis more difficult, and lack of comprehensive understanding of the biology of ovarian cancer hinders effective treatment of ovarian cancer. The present invention provides an ovarian cancer marker (OVTA1) expressed by the OVTA1 gene to overcome the above deletion. Ovarian cancer can be diagnosed with high specificity and sensitivity with the OVTA1 of the present invention. Furthermore, lowering the expression of OVTA1 of the present invention inhibits the growth and metastasis of ovarian tumor cells, and this result shows that it can be used as a target for treating ovarian cancer.

definition

As used herein, the term "variant" means an isoform, a dual gene variant of a gene or a region thereof, a natural mutant version of a gene or a region thereof, or a polypeptide or fragment having an amino acid sequence, wherein The amino acid sequence differs in one or more amino acids but retains one or more of the desired characteristic biological functions. This can be accomplished by adding one or more amino acids to the amino acid sequence, deleting one or more amino acids from the amino acid sequence, and/or substituting one or more amino acids for the other amino acid. Amino acid inversion and any other mutational changes that result in changes in the amino acid sequence are also included in this definition. Variants can be prepared by altering the nucleotides of the nucleic acid sequence and altering the amino acid to be altered as the nucleic acid sequence of the mutation is expressed. Alternatively, for example, an amino acid sequence containing a desired amino acid change can be synthesized, which is within the skill of the artisan.

As used herein, the term "OVTA1 gene" means the full-length gene having nucleotides 438 to 4229 (SEQ ID NO: 1) of the sequence of GenBank No. AB023216 (the entire sequence of AB0232167 is disclosed at http://www) .ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=14133228). The sequence "AB023216" and its protein product "KIAA0999" (product number: 65551; gene/protein property table disclosed at http://www.kazusa.or.jp/huge/gfpage/KIAA0999) are disclosed in DNA Res. 1999 Feb 26 ;6(1): 63-70, and its coding gene sequence, the functional protein it encodes and its function are still unknown.

As used herein, the term "OVTA1 protein" means the full length sequence of the protein encoded by the OVTA1 gene, and the amino acid sequence thereof is shown in SEQ ID NO: 2.

As used herein, the phrase "isolated" means that the substance is removed from its original environment (eg, if it is a naturally occurring, its natural environment). For example, a natural polypeptide or polynucleotide in an animal is not isolated, and the same polypeptide or polynucleotide separated from some or all of the coexisting materials in the natural system is isolated. Such a polypeptide or polynucleotide can be part of a composition, and if the composition is not part of the natural environment, the polypeptide or polynucleotide remains as an isolate.

As used herein, the term "polypeptide" means a linear amino acid that is linked to each other by a peptide bond between an adjacent alpha-amino group and a carboxyl group.

As used herein, the phrase "polynucleotide" or "nucleotide" means a polynucleotide comprising DNA. Examples of polynucleotides also include all sequence patterns including, but not limited to, single-stranded, double-stranded, hairpin, stem-and-loop structures, and the like.

As used herein, the phrase "encoding" or "encoded" means that the polynucleotide or nucleic acid contains the necessary information to directly translate the nucleotide sequence into a particular protein. A message describing the encoded protein is specifically described using a codon. A nucleic acid or polynucleotide encoding a protein may comprise a non-transcribed sequence (such as an intron) within the transcribed region of the nucleic acid, or it may lack a non-transcribed sequence of the insertion (as in the case of cDNA).

As used herein, the terms "polypeptide", "peptide" and "protein" are interchangeable and mean a polymer of an amino acid residue. This term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs corresponding to natural amino acids, and to natural amino acid polymers.

As used herein, the term "ovarian cancer" encompasses primary and metastatic ovarian cancer. The criteria for classifying malignant tumors as ovarian cancer are well known in the art (see Bell et al., 1998 Br. J. Obstet. Gynaecol. 105: 1136; Meier et al., 1997 Anticancer Res. 17(4B): 3019 Cioffi et al., 1997 Tumori 83: 594), human ovarian cancer cell lines from primary and metastatic tumors (eg OVCAR-3, Amer. Type Culture Collection, Manassas, Va.; Yuan et al ., 1997 Gynecol. Oncol. 66:378) has also been established and characterized.

As used herein, the term "antibodies" encompasses a plurality of antibodies, monoclonal antibodies, and fragments thereof, as well as any naturally or recombinantly produced binding moiety that is a molecule that specifically binds to an antigenic polypeptide of the invention. An antibody can be defined as "immunospecific" or specific binding if it binds to the antigenic polypeptide of the invention with high affinity. The affinity of the binding moiety or antibody can be determined using conventional techniques (e.g., as described by Scatchard et al ., Ann. NY Acad. Sci. 51:660 (1949)).

As used herein, the term "expression" encompasses any step involved in the preparation of a polypeptide, including but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

As used herein, the expression "expression vector" means a linear or circular DNA molecule comprising a polynucleotide encoding a polypeptide of the invention, wherein the polynucleotide is operably linked to additional nucleotides that provide for its expression. . The term "operably linked" means a configuration in which the control sequence is located at an appropriate position relative to the coding sequence of the polypeptide sequence in order to control the expression of the coding sequence of the sequence-directed polypeptide.

As used herein, the term "host cell" encompasses any cell type that can be transformed, transfected, transduced, and the like by a nucleic acid construct comprising a polynucleotide of the present invention.

As used herein, the term "identity" means the correlation between two amino acid sequences or two nucleotide sequences. For the purposes of the present invention, the degree of identity between two amino acid sequences or two nucleotide sequences is determined by conventional methods and software. For example, the Clustal method (Higgins, 1989, CABIOS 5: 151-153) or the Wilbur-Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730).

Antigen polypeptide of the invention and polynucleotide encoding the same

The present invention is the first to unexpectedly find an antigenic polypeptide (OVTA1 protein) encoded by the OVTA1 gene that can be expressed in a patient with ovarian cancer. The above antigen polypeptide is named as an ovarian tumor-associated antigen. Ovarian cancer is diagnosed by detecting the presence of an antigenic polypeptide (OVTA1 protein) in each body.

The present invention provides an isolated antigenic polypeptide which is expressed in a patient having an ovarian cancer and is selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 2; (b) a polypeptide encoded by a polynucleotide that hybridizes to SEQ ID NO: 1 under stringent conditions or a full length complement of SEQ ID NO: 1; (c) comprises at least 85% sequence identical to SEQ ID NO: a polypeptide encoded by a polynucleotide of a nucleotide sequence; and (d) an amino acid fragment encoded by the polynucleotide of SEQ ID NO: 4 or comprising the amino acid of SEQ ID NO: a polypeptide of a fragment; the restriction is that the polypeptide sequence is contained in (a), (b) or (c).

In a first aspect, the invention relates to an amino acid sequence comprising 85%, preferably at least 90%, more preferably at least 95%, and most preferably at least 98% identity to SEQ ID NO:2. The polypeptide is isolated and can be expressed in a patient with ovarian cancer.

The polypeptide of the present invention preferably comprises an amino acid sequence of SEQ ID NO: 2, a variant thereof or a fragment thereof, which can be expressed in a patient with ovarian cancer. According to the invention, variants of the invention may be artificial variants or mature polypeptides thereof comprising one or more of the conservative amino acid substitutions, deletions and/or insertions of SEQ ID NO: 2. The amino acid change is preferably a minor modification, i.e., it is a conservative amino acid substitution or insertion that does not significantly alter protein folding and/or activity. Examples of conservative substitutions are basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine) And aspartame), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (in the group of glycine, alanine, serine, threonine and methionine). Amino acid substitutions which generally do not alter a particular activity are well known in the art and are disclosed, for example, in H. Neurath and R. L. Hill, 1979, The Proteins, Academic Press, New York. The most common interchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys. /Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

According to another embodiment of the invention, the antigenic polypeptide of the invention comprises the amino acid of SEQ ID NO: 2.

In a second aspect, the invention relates to an isolated polypeptide which is expressed in a patient suffering from ovarian cancer, under stringent conditions, preferably under moderately stringent conditions, more preferably under highly stringent conditions and optimally A polynucleotide that hybridizes to a nucleotide of SEQ ID NO: 1 or a full length complementary strand of SEQ ID NO: 1 under extremely high stringency conditions (J. Sambrook, EF Fritsch, and T. Maniatus, 1989, Molecular Cloning) , A Laboratory Manual, 2nd edition, Cold Spring Harbor, NY). Temperature and ionic strength conditions determine the "stringency" of hybridization. When initially screening for homologous nucleic acids, low stringency hybridization conditions (equivalent to T ^m (melting temperature) 55 ° C) can be utilized (eg 5 times SSC, 0.1% SDS, 0.25% milk and no formamide, or 30% formazan) Amine, 5 times SSC, 0.5% SDS). Moderate stringency hybridization conditions correspond to a higher ^Tm (eg, 40% methotrexate and 5 or 6 times SSC). Highly stringent hybridization conditions correspond to the highest ^Tm (eg, 50% methotrexate and 5 or 6 times SSC) SSC is 0.15 M NaCl, 0.015 M Na-citric acid.

In a third aspect, the invention relates to an isolated polypeptide which is expressed in a patient having an ovarian cancer, comprising at least 85%, preferably at least 90%, more preferably at least 90% of the nucleotide set forth in SEQ ID NO: 1. Preferably, at least 95%, and preferably a polypeptide encoded by a polynucleotide of at least 98% sequence identity nucleotide sequence, can be expressed in a patient with ovarian cancer.

According to an embodiment of the invention, the antigenic polypeptide of the invention may be encoded by the nucleotide sequence set forth in SEQ ID NO: 1 or its degenerate sequence. According to another embodiment of the present invention, the antigenic polypeptide of the present invention can be encoded by the nucleotide sequence shown in SEQ ID NO: 1.

In a fourth aspect, the invention relates to an isolated polypeptide which is expressed in a patient having an ovarian cancer, comprising an amino acid fragment encoded by the polynucleotide of SEQ ID NO: 4 or comprising the sequence shown in SEQ ID NO: Amino acid fragment; the restriction is that the polypeptide sequence is contained in (a), (b) or (c). The present inventors have also unexpectedly discovered that polypeptides comprising OVTA1 protein amino acid fragments 955 to 1112 (SEQ ID NO: 3) have preferred immunogenic activity and are also useful as ovarian tumor associated antigens. The above polypeptides are encoded by nucleotides 2863 to 3336 (SEQ ID NO: 4) of the OVTA1 gene.

Techniques for isolating or selecting a polynucleotide encoding a polypeptide of the present invention are known in the art and include genomic DNA isolates, products prepared from cDNA, or combinations thereof. The library of expression can be screened, for example, using conventional polymerase chain reaction (PCR) or antibody screening to detect selected DNA fragments having common structural features to select a polypeptide of the invention from genomic DNA. Other nucleic acid amplification procedures (eg, ligase chain reaction (LCR), zygote-activated transcription (LAT), and nucleotide sequence-based amplification (NASBA)) can also be utilized.

The antigenic polypeptides of the invention can be prepared from genetically engineered host cells comprising a performance system using methods well known to those skilled in the art. Thus, in another aspect, the invention relates to a system of expression comprising a polynucleotide of the invention, a host cell genetically engineered by the expression system, and for the production of a polypeptide of the invention using recombinant techniques. Accordingly, the invention is also directed to a nucleic acid construct comprising an isolated polynucleotide of the invention, wherein the isolated polynucleotide is operably linked to one or more coding coding sequences in a suitable host cell under conditions suitable for the control sequence The control sequence in the performance. The isolated polynucleotide encoding a polypeptide of the invention can be manipulated using a variety of methods to provide for polypeptide expression. The polynucleotide sequence may or may not be required to be manipulated prior to insertion into the vector, depending on the expression vector. Techniques for modifying polynucleotide sequences using recombinant DNA methods are well known in the art.

The expression system or a portion thereof or a polynucleotide of the invention can be incorporated into a host cell for genetic engineering to produce an antigenic polypeptide of the invention. Available in many standard laboratory manuals (Davis, et al ., BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook, et al ., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring The method of Harbor, NY (1989)) introduces a polynucleotide into a host cell. Representative examples of suitable hosts include bacterial cells (e.g., E. coli cells (JM109 pure line)).

The polypeptides of the invention can be prepared using a number of different expression systems. Such vectors include chromosomal-, episomal- and viral-derived vectors. A performance system construct can include a control zone that regulates and produces performance. In general, any system or vector suitable for maintaining, transmitting or expressing a polynucleotide and/or expressing a polypeptide in a host can be used for the performance described herein. Any of a number of conventional and routine techniques (e.g., as disclosed by Sambrook et al ., MOLECULAR CLONING, A LABORATORY MANUAL (suppl) can be utilized to insert appropriate DNA sequences into the expression system.

In a recombinant expression system of eukaryotic cells, a suitable secretion signal can be incorporated into the expressed polypeptide to allow secretion of the transcribed protein into the endoplasmic reticulum, periplasmic region or extracellular environment. Such signals may be endogenous or may be heterogeneous signals to the polypeptide.

The expressed antigenic polypeptides of the invention can also be used as the subject antigen for routine antibody screening assays, which can be readily performed by those skilled in the art.

An antibody that specifically binds to an antigenic polypeptide of the present invention

The present invention provides an antibody which specifically binds to a sequence comprising at least the consensus sequence of the C-terminus of the antigenic polypeptide of the present invention: X ₁ -PHX ₂ -YX ₃ -X ₄ , wherein X ₁ , X ₂ , X ₃ and X ₄ may be any amino acid. Preferably, X ₁ may be Q, N, S, T, V, W, A or L, X ₂ may preferably be H, S, G or N, and X ₃ may preferably be S, P, M, F, A or K, and X ₄ may preferably be L, H, K, F, M, S or R. The consensus motif further has the amino acid sequence Thr-Pro-His-Gly-Tyr-Ala-His (SEQ ID NO: 5). The present inventors have found that the antigenic polypeptide contains a consensus motif: X ₁ -PHX ₂ -YX ₃ -X ₄ , which is a highly immunogenic epitope of the antibody. According to a preferred embodiment of the invention, the antibody of the invention specifically binds to the antigenic polypeptide of the invention. More preferably, the antibody of the invention specifically binds to SEQ ID NO: 2 or SEQ ID NO: 3 of the invention.

The consensus sequence that specifically binds to the antigenic polypeptide of the invention can be readily produced in the form of a single antibody or multiple antisera, or in the form of a genetically engineered immunoglobulin designed to have the desired properties, using methods well known in the art. Antibody. The obtained antiserum can be purified by a known purification method (e.g., salting out, ion exchange chromatography, affinity chromatography, and the like) as appropriate to prepare a plurality of antibodies of the present invention. The antibody of the present invention can be obtained in the following manner. The antibody-producing cells (for example, splenocytes, lymphocytes, or the like) are collected from the immunized animal, and fused with myeloma cells or the like, using a conventional method (which uses polyethylene glycol, Sendai virus) ), electric pulse or the like) to make it a fusion tumor cell. Thereafter, a pure line which produces an antibody which binds to the consensus sequence of the antigenic polypeptide of the present invention is selected and cultured, and the desired monoclonal antibody is purified from the obtained cell culture supernatant. Purification may be carried out by combining known purification methods such as salting out, ion exchange chromatography, affinity chromatography and the like as appropriate. The novel antibodies can also be prepared using genetic engineering techniques. That is, the spleen cells or lymphocytes of the animal immunized with the consensus sequence of the antigen polypeptide of the present invention, or the lymphoma cells from which the monoclonal antibody having the specificity of the antigenic polypeptide of the present invention is produced, are purified and used. mRNA preparation cDNA library. Thereafter, a pure line which can produce an antibody which reacts with the antigenic polypeptide of the present invention is screened from the cDNA library, and the pure line is cultured to obtain a cell culture supernatant, and the desired method is used to purify the cell culture supernatant. antibody. For example, by way of illustration and not limitation, antibodies may comprise recombinant IgGs useful for detecting OVTA1 of the invention, chimeric fusion proteins having sequences derived from immunoglobulins, or humanized antibodies.

a kit comprising an antibody that binds to a sequence comprising at least the consensus sequence of an antigenic polypeptide of the invention

The invention also provides kits for diagnosing ovarian cancer comprising an isolated antigenic polypeptide of the invention or an antibody that binds to a sequence comprising at least a consensus sequence of an antigenic polypeptide of the invention. Thus, the kit comprises an isolated antigenic polypeptide of the invention, or an antibody comprising a sequence that specifically binds to and/or forms a complex comprising at least the consensus sequence of an antigenic polypeptide of the invention. More preferably, the antigenic polypeptide of the present invention has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 of the present invention, and the antibody of the present invention more preferably binds specifically to SEQ ID NO: 2 or SEQ ID of the present invention. NO: 3. The binding of antibodies (eg, single, multiple, human, human, etc.) is used to diagnose ovarian cancer in an individual. The kits of the present invention are suitably packaged and, where appropriate, provide additional components (e.g., buffers and instructions for determining binding to sequences comprising at least a sequence consistent with an antigenic polypeptide of the invention, such as capture agents, developers, labels , reaction surface, detection method, control sample, and instructions. Operational instructions can be used for the measurement of any antigen binding (including, but not limited to, the analytical methods described herein). In certain embodiments, the above reagents are provided so that Performing multiple measurements, for example, performing measurements over a period of time in the same body or taking measurements in multiple individuals. Available (the kit also provides) any suitable method (eg, labeled anti-human antibodies, where the label can The binding of antibodies is detected for enzymes, fluorophores, chemiluminescent materials, radioisotopes or coenzymes.

Method for detecting or diagnosing ovarian cancer in a biological specimen

The invention provides a method of diagnosing an individual suffering from ovarian cancer comprising detecting the expression of an antigenic polypeptide of the invention in a biological sample taken from an individual under conditions and for a time sufficient to detect the manifestation.

The invention also provides a method for diagnosing an individual suffering from ovarian cancer, comprising: combining the biological sample taken from the individual with at least one specificity to at least the condition and time sufficient to detect binding of the antibody to the consensus sequence An antibody that is in the sequence of the C-terminus of the antigenic polypeptide of the present invention: X ₁ -PHX ₂ -YX ₃ -X ₄ (preferably Thr-Pro-His-Gly-Tyr-Ala-His) is contacted to determine biopsy The presence of an antigenic polypeptide of the invention in vivo and thereby detecting ovarian or ovarian cancer metastasis. The expression of the antigenic polypeptide represents ovarian cancer, and the overexpression of the antigenic polypeptide represents not only ovarian cancer, but ovarian cancer has metastasized.

According to the present invention, the antigenic polypeptide of the present invention can be detected in a biological sample taken from an individual or a biological source. Blood samples, tissue section specimens, tissue explants, organ cultures, biological fluids, or any other tissue or cell preparation from an individual or biological source can be obtained to provide a biological specimen. The individual or biological source may be a human or non-human animal, a primary cell culture, or a cell culture-adapted cell line, including, but not limited to, a genetically engineered cell line that may contain a nucleic acid sequence inserted into a chromosomal or episomal form, immortalized or immortalized. The cell strain, the somatic cell hybrid cell strain, the differentiated or differentiated cell strain, the transformed cell strain or the like. In certain preferred embodiments of the invention, the individual or biological source may be suspected of having or at risk of developing ovarian cancer, and in certain other preferred embodiments of the invention, the individual or biological source may be known to be unaffected or not There is a risk of suffering from this disease. According to the invention, the bioassay system is selected from the group consisting of ovarian tissue, ovarian cells, blood, serum, plasma, ascites and peritoneal fluid.

According to the present invention, overexpression of the antigenic polypeptide or OVTA1 protein of the present invention can significantly increase proliferation and migration of ovarian cancer cells. Thus, detecting the amount of antigenic polypeptide of the invention can be used to diagnose ovarian cancer and its metastasis.

Inactivating OVTA1 gene to treat ovarian cancer

After further gene knockdown experiments, the present inventors found that inactivation of the OVTA1 gene significantly reduced cell growth and cell migration as well as tumor growth rate. Inactivation of the antigenic polypeptide or OVTA1 gene of the invention is useful for preventing and/or treating ovarian cancer and inhibiting ovarian cancer metastasis. Therefore, the present invention provides a method for preventing and/or treating ovarian cancer comprising the step of inhibiting the expression of the antigenic polypeptide or OVTA1 of the present invention.

Example Example 1: Preparation of an antigenic polypeptide of the present invention and cell culture confirming that the polypeptide is an immunogenic target

OVCAR-3, SKOV-3, and TOV-112D ovarian cancer cell lines and HeLa lines were purchased from the American Type Culture Collection (Rockville, MD). DMEM and Ham's F-12 medium containing 10% fetal bovine serum (FBS), penicillin (100 units/ml)/streptomycin (100 μg/ml), 0.1 mM non-essential amino acid and 1 mM sodium pyruvate (Invitrogen) (1:1) (Invitrogen, Carlsbad, CA) cultured OVCAR-3 and SKOV-3 cells. TOV-112D cells were cultured with MCDB105 and Media 199 (1:1) (Sigma, St. Louis, MO) supplemented with 15% FBS, penicillin and streptomycin. HeLa cells were cultured in DMEM containing 10% FBS.

Ascites, serum and tissue samples

Under the permission of the Human Health Research Committee of the National Institutes of Health, 12 ascites samples and 36 tissue sections were collected. The histological subtypes of ascites samples were 10 serous, 1 bright cell and 1 mucinous subtype, while the tissue samples contained 16 serous, 9 endometrium, 6 bright cells, 4 A mucinous and a type of endometrial/bright cell mixed subtype. The sera of the control group were collected from 10 healthy women of the same age. The subject's ascites and serum immunoglobulin G (IgG) were purified by immobilized A/G (Pierce, Rockford, IL) and following the manufacturer's instructions.

Phage library screening

The Ph.D.-7 phage display peptide system (New England BioLabs, Beverly, MA) was used to perform serological selection of phage pure lines presenting peptides recognized by malignant ascites antibodies in ovarian cancer patients. Make some improvements according to the manufacturer's instructions and perform a bio-panning program. Briefly, after removing the non-specific conjugates with a healthy control IgG mixture, phage (10 ¹¹ pfu) and IgG antibodies purified from 96 ovarian cancer patients (100 μg/ml) pre-coated on 96-well plates were used. ) reacted at room temperature for 2 hours. The unbound phage was removed by washing 10 times with TBST solution (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% Tween-20). The bound phage was lysed in a dissolving buffer (0.2 M Glycine-HCl (pH 2.2), 1 mg/ml BSA) and vigorously shaken at 37 ° C for 4 to 5 hours to infect E. coli host cells (pure line ER 2738) and Phage proliferation. Centrifuge and discard the cells. A 1/6 volume of PEG/NaCl solution (20% (w/v) polyethylene glycol-8000, 2.5 M NaCl) was added to the supernatant and centrifuged at 16,000 x g for 15 minutes at 4 ° C to collect the amplified phage. The resulting phage was resuspended in TBS (50 mM Tris-HCl (pH 7.5), 150 mM NaCl), and the titer of the phage was determined using the LB/IPTG/Xgal disk according to the method provided in the specification. The above bioaffinity screening procedure was repeated three or more times to increase the antibody-bound phage pure line.

The peptide sequence presented by the bound phage is determined by direct DNA sequencing. Phage were randomly selected from 15 blue plaques, propagated in E. coli host cells, and collected according to the above precipitation and centrifugation steps. The obtained pellet was resuspended in 100 μl of iodine buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI), and 250 μl of ethanol was added. After 10 minutes of incubation, single-stranded phage DNA was preferentially precipitated, and then dissolved in 30 μl of TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA). The DNA insert of the presented peptide was directly sequenced using an automated DNA sequencer, ABI 8700.

Enzyme linked immunosorbent assay (ELISA)

Sequence analysis revealed that 87% (13/15) of the selected phage pure lines exhibited a consensus motif X ₁ -PHX ₂ -YX ₃ -X ₄ . The purified antibody was applied to the well for ELISA analysis to determine the binding of the phage containing peptide #10 to individual antibodies purified from 12 ovarian cancer patients. After washing, the bound phage was detected with horseradish peroxidase (HRP)-conjugated anti-M13 antibody (1:2000) and reacted with ABTS peroxidase receptor (KPL, Caithersburg MD) to visualize the results. The control wells were either 10 μg/ml BSA or 100 μg/ml purified IgG mixture or serum from healthy subjects. M13 phage which did not exhibit any peptide was used as a negative control group.

Gene construction and production of antiserum

The FJ10213 plastid was used as a template for encoding the KIAA0999 protein in this experiment. The gene insert was cleaved with Sal I and Not I enzymes, blunted and subcloned into the EcoR V position of the pcDNA3.1 plastid, designated pcDNA-FJ10213. Based on the FJ10213 gene sequence provided by NCBI GenBank (No.: AB023216), the myc-labeled plastid (called myc-CT) was constructed by culturing the FJ10213 pure nucleotides 2278 to 3336 into the pBlueScript plastid EcoRI nick. -OV1). The DNA insert encodes a portion of the OVTA1 C-terminal protein with 353 amino acids, including the phage-derived consensus motif TPHGYAH. The plastid myc-CT-OV1 del-7mer lacking the consensus sequence was induced by site-directed mutagenesis using a pair of the following primers.

Pre-priming: 5'-GCT TCC TCA CCC ACC CCG CAG CCG GCA CTG ATG CAT-3' (SEQ ID NO: 6);

Inverse primer: 5'-ATG CAT CAG TGC CGG CTG CGG GGT GGG TGA GGA AGC-3' (SEQ ID NO: 7).

To generate an antiserum that specifically binds to OVTA1, nucleotides 2863 to 3336 (SEQ ID NO: 4) are cloned into the 5'-Xba I and 3'-Xho I sites of the pGEX-KG plastid, and It is expressed in E. coli (JM109 pure line). The GST-tagged recombinant protein was then purified according to the method described in the previous experiment (Clinical Cancer Research, 2006 Oct 1; 12(19): 5746-5754), and the recombinant protein was used as an immunizing antigen for rabbit or mouse. The resulting antiserum was purified using a Melon Gum IgG Purification System (Pierce Biotechnology, Inc., IL, U.S.A.) according to the manufacturer's instructions. For intracellular functional studies, the full-length OVTA1 gene having nucleotides 438 to 4229 (SEQ ID NO: 1) was constructed into a vector (pcDNA3-myc) and expressed as a Myc-OVTA1 recombinant protein. In addition, plastids expressing small fragment interfering RNA to reduce OVTA1 expression (called pshOVTA1 (pure line number: RHS3979-9604860)) and its scramble control pLKO.1 were purchased from Open Biosystems (Huntsville, AL, USA). . The OVTA1 gene showed a steady increase in OVCAR-3 gene expression, and transfection of SKOV-3 cells with pshOVTA1 attenuated its performance.

Try to select more immunogenic tumor-associated antigens that can be purified from autologous antibodies in the ascites of ovarian cancer patients. Screening was performed using a 7-mer random peptide phage display library. The graph of Figure 1 illustrates the bioaffinity screening assay of this screen. The library was pre-adsorbed from total immunoglobulin G (IgG) from 30 healthy donors to mask the IgG-identified peptide epitope. Next, phage displaying potential tumor-associated peptides were selected using ascites IgG purified from 32 ovarian cancer patients. After 4 cycles of bioaffinity screening enhanced, 13 of the 15 phage pure lines exhibited the consensus xPHxYxx sequence shown in Table 1 below.

The nucleotide sequence of the peptide presented by direct sequencing insertion is shown to show the peptide presented by the antibody binding phage. The peptide sequences presented by the 15 randomly selected antibody-binding phages after the fourth bioaffinity screen are shown in Table 1. Interestingly, the peptide sequences presented thereby provide the consensus motif X ₁ PHX ₂ YX ₃ X ₄ . The putative protein containing the peptide sequence presented above (found in the NCBI protein library) is shown in the right column of Table 1. Among them, a novel human gene containing peptide #10 was temporarily named as OVTA1 gene, which was identified as part of the KIAA0999 sequence. The putative polypeptide encoded by KIAA0999 contains the Pro-His-Gly-Tyr-Ala-His sequence. Therefore, this result indicates that the peptide sequence presented by the above phage may be associated with a tumor antigen. Furthermore, the data of Figure 2 shows that the phage-derived line exhibiting the TPHGYAH peptide strongly binds to the ascites antibody purified from ovarian cancer patient 11 (CA502).

The antigenic polypeptide of the invention is confirmed to be immunogenic by serology

To confirm that the antigenic polypeptide of the present invention is the immunogenic target of the patient 11 (CA502) ascites antibody, the putative 3'- of the OVTA1 gene encoding the 40 kDa Myc-tag polypeptide containing the Pro-His-Gly-Tyr-Ala-His sequence will be used. The coding region was selected from SK-OV3 cells. Western blot analysis results (see Example 2) of HeLa cells (which overexpressed the putative C-terminal OVTA1 gene with the myc sequence and the purified patient 11 antibody or anti-Myc antibody probe) showed that the C-terminus of the present invention was included. Peptide #10 was indeed the immunogenic target for patient 11 ascites autoantibodies (Fig. 3A). To further confirm whether the Pro-His-Gly-Tyr-Ala-His sequence is the major immunogenic epitope of the antibody, a deletion mutation lacking the specific sequence exhibited by the selected phage is produced. Interestingly, if the sequence is removed, the patient's autoantibody is completely destroyed to recognize the antigenic polypeptide of the present invention (Fig. 3B), and the results show that the specific sequence contained in the antigenic polypeptide of the present invention is used for tumor immunological monitoring. Immunogenic epitope.

Example 2: Characterizing the antigenic polypeptide of the present invention Western blot analysis

The lysate was prepared by the method described in the previous study (BMC Molecular Biology 2007, 8: 72 pp. 1-15). Transfection of HeLa cells with lipofectamine (Invitrogen Co., CA, USA) using a lipofectamine (Invitrogen Co., CA, USA) encoding a wild-type, mutant KIAA0999 gene plastid or control vector or using lipofectamine 2000 transfection reagent The plastid or control vector encoding the wild type, mutant KIAA0999 gene was transfected into OVCAR-3 and SKOV-3 cells. 24 hours after transfection, lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% SDS, 5 mM MgCl ₂ , 10% glycerol, 0.5% NP-40, 100 mM NaF, 1 M Na ₃ VO ₄ and protease inhibitor) The mixture (Roche Diagnostics, Indianapolis, IN, USA) was lysed. Protein concentration was quantified using BCA protein assay (Pierce). Each sample of about 15 or 150 μg was separated by 7.5 to 10% SDS-PAGE and transferred to a nitrocellulose membrane, followed by specific binding to myc-tag (dilution factor 1:10,000), GST-tag (dilution factor) 1:1,000) (Pierce), OVTA1 (dilution factor 1:1,000) antibody or CA502 purified ascites antibody (32 μg/ml). Immune complexes were detected by anti-mouse, rabbit- or human IgG (Jackson ImmunoResearch, Cambridgeshire, UK) detection combined with HRP and visualized using SuperSignal chemiluminescence detection system (Pierce, Rockford, IL) result.

Characterization of OVTA1 transcripts and proteins in ovarian cancer cells

Northern and western point analyses were performed to confirm the true size of the OVTA1 natural transcript and its encoded polypeptide in ovarian cells. Northern blot analysis using an antisense probe containing a sequence encoding a 7-mer peptide revealed that the approximately 4.5 kb band of SK-OV3 and TOV-112D cells is the major corresponding transcript of the OVTA1 gene, whereas OVCAR3 The transcript expression of the cells was significantly lower (Fig. 4). At the same time, the recombinant CT-OVTA1 gene fused with the GST marker sequence was constructed, and the recombinant antigen was expressed and purified to produce rabbit antiserum which specifically binds OVTA1. HeLa cells expressing the myc-tagged CT-OVTA1 gene or the control vector were analyzed by Western blotting to confirm the specificity of the antiserum (data not shown). As previously consistent, the primary immunoreactive protein of SK-OV3 and TOV-112D cells has a molecular weight of about 150 kDa, but OVCAR3 cells are barely detectable (Fig. 5). The results of experiments using the in vitro transcript and the translational coupling system revealed that the coding gene (ie, the OVTA1 gene of the present invention) on the putative KIAA0999 sequence (number: AB023216) disclosed in the NCBI database can be transcribed into a 150 kDa polypeptide chain (Fig. 5). And immunoreactive with OVTA1 antiserum (data not shown). Taken together, the above results clearly indicate that the OVTA1 gene is a functional dual gene and encodes a 150 kDa protein of an ovarian cancer cell.

Organizational distribution of OVTA1 performance

Polymerase chain reaction (PCR) of cDNA libraries from 12 normal human tissues was performed using two pairs of gene-specific primers located in the 3'-coding region and the non-translated region of the OVTA1 gene to confirm the genes of OVTA1 in various tissues. which performed. The nested PCR analysis of Figure 6 shows that OVTA1 is ubiquitous in a variety of tissues, but its performance is significantly different in each tissue. Its performance in lung, heart and testis is higher, while the expression in brain and ovary is significantly lower.

Example 3: Overexpression of OVTA1 increases cell proliferation rate and cell migration Excessive expression of OVTA1 in OVCAR3 cells

Establishment of OVCAR3 stable pure line: using RT-PCR (Justice: 5'-CGG GAA TTC TCT CAG CAA CAT GCC AGG C-3' (SEQ ID NO: 23); Antisense: 5'-AAT GAA TTC TCA GTT GAT TAG GGC AGA-3' (SEQ ID NO: 24)) constructs the OVTA1 gene from SK-OV3 ovarian cancer cells. Construction of pcDNA-OVTA1 plastids using the following specific primers: 5'-CGC CAG TGT GCT GGA ATT CTG CTG TCC GGC GCG AGC-3' (SEQ ID NO: 25); Antisense: 5'-GCA TGC TCG AGC GGC CGC TTA CAC GCC TGC CTG CTC CAT-3' (SEQ ID NO: 26). OVCAR3 cells were transfected with 1 μg of pcDNA-OVTA1 plastid to establish a stable line of OVTA1 or transfected with pcDNA3.1 as a vehicle control group. After 4 weeks, a stable pure line was selected from the medium containing 400 μg/ml of G418. The amount of expression was confirmed by RT-PCR and Western blot analysis.

OVTA1 expression leads to cell proliferation and migration of ovarian cancer cells

SK-OV3 cells are known to have a higher rate of in vitro proliferation compared to OVCAR3 cells. SK-OV3 cells were transfected with pLKO.1-shOVTA1 or transfected with pLKO.1 vector as a mock control to investigate whether OVTA1 is involved in ovarian tumorigenesis. At the same time, OVCAR3 cells were transfected with pcDNA or pcDNA-OVTA1 vector. RT-PCR and Western blot results showed that the OVTA1 mRNA and protein expression of pcDNA-OVTA1 transfected OVCAR3 cells increased (Fig. 7).

Migration analysis

Cell migration experiments were performed using in vitro cell penetration assays. 5× ^{10 4} cells were resuspended in serum-free medium and seeded in a cell culture dish (Costar, Cambridge, MA, USA) containing a 8 μm pore size membrane. After the cell culture dish was placed in a well prefilled with M199 medium containing 10% FBS, the cells were cultured at 37 ° C for 6 hours. The number of cells that migrated from the upper chamber of the cell culture tray to the lower side due to chemotaxis was counted according to the manufacturer's instructions (Costar).

Excessive expression of OVTA1 in OVCAR3 cells resulted in a significant increase in cell proliferation rate (Fig. 8A) and cell migration (cancer metastasis) (Fig. 8B) from the control group by 2.75 to 3.1 fold.

Example 4: Reduce OVTA1 performance Reduction of OVTA1 expression in SK-OV3 cells by small interfering RNA

A pLKO.1-shOVTA1 vector containing 5'-CCGGGCCAGGCTTTATCTTATCAAACTCGAGTTTGATAAGATAAAGCCTGGCTTTTTG (SEQ ID NO: 27) and a pLKO.1 control vector (Open Biosystems) were prepared. SK-OV3 cells were transfected with 1 μg of pLKO.1-shOVTA1 or SK-OV3 cells were transfected with 1 μg of pLKO.1 as a control group. Stable pure lines were selected at 2.5 μg/ml puromycin for 4 weeks, and interference efficiency was analyzed by RT-PCR and Western blotting. RT-PCR and Western blot analysis showed that OVTA1 mRNA and protein expression was inhibited in SK-OV3 cells transfected with pLKO.1-shOVTA1 in the reduced performance assay (Fig. 9). As a result, inhibition of OVTA1 expression of SK-OV3 cells significantly inhibited the rate of cell proliferation (Fig. 10A) and cell migration (Fig. 10B). Taken together, the above results show that the high performance of OVTA1 may promote the proliferation and migration of human ovarian cancer cells.

Example 5: Relationship between OVTA1 performance and tumor development Xenograft mouse model of ovarian cancer

SCID mice of 5 to 6 weeks old were purchased from Tzu Chi University, Hualien, Taiwan. Animals are raised under specific pathogen-free conditions and provided with sterile food and water. The mice were acclimated for at least 6 days. The mice were injected subcutaneously with SK-OV3 and transfectants containing pLKO.1-shOVTA1 or the control vector (each mouse was injected under sterile conditions with 1×10 ⁶ cells dissolved in 0.1 ml of phosphate buffered saline solution) . Tumors were observed weekly and the tumor length was measured with a caliper to record tumor size. The tumor volume is calculated from the measured length and width of the tumor as follows: tumor volume = length x width ² x π / 6 (reference).

OVTA1 performance is associated with tumor development

SCID mice were injected subcutaneously with SK-OV3 cells transfected with pLKO.1-shOVTA1 or a control vector to further investigate the role of OVTA1 in vivo. Tumor growth in each mouse was monitored weekly. Tumor size was measured for a total of 8 weeks after cell inoculation. All mice that were injected subcutaneously with SK-OV3 cells developed tumors, whereas mice that were inoculated with SK-OV3/shOVTA1 cells did not (Fig. 11A). Decreasing OVTA1 performance reduced the tumor growth rate of NOD-SCID mice (Fig. 11B). The above results show that OVTA1 plays a key role in tumor development.

Example 6: Use of the antigenic polypeptide of the present invention as a target for diagnosing ovarian cancer Immunohistochemistry

The formalin-fixed, paraffin-embedded tissue samples were obtained from a cooperative hospital and stained with anti-GST control antibody or antibody specific for CA125 (Dako, Carpinteria, CA) or OVTA1 using conventional methods. The sections were sequentially dewaxed, rehydrated and washed with PBS. After 20 minutes of heat-mediated antigen retrieval in 10 mM sodium citrate (pH 6.0), sections 3 were washed with wash buffer (10 mM Tris-HCl (pH 7.4) and 150 mM sodium chloride). This was followed by treatment with 3% hydrogen peroxide for 5 minutes to block endogenous peroxidase. After washing with PBS, the sample was diluted with the primary antibody (diluted 1:20 of CA125, diluted dilution of OVTA1 rabbit antiserum 1:4000 or diluted dilution of self-made rabbit anti-GST antiserum 1:2000) at room temperature. The reaction was carried out for 1 hour or at 4 ° C overnight. Primary antibodies were detected using the LSAB kit (Dako) and sections were counterstained with hematoxylin. The performance status of OVTA1 and CA125 was evaluated and graded independently under blind conditions by two pathologists at a final magnification of 200x. The conflict score was analyzed by microscope.

Overexpression of OVTA1 in ovarian cancer tissues

Forty tissue sections taken from non-cancer ovaries and 39 sections taken from ovarian cancer tissues were prepared, and the expression of OVTA1 and CA-125 was studied using anti-OVTA1 or a conventional anti-CA-125 antibody. Immunohistochemistry results clearly show that OVTA1 is overexpressed in ovarian cancer tissues compared to normal ovarian tissue or adenomyosis. Conversely, CA-125 antigen was detected in ovarian cancer tissue and adenomyosis tissue. Figure 12 shows representative results. The statistical results are summarized in Table 2 below. The results in Table 2 show that the OVTA1 antigen was detected only in ovarian cancer tissues but not in cancer tissues. Taken together, the OVTA1 antigen is a better diagnostic marker than CA-125, which is routinely used to detect ovarian cancer.

Figure 1 shows serological identification of tumor-associated peptides of ovarian cancer. Serological identification of ovarian tumor-associated peptides was performed using modified phage display technology. A M13 phage library in which each phage exhibits a different 7-mer random peptide is applied. The library was pre-adsorbed and purified from immunoglobulin IgGs from 30 healthy donors (including 15 males and 15 females) to mask and remove the immunogenic epitopes recognized by the normal antibodies. Next, unbound phage were screened for antibody affinity purified from 32 ovarian cancer patients. A screen showing the bioaffinity of phage displaying tumor-associated peptides is shown in Figure 1. Purified ascites or serum antibodies were applied to each well of the ELISA plate to screen potential tumor-associated peptides from the pool.

Figure 2 shows that phage containing peptide #10 in an ELISA assay binds to antibodies purified from 11 ovarian cancer patients (1-12: Ig purified from 12 patients as a coated antigen for detecting phage #10; 11c: Ig purified from patient 11 as a coated antigen for detecting M13 phage as a control group; nIg: Ig purified from 30 normal individuals as a coated antigen for detecting phage #10; and nS: using normal serum as a Detector The coated antigen of phage #10 was measured. Purified antibodies were applied to each well for ELISA assays. The bound phage was detected by an antibody that specifically binds to the M13 phage, and the result was visualized by reaction with ABTS (HRP receptor in the test). Purified or unpurified serum antibodies or bovine serum albumin were applied to separate wells as a background control. In addition, M13 phage which did not exhibit any peptide was used as a negative control group. The results showed that the phage having peptide #10 specifically binds to the antibody (CA502) purified from patient 11.

Figure 3 shows the confirmation that OVTA1 is the antigenic target of the CA502 antibody. In order to confirm that OVTA1 is the antigenic target of CA502 antibody, the C-terminus (CT) of the putative gene was selected from the human fetal brain cDNA library, and it was expressed as a myc-labeled protein in HeLa cells, and detected by CA502 antibody. The Western blot analysis results of Figure 3A clearly indicate the positive immunoreactivity of the CA502 antibody with the C-terminus containing the peptide #10 sequence TPHGYAH. The peptide was further investigated for the immunogenic epitope of the CA502 antibody by site-directed deletion mutation. Deletion of this peptide from the C-terminus resulted in loss of immunoreactivity with the CA502 antibody (Fig. 3B), and this result shows that the random-peptide phage display system is an effective tool for screening immunogenic epitopes of antigens.

Figure 4 shows the size of the OVTA1 gene transcript for the determination of ovarian cancer cells. Ovarian cancer cells were analyzed by northern blots to determine the ORF size of the OVTA1 gene. Total RNAs extracted from SK-OV-3, OVCAR3 and TOV-112D cells were resolved with a formaldehyde-containing denaturing gel. The antisense sequence of the ORFTA1 gene transcript was specifically bound to [α-32 P]dATP radiolabeled and allowed to hybridize to the RNA extracted by the cells. In Figure 4, a total of four radiolabeled bands were detected, and the 4.5 kb transcript was the major of all tested ovarian cancer cell lines.

Figure 5 shows that the putative KIAA0999 gene revealed in the NCBI database can be transcribed into a 150 kDa polypeptide chain. Western blot analysis using rabbit antiserum prepared at the C-terminus of OVTA1 showed that ovarian cancer cells continued to exhibit four protein bands (Fig. 5). A major protein of about 150 kDa was found in all cells, and the results showed that the coding sequence of the OVTA1 gene was about 4.0 Kb.

Figure 6 shows that OVTA1 is ubiquitous in a variety of tissues.

Figure 7 shows the overexpression of OVTA1 in OVCAR-3 cells.

Figure 8 shows that OVTA1 overexpression significantly increased OVCAR3 cell proliferation and cell migration. Figures 8A and 8B show that OVCA1 overexpression in OVCAR3 resulted in a significant increase in cell proliferation rate and cell migration (metastasis) by about 2.75 to 3.1 fold, respectively, compared to the control group (Fig. 8B).

Figure 9 shows a reduction in OVTA1 expression in SKOV-3 cells.

Figure 10 shows that reduced expression of OVTA1 significantly reduced SKOV-3 cell growth and cell migration. Figures 10A and 10B show that inhibition of SKOV-3 OVTA1 performance significantly inhibited cell proliferation rate and cell migration (metastasis), respectively.

Figure 11 shows that OVTA1 expression is associated with tumor development. Figure 11A shows that all mice that were subcutaneously injected with SK-OV3 cells grew tumors, whereas mice that were inoculated with SK-OV3/shOVTA1 cells did not. Figure 11B shows that decreasing OVTA1 performance reduces tumor growth rate in NOD-SCID mice.

Figure 12 shows the results of immunohistochemistry, which clearly reveals that OVTA1 is overexpressed in ovarian cancer tissue (e) compared to normal ovarian tissue (a) or adenomyosis tissue (c). Conversely, CA-125 antigen was detected in ovarian cancer tissue (f) and adenomyosis tissue (d). (b) shows normal ovarian tissue as a control tissue for detecting CA-125 antigen.

(no component symbol description)

Claims (15)

An isolated antigenic polypeptide which is expressed in an individual of an ovarian cancer, which consists of an amino acid fragment encoded by the polynucleotide of SEQ ID NO: 4 or an amino acid fragment of SEQ ID NO: 3. The isolated antigen polypeptide of claim 1, which is encoded by a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:4. The isolated antigen polypeptide of claim 1, which consists of the amino acid sequence set forth in SEQ ID NO: 3. A polynucleotide encoding the isolated antigenic polypeptide of claim 1. The polynucleotide of claim 4, which consists of the nucleotide sequence set forth in SEQ ID NO:4. The polynucleotide of claim 4, wherein the nucleotide sequence encoding the amino acid fragment is as set forth in SEQ ID NO: 3. An antibody that specifically binds to an antigenic polypeptide as claimed in claim 1. The antibody of claim 7, wherein the C-terminus of the antigenic polypeptide has the amino acid sequence Thr-Pro-His-Gly-Tyr-Ala-His. The antibody of claim 7, which specifically binds to SEQ ID NO: 3. An antibody according to claim 7, which is a plurality of antibodies. An antibody according to claim 7, which is a monoclonal antibody. A kit for detecting ovarian cancer in an individual comprising the antigenic polypeptide of claim 1 or the antibody of claim 7. A method of diagnosing an individual suffering from ovarian cancer, comprising: detecting the performance of the following antigenic polypeptides in a biological sample taken from an individual under conditions and for a time sufficient to detect the manifestation: (a) a polypeptide comprising an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 2; (b) a polynucleotide which hybridizes to SEQ ID NO: 1 under high stringency conditions or SEQ ID NO a polypeptide encoded by a full length complementary sequence of 1; (c) a polypeptide encoded by a polynucleotide comprising a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 1; and (d) a SEQ ID comprising NO: an amino acid fragment encoded by the polynucleotide of 4 or a polypeptide comprising the amino acid fragment of SEQ ID NO: 3; the restriction is that the polypeptide sequence is contained in (a), (b) or (c) The expression of the antigenic polypeptide represents ovarian cancer, and the increased expression of the antigenic polypeptide represents an increase in the ovarian cancer and ovarian cancer has metastasized as compared to an individual suffering from ovarian cancer. A method for diagnosing an individual suffering from ovarian cancer, comprising: contacting a biological sample taken from an individual with an antibody according to claim 7 under conditions and for a time sufficient to detect binding of the antibody to the consensus sequence to determine the biological test Whether or not the antigenic polypeptide of claim 1 is present in the body, wherein the combination represents ovarian cancer. The method of claim 13 or 14, wherein the bioassay system is selected from the group consisting of ovarian tissue, ovarian cells, blood, serum, plasma, ascites, and peritoneal fluid.