TWI360576B - Pharmaceutically composition comprising resveratro - Google Patents

Description

1360576 100年丨1:月02日附修正9, invention description: [Technical field of invention] The present invention relates to a medicine for treating atypical teratoid/rhinotypic cell tumor caused by cancer stem cells using scutella alcohol combination. [Prior Art] Progenitor cells, also known as stem cells, refer to cells that are not originally specialized and retain the ability to be specialized into other cell types. Related research was first proposed by the Canadian scientists Ennis Moklock and James Til in the I960s. According to the differentiation potential, stem cells can be basically divided into three types: the first type is pluripotent stem cells, which have the differentiation potential to form intact individuals. It has similar differentiation ability to early embryonic cells, and can proliferate indefinitely and differentiate into whole body. A variety of cellular tissues 'and further form all tissues, organs and thus constitute individuals. The first type is pluripotent stem cells. This stem cell also has the potential to differentiate into a variety of cellular tissues. Unlike the previous type, this type of cell lacks the ability to develop into a complete individual, and its developmental potential is limited. The third type is unipotent stem cells, which can only differentiate into one function or two functions closely related to cells. Traditionally, it has been determined that nerve stem cells can only differentiate into functionally similar neurons and star glia. And oligodendrocytes. However, studies through lateral differentiation have found that neural stem cells still have the ability to differentiate into hematopoietic cells. Furthermore, depending on the source of stem cells, it can be divided into embryonic stem cells derived from embryonic inner cell mass or primordial germ cells and undifferentiated adult stem cells derived from tissues. The above items include teratoma cells, celestial cells, blastocyst inner cell mass, embryoid body cells, and reproductive primitive cells. The latter can be from the nerves, blood, interstitial, epidermis or fat. Stem cells are capable of self-repairing and differentiation into specialized cells. Recent studies have pointed out that cells in some tumor tissues also have stem cell-like properties. In 1937, Jacob and other scholars first transplanted a single undifferentiated leukemia cell into a mouse, and as a result, the transplanted mouse also suffered from leukemia. In 1963, Robert and others demonstrated in vivo that only a small fraction of the primary cultured tumor tissue had the ability to proliferate (Robert et al., Nature, 1963, vol. 199, 79-80). Following the addition of the revisions by Robert 2 1360576 in the year of January 02, the related scholars in the 1960s and 1970s were able to confirm the presence of cancer stem cells by performing in vitro colony formation assays and in vivo transgenic assays for liquid or solid tumors (Bergsagd). D al over al,

Cancer Res, 1968, vol. 28, 2187-96. Park C. H. et al., J Natl Cancer Ins, 1971, vol. 46, 411-22. Heppner CiH. et al" Cancer Res, 1984, vol. 44, 2259-65). Many years of academic research have argued that 'most cells do not have the ability to cause tumorigenesis, only a small number of cells are Tumorigenic, and Differentiated into various cells in tumor tissues, and thus named as tumor stem cells. Cancer stem cells have been verified in tumor tissues such as leukemia, brain cancer, nasopharyngeal cancer, lung cancer and the like.

Tumor stem cells are obtained from adult tissues. It is currently believed that cancer stem cells and adult stem cells are in the molecular standard tfe and fineness. Molecular markers are mainly to confirm the surface antigen of cells or specific _factors. The ts are often described as follows: Surface antigens commonly used in embryonic stem cells have stage-specific embryonic antigens 3 for glycosylated lipids (stage Speciflc Emhyonic) Antigen 3; SSEA3) and stage-specific embryonic antigen 4 (stage Spedfic Embryonic Antigen 4; SSEA4) and tumor rejection antigen-l-60 (TumOT Resistant Antigen-1-60; ^-60) and tumor rejection for keratan sulfate Anti-il 8l (Tum〇r Resistant Antigen-1-81; Tm-1-81); transcription factors are Ips_〇ct4, Nan〇g, 8〇χ2

Klf-4, c-Myc, and Lin28, also known as stem cell genes. Hematopoietic stem cells were identified by which 4 and CD133 surface antigens and adenosine triphosphate-binding cassette superfamily G member 2 (ABCG2). The neural stem cells were confirmed by nestin, polysialic acid cell adhesion molecule (4) s·__η嶋i (4) adhesion molecule; PSA-NCAM) and neurotropin receptor N_tr_r; NTR). Mesenchymal stem cells are identified by the STR (M antibody) that recognizes CD34. The ability of stem cells to self-renew and differentiate themselves is then detected. The tumor stem cells are still capable of weaving the tumorigenic ability of such cells. For money-spreading stem cells, the identification of surface molecules labeled 'the study mentioned CD44, CD24, B38 1 and epithelial specific antigen (ESA) are the surface molecular markers of breast cancer tumor stem cells = (Muhammad AH et al , 2003, Proc. Natl. Acd. Sci. USA, voU〇〇, 3989-88 Some scholars have pointed out that CD133 can be used as a dry tumor or a tumor of the prostate. 7 1360576 100 years 11·. AO et al., Nature, 2007, vol. 445, 106-110. Gavin D. et al., J Cell Sci, 2003, vol. 117, 3539-45.) Wolf et al. proposed marginal cells (side p0pUlati〇 n ceus ; SP cells) Theory as a feature for screening cancer stem cells (Wolf NS et al., Exp Hematol, 1993, vol. 21, 614-22 〇Wolf NS et al., Blood, 2001, vol. 98, 1166- 73) 〇Max S. Wicha et al. at the American Cancer Research Association Annual Conference on Cancer Prevention in 2006 It is indicated that it can be used to detect normal and malignant human breast cancer stem cells. As for the stem cell gene detection part, Beriani, Nico and Ram et al. published relevant literatures indicating that the embryonic stem cells undergo self-repair or drive into pluripotent stem cells. In the process, OCT-4 plays an important role as a regulator (Bi〇ani MSHR, Nat Rev Mol Cell Biol, 2005, vol. 6, 872-884-Nichols J. et al. 5 Cell, 1998, vol. 95 , 379-391 ° Lamb KA and Rizzino A, Mol Reprod Dev, 1998, vol.51, 218-224) ° Okinawa, Buck and Tour et al. have experimentally confirmed that there are four factors that can make adult cells become like heavy Editing the ability of pluripotent stem cells, and Oct-4 is one of them. (〇kita K, et al., Nature, 2007, vol.448, 313-317 «Park IH, et al., Nature, vol. 451 , 141-146〇Yu J. et al., Science, 2006, vol. 318, 1917-1920). Other prior studies have also shown that mouse lung stem cells endogenously exhibit 〇ct-4 (Ling T.Y. et al., Proc atl Acad Sci USA, 2006, vol. 103, 9530-9535). In the early stage, Jin, Wang, Meng Ke, Ji Deke and others found that 〇ct_4 transcriptional action is carried out in human embryonic cancer cells, testicular cell reproductive tumors, spermatoma, bladder tumor stability (Jin T. et al., Int J Cancer). , 1999, vol. 81, 104-112. Wang P. et al., Biochem J, 2003, vol. 375, 199-205. Monk M. et al., 2001, vol. 20, 8085-8091.

Gidekel S. et al., Cancer Cell, 2003, vol. 4, 361-370). Further human breast cancer stem cells in the dyke also exhibit Oct-4 (Ponti D. et al., Cancer Res, 2005, vol. 65, 5506-5511). This result shows that the performance of 〇ct-4 is related to an update or tumor formation by activating the target gene downstream of the machine. The stem cell-associated genes discussed above can be found in the literature (Chamber I. et al) Cell, 2003, vol. 113, 643-55. Mitsui K. et al., Cell, 2003, vol. 113, 631 -42. (Scholer, HR et al., Trends Genet, 1991, vol. 7, 323-329 ° Maurizio P et al., Stem Cells, 2001, voU9, 271-8). These stem cells are important related genes, not only May be involved in the pathogenesis of malignant tumors and the formation of cancer stem cells, may also be the tumor stem cells specific 8 1360576 November 02, 100 supplementary gene expression gene (Gene signature), however, there is no paper clearly pointed out the detailed gene stalk Linking with the mechanism. π Stem cells are dereliction of duty, and the contact can be used as a nucleus: the basic research, human body repair or medicine (4) selection of materials should be selective medium culture, providing a large number of cells to replicate ^ Ingredients' can also be used to screen out cell populations that tend to a specific differentiation pathway. Take nerve stems and cells as an example. The nerves are squashed in a serum-free gorge, the inner Weisi, the egg, the shout, Fibroblast growth factor and fibronectin The number of nerve-drive cells with nestin expression is greatly increased; another example is the addition of human sonic sigma (SGniehedgeh〇g SHH), which causes the differentiated nerve cells to favor the characteristics of the ventral cells of the neural tube. A large increase in the number of cells expressing NKx6.1 and 01ig2. The 3 embryonic stem cells are cultured for 4 days in the form of embryoid bodies, and cultured in a known composition of H-fiber-binding protein, so that most of them can be made on _ About 85% of the neural ciliary populations will express the epithelial cells of the neuroepithelial cells, and the ants will enter the sputum, ί, and the knife can be removed. If the fibroblast growth factor 2 is removed, there will be a large number of cells. # == The way of treatment still has epidermal cells: Molecular::: = keratin CK18) 'At the same time, it also produces pluripotent performance of stage-specific embryos that are resistant to rectification. W is determined by a certain cell population The method of selectively promoting the differentiation of nerve cells is to make the embryonic stem cells very low in the mouth and supplement the leukemia inhibitory factor (Leukemia i secret (10) 爹 can get the structure of the nerve cell mass, contained,), k-like cells. There are 4b Scholar cut n % It will express the neural precursor of the nestin factor Si stem cells, because this cell is absolutely necessary for leukemia inhibition - single = way does not seem to be \=====; _ (4) This is followed by 9 1360576 supplemented on November 2, 100 The modified cytokine is closely related to the proliferation and differentiation of neural stem cells. Different cytokines play an important role in the differentiation of neural stem cells, but there is no cytokine that can induce neural stem cells to differentiate into desired functional nerve cells in vitro. . The cytokines involved in the differentiation of neural stem cells are interleukins such as interleukin i, interleukin 7, interleukin 9, and interleukin-11. Neurotrophic factors affect the entire process of neural stem cell differentiation into terminal cells. If the cultured neural stem cells are placed under the brain-derived neurotrophic factor, a large number of neural stem cells can exhibit the characteristics of differentiated neurons. Growth factor classes, such as epidermal growth factor, nerve growth factor, and basic fibroblast growth factor, also affect the differentiation of neural stem cells. Neural stem cells have different effects on different types, different concentrations of factors, and multiple factors. The same factors play different roles in different stages of neural stem cell development and differentiation. For example, in the presence of epidermal growth factor and basic fibroblast growth factor, embryonic neural stem cells mainly differentiate into neurons, astrocytes and oligodendrocytes, while postnatal and adult brain neural stem cells, whether or not There are epithelial growth factors and basic fibroblast growth factors, which are mainly differentiated into astrocytes. These studies suggest that epithelial growth factors and basic fibroblast growth factors are complex for the differentiation of neural stem cells into functional cells. The most commonly used compound, such as the use of chemicals, is retin〇ic acid (ra). The main reason is that RA plays an important role in embryonic development, especially in the process of neural differentiation. The following is a comparison of related technologies derived from the selective culture of cancer stem cells. The paper published in the Proceedings of the National Academy of Sciences in 2003 by Mr. McKay et al., Human Breast, Tumor Tissue Enzymes Remove Substance and Subcutaneous The injection method is given to a small combined immunodeficiency small bed, and human tumor stem cells can produce tumor tissue in mice. The method can effectively isolate human cancer stem cells having differentiation potential and self-renewal energy from mice. However, it cannot be carried out in large quantities, and only a mechanism can be explored (Muhammad A. H. et al, PNAS, 2003, v〇l. 1〇〇, 3983-3988). In the same year, Peter Drake et al. published a paper on cancer research using tumor cell culture media to screen cancer stem cells from primary cultures of brain tumor tissue. The medium is a serum-free medium containing 20 ng/ml of human recombinant epidermal growth factor, 2 〇NEK/ml of beta_ 10 1360576 100 years: November 02 曰 supplemental modified fibroblast growth factor, 10 ng/ ML of leukemia inhibitory factor, double neurosurvival factor and H g of 7 liters of acetylcysteine. The scholar provides a selective, efficient, in vitro culture of selective media. But the messy egg (four) #, mixed enough to find a large number of experiments (Sheila KS et al " Cancer Research, 2〇〇3, v〇l 63, 5821 5828). Dunsi. Human heterozygous f(four)敎 refers to in vitro experiments with 1U/ml of Lai eggs from the scale human uterus __, which contributes to the proliferation of endometrial cells (Atsushi Yanaihara et al., Matha H_r(4) 2_, vol.6, 469-473). Andrew Gray and others published in molecular metabolism in 2002. It is shown that lactoferrin can promote osteoblast differentiation and survival in vitro. The former uses fetal bovine serum containing = The latter uses a cell culture medium containing 5% calf serum. Both medium systems contain serum and cannot be used for screening stem cells (Andrew Grey et al., Molecular Endocrinology, 2〇〇45) Νο1.16? 2268.22y8) The method used by Li Ruochu et al. in a paper published in the Chinese Journal of Cancer in 2006 to isolate cancer stem cells is to provide patients with a _ mother _ woven towel divided into skin containing raw W, Gu « Serum-free medium with sub- and fat supplements The type of brain tumor stem cell spheres were successively subcultured, and a single clone formation test was performed to compare the percentage of swollen cells in the initial tumor tissue. After observation, the stem cell sphere was heavier than the serum-containing medium' to observe the tumor stem cells. Differentiation phenomenon (Li Ruochu special person 'Cancer, 2006, vol.2). Ouyang Zhen and others in the toilet casting table _ private study without paper mixed use of the paper to use the lining fine scales money, turn the ball ship culture equipment The test value is in serum-free DMEM/F12K medium of 2 to 7.4, while the medium contains 2 〇μg/ml of table = long factor, 20 micro-order _ mother _ raw fairy, 2 micro-mil / liter l _ glutamine 4 IU / liter of insulin, 1 (8) international monom liter of penicillin, (10) IU / ml of streptomycin. Subsequent _ beads sorted fine] positive cells, that is, swollen cells. τ 11 1360576 Supplementary amendments on November 2, 100

Akio et al. published in a paper published in the journal Biochemistry in 2008 that epidermal growth factor plays a pivotal role in cell proliferation in brain cancer stem cells. Serum-free DMEM/F12K medium' and the medium contains streptomycin, penicillin, B27 supplement, 20 μg/ml of epidermal growth factor, 2 μg/L of fibroblast growth factor, 1 IU/ ML of leukemia inhibitory factor. The authors believe that only epidermal growth factor can promote the formation of spheroid cells' and can increase the ability of cells to repair themselves (Aki〇s et al, j Bi〇Chem, 2008, vol. 3, 1-10).

Phedias et al. expect to identify neural stem cells as a therapeutic basis for neurological diseases or to find new findings in brain tumors. Separation and culture of mouse neural stem cells using NSC culture medium containing 20 μg/ml of epidermis Growth factors, 2 μg/L of fibroblast growth factor and 2 μg/ml heparin. The culture medium was changed every two to three days. (phe(jias etai..

Nature Chemical Biology, 2007, vol. 3, 268-273). In summary, the current widely used method for selective culture of cancer stem cells is not limited to the use of media with salts, vitamins, and silk acids, and additional cellular factors that promote cell proliferation. The subsequent separation method is nothing more than the traditional transfer disk separation, and then manually scraped down the cells to continue the culture, or using a flow cytometer with magnetic beads for separation. However, with the rapid development of various biotechnology such as genetic engineering, embryo engineering, cell engineering, and tissue engineering, stem cells are manually isolated and cultured in vitro according to a certain purpose. The main direction of stem cell application, in addition to the use of dried sputum, sputum and materials as a source of miscellaneous, the development of ώ convenient, well-defined, rapid, cytotoxic treatment and new lining cell culture methods and devices will be development and improvement the key of. However, in recent years, temperature sensitive materials such as temperature sensitive isopropyl propyl amide (NIPAAm) have been used in tissue engineering. Harjm〇t〇M et al. revealed a Weifang New Zealand-贼m thief temperate cell culture dish that achieves two-cell co-culture to cover bloodline endothelial cells on monolayer hepatocytes (Hari_. M et al, Bbmed) Mater (6), 2002, 62(3): 464-70). Hsiue G. H. et al. disclose the use of bioengineered cell sheets to rebuild corneal endothelial cells (Hsiue GH et al., Transplantation, 2, 6, 81(3): 473_6). And 12 1360576, November 2, 2010, Supplementary Amendment, Japan's CellSeed Company has made a further effort. (10) Year η month 〇 2 days, such as a culture dish or a culture hole, the temperature sensitive material is developed into a cell culture device. 'Drug screening is a step in the modern drug development process' refers to the pharmacological experiments applied in the screening of drugs for the selection of a specific active compound or a new compound by standardizing the actual physiologically active compound. The screening model is a feature of quantification and quantification. Therefore, there is less consideration in the screening scheme for the screening of the drug delivery, and the screening of the cell level in the drug screening according to the animal experiment. Cell-level drug screening and standard selection, the model is to design the drug effect _ cell-residue screening cells, these cell candidate compounds interact, to obtain the required fine nr; the ability of the object ' Therefore, the change of the free energy of the compound, the accurate determination or the molecular structure of the protein, the precise and the I-speed interaction is the key to the virtual drug screening, and it is also limited to i = select miscellaneous. In the case of the drug screening technique of the (four)-transformed hybrids, the scientist pointed out that 遁=,,, the field cell had resisted the target (four) filament, and in the radiotherapy treatment, the deoxygenated nuclear bitter ill tree _ touched The sub-districts after the differentiation are strong. The Year of the Year was published in a special report that the pharmaceutical industry is tracking the footprint of cancer stem cells. Like the mouthpiece, Le Factory's G_ company in California, StemJine in New York, (5). Department of R&D, R_Company, Toronto's R&D company, or a biotech or pharmaceutical company that locks on cancer stem cells as a strategy for developing anticancer drugs =-. The most development (four) is Tyverb, the drug is a small molecule drug for the treatment of Wei cancer, the purpose has been approved by the United States bribery food, ready to go on sale (charieis, Natoe

Biotechnology, 2008, vol. 26, 366-367). For the sake of the job, it provides a cell culture method and device that is efficient, easy to use, clear in mechanism, fast and suitable for disease treatment and screening of new drugs. It is currently developed and improved., 13 1360576 Supplementary on November 02, 100 Revised Resveratrol (3,4',5-tri-hydroxy-trans-stilbene, also referred to as RV), which is currently known from red wine, belongs to the natural variety (Bradamante S et al., Drug Rev, 20〇4, vol.22, 169-188). Resveratrol has multiple and healthy effects, such as protecting the heart, fighting the virus, resisting inflammation, resisting aging or prolonging life, etc. (de la Lastra CA and Villegas I, Mil Nutr Food Res, 2005, vol .49, 405-430 Nonn L et al., Carconogenesis, 2〇07, vol. 28, 1188-1196). Recent studies have indicated that resveratrol has anti-tumor effects and inhibits tumor neoplasia, the mechanism of which is to induce apoptosis through the regulatory pathways of Fas-, P53 and P21waf/cip1 (Atten MJ et al) Invest New Drug, 2005, vol. 23, 111-119; Kuo PL et al., Life Sci, 2002, vol. 72, 23-24; Roccaro AM et al., Clin Cancer Res, 2008, vol.14, 1849 -1858) Resveratrol also increases the sensitivity of tumor cell lines to radiation (Johnson GE et al., Apoptosis, 2008, vol. 13, 790-802; Baatout S et al., Int J Mol Med, 2004, Vol. 13, 895-902). Recent studies have pointed out that resveratrol-activated apoptosis plays a role in not only inhibiting tumor growth, but also acting as a sensitizer for radiation therapy in cancer therapy (Ivanov VN). Et al., Exp Cell Res, 2008, vol: 314, 1163-1176 'Chakraborty PK et al., 2008, Cancer Sci, vol: 99, 1109-1116). In the examples 'the tumor stem cells are from brain tumors Or other tissue samples taken. Cancer stem cells have the characteristics of stem cells or malignant tumors. We further observed whether resveratrol might be used to treat cancer stem cells. Our results show that treatment of tumor stem cells with high doses of resveratrol can significantly inhibit tumor invasion and inhibit cell population formation. Whether it is the activity test of apoptotic enzyme 8 or 3, or *TUNEL analysis, it can be known that resveratrol treatment can increase the apoptosis effect. Finally, the results of the experiment in vivo, do not endure the white gourd Alcohol supplementation can improve the radiotherapy effect of cancer stem cells. Previous studies have suggested that white alcohol can increase the sensitivity of radiation by several machines, such as activation 'also' or increase cell cycle S phase arrest (LiaoHF et al ,JRadiatRes,2005, vol.46, 387-393) 〇, all patents, applications and references listed as references are incorporated by reference in their entirety. In addition, if the name is in the definition of reference and provided here Where the definition does not conform or vice versa, the definition provided herein is dominant. The present invention is directed to achieving one or more of the above requirements, although the invention is One or more of the above requirements can be excluded, and some of the features of the present invention should be understood and 14 1360576 Supplementary Amendment of November 2,100 does not necessarily exclude its requirements. SUMMARY OF THE INVENTION A blood-free β-medium containing a stem cell, a secret cell, or a stem cell, which contains at least lactoferrin, may additionally contain a salt, a vitamin, an amino acid, and an epidermal growth factor (EGF). , beta-fibroblast growth factor or transferrin. The present invention also provides a device for screening stem cells, which comprises (8) a top layer, which is a microporous membrane separating the upper chamber and the lower chamber from bottom to bottom, (9) attached to the microporous filter, membrane. Polyisopropylacrylamide-pAMS), and (iii) cell-mobilized chemotactic compounds attached to the microporous membrane; and (b) 1rt. Shouting the (i) scratching _ red and sputum coated cell-assisted chemotactic compounds, including fibronectin, poly-uric acid, fibronectin or thymosin B4. The device of the present invention further provides a method for screening embryonic stem cells or adult stem cells or a tumor stem cell device for culturing dry cells, the device for transferring stem cells, comprising (4) an upper chamber, which is sequentially arranged from bottom to top (1) upper chamber and lower chamber. a microporous membrane in the chamber space, (ii) polyisopropylacrylamide attached to the microporous membrane (8), and (d) a cell-moving auxiliary chelate attached to the microporous membrane; and (b) The lower chamber is coated with a cell-assisted chemotactic compound, the method comprising: (a) providing stem cells and culture fluid from the specimen to the lower chamber, (9) inserting the upper chamber into the lower chamber culture medium for a period of time, and (6) changing the temperature to allow the brain to be concentrated Silky amine (NEPPAMS) and cultured dry and aged. The above-mentioned method of changing the temperature is carried out by placing the upper chamber in cold water to separate polyisopropyl isopropylamine (nipPAMS) and cultured stem cells. Thereafter, the cell recovery solution can be separated to separate polyisopropylacrylamide (NIPPAMS) and cultured stem cells to separate the cells. The invention also provides a method for identifying tumor stem cells, selected from the following methods, including observing (a) an increase in the formation of spheroid cells; (b) a stem cell gene! Changes in the expression of pS_〇ct4, s〇x2, Nan〇g, Klf4*cMyc; (c) specific molecular markers CD133, ABCG2, ALDH-1, CD117 positive and marginal cell population (side p〇pdati〇n) Increase in number; detection of in vitro tumorigenesis; (e) formation of tumors after xenogeneic colonization in vivo; and (1) resistance to chemicals and radiation. 15 1360576 100 years · November 02 supplementary correction In addition, the present invention also provides a method for identifying tumor stem cells, and 0ct4, NanQg' CD133 is positively correlated in clinical cancer stages of oral cancer, head and neck cancer, brain cancer, and lung cancer patients. However, it is significantly inversely proportional to the cancer, so 〇ct4, Nanog, and CD133 can be used as predictors of clinical cancer recovery. Furthermore, the expression levels of 〇ct4, Nan〇g, CD133 genes or proteins are also positively correlated with the production of tumor stem cells, so 〇ct4, Nan〇g, and CD133 are also uniquely labeled as cancer stem cells. The present invention further provides a method for confirming the clinical stage and the recovery of a cancer patient, which is characterized in that the gene or protein expression amount of Oct4, Nanog and CD133 is detected. Among them, cancers include those selected for epithelial malignancies and malignant tumors of organs, tissues, and blood of non-epithelial malignancies including tumor-forming and non-formogenic. In other words, the cancer system is at least from skin cancer (including melanoma), breast cancer, ovarian cancer, uterine cancer, sputum malignant tumor, prostate cancer, bladder cancer, kidney cancer, thyroid cancer, pharyngeal cancer, throat cancer, tongue cancer, Upper jaw cancer, esophageal cancer, gastric cancer, colon, rectal cancer, lung cancer, bronchial cancer, liver cancer (including hepatocellular carcinoma, intrahepatic cholangiocarcinoma), extrahepatic cholangiocarcinoma, gallbladder cancer, sputum cancer, leukemia, malignant lymphoma, Shaped cell swelling, osteosarcoma, cartilage sarcoma, smooth muscle swelling, rhabdomyosarcoma, fat edema, fibrous edema, malignant edema, malignant vascular endothelium and brain cancer (including meningioma, glioma, astrocytoma, etc.) Selected from the group. Further, it can be further defined in oral cancer, head and neck cancer, brain cancer, and lung cancer. The invention also provides a method for predicting a clinical cancer, comprising detecting (OOcM and CD133; (2) Nan〇g and CD133; or (3) 〇ct4, Nan〇g and cm33 in oral cancer, head and neck cancer, brain cancer The clinical cancer of the lung cancer patients (clinical cancer stage) pr〇gn〇sismarker is positively correlated' but is significantly inversely proportional to the cancer. The present invention further provides a method for identifying tumor stem cells, comprising detecting (1) Oct4CD133 from a cancer sample; 2) Nanog and CD133; or (3) 〇ct4, Nanog and CD133 gene or protein expression is positively correlated. 1360576 November 02, 100 Supplementary amendments The present invention provides a step-by-step treatment for disease-causing cells or changing the money Long and prolonged survival compositions include (1) Oct4 and/or Nanog short interfering nucleotides or (10) and or Nanog protein inhibitors. The present invention further provides a method for treating cancer stem cells or improving tumor growth and prolonging survival. Composition comprising resveratrol or SirTl short interfering nucleotide ❶ φ The present invention further provides a composition for treating a patient's cancer stem cells or improving tumor growth and prolonging survival. Including BCL-2 short interfering nucleotide and checkpoint kinase inhibitor (debromohymenial disine) ° [Embodiment] Example 1: Preparation of temperature sensitive easy-peelable water-adhesive layer preparation process Referring to Figure 1 (a), the material is first passed The surface was pretreated with electricity. Then 1.2 gram of N-isopropylacrylamide (NIPAAm), 0.026 g of the initiator Ammonium peroxodisulfate (APS), 0.04 ml was added. Promoter tetramethylethylenediamine (^凡>1七11^-111 basis> such as 1;11}^116-^111丨116; Ding 〇 〇) and 0.5 gram of parent-linked agent N,N-methyl-enebisacrylamide (NMBA) is dissolved in the secondary water to make the total volume of 2 〇ml, the mixture is the water-gel base material. The water-gel base material is added to the initial concentration. It is 〇.〇1 g/L of Vit-B2, the ratio of mixing is 4:1 (water-adhesive substrate: Vit-B2), and after mixing, it is subjected to a 65 ° C water bath for 1 hour to carry out surface graft polymerization of NIPAAm. Then 'clean overnight with secondary water' to remove the unbonded monomer. Finally, it can be easily irradiated with ultraviolet light to complete the easily peelable water gel. The production of the layer. When the ambient temperature is less than 32. (::, the water knee layer can be peeled off. 17 1360576 November 02, supplementary correction example 2: the preparation of the transfer tray and the temperature sensitive water gel easy peeling layer is first taken A transfer tray with a nylon mesh is used for subsequent plasma treatment and co-polymerization. The procedure was as follows: first evacuate to 40 mTorr, then argon to 250 mTorr, and apply a 50 watt plasma atmosphere for 10 minutes to generate free radicals for surface test piece activation. Then, 1 〇 0 / 〇 (w/v) of polyisopropylacrylamide (N-isopropylacjyl^ide; solution and addition of ammonium persulfate (APS), tetramethylethylenediamine (N' M': N_teti: a-methylethylene ^diamine; TEMED) and methylene bisacrylamide (N': Nr_methyl-enebisacryiamide; NMBA) additive, then immersed in the transfer tray (trar^well), placed in a timed rotation Taichung, irradiated with ultraviolet light with a wavelength of 256 μm and a power of 1 watt, and maintained the overall reaction at 15 degrees with a cooling system, and slowed down the reaction time by temperature control to make the polymerization of the ruthenium more homogeneous. Example 3: Cultured 6-well culture dishes of human normal cells or tumor cells must be coated with fibronectin at 5 ng/ml as shown in Figure 种植. Plant normal cells or tumor cells in the wells to make the cells reach eight points. For cell culture medium containing DMEM/F12, N2 supplement, ίοNike/ml epidermal growth cells, 10 ng/ml beta fibroblast growth factor, 1 μg/ml lactoferrin, 1% antibiotic, Every two days during cell culture A fresh culture solution, to observe the initial cell formation of the spher〇id φ cells, is placed in a freshly prepared transfer disk, using chemical chemotactic traits to pass the cell sphere through the outside of the bottom of the transfer disk, and then By transferring the pores of the disk of the dragon's hole, and then passing through the porous, south molecular network membrane, the temperature-sensitive water wins the peeling layer and reaches the artificial base film layer. Finally, the cell recovery solution (BD354253) can be used to laminate the artificial base layer. The cells were isolated. Example 4: Identification of oral squamous cell-like tumor stem cells and methods Cell lines and sigma squamous epithelial cells Tumor stem cells (4) (3) r - 丨 _ 18 1360576 November 02, 100 Supplementary amendment OC- Separation of SLCs from oral squamous ce丨丨carcinomas (OSCC) used two strains of SAS and OECM1 isolated from oral tumor cells. Normal human normal oral keratinocytes (NHOK) were cultured in the first place, and the culture method is described in Lu SY et al., Carcinogenesis, 2006, vol. 27, 1273-1284. The cultivation process is briefly described below. First, SAS uses DMEM medium, OECM1 uses RPMI medium, and the culture solution adds 10% fetal bovine serum. Then, the two cell lines were cultured in a tumor cell spheroid culture medium, which was a DMEM/F12 culture medium without a helmet, containing Ν2 supplement, 1 〇N/ml of human recombinant beta-fibroblast growth factor. And an epithelial cell growth factor of 10 ng/ml. The cells were planted on a 10 mm culture plate in a total amount of 7.5 x 10 O5 viable cells. The medium was then replaced with each sputum until cell spheroid formation was observed approximately four weeks later. Real-time RT-PCR Purification of primary cultured oral tumor cells and 〇C-SLCs-derived cells to obtain total nucleotides. Jane 5's 1 mg of total nucleotides per sample was subjected to reverse transcription by reverse transcription polymerase Superscript II RT (Invitrogen, Carlsberg, CA, USA). Thereafter, the amplification reaction was carried out in an environment of a total volume of 2 〇 microliter. 20 microliters of reaction solution containing 〇.5μΜ positive and negative vector primer, 4mM sterilized magnesium, 2μl LightCyclerTM-FastStart DNA Master SYBR green I (Roche Molecular Systems, Alameda, California, USA), and previous preparation 2 μl of cDNA ° in a separate experiment 'magnification with the housekeeping gene _gapdh as a reference standard. The GAPDH primer sequence is GAPDH (positive strand): GGGCCAAAAGGGTCATCATC (nt414-434, GenBank accession no. BC059110.1). GAPDH (anti-share) ATGACCTTGCCCACA GCCTT (nt 713-733). The experiment was repeated in two steps and heated to 95. 〇 After 〇 〇 minutes, start 4 replicate reactions, each of which is denatured 95. 〇 lasts for 1 second, sticks 55t for 5 seconds, and extends 72t: lasts 2 seconds. Immunofluorescence staining of cancer stem cell markers 19 1360576 November 02, 100 Supplementary amendments Briefly 'cells are grown on glass slides covered with poly-L-ornithine or fixed with 4% paraformaldehyde The OSCC tumor tissue was cryosectioned and washed with acid buffered physiological saline. The cells were permeabilized for 1 min with 0.1% Triton X-100/acid buffered saline. Subsequently, the cells are co-cultured with a primary antibody comprising: Nestin, Oct-4, Nanog, and CD133 (Chemicon, Memcula, CA, USA). Detection of immunoreactive signals was performed using biotinylated rabbit anti-mouse IgG and fluorescent labeling reagent Fluoesave (Calbiochem, La Jolla, California, USA). Further, it is identified by a secondary antibody labeled with fluorescein isothiocyanate (FITC) or phycoerythrin (PE). The fluorescence intensity was recorded with an inverted fluorescent microscope equipped with a CCD camera. The percentage of each of the photoflash signals was analyzed by Image Pro-Plus. The elapsed cytometry analysis is to identify the cell surface markers of OC-SLCs. The single cell suspension after cell sphere treatment is reacted with antibodies against CD133, CD117 (c-Kit) and ABCG2, and then labeled with FITC or PE. Grade antibodies were identified (Dako, Carpinteria, California, USA). The instrument for analysis was a FACS Calibur device (Becton Dickinson, San Diego, CA, USA). Cell viability test for radiation treatment · Transmission of gamma radiation (free radiation, 'ionizing irradiation; IR) with Theratronic cobalt unit T-1000 (Theratronic Inte ribolysis, Inc. Ottawa, Canada), dose selection of 1.1 Gray / Minutes (SSD = 57.5 cm). The cells were seeded in a 24-well culture dish with a cell density of 2 X 104 cells/well. MTT assay (Sigma-Aldrich Co) was performed 24 hours after radiation treatment. Differentiation of the System 20 1360576 100: November 2, 2011 Supplementary correction of 24-hole transfer plate with 8 micron pores of polycarbonate-acid vinegar resin Transwell® (Coming, UK) was used to evaluate OSCCs and OC-SLCs derived Cell invasion ability. The membrane is covered with a layer of base film MatrigelTM. The tumor cell suspension is placed in the upper chamber of the transfer plate at a cell density of 1 x 1〇5 cells/100 μl of serum-free medium. The serum-free medium was also added to the lower chamber. After 24 hours of culture, the medium was removed and the filter was fixed with 4% fumarine for 1 hour. Then, the attached cells facing the decidua of the lower chamber were treated with Hoechst 3%4. Staining. The transferred tumor cells were observed under an inverted microscope. 'After magnifying 100 times', 5 different visual zones were selected for counting. Soft gel test each hole (35 mm) of a 6-well cell culture plate with 2 ml of bottom glue The mixture was covered, and the bottom knee mixture was mainly composed of DMEM containing 1% by volume of calf serum and 0.6% by volume of colloid. After the bottom colloid was formed, it was covered with 2 ml of the upper gel mixture, mainly The composition is DMEM' containing 10% (volume ratio) calf serum, 0.3% by volume colloid, and 2 χ1〇4 cells. The culture plate is placed at 37. (: The environment is cultured for 4 weeks. The plates were counted after staining with 5% crystal violet. Statistical analysis was performed using Student, s (assay. In vivo tumor formation analysis® Animal use followed the guidelines of the Animal Care and Use Committee of Taipei Veterans General Hospital. In order to observe the tumor growth and diffusion effects of oral cancer stem cells, the parental cells of the SAS cell line of i xl〇4 to 2χ1〇5 cells and the GC_SLCS cells or the cells of the primary cultured cells were injected for eight weeks. BAL In the oral mucosa of B/c nude mice, the tumor volume was calculated as (length χ width 2)/2. The primary tumor cell sphere cultured OSCC tumor samples were from donor patients. After washing, the tumor was based on Lin sc et al. in J(10) Pathol. The method described in <448 (2007) 79-86 is carried out and the tissue is separated. The tumor cells are then suspended in a serum-free cytosolic Wei towel, which contains DM £M/F12 culture without sputum. 21 1360576 November 02, supplemental solution, N2 supplement, 10 ng/ ML of human recombinant beta fibroblast growth factor and 10 ng/ml of epithelial cell growth factor. Immunohistochemical analysis Of the 52 unselected patients who underwent surgical treatment of oral tumors from 1994 to 1997 in the Department of Oral and Facial Surgery at the Ma Rong Memorial Hospital. Based on the purpose of the Helsinki Declaration, all the samples were informed of the patient and signed a consent form. All patients were patients who had not received radiation or chemotherapy before surgery. Donated tissue samples from 52 different disease stages were placed on glass slides' for immunohistochemical analysis. After removing the paraffin and rehydrating, the tissue sections were placed in a sodium citrate buffer (1 〇, pH 6 〇) to boil the antigen to restore the antigen. The slides were immersed in 3% hydrogen peroxide solution for 1 minute and then washed three times with phosphate buffered saline. The tissue 乂ih (Vestastain £1 plus abc kit, Vector Labratories, Burlingame, Calif.) was subjected to a 30-minute barrier. Further, a room temperature reaction was carried out for 2 hours by adding a buffered physiological saline solution containing a primary antibody to an antibody against 〇ct-4 and anti-Nanog (Chemicon, Temecula, plus 2). After washing the slide with a dish of acid buffered saline, the slides were incubated with biotinylated secondary antibody for 30 minutes. Subsequently, the streptavidin peroxidase linkage was added for 3 minutes, and washed three times with phosphate buffered physiological saline. The chromogen 3,3,-diaminobenzidine mixed with a nitrogen peroxide substrate solution (Vect01^DBA/Ni matrix kit, SK-4100, Carrier Laboratory, Burlingame, California USA) was used for 1 minute. Finally, the tumor tissue sections were mounted using a coverslip in conjunction with Gun<S) (BDH Laboratories' UK) and subsequently observed using a microscope. Data were obtained in a random manner using two immunohistochemical pathology scores. Five different visual regions were selected for each slice to illustrate the results, and 100 cells were counted per viewport for analysis. Statistical Analysis Statistical analysis was performed using the SPSS Analysis Suite version 13.0 (SPSS, Inc., Chicago, USA). The independent Student's T test or ANOVA was used to analyze the continuous differences between the groups, while the X test was applied to the comparison of the difference between the two groups. The Kaplan-Meier method is used to perform survival points. 22 1360576 November 2, 2010 Supplementary corrections and log-rank tests can be used to compare the survival time of different patient groups. For all experiments, statistically significant differences were set at 〇.〇5. Results OC-SLCs were isolated from OSCC for culture.

To observe the presence of OC-SLCs in oral tumor cells at different stages of the disease, two oral tumor cell lines - SAS (highly exacerbated and metastatic) and OECM1 (lower deteriorating), and normal human oral keratinocytes (normal) were used. Human keratinocytes (NH0K) are defined as a culture without blood, a primary culture containing beta-fibroblast growth factor and epithelial growth factor. After two weeks of culture, the tumor cells were detached from the culture plate and agglomerated to form sphere_like bodies (SBs). Obvious SBs can be observed after three weeks of serum-free culture, see Figure 3. Compared to the 0SCCs 'NHOK cells, serum-free conditions produced less and smaller SBs' and apoptosis began two weeks later. Weekly tests of SAS and 0ECM1 self-proliferation and the ability of primary ellipsoid formation. The results showed that the activity of SAS cell proliferation and the number of new spheroid formations were much higher than those of OECM1, and the data are shown in Figures 9(a) and (b). OC-SLCs show an increase in initial cell/stem cell genes. Φ Detects the amount of primary cell/stem cell genes, such as Oct-4, Nanog, and Nestin. After SAS, OECM1, and NH0K were cultured without gold, the parental cells or the total nucleotides of the spheres were purified. Using real-time reverse transcription polymerase chain experiments, it was found that the transcriptional effects of Oct-4, Nanog and nestin in these 〇C_slCs cells after activation were significantly improved compared with the parental 〇scc cells, Fig. 9(c). Immediate reverse transcription polymerase chain experiments confirmed that the transcriptional effects of Oct-4, Nanog and Nestin were increased in activated OC-SLCs cells, as shown in Figure 3(b). In addition, 'the third generation of OSCCs cultured OC-SLCs-OC3 (the worst of the three kinds of OSCCs), the performance of 〇ct-4, Nanog and nestin also increased (Figure 3 (b)). In order to cooperate with the results of the real-time inversion rate polymerase bond experiment, Western blotting experiments were carried out to confirm the protein expression of Oct-4, Nanog and Nestin in the activated C-SLCs. Results 23 1360576 100: Supplementary corrections on November 2, 2008 showed that the OC-SLCs in the activated culture were higher in performance than the parental cells, as shown in Figure 3(c), and the left row was SAS' in the middle of OECM1. Furthermore, immunofluorescence staining also showed the intracellular content of 〇ct_4, Nan〇g, and nestin. The sputum from SAS (: 8 £(:3) The amount of three proteins in the cell is far beyond the parental cell. See Fig. 3(4), the upper row is 〇ct_4, and the lower row is Nan〇g. Figure 3(4) shows the fluorescence intensity of OC-SLCs cells after activation, 〇ct 4, Nan〇g* nestin gene expression Significantly improved, Figure 9(d) can also be supplemented as a result of this section. NHQK cells can detect nestin in either parental or spheroid-like nestin, which may be due to tissue culture. It is mixed into stromal cells (initial cells of skin tissue). However, the cells of the NH0K-like spheroids exhibit no above-mentioned genes associated with the initial cells or stem cells, as shown in the right row of Fig. 3(c).

Separated OC-SLCs for initial cell/stem cell identification

To further confirm the characteristics of the initial cells/stem cells of the 〇C-SLCs after activation, we used a lapse cell counter to detect the cell surface marker molecules of the initial cells/stem cells. As shown in Fig. 5(a), both SAS and OECM1 cells exhibited surface molecules of CD133 and CD117 (c-Kit), and both surface molecular markers were cell surface markers of general stem cells or tumor cells. Interestingly, we also detected that most of the OC-SLCs that were activated from SAS or 0ECM1 also exhibited ABCG2 (Fig. 5(a)). OC-SLCs after activated culture from SAS or 〇EC]yn ' When serum-free culture for a long time, 6〇% of the cells belong to cells positive for cm33, CDU7 and ABCG2, see Figure 5(b)t) To evaluate the sensitivity of parental cells or derived 〇C SLCs cells to radiation, SAS and SAS-activated 〇C-SLCs were treated with 1 〇Gray dose radiation, and then observed for individual cell viability 4AS activation culture. 〇c_SLCs have better radiation resistance relative to the parental cells, as shown in Figure 5 (^, {5 value < 〇〇 5. Next, replacing the previously serum-free culture with a culture medium containing 10% calf serum Liquid to culture the spheroids of 〇C SLCs. We found that OC-SLCs will spread as well as the parental cells, Figure 5(d). OC-SLCs also show keratinocyte specificity in normal calf serum. The marker molecule, CK18, is shown in Figure 5(e). These results confirm that activated cultured 〇C SLCs cells will exhibit surface marker molecules of stem cells, and will have better radiation resistance, as well as hyperplastic self-healing, 24 1360576 Supplementary correction and differentiation into corners on November 2, 100 The potential of the cells. The in vitro invasion ability test and the soft gel lesion formation test confirmed that the tumorigenicity of the isolated 〇C_SLCs was enhanced by sf·estimating whether the isolated 〇C-SLCs had a change in their tumorigenicity. We performed in vitro basement membrane matching with transfer plate assays and soft gel cell colony formation analysis. OC-SLCs from SAS or OECM1 showed high invasiveness against invasion assays, Figure 6(a) , p value < 0.05. Similarly, 'the ability of both cells to form lesions' is also stronger than that of the parental cells, see Figure 6(b) 'p value<0. (Π. Interestingly, in the lesion formation test In the experiment, even if the same number of cell 'SAS parent cells were placed, the ability of cell colony formation was similar to that of 〇ECMi activated culture 〇c_SLCs. OC-SLCs tumorigenicity-enhanced in vivo test to further confirm activation-cultured OC- SLCs also have the effect of enhancing tumorigenicity in vivo. 'Parental SAS cells and OC-SLCs derived from SAS were injected into the oral cavity of nude mice for tumorigenicity analysis. Table 1, three-thirds One nude mouse was transferred to lx After the SAC parent cell of 5〇5 cells, new tumors will be produced. • Table 1. Number of tumorigenic cells injected into OC-SLCs of NOD/SCID mice 2x105 lxlO5 5x104 lxlO4 SAS 3/3 1/3. 0/3 0/3 OC-SLCs 3/3 3/3 2/3 2/3 However, when SAS-derived OC-SLCs are injected into nude mice, only 1×10 4 cells will cause tumor formation. Upgrade to two-thirds. This result indicates that the tumor-initiating ability of SAS-derived 〇C-SLCs has been increased by at least ten times. The results of tissue section also showed that the proliferative capacity of OC-SLCs was significantly improved compared to the parental cells, see Figure 6(c). In addition to 25 1360576 November 02, 100 supplementary corrections, the OC-SLCs _ 彡 肿 肿 也 也 也 也 也 也 也 也 也 也 也 也 也 也 也 也 也 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管 血管Observing the formation, size, and volume of tumor lesions, it was found that the results of OC-SLCs were significantly higher than those of the parental cells, as shown in Figures 6(6) and (6), and the value of ρ<〇〇5. Moreover, we also observed the ability of 0C_SLCS to lingo from the mouth (data not provided). Furthermore, the survival rate of the c_SLCs group was lower than that of the parental cells by the survival curve analysis. Fig. 6(e), p value <〇.〇1. Isolation and Characterization of _c_SLCs Cells from Tumor-derived Cultures of Oscc Patients

The cells were degraded by using our serum-free cultured lysate, and the cell surface was the spheroid of the tumor of the scc patient after one week of culture, as shown in Figure 7 (8). Comparing the data of Fig. 3 (8) with Fig. 7 (8), it was found that cells isolated from OSS disease tumors formed 0C_SLCs spheres faster than the parental cells. In addition, the results of the cytometry analysis showed that the activated OC-SLCs cells of the five 〇scc primary cultures showed a relatively large amount of CD133, see Fig. 7(b). To further confirm the tumorigenicity of the parental cells and 〇C-SLCs in individual patients, we injected a total of 1000, 3000, and 104 cells into the back of the back of the mice. The results showed that four-fifths of the mice injected into one of the four parental cells did not cause tumor formation. However, simply injecting 3000 OC-SLCs into the back of the mouse will result in visually detectable tumorigenesis in all mice'. Figure 7(b) and the table below.

Table 2 Patient number Tumor subgroup tumor stage CD133+ (%) CD 133+ CD133-like spheres such as globules-CD133 positive reaction ί°/〇) 1 0SCC Level 4 2.2 10,000 (3/3) 10,000 (0 /3) There are 20.2 3,000 (3/3) 3,000 (0/3) 1,000 (3/3) 1,000 (0/3) 2 0SCC Level 3 1.8 10,000 (3/3) 10,000 (0/3) with 18.2 3,000 (3/3) 3,000(0/3) 1,000 (2/3) 1,000 (0/3) 3 0SCC Level 3 2 10,000 (3/3) 10,000 (0/3) Yes 17.4 26 1360576 4 oscc Level 4 5 oscc Level 2, November 2, 100 Supplementary Amendment 3,000 (3/3) 3,000 (0/3) 1,000 (1/3) 1,000 (0/3) 2.1 10,000 (3/3) 10,000 (0/3) There are 22.1 3,000 (3/3) 3,000 (0/3) 1,000 (3/3) 1,000 (0/3) 0.8 10,000 (1/3) 10,000 (0/3) with 10.3 3,000 (1/3) 3,000 (0 /3) _____1,000(0/3) 1,000(0/3)__ Remarks: Individual cells are injected into the body of immunocompromised mice; the spheroid type is in serum-free culture state. Only beta fibroblast growth is added. Factor and epidermal growth factor.

Immunohistochemical analysis of Oct-4, Nanog, and CD133 in OSCC patients was performed to observe the expression of 〇ct_4, Nanog, and CD133 in oral cancer patients at different stages of the disease. We aimed at 52 oral cancer patients. The immunohistochemical staining analysis was performed to establish the individual occurrence data of 〇ct_4, Nanog and CD133, referring to Fig. 8(a), the above list is 0ct_4, the middle column is Nanog and the following is CD133. The results showed that the incidence of Oct-4 was positively correlated with progression of cancer, moderate to low differentiation of oral cancer (but not metastasis to lymph nodes), see Figure 8(a) and the table below. The tumor tissue sections of patients with oral cancer in the third or fourth stage can also be found that the performance of Oct-4 is higher in the nucleus than in the first and second phases. Similarly, Nanog or CD133 is also associated with cancer progression and moderate to low differentiation, as shown in Figure 8(a), p-value <0.05; Tables 3, 4 and 5. Table 3, Oct-4 performance and number of clinicopathological variants (n=52) Number of negative reactions (%) Number of positive reactions (%) __ T stage precancerous-T2 25 16 (65) 9 (35) T3-T4 27 9(34) 18(66) 27 1360576 Supplementary amendments on November 02, 100 *P=0.0495 N stage N=0 31 16 (70) 7(30) N>0 21 9(32) 20 ( 68) Ρ=0·0971 overall stage precancerous-second stage 23 16 (70) 7(30) third to fourth 29 9(32) 20 (68) *P=0.0225 Survival rate Yes 27 17 (67) 10(37) No 25 8(32) 17(68) *Ρ=0·0308 Good differentiation 24 16 (67) 8(33) Moderate to low 28 9(32) 19 (66) *Ρ=0.00250

Remarks: Fisher’s extract check.

Table 4, Nanog performance and clinical pathological variation number of patients (n=52) Number of negative reactions (%) Number of positive reactions (%) Τ Stage precancerous - Τ 2 25 17 (68) 8P2) Τ3-Τ4 27 9 (33) 18(67) *Ρ=0.0254 Ν Stage Ν=0 31 19(61) 12 (39) Ν>0 21 7(32) 14 (68) 28 1360576 Supplementary amendments on November 2, 2010

P=0.0889 overall stage precancerous-second stage 23 16 (70) 7(30) third to fourth 29 10 (32) 17 (69) **Ρ=0·0017 Survival rate Yes 27 18 (74) 7 (26) No 25 8(31) 17 (69) **P=0.0047 Good differentiation 24 17(71) 7 09) Moderate to low 28 9(32) 19 (66) *P=0.0015 Remarks: Fisher's Extract check. Table 5, CD133 performance and the number of pathological samples of pathological variation of Linshi S (n=52) Number of negative reactions (%) Number of positive reactions (%) T stage precancerous-T2 25 18(71) 7(29) T3 -T4 27 6(25) 21(75) **P=0.002 N stage N=0 31 14 (45) 17(55) N>0 21 10(48) 11(52) Ρ=1·0 overall stage cancer Pre-Phase 23 17 (74) 6 (26) Third to Fourth 29 7 (24) 22 (76) 29 1360576 **P=0.001 p Survival rate Yes 27 18(66) 9(34) No 25 8(32) 17C68) *P=0.03 Good differentiation 24 16 (67) 8(33) Moderate to low 28 10 (36) 18ί64Ί *P=0.04 Remarks: Fisher's extract. The low rate of miscellaneous cancer patients with 〇et_4, NanGgifu cm33 is positively correlated with Kapian-Meier survival analysis to identify 〇cM, Nan〇g and for the diagnosis of oral cancer patients, according to the organization Pathological analysis diagnosed patients with a five-year survival rate, we did not make a "sexual difference system (four), high scores, low scores, refer to Figure 8 (b), p value < 0.06. The second 'Kaplan_Meier survival analysis showed that the case of 〇ct 4 immuno- glory-positive reaction was asexually responsive, and the heterogeneous reaction was related to the difference in the whole age (see Figure %), p value < 〇. 51. Regarding the performance of Nan()g, our results also show that the 'lower performing group' has a higher survival rate, Figure 8(d), p value < Patients with a fourth 'CD133-positive response were diagnosed with poor survival, Figure 8 (4), p-value < 〇〇 5. In summary: these results support the following discussion, 〇ct_4, Nan〇g, and cDm's performance in the organization rises directly, and m NaΑ survival rate and disease progression side, refer to Figure 8 (c), (4) And (e). In particular, as long as it is a patient who has a percentage of the performance shirt, it is diagnosed that there is a poor survival. The p value is < aG1, which is higher than other ones. Considering (10) 4 and cdi33 for the operation of the oral county, the oil found that the patient with positive reaction to 〇eM negative reaction compared with the patient with negative reaction of 0cM positive reaction, the survival rate is shown in Figure 8 (e ) p value <〇.〇5. If the patient is positive for both, the survival rate is also poor. See Figure 8(e) ' 〇ct-4 positive reaction 〇n〇g positive reaction compared with 〇ct_4 yin 1360576 100 years 11 The patient who supplemented the corrective response/Nanog negative reaction of the month 02曰's ρ<〇·〇〇〇1. Moreover, all of the three surface marker molecules were positive, and the worst survival rate was diagnosed. Figure 8 (g), 〇ct_4 positive anti-^ sexual response / CD133% sexual response compared with other groups . In summary, these data show

The amount of Nanog's performance is important for the diagnosis of disease progression or clinical outcomes in patients with oral cancer. In OSCC patients, the presence of 〇ct-4, Nanog and CD133 markers in cells is confirmed in the presence of cells in OSCC patients whose Oct-4, Nanog and CD133 marker molecules exist in cells. We use immunofluorescence staining. To detect. 〇ct_4 and Nan〇g proteins are present in the nucleus of 〇scc swollen φ tumor, while CD133 is present on cytoplasm and cell membrane, see Figure 1〇. The upper row of Figure 10 is the double staining of Oct-4 and Nanog, the middle of Figure 10 is the double staining of 〇cM and cm33, and the following is the double staining of CD133 and Nanog. The results showed that 〇ct_4 and Nanog proteins coexisted in the nucleus of OSS tumors. However, not every CD133 1% reactive cell is also stained with 〇ct_4 or Nanog, as shown in Figure 1〇 and below. Example 5: Identification of CD133-positive reactions in radiation-resistant cells in atypical teratoma/rhabd〇id AT/RT Φ Materials and methods were isolated from AT/RT tissues Discriminating CD133+ Cell Subpopulations The study followed the Helsinki Manifesto, and all samples were obtained in advance and informed consent. The cells isolated from brain tumor samples from patients with atypical teratoma/striated tumors were 1 ml. A CD133 cell separation reagent kit (MACS, Meitian Biotechnology Co., Ltd., Germany) was used. One microbead was used per million cells. CD133-positive cells were cultured in serum-free DMEM/F12 medium (GIBCO) supplemented with N2 supplement &(R&D), 1 〇N/ml of human recombinant beta fibroblast growth factor @&amp ;Ε)), 1〇31 1360576 Supplementary correction of Nike/ml epithelial cell growth factor (R&D) on November 02 of the following year. The gamma radiation (ionizing irradiation; IR) was delivered by Theratronic cobalt unit T-1000 (Themtr〇nic Inte nucleoside acid, Inc., Ottawa, Canada) at a dose of U Gray/min (SSD=57 5 Centimeter). To evaluate the rate of cell proliferation, cells were seeded in a 24-well culture dish at a density of 2 X 1 4 cells/well, followed by MTT analysis (Sigma-Aldrich Co). The microplate reader (SpectraMax 250, Molecular Device, Sunnyvale, Calif., USA) was used to determine the yield of the MTT formazan product, and the absorbance was set at 560 nm. Comparative genomic hybridisation (CGH) The comparative genomic hybridization technique is based on the method described by Kao CL et al., Mol. payh〇l. (2005) 18:769-778, which uses a standard procedure from the patient's lymphocytes. Conduct a medium-term spread. Gap translation, red-lighted tumor DNA, and green-light-labeled general cellular DNA were co-precipitated with a large number of unlabeled human Coi-i DNA (GibcoBRL), followed by denaturation and hybridization with normal mid-slice sections. Capture 1 to 12 images for analysis. The analysis tool is

Cytovision workstation. The threshold was obtained by setting the acquisition value to 12, and the loss value was set to 0_8 ° Microarray analysis and timely reverse transcription polymerase chain reaction using Tnzol reagent ((Life Technologies, Bishda, Massachusetts, USA) for overall nucleus Nucleotide purification by nucleotide extraction and Qiagen nucleotide easy column (Qiagen, Valencia, California, USA). Superscript II negative reverse transcriptase (Gibco BRL) generates C 3 cDNA probes and supplies them separately. For control or experimental use, Cy3 and Cy5 were purchased from Amersham Biosciences Co., Piscataway, NJ, USA. Hybrid probes were used to hybridize microarray wafers containing -1000 cDNA fragments immobilized. Cy3 and (7) Fluorescence intensity was detected and scanned by GenePix 4000B microarray scanner (Ax〇n Instmments, Beringer California, USA) using GenePkΡιΌ3.0.5.56 (Ax〇nInStmments, USA (10) and GeneSpringGXUi software (Agi丨ent, Pa Data analysis of Loalto, Calif.. Real-time reverse transcription polymerase chain reaction according to Yang et al. published in 〇nc〇gene 32 1360576: Supplementary amendments on November 2, 100 (2 〇〇7) Method of 26.14559_1467. Briefly, each sample uses reverse transcriptase (1 μg) for each sample. The reaction volume is 2 G microliters, containing Q 5 μg. Coffee dT and 2〇〇 • International unit of gamogen, Kalbes, Calif.) The primer sequence is as follows: The total volume of the sequence amplification reaction is 20 μl, containing 〇5 μΜ of the primer, 4 touch of magnesium chloride, 2 μL of LightCycler~ Secret Such as DNA Hall 咏s job as I _he

Molecular Systems, Alameda, Calif.) and 2 μl of the diluted cDNA polymerase chain reaction was carried out in two replicates. After heating to 95 ° C for 1 G minutes, 4 G repeat reaction procedures were started, each single The procedure is denaturation 95. 〇 lasts for 1 second, and the adhesion 55<>c lasts for 5 seconds and the extension system is 72. (: lasts as a second. Each sample has a target gene and a standard curve for the internal reference (GAPDH) (cycle threshold and template concentration). Quantification of unknown samples using LightCycler Relative Quantitative Software version 3.3 (R0che Molecular Systems , Alameda, California) for quantification.

Table 6. Setting 1: Immediate reverse transcription polymerase chain reaction using primer primer accession sequence product (base pair) Temperature (°〇BCL-XL Z23115 Stock: CAGGGACAGCATATCAGAG Counter stock: TGGTCATTCAGGTAAGTGG 184 55 ΒΑΧ NMJ04324 Stock: GATGCGTCCACCAAGAAG (226) Counter Stock: AGTTGAAGTTGCCGTCAG 163 55 MDM2 BT007258 Stock: gtagtAgtcaatcagcaggaatc Counter Stock: GAAACCAAATGTGAAGATGAAGG 140 52 CDK2 NMJ01798 Stock: CCTGGACACTGAGACTGAG Counter Stock: GTGAGAGCAGAGGCATCC 183 53 CDKN1A NMJ00389 Stock: TCTACATCTTCTGCCTTAGTCTC Counter Stock: TCTTAGGAACCTCTCATTCAACC 164 54 TP53 NMJ00546 Stock: TGCGTGTGGAGTATTTGGATG Inversion: GTGTGATGATGGTGAGGATGG 168 55 TP53BP1 BC112161 Stock: ATACTTCAGGCAATACTACACATTC 193 55 33 1360576 November 02, 100 Supplementary corrections: TTAGCATCCACATCAGACAGC BCL-2 NM—000657 Stock: GCGACTCCTGATTCATTGG Counter Stock: GTCTACTTCCTCTGTGATGTTG 162 52 CDC25a NM—201567 Shares: AAGCGTGTCATTGTTGTG Counter Stock: CAGGGTAGTGGAGTTTGG 118 53 Cell invasion performance analysis in vitro and soft rubber test Polycarbonate with 8 micron pores A 24-well transfer plate of ester resin membrane TmnSwell® (Coming, UK) was used to assess the invasive ability of the cells. The membrane was covered with a layer of basement membrane MatrigdTM. The tumor cell suspension was placed in the upper chamber of the transfer tray. The cell density was 1 x 105 cells/1 〇〇 microliter of serum-free medium. The serum was also added to the lower chamber. After 24 hours of culture, the culture solution was removed and the aponeurosis was fixed with 4% fumarine for 1 hour. The attached cells facing the lower chamber membrane surface were stained with H〇echst 33342 for three minutes. The transferred tumor cells were observed with an inverted microscope, and after magnifying 100 times, five different viewing zones were selected for counting. The method of soft analysis is as follows: 'Every hole (35 mm) of the six-well cell culture plate is covered with 2 ml of the bottom glue mixture. The bottom glue mixture' is mainly composed of DMEM and contains 10% by volume. Bovine serum, 〇 6% (volume ratio) colloid. After the bottom colloid was formed, it was covered with 2 ml of the upper gel mixture. The main component was DMEM' containing 10% by volume of calf serum, 〇.3% by volume of colloid, and 2χ1〇4 cells. The culture plates were placed in an environment of 37 ° C for 4 weeks. The plate was counted after staining with 0.0005% crystal violet for one hour. Immunofluorescence staining and immunohistochemical analysis procedures are described by Chiou SH et al., J Immunol (2006) 177:6199-6206. Briefly, the immunoglobulin staining of differentiated sphere cells and neuron-like cells uses the avidin-biotin complex method. Each slice is used for CD133 (MACS, Miltenyi Bi〇tec), GFAp (Chemicon), MAP2 (Chemicon), Phosphorylated ATM (ser-1981; Upstate, Placid 34 1360576 • November 2, 100 Supplement Modified Lake, New York) and BCL-2 (Chemicon). The immunoreactive signal was added to biotinylated rabbit anti-mouse IgG and Fluoesave (Calbiochem, La Jolla) for detection. In Vivo Tests for Tumor Growth and Metastasis Animal use follows the guidelines of the Animal Care and Use Committee of the Taipei Veterans General Hospital. To observe the tumor growth and proliferation effects of oral cancer stem cells, 2×104 cells of CD133-positive AT/RT cells and CD133-negative AT/RT cells were injected into the oral mucosa of eight-week-old BALB/c nude mice. . The green fluorescent protein image was observed and detected by a fluorescent device (LT-9500 Illumatool TLS in conjunction with a 470 nm radiation source and a 515 nm filter disk). The volume of the tumor is detected by a vernier scale, and the tumor volume is calculated as (length X width 2)/2. After taking the optical density of the green fluorescent light, the pro_pius software was used for calculation and analysis. Statistical analysis The results were presented as data with mean: t standard deviation. Statistical analysis using Student, s τ check or

One-tailed or two-tailed AN〇VA analysis after Turkey^ verification. For all experiments, statistically significant differences were set at p<0.〇5. Results CD133-positive cells were isolated from AT/RT tissues and confirmed for characteristics. This study included women with W-rain disease. The tumor eggs from this disease are positive for #, including: vimentin, this cell membrane antigen, cytokeratin, neuron-specific olefin, thief-transformed protein, and synaptophysin, refer to Figure 11 (8), Other relevant data is not available. A total of nine tumor samples were taken from the nine patients to compare the baseline _ New _ and SMARCB1 (10) fat (10) grading analysis. 35 1360576 Supplementary corrections on November 2, J00 In combination with the use of magnetic beads, the results of the CD133-positive AT-RT cells were isolated from the above 14 tumor samples. Figure 11(b) and Table VII. Table VII, case description and tumor characteristics of CD133+AT/RT_Injected cells Zhao case: feL year gender _ full · analysis * survival 晬 年, rnm+ (%) CD133+ CD133 1-1 0.7/ male positive 0.2 36.4 10,000 (3/3) 10,000 (0/3) 3,000 (3/3) 3,000 (0/3) 1,000 (2/3) 1,000 (0/3) 2 2.3 /-k positive 0.3 21.8 (69.5)** 10,000 ( 3/3) '10,000(0/3) 3,000(3/3) 3,000(0/3) 1,000(3/3) 1,000(0/3) 3 2.8/ Male Positive 4.4 7.3 (29.6)** 10,000 (3 /3) 10,000 (0/3) 3,000 (3/3) 3,000 (0/3) 1,000 (3/3) 1,000 (0/3) 4 5_1/ male positive 1.7 25.9 (43.1) ** 10,000 (3/3 10,000(0/3) 3,000(3/3) 3,000(0/3) 1,000(3/3) 1,000(0/3) 5 1_4/ Male Positive 8.7 1.3 10,000 (2/3) 10,000(0/3) 3,000(1/3) 3,000(0/3) 1,000(0/3) 1,000(0/3) 6 3.3/Female Positive 7.5 1.6 10,000 (2/3) 10,000(0/3) 3,000(1/3) 3,000 (0/3) 1,000(1/3) 1,000(0/3) 7 8.1/Female Positive 4.7 2.4 (37.5)** 10,000 (3/3) 10,000(0/3) 3,000(3/3) 3,000(0 /3) 1,000(0/3) 1,000(0/3) 8 5.1/Male Positive 1.7 3.9 (48.5)** 10,000 (3/3) 10,000 (0/3)

36 1360576 • November 2, 100 Supplementary Amendment 3,000(3/3) 3,000(0/3) 1,000(3/3) 1,000(0/3) 10,000 (3/3) 1〇,〇〇〇(〇/ 3) 3,000 (3/3) 3,000 (0/3)

Molecular analysis included the cross-sectional examination of 22qll·2 and Gu Fsu/7 琢 删除 deletion or mutation and the results of CGH experiment 9 mouth / male positive 2.5 second surgery for tumor removal. OM33 X and CD133· cells were injected into the bottom of the brain of immunocompromised mice. Figure 11 (c) Immunofluorescence data confirms that CD133+ cells collected by magnetic beads are highly expressed CD133, whereas CDI33- cells do not detect green fluorescent expression. Furthermore, we also performed a comparative gene heterogeneous technique and molecular analysis of SMARCB1 to confirm the phenomenon of CD133+ cell chromosome hangover. The results show that these CD133+ cells exhibit anomalous att/RT chromosome 22 monomer, large change or deuterium deletion, and these are all atypical symbols of AT/RTs, see Figure 11(d) and Table VII. Tumor-type stem cell characteristics of CD133+AT/RT cells After isolation of CDK cells from tissues of AT/RT patients, we next confirm whether the cells have tumor-like stem cell characteristics. According to the MTT assay, CD133+ cells have higher cell proliferation ability than cm33· cells, Fig. 12(8), p<〇5. Furthermore, in vitro assays of the invasive ability of the substrate f-transfer disk showed that CD133+ cells had a higher invasive ability than CD133· cells, Fig. 12(b), p<0.05. CD133 cells have better tumor colony forming ability when planting the same number of cells on soft gel, Figure i2(c), p<〇5. In order to further confirm the ability of CD133+ and CD133-cells to produce tumors in vivo. CD133+ _ cm33- cells with different cell numbers (300, 103, 3χΐ〇3, 104) were injected into the basal layer of the brain of immunocompromised mice. The results of Table 6 show that even if 1 4 CD133- cells were injected into the mice, tumor formation could not be caused. However, as long as 3 来自 CD133+ 37 1360576 from patients • Supplementary correction of cells on November 2, 100 can promote the formation of tumors, the data is shown in Table 6. Tumor cells reduced to one-quarter of 300 CD133+ cells still have the ability to cause tumorigenesis. The data are shown in Table VII. See also Figure 12(d) No. 2 patient. Furthermore, 1000 CD133+ cells isolated from the brain of the transplanted mouse brain can further cause the formation of new tumors (also known as secondary tumors, and this part of the data is not presented). To further investigate whether CD133-AT/RT can form tumors after transfection, a higher dose of cells is used to infuse the brains of eight-week-old immunodeficiency mice. The results of the test were '1〇5 tumor-separated cells of the fourth patient (the tumor cells isolated from other patients did not have such a phenomenon) can induce the formation of brain tumors in immunodeficiency mice, and the dose was increased to 1Ό6 cells. Tumor-derived cells from four sample sources can induce tumor formation, see Figure 12(d) and Table 8. Table 8. CD133+ cells derived from four AT/RT patients and CD133-cells WsN0D _ Allogeneic transplantation analysis of mice with immunodeficiency to observe the frequency of tumor formation in the four patients _ the number of cells injected 300 103 104 105 106 CD133+ 25% 100% 100% 100% 100% CD133* Nothing 25% 100% In addition, 'for the observation of the characteristics of stem cells from AT/RT sub-CD133+ or CD133-cell population, we target The ability to spheroid bodies (SBs) and the differentiation of multiple cell systems was tested. The isolated subpopulation of cells was cultured in DF_12 serum-free medium containing beta fibroblast growth factor and epidermal growth factor. After four weeks of culture, CD133+ cells aggregate and form spheroid cells, see Figure i3(a). For the ability to form spheroid cells, CD133+ AT/RT is significantly different from CD133- (p<〇〇5; Fig. 13(b)). The results of immuno- glory staining showed that CD133+_SBs can differentiate into __2 positive reactions (signs of nerve cells) and GFAP-positive reactions (marks of astrocyte glial cells) and the like. See Fig. 1; 3(c). Furthermore, 10,000 CD133+_SB cells were injected into the brain of immunocompromised mice. After 6 weeks, pathological analysis indicated that the teratoma-like tissue had formed at the injection site, Fig. 13(d). Importantly, we can see the development of the three germ layers by the Sumu purple-eihong staining method, 38 1360576: November 02, 100 supplementary correction including the endodermal layer of Fig. 13(d), Fig. 12 (d 3 teratoma tissue, Figure 12 (the mucosal layer of the phantom 4, the cartilage-like tissue of Figure 5 (d), and the neurogenic epithelial of the figure of Figure 12 (d). Conversely, even if it is surrounded After serum-free combination of beta-fibroblast growth factor and epidermal growth factor, CD133-only a few spheroid cells can be formed. In vitro, CD133-can not differentiate into multiple cell systems (Fig. 12 (c )), and the teratoma-like tissue could not be produced in the internal test. This part did not provide experimental data. Combined with these data, we can get the following conclusions from the AT/RT patient tissue with Cells expressing CD133 surface molecules can exhibit the characteristics of tumor-like stem cells. φ In vivo or in vitro tests to detect the radiation sensitivity of cells To confirm the effect of radiation on tumor growth rate, use a dose from 〇 to 1〇Gray Free radiation As shown in Fig. 14(a), after radiation treatment, the survival rate and the number of cells of CD133+ are higher than those of CD133, and the data has statistical significance, p value < 〇〇 5. To confirm the body The effect of part of the radiation on the proliferative capacity of CD133, immunodeficiency mice = CD133 cells were injected into the brain of mice every other week after radiation irradiation. Also after radiation treatment, 0) 133+ tumor volume ratio CD133-tumor The volume has a significant increase. Moreover, CD133+ cells had no significant difference in tumor growth rate between tumor growth and non-radiation-treated mice even after radiation treatment in immunocompromised mice, P value > 0.05, data Not presented. Furthermore, the elapsed cell counter and immunohistochemical analysis were used to judge the ability of AT/RT patients to exhibit CD133+ after treatment. As shown in Table 7, patients with '2, 3, 4, 7 and 8 received complete radiation and chemotherapy. However, the tumor recurred and the five patients subsequently underwent a second tumor resection. Figure 14 (10) c) shows that the percentage of CD133+ in tumor recurrence in five patients is significantly higher than that in CD133+ isolated from the first tumor. See also Figure 14 (φ and Table VII. In addition, the efficiency of treatment is 9 There was a negative correlation between the survival rate of the AT/RT patients and the amount of the coffee 33+, P<0.〇5, as shown in Table 7. Throughout, these can support the following arguments, AT/ There is a positive correlation between the ability of patients with RT and the presence of C on the surface of the molecule or the ability of the tumor to fight radiation therapy/chemotherapy. 39 1360576: Supplementary amendment CD133 /-AT on November 2, 100 /RT cells were subjected to radiation treatment, and the expression of 1494 genes was analyzed by microarray wafers against cell degeneration, cell cycle and deoxynucleotide repair gene cluster. After radiation treatment, CD133+ cells were compared with CD133· cells. The performance of the gene bundles was significantly different whether it was 0.5, 2, 6, u or 24 hours after treatment, refer to Figure 15 (3). The profile of the 1494 genes and time-dependent performance, using GeneSpring The software is combined with the K-means algorithm for analysis. Figure 15 ( b) The results indicate that 'the same is the radiation-treated cm33+ cells and cd133· cells, the gene expression between the two, a total of 327 gene expression was detected to have a significant difference. And the expression of CD133 cells is The other two times more (upward regulation) or 疋CD133 cells are less than 0.5 times the other (downward regulation), which is defined as a significant difference. The above differential genes can be divided into three The population is (1) anti-apoptotic or apoptotic genes; (2) cell cycle-related genes, and (3) deoxynucleotide repair-related genes. The data is presented and analyzed using GeneSpring GX Gene. Tree Clustering, see Figure 15(c). Subsequent use of timely reverse transcription polymerase chain reaction to confirm microarray wafer data. We found that CD133 cells exhibited BCL at 0.5, 2, 6, 12 or 24 hours. The ability of -2 and BCL-XL was affected by up-regulation, as shown in Figure 19. However, CDKN1A (the expression of p21 myeloid gene in CD133+ cells, also at the 0.5 and 2 hour time points after radiation treatment) showed upward regulation; At the next time points 6, 12 and 24 hours, it is a downward regulation phenomenon, as shown in Fig. 19. Moreover, the expression level of TP53BP1 in CD133+ cells will rise slowly after two hours of radiation treatment until 24 hours, such as Figure 19. In addition, the results of Western blot analysis are similar to those of previous genes, and the data are not presented. Therefore, with cell cycle, cell growth, transcription signals, anti-cells, weekly death, and cell death Different expression levels of related genes may induce a message cascade leading to cell cycle reactivation, inhibition of cell proliferation and deoxynucleotide repair, and finally, radiation-treated CD133+ cells undergo cell repair, regeneration or mutation. phenomenon. What's more, 'we use MEDLINE's all documented literature for network analysis. Supplementary correction of 1360576 微 after microarray wafer experiment using Natural Language Processing (NLP)

100 years November 02 Data are grouped according to target system genes. We isolated 37 literature-based, network genes that are associated with radiation therapy, as shown in Figure 14(d) and Table VIII below. Of the 37 genes in Figure 14(d), 19 are genes marked in light gray, while the co-expression genes (I set from PubGene) are noted in dark gray. The results of the literature system analysis supported the data of the microarray wafers, confirming that the expression of CD133 is closely related to the genes involved in anti-apoptosis, cell cycle regulation, and deoxynucleotide repair. Table IX, gene name and proxy gene pronoun ATR ataxia telangiectasia and Rad3 related BAX BCL2-associated X protein BCL2 B-cell CLL/lymphoma 2 BIRC2 baculoviral IAP repeat-containing 2

CDC25C cell division cycle 25C CDK2 cyclin-dependent kinase 2 CHEK2 CHK2 checkpoint homolog (S. pombe)

CST6 cystatin E/M CYCS cytochrome c, somatic DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 MCL1 myeloid cell leukemia sequence 1 (BCL2*related) MDM2 Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse PAK1 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast) PROM1 prominin 1 RAD 17 RAD17 homolog (S. pombe) RAD23A RAD23 homolog A (S. cerevisiae) RHOC Ras homolog gene family, member C TP53 tumor protein p53 (Li-Fraumeni syndrome) TP53BP1 tumor protein p53 binding protein, 1 ANTXR1 Anthrax toxin receptor 1 ATM ataxia telangiectasia mutated (includes complementation groups A, C and D) BAK1 BCL2-antagonist/killer 1 BCL2L1 BCL2-like 1 CHEK1 CHK1 checkpoint homolog ( S. pombe)

H2AFX H2A histone family, member X IL2RA interleukin 2 receptor, alpha LOC440361 similar to Ig heavy chain V-lll region VH26 precursor MKI67 antigen identified by monoclonal antibody Ki-67 MMAB methylmalonic aciduria (cobalamin deficiency) cbIB type MYC v-myc myelocytomatosis viral oncogene Homolog (avian) NBN nibrin, label Hs.27179T hs.631546 Hs. 150749 Hs.643515 Hs.656 Hs.19192 HS.291363 Hs. 139389 hs.437〇6〇Hs.484288 Hs.632486 hs.5673〇3 Hs. 435714 hs479220 Hs.16184 Hs.440960 Hs.502659 Hs.4〇8312 Hs.440968 Hs. 165859 Hs.435561 Hs.485139 Hs.516966 Hs.24529 Hs.477879 . Hs.467891 Hs.512293 Hs.80976 Hs.121 〇6 Hs.202453 Hs.492208 41 1360576: November 02, 100 Supplementary amendments PRSS3 protease, serine, 3 (mesotrypsin) Hs. 128013 RET ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) Hs .350321 SERPINA2 serpin peptidase inhibitor, dade A (alpha-1 antiproteinase, antitrypsin), member 2 Not found

Hs.584811 Hs.2030 Hs.241570 TG thyroglobulin THBD thrombomodulin TNF tumor necrosis factor (TNF superfamily, member 2) In vivo and in vitro experiments confirmed that CD133+ AT/RT cells increased phosphorylation of ATM-related proteins and BCL-2 protein after radiation exposure The increase in performance compared the two subcellular populations from ΑΤ/RT, the early ATM-related deoxynucleotide damage response to observe CD133+ radioresistant AT/RT cells with their deoxynucleotide checkpoints The reaction. In addition to the microarray results, the activation of checkpoint protein phosphorylation, the expression of p-ATM, p-RAD17 and p-CHK2 phosphorylated proteins in CD133+ cells were significantly higher than CD133·, see Figure 16(a). . The results of this experiment show that the reaction of CDA+ cells with deoxynucleotide damage has better checkpoint activation. Immunofluorescence analysis indicated that CD133+ cells exhibited significantly higher BCL-2 protein than CD133-, p<〇.〇5, see Figure 16(b). It is worth mentioning that CD133+ cells have higher endogenous BCL-2 expression even without radiation treatment, while phosphorylated proteins p-atm'p-radp and P-CHK2 are also highly expressed. 'See Figure 16 (a) and (b). We have further found that BCL-2 up-regulation can increase radiation resistance and increase the anti-apoptotic properties of CD133 after radiation treatment. 1 μg/ml of cisplatin (Cisplatin), 1 〇〇Ng/ml of TRAIL, or both of the above drugs were given to the CD133 cells after radiation exposure. As shown in Fig. 20 (8), the cell viability of the CD133+ cells treated with radiation is not significantly reduced by the administration of cisplatin. Furthermore, even if TRAIL is not added or added, the difference in results will not be caused. Sex. Conversely, the survival rate of CD133· cells was significantly reduced after treatment of cisplatin, see Figure 20(a). Radiation therapy with cisplatin, TRAIL or both cisplatin and TRAIL, CD133· cells will increase the activity of the cell death enzyme 3 but the CD133+ cells receive the same treatment but there is no such phenomenon, see Figure 2〇(b) . We would like to further observe whether the in vivo test also has such a result. The immunized mice were transferred to 42 1360576: On November 2, 100, the CD133+ and CD133· cells were supplemented with radiation, and then cisplatin was added for treatment. Figure 15 (c) shows the results of immunohistochemical analysis showing that p ATM (Fig. 15(d)) and BCL-2 (Fig. 15(e)) have improved in both cell populations. The effect, but the lifting effect of CD133+ cells is higher than the other. In addition, using the in vivo green fluorescent protein imaging system to present tumors, the tumor volume of CD133 cells cannot be treated by radiation alone, cisplatin alone, or radiation/cisplatin combination therapy as effectively as CD133· cells are treated. Reduce the role of tumors 'see Supplement 3C. Finally, Kaplan-Meier survival analysis indicated that the survival rate of the irradiated/cis-treated CD133+ cell mice was lower than that of the same treated CD133-cell group. Checkpoint stimulation inhibitors and BCL-2 short-interference nucleotides can enhance the sensitivity of cdi33+ AT/RT cells to radiation. CD133+ AT/RT cells ATM pathway protein phosphorylation and increased BCL-2 expression in the cells Why color? We treated cells with debromohymenial disne (DBH, checkpoint kinase inhibitors at a concentration of 3 mM; Calbiochem, USA) alone or with BCL-2 short interfering nucleotides' Figure n(a). The results of this experiment indicate that the effect of radiotherapy on CD133+AT/RT cells can be enhanced by the addition of DBH, either alone or in combination with BCL-2 short interfering nucleotides, Figure n ( a). Compared with CD133+ AT/RT cells treated with pure radiotherapy alone, DBH treatment alone or DBH combined with BCL-2 short interfering nucleotides can significantly inhibit the metastasis/invasive ability (Figure 17). (b)) and the formation of tumor lesions (see Figure 17 (c)). The above data indicate that the resistance of CD133+ at/rt cells to radiation is partly due to the activation of checkpoint kinases and Bd_2 proteins. Further in vivo experiments confirmed the ability of CD133+ AT/RT cells to proliferate and radiosensitivity. The eight experimental groups were CD133+ cell group, CD133-cell group, CD133+ cell group treated with radiotherapy alone, and CD133-cell treated with radiation alone. Group, DBH-treated CD133+ cell group, DBH/radiation co-treated CD133+ cell group, DBH/BCL-2 short interfering nucleus 43 1360576 100 years 丨January 02 supplemented with modified glucosinolate co-processing CD133+ group and DBH/BCL-2 Short interfering nucleotide/radio triple treatment of CD133 cell group. The cells prepared by the above different treatments were each injected into the immunocompromised mice from the tail vein to detect the formation of allogeneic tumors. Treatment of CD133 cells with radiation either or even increased the treatment of BCL-2 short interfering nucleotides, compared with untreated CDI33, cells and CD133+ cells treated with radiotherapy, the tumor formation and volume were significantly reduced, p&lt ;0.01, Figure 18 (a). It is worth mentioning that the Kaplan_Mder survival analysis also pointed out that the average of the survival rate of the CD133+ cell group treated with βΗ/radiation and the CD133+ cell group treated with DBH/BCL-2 short interfering nucleotide/radiation double treatment were significantly higher. The CD133-cell group and the CD133+ cell group treated with radiation alone were longer, p < 〇〇 1, Figure 18 (b). In addition, the results of in vivo experiments also showed that chemotherapy for CD 133+ cells can be achieved by increasing BCL_2 nucleus interference. From the above data, it is known that targeting p_ATM or BCL_2 in CD133+ cells will improve the therapeutic effects of fatal diseases such as AT-RT. Example 6: Identification of Tumor Stem Cells Materials and Methods Isolation of Stem Cells from Normal Tissues Hole cultures are now coated with fibronectin at 5 ng/ml, as indicated by B1. Planting normal cells in the holes makes the cells reach eight points. Squamous cell culture medium containing DMEM/F12 'N2 additive, 1 〇, epidermal growth cells, Nike/ml beta fibroblast growth factor, 1 μg/new, 2 lactoferrin, 1% antibiotic, cells During the culture period, the fresh & liquid is changed every three days to observe the spheroid cells with initial cell formation, that is, the new outer sputum is placed, and the 20% transfer disk is used to pass the cell sphere through the chemical chemotactic trait. At the bottom of the transfer tray, the hole of the bribe hole is transferred, and the lion wears a layer of water-filled layer of fresh pores and a polymer mesh membrane to reach the human basement layer. 1360576 100 years of the next month, 02 曰 Supplementary corrections Primary tumor cell sphere culture • OSCC tumor samples from donated patients. After washing, the tumors were subjected to tissue separation according to the method described by Lin sc et al., j Oral Pathol Med., 448 (2007) 79-86. The tumor cells are then suspended in a serum-free cell culture medium containing serum-free DMEM/F12 medium, N2 supplement, 10 ng/ml of human recombinant beta fibroblast growth factor, and 1 〇. Nike/ml epithelial cell growth factor. Real-time reverse transcription polymerase chain reaction (Real-time RT-PC!R> ® Purification of primary cultured cells to obtain total nucleotides first. In short, each sample of 丨 milligrams of total nucleotides is reverse transcriptase polymerase Superscript II RT (Invitrogen, Carlsberg, California, USA) for reverse transcription. Then, the amplification reaction was carried out in a total volume of 20 μl. The 2 〇 microliter reaction solution contained 0.5 μΜ positive and negative reaction primer, 4 mM magnesium chloride. 2 μl of LightCyclerTM-FastStart DNA Master SYBR green I (Roche Molecular Systems, Alameda, California, USA), and previously prepared 2 μl of cDNA. In individual experiments, magnification was based on housekeeping gene-GAPDH The GAPDH primer sequence is GAPDH (positive strand): GGGCCAAAAGGGTCATC ATC (nt 414-434, GenBank accession no. BC059110.1). GAPDH (anti-strand) ATGACCTTGCCCACAGCCTT (nt 713-733) ® Experiment with two replicates, heated to 95. (: After 10 minutes of maintenance, start 4 repeated reaction procedures, each of which is denatured at 95 ° C for 1 〇 seconds, adhesion 55. (: lasts 5 seconds and Long-acting at 72 ° C for 20 seconds. Flow cytometry analysis to identify cell surface markers, single cell suspension after cell pellet treatment was reacted with antibodies against CD133, CD117 (c-Kit) and ABCG2, and then Marked with secondary antibodies to fitc or PE (Dako, Carpinteria, California, USA). The instrument for analysis is a FACS Calibur device (Becton Dickinson, San Diego, CA, USA 45 1360576: Supplementary amendments dated November 2, 100) The cell viability test for radiation treatment was conducted with Theratronic cobalt unit T-1000 (Theratronic Inte, Inc., Ottawa, Canada) to deliver gamma radiation (ionizing irradiation; IR) at a dose of 1.1 Gy/min. (SSD = 57.5 cm). The cells were seeded in a 24-well culture dish with a cell density of 2 X 1 4 cells/well. MTT analysis (Sigma-Aldrich Co) was performed 24 hours after radiation treatment. Cell viability test cells were seeded in 24-well culture dishes at a cell density of 2 X ι 4 cells/well. MTT analysis (Sigma-Aldrich C〇) was performed 24 hours after treatment with different concentrations of chemotherapeutic drugs. Chemical drug cells include cisplatin, γρ-16 (etoposide; etosopide), doxorubicin, and paclitaxel (paditaxel). Tumor formation analysis in vitro - soft gel test Each well of a six-well cell culture plate (35 mm) was covered with 2 ml of a bottom gum mixture, the bottom gum mixture, the main component was DMEM, containing 1% by volume (volume ratio) Calf serum, hoarding ratio) colloid. After the bottom knee was formed, it was covered with 2 ml of the upper kick mixture, mainly containing 10% (by volume) calf serum, 〇.3% (by volume) of colloid, and 2 χΐ〇 4 cells. The culture plate was placed in a grasping environment for 4 weeks. The plate was counted after staining with 5% 5% crystal violet. Statistical analysis was performed using Student's t test. Tumor formation analysis in sputum 1360576 November 02, 100 Supplementary correction of stem cells and 5X106 cell number of the above two kinds of cells mixed, ^ size, swollen ship Na Butterfly (strip width % ~ rewards quasi-tumor statistical analysis 3. The G version (spss, ^., Chicago, _ for statistical analysis 2. Using independent Student, s τ check or Na has always analyzed the continuous differences between groups and the X test is applied to the comparison of the difference between the two groups. Kaplan_Meier The method was used for survival analysis, and the log-rank assay was used to compare the survival time of different patient groups. For all experiments, statistically significant differences were set at 0.05. Results Normal stem cells were isolated from normal tissues. The device is subjected to separation from normal _ dry sputum. The stereoscopic 30-cell spheroid formed by the observing cells is placed in a freshly prepared transfer tray, using chemical chemotactic traits. The 3D cell sphere passes through the outer side of the bottom of the transfer disk, and then passes through the hole of the dragon-resistant hole of the transfer disk, and then passes through the porous, polymer-like membrane-like temperature-sensitive water-repellent peeling layer to the Base film layer. Figure 21 dd control group, refers to the cells that have not been screened by the device after the same culture conditions and time, the cell type is the bottom of the cell. da, db, dc via The cells isolated by the device. It is apparent that the 'screened cells all exhibit the shape of the spheroid cells. The tumor stem cells are isolated from the tumor tissues. Figure 22 is a stereoscopic 3D spheroid cell formed by isolating tumor cells from different tumor tissues. Tumor tissue including brain tumor, oral tumor, head and neck tumor, breast tumor, stomach tumor, pancreatic tumor, liver tumor, kidney tumor, gallbladder tumor, rectal tumor, prostate tumor, ovarian tumor, 47 1360576: November 100 On the 02th, the phenomenon of stereoscopic 3D spheroid cell formation was observed in tumors isolated from the lungs. Figure 22(c) further confirmed by experiments that even if the parental cells from two different sources, the derived tumor stem cells Or the ability of non-tumor stem cells to form stereoscopic 3D spheroid cells, and there is no significant difference between them. The gene family of embryonic stem cell genes Detecting primary cells / amount of expression of stem cell genes, genes of pre-detection, such 〇ct_4, 〇ct_4A,

Nanog, Nestin, Sox-2, Mushashi, C-Myc, beta-CAT, Brtiil, MDR-1, MRP-1, ABCG2, and Klf4' are shown in Figure 23. CD133 is a molecular marker currently known to be useful as a stem cell marker. The results of the experiment showed that the cells with positive CD133 expression showed an increase in the above-mentioned gene expression. Confirmation of initial cell/stem cell characteristics of the isolated cells To further confirm the characteristics of the initial cells/stem cells of the cells after activation, we used a flow cytometer to detect the cell surface marker molecules of the initial cells/stem cells. As shown in Fig. 24(a), the tumor stem cells all expressed surface molecules of CD133, ABCG2, and CD117 (c-Kit). The two surface molecular markers CD133 and CD117' are cell surface markers of general stem cells or tumor cells. Interestingly, the isolated cancer stem cells also exhibited ABCG2. Even if selected from different parental cell sources, there is a similar trend, see Figure 24(b). In addition, the amount of ALDH enzymes and the production of marginal cells can also be echoed by the production of cancer stem cells. It was confirmed by in vitro invasion ability test and soft gel lesion formation test that the isolated tumor stem cells have the effect of improving tumorigenicity. To evaluate the isolated tumor stem cells, whether the tumorigenicity is changed, we performed the in vitro basement membrane gelation. Transfer plate assays, as well as soft gel cell colony formation assays. The isolated cancer stem cells showed high invasive ability against the invasion test of the transfer disk, Fig. 25(b), p value < 0.05. 48. 1360576 • · November 2, 100 Supplementary Correction Interested in the lesion formation test, the isolated cancer stem cells also have better colony forming ability. These phenomena can be examined in tumor cells from different sources. In vivo test for tumorigenicity of 〇C-SLCs* For further screening, it is confirmed that cancer stem cells also have the effect of enhancing tumorigenicity in vivo. 'Tumor stem cells and non-tumor stem cells are injected into nude mice for transduction. Tumorogenicity analysis. Figure 26 (a) After the tumor-transplanted mice sacrificed, the actual form of the lungs was observed, and the group of tumor stem cells was transferred, and the tumors were formed in the lungs. (b) The tumor size of the transplanted mice was measured. The results showed that the tumor stem cells with lxl〇4 cell counts had a significant tumorigenic effect when they were thinned into nude mice. These effects are apparent from non-tumor stem cells or 5χ1〇6 whole cells of lxl〇6 cells. Non-tumor stem cells are also removed from the tumor tissue, but do not form lesions even after 28 days after being transferred into the body of the mouse. Resistance to chemotherapy or electrotherapy Figure = 7 Department of fine blue pure _ material contribution _ shooting degree _ test. (Do not use chemotherapeutic drugs to treat swollen cells or silk of hybrid cells. _ Visible, cancer stem cells in the cells treated with drugs __ alcohol is higher, can be pushed to the test (four) with resistance Figure 27 (b The result of treating tumor stem cells or non-tumor stem cells for different doses of radiation. When the radiation enthalpy is raised to 4 Ge ra, the resistance of the swollen cells can be observed. The slave secret fruit can be inferred __ dry fine method, Selected from the following financial formula, package inspection (8) _ fine secret into _ plus; (b) dry and fine secret milk gamma, ^, version %, : and c-Myc performance changes; (c) specific molecular standard view 33 On the basis of H, it is similar to her scale, she (4) is also eye-catching (4) external tumor detection; (e) the characteristics of heterogeneous pigs in the living body. ___ tumor; and 2 anti-chemical (four) and anti-49 1360576 100 years Supplementary Amendment Example No. 7 of November 02: Control of potential tumorigenesis in vivo by treatment of LC-CD133+ with Oct-4 siRNA In order to observe the effect of treatment of lung cancer LC-CD133+ in chemotherapy radiation by Oct siRNA, green fluorescent protein was used. The gene (GFP) binds to the lentivirus and first infects LC-CD133+, and then the living GFP image and tissue are studied. In order to monitor tumor growth, 1〇4 LC-CD133+-GFP cells were injected into the subcutaneous position of nude mice by different procedures. When the tumor was exposed to IR alone, cisplatin alone or cisplatin, LC was treated with 〇ct-4 siRNA. -CD133+ significantly reduced tumor mass (ρ<〇.〇ι; Figure 28A). In order to further evaluate the ability of LC-CD133+ to invade and transfer tumors with different therapeutic agents, 104 LC-CD133+ from different treatment groups -GFP cells were injected into the tail vein of SCID mice. The results of GFP imaging in vivo showed that LC-CD133+ was treated with 〇ct_4 siRNA and LC-CD133 was treated with -4 siRNA in the lung tumor point and metastatic injury (p&lt 0.01; Fig. 28B). In addition, in order to investigate the effect of 〇ct-4 on LC-CD133+ expression in vivo, the SCID rats were injected into the tail vein for the transplantation of allogeneic tumors in 7 groups (Fig. 28C). Chemical (THC) showed that Oct-4 expression was highly expressed in LC-CD133+ injected SCIP mouse lung cancer compared with other treatment groups (Fig. 28C). When exposed to IR alone, cisplatin alone or IR combined with cisplatin, Oct-4 -IHC content in 〇ct-4 siRNA treatment. LC-CD133 was significantly reduced (ρ <〇.〇1; Figure 28C). In addition, the average survival rate of the 'LC-CD133+ group in combined chemoradiation treated with 〇ct-4 siRNA was compared with other treatments or controls. The group was significantly prolonged (ρ < 0·05, Fig. 28D). In vivo experiments also confirmed that treatment with 〇ct_4 siRNA improved the treatment of chemical radiotherapy in the LC-CD133+ group. Lentiviral-mediated interfering RNA (Lentivira®-mediated RNAi) The pLVRNAi and pCDH-MCS1-EFl-copGFP vectors were purchased from the Academia Sinica Interfering Ribonucleic Acid Center. The method for cloning the double-stranded interfering RNA is based on the operating manual. The nucleotide sequence of ribonucleic acid is 5,-cCGGCCCrCAeireAC:TGiC:AeT(iTAeTCOACnAeACiTCe AGTGAAGTGAG GGTTTTT-3', which is the target human SirT1 gene (丽_〇〇27〇1, also 1〇35-1〇55) The ribonucleic acid was synthesized and cloned into the vector of pLVRNAi to generate a lentiviral-mediated expression vector supplemented with the modified version of 50, 1360576, November 02, 100. The reverse transcription polymerase chain experiment was used to amplify and purify the Oct. -4 complementary deoxyribonucleic acid (cDNA), then ligated into pCDH-MCS1-EFl-copGFP vector. The vector was transfected into 293T with Lipofectamine 2〇00 (LF2〇00, Invitrogen) to generate lentivirus. After 48 hours, the supernatant was collected and filtered. The titer of the virus was determined by FACS instrument. The infection was repeated with 5 times the concentration of 8 μg/ml polybrene (Sigma-Aldrich) to make lentivirus infection grow. Cell. Radiation treatment analysis of cell survival was performed using Theratronic cobalt unit T-1000 (Theratronic Inte Nucleotidetion, Inc. Ottawa, Canada) to deliver gamma radiation (ionizing irradiation; IR) at a dose of ι·ι Gray/min (SSD = 57.5 cm). The use of in vivo test animals for tumor growth and metastasis follows the guidelines of the Animal Care and Use Committee of the Taipei Veterans General Hospital. To observe the tumor growth and diffusion effects of cancer stem cells, 1000, 3 and 2 X 〇 4 cells of cells were injected into the vein of an 8-week-old SCID mouse. Using a fluorescent device (LT_95〇〇niumat〇〇1 TLS with nanoradiation source and 515 nm filter disc) The green fluorescent protein image was observed and detected in the body. The volume of the tumor was detected by a vernier scale, and the tumor volume was calculated as (length X width 2)/2. After taking the optical density of green fluorescence, The statistical analysis of the Pr〇plus software is performed. The data is presented by the value ± standard deviation. The statistical analysis of the dirty T test or the whole test will have statistically significant difference in tumor formation and metastasis. The use of test animals was followed by the guidelines of the Animal Care and Use Committee of the North Rongmin General Hospital. To observe the oral growth and diffusion effects of tumor stem cells in the oral cavity 51 1360576, November 02, 100 '1000, 3000, and 2 X 104 Cells of the number of cells were injected into 8-week-old SCBD mice. The green fluorescent protein was visualized and detected by a fluorescent device (LT-9500 Illumatool TLS with a 470 nm radiation source and a 515 nm filter disk). The volume of the tumor is detected by a vernier scale, and the tumor volume is calculated as (length X width 2)/2. After taking the optical density of green fluorescence, the calculation was performed using Pro-plus software. Example 8: Resveratrol promotes the efficacy of radiation therapy and prolongs the survival time of tumor stem cell allografts Materials and Methods The isolation of cancer stem-like (CD1334) cell subsets was determined from AT/RT tissue. Following the Helsinki Declaration, all samples were obtained in advance and the consent was obtained. The cells isolated from brain tumor samples from patients with atypical teratoma/striated tumors were 1 ml. A CD133 cell separation reagent kit (MACS, Meitian Biotechnology Co., Ltd., Germany) was used, and 1 microbead was used per million cells. CD133-positive cells were cultured in serum-free DMEM/F12 medium (GIBCO) supplemented with N2 supplement (R&D), 1 〇N/ml of human recombinant beta fibroblast growth factor (R& D), 1 〇N/ml of epithelial cell growth factor (R&D). The gamma radiation (free radiation, i〇nizing _ irradiation; IR) was transmitted by Theratronic cobalt unit T-1000 (Theratronic Inte Nucleotide, Inc. Ottawa, Canada). The dose was U Gray/min (SSD=57 5 cm) In order to evaluate the rate of cell proliferation, the cells were seeded in a 24-well culture dish at a density of 2×1〇4 cells/well, and then subjected to MTT assay (Sigma-Aldrich Co), followed by a microdisk reader ( SpectraMax 25〇,

Molecular Device, Sunnyvale, California, USA) determined the yield of mash products with a absorbance of 560 nm. Timely reverse transcription polymerase bond reaction The immediate reverse transcription polymerase bond reaction is based on the method of 9〇ncogene (2〇〇7) 26.14559 I467 published by Yang et al. Briefly as follows, each sample uses a whole nuclear micro (] microgram) 52 1360576 November 2, 100 supplementary correction for reverse transcription, the reaction volume is 2 〇 microliters, containing 微 5 micrograms of 〇lig〇dT and 2 〇〇 International Unit of Superscript IIRT (Invitrogen, Kalbes, CA). The primer sequence is shown in the following table - the total volume of the sequence amplification reaction is 20 μl, containing 〇5 μΜ of the primer, 4 mM of chlorinated money, and 2 μl of [CurroTM-FastStart DNA Master SYBR green I ( R0Che Molecular Systems, Alameda, Calif.) and 2 μl of 1 〇 diluted cDNA. The polymerase chain reaction was carried out in two replicates and after heating to 95 ° C for 1 minute, four replicate reaction procedures were initiated, each of which was denatured 95. 〇 lasts for 1 second, sticks for 5 seconds, and extends for 2 seconds. Each sample has a target gene and a standard curve for the endogenous reference (GAPDH) (cycle threshold and template concentration). Quantification of unknown samples was quantified using LlghtCycler Relative Quantitative Software Version 3.3 (Roche Molecular Systems, Alameda, CA). Analysis of cell invasion ability and soft gel test for external test A 24-well transfer plate Transwdl8 (c〇ming, UK) with a polycarbonate resin filter of 8 μm pores was used to evaluate the invasive ability of the cells. The filter membrane is covered with a base film glue layer MatrigdTM. The tumor cell suspension was placed in the chamber above the transfer plate, and the cell density was 丨χ1〇5 cells, eight liters of microliters of serum-free medium. A serum-free medium is also added to the lower chamber. After 24 hours of culture, the culture solution was removed, and the filter was fixed with 4% Formalin for 1 hour. Thereafter, the adherent cells facing the lower chamber membrane surface were stained with 33342 for two minutes. The transferred tumor cells were observed under an inverted microscope, and after magnifying 100 times, 5 different viewing zones were selected for counting. The method of soft gel analysis is as follows: 'Every hole (35 mm) of the six-well cell culture plate is covered with 2 ml of the bottom glue mixture. The bottom part of the mixture is DMEM, containing 1% by volume (volume ratio). Calf serum, 〇 6% (volume ratio) colloid. After the bottom colloid was formed, it was covered with 2 ml of the upper gel mixture. The main component was DMEM' containing 10% (by volume) calf serum, 〇 3% (by volume) colloid, and 2 χ1〇4 cells. The culture plate was placed in a 37 C environment for 4 weeks. The plate was counted after staining with 5% 5% crystal violet for one hour.

Enzyme-linked immunosorbent assay (ELISA) and DNA 53 1360576, November 2, 100, supplemented with terminal dUTP nick-end labeling (TUNEL) test with enzyme immunoassay test group (Medical & Biological Laboratories Co., Ltd., Nagoya, Japan) to detect the activity of apoptotic enzyme 8 and apoptotic enzyme 3. The quantitative reading was set at 490 nm (model: MRX 'Dynatech Laboratories, Chantilly' Virginia, USA). Three replicate analyses were performed for each individual sample. Furthermore, apoptotic cells were read using the DNA end-transferase marker (in situ cell death detection reagent, Roche Boehringer Mannheim Corp, Indiana, USA). The method of detection is as follows. The cells on the coverslip are first washed with double the phosphate buffer solution, and then fixed with 4% trimeric furfural for 1 minute, and TritonX-ΙΌΟ of 〇·ι〇/0 for 5 minutes. It was then reacted with TUNEL reagent for 1 hour. 3-Ammonia-9-ethyl scented to make it color, and finally the slide was subjected to background staining using H&E. Lu's intratumoral test for tumor growth and metastasis The use of animals follows the guidelines of the Animal Care and Use Committee of the Taipei Veterans General Hospital. To observe the tumor growth and proliferation effects of oral cancer stem cells, 2×1〇4 cells of CD133-positive AT/RT cells and CD133-negative AT/RT cells were injected into the mouth of eight-week-old BALB/c nude mice. In the mucosa. The green fluorescent protein image was observed and detected by a fluorescent device (lT_95〇〇 mumat00l xls in conjunction with a 470 nm radiofluorescent light source and a 515 nm filter disk). The volume of the tumor was detected with a vernier scale, and the tumor volume was calculated as (long product X width 2)/2. After taking the optical density of the green fluorescent light, the pro_plus software was used for calculation and analysis. Statistical analysis Results were averaged ± fresh 1 for scale n阙 · analysis of lion Student, s τ test or

Turkeys 攸 fresh tail or two-tailed ANOVA training ^ (4) experiment, the significant difference in the observation is set at p < 0.05. 5.4 100 years 丨 January 02 Supplementary corrections Results Evaluation of the effect of resveratrol on the cytotoxicity of cancer stem cells Recently, resveratrol was indicated to have the effect of inhibiting the growth of tumors. However, there is currently no laboratory needle, whether white curcumol can inhibit tumor stem cells derived from brain tumors and have cell-like properties like swollen age. In order to find this answer, the cancer stem cells were treated with different doses of resveratrol (〇, 1〇, 5〇, 1〇〇, (9), ^ 25〇μΜ), and the cell survival was detected by MTT assay. I, as shown in Fig. 29 (a), the tumor stem cells were treated with different doses of resveratrol for μ hours, and the cell viability was not affected when the concentration of ruthenium ruthenium was less than 50 micromolar. When the reaction group was observed for 48 hours, the survival rate of tumor stem cells was reduced by 20 to 25% when the concentration of lysine was higher or higher. When the concentration was increased to 15 〇 micromolar concentration, the cell viability was reduced by 4%. Tumor stem cells were treated with a molar concentration of self-lysine for 48 hours, and the growth rate was only slightly reduced after comparison with the control group. When the concentration of resveratrol was increased to 2 〇〇 micromolar concentration, the number of cells in the whole tumor stem cells was significantly reduced, and the growth rate and rate of cell proliferation of the experimental group were also the same. Significant reduction trend, see figure). The morphology of the cells was observed directly by microscopy, and untreated tumor stem cell groups and tumor stem cells treated with 2 μM of micromolar concentration for 48 hours were revealed. The results showed that the resveratrol-treated group formed spheroid-like tumor stem cells and was single-suspended. Resveratrol treatment of cancer stem cells can enhance the sensitivity of cells to radiation treatment. Resveratrol regulates the growth of cancer stem cells. We want to further observe whether resveratrol can also be used as a radiation increase against cancer stem cells. Sensitizer. The effect of treating tumor stem cells with radiation is a & value < 〇〇 1, which can be significantly improved by the treatment of increasing resveratrol, see Fig. 30 (a)). Compared with radiation treated alone, 'the treatment of resveratrol alone or in combination with radiation' has a significant increase in the ability of metastasis/invasiveness (see Figure 3〇(c)) and the formation of tumor cell populations (see Figure 29 (d)). Moreover, when resveratrol at a concentration of 200 micromolar is used, the ability of tumor stem cells to form tumors can also be suppressed in an in vivo test, as shown in Fig. 3(c). Our knot•55' 1360576 November 02, 100 supplementary correction results show that resveratrol can effectively inhibit the proliferation and tumor formation of cancer stem cells, and in this experimental group, we also found resveratrol The sensitivity of the cells to radiation can be significantly enhanced. Cholesterol increases the ability to treat cell-induced apoptosis due to radiation. A recent study indicates that resveratrol can promote glioma cells for apoptotic responses. To confirm whether resveratrol can promote the apoptosis of cancer stem cells, and further improve the efficacy of radiation therapy, we use enzyme immunoassay to detect the activity of apoptotic enzymes 3 and 8, while the TU1SEL test Can be used to confirm the overall apoptosis. We found that the apoptotic activity of calcium-dependent phospholipid-binding protein (Annexin V) and the activity of apoptotic enzyme 3 in the cells treated with resveratrol for 72 hours can be enhanced. In addition, the formation of apoptotic bodies was also observed as a result of TUNEL analysis (see Figure 3 (b)). Moreover, resveratrol not only promotes the increase of apoptosis, but also promotes the effect of radiation-induced apoptosis, as shown in Figure 30(b). In vivo tests to verify that the resveratrol treatment group can promote the improvement of radiotherapy and prolong the survival time of tumor stem cell allogeneic in order to further confirm the radiosensitivity and anti-proliferation of resveratrol to cancer stem cells in vivo. The experiment of the age of the 'five groups' was used to inject the tumor stem cells by intravenous injection, and the results of tumor formation were confirmed using a xenogenic colonization tumor formation assay. The five groups were: cancer stem cell group (control group), non-tumor stem cell group, cancer stem cell group treated with radiation alone (dose selected 2 Ge ra), tumor stem cell group treated with resveratrol alone, and radiation and Baili Resin co-treatment group. The results showed that compared with the tumor stem cell group (control group) and the cancer stem cell group treated with radiation alone, the volume of tumors in the radiotherapy group and the radiation treatment group was significantly reduced (P value < delete, see Fig. 3〇 ( c)). It is worth mentioning that (4) 撼 撼 ^ survival analysis results of the age of 'her in, swollen fine touch (test) and single thief Li Lin's cancer stem cell group, ageing and resveratrol The recurring time is fine and the secret is extended 56 1360576 loo years 丨 January 〇 2 days supplementary correction <0.01, see Figure 30 (d)). In order to confirm that imitol can be used as a future treatment for cancer stem cells, we observe the time-dependent and dose-effect response of autologous alcohol production to inhibit tumor stem cell growth, see Figure 4 (4). Pretreatment with erythritol significantly reduced the cell viability of cancer stem cells due to radiation therapy (see Figure 29 (c&d)). The white violent alcohol treatment group can effectively enhance the cell's radioactivity recording, and activate the cells through the cell death process of the receptor tank protein binding protein (Annexin V), the death enzyme 3, and the growth of the body (see Figure 3 (a & b)) » Furthermore, the experimental indicator of xenogeneic colonization of tumors, resveratrol will reduce the proliferation of cancer stem cells, and further inhibit the tumor reset (plus monestorhon) or tumor formation φ effect ( See Figure 30(c)) The KaPlan-Meiei·survival analysis indicated that increasing the treatment of resveratrol can improve the effect of cancer stem cells on radiation therapy, see Figure 29(d). The above results can be used to support resveratrol for the effective anti-proliferation, apoptosis-promoting treatment of cancer stem cells, and as a radiosensitizer. Moreover, resveratrol has the potential to be developed for therapeutic use in the treatment of malignant tumors or cancer stem cells. Example 9. Inhibition of SirTl gene expression to enhance the sensitivity of tumor stem cells to radiation and to detect programmed cell death. Methods and methods for the isolation of cancer stem cells. The study followed the Helsinki Declaration's full sample to obtain prior informed patients and obtain consent. book. The cells isolated from the patient's sample were 1 ml. A CD133 cell separation reagent kit (Miltenyi Biotech, Aubum, Canada) was used, using 1 microbead per million cells. CD133 positive cells were cultured in serum-free DMEM/F12 medium (GIBCO) supplemented with N2 supplement (R&D), 10 ng/ml of human recombinant beta fibroblast growth factor (R&D) ), 10 ng/ml of epithelial cell growth factor (R&D). • 57 1360576 November 02, 100 Supplementary Correction Flow Cytometry Analysis To identify cell surface markers, a single cell suspension after cell sphere treatment was reacted with antibodies against CD133, CD117 (c-Kit) and ABCG2, and then Identification by secondary antibodies labeled FITC or PE (Dako, Carpinteria, California, USA). The instrument for analysis was a FACS Calibur device (Becton Dickinson, San Diego, CA, USA). Lentiviral-mediated interference with Lentiviral-mediated RNAi to block the expression of the SirT1 gene (knock-do but u) The pLVRNAi and pCDH-MCS1-EFl-copGFP vectors were purchased from the Academia Sinica Interferon Nucleic Acid Nucleic Acid Center. The method of cloning the double-stranded interfering RNA is based on the operating manual. The nuclear interference nucleic acid sequence of the small interfering ribonucleic acid is 5'-CCGGCCCTCACTTCACTGCACTGTACTCGAGTACAGTGC: AGTGAAGTGA GGGTTTTT-3' ' This sequence is the ribonucleic acid of the stem human SirT1 gene (NM_002701, nt 1〇35-1〇55). After synthesis, it is cloned into a vector of pLVRNAi to generate a lentiviral-mediated expression vector. The real-time reverse transcription polymerase bond assay was used to amplify and purify the complementary deoxyribonucleic acid (cDNA) of the SirTl and then access the pCDH-MCS1-EFl-copGFP vector. The vector was transfected into 293T with Lipofectamine 2000 (LF2000, Invitrogen) to generate a lentivirus. After 48 hours of transfer, the supernatant was collected and filtered. The titer of the virus was determined by the FACS instrument. A long-term cell was infected with lentivirus (p〇lybrene, Sigma-Aldrich) at a concentration of 8 μg/ml with an infection repeatability of 5. In vivo testing of tumor growth and metastasis The use of animals follows the guidelines of the Animal Care and Use Committee of the Taipei Veterans General Hospital. To observe the tumor growth and diffusion effects of tumor stem cells, cells of 1000, 3000 and 2 X 104 cells were injected into the veins of eight-week-old SCID mice. The green fluorescent protein image was observed and detected by a fluorescent device (LT_95〇〇 mumat〇〇1 TLS with a 470 nm radiation source and a 5 丨 5 nm filter disc). The volume of the tumor was detected by a vernier scale, and the tumor volume was calculated. The correction degree X width 11 was added on November 2, 100, 100. After taking the optical density of the green fluorescence, the statistical analysis was carried out with ΡΓ〇-software. Material analysis using student, s T test or s疋 fresh tail 妓攸 implicit analysis. At the time of casting, the county has significant values set at p<〇.05. In vivo testing of tumorigenesis and metastasis The use of animals follows the guidelines of the Animal Care and Use Committee of the Taipei Veterans General Hospital. To observe the growth and diffusion effects of oral tumor stem cells, face, fiber, and 2 χ 1 () 4 cell counts/primary eight-week-old SCID mice. The green fluorescent protein image was observed and detected by a fluorescent device (lt_95〇〇 niumat〇〇1 TLS in combination with a 47-nano-radiation fluorescent light source and a 5:5 nm filter disc). The volume of the tumor (10) scale is calculated by the side's collision product formula (length χ width 2)/2. The optical density of green fluorescence was extracted and analyzed by Pro-plus software. Results Inhibition of tumor stem cell SirT! gene expression will attenuate the expression of stem cell gene or drug resistance gene. In order to investigate the role of SirTl in tumor stem cells or tumor stem cells, small interfering RNA is used to achieve SirTl gene silence. The purpose of the transformation. We found that the presence of SirT1 in tumor stem cells can achieve gene suppression by the use of SirTl small interfering nuclear transduction nucleic acids (Fig. 31(a)). The results of real-time reverse transcription polymerase chain experiments showed that the expression levels of ribonucleic acids of stem-like cell genes (〇ct_4, Nanog, Sox-2, KLF-4, and nestin) are shown in Figure 31(b), while drug resistance The degree of expression of the ribonucleic acid of the gene (ABCG2, MDR-1, and MRP-1) is also shown in Figure 31(b). The amount of expression of the above genes in cancer stem cells was improved compared to non-tumor stem cells 59 1360576. These up-regulated stem-like genes or drug-resistant genes are inhibited when tumor stem cells process SirTl small interfering RNA. We have also found that the importance of these changes is that treatment of tumor stem cells with SirT1 small interfering ribonucleic acid interferes with the formation of spheroid cells. In addition, the expression levels of CD133 and ABCG2 were significantly inhibited after seven days of SirTl glucomannan treatment. The results of metastasis/invasive/tumorigenesis analysis showed that the ability of tumor stem cells to metastasize or invade in vitro, or to form cell colonies, was significantly inhibited by the small cell RNA interference of SirT1, p value < .〇〇1. The above results indicate that SirT1 can maintain the role of cancer stem cells in cell renewal and tumor malignancy. Treatment of SirTl small interfering RNA helps to increase the sensitivity of cells to chemotherapy or radiotherapy and increase the activity of apoptosis. The study of SirTl has radiographic resistance during radiotherapy. To confirm the effect of SirTl gene on tumor growth or radiation resistance after treatment of radiation by cancer stem cells, we used radiation doses of 〇 to 1 〇 镭 radium to treat cancer stem cells and non-tumor stem cells. In addition, compared to the untreated group and the negative control group using the mutated sequence small interfering ribonucleic acid (scramble siRNA), the effect of radiotherapy on the sirT1 small interfering ribonucleic acid group can be attributed to the small interference RNA of SirTl. It is significantly improved by use, p value < implementation, see Figure 30 (a). Moreover, we also found that the activity of the calcium-dependent lipobinding protein (A^eynv) and apoptotic enzyme 3 can be activated rapidly and efficiently after 72 hours of treatment of the SirT1 small interfering ribonucleic acid. The results of cell survival of tumor stem cells treated with SirT1 small interfering ribonucleic acid (see Figure 31(b)), the experimental data of western blots can further show the turbidity of pARp-activated form (enzymes) The aging cells can treat SirTl small interfering RNA and silking, and even the chemotherapeutic treatment can increase the sputum. See Figure 31(c). The results of the TUNEL analysis also show the activity of the cell dying, because the cancer stem cells After treatment of SirTl small interfering ribonucleic acid, there is a significant increase in sputum radiation, TMZ (tim _, temosinamide) or both, see Figure 31 (d). Therefore, inhibition of the expression of the Sim gene in cancer stem cells can effectively promote the radioactivity of the cells in response to radiotherapy or chemotherapy. We believe that Sim is a swollen cell. 60 1360576 November 02, 100 Supplementary corrections There are important factors in fighting radiation or chemotherapy. In vivo experiments demonstrate the inhibitory effect of SirTl small interfering RNA-treated tumor stem cell group on its tumorigenic potential

In order to observe the effect of chemotherapy or radiotherapy on the stem cells of SirTl small interfering ribonucleic acid, the lentiviral transgenic gene will be used to express the green fluorescent protein gene sequence into the tumor stem cells, and then the green fluorescence can be observed in vivo. The presentation of proteins and histological experiments allow us to observe the effects of tumor growth. First, we injected tumor cell stem cells with 1 to 4 cell counts and green fluorescent protein into the striatum of the small genus SCID, and then performed different treatments. In contrast to the control group, the green fluorescence imaging of the in vivo test indicated that the volume of the tumor could be treated by the treatment of SkTi small interfering RNA, and then treated with radiation alone, treated separately, or both. Decrease the trend, p value < 〇.01 (see Figure 32 (4)). In addition, shT1 small interfering ribonucleic acid was used in combination with radiotherapy and chemotherapy, and the average survival time of the tumor stem cell group was significantly prolonged, p value < 0.05, see Fig. 32 (d). As a result of this in vivo test, it was further confirmed that the treatment of SirTl small interfering ribonucleic acid contributes to the therapeutic effect of radiotherapy and chemotherapy of cancer stem cells. [Simple description of the map]

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a preparation of the apparatus of the present invention and polyisopropyl propylene. Figure (4) is a device of the present invention. 10 is a layer containing cells, cell adhesion; 20 is a layer of polyisopropyl acrylamide; 3 is a cell movement assisted chemotaxis 4 with a base film glue layer; It is the transfer turntable; (9) is the upper chamber; % is the micro-porosity filter, and 8 inches down. Figure 1 (b) is a preparation method of a polyisopropylacrylamide amine layer. M-series electropolymerization surface treatment; 22 series of polyisopropyl propyl-amine mixtures were added; % was placed in a pit water bath for 1 hour to carry out graft polymerization; 26 was irradiated with ultraviolet light for 24 hours. The invention of the process of rejuvenating the cells. 41 is a serum-containing culture solution; (10) is a sub-, Tian, 101 疋 neurosphere; 110 neural stem cell culture solution (no clear); the mountain is a fine (four) scale bribe for three days, is a god cell culture medium ^ month) cultured for two days' and placed in the upper chamber; 230 is three to seven days of cultivation (10) is to remove the upper chamber, down 1360576, November 2, 100, supplemented with a modified low temperature to separate the layer containing the cells, and 250 is The layer containing the cells is moved to another culture space. Figure 3 shows the initial cell/stem cell gene expression of orai cancer stem-like cells (OC-SLCs) produced by OSCCs cultured and proliferated. (8) SAS, OECM1 cultured in serum-free and primary cultured NHOK cells. The culture medium was a DF-12 serum-free medium, and additional beta fibroblast growth factor and epidermal growth factor were added. a line parental cell; b line cultured for three weeks; c line cultured for four weeks; d line SAS cells; e line OECM1 cells; f line NHOK cells. (b) Total nucleotides purified from the parental cells. The cells are derived from SAS, OECM1 and OSC-OC3 or derivatized OC-SLCs which are less tumorigenic than SAS and OECM1. The expression of individual genes was detected by an instant reverse transcription polymerase chain reaction, and the contents of the observation included Oct-4, Nanog and Nestin. The data is expressed as the amount of expression of the derived C-SLCs compared to the amount of expression of the parent cell, and may also be referred to as the spheroid-like parent cell' as S/p. The experiments were all three replicates' results are expressed as mean ± standard error. Whereg g refers to 〇ct_4; h refers to Nan〇g; i refers to nestin; j-type spheroids are compared to parental cells. (6) The total protein of the parental OSCCs cells or spheroid cells is subjected to an immunological dot test with antibodies against 〇ct_4, anti-Nanog, anti-nestin or anti-GAPDH. The amount of GAPDH protein is considered to be the control of the sample size between different groups. And k-series SAS cells; 1 line OECM1 cells; m-line parental cells; n-type spheroids; sputum refers to Oct-4; sputum refers to Nanog; q refers to nestin; r refers to housekeeping gene GAPDH. (4) Immunofluorescence assay The above stained blocks of anti-Oct-4 antibody, which are listed as staining blocks for anti-nestin. The following are stained blocks against Nanog. The magnification is two hundred times. And m-type parental cells; η-type spheroids; s refers to white light visual field; t refers to DApi-stained visual field; u refers to visual field of specific surface marker molecular fluorescent staining. Figure 4 is an enlarged view of the spheroids separated by the OSCC organization. v refers to the parent cell; w refers to a cell that is activated in a week; X refers to a cell that is activated in two weeks; and 7 refers to a tumor that has been cultured in the first generation. Figure 5 shows the expression of specific marker molecules on the initial cell/stem cell surface of activated cultured 〇C-SLCs, radiation resistance, and differentiation ability of keratinocyte system. (a) Identifying the initial with a lapsed cell counter. 62 v 1360576 November 02, 100 Supplementary correction Cell/stem cell surface-specific marker molecules, including CD133, CD117, and ABCG2. The single cell suspension is a blank control antibody or an experimental group of anti-CD133 antibody, anti-CD117-antibody or anti-ABCG2 antibody. Aa refers to SAS parental cells plus anti-IgG blank control group, . . . ab refers to SAS parental cells plus experimental group specific antibodies; ac refers to SAS activated cultured OC-SLCs plus experimental group specific antibodies ;ad refers to CD133; ae refers to CD117; af refers to • ABCG]; ag is the relative value; ah refers to the second stain; ai refers to the first stain (°) CD133, CD117 or The percentage of ABCG2 positive cells. Aj refers to SAS cells; ak refers to SAS activated cultured OC-SLCs cells; al refers to 0ECM1 cells; am refers to OECM1 activated cultured C-SLCs cells; an refers to positive cells; ao Φ Refers to CD133; aP refers to CD117; aq refers to ABCG2. The experiments were all three replicates and the results were expressed as the mean ± coupling error. (c) Assessing the sensitivity of SAS parental cells to SAS-derived OC-SLCs cells to gamma rays. The experimental method was to measure the number of viable cells in the MTT assay after the cells were treated with the radiation dose of 1 〇 Gray for 24 hours to evaluate the cell proliferation results. The experiments were repeated, the results were expressed as mean ± standard error, * indicates p value < 〇〇 5〇 and the anal refers to SAS activated cultured C-SLCs cells; as system refers to SAS cells; Survival factor; au refers to the radiation dose (Ge ra). (d) Spheroid cells such as SAS-derived OC-SLCs are cultured by replacing the previously serum-free medium with a culture solution containing calf serum. The spheroid cells will present the parental cells in the long-cultured chick-flat system. Av refers to c_SLCs cells; aw refers to one week after culture; refers to culture after two weeks; 吖 refers to culture for three weeks; az refers to CK18 molecular standard®; ba refers to white light visual field; bb refers to overlap Image; be refers to differentiation. Figure _ 6 is the improvement of the OMSLCs. The invasion and lesion formation ability of the MSC-SLCs cells and the single cell suspension are placed on the transfer plate or soft gel. (8) Data for the transfer disk and (9) Microsoft glue data. The experiments are all triple i, and the results are expressed by the mean soil standard error, * indicates the p value < 〇 〇 5, ** indicates the p value < 〇 〇ι. μ refers to SAS cells; be refers to OECM1峨; bf refers to the number of cells undergoing invasion; refers to parent cells; bh·spheres. (6) Histopathological analysis of the survival rate of nude mice with negative tumors. Tumors or normal tissue sections were stained with Η/E dye. Black arrows indicate the location of the tumor. The white arrow indicates where the new gold tube is produced. (4) After the injection of tumor cells by bribes, the volume of 63 Ϊ 360576 supplemented with corrections on November 02, 100. * indicates P<〇.〇5. Wherein bi refers to SAS cells; bj refers to activated cultured 〇c sLCs cells; bk refers to tumor volume (1 mm 3 mm); (4) survival rate after injection of parental cells in nude mice, ** indicates p value <;0.01. Wherein bi refers to SAS cells; bj refers to activated cultured c_SLCs cells; bl refers to percent survival. Figure 7 shows the isolation of OC-SLCs from tumors of OSCC patients and confirmation of their characteristics. (4) Class ball, formed. Primary cells isolated from tissue were cultured using serum-free culture. Bm# refers to the score 咼' bn means that the score is low 'bo refers to the result of sputum ct-4 staining; bp refers to the result of Nan〇g staining; bq refers to the result of CD133 staining. (b) (c) (d) (e) (f) (g) Confirmation of cell surface marker molecules by a lapsed cell counter. Bm means high score; bn means low score; br means 〇4 positive reaction' bs means Oct-4 negative reaction; bt means survival percentage; bu means time (month); bv means Nanog positive Reaction; bw means Nanog negative reaction; bx means CD133 positive reaction; by means CD133 negative reaction; bz means first group: 〇ct-4 negative reaction and Nanog negative reaction, ca means 〇ct-4 positive reaction ; cb means Nanog positive reaction; cc means 〇 ct_4 positive reaction and Nanog positive reaction. Figure 8 is a graph showing the relationship between the clinical score and predicted survival rate of oral cancer patients and the 〇ct_4 or Nan〇g performance. (a) Immunohistochemical analysis was performed on 52 tissue sections of oral cancer patients with different disease durations, ' Oct-4 (listed above), Nanog (middle), and CD133 (below). The one with the highest score on the left is the one with the lowest score on the right. Arrows are shown in different oral cancer tissue sections, with 〇ct-4 or Nanog (upper or middle) in the nucleus and cytoplasmic CD133 (below). Kaplan-Meier overall survival analysis of 52 patients (Fig. 8(b); p=0.06), single Oct-4 performance (Fig. 8(c), * indicates p<〇.〇5), single Nanog performance (Fig. ,), ** indicates ρ<〇.〇1), single CD133 performance (Fig. 8(e), * indicates p<〇.〇5), 〇ct-4 and Nanog simultaneously (Fig. 8 (f), *** indicates p<0.0001) and Nanog and CD133 are simultaneously expressed (Fig. 8(g), *** indicates p<0.0001) 〇 Figure 9 is the cell proliferation activity of OSCC-derived spheroid cells and 0ct_4, The result of the increase in transcription of Nanog and nestin. In (a), (b) and (c), cd refers to SAS cells; ce refers to 64 - 1360576 supplemented OECM1 cells on November 2, 100; cf refers to the number of cells; eg refers to the number of days; Refers to the number of glycocalyx contained in each hole; ci refers to the number of weeks; cj refers to the parent cell; Ck refers to the spheroid; ci refers to 〇ct_4; cm refers to Nanog; cn refers to nestin; co refers to Housekeeping gene GADPH. (d) cp refers to the percentage of cells positive for ct-4, cq refers to the percentage of cells positive for nestin; cr refers to the percentage of cells positive for Nan〇g; (e) (f) cs means low score ; ct means the score is high; cu means the percentage of 〇 ct_4; cv means the percentage of Nanog. Figure 10 is the location of Oct-4, Nanog and CD133 in tumor cells of OSCC patients. Immunofluorescence staining experiments were performed to observe the location of 〇ct_4, Nanog and Cdl33 at the cell level in OSCC patients. First, frozen sections of tumor tissues of OSCC patients were reacted with primary antibodies (anti-antibodies against the three markers), followed by detection with FITC or PE-labeled secondary antibodies. DAPI staining indicates the location of the nucleus. The above is a double staining of 〇ct4/Nan〇g, the double staining of CD133/Oct-4, and the following double staining of cD133/Nanog. Figure 11 is the separation and identification of CD133+ from AT/RT tissue. (a) Tissues isolated from tumors of AT/RT patients were subjected to immunohistochemical analysis, and the detected marker molecules were vimentin, epithelial membrane antigen, cytokeratin, and neuron-specific enolase. CD133+ cells are isolated, (b) is separated by magnetic cell counting method, and (c) is immunofluorescence method. This method can identify CD133+ cells, and the fluorescent responder is CD133 positive 瘫 reaction cells, the short column is a scale of 2 〇 micron. (d) Analysis of chromosomes in CD133+ AT/RT cells by comparative gene body hybridization analysis. Three repeated tests, the data shows the mean standard error. In the figure, a is the number 18 data; b is AR/RT parental cell; c is CD133+ AR/RT cells; d is CD133·AR7RT cells; e is CD133 positive cells; f is CD133 negative reaction The cells; g-CD133 fluorescent staining; h-system white light images; and i-series overlapping images. Figure 12 is an analytical test for the growth rate, invasive ability, and tumor formation ability of CD133+/-AT/RT cells. (a) is an MTT test for cell viability; (b) is an extravasive invasive ability test of a basement membrane matrix transfer disk; (c) a soft gel lesion formation test. * indicates p<〇〇5; (d) CD133+/_ 65^ 1360576 November 02, 100 Supplementary correction of tumor-producing activity test in AT/RT cells in vivo, by injecting different doses of cells to immunization The brain matrix of incomplete mice. As a result, a minimum of only 300 CD133+ AT/RT cells can contribute to tumorigenesis (patient No. 2). CD133·AT/RT cells must be 1〇5 to promote tumor formation. The short bars represent a scale of 150 microns. Figure 13 is data demonstrating the ability of CD133+/- AT/RT cell multiplex cell differentiation. (a) and (b) are graphical representations of the formation of CD133+/- AT/RT spheroids, respectively. The CD133 cells were cultured overnight with a serum-free medium containing beta fibroblast growth factor and epithelial cell growth factor. (c) CD133+/- AT/RT cells were cultured on a poly-L-lysine-coated plate for 14 days, and the culture contained 2% fetal bovine serum. The percentage of positive responses to MAP-2 (a marker of nerve cells) and GFAP (a marker of colloidal cells) was examined to confirm the trend of differentiation after CD133+/- AT/RT cells. DAPI, used to mark the position of the nucleus (short column indicates 20 microns), * indicates p < 0.05. (d) CD133+AT/RT cells were administered to immunocompromised mice, and the number of samples was taken as 6. All mice developed teratomas. (1) The arrow is the normal kidney tissue. The three germ layers contain (2) epithelial-like tissue (3) epidermal-like tissue, (4) muscle tissue, (5) cartilage tissue, and (6) neuronal epithelial tissue. The short column is 100 microns. The data here is the mean of the three replicates ± standard error. 〇 CD CD133 positive cells; p line CD133 negative cells; s line; t line differentiation into nerve cells; w before differentiation; X line differentiation; y line CD133 positive reaction sphere; z line CD133 A sphere such as a negative reaction. Figure 14 is an assessment of in vivo and in vitro radiation resistance of C133 +/- AT/RT cells. (4) The change in survival rate of C133+/-AT/RT cells after radiation treatment, and the radiation dose of the experiment was 〇10 gray. (b) Results of immunohistochemical analysis of C133+/- AT/RT cells from individual sample sources after one or two radiation treatments. The short column indicates 5 μm. (c) The percentage of C133+ AT/RT cells increased significantly after tumor recurrence, the first surgery: nine patients; the second surgery: five patients. (d) Compare the tumor samples of the first and second surgery of the five patients. * indicates p<〇.〇5, ** indicates pO.OOl. Data are presented as mean ± standard error of three trials. Aa survival rate; ab line CD133+ AT/RT cells; ac line CDmAT/RT cells; ad line radiation dose (unit: Ge ra); ae line CD133 yang 66 1360576 100 years November 02 曰 percentage of supplemental modified cells ;af is the first postoperative operation; ag is the second postoperative operation; the percentage of CD133 positive cells in this recurrence case; the succession of ai tumors, the left surgery is the first operation, the right side For the second operation; aj patient number 2; ak. patient number 2; al patient number 4; am patient number 7; an patient number 8. Figure I5 shows the transformation of CD133+/-AT/RT cells against cell death, cell cycle and deoxynucleotide repair after radiation treatment. (a) The time point of the gene tree at five time points of CD133+AT/RT cells compared to cd133·AT/RT cells is radiation. After 5, 2, 6, 12, and 24 hours; gene The total number is M94; the tool used is GeneSpring Gx software. (b) The molecular function of 327 specific genes, the effect of upward lifting after selection is more than doubled or the magnification of the lower chick is less than 0.5 times; (c) phylogenetic & After the three major gene groups, including anti-cell death and cell death, cell cycle, and DNA cluster related to deoxygenation repair. Correlation depends on the left node; the selected gene is on the right; the value is indicated by the average of the three replicates. (4) 37 literature-dependent network genes are associated with radiation therapy. Of these, 17 genes (Table 8) were indicated by rose red 'common expression genes (collected by PubGene) in dark gray. CD(3) performance is directly related to BCL2, BCL2L1, BAX, TNF, MK167, IL2RA, TP53, and hall elbow 2. A straight line indicates that more than one document 1 7 7 is also available. And the digital frequency • The record on MedHne' includes a comparative noun or a synonym. This tool allows us to carefully analyze the relevance of a certain type of gene, egg quality, or a combination of the two on the basis of the text. The literature network is based on natural grammar (10) Fu-Language ρΐΌ__; NLP) for Medline records (topics and abstracts) for genetic or egg searches. At refers to gene expression. Figure 16 shows the results of radiochemical treatment of CD133+/- AT/RT cells after detection of ATM phase BCL-2 protein. (8) Using the Western blot method to divide]; the increase in phosphorylation of P-RAD17 and P-CHK2. (9) Immunofluorescence staining before and after BCL 2 protein treatment, and the short column indicates 100 μm. (〇进—Step 哼 Radiation 67, 1360576 November 02, 100 Supplementary correction line effect on the protein expression, after CD133+/- AT/RT cell allogeneic immunization in mice, observe whether there is radiation therapy It will affect the growth rate of mouse brain tumors by the method of green fluorescent protein imaging and immunohistochemical analysis. (4) and (e) are small for CD133+/-AT/RT treatment group. The brain tissue of the mouse was analyzed by immunohistochemistry, and the expression of phosphorylated p-ATM protein and BCL-2 protein was observed. The short column represents 150 μm, and the * is labeled p<〇.〇5. After three repetitions, the mean value ± standard error was taken. au was treated with radiation (dose was 10 gram radium); av-based phosphorylated ATM (p-ATM); ax-based ATM; ay-phosphorylated RAD17 (p-RAD17); Az RAD17; bai-phosphorylated CHK2 (p-CHK2); bb-line CHK2; be-line beta actin; bd-based CD133· cells; be-line CD133+ cells; bf-based BCL-2 protein; bg-based DAPI staining; bh BCL-2/DAPI co-staining; bi-system CD133+ cells are treated with radiation; bj is CD133- The cells were treated with radiation; the bk line was treated with radiation; the bl line was not treated with radiation; the bm line was treated with radiation; the bn line CD133+ cells; the bo system CD133· cells; and the percentage of bp line phosphorylation positive reaction cells. Figure 17 is CD133+ /-AT/RT cells showed a synergistic effect on the radiation resistance of cells after complex treatment of checkpoint kinase inhibitors and short interfering nucleotides of BCL-2. (a) Western blot method showed that CD133+AT/ The content of BCL-2 protein in RT cells was significantly higher than that in CD133_AT/RT cells. The effect of radiation on CD133+AT/RT cells was also significantly improved by the addition of DBH. This phenomenon is even a short interference nucleus with DBH and BCL. Glycosylates also have the same results. (b) and (c) discuss the tumorigenic properties of transfer/invasive ability and tumor lesion formation, respectively. The result is DBH alone or short-interference with BCL-2. Treatment of CD133· cells, compared with CD133+AT/RT cells of the same treatment mode, can effectively inhibit the cell migration/invasive ability and the ability to reduce the formation of tumor lesions. * Labeled as P<〇.〇5. Triple repetition Take the average soil standard error. Figure 18 is a comprehensive treatment of checkpoint kinase inhibitors and BCL-2 short interfering nucleotide acid in CD133+ AT/RT cell transplantation of immunocompromised mice can significantly improve tumor growth and prolong survival . (a) Tumor formation analysis 'Shows the number of tumor colonies and the volume of tumors eDBH/ 68 " 1360576 . · November 02, 100 Supplementary Correction Radiation Treatment Group and DBH/radiation/BCL-2 Short Interference Nucleotide Treatment Group Compared with the CD133+ cell control group and CD133+ cells in combination with the radiation treatment group, the number and volume of tumors can be effectively reduced. Furthermore, the effectiveness of radiation treatment for CD133+ cells can also be improved by the use of DBH, regardless of whether or not BCL-2 is added to interfere with nucleotide acid. * is marked as p < 0.05. The CD133+/DBH treatment group was higher than the CD133+/DBH/radiation treatment group; • The CD133+/DBH/BCL_2 short interference nucleotide treatment group was higher than the CD133+/DBH/BCL-2 short interference nucleotide/radiation treatment group. The data shows that the average soil standard error is taken after three repetitions. (b) Kaplan-Meier survival analysis further indicated that the CD133+/DBH/radiation treatment group or the CD 13 3+/DBH/BCL-2 short-interference nucleotide/radiation group can effectively prolong the life φ cycle, and the result is The CD133+ control group was compared with the CD133+/radiation control group. * is labeled ρ<0·05. And the data shows that the average standard error is taken after three repetitions. Figure 19 shows the changes in the amount of nucleotides expressed by CD133+/- AT/RT cells before and after radiation treatment. The time-reversed reverse transcription polymerase chain reaction was used for detection, and the time point was 〇. 5, 2, 6, 12, and 24 hours after radiation treatment. The results of the display are in the order of (b) BCL_2, (b) BCL-XL, (6) BAX, (9) CDKN1A, (8) TP53BP1, and (f) MDM2. Moreover, the data shows that the average soil standard error is taken after three repetitions. The multiple of the relative performance of the system is based on the CD133·cell group. Figure 20 is a view of CD133+/_ AT/RT cytoplasmic radiotherapy/chemotherapy sensitivity and anti-cell apoptosis ability. (a) CD133+/· AT/RT cells, analysis of cell viability after radiographic treatment, and or afterwards, 1 μg/ml cisplatin or 1 〇〇NEK/ml alone , or 疋 co-processing both drugs. Analysis by enzyme immunoassay (:]:) 133+/_8] "/1^ The activity of cell death enzyme 3 after radiotherapy. * marked as p<〇.〇〇卜 and data display=all After the third _, take the average soil standard error, and treat it with ng/ml cisplatin or 100 ng/ml TRAIL beforehand or afterwards, or treat both drugs together. After taking the average soil standard error, (6) the group of tumors treated by the green radiance protein and the histological method to observe the CD133+/_ AT/RT cell transgenic immunodeficiency fraction includes the radioactive group called the sputum group, Radiation/cisplatin group. (3) Department 69 1360576 November 2, 100 Supplementary corrected cell survival percentage; cd line cell apoptosis enzyme 3 relative activity; tumor volume (unit: cubic mm); cf line CD133 negative reaction cells; Cg CD133 positive reaction cells; ch system control group; ci line radiation treatment group; cj cisplatin group; ck line radiation/cisplatin group. Fig. 21 is a normal stem cell screened by the device of the present invention "da system; db system; Dc system; dd system control group, means no The cell type of the selected cells after the same culture conditions and time. Figure 22 is a spheroidal cell formed by separating cells from different tumor tissues. (a) de brain tumor; df oral tumor; dg Head and neck neoplasms; dh-based breast tumor; di-system gastric tumor; dj-based pancreatic tumor; dk-based liver tumor; dl-based renal tumor; dm-based gallbladder tumor; dn-line rectal tumor; It is an ovarian tumor. (9) is a stem cell isolated from a lung tumor. dq is a tumor stem cell; dr is a non-tumor stem cell ^ (4) to observe the parental cells from two different sources, the derived tumor stem cells or non-tumor stem cells each form a sphere Cell capacity ^ dq is a tumor stem cell; dr is a non-tumor stem cell; ds is the number of sphere cells formed in a certain visual field; dt parent cell No. 1; du parent cell No. 2. Fig. 23 is an embryo The population of stem cell gene expression. (a) CD133+ cells or CD133_ cells detect the expression of various stem cell genes by RT-PCR. (1)) is the result of running the gel after RT_pCR detection. bn CD133+ cells; CD133· Cell; dv is the relative multiple of niRNA expression; ea 〇ct-4; eb is Oct-4A; ec is Nanog; ed nectar; ee is Sox_2; ef is Mushashi; eg is C-Myc; - CAT; ei is Bmil; ej is a ruler; therefore, MRP-1; el is ABCG2; em is Klf4; en is GAPDH; eo is the condition of treatment. HCC line; ptl parental cell No. 1; t3 parental cell line human embryonic stem cell; GBM line; BT line. Salty 'Caf' Figure 24 shows the specific molecular targets or the expression groups of the surface objects. (4) Tumor stem cells The expression of CDm, ABCG2 or CDm on the surface of hybrid cells is quantified. (c) The amount of ALDH enzyme expression; the left side shows the additive inhibitor Qiu Xianzhi's supplementary correction on November 2, 100, and the control group on the right. (d) The cells were stained with Hochest 33342 to identify the production of marginal cells, and the position selected by the circle in the figure is the cell population of the marginal cells. Dq is a tumor stem cell; dr is a non-tumor stem cell; ep is detecting CD133; eq is detecting ABCG2; er is detecting CD177; from the vertical axis of the coordinate, representing the number of cells showing positive reaction; drl parent cell 1 Non-tumor stem cells; dql parental cell No. 1 tumor stem cells; dr2 parental cells No. 2 non-tumor stem cells; dq2 parental cells No. 2 tumor stem cells. Figure 25 shows the tumorigenicity test in vitro. (a) The ability of tumor stem cells or non-tumor stem cells to form tumors. (b) Observing the number of cells after tumor formation or the number of cell colonies of tumor stem cells or non-tumor stem cells formed by different parental cells, * represents p<〇.〇5^ dr non-tumor stem cells; d(l system Tumor stem cells; number of et cells; number of eu-forming cell colonies; pti from parental cell No. 1; pt2 from parental cell No. 2. Figure 26 is a tumorigenicity test in vivo. (8) Small tumor metastasis After the sacrifice, the lungs were observed. (9) The tumor size of the transgenic mice was measured. The dr-type non-tumor stem cells; the dq-based tumor stem cells; the horizontal axis of the ev-system coordinates, representing the number of days in which the tumor cells were colonized; The vertical axis represents the volume of the tumor in cubic centimeters; the number in front of the cell is the number of cells that have been colonized, and the number refers to the tumor cells that have not been isolated by the device. Figure 27 is a thin _ chemotherapeutic drug Or (10) line irradiation sensitivity test. (8) for different kinds of chemical, drug treatment Gugan _ or the results of the squamous cells. (9) for the amount of radiation treatment of swollen thieves is a secret fine snail. ex shop The object is narrated, the concentration is 2 micro Concentration; ey is stored in alcohol, the unit is %; fa is the axis treatment group; exempted from the finger; etosopide); f〇^ tb£(Dox〇rubicin); fd yang cedar (paditaxd); refers to the radiation dose, For the test; the transfer system refers to the survival rate. ^ Treated by Lung _er stem ceU (Lc_CD133+) 4·4 Delete eight 2 treatment pairs produce a fine _ turn pure shot no secret group like fine +: GF = magnetic to nude mouse subcutaneous position 1 exposed only m , only the coffee or the combination of Han) 1360576 November 02, when the supplementary correction. (A) tumor volume, and (B) a significant reduction in lung tumor mass. Cis: cisplatin; 〇ct 4i: 〇ct 4 siRNA. (#p<0.01: treatment of LC-CD133+ with LC-4CD133+ *p<lt; with Oct-4 siRNA. plus cisplatin treatment of LC- CD133+ is relatively only processed with dsplatinP

LC-CD133+. '<0.01: LC-CD133+ was treated with Oct-4 siRNA plus IR versus LC-CD133 treated with IR alone. ^<0.01: LC-CD133+ and tissue sections (upper left) were evaluated by 〇ct-4 siRNA plus cispiatin and Han treated LC-CD133+ versus Oct-4 siRNA and IR treatment of LC-CDl33+〇(C) LC-CD133 - In vivo tumor activity in SCID mice injected. Immunohistochemistry (IHC) was used to study the expression of Oct-4 in lung injury of SCID mice injected with LC-CD133+ using different treatment procedures. The black arrow refers to the detection of 〇 in the tumor by me (the positive signal of Λ·4 expression. Bar: 50/um. (D) LC-CD133+ cisplatin treatment LC-CD133+, IR treatment LC-CD133+ injection SCID mouse survival Analysis, and LC_CD133+ treatment 〇cM siRNA different groups (individual IR, cisplatin alone or IR combined with cisplatin) were injected into SCID mice for survival analysis, and each group tested 6 mice. The data here showed the mean standard deviation of the three trials. Figure 29 is a test of the cytotoxicity of resveratrol on cancer stem cells. (a) Treatment of tumor stem cells with resveratrol at concentrations of 0, 10, 50, 150, 200 and 250 micromolar respectively 24, 48 The viability of the cells was observed by the MTT assay at 72 hours. (b) The number of all tumor stem cells after treatment was shown. The right panel shows the untreated group and 24 μmol concentration of resveratrol. After 48 hours, the morphology of the cells was observed under a microscope. (c) indicates that resveratrol enhances the sensitivity of the tumor stem cells to radiation and inhibits the cell growth of the cells. In vitro, the basement membrane transfer disk invasion Ability test 'can be used to detect fine Transfer/invasion ability. * indicates 〇〇1, the data presented in this location are the mean ± standard error obtained after three trials. Turtle cell survival rate, expressed in %; fll is the concentration of resveratrol, The unit is used as the molar concentration; the value refers to the treatment after 24 hours; the transposition treatment after 48 hours; the & refers to the treatment after 72 hours; the fl refers to the number of cells, the unit represents the number of xlO cells; the finger refers to the culture time The unit is the hour; the sputum refers to the control group; the f〇 refers to the treatment of the cancer stem cell group with resveratrol at a concentration of 50 micromolar; the turtle refers to the treatment of the cancer stem cell with resveratrol at a concentration of 2 〇〇 micromolar Group; fq refers to the control group; mound refers to the treatment of cancer stem cell group with 2 〇〇 micromolar concentration of resveratrol; fs refers to the number of cells transferred; refers to the control group of molecular marker CD133 positive reaction cells; &; refers to the CD133 positive reaction cells in the radiation treatment group 'fV refers to CDH3 positive cells treated with resveratrol; plus 7 (3) positive reaction

72T 1360576 November 02, 2010 Supplementary correction Cells are treated with radiation and resveratrol; the number of cell colonies formed. Fig. 30 is a graph showing that resveratrol enhances the sensitivity of tumor stem cells to radiation, and promotes the cell's fine cell action and inhibits the cell's fine-aged action. (8) Survival rate of cancer stem cells after treatment with resveratrol and _ Ge radium. The data were compared with the dryness of the tumor stem cells that were treated with radiation alone. (b) Treat the radiation, the scutellaria, or the combination of the two in the Lai stem cells, and transfer the TUNEL test from the end or test the severity of the DNA fragmentation. ** indicates the value of the cut, and the data presented by the ^ are the average soil standard errors obtained after three tests. ((Tumor cancer stem cell group, Lufei cancer stem cell group, cancer stem cell group treated with radiation alone (dose: 2 Ge ra), tumor stem cell group treated with resveratrol combined with radiation, respectively, injected by intravenous injection 8(:1〇 mice were used for the analysis of heterogeneous colonization tumor formation test. The mice treated with lysalol and radiation were significantly lower in tumor volume than the control group, and the control group was tumor. The stem cell group or the non-tumor stem cell group treated with radiation, * indicates the value < 〇〇 1, and ** indicates P 0.001. (cDKaplan-Meier survival analysis further indicates that the cancer stem cells are coexisting with alcohol and radiation. Compared with those mice that were transplanted with tumor stem cells alone and those that were treated with radiation-only tumor stem cells, the mice in the treated group significantly prolonged the survival rate, and the N value of each group. 6. The data presented in the space are the average soil standard error obtained after three trials. ft refers to the control group of the molecular marker CD133 positive reaction cells; & refers to the cm33 positivity The cell-treated group refers to the CD133-positive cells treated with resveratrol; the CD133-positive cells are treated with radiation and resveratrol; fy refers to CD133-negative cells; ga refers to survival. Factor; gb refers to the percentage of apoptosis obtained after experimental analysis; gc refers to tumor volume (unit is cubic mm); gd refers to no tumor; ge refers to radiation dose 'unit is Ge ra; gf Refers to the survival time, the unit is the number of weeks. Figure 31 shows that the tumor stem cell SirTl gene expression inhibition, the number of stem cells or drug-induced genes decreased. (a) by Western blot method The tumor stem cell group, the non-tumor stem cell group, the tumor stem cell group that processed the variant siRNA, and the degree of expression of the SirTl gene in the tumor stem cell group that treated SirT1 siRNA were used. The radiation dose we used was from 〇 to 1〇73 1360576 丨00 On November 02, supplemented with Ge Lei to deal with _ dry fine or non-dry fine touch, and with the Reich cell group cancer stem cell group to rely on. The result is _ the extinction, ΡΛ<Please. Further, 2 tumor stem cell group treatment of radiant effect, ssim siRNA (four) dysfunctional treatment of variant siRNA compared to tumor stem cell group, its dimension <_b (9) by quantitative instant reverse transcription polymerization _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ The content of the site is the average value obtained after three trials ± standard error ^ (6) fine-grained - step detection of inhibition of tumor stem cells after the performance of SirTl gene 'the sensitivity of its cells to chemical drugs or lining, And observe the activity of apoptosis. Cell storage is quantified by the uMTT test. After 72 hours of SirT18 deletion, the activity of the weekly necrosis enzyme 3 (measured by the enzyme immunoassay) in the SirTl siRNA-treated group was significantly improved. (d) The results of the DNA terminal transferase marker detection method further show that the activity of apoptosis is also significantly enhanced, such as the stem cell group treated with SirT1 siRNA, when the cells are treated with radiation alone, or 1] ^Single treatment, or radiation-assisted TMZ-up treatment are (* indicates that 肿瘤.〇& treatment of SirT1 tumor stem cells separately treated SirTl tumor stem cell group. #表示p<0 〇5: treatment of sirT1 siRNA*TM^ Radiation-treated tumor stem cell group ViS•SirT1 siRNA and radiation tumor stem cells). The short bars represent 50 microns. The data presented by the premises are the mean soil standard errors obtained after three trials. The relative multiples of dv mRNA expression; eb is Oct-4A; ec is Nanog; ed is nestin; ee is Sox-2; ef is Mushashi; eg is C-Myc; eh is beta-CAT; ei is Bmil; MDR-1; ek is MRP-1; el is ABCG2; ft is the control group of CD133 positive cells; fU is CD133 positive cells by radiation treatment; fy is CD133 negative reaction cell group; ga is Survival factor; ge refers to the radiation dose, the unit is Ge Lei; the sputum CDn3 positive cells treated the mutant sequence small interfering ribonucleic acid; the gi CD133 positive reaction cells treated the SirTl small interfering ribonucleic acid; gj refers to SirTl; gk refers to the beta Actin; gl refers to the control group; gm refers to the first group of SirTl small interfering ribonucleic acid treatment group; 轵 refers to the second group of sirTl small interfering ribonucleic acid treatment group; go refers to the third group of SirTl small interfering ribonucleic acid treatment group Group; gp refers to PARP protein; gq refers to TMZ treatment; gr refers to radiation treatment; gs refers to control group; gt refers to SirTl small interfering ribonucleic acid treatment group; gu refers to relative activity of apoptosis enzyme 3; gy system Refers to CD133 positive reaction cells at 74 1360576 100 years 丨 January 02 Correction charge of TMZ treatment the experimental group; GW refers CD133 positive cells simultaneously treated 1 ^ and the radiation in the experimental group; gX refers to cell viability, in%; Gy 7_1 mean percentage positive cells, • A unit is%. _ Figure 32 is a SCID mouse that is irradiated with SirTl siRNA to treat GBM-tumor stem cells after allogeneic colonization, which can significantly improve tumor growth and prolong survival. Tumor stem cells labeled with green fluorescent protein were inserted into the subcutaneous position of nude mice and treated differently. (8) The volume of the tumor and the progression of the disease were analyzed using a 3T micro magnetic resonance imager (microMRI). At the same time, visual and pathological examinations are also performed. Black arrows indicate tumors. The tumor formation analysis showed that the tumor growth rate of the SCID mice φ co-processing TM2, radiation and siRNA was significantly reduced compared with the radiation treatment group alone or the TMZ treatment group. (c) The tumor stem cell group of the sirT1 siRNA inhibitory gene was treated with radiation, cisplatin, or radiation-conjugated TMZ, which was larger than the tumor volume of the group in which no gene suppression was performed. (9) Kaplan_Meier survival analysis further indicated that the average survival rate of tumor stem cells in the radiation-treated, radiation-matched SirTl siRNA-suppressing gene-treated group was significantly longer than that of the tumor stem cell group or the tumor-only stem cell group. p value < 0. 〇 5. The data presented by the premises are the mean ± standard error obtained after three trials. Ft refers to the control group of CD133 positive cells; fU refers to CD133 positive cells treated by radiation; gc refers to tumor volume (unit is cubic mm); gs refers to control group; gt refers to SirTl small interfering RNA Treatment group; gv refers to the CD133 positive reaction φ cells treated TMZ experimental group; gw refers to CDI33 positive reaction cells simultaneously treated TMZ and radiation test group; gz refers to the percentage of CD133 positive reaction; ha refers to CD133 positive reaction cells simultaneously processed TMZ, SirTl small interfering RNA and radiation test group; hb refers to the number of weeks; he refers to the experimental group of CD133 positive cells treated with SirTl small interfering ribonucleic acid; hd means CD133 positive reaction standard for the treatment of SirTl small interfering RNA and radiation The experimental group; he refers to the CD133 positive reaction standard for the treatment group of SirTl small interfering ribonucleic acid and TMZ; hf refers to the cumulative survival probability. [Main component symbol description] 10 layer containing cell adhesion material 75 1360576 November 02, 100 Supplementary correction 20 polyisopropyl acrylamide layer 21 series plasma surface treatment 22 series added well-mixed polyisopropyl acrylamide The mixture 24 was placed in a 65 ° C water bath for 1 hour, and subjected to graft polymerization. 26 ultraviolet light irradiation for 24 hours. 30 cell movement auxiliary chemotaxis film 40 base film adhesive layer 50 transfer turntable 60 upper chamber 70 microporous filter film 80 Lower chamber 76 1360576: Supplementary Supplementary Sequence Table of November 2, 100, <11 〇> Executive Yuan National Army Retirement Officer and Mentoring Committee Taipei Rongmin General Hospital

<120> A pharmaceutical composition for treating atypical teratino/rhinomatosis caused by tumor stem cells using resveratrol <130> 0726-VGH-TW <140> 097132616 <141> 2008-08- 27 <160> 21

<170> Patent In version 3.4 <210> 1 <211> 20 <212> DNA <213>Artificial sequence<220><223> GAPDH positive stock primer <220><221> misc_feature <222> (1)..(20) <400> 1 gggccaaaag ggtcatcatc <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> 20 1360576 : 100 years 11 Supplementary Correction <223> GAPDH Anti-Share Primer<220>221> misc_feature <222> (1)..(20) <400> 2 atgaccttgc ccacagcctt 20 <210> 3 <211> 19 <212> DNA <213>Artificial sequence<220><223> BCL-XL positive stock introduction <220><221> misc_feature <222> (1)..(19) <400> 3 cagggacagc atatcagag 19 <210> 4 <211> 19 <212> DNA <213> artificial sequence <220><223> BCL-XL anti-strand introduction <220><221> Miscjeature 1360576 November 02, 100 Supplementary correction <222> (1)..(19) <400> 4 19 tggtcattca ggtaagtgg <210> 5 <211> 18 <212> DNA <21 3>Artificial sequence <220 <223> ΒΑΧ正股引子

<220><221> misc_feature <222> (1)..(18) <400> 5 gatgcgtcca ccaagaag 18

<210> 6 <211> 18 <212> DNA hit <213> artificial sequence <220><223> ΒΑΧ counter-introduction <220><221> misc-feature <222> 1)..(18) <400> 6 agttgaagtt gccgtcag 18 1360576 • Supplementary correction <210> 7 <211> 23 <212> DNA <213> artificial sequence <220><223> MDM2 positive stock introduction <220><221> misc_feature <222> (1)..(23) <400> 7 gtagtagtca atcagcagga ate 23 <210> 8 <211> 23 <212> DNA <213>Artificial Sequence<220><223> MDM2 Anti-Stock Primer<220><221> misc_feature <222> (1)..(23) <400> 8 gaaaccaaat gtgaagatga agg 23 <210> 9 <211> 19 <212> DNA <213> Artificial sequence 1360576 November 02, 2012 Supplementary correction <220><223> CDK2 positive stock introduction <220><221>; misc_feature <222> (1)..(19) <400> 9 19 cctggacact gagactgag

<210> 10 <211> 18 <212> DNA <213> artificial sequence <220><223> CDK2 anti-strand introduction <220><221> misc_feature <222> (1). .(18)

<400> 10 18 gtgagagcag aggcatcc <210> 11 <211> 23 <212> DNA <213>Artificial sequence<220<223> CDKN1A positive stock introduction 5 1360576 Supplementary amendment on November 2,100 <220><221> misc_feature <222> (1)..(23) <400> 11 tctacatctt ctgccttagt etc 23 <210> 12 <211> 23 <212> DNA <213> Sequence ' <220><223> CDKN1A anti-share primer <220><221> misc-feature <222> (1)..(23) <400> 12 tcttaggaac ctctcattca acc 23 <210> 13 <211> 21 <212> DNA <213> artificial sequence <220><223> TP53 positive stock primer <220 <221> misc_feature <222> (1)..(21) <;400> 13 1360576 November 02, 2014 Supplementary Amendment 21 21 tgcgtgtgga gtatttggat g <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220><223> TP53 Anti-Share Lead <220>

<221> misc_feature <222> (1)..(21) <400> 14 gtgtgatgat ggtgaggatg g <210> 15 <211> 25 <212> DNA <213>

<220><223> TP53BP1 positive stock introduction <220><221> misc_feature <222> (1)..(25) <400> 15 atacttcagg caatactaca cattc 25 <210> 16 <211&gt 21 7 1360576 November 02, 100 Supplementary correction <212> DNA <213>Artificial sequence <220><223> TP53BP1 anti-strand introduction <220><221> misc-feature <222> (1)..(21) <400> 16 21 ttagcatcca catcagacag c <210> 17 <211> 19 <212> DNA <213> Artificial sequence <220><223> BCL-2 Stock introduction <220><221> misc_feature <222> (1)..(19) <400> 17 19 gcgactcctg attcattgg <210> 18 <211> 22 <212> DNA <213> Artificial sequence <220><223> BCL-2 anti-share primer 1360576 November 02, self-supplementary correction <220><221> misc-feature <222> (1)..(22) <400> 18 gtctacttcc tctgtgatgt tg 22

<210> 19 <211> 18 <212> DNA • <213> artificial sequence <220><223> CDC25a positive stock introduction <220><221> misc_feature <222> (1) ..(18) <400> 19 aagcgtgtca ttgttgtg

<210> 20 <211> 18 <212> DNA <213> Artificial sequence <220><223> CDC25a anti-strand introduction <220><221> misc_.feature <222> 1)_) (18) 9 1360576 Supplementary amendments on November 02, 100 <400> 20 cagggtagtg gagtttgg 18 <210> 21 <211> 57 <212> DNA <213> Artificial sequence <220><223> S ir T1 target si RNA coding sequence

<220><221> misc_feature <222> (1)..(57) <400> 21 ccggccctca cttcactgca ctgtactcga gtacagtgca gtgaagtgag ggttttt 57

10

Claims (1)

1360576 » . : November, 2001, Supplementary Amendment Notice 10. The scope of patent application: • 1. Atypical teratoid/rhabdoid tumor, AT/RT, for the treatment of tumor stem cells The pharmaceutical composition comprises resveratrol; wherein the tumor stem cell line is derived from a molecular marker CD133 positive reaction cell of atypical teratoma/rhinomatosis. 2. The composition of claim 1, wherein the resveratrol increases the apoptosis of the cancer stem cells and/or decreases the cell survival rate of the tumor stem cells. 3. The composition of claim 1, wherein the resveratrol inhibits tumor stem cell invasion and/or community formation. 4? The composition of claim 1 wherein the resveratrol enhances the radiation sensitivity of the tumor stem cells. • 5. The composition of claim 2, wherein the dose of resveratrol is 50-200 micromolar. 6. The composition of claim 5, wherein the dose of resveratrol is 200 micromolar. 7. The composition of claim 3 or 4 wherein the dose of resveratrol is 15 〇 2 〇〇 micromolar. 8. Prolonging the survival rate of atypical teratoid/rhinomatosis-like patients caused by cancer stem cells 1360576: a pharmaceutical composition supplemented with rectification on the next day of November, 100, including resveratrol; _ self-connected (four) fetal / sarcoplasmic cell tumor age marker CD133 positive cells. 9. The composition of claim 8, wherein the leucovorol increases the apoptosis of tumor stem cells and/or decreases the cell survival rate of the tumor stem cells. 10. The composition of claim 8, wherein the resveratrol inhibits tumor stem cell invasion and/or community formation. 11. The composition of claim 8 wherein the resveratrol enhances the radiation sensitivity of the tumor stem cells. 12. The composition of claim 9 wherein the dose of resveratrol is 5 〇 2 〇〇 micromoles. 13. The composition of claim 12, wherein the dose of the resveratrol is 2 〇〇 〇 〇 14. The composition of claim 10 or η, wherein the resveratrol The dose is 150-200 micromoles.