TWI310787B - Antiangiogenic polypeptides and methods for inhibiting angiogenesis - Google Patents

Description

A7 B7 1310787 V. INSTRUCTIONS (1) Technical Paradigm The present invention relates to the field of peptide chemistry. More particularly, the present invention relates to the preparation and use of a covalent peptide comprising an amino acid sequence substantially similar to the corresponding sequence of mammalian plasminogen, a pharmaceutical composition comprising the peptide, and a blood vessel Treatment of diseases caused by or exacerbated by hyperplasia. BACKGROUND OF THE INVENTION The process of angiogenesis, by which new blood vessels are formed, is essential for normal physical activity, including reproduction, development, and wound repair. Although the process is not thoroughly understood, Xian believes in complex interactions involving molecules that regulate the growth of endothelial cells (the main cells of microvasculature). Under normal circumstances, these molecules appear to maintain the microvasculature in a static state for a long period of time (ie, without a capillary growth), which can last for several weeks or, in some cases, sustain ten year. When needed (as during trauma repair), these same cells can undergo rapid proliferation and turnover over a five-day period (Folkman, J. and Shing, Y., The J0urnal of Bi〇1〇gical chemistry, 267 (16), 10931-10934, and F〇lkman, j jkugsbrun, M, Science, 235, 442-447 (1987)) Although angiogenesis is a highly regulated process under normal conditions, many diseases (its Characterized by vascular proliferative disorders) continues to be controlled by unregulated angiogenesis. Another argument is that unregulated angiogenesis can directly cause a specific disease or exacerbate the existing pathology. For example, the angiogenesis of the eye has become the most common cause of blinking and dominates about 20 eye diseases. In some existing conditions, such as arthritis, newly formed capillary tubes invade the joints and destroy the cartilage. -4 - This paper size applies to Chinese National Standard (CNS) A_4 specification (21〇 χ 29? mm)

装—1 1310787 A7 B7 V. INSTRUCTIONS (2) In diabetes, new capillaries formed in the retina invade the vitreous, bleed, and cause blinking. The growth and metabolism of solid tumors also depend on angiogenesis (Folkman, J., Cancer Research, 46, 467, 473 (1986), Folkman, J., Journal of the National Cancer Institute, 82, 4-6 (1989)). Tumors that have been shown to be larger than 2 mm must obtain their own blood supply and do so by guiding the growth of new capillaries. Once these new blood vessels are embedded in the tumor, they provide a way for tumor cells to enter the circulation and move to distant places like the liver, lungs or bones (Weidner, N., et al., The New England Journal of Medicine, 324 ( 1): 1-8 (1991). Currently, in order to treat vascular proliferative diseases, several inhibitors of angiogenesis are under development, but these compositions still have disadvantages. Fumagillin, a kind of 烟A compound secreted by Aspergillus fumigatis fresenius has a proven vasopressor effect, but has not been clinically developed because of the dramatic weight loss of experimental animals after prolonged exposure. TNP-470, a smoke Synthetic analogs of kojimycin also inhibit endothelial growth, but have been shown to cause weakness and neurocortical toxicity in humans, limiting the allowable dose (J. Clin. Oncology 17, 2541 (1989)). An angiogenic factor, particularly a clindapeptide fragment of plasminogen (see, e.g., U.S. Patent No. 5,639,725; U.S. Patent No. 5 > 733, No. 876; U.S. Patent No. 5,792,845; U.S. Patent No. 5,837,682; U.S. Patent No. 5,861,372; U.S. Patent No. 5,885,795; U.S. Patent No. 6,024,688;

Iy -5- This paper size applies to Chinese National Standard (CNS) A4 specification (210 X 297 mm) 1310787

7 7 AB 5. Inventions (3) 5'854, 221; U.S. Patent No. <RTIgt;</RTI><RTIgt;<RTIgt;</RTI> U.S. Patent No. 5,981,484; U.S. Patent No. 5,972; All are incorporated herein by reference). Regardless of the promising anti-angiogenic properties of these segments, their circulating half-lives are very short. Therefore, there is still a need for anti-angiogenic compounds, such as Klein skin fragments, which have improved their pharmacokinetic activity. It is also should be easy and cost effective to manufacture such compounds. SUMMARY OF THE INVENTION In its principle specific embodiments, the present invention discloses a conjugated Klein peptide fragment consisting of a functionalized Klein peptide fragment that is chemically conjugated to a functionalized polymer. Preferably, the functionalized Klint peptide fragment

The N-terminal is conjugated to the functionalized polymer via a hydrazone linkage or via a carbon-nitrogen single bond. In a preferred embodiment, the functionalized Klein peptide fragment is substantially selected from the group consisting of Klein hook i including plasminogen, Klein hook 5 of plasminogen, and blood fiber. The plasminogen Klein 4_5, and the clindapeptide fragment of the plasminogen of Klein-2. Preferably, the babesin peptide fragment is graminogen 5 of plasminogen or clinoptin 4_5 of fibrinogen. Preferably, the clindapeptide fragment is a Klein 5 peptide peptone, which is plasminogen selected from the group consisting of human, mouse, cow, dog, tracing, and rhesus monkey blood fibrinogen. The fragment, which has a substantial sequence isoform β, in other preferred embodiments, the functionalized polymer consists essentially of a polymer of ethylene glycol. Preferably, the polyethylene glycol is selected from the group consisting of linear 1310787 A7 B7. 5. Description of the invention (4, branched, disubstituted or unsubstituted polyalkylene glycol, polyethylene glycol homopolymer, poly a propylene glycol homopolymer and a copolymer of ethylene glycol and propylene glycol, wherein the homopolymer and the copolymer are unsubstituted or substituted at one end of the alkyl group. Particularly preferred polyalkylene glycol is polyethylene. The diol (PEG) and methoxypolyethylene glycol (mPEG) have a molecular weight of from about 5,000 to about 40,000. Preferably, the polyalkylene glycol is a molecular weight of from about 1 Torr to about 20,000. Methoxypolyethylene glycol (mPEG). In another embodiment, the present invention discloses a pharmaceutical composition comprising a conjugated clindapeptide fragment in admixture with a therapeutically acceptable carrier. In a specific embodiment, the invention discloses a method of treating a disease in a patient in need of anti-angiogenic therapy comprising administering to a human or animal a therapeutically effective amount of a conjugated Klein peptide fragment. Selected from cancer, arthritis, macular degeneration and diabetes More preferably, the disease is cancer, and optimally, the disease is selected from solid tumors including primary and metastatic, carcinoma, sarcoma, lymphoma, psoriasis and hemangiomas. In a specific embodiment, the invention discloses a method of inhibiting endothelial cell agitation in an individual comprising administering to the individual an effective amount of a conjugated Klein peptide fragment. In another specific embodiment, the invention discloses in vitro A method of inhibiting endothelial cell proliferation, comprising administering to a endothelial cell an effective amount of a conjugated Klein peptide fragment.., and phlegm detailing the use of 'nan' and 'the" in the singular form, unless This paper scale applies to China National Standard (CNS) A4 Shenge (2i〇x297 mm) ---~~- 1310787 Five invention description (A7 B7

, all applications: clearly specified in the context of the text, otherwise including the plural meaning. Further, the published scientific and patent documents (including patents) referred to herein are hereby incorporated by reference in their entirety. When used in this article "K5,,," "Klint 5", "κι" and "Kling hook ~ words, means the graminogen region of plasminogen. When using "Κ2"-word, it means the Klein hook region of plasminogen. Unless otherwise stated, the following nouns shall have the following meanings: 醯基一一意扣扣 C! - C10 alkyl group Attached to a portion of the parent molecule via a carbonyl group. The term "deuterated group" means an agent capable of donating a thiol group to a nitrogen atom of a molecule during the reaction. Examples of the deuterated group include acetic anhydride, acetamidine, and the like. The term "C^Cioalkyl" means a monovalent group having from 1 to 1 carbon atoms derived from a linear or branched saturated hydrocarbon by removal of one hydrogen atom. The term ' "Cr C1Qalkyl" means a divalent group having from 1 to i carbon atoms derived from a straight or branched saturated hydrocarbon. "carbonyl" means - C(0)-. "Conjugation of the Klein peptide fragment" or "conjugated Klint peptide fragment" - means a functionalization chemically coupled to a functionalized polymer Klein peptide fragment. A method of producing such a conjugate has been described (see, for example, W096/41813 and J. Pharmaceut. Sci-87, 1446-1449 (1998)). Non-limiting examples of conjugates of clindapeptide fragments, including the standard for polyethylene glycol equivalent papers, China National Standard (CNS) A4 size (210X 297 mm) 1310787 A7 _____B7 5^Inventive description (6 ' " Linked Klint 5 peptide fragment, Kline hook 5 peptide fragment coupled with methoxy polyethylene glycol, Klin hook 5 peptide coupled with methoxy polyethylene glycol, and Its analogues. "Functionalized clindapeptide fragment," means a clindapeptide fragment as defined herein, which has been modified in a specified position to contain a reactive group. Peptide fragments are also intended to include clindapeptide fragments which have been modified by the addition of one or more non-natural amino acids at the N-terminus. The added amino acid may serve as a reactive group or may be further modified i itself' forms a reactive group. For example, a leucine residue (Leu) residue at position 450 of the Krebs5 peptide fragment having a sequence from amino acid position 450 to amino acid position 543 The serine (Ser) is added upstream (i.e., before). The Ser of the N-terminus can then be modified in a defined manner to form a reactive group such as an aldehyde. Any method well known in the art can be used, Manufacture of a Krebs peptide fragment having one or more non-native amino acids at its terminal, such as, for example, by recombinant DNA methodology, or by synthetic peptide chemistry. Known by this artist (see, for example, W096/41813 J. Pharmaceut. Sci. 87,1446-1449 (1998)).

The term "functional or functionalized polymer" as used herein, means the formation of an amino-oxy group or aldehyde on a polymer to allow the polymer to be in a specified position. Conjugated with a complementary functionalized target, such as a Klein peptide fragment. For example, at w〇96/41813 and J

A method of functionalizing a polymer is also provided in Pharmaceut 'Sci. 87, 1446-1449 (1998). The term '•克林勾融合蛋白" means a polypeptide comprising amino acid sequences obtained from two or more individual polypeptides, one of which is a clindapeptide fragment. The National Standard for Ten Countries (CNS) A4 specification (210 X 297 mm) can be used on the paper scale. 1310787 A7

The expression of the glycosidic acid in which the coding sequence of the Klein peptide fragment has been linked to at least one = other polypeptide (such as two (or more) editing frameworks), forming a Klein hook fusion protein. A non-limiting example of Klein hook fusion protein' includes the fusion of two or more individual clindapeptide fragments, f疋克林勾4-5 (K4-5). Other examples of the Klein hook fusion protein of the present invention include a separate Klein peptide fragment further linked to a biological tag, or a Klein peptide fragment fused to other polypeptides. Such a Klein fusion protein may or may not be cut from its origin to become a separate protein. The term "Klint peptide fragment" refers to the Klein hook region of fibrinogen or prothrombin having anti-angiogenic activity and includes the following sequences: (a) plasminogen Individual Klein peptides, such as Klein and Kling hook 5 (K5); (b) Klein peptide of prothrombin, such as Klein peptide 2 (K2) '· (c) as in a Klein hook fusion protein as defined herein; (d) a clindapeptide having a substantial homology to the sequence of sequence (a), (b) or (c) and (e) (a), (b) Or a peptide fragment of (c) which has a substantial sequence homology to the sequence described in (a), (b) or (4). It is already in the patent literature (see U.S. Patent No. 5,639,725, U.S. Patent No. 5,733,876 U.S. Patent No. 5,792,845; U.S. Patent No. 5,83,682; U.S. Patent No. 5,861,372; U.S. Patent No. 5,885,795; U.S. Patent No. 6,24,688; U.S. Patent No. 5,854,221; U.S. Patent No. 5,801, No. 146; U.S. Patent No. 5,981,484; U.S. Patent No. 6,057,122; and U.S. Patent No. 5,972,896 In the literature, the above-mentioned Klinop's peptide fragment and the method of manufacturing and using the same are widely described. The preferred Klin-10- paper scale applies to the Chinese National Standard (CNS) A4 specification (210X297) PCT)

1310787 A7 ____B7 V. Description of the invention (8) The peptide fragment is a single, fused to one or more Klein peptide fragments, or to other Klein hooks of plasminogen (eg, angiostatin) (angiostatin)) and/or an anti-angiogenic preparation, such as a K5 peptide fragment mixed with endostatin. Other preferred clindapeptide fragments are clindapeptide fragments having substantial sequence homology to the human K5 peptide sequence, as described herein. The excellent K5 peptide fragment has a sequence recognition number from amino acid residues 450 to 543, and sequence recognition! The sequence from amino acid residues 458-543. The term "polymer" means a chemical compound consisting of repeated non-peptide structural units. Preferred polymers of the invention are water-soluble. The most preferred water soluble polymers are polyethylene glycol (PEG) and methoxy polyethylene glycol (mpE). The terms "polypeptide", "peptide" and "protein" mean the molecular chain of an amino acid, respectively, but do not mean a specific chain length. The term also refers to polypeptides, peptides and proteins. Performance - post-modification, such as glycosylation, acetylation, phosphorylation, and the like. The term "purified polypeptide" means the polypeptide of interest or a fragment thereof that is essentially free That is, a cell component that naturally binds to the polypeptide of interest, containing about 5% or less (more preferably about 70% or less, and even more preferably about 9% or less). Methods for purifying polypeptides are well known in the art. The term "substantial sequence homology" means approximately 60% of the amino acid sequence corresponding to the plasminogen of human, mouse, cow, dog, cat, rhesus or code plasminogen. Identity, want at least about 7 % amino acid identity 'more want about 80% amino acid identity, and more want big -11 - this paper scale applies to Chinese national standards (CNS A4 size (210 X 297 mm) 1310787 A7 __B7 _._ V. Invention description (9) about 90% identity, and most wanted is about 95% amino acid identity. Human plasminogen has a sequence of considerable sequence homology called a "homolog." In addition to having considerable sequence homology, the homologues of the invention demonstrate biological activity (i.e., anti-angiogenic activity) similar to the Klein peptide fragment described herein. Because the number of amino acid sequences or amino acids in the Klein peptide sequence can vary with the species or with the method of production'. In some instances, it cannot be precisely defined in the Klein skin fragments. The total number of amino acids. Even in these sequences, at least 73% of the amino acids are identical, it should be understood that the amino acid sequence of the Klein peptide fragment is substantially similar between species, and the Klein peptide fragment is produced. The method provides a clindapeptide fragment having a substantial sequence homology to the corresponding amino acid sequence of human plasminogen. All peptide sequences are based on generally accepted protocols, whereby the amino acid residues at the Ν-terminus are on the left and the σ^ _ terminus is on the right. When the term "α-Ν-terminal" is used herein, it means the free a-amino group of the amine group in the peptide, and the term "α · C _ terminal" refers to the peptide. The free carboxylic acid terminal of the amino acid. The compounds provided herein have anti-angiogenic activity, including functionalized Klein peptide fragments conjugated to a functionalized polymer. The formation of such conjugates makes them more stable and can be used as therapeutic agents. For example, the properties of the desired conjugated Klein peptide fragments, including in aqueous solutions: solubility, increased stability during storage, reduced immunogenicity, increased resistance to enzyme degradation, and various drugs The drug delivery system is compatible and adds half life to the body. -12- The paper size is applicable to China National Standard (CNS) Α4 specification (210X 297 public) 1310787 A7 ___?!______ V. Description of invention (1()) In a specific embodiment, the following formula can be used The functionalized polymer of the invention: PX-0-NH2 wherein P represents a polymer, preferably water soluble, X represents a spacer group, which may be present as desired, and 0-ΝΗ2 represents an amino-oxy group. Since polymer p includes various numbers of multiple repeating units, it should be understood that the molecular weight of p will vary considerably. When P has a specific molecular weight, the molecular weight may be only approximately 値' reflecting the average molecular weight of the P molecule group, which differs from each other in the number of subunits present in the molecule. In general, p will have a molecular weight of from about 5,000 to about 40,000, preferably from about 1 Torr to about 20,00 (however, knowing that the molecular weight suitable for p will depend on the Klein to be modified The spacer X may be absent or, if present, function to link an amino-oxy group to the polymer of interest. The spacer group x represents a non-reactive group 'including substituted or Unsubstituted, branched or linear, aliphatic or aromatic group, such as a phenyl or alkyl moiety, a Cl_Cl0 alkyl group or a combination thereof or an amino acid chain (like a flexible strand) A chain or loop sequence (see, for example, J_Mol. Biol, 211, 943-958 (1990)), a nucleotide chain, a sugar chain, a lipid chain, or a combination thereof, m has a hetero atom. In a preferred embodiment 'X includes -CH2- or CHOH- or -COCHr or ·NH_C0_CH2'_.

When the amine-gas radical is on the functionalized polymer, 'appears in the additional linking structure, and the pendant solid (ie, the spacer group) adjacent to the amino-oxyl function is not decisive. The necessary condition for any spacer group is that it does not work well between the amino-oxy group and its complementary lap, and the formation of the bond I -13 - this paper scale common Chinese National Standard (CNS) A4 specification ( 210X297 mm> 1310787 A7 __________B7_ V. INSTRUCTION DESCRIPTION (11) Therefore, the spacer group should not react with the aldehyde before the amino-oxy group, nor should it provide steric hindrance or reactive groups. In a further embodiment, a functionalized polymer comprising a di- and poly-polymer is provided. Such a polymer has the formula: (P) mLX-〇-NH2 wherein P, X and 〇- NH2 is as defined herein, the claw is an integer from 2 to 10, more preferably 2 to 5, and L is a multivalent cross-linking agent, each of which is separately covalently linked thereto, and wherein the valence of L At least m + 1. In the case of di- and poly-polymer functionalized polymers of the invention, functional The action of the polymer to conjugate with the target macromolecule in a specified position, resulting in the attachment of two or more polymers through a single hydrazone linkage, in a specified position, via the -0-NH2 group and multivalent L-structure attachment. Thus 'functionalized polymers containing di- or poly-polymers capable of attaching two or more polymers (identical or different, preferably identical) to a single molecule In a preselected position, where L is a trivalent group, m is 2. Preferably, the valence of L is m+1, wherein the monovalent value of L is occupied by a group forming a hydrazine, optionally via X, and the remaining price of L is occupied by one or more (that is, m) polymers. The structure of L is not important, nor is it the linkage of L· to the polymer, as long as l is subsequent The hydrazine reaction does not provide steric hindrance and does not deactivate the reactive group. L does not react with other emerging functionalities. Each arm or valence of the linking group L in the functionalized polymer preferably comprises a group that does not react, including a substituted or unsubstituted aliphatic or aromatic group, such as phenyl or Ci- Ci〇 stretching base, Ci-CiG alkyl group or a combination thereof, or amino acid chain (such as a flexible hinge or ring sequence (-14- This paper scale applies to Chinese National Standard (CNS) A4) Specification (210X297 mm) 1310787 A7 ______B7 i, invention description (12~~) ' - See 'eg J. M0l. Biol., 211, 943-958 (199〇)), nucleotide chain, sugar chain, lipid a chain or a combination thereof, and may contain a hetero atom. Preferably, all but one of the arms or valencies of L contain a functional group before being conjugated to the polymer, which specifically reacts with a group on the polymer. Preferably, the group is at the end of the polymer. The remaining valence is protected so that it can later react with a compound that provides a hydrazine-forming function (which is in a deprotectable state if desired) or otherwise takes up S. Where a polymer conjugate is used for antigen or immunogen purposes, it is apparent that those skilled in the art will select a co-agent that is not itself strongly immunogenic. Where a polymeric conjugate is used for binding purposes, the preferred crosslinker will enhance or at least not interfere with properties such as binding, antibody avidity, product stability or solubility. The linker structure itself may contain the valence occupied by the group forming the oxime, and the (P)mL-structure can be assembled using a parallel combination (through the formation of an elbow with the complementary functionalized polypeptide of the invention). Therefore, the base structure described in U.S. Patent Nos. 8/57,594, 〇8/ι 4,877 and 08/057,594, and the international application pcT/IB94/〇〇〇93 are suitable for use as the structure of L. Other complementary reactive groups may be utilized to replace the ruthenium forming groups of the base; however, for assembly, it is preferred to use ruthenium formation. The preferred L structure is derived from a tri-amine compound in which the coupling of the polymer can be carried out using either of the two amine groups, respectively, and the remaining amine groups can be used to introduce the group forming the oxime. A preferred tri-amine is a compound of the formula N(R5-NH2)3 wherein any two amine groups (_Nh2) can be coupled to the polymer and the remaining amine groups can be used to introduce a fatty group. And R is a non-reactive group, including a substituted or unsubstituted aliphatic or aromatic group, such as a phenyl or C1_C1() alkyl moiety, a ^-(:(7) alkyl group -15- This paper size is suitable for plant standard (CNS) A4 specification (21GX297 dongdong) 1310787 A7 ________B7 V. Invention description (13) or a combination thereof' or amino acid chain (like elastic hinge or ring) a sequence (see 'eg J. Mol. Biol., 211, 943-958 (1990)), a nucleotide chain, a sugar chain, a monthly chain or a combination thereof, and may contain a hetero atom. r5 is preferably a cjj2_ CH2. The two primary amine groups are preferably at the distal end of the nitrogen. Preferably, the 'tri-amine compound is tris-(2-aminoethyl)amine. In other embodiments, first Obtaining the desired multivalent L structure 'usually one of the valences is protected, and then reacting the protected L _ structure with a suitably activated polymer intermediate, usually known in the art. A functionalized polymer of a di- or poly-polymer is synthesized by a linking chemistry or by reaction with a functionalized polymer of the present invention. After separation of the di- or poly-polymer product, in accordance with the present invention, By deprotecting the remaining retained edge k of L, followed by subsequent reaction with a deuterated group containing a suitably protected amino-oxy group (eg, deuteration in the case of an amine group), The product is functionalized. After deprotection of the fatty functional group, the final product, ie the di- or poly-polymer functionalized polymer, is obtained. Or 'first using an appropriately protected amino-oxyl group. The group derivatizes L, and then at each remaining valence, the mono-substituted l derivative and the polymer intermediate (such as those with COOH, where L contains NH2; or NH2 group' at this time L • Contains COOH) or reacts with the functionalized polymer of the present invention (in this case, hydrazine chemistry is used to assemble P to L). For example, it can be used in H〇Bt (hydroxybenzotriazole hydrate)*DCC (1) In the presence of 3_dicyclohexylcarbodiimide), the mPEQ-COOH intermediate polymer is associated with l- Structurally free amine group coupling, or if mPEG_c〇〇I^〇 amber quinone imine derivative is prepared first, these reagents are not needed, and the functional group that will form the elbow is removed - 16 - paper Scale towel g S standard (CNS) A4 specification (_Χ297 public) 1310787 A7 B7 V. Description of invention (14) After protection, obtain the final product, ie di- or poly-polymer functionalized polymer. When the amino acid forms an L group, the peptide sequence of the L structure can be synthesized by conventional solid phase peptide synthesis ("SPPS"), and the peptide is still attached to the activated form of solid phase PEG-COOH, like N-hydroxy amber imine vinegar can be added to the nascent peptide chain. For example, the L structure can be composed of a peptide having six reactive groups, such as five amino acid residues and an N-terminal amine group. The PEG-COOSu transbasic sulfhydryl ester reacts with the ε-amino group of each amide acid residue (while the Ν-terminal α-amino group remains protected). At this time, the Ν-terminal amine group of the completely deuterated peptide is unprotected, and the structure containing the polymer reacts with the active ester containing Boc-ΑοΑ, and the Α Α Α group is introduced, followed by removal of B 〇 c, It is gently cut from the resin to produce a functionalized polymer of the present invention containing a penta-polymer. It is important to note that this method has found particular use for synthetic structures (and perhaps some recombinant products) because these can be designed to exclude additional residues that require protection during processing and which subsequently require deprotection. Alternatively, an activated form of B〇c_ Ser(benzyl)-〇H or Boc-Ser (tributyl)-〇H, such as N-# to hydrazide, may be attached On the ε-amino group of the amine acid residue. The --terminal α-amine group is then deprotected and introduced into an amino-oxy group (e.g., α〇α) such that after removal of Boc. The structure of the precursor L containing ε-Ser-penta-amino acid was obtained. Once conjugated to the protein, it is convenient to treat the precursor L structure with a mild oxidizing agent, which is a periodate at pH 7, which will convert ε-ser-penta-amino acid to ε-GXL-penta-amino acid. Thus a five-GXL L structure is produced' which can then be reacted with the amine-oxyl functionalized polymer of the invention - 17 - This paper scale applies to the Chinese National Standard (CNS) 8 4 specification (210 X 297 mm) 1310787 A7 ^ _____ B7 V. Description of invention (15). Any 1,2-glycol or hydrazine-amino-2-ol or phenol-2-amine compound having a relatively free rotation, about 丨, 2 bond, such as ethylene glycol, can be used. The oxidation reaction is stopped. Alternatively, the oxidation can be stopped by rapid removal of periodate', e.g., by reverse phase high efficiency liquid chromatography (RP_HPLC). Therefore, the oxidation reaction occurs only with the serine residue containing the primary amino group, and only the ε-serine residue is converted to glyoxyl. When it is desired to protect, those skilled in the art know how to chemically retain the N-terminal serine acid from oxidation, and then do not protect the N-terminal amino group and make the polymer-containing structure and B〇(>a〇a active ester reaction, introduction of AoA group, followed by removal of Boc, resulting in a five-St compound of the present invention, which can be subsequently subjected to mild conditions suitable for the product ( See, for example, Green and Wuts (1991) "pr0tective Groups in Organic Synthesis," 2nd edition, Wiley, New York, NY), removing Boc or a representative amine-protecting group used in peptide synthesis. In another specific embodiment, the following formula represents a functionalized polymer of the invention: w 0

Wherein P represents a polymer as previously defined, and x represents a spacer group which may be present as desired. The spacer group X may be absent or, if present, function as a polymer that is more susceptible to attachment. The spacer group X represents a non-reactive group 'including a substituted or unsubstituted, branched or straight aliphatic or aromatic «'like « or a base moiety' or a group of 18 alkyl groups or 18 1810787 A7 B7 Description of the invention (16 combinations thereof, or amino acid chains (like elastic stranded or loop sequences (see, eg, Factory Hall, Rats, 211, 943-958 (test)), nucleotide chains, sugar chains, = a quality chain or a combination thereof, and may contain a heterogeneous compound. In the preferred embodiment 'X includes -CH2_. appearing in an additional linking structure, the group with the carpet (ie, the spacer group) is not decisive; However, the necessary condition for any spacer group is that it must not interfere with the formation of a carbon-nitrogen bond between the complementary amine group and the amine group. Therefore, the spacer group should not be placed before the primary amine group. In response to the reaction, the reaction should not be provided with a steric hindrance phenomenon or to deactivate the reactive group. The present invention also provides a method for inhibiting endothelial cell proliferation in vitro and in vivo using a Klein peptide fragment. And treating people who need treatment for anti-angiogenesis A method of class or animal comprising administering to such an individual a conjugate of a therapeutically effective amount of a Klinop's peptide fragment. The invention further provides a conjugate comprising a Klein peptide fragment and is pharmaceutically acceptable Pharmaceutical compositions of the present invention. Compounds of the invention, including but not limited to those specified in the Examples, have anti-angiogenic activity. As inhibitors of angiogenesis, such compounds are useful for treating primary organs of the following organs. And metastatic solid tumors, as well as cancer: breast; colon; rectum; lung; oropharynx; throat; esophagus; stomach; pancreas, liver, gallbladder; bile duct; small intestine; urinary tract, including kidney, bladder and bladder epithelium, carved Sexual genital tract, including cervix, uterus, ovary; choriocarcinoma and gestational trophoblastic disease; male reproductive tract, including prostate, vas deferens, testicular and germ cell tumors; endocrine glands, including thyroid, adrenal gland and hypothalamus Skin, including hemangioma, melanoma, -19- The paper size is 中国 Chinese National Standard (CNS) A4 size (210 X 297 mm) 1310787 A7 _ _____B7 5, invention description (17) sarcoma caused by bone or soft tissue, as well as Kaposi's 邛〇si, y sarcoma, brain, nerve, eye and meningeal tumors, including astrocytoma, neuropilin, nerve Glioblastoma, retinoblastoma, neuroma, diploid blastoma, Schwann〇mas, and meningioma; solid tumors caused by hematopoiesis, such as leukemia, including green tumors, plasma Cell tumors, plaques and tumors of verrucous granulomas, and tau-cell lymphoma/leukemia of the skin, lymphoma, including Hodgkin's and non-Hodgkin's lymphomas' Prevention of autoimmune diseases, including rheumatoid arthritis, immunity and degenerative arthritis; diseases of the eye, including diabetic retinopathy, precocious retinopathy, rejection of corneal transplant, post-lens fibrous tissue hyperplasia, neovascularization Glaucoma, redness, retinal angiogenesis due to macular degeneration and hypoxia; abnormal angiogenesis of the eye; skin diseases including psoriasis; vascular disease, including Hemangiomas and capillaries in atherosclerotic plaques; Osler_Zhangbo (〇sler_Webber) syndrome; myocardial vascular proliferation: angiogenesis of spots; microvascular dilatation • 'hemophilic joints; vascular fibers Tumor; wound granulation; characterized by excessive or abnormal hedgehog of endothelial cells, including small intestinal adhesions, Crohn's disease, atherosclerosis, scleroderma and hypertrophic scars (ie scars), and blood vessels Proliferation becomes a pathological result of diseases including cat scratching (Rochele minalia quintosa) and ulcers (Helicobacter pylori (Hdic〇bac such as pylon)). Other uses are as birth control agents that inhibit ovulation and placenta establishment. The compounds of the present invention may also be used alone or in combination with radiotherapy, and/or other conventionally administered to a patient for the treatment of vascular neoplasia-20- This paper scale applies to the Chinese National Standard (CNS) A4 specification ( 210 X 297 mm) 1310787 A7 _B7_._ V. Inventive Note (18) The combination of chemotherapeutic treatment and/or in combination with other anti-angiogenic agents is used to prevent metastasis of the above tumors. For example, when used to treat solid tumors, the compounds of the invention can be administered with chemotherapeutic agents, such as alpha interferon, COMP (cyclophosphamide, vincristine, amine methotrexate, and dehydrogenation). Pine), etoposide, mBACOD (amine saponin, borschine, doxorubicin, cyclophosphamide, vincristine and dexamethasone), PRO-MACE/MOPP (dehydrogenation) Pine, Amino Essence (with w/leucovin rescue), Doxorubicin, Cyclophosphamide, Paclitaxel, Mechlorethamine, Changchun New Test, Dehydrocortisone and C Procarbazine, Changchunxin, Changchunhua, angiostatin, TNP-470, pentosan polysulfate, platelet factor 4, angiostatin, LM-609, SU-101, CM -101, Techgalan, thalidomide, SP-PG and the like. Other chemotherapeutic agents include alkylating agents such as nitrogen mustard, including nitrogen mustard, amphetamine, chlorambucil, cyclophosphamide, and i-fosfamide; nitrogen sources, including Nitroxine mustard, lomustine, semustine and streptozocin; acid-based vinegar, including b usulfan; , including dacarbazine; ethyenimines, including tris(cyclopropylpropyl) sulfide and hexamethylmelamine: folic acid analogs, including amine methotrexate; Pyrimidine analogs, including 5-fluorouracil, arabinoside; purine analogs, including 6-mercaptopurine and 6-thioguanine; anti-tumor antibiotics, including actinomycin D; anthracyclines Phytomycin, broccolimycin, mitomycin C and methamycin-21 - This paper scale applies to China National Standard (CNS) A4 specification (210X 297 mm)

Binding 1310787 V. Inventions (19) (methramycin); hormonal and hormonal antagonists, including tamoxifen and corticosteroids, and mixed preparations, including cisplatin (c1Splatm) and brequinar (brequinar) . For example, surgery can be used to treat tumors with surgical H-line or chemotherapy and co-consumption of Klein, followed by conjugated Kling hook 5 to prolong the rest of the micrometastasis and stabilize and inhibit any residuals. The growth of primary tumors. Other anti-angiogenic agents include other clindapeptide fragments of plasminogen, such as K1 and K4~5, and prothrombin [2]. When the term "parenteral" is used herein, it refers to a mode of administration that includes intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, and intra-articular injections and infusions for parenteral injection. Pharmaceutical compositions include pharmaceutically acceptable sterilized aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and reconstituted sterilized injectable solutions or dispersions before use. Examples of aqueous and non-aqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and The appropriate mixture 'vegetable oil (like olive oil), and injectable organic vinegar, such as oleic acid vinegar. For example, by using coating materials, such as egg yolk, in the case of scattered limbs The intermediate sperm maintains the required particle size and maintains proper fluidity by the use of surfactants. These compositions may also contain adjuvants such as preservatives, runoffs, emulsifiers and dispersing agents. By including various ^ Bacteria and anti-fungal preparations, such as benzoic acid vinegar (called), chlorobutanol, sorbic acid and their analogues, to ensure the prevention of sputum activity. May also want to contain isotonic agents, like It is a sugar, sodium chloride and its analogues. -22· 1310787 A7 B7 V. INSTRUCTIONS (2〇) '-- Can be used for injection by means of formulations containing delayed absorption, such as magnesium monostearate and gelatin. Prolonged absorption of the pharmaceutical form, by forming microcapsules of the drug in biodegradable polymorphisms such as polylactide-polyethylene, I (orthoesters) and poly(anhydrides) The matrix, which is used to make the reservoir for injection. The rate of drug release can be controlled depending on the ratio of drug to polymer and the nature of the particular polymer used. It can also be made compatible with body tissue In a vesicle or microemulsion, to prepare a storage formulation for injection. For example, the formulation can be sterilized by filtration through a filter that retains bacteria, or in a sterile solid composition. In the form, by sterilizing by incorporation of a sterilizing agent, it can Dissolve or disperse in sterile water or other sterile injectable medium before use. Administration C. It includes administration to the skin, mucous membranes and lung surface. It can be prepared by topical administration in the form of dry powder which is neither compressible nor non-pressurized. The composition may be used in an undesired powder composition, in a finely divided form, in a larger size (mixed with a pharmaceutically acceptable inert carrier comprising particles having a size of, for example, up to 100 microns in diameter, Suitable inert carriers include sugars, such as cherries. It is desirable that at least 5% by weight of the active ingredient particles have an effective particle size ranging from 0.01 to 10 microns. Alternatively, the compounds of the invention can be directly injected. The vitreous humor of the eye and the aqueous humor of the eye. The compounds of the invention may also be administered in the form of vesicles. As is known in the art, vesicles are typically derived from phospholipids or other lipid materials. The vesicles formed by the mono- or multi-layer hydrated liquid crystal are dispersed in an aqueous medium. Any lipid which is non-toxic, physiologically acceptable and identifiable, and capable of forming vesicles can be used. The present invention is in the form of aliquots -23- i paper scale ss material (CNS) A4_21G χ 1310787 V. Description of the invention (21 S ☆ ☆ In addition to the compound of the present invention, it may contain a stabilizer, a preservative Shape agents and the like. Preferred lipids are natural or synthetic phospholipids (lecithins). The method of forming the vesicles is known in the art. When used in the context of a treatment or other treatment, the compound of the invention may be used in a pure form in the form of a pharmaceutically effective salt, or in the form of a pharmaceutically acceptable salt, with or without A pharmaceutically acceptable excipient. The compound of the present invention, '3⁄4', which is effective in the amount of /0 therapeutically, means that the compound is present in an amount sufficient to establish the benefit of the field. Treating blood η η any combination of medications ^ + , ! / 潦 潦 潦 增生 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) Will be the clinician responsible for the care, in the treatment:: learning judgment Within the scope of the decision. The effective dose level specified for any particular patient will be based on various factors, including the severity of the disorder and the severity of the disorder; Gender and diet; time of administration; route of administration; rate of excretion of the compound; duration of treatment; drugs used in conjunction with or concurrent with the particular compound used, and similar factors well known in the art of medicinal techniques. For example, it is best to use a lower dose of the compound required for the ''', 'mouth' effect:: (The amount to be treated until the desired effect is achieved. Bureau Shao or Wang personally voted for human or other breastfeeding _ stomach Lin hook 5 peptide fragments of her daily full 丨 | 佰 king's conjugated gram per gram, can be, for example, from 0.015 mg / kg -24 - paper Scale Fits for Money (CNS) M Specification (Coronation; Public Love---------- 1310787 A7 B7 V. Description of Invention (22) Weight per day, and more often 0.05 to 1 mg /kg body weight. If necessary, for the purpose of administration The effective daily dose is divided into a plurality of doses. As a result, a single dose of the composition may contain such a level, or a fraction thereof, to constitute a daily dose. It will be understood that it can be mixed with the compound of the present invention, and inhibited, The preparation for treating or preventing vascular proliferative diseases is not limited to those enumerated above, but includes, in principle, any preparation which can be used for treating or preventing vascular proliferative diseases. Synthetic method plan 10 mPEG-NH2 Boc-AoA-OSu (3) + . Secret, Η (4) (2) (Lineine 459) K5 Periodic acid sodium X (5) nh4hco3 _ grade Η pH 5 pH 8.3 (6) 0 mPEG, N NH2 Η 0 H^"K5 (6) 0 Secret, person 〇, ναΚ5 Η (4) One (7) Scheme 1 shows the preparation of a poly(alkylene glycol conjugate) of type K5, which can be rapidly extended to synthesize other common clindapeptide fragments. Amino methoxypolyethylene glycol (2) (5 -30 kD) can be condensed with (Ν-tris-butoxycarbonylamino)oxy)ethyl fluorenyl-hydroxyarene ylide (3) , -25- This paper size applies to Chinese National Standard (CNS) A4 specification (210 x 297 mm) 1310787 A7 _____ B7 V. Description of invention (23) Provides (amino-oxy)ethylidene-functionalized poly Ethylene glycol (4). These can be condensed with an aldehyde (6) (formed by oxidation with sodium periodate (serine 459) K 5 (5 )) to form the desired conjugated peptide fragment with various polyethylene glycol lengths. (7). Plan 2 (serine 450) K5

mPEG-0-CH2-CH=0 (5)_^ mPEG-O-CH^-CH^-NH^CH-CONH-LLPD-KS (8) NaCNBH3 (9) Plan 2 shows another K5 polyethylene glycol vehicle The preparation of the material can also rapidly extend the preparation to synthesize other conjugated Klein peptide fragments. The decyloxypolyglycolaldehyde (8) (5-301^) can be condensed with (serine 459) in the presence of a reducing agent such as sodium cyanoborohydride to form the desired A conjugated peptide fragment (9) with various polyethylene glycol lengths (LLPD-K5 = leucine-leucine-proline-aspartic acid _ Κ 5). The following examples will be provided to further explain the preparation of the novel compounds of the invention: Example 1 pET32-Kan-Ek-SLLPD-K5, pET32-Kan-Ek-SEED-K5, pET32-Kan-Tev-SEED-K5^ ^ % Using PCR Production of Klein hook fusion protein including Klein hook 5 peptide fragment. Synthesis of 5 卞 0 ft primer, which encodes enterokinase cleavage position VIII 5 - 8 5 - 8 5 - 8 3 - Lys (sequence recognition 2 Next, followed by the Ser residue, and the K5 N-terminal crypto sequence starting at fibrin residue 450 and extending the residue 453 of the genomic recognition sequence No. 1 : TGGGTACCGACGACGACGACAAGTCCCTGCT TCCAGATGTAGAGA (SEQ ID NO: 3). Synthesis of 5'PCR primers, -26- This paper size is applicable to the National Standard (CMS) A4 specification (210X297 mm) 1310787 A7 B7____ V. Description of the invention (24) Coding enterokinase incision position Asp- Asp- Asp- Asp - Lys (SEQ ID NO: 2), followed by a K5 N-terminal crypto sequence starting at fibrin residue 458 and extending to residue 461 of sequence recognition number 1: TGGGTACCGACGACGACAAGTCCGAAGAAGACTGTATGTT TGGG (sequence identification 1J 4) . Synthesis of a 5TCR primer encoding the Tobacco Etch Virus (TEV) protease cleavage site Glu-Asn-Leu_ Tyr-Phe-Gln (SEQ ID NO: 5), followed by the K5 N-terminal crypto sequence, which begins with blood The plasminogen residue 458 extends to the residue 461 of the sequence recognition No. 1: TGGGTACCGAAAACCTGTATTTTCAGTCCGAAGAAGACTG TATGTTTGGG (Sequence 歹 'j recognition No. 6). Also synthesized is K5 C-terminal 3, the primer TTATTAGGCCGCACACTGAGGGA (sequence-recognition | J7). Use 50 μl of Pfu DNA polymerase buffer solution (Stratagene 7, La Jolla, CA), dNTP each 200 μΜ, 500 μΜ ATP, each appropriate 5, primer and 3· primer 0.5 μΜ each, and Τ 4 polynucleotide Kinases, which produce PCR fragments, respectively. After incubation at 37 ° C for 15 minutes, primers, Pfu DNA polymerase and approximately 1 〇 nanogram of Dral-digested KT-containing K4A plastids were added to the kinase (previously US Patent No. 6,057,122) The vector described in the pHIL-D8. Sequence identification No. 4 and sequence identification No. 7 were used as the primers, and after 1 minute at 94 ° C, PCR was performed in the thermal cycle column, using 20 times [94 * C 1 second, 40 seconds; 72 ° C A cycle of 1 second; 50 ° C for 1 minute, 30 seconds; 72 Ό 1 second, 4 minutes] yielded a product encoding Ek-SEED-K5. Sequence identification numbers 3 and 7 were used with sequence identification numbers 6 and 7 as primer sets, at 94. (: After 1 minute, PCR was performed in the thermal cycle column, using 20 times [94 ° C for 1 second, 40 seconds; 72 ° C for 1 second; -27- This paper scale applies to China National Standard (CNS) A4 specification ( 210X 297 mm) 1310787 A7 ___ _B7____ V. Description of invention (25) 50°c 2 minutes, 30 seconds; 72°C 1 second, 4 minutes] cycle, resulting in codes Ek-SLLPD-K5 and Tev-, respectively The product of SEED-K5. The PCR product was then purified on a S400-HR spin column (Amersham Pharmacia Biotech, Pisca-taway, NJ). The pET32-Kan expression vector was constructed in the following manner: using Bpull02I + Spal (New England Biolabs; Beverly, ΜΑ) cut pET32aDNA (N〇vagen; Madison, WI) and purify the 3426 base pair fragment by agarose gel electrophoresis (positions 81-3507). Also cut PET24d DNA with Bpull02I+SapI ( Novagen, Madison, WI), and purified 2341 base pair fragments containing the Kanr gene by lipogel gel electrophoresis (舆 position 3047-8 1 ). Using the Rapid Ligation kit (Roche Molecular Biochemicals; Indianapolis, IN) joins two fragments and transforms the large intestine with a ligation mixture Bacillus BL21 (DE3) qualified cells (Novagen; Madison, WI) were placed on LB-Kan agar plates (Micro Diagnostics; Lombard, IL). Individual colonies grew up in LB-Kan medium and used midiprep kits. (Quiagen; Valencia, CA) Purification of plastid DNA. The DNA sequence of the cryptodomain was confirmed by DN A sequence analysis including the T7 promoter gene and the sequence of T7 termination transcription. 1 μg of pET32-Kan was digested with Bglll plus Xhol and then filled Terminal, and according to the previous description (U.S. Patent No. 6,057,122, prior), the DNA is luciferatized and purified. In a volume of 5.25 microliters, as described previously, using a rapid selection set, 1 microliter (approximately 1 〇 nanogram) of the pET32-Kan vector was ligated with 1 microliter of K5 PCR product. Then 1 microliter of each ligation mixture was transformed into 20 microliters of HMS 174 (DE3) qualified cells.

Binding 豢 -28- The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 1310787 A7 B7 5. Inventive Note (26) (Novagen, Madison, WI). Recombinant cells were selected on LB-Kampicillin agar. According to the previous description (U.S. Patent No. 6,057,122, supra), colonies were screened by PCR for the presence of inserts of the correct size and orientation. The correct colonies are then grown to isolate the plastid DNA, confirm the DNA sequence, and perform a small-scale performance study as previously described (U.S. Patent No. 6,057,122, supra). Example 2 pET32-Kan-Tev-SLLPD-K5^pET32-Kan-Tev-LLPD-K5^ 两个 Synthesis of two 5' PCR primers encoding the TEV protease cleavage site Glu-Asn-Leu-Tyr-Phe-Gln ( Sequence recognition No. 5), one with no Ser residue followed by a K5 N-terminal crypto sequence starting at plasminogen residue 450 and extending to residue 453 of sequence recognition No. 1: TGGGTACCGAAAACCTGTATTTTCAGTCCCTGCTTCCAGA TGTAGAGA (sequence identification No. 8) and TGGGTACCGAAAACCTGTA TTTTCAGCTGCTTCCAGATGTAGAGACTC (sequence identification | J 9). C-terminal 3 · primers were prepared as described in Example 1 above. The PCR reaction was prepared on a thin walled tube on ice and then directly transferred to a stand on a Perkin-Elmer 480 thermal cycler preheated to 94 °C. Sequence identification Nos. 8 and 7 and sequence identification 9 and 7 were used as primer sets, and after 1 minute at 94 ° C, PCR was performed in a thermal cycle column, using 25 times [9 4 ° C 1 second, 40 seconds ; 8 0 ° C for 1 second; 4 5 ° C 5 minutes, 30 seconds; 7 2 Ό 1 second, 8 minutes] cycle, resulting in the products encoding Tev-SLLPD-K5 and Tev-LLPD-K5, respectively. Colonization was carried out as described in Example 1 above. ' 29 - This paper scale adopts Chinese national standard (CNS> A4 specification (210X297 mm)

Binding

1310787 A7 B7 V. INSTRUCTIONS (27 Example 3 Isolation and purification of K5 from fusion proteins (a) Isolation of fusion proteins: Ek-SLLPD-K5, Ek from Examples 1 and 2 were removed from storage at -8 0 °C Cell paste of -SEED_K5, Tev-SLLPD-K5, Tev-SEED-K5 or Tev-LLPD-K5 and with lysis buffer solution (50 mM Tris, 300 mM NaCl, 1 mM NaN3, pH 7.9, Hampton Research, Laguna Niguel, California) , protease inhibitor (8 7 μg/ml PMSF, 5 μg/ml aprotinin, 78 μg/ml benzamidine, 1 μg/ml leupeptin, 5 μg/ml valolinin ( Phenanthrolin)) (SIGMA, St. Louis, Missouri) and benzoic acid (Benzonase (20 μl/100 g cell paste) (EM Industries, Hawthorne, New York). Using a microfluidizer, 11,000 The cells in the suspension were lysed by Microfluidics (Newton, Massachusetts). It was confirmed by microscopy that it usually dissolved > 90% by centrifugation (RCF = 22000g, 30 minutes at 4 °C) Clarify the suspension. Slowly pour out the supernatant and batch with Ni IMAC tree (Probond, Invitrogen Corporation, Carlsbad, California) Mixing. Rinse the resin with a lysis buffer to remove non-specifically bound proteins. Take a step gradient in the lysis buffer (5 mM, 100 mM, 250 mM and The fusion protein was eluted at 500 mM. The pure fusion protein was concentrated, and the buffer solution was exchanged by dialysis to incubate the buffer solution (5 mM Tris, ImM NaN3, pH 7.9) (Hampton Research, Laguna, Califonia) 0 (b) image .....g enterokinase cleavage fusion protein: make the £k fusion protein solution the final concentration of 1 mM CaCl2t. For each gram of fusion protein 816.8163 to 14.3 -30- this paper scale is applicable to the national standard (CNS) A4 size (210 X297 mm) 1310787 A7 B7 V. Inventive Note (28) Position (determined by absorbance at 280 nm), enterokinase (EKMax, Invitrogen Corporation, Carlsbad, California) is added to the fusion protein in. The solution was allowed to reach 37 ° C and the incision reaction was allowed to continue for 20 to 24 hours. The incision was monitored by SDS-PAGE under reducing conditions. (c) The fusion protein was cleaved using TEV protease: the Tev fusion protein solution was made to a final concentration of 1 mM DTT (SIGMA, St. Louis, Missouri). Recombinant Tev protease (GibcoBRL Life Technologies, Gaithersburg, Maryland) was added to the fusion protein at 76.2 to 1330 units per gram of fusion protein (determined by absorbance at 280 nm). The solution was allowed to reach 30 ° C and the incision reaction was allowed to continue for 2 to 24 hours. The incision was monitored by SDS-PAGE under reducing conditions. Separation • The cut K5 was isolated by mixing the cut solution batchwise with Ni IMAC resin (Probond, Invitrogen Corporation, Carlsbad, California). The flow-through cut was collected and the resin was rinsed with a slit buffer solution. The rinsing solution containing hydrazine 5 was mixed with the flow-through cut and applied to an anion exchange resin (Q-Sepharose, SIGMA, St. Louis, Missouri). Pure K5 was isolated using a linear NaC1 gradient (〇 mM to 300 mM) in a slit buffer. The fusion protein is cleaved with an appropriate enzyme to produce a product which is hereinafter referred to as SLLPD-K5, SEED-K5 and recombinant LLPD-K5. Example 4 Functionalization of the N-terminal of SLLPD-15, and conjugated effect of methoxypolyethylene glycol (mPEG. molecular weight 20,000) -31 - This paper scale uses the Chinese National Standard (CNS) A4 specification ( 210 X 297 mm) 1310787 A7 B7 V. Description of invention (29)

The Klint 5 peptide fragment SLLPD-K5 was functionalized essentially as described by Gaertner et al., Bioconjugate Chem., 7, 38-44 (1996), and with decyloxy polyethylene glycol (5-30 kD). Conjugation. The draft used is briefly described below. (a) Formation of N-based succinimide of BOC-AOA: treatment with a solution of N-succinimide (1,15 g) in ethyl acetate (30 ml) at room temperature A solution of BOC-amino-oxyacetic acid (B0C_AAA, 1.9 g, available from Novabiochem) in ethyl acetate (30 mL). The resulting mixture was treated with a solution of N,N'-dicyclohexylcarbodiimide (2.06 g) in ethyl acetate (5 ml), stirred for 18 hours, filtered and concentrated. The concentrate was wet-milled with diacetic acid (4 ml), filtered, and the resulting solid was dehydrated under vacuo to give 1.2 g of desired product. MS m / e 306 (M + NH4) + : iH NMR β 1.48 (9 Η), 2·88 (4 Η), 4·78 (2 Η). (b) Formation of MeO-PEG'okd-NH-COCH.iO-NHfAOA-EG^okd): treatment with acetonitrile at room temperature in Example 3A (50 mg) and 4-mercaptomorpholine (0.1 mL) A solution of MeO-PEG20kd-NH2 (1 - 5 g, available from Rapp Polymere Inc., Tubingen, Germany) in (4.5 mL) was stirred for 2 hours and concentrated. The concentrate was dissolved in water (9 mL), treated with /?- alanine (1 </i>g) and adjusted to pH 9.2 with 2N NaOH. The mixture was dialyzed against water (4 liters, 2 replacements) using a 3,500 molecular weight cut-off dialysis tube and then lyophilized to yield 1:4 g of BOC-AOA-PEG-OMe. A solution of BOC-AOA-PEG-〇Me (1.4 g) in trifluoroacetic acid (TFA '2.5 liters) was allowed to stand at room temperature for 3 hours and concentrated to water (5-32-32- This paper scale applies to the Chinese National Standard (CNS) A4 specification (21〇x 297 mm)

Binding

1310787 A7 B7 V. INSTRUCTIONS (3.) 升) Processed and re-concentrated. The concentrate was dissolved in water (7.5 mL) and adjusted to pH 3.0 with 2M NaOH. The solution was then dialyzed against water at 4 ° C (3 _ 5 kD cut-off dialysis tube) and lyophilized. A part of the obtained solid (29 mg) was dissolved in water (1 ml). The amine-oxyl functional group of the solution was estimated by spectrophotometric analysis by condensation with m-nitrobenzaldehyde (MNBA) in 50 mM acetate buffer, pH 4.0. Quantitative reaction of the solution from the weighed MNBA with excess AOA-PEG-OMe showed an increase in the molar increase in the absorbance of the aldehyde, at which time the conversion to mPEG-oxime at 255 nm was 12,400. The complete reaction of AOA-PEG-OMe was completed at 60 ° C for 15 minutes, at which time the aldehyde was 1.0 mM and it was evaluated by a weight of AOA-PEG-OMe to exceed the 1.5-2 fold excess of the latter concentration. A solution of 2 9 mg/ml was found to be 0-95 mM (having 68% activity) based on a molecular weight of 20,000, equivalent to 19 mg/ml of aldehyde-reactive polymer. (c) Oxidation of SLLPD-K5: Approximately 1 mg/ml of purified SLLPD-K5 was supplemented in a Tris-Cl buffer solution pH 7.8 containing 100 mM NaCl. From the optical density at 280 nm, the protein concentration of PEG co-consumers of K5, SLLPD-K5 and K5 was evaluated at 1.0 mg/ml solution (1.0 cm diameter, pH 4- range 4-8.5), with OD = 1.70. SLLPD-K5 was dialyzed into 0.1 M NH4CO3 (pH 7.5-8) and then concentrated to 3.3 mg/ml by filtration through a 3 k d cut-off membrane. This solution (66.6 ml, 220 mg of Klingon 5, molecular weight 10,500) was treated with 1-methylthiocyanate (50 mg) to give a final methionine concentration of 5 mM. Adjust the mixture to ρίί 8.0 with concentrated ΝΉ4ΟΙί, with sodium periodate (1 8 mg, 4 -33- This paper scale applies to Chinese National Standard (CNS) Α4 size (210 X 297 mm) 1310787 A7 B7 V. Description of the invention (31) Equivalent) treatment and monitoring by reverse phase HPLC (C-8 Waters Symmetry 4.6 x 250 mm, acetonitrile in water with 〇·1% TFA, increasing CH3CN from 5% to 4 in 30 minutes 0 %). After 1 hour, the mixture was treated with an additional 13.5 mg, stirred for an additional 1 hour, and the mixture was treated with an additional 13.5 mg, mixed for an additional 1 hour, treated with 25 microliters of propylene glycol, stirred for 1 hour, and 1 : 1 ethyl glacial acetate / water was adjusted to pH 4.8. The mixture was dialyzed against a 50 mM sodium acetate buffer solution pH 5.0 (4 liters) overnight (3,500 molecular weight cut-off membrane) and analyzed by mass spectrometry indicating acetaldehyde oxime-based keeling hook 5 (10,516) and Its hydrate (1〇, 534) is present. (d) _4PA: Condensation of PEG with acetaldehyde decyl-LLPD-K5: Example 4(c) (3 mg/ml, 66.7 ml, 19 micromolar) by dropwise addition of 1:1 glacial acetic acid/water The solution of the ear) is adjusted to? ^4.0. The solution was treated with 0.95 «1\1 of Example 4 (13) (3 4 ml '32 micromoles' over protein l68_fold excess) and concentrated to 1 / 5 ' of the original volume over a 4 hour period, The cells were stirred with a 3,500 molecular weight cut-off membrane to give a final protein concentration of approximately 1 mg/ml. The reaction was continued for 24 hours, and the mixture was quenched with 1 mM mM in ethanol (〇. 12 ml), mixed for 3 minutes, and adjusted to pH 7.8 with 2 M Tris base. The desired product. The mPEG is also conjugated to SEED-K5 essentially as described above. SLLPD-K5 and SEED-K5 co-located with decyloxypolyethylene glycol are hereinafter referred to as mPEG·SLLPD-K5 and mPEG-SEED-K5. EXAMPLE 5 The production of the PECH 匕Klin peptide fragment is carried out using methods well known in the art (such as, for example, recombinant and synthetic techniques - 34-I paper scale application 0 @家料(CNS) A4 specification (21G) &gt;&lt;ϋ))'' *---- 1310787 A7 ___ B7 V. Description of invention (32), to produce clindapeptide fragments 'and/or have a naturally occurring or non-naturally occurring N - The following compounds are prepared by the Klein peptide fragment of the terminal serine acid, or by the following Scheme 1 and the above examples: (a) (Chromoplasminogen) Klein hook methoxy Polyethylene glycol conjugate, (b) (plasminogen) Klinot 4·5_methoxypolyethylene glycol conjugate, and (f) prothrombin Kline 2 - methoxy polyethylene glycol co-consumer. In addition, each of the above-mentioned Klin tucks can also be synthesized by substituting another polyalkylene glycol for methoxypolyethylene glycol in the procedure outlined in Scheme 1 and Example i_5. A mixture of peptide fragments and other polyalkylene glycols. Example 6 Endothelial Cell Mobility Assay The original strain of HMVEC (human ecchymial microvascular endothelial cells) was grown to 80-90% confluence 'washed cells with squaric acid-buffered saline (pBs) and then placed in a containing 1 The minimum nutrient requirement medium (Eagles balanced salt solution, no supplement) of 〇% fetal calf serum (FCS) was 18 hours. Rinse with PBS and trypsinize the cells and resuspend at 2 - 5 x 106 cells / ml ' and then cultivate with the calcein AMTM (MOLECULAR PROBES, Eugene, Oregon) in the dark, loading the camp Light group. Vascular endothelial growth factor (VEGF) in the culture medium was placed in the wells of a 96-well culture plate, and finally, filter paper was placed on these solutions. After re-suspension after centrifugation, and to assess the degree of labeling, cells and various levels of rK5 (sequence recognition number 1 amino acid position 450 to amino acid 543), purified -35- paper scale for China National Standard (CNS) Α4 Specification (210X297 mm) 1310787 A7 B7 V. INSTRUCTIONS (33) mPEG-SLLPD-K5 or purified mPEG-SEED-K5 is added above these wells. After 4 hours at 37 ° C, free cells (not moved) were wiped from above the filter paper, and fluorescence was measured. Data were derived as a fraction of the number of cells moving in wells without control inhibitors and are indicated in Table 1 as % inhibition. S e m represents the standard deviation of the mean enthalpy. Table 1: EC mobile protein concentration (ng/ml) inhibited by mPEG Klint 5 construct rK5(%I) sem mPEG-LLPD- Κ5(%1) sem mPEG-SEED- Κ5(%1) sem 10 73 1 70 15 75 13 1 47 7 59 10 71 3 0.1 32 12 53 23 65 9 0.01 45 8 68 4 39 15 0.001 19 18 19 12 53 7 0.0001 8 8 33 21 46 9 As shown in Table 1, mPEG-SLLPD -K5 and mPEG-SEED-K5 inhibit endothelial cell migration to the same extent if there is no greater extent than unpegylated rK5. Example 7 Pharmacokinetics of monkeys All samples were diluted to 1.1 mg/ml with phosphate buffered saline. Before the administration, nine macaques weighing 3-6 kg were fasted overnight, but the -36- paper size was applicable to China National Standard (CNS) A4 specification (210X 297 mm) 1310787 Δ7 Α7 Β7_____ V. Description of invention (34) Drink water ad libitum. Give the monkey food 3 hours after the administration. Animals were housed separately during the study period. The study was performed in parallel with three groups of monkeys; each group contained three animals. All animals received an intravenous dose of 1 mg/kg (0.91 ml/kg) of compound (mPEG-SLLPD-K5, mPEG-SEED-K5 or recombinant LLPD-K5) for slow bolus administration in the saphenous vein . Blood samples taken from the femoral artery or vein of each animal prior to administration and at 0.1, 0.25, 0.5, 1'2, 3, 4, 6, 9, and 24 hours after administration (in approximately EDTA) 3 ml). The results are shown in Table 2 and Figure 2 below. Table 2 1 mg / kg IV dose tl / 2 * Vc + νρ Λ AUC 〇. 〇〇 # C1, Form: (hours) Qing kg) (Na kg) (micrograms · hour / ml) 1 (Public City hours - kg) T-LLPD-K5 0.19 0.033 0.033 9.85 0.11 mPEG-SEED-K5 5.05 0.044 0.057 150.20 0.0078 mPEG-SLLPD-K5 5.53 0.031 0.067 126.66 0.0081 %1/2 = half-life in circulation + Ve = volume parameter AVe volume parameter # AUC 〇- ~ = area under the curve &quot;Clp=clearance rate is shown in Table 2. · When administered intravenously in monkeys, mPEG-SEED-K5 and mPEG-SLLPD-K5 show better than recombination The LLPD-K5 has a 27-fold longer half-life (tV2) and is slower than the unpegylated K5-37- This paper scale applies to the Chinese National Standard (CNS) A4 specification (210 X 297 mm) 1310787 A7 B7 , invention description (π) I3x times the removal rate (Clp). The conjugation of N-terminal methoxypoly polyethylene glycol aldehyde (PEG-aldehyde, molecular weight 20,000) of Example 8 is substantially as described in j, Pharmaceut. Sci., 87, 1446-1449 (1998), The clindaline 5 peptide fragment SLLPD-K5 was functionalized and conjugated to methoxypolyethylene glycol (5 - 3 OkD). The draft used is briefly described below. The valence of oxypolyglycol aldehyde: 2 mM methoxypolyglycolic acid (200 μl in H2O) treated with 1 OmM of nitrophenyl hydrazine (200 μl '15_3 mg in 1 mL of ethanol) 40 mg/ml) and incubated for 24 hours at room temperature. An aliquot of 50 microliters was diluted to 1 〇 ml with loomM HC1, and the absorbance at 405 nm was measured at t = 0 and t = 24 hours. The change in absorbance (λ 405 = 0.64, t = 24 hours) is compared with (λ 4 〇 5 = 〇 · 67) of a 50 uM standard of 3-phenylpropene p-nitrophenyl hydrazine. The 9 6% aldehyde content can be compared to what is predicted by weight. [b) Condensation of methoxypolyglycolaldehyde with SLLPD-K5: 5M cyanoborohydride in 1 M NaOH with decyloxypolyether (1.14 g '0.05723⁄4 mol' from Shearwater) Sodium (43·4 μl, o.217 mmol), treated in 5〇111]\4 acetate steel (21.7 ml, 卩?14.7) in 51^?0-anti 5 (300 mg) mixture. The mixture was incubated at room temperature for 48 hours while monitoring the progress of the reaction by HPLC (Waters C8 Symmetry column, 4 6 x 150 mm; solvent gradient: 5% to 40% acetonitrile / containing 〇 1 〇 /. H20 of TFA, within 30 minutes). Treat the mixture with additional methoxypolyglycolic acid (200 mg) and sodium cyanoborohydride (43.4 μl) and apply to the Chinese National Standard (CNS) A4 specification at room temperature -38- (210 X 297 mm)

Binding

1310787 A7 B7 V. INSTRUCTIONS (36) Train for an additional 24 hours. (c) Purification of mPEGylated-K 5 via reductive amination: at 3 - 7 mg/ml - mPEGylated K5 was stored in 50 mM Tris buffer solution, 100 mM NaCl and 1 mM NaN3, pH 7.7. The PEGylated K5 reaction mixture was concentrated to about 10 mg/ml and dialyzed into a buffer solution (buffer solution A) containing 25 mM sodium acetate at pH 5.0 for chromatography. Chromatography was performed on a Tosoh Biosep (Montgomeryville, PA) TSK-SP5PW column using a 25 mM sodium acetate buffer solution at pH 5.0. A gradient of pH 5.0 containing buffer solution A (buffer solution B) of 200 mM NaCl was generated using a Pharmacia FPLC system to elute the protein. Different sample loads are used to control different sample loads, but the most commonly used is TSK-SP5PW-HR (2x15 cm). The flow rate was adjusted to match the column size and changed from 1. 2.5 to 2.5 cc/min. The column was equilibrated with buffer solution A and the sample previously dialyzed into buffer solution A was loaded. The column was then rinsed with up to 3 column volumes of buffer solution A to remove excess mPEG-aldehyde, which was removed according to absorbance at 280 nm. After rinsing the column, the gradient was started with 2 to 3 column volumes above, from buffer A to 25% buffer solution B (50 mM NaCl). Place the gradient in 50 mM NaQ until the absorbance returns to the baseline. At this point, the gradient was increased to 1% buffer solution B (200 mM NaCl), and unreacted K5 was eluted » three peaks were eluted in the 50 mM NaCl &quot;preservation gradient&quot; SDS polyacrylamide gel electrophoresis (SDS-PAGE) analysis indicated that the first (smaller) high is about 9 〇, 〇〇〇 MW (probably a di-mPEGylated product). The second smaller peak eluted at approximately 50,000 Da and traveled from the gel to approximately 50,000 -39- This paper scale applies to the Chinese National Standard (CNS) A4 specification (210x 297 mm) 1310787 A7 I--- B7 V. Invention Description (π)

Da <Separated from the second (smaller) peak. By SDS-PAGE set «Dissolution from the highest peak. In terms of purity and identity, the characteristics of the maximum peak (80-90% of the total amount) are determined by the following method, and it is judged to be the single-mPEGylated K5 of the N_terminal. Methods for determining the K5 characteristics of N-terminal single _mPEGylation: 1 • Mass spectrometry; 2. Analytical chromatography on mono-S (HR); 3. On mono-Q (HR) Analytical chromatography; 4_hydrophobic interaction on TSK phenyl 5PW; 5_ gel filtration on Superdex 75 (HR); 6 _ cyanogen bromide cleavage; 7. N-terminal sequencing; _Amino acid composition analysis. EXAMPLE 9 Production of gkPEGylated Klein peptide fragments. Methods well known in the art, such as, for example, recombinant and synthetic techniques, to produce clindapeptide fragments, and/or have naturally occurring or Non-naturally occurring (K-linking peptide fragments of N-terminal serine, and or by the following Scheme 2 and the above examples, the following compounds can be prepared: (a) (plasminogen) Klein-l-oxyl polyethylene glycol conjugate, (e) (plasminogen) Klinot 4_5-methoxy polyethylene glycol co-consumer, and (f) thrombin Original Kline hook 2_methoxy polyethylene glycol conjugate. -40- This paper scale is suitable for wealth 8 @家标准(CNS>A4 specification (21 hearts 297 public.) 1310787 A7 B7 V. Invention description ( 38) In addition, each of the above-mentioned Klin tucks can also be synthesized by substituting another polyalkylene glycol for methoxypolyethylene glycol in the procedures outlined in Schemes 2 and 8. The conjugate of the peptide fragment with other polyalkylene glycols. Example 1 0 The pharmacokinetics of monkeys were administered intravenously at 1 mg/kg in rhesus monkeys (n = 3). Point analysis to determine plasma concentration. The results are shown in Table 3. Table 3 Plasma concentration (μg/ml) Time (hours) rK5 (sem) 20kD Monthly loss PEGK5 (sem) 20kD Reductive amination mPEG K5(sem) 0.1 20.6 (1.44) 30.2(1.13) 30,1 (2.62) 0.25 14.34(1.97) 27.4(1.12) 32.0(1.84) 0.5 6.38 26.3 (1.2) 33.64(1.24) 1.0 3.47 22.12(2.66) 31.0 (0.68) 2 0.79 17.23 (0.82) 29.64 (0.93) 3.0 - 10.89 (0.25) 23.93 (0.37) 4.0 - 9.26(2.1) 20.84 (0.47) 6.0 - 5.98 (1.3) 16.1 (1.85) 9.0 ND 2.29(0,1) 11.57 (1.96) 24.0 ND 0.7 (0.26) 1.69 (0.46) 36.0 ND ND 0.73 (0.15) -41 - This paper size is applicable to China National Standard (CNS) A4 specification (210 X 297 mm) 1310787 A7 B7 V. Invention description (39) sem = standard deviation of mean ND ND = not performed as shown in Table 3, m PEGylation using 20 kD m PEG at the N-terminal, dramatically reduced in monkeys compared to un-mPEGylated K 5 Clearance in plasma. MPEGylation via reductive amination results in slower peptide scavenging compared to mPEGylation via hydrazine formation. -42- This paper size applies to Chinese National Standard (CNS) A4 specification (210 X 297 mm)

装町-f

Claims (1)

擎修正' -S' im Supplement A8 B8 C8 D8 1310冢8^Zi22249 Patent application Chinese application patent scope replacement (October 1997) 1 I — Patent application scope 1 'Kingle Kringo a peptide fragment consisting of mPEG_SLLPD-K5 or mPEG-SEED-K5. A pharmaceutical composition for treating a disease treated by an anti-angiogenic therapy comprising a conjugated clindapeptide according to the scope of the patent application and a therapeutically acceptable carrier. 3. The pharmaceutical composition according to claim 2, wherein the disease is selected from the group consisting of cancer, arthritis, macular degeneration and diabetic retinopathy. 4. The pharmaceutical composition according to claim 3, wherein the disease is cancer. The pharmaceutical composition according to claim 4, wherein the disease is selected from the group consisting of primary and metastatic solid tumors, cancer, sarcoma, lymphoma, psoriasis and hemangiomas. A pharmaceutical composition for inhibiting proliferation of endothelial cells of an individual, which comprises an effective amount of a conjugated clindapeptide fragment of the scope of the patent application. 7 'A method for inhibiting endothelial cell proliferation in vitro' which comprises administering to the endothelial cells an effective amount of a conjugated clindapeptide fragment of the scope of the patent application. This paper scale applies to the Chinese National Standard (CNS) A4 specification (210X297 public)