TWI247040B - Flax seed specific promoters - Google Patents

Abstract

Novel methods for the expression of non-native genes in flax seeds and the seeds of other plant species are provided. The methods involve the use of seed-specific promoters obtained from flax. Additionally provided are novel flax seed-specific promoters, chimeric nucleic acid constructs comprising novel flax seed-specific promoters, transgenic plant cells, transgenic plants and transgenic plant seeds containing novel flax seed-specific promoters. The promoters and methods are useful, for example, for altering the seed oil and protein composition in flax seed or other plant seeds.

Description

1247040 V. INSTRUCTIONS (1) Field of the Invention The present invention relates to plant genetic engineering methods for altering the composition of plant seeds. More specifically, the present invention relates to the priming gene obtained from flax, which can direct the expression of non-native genes in linseed and other plant seeds. Background of the invention

Linum usitatissimum is a commercially important oilseed crop. Another economically important raw material for flax fiber can be obtained from plant stems. Linseed oil is used for non-food purposes, such as the manufacture of varnishes and paints, and has recently been more suitable for the manufacture of some food products, such as margarine, salad oil and condiments, because of the new variety cultivated as L i π ο 1 a Therefore (Gree η (1986), Can. J. Plant Sci·, 66: 499-503). Flax is mainly used as a component of the anti-shear animal feed, while flax fiber is used to make linen. As an economically important source of raw materials, there is a need to further improve and diversify the portfolio of viable flax cultivars, on agronomic benefits such as seed yield, resistance to pathogens and low temperatures, and on the yield and quality of raw materials, To suit downstream applications. Although it has been proved by the development of the L i no 1 a cultivar, the improved flax cultivar can be obtained through the cultivation of conventional plants, but the development of an excellent agronomic plant route requires a large investment in plant cultivation due to the long-term involvement. Plant genetic engineering technology has been able to directly isolate genes from unrelated species and transfer these genes to an agronomic background, thus greatly reducing the time required to develop new cultivars. In addition, plant genetic engineering can produce products that are not naturally available from flax, such as therapeutic agents. In order to develop novel flax cultivars through plant genetic engineering,

Page 5 1247040 V. INSTRUCTIONS (2) The key point is to control the introduction of external clips & t 4 1 "The performance of the surgical or non-native genes. The required performance characteristics of the non-Texan cause, such as the non-Shishi 4 a The violent turmoil is indeed the performance level of the non-biological gene, the special plant turtle that is not represented by the non-genesis: crying, Μ B 丄 令 令 令 令 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 And the special Japanese 聋 卩拙Μ 卩拙Μ 圳 圳 圳 圳 , , , , 植物 植物 植物 植物 植物 植物 植物 植物 植物 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别, raw * ...,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, U.S. Patent No. 5,420,034. On the other hand, the performance of pharmaceutical proteins preferably requires high levels of leaf colony performance when plant leaves are harvested (see, for example, U.S. Patent No. 5,9,29,304) for manipulation of non-native genes. Performance characteristics, there are many factors that will be affected One of the factors is the selection of the transcriptional genes used. Currently, a wide range of plant-compatible mobilization genes are available, some of which are preferably recorded genes, including constitutive genes, such as the 35-S CaMV mobilization gene (Rothstein et al. (1 987), Gene 53 : 1 53- 1 6 1 ), the Genes of Genes (US Patent No. 5, 614, 399), organizes special genes, such as seed-specific genes, such as the bean sprouting genes ( Sengupta_ 6〇口31311等人 (1 985 ), “8 118 people 8 2:3 32 0-33 24), and induced genes, such as heat-induced (Czarnencka et al. (1989), Mol· Cell · Biol·9(8): 3457-3464), UV light, inducer and injury ([〇" et al. (1 989), £%60.].8(6): 164b 1648) ' or chemistry Agents such as endogenous hormones (Skriver et al. (1991), Proc. Natl. Acad. Sci. USA 88(16): 7766-7270). Other factors that can be manipulated to control the performance characteristics of non-native genes in plants, Contains transcriptional engineering factors such as intragenic regions, polyadenylation sites, and transcription termination sites

Page 6 1247040 V. Description of invention (3)

Set. The performance characteristics of non-native genes are in turn influenced by factors that influence translation, such as the binding of nucleic acid saccharide bodies, and the skew of the code displayed by the host. In addition, the non-native gene itself affects the vitality of the transformed plant, and is therefore particularly limited to the level of performance available. This problem can be overcome in a number of situations, using special means within the tissue, such as leaves or seeds, to express proteins, or to limit the accumulation of proteins in different subcellular compartments, such as cytoplasm, internal cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasmic cytoplasm Typically, it is in the presence or absence of a particular target sequence that directs the protein to such intervals. Another factor that affects performance characteristics is where the structure itself is attached to the host stain. This effect can be used to illustrate how the different plants will behave in a fluctuating level when they are transformed in the same recombinant structure.

As far as the inventors are aware, the performance of non-bensogenic genes in linseed is only contained in PCT Plant Patent Application No. WO 98/1 8948. This case reveals two stearin-mercapto carrier protein thinning enzyme (SAD) genes derived from flax. The relevant SAD priming gene sequences can be used to engineer flax and other plants to express endogenous or foreign genes. However, the method taught by W0 98/1 8948 is limited by the fact that the SAD priming gene has no seed specificity in flax and imparts expression to leaves, stems, flowers, and seeds. The performance of non-native genes can cause undesirable side effects in non-seed tissues. In addition, using SAD to launch genes, there is limited control over performance levels and performance timing. Technically, it is necessary to further improve the expression of non-native genes in linseed and other plant seeds. Summary of invention

Page 7 l247〇4〇五, invention^明(4) -一f invention is a species of non-native gene in plants;; square:; good:: Ming especially refers to non-native genes in flax: </ RTI> The present invention provides a beneficial nucleic acid sequence in a flax-operated chimeric nucleic acid construct 'in the 5, to 3, and in the direction of transcription, including (1) a special promoter gene derived from flax; and (2) a beneficial nucleic acid sequence, wherein the beneficial nucleic acid sequence seed special gene is non-tapiogenic; ^ (b) = the chimeric nucleic acid construct, introduced into the flax plant cell; (Ο使= 长长为结性的熟Under the control of the flax plant gene, it is expressed in the seed. The cook special mobilizes the acid store Ϊ Ϊ Ϊ ί 较佳 较佳 较佳 较佳 较佳 ' ' ' ' ' 发 发 发 发 发 发 发 发 发 发 发 发 发 发 发 发 授予 授予 授予 授予In the performance of the system, the hemp is similar. In the case of - with white hair gene ' or bean sprouting gene, 2s storage egg, ^ φ 匕 叙 叙 seed storage protein mobilization gene. By: side: Γ Γ: The invention provides a kind of transformation gene linseed, which is (U::nucleic acid construct, in transcription 5 To 3, 刼Connection components: u 4 Page 8 1247040 V. Description of invention (5) (1) Special genes for seed production from flax, and (2) beneficial nucleic acid sequences, wherein the beneficial nucleus seed special priming gene For non-bensogenic, the sub-chimeric nucleic acid construct is introduced into the flax plant cell; (C) the flax plant cell is grown as Cocoa, wherein the beneficial nucleic acid sequence is in the hot flax plant gene Under control, in the seed; linseed special launching In the present invention, a seed of the flax plant is prepared by the following method, the method comprising: j extracting (a) preparing a nucleic acid construct, in transcription 5, operational linkage components: universal to include (1) special genes for seed production from flax. (1) beneficial nucleic acid sequence, wherein the special substrate for the sesame seed is non-native 歹] for the sub (b) The chimeric nucleic acid construct is introduced into the cells of the flax plant; (c) the flax plant cell is grown into, wherein the beneficial nucleic acid sequence is; under the control of the hot flax plant gene, in the seed ^ now = flax Special Launching In yet another gist, the present invention provides: Genes that can be used in linseed and other plants _ = linseed linings, and for use in, for example, transformation of seeds to exhibit non-biological basal in preferred embodiments , Seed special hair == part. 1247040 V. Description of invention (6) (a) The nucleic acid sequence shown in Figure 1, Figure 2, Figure 3 or Figure 4, where T can also be U; (b) a nucleic acid sequence that hybridizes to (a) a nucleic acid sequence under stringent hybridization conditions; (c) a nucleic acid sequence that is complementary to (a) the nucleic acid sequence; or (d) a nucleic acid having a substantial sequence homology to the (a) nucleic acid sequence sequence.

In another gist, the invention provides a chimeric nucleic acid sequence comprising a first nucleic acid sequence derived from flax, operatively linked to a second nucleic acid sequence that is non-native to the first nucleic acid sequence, wherein the first nucleic acid The sequence includes a novel linseed special launching gene. Other features and advantages of the present invention will be readily apparent from the following detailed description. It is to be understood that the detailed description of the preferred embodiments of the invention, BRIEF DESCRIPTION OF THE DRAWINGS The present invention is illustrated by the following figures: Figure 1 shows the DNA sequence of a flax genome homologous plant encoding a 16.0 kDa oleosin protein;

Figure 2 shows the DNA sequence of the flax genome encoding the 18.6 kDa oleosin protein; the 苐3 chart does not encode the DNA sequence of the flax genome of the 25-stored protein; Figure 4 shows the flax of the protein encoding the 54.5 kDa soy-like protein. base

Page 10 1247040 V. Inventive Note σ) D Ν Α sequence of the group; Figure 5 shows the linseed DNA sequence

Southern blot analysis; j-detected flax genomic DNA analysis 6 shows the northern blot analysis of the special performance of linseed oil seeds; Figure 7 shows the northern blotting of the development of linseed oil in the seed 8 chart The sesame oil germination base # ^ *, the raw gluten 艿 艿 艿 甘 甘 甘 甘 — — — — — G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G

Figure 9: The (3)s expression of the gene gus fused seeds and the developing linse germs with 25 proteins; the nucleus priming gene-G us nucleus termination gene structure transfer I, the special performance of Gus tissue in the sacred flax « _ ΐ L1 diagram shows the temporary expression of GUS in the transformed flax plant that transcribes the gene-GUS nucleus to terminate the gene construct I. The 12th chart is not in the gene-Gus nuclear termination gene construct. Transformation of GUS expression in Brassica napus plants (L1 to L9); Figure 13 does not initiate gene-GUS nuclear termination gene construction with nuclear filaments

Unsuccessful seed-transformation transformation of the GUS performance in the Arabid〇pSis plant. Detailed description H As described above, the present invention relates to an improved method of expressing a non-geneogenic gene in a plant, especially a linen. The method provided by the present invention allows for the special expression of non-biogenic genes in seeds of flax. The advantage of the method of the invention is that

Page 11 1247040 Limiting it in the linseed. In addition, the performance week of the object is a two-way component of the performance. The invention provides a special germination of the scorpion scorpion, wherein the genus is non-introduced into the subsequence, which is expressed in the seed, and the genus refers to the sequence of the genus Μ@A species. Improved control of non-benign genes: the performance of the genes is limited to seeds, and thus the potential adverse effects obtained by dressing into control performance characteristics, such as the performance level of plants and non-native genes can be used in accordance with the present invention, in quality and more Valuable raw materials such as saccharides Therefore, in one aspect, the present methods of expression include: (a) Preparation of nucleated nucleic acid constructs for processing linkage components: (1) species derived from flax (2) beneficial nucleic acid sequences, special seeds of sesame seeds ( b) constructing the chimeric nucleic acid and (c) the flax plant cell, under the control of the beneficial nucleic acid gene, in the present case, "any nucleic acid that is not related to the gene of the native gene. This includes and is derived from Genes are not, and are derived from the same wild-type (non-transformed) plants as the genes that are priming. The methods provided by non-native plants or tissues are Reprogramming a non-bensogenic gene. The method of the present invention is particularly related to the beneficial nuclear nucleus in the oil, protein seed, in the 5, to 3, and in the direction of transcription, including the gene; and the nucleic acid sequence of the pro-negative; The mature linseed plant of the linseed is a special genital genus. Normally different from the seed specific RNA or DNA sequence of the different nucleic acid sequence, j homologous nucleic acid sequence, but because of irrelevance.

1247040 V. Description of invention (9)

When a non-native nucleic acid sequence is linked to a seed-specific germinating gene, it will result in a heterozygous structure. The chimeric construct is introduced into the flax plant cells to produce the transformed gene flax plant cells, so that when compared with the non-transformed flax plant cells or the flax plants grown thereby, the flax plant cells of different phenotypes can be detected or grown therefrom. Flax plant. The immediate nucleic acid sequence that is identical to the nucleic acid sequence of the post-construction is not present in the non-transformed flax plant cells or the flax plants grown thereby. In this aspect, the chimeric nucleic acid sequence comprises a sequence comprising a numerator gene linked to a nucleic acid sequence obtained from another plant species, or a nucleic acid sequence derived from flax but which is usually not associated with the priming gene. The chimeric nucleic acid sequences used herein further comprise a sequence comprising a flax-launching gene and a nucleic acid normally associated with a priming gene, but additionally comprising a non-neogenic nucleic acid sequence. For example, if the germination gene is a linseed-specific oleagin-producing gene, the linseedin-initiating gene is a "non-native" sequence, and also contains a sequence of fusion between linseed oil genes naturally associated with the oil-producing gene. And useful coding sequences that are not naturally associated with the priming gene. The non-negative term also means that the above-described fusion gene is included, and a cleavage sequence is included, which separates the nucleic acid sequence normally associated with the priming gene sequence from the gene encoding the beneficial protein.

The term "nucleic acid sequence" refers to a series of nucleotide or nucleotide monomers consisting of naturally occurring bases, sugars, and intrasaccharide (backbone) linkages. This term also includes modifications or substitution sequences, including non-naturally occurring monomers or parts thereof, which have similar functions. The nucleic acid sequence of the present invention may be ribonucleic acid (RN A) or deoxyribonucleic acid (DNA) and may contain naturally occurring bases including adenine, guanine, cytosine, thymine, uracil. This sequence may in turn contain modified bases

Page 13 1247040 V. Description of the invention (10) 2~propyl and azouracil 4 monothiourethane, such as xanthophylls, hypoxanthine, 2-aminoadenine' 6 - oxidine other alkyl Adenine, 51 uracil, cell pyrimidine 6-chaotic cytosine and 6~nitrothymidine base, pseudouridine 8-halide adenine, 8-aminoadenine, 8-sulfate gland ▲ adenine, 8-hydroxyl Adenine and other 8-substituted adenine II: ~sulfanyl, 8-aminonirum, 8-thioguanine 4,8-thiol: 嗓呤:? Ostrich crickets: and other 8-substituted guanines, other nitrogen and denitrifying urine; genus-based adenines, cytosines, adenines or guanines, 5^tris uridine and 5-trifluoro Cell pyrimidine. - The special emission gene of difluoromethyl seed means that the gene is controlled by the gene, and the gene is mainly expressed in the seed of the plant tissue which has no or substantially no performance in other plant tissues, and is generally expressed in the overall performance. The level is below 5%. In another gist, the present invention provides novel linseed special priming genes useful for expressing non-native genes in linseed and other plant seeds. The priming gene can be used to engineer a protein, oil, or polysaccharide component such as a seed. In a preferred embodiment, the seed specific priming gene comprises: (a) a nucleic acid sequence as shown in Figure 1, Figure 2, Figure 3 or Figure 4 wherein T can also be U; (b) and (a) a nucleic acid sequence complementary to the nucleic acid sequence; (c) a nucleic acid sequence substantially homologous to the (a) or (b) nucleic acid sequence; (d) a nucleic acid sequence identical to the nucleic acid sequence of (a) (b) or (c); (e) A nucleic acid sequence which hybridizes to (a) (l)) (c) or (d) a nucleic acid sequence under stringent hybridization conditions. - "substantially homologous sequence" means slightly different from the sequence in (a) or (b)

1247040 V. INSTRUCTIONS (11) Nucleic acid sequences of sequence variations that are negligible, i.e., sequence functions, are substantially identical and can drive seeds to specifically express non-neogenic nucleic acid sequences. This variation is due to local mutations or structural modifications. A nucleic acid sequence having substantial homology, comprising a nucleic acid sequence that recognizes at least 65% of the nucleic acid sequence shown in Figure 1, Figure 2, Figure 3 or Figure 4, preferably at least 85%, and at 90-95% the best. "Hybridization sequence" refers to a nucleic acid sequence that hybridizes to (a) (b) (c) or (d) sequences under stringent hybridization conditions. Appropriate "strict hybrid conditions" that can initiate dn A hybridization are known to those who are good at this road, and can also be found in Current.

Protocols in Molecular Biology, j〇hn Wiley &amp; Sons, New York (1 9 8 9 ), 6 · 3 · 1 — 6 · 3 · 6. For example, the following can be used: about 4 5 . (: 0.000 χ gasification sodium / sodium citrate (SSC), followed by 2 ° 〇χ SSC at 50 ° C. Strictly selected according to the conditions used in the washing step. For example, the 步骤 concentration of the washing step is Highly rigorous, optional 5 (rc is about 2x SSC. In addition, the temperature of the washing step is about 65 ° C under high temperature conditions. "Nucleic acid sequence of the same kind" means (a) (b) * The sequence of (c) compares the engineered nuclear I sequence 'where the transformation does not alter the utilization of the sequence (ie, the seed-specific gene). The engineered sequence or the like may outperform (a) (b) or (c) Improved performance of the sequence shown. One of the modifications of the same type is to modify bases such as luteal, hypoxanthine, 2-aminoadenine, methyl, 2-propyl and other alkyl adenines 5 ~ Halopyrimidine, 5-halofluorocytosine, 6-nitrogen urinary cancer bite, 6-aza-cytosine and 6-nitrothymidine base, pseudo-pyrimidine, 4-thiourea shout, 8-halogen adenine, 8~ Aminoadenosine, 8 嘌呤, 8-thioalkyl adenine, 8-hydroxyadenine and other 8-substituted adenines

Page 15 1247040 V. INSTRUCTIONS (12) ^ 呤, 8-halogenated guanine, 8-aminoguanine, 8-thioguanine, 8-thioalkylguanine, 8-cyanoguanine and others 8 - Substituting guanine, other nitrogen and denitrifying urinary bites, thymidines, cell squirrels, adenines or guanines, 5-trifluoromethyl urinary sputum and 5-trifluoromolecular spray bite. One of the naturally occurring bases (i.e., adenine, guanine, cytosine, or thymine) of the sequence shown in Figure 1, Figure 2, Figure 3, or Figure 4.

Another modification is in the nucleic acid molecule shown in Fig. 1, Fig. 2, Fig. 3 or Fig. 4, in a phosphate lactic acid skeleton, a short-chain alkyl group or a cycloalkyl sugar bond, a short-chain hetero atom or a hetero The inter-cyclic sugar bond contains modified phosphorus or oxygen atoms. For example, the nucleic acid series may contain phosphorothioate, capric acid triester, methyl phosphonate, and dithioacid acid. Another example of a nucleic acid molecule of the present invention is a peptide nucleic acid (ρΝΑ) in which a deoxyribose (or ribose) carboxylic acid skeleton in DNA (or RNA) is substituted with a similar polyamine skeleton as seen in the peptide (ρ· Ε · Nielsen et al., Science 1991, 254, 1497). PNA shows resistance to enzyme degradation,

Lifespan can be extended both in vivo and in vitro. Due to the lack of mutually exclusive charge between PM and DNA, PNA can also bind more strongly to complementary DNA sequences. Other nucleic acids The same type may contain nucleotides and contain a poly- orbital skeleton, a cyclic skeleton or a non-type skeleton. For example, a nucleotide may have a morpholine skeleton structure (U.S. Patent No. 5,034,506). The like may contain, for example, a reporter population to remove the pharmacokinetic or pharmacodynamic properties of the nucleic acid sequence. In another gist, the invention provides a chimeric nucleic acid sequence comprising a first nucleic acid sequence derived from flax and operably linked to a second nucleic acid sequence which is non-essential to the first nucleic acid sequence, wherein the first nucleic acid sequence Including novelty

1247040 U Ming Description (13) ----- Flaxseed special launch beauty &quot; ------__ a picture, 3rd picture and flute, because. The priming gene is preferably selected from the group of the mobilizing gene of Fig. 4, which includes the nucleic acid sequences of Fig. 1 and Fig. 2 . *Dynamic gene group or noisy under severe conditions 2 According to the present invention, 'in the media, the disc protector* embedded 5 nucleic acid sequence can be known as a scorpion containing a 4 * preserved in the seed cells have a good table Silver added to the reorganization table = each reorganization of the performance media, issued in the white, two: performance. In the present invention, the chimeric nucleic acid sequence of the invention. The expression of a seed in the seed is suitable for the performance in the seed cell. "The word "special" 4 contains the invented scent of the present invention. The recombinant performance is based on the county worker, the nucleic acid sequence, the regulatory region and the termination zone. The media spit the field and chose to 'operate with the nucleic acid sequence encoded by the desired amino acid f. The operational linkage is intended to be; the chimeric nucleic acid sequence of the poly-code of the 黾 composition is linked to the regulatory sequence and to the end: two polymorphic intracellular expressions. The typical 槿, 生.古W'谷许 in the seed, the structure of I is attached to the 5' to 3' direction of the regulatory region of the 邕矣 phase in the plant, including the polypeptide writing region and '= The effect occurs in the cells. Constructions such as &amp; can be made according to methods well known in the art of molecular biology, see, for example, Sambrook et al. (199 〇), Sub-Replication, Second Edition, Cold Spring Harbon. Constructed &amp; related technologies such as restriction digestion, ligation, gel electrophoresis, occupational a-alignment and PCA. There are a variety of copy media available to make the necessary copy steps. Particularly suitable for this purpose are replication media with repetitive systems that are effective against E. coli, such as pBR322, pUC series 'M13mp series, pACYC 1 84, pBluescr ipt, and the like. Nucleic acid sequences can be introduced into such media, and the media can be used to transform E. coli grown in a suitable matrix. 1247040 5, invention description (14) ^^ ----- to introduce plant media, and integrate into plants Rong. 11 and R i plastid phase According to the present invention, the non-geneogenic gene is carried out in linseed using any linseed specific germination gene, and is not limited by the method and the mobile gene. In a preferred embodiment of the invention, the special priming gene confers a non-native nucleic acid sequence with at least one sputum, linseed, and the native priming gene confers a characteristic or consistent expression of the native nucleic acid sequence. As used herein, "performance characteristics" refers to any measurability of a flavonoid-specific property similar to the nucleic acid sequence to which it is operatively linked! : Genetics Therefore, in a preferred embodiment, the non-native nucleic acid sequence effect. To. The timing of the expression of the -Uti nucleic acid sequence is similar or "the same as the expression of the original nucleic acid U water L: the performance level of the original nucleic acid sequence. In the system, the non-native gene is equivalent to the light. In another special degree, such as temperature change, tissue damage: variable wavelength or light hormone and insecticide B, similar to Bunsen's 眭: 2 concentration', such as plant response.丨 linseed special = sequence of these stimulating properties, where the essence of the Tao is recognized, knowing 5 = μ, he * needs to show the genes. Therefore, it is possible to use a linseed, a flavonoid-specific protein-related mobilizing gene which can be used in the present invention, such as: a gene, which contains a protein containing a broad bean protein and a bean protein, and a protein and a globulin, which are not related to the seed. Start a gene, such as oil. And genes associated with seed storage protein metabolism, such as aviation, are beneficial to fatty acids such as enzyme-based carrier protein (ACP), full

1247040 V. INSTRUCTION DESCRIPTION (15) and enzymes, desaturase, and elongation enzymes are preferred embodiments of the present invention. The gene for the gene, the bean protein-like seed storage, and the special promoter gene are the oil-promoting genes. In the characteristic priming gene, or 25 stores with the first, second, third or second two seed special priming genes and hybridize under strict conditions, What nucleic acid sequence is available. Any of the various nucleic acid sequences can be obtained by using other flaxseeds in many ways. Linseed protein 2 kines. These genes are motivated, so that nucleic acid probes can be designed to partially enhance the rna and sub-species that are particularly relevant to the seed when the separation is detected. In order to further deduct mRNA or cDNA/Hi cells from the non-seed cells = preparation of CDNA, the sequence can be separated and related::: Maine V can obtain known seed-specific genes for cDNA hybridization, so that other plant species DNA can be used. The library, followed by a μ 4 , genomic tissue made of linseed tissue to isolate its related genes. Because the seed has a sequence of m. ^ Also through the random arrangement of the cDNA library of the pockmarks, get the CDNA sequence of the known protein storage protein sequence, and sin the female gene. A database containing sequence information from, for example, Arabidopsis*i Mei I = 4 columns, can be used to search for known seeds, ii hu / or genes, and information can be used to characterize the genes in the sequence of ice. sequence. A novel alternative gene can be found by using a workaround to isolate the other special gene, and a novel genital gene can be found and used in accordance with the present invention. Page 19 1247040 V. INSTRUCTIONS (16)^ _____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ Any sequence encoding an enzyme or a coding sequence may be a sequence complementary to the genomic sequence, wherein the genomic complement sequence may inhibit the trans-two-two gene internal region, the non-coding precursor sequence, or any sequence to the A-heart knife RNA. Processing, such as splicing or translating fragments, for example, one. The beneficial nucleic acid sequence can likewise be the property of a natural sequence nucleic acid, ♦ S catalytic domain or a particularly important structure. Depending on the preferred symbol, the sequence can be synthesized by using the plant preferred identifier. Plants are determined by the maximum amount of protein in the highest frequency of the plant. Beneficial Nucleic Acid Skins ^ The method of the invention expresses 2 various recombinant protein encodings. A protein that can be used for efficacy, or an example of a protein of the group &&; contains a desirable catalytic white matter. And the right gift # Ϊ 到 到 Ϊ Ϊ :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: :: The new phenotype includes such modifications as changing seed proteins, seed oil components, seed polysaccharide composition damage, enhancing the production of pre-existing desired products or properties, and using antisense, ribozymes, co-suppression technologies, products or properties Reduced or even suppressed, antisense see izant* Weintraub (1 984), Cell 26. 1007-1015; ribozyme see Hazelhoff and Gerlach (1988) Nature 334: 585-59 1 ; co-inhibition see Napol i et al. (1 99 0 ) Plant Cells 2 : 2 7 9 - 2 8 9 . It is expected that the desired protein can be expressed in all embryonic tissues, although various cell types can be detected in different embryonic tissues such as embryonic axis and villus leaves.

Page 20 1247040 V. INSTRUCTIONS (NO. Advantageous nucleic acid sequences can be expressed at any stage of seed development. The timing of expression f depends on the particular use of the invention. The enzymes involved in oil engineering may be required for early seed development. For example, in addition to the priming gene region and the beneficial nucleic acid sequence, the nucleic acid sequence that can terminate transcription is typically contained within the expression medium before the seed storage protein is accumulated. The transcription termination gene is about 200 to about 1, purine nucleoside Acid base pairs are preferred and may include any sequence that is effective in plants, such as the leucovorin synthetase termination region (Bevan et al.

(1984), Nucl· Acid·Res·11: 369-385), the crotonin termination gene (van der Geest et al. (1994) Plant J·6(3): 413-423), root treatment of Agrobacterium The gene is used to terminate the gene, or other similar functional elements. Such transcription termination gene regions may be as described by An (1987) in Methods in Enzym, 153: 292, or may be present in commercially available plastids from ClonTech, Palo Alto, California. The selection of an appropriate termination gene has the effect of transcriptional evaluation. The chimeric construct may in turn include potentiating factors such as AMV precursors (Jobling and Gehrke (1 987), Nature 325: 622-625) or intragenic regions. It is to be noted that the δ of the performance media depends on factors such as the choice of plant variety and/or the variety of species to be expressed. '

Performance media often also contain marker genes. The marker gene includes all genes that can be transformed from non-transformed cells to transform plant cells, including selectable and greedy marker genes. For convenience, the marker may be resistant to herbicides such as glyphosate or phosphinothricin, or to antibiotics such as connamycin, G418, bleomycin, hygromycin, chlorophyll, etc.

1247040 V. INSTRUCTIONS (18) 'Special qualities that can be selected using chemical means. Screening criteria can be used to visualize transitions through observation. Contains, but is not limited to, /3 - urinary acidase or //id A gene, serotonin gene or green fluorescent protein (Niedz et al. (1995), Plant Cell Rep. 14: 403). In order to introduce nucleic acid sequences into plant cells, there are various techniques in general. Agrobacterium colonies of flax plant cells have been reported, and according to Dong and McHughen (1 993), Plants: Transformation: 61-77 teaches that flax transformation can be obtained, although it is also scientific. Technique (see below), the chimeric DNA construct 5 is inserted into the cell. Into the linen, according to the knowledge of the people of this road, the cultivation of agricultural practices can allow the knot. Flax-type flax is available from mature flax plants with respect to the desired changing properties of wild-type seeds. And analysis plants can be crossed or self-grown for two or more generations to achieve the desired phenotypic properties of A and lines, including the production of recombinant polypeptides. The homozygosity of cypress plants in plants to ensure the continued inheritance of recombinant traits. = To determine the method of sex plants, for the experts who are skilled in plant cultivation techniques, choose homozygous alternate auto-insemination and select anthers and microspores. Litit: Contains the transformation of cells or tissues, followed by regeneration of unit cell saplings, followed by early carcass means (for example, treatment of any known homozygous plants with colchicine or other microtubule cleavage agents. J' may also be obtained The invention also encompasses transformational methods made according to the following methods: u linseed, (a) preparation of chimeric nucleic acid constructs, including in the 5, to 3,

L247〇4〇五、发明说明(10) Operational linkage (1) by (2) having hemp (b) inserting the embedding It is composed of oil. Special Figure 4 is shown. The invention further comprises the following steps: (a) preparing a nesting operation (1) by (2) having a hemp (b) the inlaid component: flax obtained a nucleic acid sequence seed special hair-binding nucleic acid constructing a plant cell sequence, In the person. In the specific example, the following nucleic acid structure is composed of the 2S storage gene and the priming gene sequence: the seed nucleic acid sequence of the flax is obtained, the seed special hair nucleic acid structure and (c) the flax plant cell is specially launched. Gene · 'The beneficial nuclear 竣 kinetic gene is a non-native sequence of this sub-, into the flax plant 蝻 细胞 cells; to grow into a knot 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰 孰Under the control of soil factors, the seed special hair-free protein-free mobilization base is selected from the sub-bean-like seed storage protein protein as shown in Figure 1, the second kinetic base 24 'Fig. 3 and the seed shown in the method To the hemp plant, the square, in the 5' to 3 transcription, the universal direction includes the special promoter gene; and wherein the beneficial nucleic acid stimulating gene is non-native; ^ the sub-introduction into the flax plant cell; Ripe flax plants with knots.

1247040 V. INSTRUCTION DESCRIPTION (20) wherein the beneficial nucleic acid sequence is expressed in the seed and in the seed. Initiating the control of the gene, the present invention provides a novel priming base as shown in Fig. 2, Fig. 3, and Fig. 4 under the plant system other than flax; The invention also encompasses the construction of chimeric nucleic acid constructs, including egg methods. Therefore, the genes shown in Fig. 3 and Fig. 4, as well as in Fig. 1, and in plant varieties other than flax, and: 2 nucleic acid sequence: expression of hematopoietic gene control in a seed-specific manner of beneficial nucleic acid sequences According to another aspect of the present invention, there is provided a method of intra-subsequent expression comprising: a nucleic acid sequence in a plant (a) for preparing a chimeric nucleic acid construct, in a transcriptional 5, an operational linking component, a direction comprising a w ( 1) Seed-specific germination gene, selected from the group of serotypes: The following 1 seed traits (i) are as shown in Figure 1, Figure 2, and the acid sequence, where T can be u or Figure 4 ( 1 1) The core (iii) complementary to the (1) nucleic acid sequence is substantially identical to (i) or (· x jun sequence; acid sequence; nucleic acid sequence homologous core (b) and (i) (ii) or (iii) a nuclear sequence; (a) a nucleotide sequence of the same type (v) hybridized with an acid (iv) nucleic acid sequence under stringent hybridization conditions (1 } (1 i ) (2) the beneficial nucleic acid; 'x &amp;sequence; or

1247040 V. INSTRUCTIONS (21) (b) introducing a chimeric nucleic acid construct into a plant cell; (C) growing the plant cell into a mature plant capable of knotting, wherein the beneficial nucleic acid sequence is a gene that specifically emits the seed Under control, the person is represented in the seed. There are various techniques for introducing the nucleic acid sequence, particularly DNA, into a general plant host cell. For example, chimeric DNA can be constructed using standard Agrobacterium to transform experimental programs, such as Moloney et al. (1989),

Plant Cell Rep· 8: 238-242, or Hinchee et al. (1988) ^〇/1^ by 11〇1,6:9 1 5-922, or other techniques known to the expert, to introduce dicotyledons such as tobacco , and host cells obtained from oily varieties such as Brass丨ca napus. For example, the use of T-DNA for plant cell transformation has been intensively studied, as detailed in £ 012 0 516, 11〇 61^111 &amp; et al. (1985), Binary Plant Media Systems, 5th Early 'Albra Kauters BV Press, Sedan; Knauf et al. (1 983) <Gene analysis of host performance using Agrobacterium>, see Molecular Genetics of Bacterial and Plant Interactions, 245 pp., A· Puhler et al., Springer, New York Society; and An et al. (1 985), EM BO J. 4: 277-2 84. Agrobacterium transformation can also be used to transform monocotyledonous varieties (US Patent No. 5, 5 9 1, 6 16). For convenience, the implant is rooted in Agrobacterium or rooted soil rods for planting in a plant host cell. After the transformation of the Agrobacterium, the plant cells are dispersed in a suitable matrix for selection, and then the flesh, branches, and finally the plants are restored. The Agrobacterium host is housed in a matrix that includes the vitality (Vir) gene necessary to deliver T-DNA to plant cells. For injection and tlectroporation (details),

1247040 V. INSTRUCTIONS (22) Introduce the detached Ti-plast (the tumor-deficient gene, especially the T-DNA region) into plant cells. Using the non-Agrobacterium techniques, it was possible to obtain transformation and performance within various monocotyledonous and dicotyledonous plant varieties using the above construction. These technologies are particularly useful for the transformation of tough plant varieties in Agrobacterium transformation systems. Other techniques for gene delivery include particle propagation (Samford (1 988), Biotechnology Trend 6: 299-302), electroporation (Fromm et al. (1985), PNAS USA 82: 5824-5828; Riggs and Bates (1986) , PNAS USA 83 : 5 6 02-5 6 0 6 ), PEG intervening DNA uptake (Potrykus et al. (1985), Mol. Gen. Genetics, 199: 169-177), microinjection (Reich et al. Bio/Techn) · (1986) 4: 100 Bu 1004), and carbonized fossils (Kaeppler et al. (1990) Plant Cell Rep. 9:415-418). In further special applications such as rapeseed, the goal is to accept reorganization. The host cell of the DN Α construct is typically derived from the cotyledon stalk as described by Molony et al. (1989) Plant Cell Rep. 8: 238-242. Other examples of the use of commercially available oilseeds include cotyledon transformation in soybean cultures (Hinchee et al. (1988) Bio/Technol, 6: 915-922), and stem transformation of kapok (Umbeck et al. (1 9 8 7 ) Bio /Technol, 5: 263-266) ° After transformation, cells (eg, in leaf discs) grow in selective media. Once the buds are started, they are excised and placed on the rooting medium. After forming a sufficient root, the plants are moved to the soil. Test whether the hypothetical transformed plants have signs or not. Southern blotting of genomic DN A using appropriate probes

Page 26 1247040 V. INSTRUCTIONS (23) shows the genome integrated into the host cell. The methods provided by the present invention are applicable to a wide variety of plant varieties. The particularly preferred plant cells used in the present invention comprise cells of the following plants: soybean (Glycine max), rapeseed (grassica napUS, Brassica campestris), sunflower (Helianthus annus), kapok (Gossypium hirsutum), maize (Zea mays), tobacco (Nicotiana). Tobacum), Medicago sativa, wheat (Triticum sp.), ryeum (Hordeum vulgare), oatmeal (Avena sativa L.), sorghum bicolor, Arabidopsis thaliana, Solanum sp. Linum usitatissimum &quot;Carthamus tinctorius, Eleais guineeis, Arachis hypogaea, Bertholletia excelsa, Cocus nucifera, Ricinus communis, Hu Curiandrum sativum, Cucurbita maxima, Simmondsia chinensis, and Oryza sativa. The invention is versatile and includes improving the intrinsic value of plant seeds, utilizing cumulatively altered polypeptides or novel recombinant peptides, or utilizing addition or elimination or metabolic steps. Using the present invention, improved protein quality (e.g., increased concentration, basic or rare amino acids) can be achieved by modifying the fatty acid composition to improve liquid quality, improving or enhancing the sugar component. Examples include, for example, in seeds lacking sulfur-containing amino acids, which exhibit sulfur-rich proteins such as those found in lupin or Brazil. It can also be achieved by expressing a protein or protein fragment rich in basic amino acids such as lysine, cysteine, methionine, and tryptophan.

1247040 V. Description of invention (24). In addition, the fat can be expressed as fat 醯 酶 酶 酶 , 是 是 是 : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : Similarly, the peptide may be fragmented or derivatized, or the native proteinaceous material may include, but is not limited to, an anticoagulant, such as an antibody that is hydrolyzed by diphtheria to 3 early propagation, and antibody fragments, vaccines, fine fcDpf / Λ Factors such as bovine growth factors, bilirubin-induced differentiation due to alizarin: two factors: nutritional factors (NTF), fibrous tissue growth factor (G CSF), four long factors, gonadotropin, granulocyte bacterial stimuli ΓϋΙ ^ cell giant python, cell flora stimulating factors (GM-csn host growth hormone, interfering virus protein a (IFN-α), interference disease: ί : ί (IFN 一点), interference virus tropin r ( IFN-r), the middle gate accounts for 1 士, 1 alpha (1L1 _ α ), intermediate leukocytein 0 (IL1 - p ), intermediate η-2 (IL_2), intermediate leukocyte _3 (il_3), middle White blood hormone-4 (IL-4), intermediate leukocyte _5 (IL_5), intermediate leukocyte _6 intermediate leukocyte _l〇 (IL-10), leukemia inhibitory factor (lif thioredoxin, macrophage colony stimulation Factors (m-CSF), bone marrow mononuclear blood cell growth factors, nerve growth factors (NGF), onc〇statin Μ, gray plate derived Factors (PDGF), cytokines, transformational growth factors Q: (TGF - α), transformational growth factors 泠 2 (TGF - / 32), tumor necrosis factor α (TNF-α ), and tumor necrosis factors (TNF - Cold). Pharmaceutically useful proteins also contain mammalian proteins, such as, but not limited to, α-丨-pancreatic eggs, page 28, 1247040. 5. Inventions, enzymes, ammunition, hemoglobin, industrial amylase, sugar hydrolyzation, Hydrogenase, lactose, semi-fibrin, lyase, lysine, leucovorin, leucovorin, leucovorin, intestinal protein, insulin, white matter, but not limited to alpha-glycosidase, chitin , rennet enzyme 'α-galactose glucomannan enzyme, isomerase, oxidase lyase, enzyme, branched i oredox i η, (25) 素' anti-obesity protein, elastin, human serum albumin And peptides useful on the lung surfactant egg, including, powdered glycogen, glycoside, cellulose enzyme, hormone, endoglucan enzyme cold ~ galactose enzyme, vegetarian, stomach Fatase, enzyme, hydrolyzate, enzyme, lysozyme, pectin enzyme, pectin phytase, protein acid protein enzyme, th' and xylanase

Ml, gelatinous, glia-like glandular enzyme, fibrinolytic iron, muscle cell-house powder enzyme or other contact enzymes, fiber B, condensed milk protein enzyme, galactose enzyme, glucosidase, or other half, glucose Isomerase, woody enzyme, fat, oxidoreductase, hydrogen peroxide enzyme, sputum amylase, reductase transferase, pancreatic egg to illustrate the invention of this special cDNA library separate from the seed special (9) "asexual reproduction. Fine tools (blast), out of sequence, using basic local alignment to search for comparison. And these sequences are shown with the amino acid sequence in the public database such as 汕31^, with == comparison = by several kinds of separation CDNA deduced - low in oil, 2S-protein and soy protein storage

1247040 Five 'Shuangming Description (26) The ϊ i sub-quantity has a high degree of similarity. A probe was prepared from a (partial) cdna encoding oil f, protein and soy white, used to screen for genes made from the flax line Forge, which is homozygous for the tetraterpene resistance gene = ^ (Anderson Et al. (1 997), Plant Cells 9: 64 651). = Several positive and asexual reproduction lines, which are checked after highly rigorous screening. The attached body is sub-sexually propagated into the plastid media pBlaescript and the sequence is discharged. The sequence information revealed that the present inventors have separately isolated the genomic counterparts of the oil, 2S protein and cDNA ugly cDNA. Figures i and 4 present sequence information for the genomic clonal line, respectively, containing sequences encoding high and low molecular weight oil isoforms, 2 S proteins, and soy-like genes. Figure 1 shows the DNA sequence of the flax genomic cloned line, encoding the 1 6 〇 kDa oleosin protein (low molecular weight or l isoform). Characterizes and indicates a virtual regulatory element, including a reverse gene repeat (base pairs 805 to 813 and 821 to 829; base pairs 1 585 to 1 866 and 1877 to 1 885), forward gene repeats (base pair 184 to 193 and 1102 to 1111; base pairs 393 to 402 and 1701 to 1710; base pairs 683 to 692 and 1546 to 1555; base pairs 770 to 781 and 799 to 810; base pairs 955 to 964 and 1936 to 1945; Base pair 1483 to 1 496 and 1513 to 1 52 6 ), abscisic acid response element (ABRE) (base pair 1 85 9 to 1 866), CACA box (base pair 1 933 to 1 936), TATA box (base pair 1 92 5 to 1931), and CAT box (base pair 1989 to 1993). For the same reason, the polyadenylation signal (base pair 3 0 2 0 to 3 0 2 5 ) is indicated. The open reading frame is interrupted by a short gene inner region (with a marker), while the B gene outer region is translated and indicated within the I UPAC single word amino acid codeword. Figure 2 shows the DNA sequence of the genus clone of the flax genome, for 18.6

Page 30 1247040 V. INSTRUCTIONS (27) kDa oleosin protein (high molecular weight or heterogeneous) coding. Characterize and indicate virtual regulatory elements. These include forward gene repeats (base pairs 14 to 25 and 1 42 7 to 1438; base pairs 80 to 89 and 1 24 2 to 1451; base pairs 177 to 186 and 837 to 846; base pairs 1281 to 1290 and 1242 to 1251; base pairs 1591 to 1600 and 1678 to 1287). The open reading frame is not interrupted by the intragenic region, but is translated and indicated in the I UP A C single word amino acid codeword. Figure 3 shows the DNA sequence of the flax genome clonal lineage, encoding the 2S reservoir protein. The nucleotide sequence of this clonal propagation line reveals an open reading frame with 丨7 4 amino acids, showing homology to the plant 2 S storage protein group. The sequence encodes an open reading frame with 38% overall similarity for Brassica oleracea 2S storage protein, including complete preservation of glutamine-extended QQQGQQQGQQQ. In addition, the 2S storage protein mobilization gene contains several virtual promoter regulatory elements. These include AT-rich gene repeats (base pairs 25-36, 97-108, and 167-190), RY-like gene repeats (base pairs 240-247), G box-like elements (base pairs 274-280), Seed special box-like motives (base pair 285-290) and TATA box (base pair 327-333). Figure 4 shows the D N A series of the genus clonal lineage of the flax genome, encoding the 54.8 kD a flax-like seed storage protein. The ugly seed storage protein gene is also known as the "nuclear filament". The deduced amino acid series of the nuclear gene, and the soy protein from R. communis, from the precursors of M. salicifolia, Q. robur and G. hirsutum, from the surface protein of 0· sativa, And 12S seed storage proteins from A. thaliara were compared and compared. The sequence of the nuclear gene is taken from R. communis, Μ. salicifolia, Q. robur, G· hirsutum,

Page 31

1247040 V. INSTRUCTIONS (28) 0 · Corresponding protein identity/similarity of sativa and A · tha 1 iana, 59/15, 47/16, 50/17, 45/17, 43/18 and 43 respectively /18 percentage. Characterize and direct the activation of virtual regulatory elements within the gene region. These include reverse gene repeats (base pairs 265-276 and 281-292; base pairs 513-524 and 535-545), gene duplications (mineral pairs 1349 - 1360 and 1367 - 1378; base pairs 1513- 1529 and 1554-1572), abscisic acid response element (ABRE) (base pair 1223 - 1231), soy box (RY gene repeat) (between base pairs 1223 and 1231), possibly pea globulin box (base pair 1887-1 894), CAAT box (base pair 1 782-1 785), and TATA box (base pair 1966-1970). Similarly, the signal peptide (base pair 2〇34-2080) indicating the target of the ER membrane. The open reading frame is interrupted by 3 short gene internal regions (with markers) and the 4 gene outer region is translated and indicated within the IUPAC single word amino acid codeword. Figure 5 shows the southern blot analysis of flax genomic DNA. Digested from leaves of 60&quot;g flax genome dNa, digested with EcoRI (lane 1), Hind melon (lane 2) and BamH I (lane 3), loaded with Gong #欠,苦r K. - qT πμα. ^ ν Each road. (Α) carried out with a random pre-32 不 standard not 3Τ cDN Α (South Molecular Sub-factor oil de-exposed agent, ^ if 4 320^ - 71? 脎 / by isotype) hybridization. (B) Carrying a random pre-P private 7R CDNA (low molecular weight linseed oil confirmed 3T (high molecular weight oil Xinxin, know 7I?r you'I total ^^ miscellaneous,, mouth fruit field f soldiers) and 7R (low-molecular-weight oil-type isoform) oil-tone cDNA hybridizes with flax genomic DNA. In particular, 1 L represents the 2 replication genes in flax, which can be represented by each of the two: //Tian\Dou is visible in the second zone. Similarly, tAMA has multiple genes, because each digestion detects multiple bands. Figure 6 shows the analysis of northern blots of linseed oil

1247040 V. Description of invention (29). Diolein mRNA enters rod R, root in different tissues; C, cotyledon 4, leaf 1, ^% hybrid. Note never - same tissue, total RNA. The membrane is encoded by (A) high molecular weight buds, extracted 10 &quot; consistent with the indicated code sequence, and (B) = ^ ftH) (with Figure 2 and the code sequence shown in Figure 1) Consistently) Detecting 1 is a sub-quantity (L)-shaped cMA and a germ-containing internal table. The two transcriptions are only in the germ embodiment 3. The linolenic oil development of Pa1 in the northern progeny seed development period The performance of the northern π point knife analysis. Each channel in the agarose &quot; g total RNA, stain in the Hyb〇nd broken plastic 乂 loading maternal 15 ^ 32p &amp; γτρ^® - / λ ji; ^ on the membrane. i〇J.). This diaphragm Ξ Ξ)? The anaesthetic reproduction line of ruthenin cDNA (low molecular weight is the number of days after flowering (ΜΑ). (3T): each channel is packed on agarose/formaldehyde gel)

Hybond Ν+diaphragm ±+ 15"g total RNA, staining is the highest in the flax stage cotyledon stage indicated by 32p &amp; CTP by symplectic diaphragm and the cotyledon stage in the pupa stage.) After 16_2〇DPA, take large Declined to 22 DPA (mature embryo). Under the control of the animal, Θ - (1990) "t-bone molecular biology technology (for example, see ^ heart (7) to et al.) made a sickle - scorpion asexual reproduction" The second edition, C〇ld Spring Harb〇r produces a 'construction of enzyme digestion, ligation and polymer leaven

1247040 V. INSTRUCTIONS (30) Prime-chain reaction (PCR). Construction of pSC 54: cold-uridine glycate enzyme information writing sequence from media GUSN 3 58 &gt; S (Clontech Laboratories), placed in the promoter gene sequence from nucleotide 2 1852 and the termination gene sequence from 2395-3501 Between (as shown in Figure 1). This attachment is vegetatively propagated into pBluescr ipt, and the resulting media is called pSC 54. Construction of pSC 60: Lu-urethane acetate enzyme information writing sequence from media GUSN 358&gt;S (Clontech Laboratories), placed between the promoter gene sequence from nucleotides i-2023 and the termination gene sequence from 2867-3925 (Such as

Figure 2 shows). This attachment is vegetatively propagated into pBluescr ipt, and the resulting media is called pSC 60. PSC 54, PSC 60 and the GUS construct with a sparse gene (control) were introduced into the flax germ by particle propagation using standard experimental protocols (see, for example, Abenes et al. (1 9 97) Plant Cell Report 17 : 1_7) . Figure 8 shows the GUS activity of the sub-emergence germ spread with PSC 54, PSC 60 and the non-acting gene GUS construct, measured 48 hours after particle propagation. It can be seen that the oil regulatory sequence is sufficient to drive GUS to manifest in the flax germ. 1

Example I Modulatory β of Protein Genes

Urinary Glycolate US) Stabilized $ pants in flax and Arabidopsis; special performance from the 5, and 3, regions of the sputum fragment shown in Figure 3, pressed into the media GUS pBll〇1 media, made _ information gene structure . Into the 5th, 400 bp amplicQn from the DNA fragment shown in Figure 3,

Page 34 1247040 V. INSTRUCTIONS (31) Use the following primers to amplify (position as shown in Figure 3): 5' Primer (1): 5'-TCCACTATGTAGGTCATA-3' 3' Primer (1): 5, a CTTTAAGGTGTGAGAGTC The -3' PCR primer also contains Hind® and Bam HI restriction sites for the vegetative propagation of 40 0 bp 5'UTR amplicon to the Hind dish/Bam HI of the pBI 101 media before the GUS information gene. The 736 bp amplicon from the 3' untranslated region (3' UTR) of the DN A fragment shown in Figure 3 was amplified by PCR using the following primers (position as shown in Figure 3): 5' Primer (2): 5, -AGGGGTGATCGATTA - 3' 3, Primer (2) ·· 5, -GATAGAACCCACACGAGC-3' PCR primers also contain Sac I and Eco RI limits. The N0S termination gene region of the pB 11 0 1 media was digested with Sac I/Eco RI and changed to a similarly digested 736 bp 3' UTR amplicon of the DNA fragment shown in Figure 3. The GUS information construct was electroporated into the Agrobacterium strain AGLI, and flax was performed according to the aforementioned experimental plan (Finnegan et al. (1 993) Plant Mol Biol 22 (4): 625-633) and Arabid 〇psis (V). The transformation of a 1 vekens et al. P r 〇c · N a 11 · A cad · S ci · 8 5 : 5536-5540). Various tissues derived from flax and Ar a b i d o p s i s plants with G U S information were histologically identified to demonstrate G U S activity. In the case of flax, leaf tissue, root tissue and medium mature germs dissected from developing seeds are stained for GUS activity. In the case of Arabidopsis, the developing seeds are GUS-stained in the silique.

GUS staining is performed by immersing the tissue in 〇·5mM X-gluc, 0·5M

Page 35 l247〇4〇

Explain (32) shout, buffer (pH 7.0), ImM EDTA, 0. 5M sorbitol, 〇5 l potassium ferricyanide, and 〇·5 mM potassium ferrocyanide in histochemical buffer, The color reaction was carried out at 37 ° C for 12-16 hours, and 95% ethanol was added to stop the reaction. Then, weaving was repeated with 95% ethanol to remove chlorophyll, and then photographed. Figure 9 = Clearly demonstrated that the developing flax germ and Arabidopsis seeds are strong... (GUS activity, while in the flax roots or leaves, or within the Arabid〇psis silique wall) there are no signs of GUS information gene expression. 6 white matter gene regulatory sequences

^LT-!_ β-Iglycan (GUS) in the flax, Arabiadoj^^) stable seed special performance using standard molecular biology techniques, including restriction enzyme digestion, purple and polymerase chain reaction (PCR), Made into a structure. In order to obtain a DNA fragment containing about 2 thiol groups from a 5' transcriptional initiation region of a flax-like seed storage protein in a configuration suitable for ligating to a GUS coding sequence, PC R was used as a basic strategy. This involves the use of a polymerase chain reaction to amplify the exact sequence required for analytical analysis. To perform the necessary PCR amplification, two oligonucleotide primers (Beckman Oligo 1000M DNA synthesizer) were synthesized with the following sequence:

5' scorpion: 5' TATCTAGA CTCAAGCATACGGACAAGGGT 3, (SJ-634) The italic base corresponds to nucleotide positions 1 to 2 1 in the sequence reported in Figure 4. The additional nucleotide 5&apos; of this sequence within the primer is inconsistent with the priming gene sequence but is included to dispose Xbal at the 5&apos; end of the amplified product.

Page 36 1247040 V. Description of invention (33)

Xbal (5'-TCTAGA-3,) is underlined. The second (3') primer was synthesized and has the following sequence: 3' Primer: 5' GGTTATCATTGTATGAACTGA 3, this primer contains an exact complement (in italics) in the order listed in Figure 4, from bases 2343 to 2363. This primer was not designed to otherwise limit the enzyme, due to the fact that the native Ncol (5, -CCATGG-3) crosses the beginning of the base pair between 2034 and 2039, thus allowing the storage protein to be mobilized into the appropriate Sexual reproduction media. The two primers were used for PCR amplification reactions to produce DNA fragments containing a sequence of the linseed storage protein gene between nucleotides 1 and 2342, Xbal at the 5' end and 302 base pairs at the Ncol from the 3' end. PCR amplification was performed using the enzyme Pfu (Strategene). The conditions used were recommended by the enzyme manufacturer. The temperature program was 94 ° C (denaturation) for 1 minute, 55 ° C (cooking) for 1 minute, and 72 ° C (extension) for 3·5. minute. The slab is vegetatively propagated in the protein group of the soybean seed storage group shown in Fig. 4. The resulting amplified product was then digested with Xbal and Ncol to remove the desired 2 kb promoter gene region. This motility gene fragment is vegetatively propagated into xbal and

Ncol digestive plastids refer to Xbal and Ncol of PGUS 131 8 (plastid pGUSN 358S (Clontech Laboratories) cut with Ncol and EcoRI, while GUS attachments are vegetatively propagated into pBluescript KS+ (Stratagene), suitable for plural The clonal breeding site contains Ncol.) The termination gene of the protein storage protein from flaxseed is also amplified by the above-mentioned genomic asexual reproduction. For the necessary PCR amplification, synthetic oligonucleotide primers have the following series: 5' Primer: 5, GCAAGCTTAATGTGACGGTGAAATAATAAmr

Page 37 1247040 V. INSTRUCTIONS (34) (SJ 620) The italic base corresponds to the nucleotide position 3780 to 38〇3 in the sequence listed in Figure 4. The additional nucleotide 5' of this sequence within the primer is inconsistent with the priming gene sequence but is included to dispose of Hind m at the 5' end of the amplified product. Lined at Hind III (5, - AAGCTT-3,). The second (3,) primer was synthesized and has the following sequence: 3, bow I: 5, TAGGTACCTGGCAGGTAAAGACTCTGCTC 3, (SJ-618)

This primer contains an exact complement to the sequence shown in Figure 4, from bases 4311 to 4290. The additional nucleotide 5 of this sequence within the primer is inconsistent with the priming gene sequence but is included for disposal at the 5' end of the amplified product at KpnI. ΚρηΙ (5, -GGTACC-3,) is crossed. The two primers were used for PCR amplification to prepare DNA fragments containing nucleotides 3779 and 4311 of the linseed storage protein termination gene, Hind melon at the 5th end, and KpnI at the 3' end. Use PCT to zoom in as above

. The above pPGUS 1318 medium containing the amplified priming gene was digested with Xhol and treated with Klenow to produce a blunt end. The medium is then digested with KpnI and attached to the amplified termination gene sequence, located at 3 of the GUS writing sequence. The resulting media contained the linseed storage protein mobilization gene, the GUS and the linseed storage protein termination gene, called pPGUST.

The Xbal-KpnI attachment of pPGUST contains a nuclear filament priming gene-GUS coding sequence-nuclear termination gene sequence, which is ligated into KbaI-KpnI of pSBS 3〇〇〇 (this medium is Agrobacterium diploid pp^p 221 Derivatives, see Hajdukiewicz et al., 1994, Plant Molecular Biology 25: 989

Page 38 1247040 V. Description of invention (35)

-994. In pSBS 3000, the plant gentamycin resistance gene of pPZP 221 was replaced with the parsley efficacious gene-phosphinothricin acetamyl-transferase gene-Netherland bud-suppressor gene sequence, conferring resistance to herbicides ). The resulting media is called pSBS 2 089. In addition, the Xbal-Kpnl attachment of pPGUST contains a nuclear filament priming gene, a GUS-writing sequence, a nucleus termination gene sequence, and is ligated to the Kbal-ΚρηΙ of the Agrobacterium diploid pCGN 1559 (MacBride and Summerfield, 1990, Plant Molecular Biology 14: 269-276, conferring resistance to the antibiotic connamycin). The resulting media is called pSBS 2083. The plastids pSBS 2089 and pSBS 2083 were electroporated into Agrobacterium strain EHA 101. Agrobacterium strain ZHA 101 (pSBS 2089) was used to transform flax and Arabidopsis, and Agrobacterium strain EHA 101 (pSBS 2083) was used to transform rapeseed (Brassica napus). The transformation of flax is basically contained in Jordan and Me Hugher (1 988) Plant Cell Report 7: 281-284, but transformation

The gene bud is selected in 1〇//1*1^- 口11〇301^11〇1:111^(^116 instead of connamycin. The Arabidopsis transformation is basically in accordance with the "Arabidopsis Experimental Plan·Molecular Biology" Method, Volume 82, edited by Martinez, Zapater JM and Salinas J., ISBN 0-89603-3 9 1 -0 2 5 9-2 6 6 (1998), said, but the virtual transformation gene plant is included Selection of 80//ML-phosphinothricine on agarose plates. The transformation of rapeseed was carried out essentially as described by Moloney et al. (1989) Plant Cell Report 8: 238-242. Figure 10 shows GUS in a nuclear silk-GUS Gene Construction (pSBS 2089) Transformation of Transformational Genes in Tissues of Plants with Special Performance. Gus Performance Is

Page 39 1247040 V. INSTRUCTIONS (36) Measured in root (R), i§L(S), leaf (L), perforation (β), and germ (e). A number of manifestations were seen in the buds, with the greatest performance in the germ tissue. No detectable performance was seen in any of the organizations that did not transition (ffT). The 11th chart is not a temporary expression of GUS in a flax plant transformed with a nuclear filament-GUS gene construct (pSBS 2089). It can be seen that the maximum performance is achieved in the flax germ before ripening (drying). ... Figure 12 Transformation of transformation When rapeseed is compared, Figure 13 shows the transformation of transformation. Can be expressed. In the performance. a table that cannot be measured in the leaf

Represents the absolute expression of GUS in the rapeseed plant (L1 to L9) of the nuclear silk-GUS gene construct (pSBs 2083). It can be seen that high level performance can be achieved within the object. Individual transformational plant plants can also be seen to have typical performance changes due to location effects. It is indicated that GUS is expressed in the Arabidopsis longhorn fruit of the nuclear silk-GUS gene construct (psBs 2089), and can also be found in the seed tissue of Arab idops is during seed development; stage 4 of sub-development (mature but not completely dry) The present invention has been described with respect to the presently preferred embodiments, and the invention is not limited to the disclosed embodiments. Conversely, the present invention is intended to be: =:: ° ° The scope of the patent scope and the various modifications and equivalents included in the scope

Where individual publications, patents or patent applications are specifically included::= All are included in the participation, all of which are included in the reforms to the same extent 1

1247040 The simple description of the quality of the flax genome and the first figure shows the DNA sequence encoding the 16·〇kDa oil | white plant; the flax genome of the protein • Figure 3 shows the DNA sequence of the flax genome encoding 25 storage proteins Figure 2 shows the DNA sequence encoding the 18.6 kDa oleosin protein; Figure 4 shows the DNA sequence encoding the 54·5 kDa phylogenetic storage group; Figure 5 shows the flax genome detected by the linseed DNA sequence (10)a Southern blot analysis; Figure 6 shows the northern blot analysis of the special performance of linseed oil; Figure 7 shows the northern blot on the development of seed linseed oil. Figure 8 shows the linseedin-inducing gene— GUS activity of flax germs impacted by GUS-flax terminations; Figure 9 shows GUS performance of Arabidopsis plant seeds and developing flax germs that are not transformed with 25 proteins, GUS fusion, % ί - GUS nuclear silk terminates the structural transformation of the gene in the transformation of the GUS tissue in the flax plant; Figure 11 shows the gene in the nuclear silk GUS nuclear filament Flax plant transformation within the GUS gene constructs transition temporarily stopping performance;, FIG. 12 shows the yarn launching nuclear GUS gene expression within the transition -GUS Brassica napus plant (1 ^ to [9) linin terminator gene constructs of transformation;

Page 41 1247040 Brief Description of the Figure Figure 13 shows the GUS performance in transformed Arabidopsis plants transformed with different genes at the stage of seed development by the gene-GUS nuclear filament termination gene architecture.

Page 42

Claims (2)

I pull 4i / (^Q correction -4- 9a n. Medium eye patent model ST 1 · A 89122618 correction includes (a) preparation operation coupling component (1) (2) hemp seed special hair (b) put the sum (c) This makes the beneficial nucleus in the seed 2. If the application for germination of the gene is granted to the non-native nucleus 3. If the application is given the timing of the performance, the response of the change, for 4. If the application is to launch the gene line, the Beans-like seed storage 5 Such as the application of the gene to the following (a) the following beneficial nucleic acid sequence in the linseed expression method, including chimeric nucleic acid constructs, in the 5, to 3, transcriptional direction, including the flax beneficial nucleus chimeric nuclear flax plant The acid sequence of the patenter Fan Qiben acid sequence patent Fan Xian level chemical agent patent van from the inclusion of the Tibetan protein patent class composition of the nuclear seed special hair gene; and the acid sequence, wherein the beneficial nucleic acid sequence is sub- The nature of the acid; the acid structure 'the bow I enters the flax plant cell; the mature flax plant that grows into a knotable cell, is the method of controlling the special gene of the flaxseed, the first item, wherein the species At least one performance characteristic of a particular nucleic acid sequence, the method of claim 2. The method of the second item, wherein the performance characteristic is a response to a change in illumination conditions, and a response to a temperature change concentration change. , wherein the linseed special oil germination gene, 2S storage mobilization gene, and kinetic mobilization gene. The method of the first item, wherein the linseed special ridge ridge 2023 nucleic acid sequence The 43rd tribute 1247040_Case No. 89122618_年月日日_Amendment VI, the scope of application for patent Η — Η (J9e Icncnu(T366CJu^666ueeon364J4JuXJ5e4JJJrDeJJ64J6ucne4-&gt;4J(I34Je-p:;e4-&gt;:;64Ju4Je4J-p4J6e4Jeeeeu-p4Ju6 -pe4-)4J4-)4Jefofo4J4Jue5pT—l8CSJrH 0 8 21uQfOeee:;4_)urofw(J4J6e4-)4J4J:i5erde{Ju4Jcn4-»4-&gt;eou:i-p5fi64Juu55J-)4-&gt;cn4J55cne4J4-&gt;ftsfOe64J6cn5fo- p4Je6-u566ecnfo-lJoeee-l-&gt;uurH〇cs]x 〇〇rslr-iueefr'e9eeue:luu4J4-)6ecne(J4J6frs56-pu64Jeu4Jcn4Jcn36cn4J4Jfo6u4-)u6ecn4J-p6o4Jf&gt;uucn4Ju:;:t-piI3u5-p4J655oe55-pefouu4JICNrHT s QCNJIrH4Ju6pll :i:iuuu6fclb3ecnlulcnle66o:;un36urDeJ-)piJ6cneeowu4J66u6iJo4J4J4J6eJJ4J634-»n3u4J6:i4Juu4J3cne6uu4Ju£&gt;eeu6aJu:i ΙποΓΗ 〇7〇t-iJ-):16eu4J56ucp:ie4J4-&gt;:;6eee-pfI34J4-)(T3e4-J-p4 -)4JJJ4Jeeue:;o4Jee4J4-)ew:;ppu4-l4Jee:;en34Je4-)ee4Jee4-)a3e4Je-prDe-pe54Je-plroleulT-H9 6 s Q9 6 uf0lsl?I?6:l663s64J4-»u525uufDe-pwss4-)5u -p4Js4J4-)6u4Jps4-&gt;e6eaJfT5se4Jeee4-)4-)f0e4J:;us-pe-p4-)es4-)4JxaDg s 〇884J4-)o65eee4-)-pu4J4Joe4-&gt;:;u4 Ju4JiJu4Ju:;eoe:;n334Jn34Jcn4Ju4J4J4Ju4J4J4J-p54J4-)ou4J-tJ-pe4J-p4Jeeu-p-p4Jee4J4-):;eee4JIeee4-)leept-HoCD s ΐΊ 00 00 ro WTroeueecnel?4JeoEee4Jfoo¥i^¥i¥^¥¥¥ i^-p4Je4J^efoen34JeeefI3e4Je55u4Je:;eee4-)e5:;eefoe4Juee4J4Jee66:;4J-pe4JX&lt;\1Bu s2〇e&gt;tnij5:i e64J4J6D&gt;uroo:;ue4J4J4Jn3ee5:;4Ju6w4JI4JIee4-&gt;l4JIul4JIn1ln3:;4J^ 6e54-&gt;e6ef&gt;4J:;e4J4J:;4-):;5e-p:i4Jecnuueeptn:;eenJ5:;e6e χ79 〇可94-)4J4J4J5n3g4-)4-&gt;u4J-u4J4-)fDu4J4JfD5uu564-) 4-&gt;5uou66uu4J&lt;T34J:;4J:;uutneuufo4J4J4-)ee4Jue4J3eeuee4-)eo4J4Jee-IJ-pe6n34-)-p:;eo4JT-H9 ς 〇9ς4Jfo-puu4Ju54Jofoeu4Ju4J4J-pu6eu4J5cn54J4-)e4Jo4J4-)6eeueu:;e54J54-&gt ;eeuuJJ4J4-)oo^4J4J4Jeecnp64Jeeu4Je6-i-)ee34Je56eeΓΗοοπ 〇(τ)π4-)e^J4_)55u:;ueeuu4J:;eeo4JouulJJJeu5e£&gt;eucnfo5uer3e5u4J4J4J£&gt;4J6:;ee-peeuou:;e64J4Jcn:;:; e5ue6ee6J_)655u-p4JK5 χ〇π S 00 ^XJI4JI66ul4JIfol6u4-)-u3eeu4-)6cn664-)-p4JufI3-p6roI?cne665666:;6-pcn5n3fO4Ju6cpe54Jcp64Je4-&gt;4Jue:;5tn5pe5e54-&gt;ecn656fOe54-)cn5r-Hcslpo 〇Γ \ Εrc5cne654_)ee54-)p55cnu4Jeue£5u4-&gt;uJ-)fo565fOue4-)ua3n3cn4JcnufD4-»4-)uf5-pe4-J£&gt;5fo63o4-)ep6eecpo4J^4J54Je4J-uuo6e6u4-&gt;uweτ-ιπΝ ΙΗ 〇t/CSJ54 -&gt;α3σ'υρ4^5:4-ρ5Γΰ556Γυυ:;Γΰ6^4-):;6υυ4-)Βυπ3υπ3ΐ?π3Γσπ366υ6υρ6669-μ¥55'^Β55¥55:υπ3-ρ6υ-ρ64-)υυ8υΓΟωϋυ4-)π39π3υοΧ9Γ—Ι ◦ 91 e4-&gt;6OJ4-&gt;:;eecn654J4J6e6foueue03(J4-J-u6u04-)-pfcucne4Jue5efou0cnfo^n36e6u6e54-3e66e6656664-)4J4J6uu6-p65ue64J6ΓΗΟΟ 〇00a'4Jfo4JucnucpfIJao4J6cn£&gt;u4J54Jfa6u-ppcne6ufocnu4J4J6efo6£&gt;5£&gt;6 :; e4-)e6fI3e6-p4Je4-)uuucncnu65e5ouu4J-pe53uun3eeeu4J:t χ Page 44 2002.06. 26.044 1247040 Case No. 89122618 曰Revised VI. Patent Application 〇Lnt/c\l6-pow66u-4u4J-ua3u64-)eee4J4-» 4JfD4J4J6p6roeuen3uuu4Ju:;e66:;foun3pcn4-Jp4-&gt;iJ4-»e54J(Jcnpe:;eup4Jfcleforo:;p4J:;cn4-&gt;4-)n3:;cnp4-)ΓΗΔΓηονι 6〇r—1HAIsseAHAVVAoioLr)6〇b eN 2. &amp;6 seven seven 69256:^:;6 〇v Hvl 33⁄4 SOI 331 SHI 33V 35 DOS 333 35 vs CUJL ss 9〇εΝ SC2 S3 331 13⁄4 113 111 ss 33V 33⁄4 £U1 3JL3 ss 310 33V 33⁄4 3JO 13⁄4 033 33⁄4 : LH3 Ηε 9S3 ? 15』1&gt; Port 7041&lt;111:21&gt;1&lt;1,7 99ςιΉ JOO 33V:UX 3HV 3δ HH3 3JO δο 33V 339 VJAZ 33⁄4 3JO VOX 13⁄4 3HD 33V 38 03V 1H3 9 812TLnΙΊ32ΘΛΙΊ2ο3νΗννΗννΜΛςε ς 812 33⁄4 313 δο 33X S13 Hxs 3HV 3JL3 33X V30 δο 030 33V 333 V33 JL3V 330 Bo 9W 05 921S忑VOASHdGOOOASHooooAsdLnI S3 05 3\ΛΙ 13X sv 83 0V3 35 9V3 SV3 3V1 33⁄4 V3V 330 S3 3S OS JLVX 33V S3 990N πΓΗΜΟΗΙϋνΛΗΟΗ ΙΟαΙΛΙΓΗ Ln 山〇C\J square &lt; οου &lt; 33V vse) υυο 3VEHVUV0V3UV3ουνονυ 1VD 0¾4Jen3o6eo4Ju4J4J:; ee4- &gt;4Je64J:; ueerH〇oc \ IΗνοs VHVX 〇〇〇 &lt; Npuuu4JJJfT3iJa3rouua3ufo4J4-) ufI3a3uuecpuu:; mee3pfo6u4Ju {I34Jpuu4-) uu4Jup4Juu4-) eeo4JIeeu4JIpa3lulrolfolueu: ip: }rnl:;4JIfol:l-IJu:lu I(N613HHV νυιδ〇ON!6rH0eu4-)-pcn0un3uuu0urau4-)uufou4Ja3(J4Juua30u-p4-)fOuu-pcn4J60fou06a03-p3a36fI34-Jfc0 564 JI60le0foeu:;u6q3cn(ti9rD6cn4Jfou6rH^rODrH 〇ί7 8τ—I-puouua3n3o6-lJ6eeeu6:;n3u64Jn33fI34-)up£&gt;ep4-)u4-&gt;4-)a34Jpueeep6pen3ep6p:;54Jee4-)e64Ja34J4-&gt;e4J4J4-lopua3e6u3un3£ &gt;-lJ:}erHm Divination CSJH 〇9 Lr-I6peu4JfI3:in16e 邙:ι6υ9ϋ£&gt;4-)π3-ρίτ3:^:;64-1:;£&gt;4-):;ρυυ6ΓΟ£&gt;Υ4-)υ4-)94-)ϋ6ρ6υ:;-ρ:;666:;-ρι66υ-ριΓΟΙ6υ-ρυπ3Γ0ρϋϋα39^4-)4-3ίΌπ3υ4-)6π3ρτ—1009 χ 0 891ulJufI3uuprduuuiJu4Jo:;e4Jw4-)uufI3fa64J-l-) e4Jftsewu6fc6JJ64-)e4-)ue66q64-)4Jn34-&gt;4J64JcnepfI3u:;6n3fI3o56fDe6o4J4J:;e4-»4Jfoa3-puχ 〇^χs _ ο〇9 Τ 6rD4J6uu:}I?6o4-J:llJiJp:ioen3fo4J:;e4J64-&gt ;4-)^fI34Ju4JeuaJ4-)efT3eu64JfI34J-u&gt;4JIw4JIa3lfol4JI4JIul4JIeiJe:;cne4-)4J4Jcrin3:;fo4JfT3aJ4-)4J4J:;6:;e4JIo!eΓΗ(ΝςΗ^山DC 〇Γ\Ις χ ^-^^-5^ 9 64-)4^weeepu4-&gt;-p:;4Jn3-po^~i'5^T^TT5&quot;5&quot;i-pu-p4J4J4JfI34J-ptT'4J4-&gt;-pfooe:;4J-pueepen3cn-pcn4Joop -pufQ4-&gt;5e(T35oe χ wx 〇π ί;ΓΗue664J4Jfow4JforI3e6uuG56-p4Jfdo5fou4JcnfI3faou64Joa3pu 4Jucn64Jefo4J£&gt;4J6fo4Jeuuu5uuuu4-)n35uuuue6fJ6u4-)4Ja36cnup4JcrlΐνΌΓΟΓΗ CSI丨Η 11·ΗΙ Page 45 2002.06. 26. 045 1247040 Case number 89122618 Revision of the patent application scope ε丨H 6 卜9rnu4J34Juoee-p6{?4J64J64J64-»64JuunD -p4J:;fI3555e6u5ecn4J6eo4-)eeee5u4-)u64-)-pe55o65o4-&gt;pu:;4-3uoeuecncn4J4Jeoee4-)ue 〇〇9ε 6 6ςΓΟrc54Jeo6eL]4JL]foo4Jfoeucn4Ju(Juee4J4Ju4-&gt;4-)e4-)-po5cn4- &gt;554Jucneero4-)u54Juu4Jpo4-Ju4-3u£&gt;e6n3ufrs£&gt;(IIu6:;-pn3fde6-p4-&gt;:;uuou:; 〇Νςρο Gr-HLne!Jeu:;:iocnl?:lou:;euoweeo :;ecn4-J4J4-)o6ecncnee64Jee66:;oofoo4J4-&gt;u6fouu6ct3uoeee6eueiofo:;oe6u:;6n3e6fouioe-p4Jf&gt; 〇5ε 6ΓΟπΓΟnJufr,]54-)l?e9eeeuuuufD5eue-p-IJo:;n3oe4J4Jeeeo:;4-&gt;55eerDu: ;4-)upeu4-&gt;n35e4-)elJeeefoeu-p6eeoeeu6eee5eue4Jcn:;4J〇9εε 6ςροε 5eforI3n35fo4Juo6enJ6u4Jpepe5e:;pe:;e5eeee4-)o64Je54-)eu5icecnn3〇ee6-p4Jue4J6fDe55:;4Jo4Jecnuu4J-IJeeu4J4Je6u4J:l 〇8 2ε CP Factory :laJaJfou:;fI36cn65u4Jfuuufoeeecn(J:;JJ4J4J:;e5euon3ueef oe6euuu4J5u £ &gt;e:;o4Jo5o4Jro5eueeeo4Jtp:; o4Juocnee4J-p5e5ue thousand and (Νη 6 6ΙΓΊ4-J4Jb4Jee3E &gt; £ &gt; e4Jueuu4- &gt; 6esuu5u-p4J4J6eu64J4Ju6-p4J54J4Jo: De5uo6e564J:; uu4Ju4Jeo4J4J6ee554Ju-IJ4J £ &gt; 4J4JfI3u64J6u6e oCSIxe 61ΓΗεro0ee5eue:; 6 :}4J6e64JrD66e6eu54Jyfoeee4J6eeucnu4J0eepuue55u4Ju:;e54Ju4J6u5:;:;e:;cne:;4J4Jep-pucn4J4J£&gt;cn6efo Xeucn-Hs VATOCU 6ε〇ε ee4J4Je-pe6e5eu4Jee:;me4JIu4J4J4J4J54-)e54Jecnuee4-)54J4-»:l54-)n35ecn£ &gt;4J4Jcneeuu:;4J£&gt;03p5u:;ee4-&gt;£&gt;4J6eee64JcnrDra-lJ5-p4J5 〇9 6C\I 6LO6ONJ4-)5-p5o4-)u4-&gt;54J4J4J4-)3u4-)4-J4J4 -) 54-) u64-) 64J5ee-l-J4J4-J4Jo4-&gt;o4-)ueee4-364J4Ju£&gt;6u554-)6u:;4_)4-&gt;6:;u:;4J4J5o4J-pu4-) cn54J4Jeee-p4J5e oCDaoCNJ 991 +ωΕ-·003υΗΛΗΟΟν.Η3σ}ν Obi 6卜83 HHol 33V0V3 wuHooEHOD VCJV 3X0Ivoe)v3 SV3VUC)311ovoe)31 se)LI8C\] 6ΓΟΪcr:a&gt;l&gt;:3HVMe)vl&gt;ISHVoalsa 0ON1I 9183oe) &lt;uve)e)we)le)ove)sv(J3oow VSUOUOEHOOW 8He)e)v JOe)e)v(JovuSHUoCJHHve)Ler-z 6ITϋϋνάΗϋοΗΛΛ 〇II 9ςΔΓ\Ι〇90&lt;0ϋ〇υοo Ouυδ 030ooe)o(J&lt; ϋΗϋ U&lt;H n_ 6n3034-Je4J-uu4J6564-)5-p-lJe6-l-)e64J:;o5-pfouue54JefI3erHQacsl 〇69 3 5fc-u5opg54Jfl3fIJuw4_)54J4-)4Ju4JfDfOfofT35u-u-u4- lfOufI3fafo4-&gt;a54Ju4Ju-l-J4-)邙cnu0354J54J-p5554-)cnfou4JcnrD5u4-)ufOa3cnfoo4-)ufufoofOrOuuoΓΗΓΗ9ΓΝ] 〇X9 3J-Juoo-pee64-)l?-u:iiIJe:;uefoeue4JfoCJCJ6eecnee4J4J64-&gt;cn65fc6:i: i4-J4-3uoe4-&gt;oe3 3(J4-)4-»3ea3uoou£&gt;4-Jo4-)4-J64-J4Jeu4-)4-&gt;-p邙ajecnl ΙΓΟςΓΝΙ ornLncsluu5fofo5cn-u4-)4Jfcufcfo4JufD-lJg4J4J ^4-)u-pfo564Ju-po5£&gt;u4Jcntr«5o4-&gt;664-3efOueu-p66u:;un3uucnfo54-)4J4J4J656-p-pcn5u-pa3cnu4-)3eΓΗς vcsl Page 462002.06.26.046 1247040 . Case No. 89126618 _年月日日_ Six, the patent application scope 55w4Jeun3u:;fIJoo4-)4-)f&ue;uee64Juepue6ue56e64J4J6u:;n34-&gt;a36cn4-J£&gt;:;e5u4Jra4Je64JeuoaJefo4-)cn4-&gt;036e 〇ac\l7 5e( Na 6e66eu6foe5fceo6p6uo:;e36eu6ue(T36£&gt;uu4J6e4-&gt;eL)fououf&gt;4Ju4-&gt;4Jeen3u:;-peuuu4J:;4J4Je4J4Joufnpen34J6ee6e4-&gt;u:;4J〇9ΐπ 6ιητ 7 ee4Ju4Jeepf&gt;-peeecnecneu eu65e:; ue64Je6cn54Jofu4Je5eg4-) p4Jeeeu6uue4Je5epp6eoe6eue64J3uppu6n3urce4J-u) cn0〇〇〇 Ding Bu 6 074-J64-J4J64J4Jee6uu: ucnu: iu: i4- &gt; ou4J-pa3e66euu4J £ &gt; 64- &gt; e4Je64Jecp4Juoe5e4J64Jp4Jn34J03u4J4Jueoe6eu4J £ &gt; uu64J66ue-lJ4Jue 〇0 〇玎6 6卬(-&quot;*·)u^c^a4Ju4J4-Jueefu66e(I3efocnee64Je4J4JJ-&gt;JJuo6oo-po:l4Jeeu4Je6ue(I:u4Jf&ee;eeeuo4Jueeeu&lt;x3uee^e{?4Jerceuuoueeeo6 〇ααΡΊ6I6rnuuufccneu£&gt;4J6efnu4Jeuu4Ju- pufOon5uo4Jefocn5euo6faucnu-p4Je&gt;eeoe4-&gt;6u664J4JouurouGeecnuu^ol-)uu4J6ucnueeuue 〇vCDro 6e8rnu4J4_.'au)fu4J4Jocr'cnn3uo4Juw4Juu4-&gt;4-3uu4Ju4J.133 34-)u4Ju5aJcn4-)ufI3ou4-)e:;6:le64-Juu4Jfae6o3- Pu6-p4-)o4-J6u6-lJ:;uu4-)4-&gt;e64-)636 〇9 Bumen 5lnbu efr!cn4-)ucnD^n3fauoeu4-Jfo4J4-)-p4-)e64-)5£ Jee:i4Ju54-&gt;u:;4J4-)u3fouu54-)oe4Jueeu4Jfou65uu4J4-)roeeficn:;u4-)eeroe-ppue4-)64J4-»3u-M〇89e H Page 472002.06.26.047 1247040 _ _ Case Number 89122618 ....... Year Month Day." Amendment _ 6. Patent application scope where T can also be U; (b) with (a) nucleic acid sequence a nucleic acid sequence; (c) a nucleic acid sequence substantially homologous to the (a) or (b) nucleic acid sequence; (d) a nucleic acid sequence identical to the (a) (b) or (c) nucleic acid sequence; (e) A nucleic acid sequence that hybridizes to (a) (b) (c) or (d) a nucleic acid sequence under stringent hybridization conditions. 6. The method of claim 1, wherein the linseed special priming gene consists of: (a) a nucleic acid sequence of nucleoside 1 - 1 8 5 2 as shown below Page 48 1247040 t Case No. 89122618_年月日日_ VI. Patent application scope 〇9Cl S2I 〇8c\It-Icnueu4J4-Jl?u:i4Jueu5eaJ4J4-&gt;:;4Jwl?64J4-)cnn3e4J4-)4-Jl? e:;4J:;4JoeufI3cn54J64Je6:icn4J-IJ-pe65:;fI36J-&gt;£J64Je64J4J6ecn4Ju4-)4J4-)fn6n3o6rH〇c\]rH 〇〇CSII ae664-&gt;e4Ju4Ju64J4Joo5JJuu4J-»Ju6e6oeero6eee4-Jocn6;D54-J4Je6( tiu6 £ &gt; o65o6p54Jn365fcfo5ppu6ro6u96un3 £ &gt; e65uu6erHCSJrHrH 〇2rHIaJ6o6nJ65u6u6e4Jeu4Ju4Jue654Je4Jeucnuuouu4Je4-) 4J6u5eJJu5uu6u4Jeeu4J4Jo:; 6fo:; uue ^ u4Juu:;:; 4Jeeu:; uuu4J5n3τ-ιπ〇ΓΗ 〇π〇Ι euue54J4J64Jou4J: l66oue64Jcn6u4J4JoiJee4Jee6o4Jpopon3ue3oe6uueo:; ue (T355ee:; 55o4Je5u54Je5eefo4J- pueeuet- (acr &gt; 〇9 6uurcuoaJJJuJJrnwuoJJeufJcnuuw-uJJeeeuofJuficncnuJ-lJJ ^ ylJuuuoewubeu ^ ecnoeuyecneuuueuuJJ-pp-pfJucpeptnseuee xGDcn s OCDCO5-p4J4-) pn35gJJe64Je4- &gt; 4Ja5ecn4-) 4Jroun3o64Jefououe64JIebul:; 54-) l4-) le3-p6cn55a34Ju:; cn ^ 64Jfi4-&gt;-pl-)eu4Je4J-p4J5eufoecn-IJe6-pcn:; x〇00 〇〇a 5-utTJu4Ju^Jcc054Jpra4Ju0ue04-):De5e5n34Jueuee34Jeecn6u5n34J5u:;54-)4 -) :; cnfl304Jeeeeeuu0e4J5p4Ju54Je-p5u4Je5e-p65 HCSJ Bu oCNIr- ^ 5u5oouaJe6eee (J5uu4Ju56eue4-) ucne6ucn4J64Jeco4Juo4J4J:; cnfoecn4Je6uwcnfoo6ee6u94Jfrscn-pe4J6u4J £ &gt; 4J5CJ4J5654J4Jn3rHlVD 〇794J503-UJ5u4Jn3uu4Juu-) u4Jfn555for3fcu4Jfnufuo6ee5eupu56cnu4- &gt;:;euu4Jeocn:; 64Jcn-p4-) etn4Ju6eu -p4-)u4Ju:i4J-lJ:;4J4J4Ju4Jee4J-pΧ9ΙΠ 〇9ς4JfcfI3J-&gt;n3cnuXJu4-5uuo64J4Joe6o9£&gt;4J4Jeu666ueeecn4J4Jwe4-)eo4-J4-)p4Ju6e5tncn-p-p4-&gt;6e4Jeeu6en3e4JeJ-)eueuoeoeu-prouoχ00l? ◦oot ;u4J6:lfcue4-)u4Jecnu64J5e5ueu:;fO-pe4-&gt;cpueeee4-J4J:;54Je664JeiJeuufou4J4Jueoe5o4Ju4J6(IJ:;euuo-peue5-p4Jtpfceu5u6 x〇7 00^u6t?l?5u6636-p-uem0aJ564J64-)64J4J564-&gt; 4Ju4-) 305uueuuu6u6euu6fDuue4- &gt; u6-p34 -) - p54-) eu4-) 4Juu54J4J-l-) 56eeeu6u4JeuXCNJPO ◦OSJPO5 £, 55ufI3uXJ-u5u4Jufo4J34Jcpfo554J5u6e5cn: lfou (T3e3o4-) o6e4Ju64Joeucne4J6u6-po6eu4J4Jou4J4Ju4J5ee〇4Jeuuu:; 4Jee:;:; s 〇t7c\!cnfouoo4-lfI3fI35J-J4-J:t:;:;4Jo£&gt;ue£&gt;o34-)64Juew4JJJuu4J-lJ55:;ou4-&gt;cn-p4Jfoeuuo:;u-peo4J:;ecrlul4JI64- )l:;eule4J-p-pfcu4J oeo4J-p54Jfo6r-Het-ls ◦ 9 X e6u4-)^fce56eu4_)64-)ut-)66o4-J-p6eu:;:i-pucn4J65e4J4Je54-)p5e5ee5n3ee5e4J4-Ju4J4Je54JuefI3n3ueee^co-pemfI3leep-pl4-&gt;lecnlerHoo I IH ◦ g^l55u4J4-3ga3fo54J5rc4J5-3,5,5,5,5,5,5,5,5,5 〇SI 〇3I CSJ丨CNJ F^uJJcr'ewJJE^^ueeebJJa-JuuucnueberdueuwpaJeu64-)p4Ju:;u4J-IJue4J-u)ucn:;ue4J4Juu:;:;-p6eouu4-)-IJ4-J4-)4J4Juuueuu4Jes ul36e6eul64JIfol64Je66fcfo66-p66CJe6fO -u)pfc-pefofDeuen3uu^f&gt;ueee36a3efoon3l?geeuee-pra64JorcfDe6fo6ueeee34J4_Jfou s aJeaJen3e4-)nJ4Jee-u4J4JufDecne e-pu 6ee ecr.4-)e e-p4J5u'i^¥¥5'^&quot;i^^ e4Jeue e 54JU eu4Jecne 64J4JU6 e e4-)ue4-)4-)w 3-pfn64-&gt;-puu IH e 6 ^¥Β55*^&quot;^¥^&quot;^5&quot;4-):;69υ5ρ9 euefd-pefo4J6cne eu9n34Juu4Joe 5 e 54Je e 54-35n3fo4J4Jcne e bo-pcnupueb-peu-pe 6 eeu5 5 e Η0ΗΗΛσΛ0Η .σΕ- · .ΧΗανΗ CJVUUVU8VUVUCJHOOVUUEHOWCJOVOVOUOVOVUV vuv 53 Hvsoue} sehv seses4J3ee 5t e06fce4Ju5l 0euJJ:;?? cne:; 4Jeeeu4J4J6fDeuuu4Ju-p4J4Jeu5:; 4J04Juueuueeeeeee4Jeu4Jueueeeun3u4Ju4Juuu:; u0eus 35ueoueuuefI35eee:; 4J4Juu-l-) 4- &gt; 4Juuu-puu4Ju4-) 4Jueu -pe4Ju4Jun34J4J64J5ufouueuf&gt;uoeu4J6cneuu6u:1.3e4J-pouolcnle5eul TSI T9LI T$IT〇山ΐ ISI I?I T9erH 卜Lnr-tWAOVVaosHHMVOUisadAooororH e'scx'31V lvHe)e)o 13⁄4 13e)lvoe)v3e)HVo8 svejw se)ovoe)ve 31JL 5VEHS SODSle)SOSCNJCSJ rnI AOAOOuvoolADCVJMSISJi·! 811 sCNJCSJsls vs 110 &lt;8 35 Ds 130 S6 0V3 SH3 Hvl sv 33⁄4 111 SI 331 D13 COl DJO ssCNl r-II Ο ΙΊϋνΝ02νΊ』ν5Λν^.ϋ I ΊΊ86 srslCNe)s δ&lt ;OHCJ00◦OHV SOSHCJUO DHUmououo&lt; OHOoue)HHHosUHV OHO013 WICNJ r-6 ννα,ΛΊΛί32οΙΛ.3Ια1ΗΙνΊ08 CK2 130 330 S33 3H3 VH3 HI3 133 30V 33⁄4 3H3 13⁄4 co〇33V U3V 33⁄4 COS 313 so S〇N LL IWJ,e)vllIoVTVTllc e)IdT8Lr) rn8〇c\JUH&lt;0H&lt;ou&lt;000HusUHH00&lt;&lt;H&lt; 000 uuoOHHoue)Hluυΰuove)e)oo〇〇L)H&lt;UUU 3H 3 t7cs] 〇c \ I LLnvHSAVeAMSVSaJosossaOHooc rnsCN] ouoυυ &lt; osuHe) vuovll OHOSWυοΗΗυονυΗνουυϋουονυοονυΗνοϋννυϋδ 3V3 S6I LZ Hdoo ^ looSAHohvooHdAHS rn Hill 6ΐ 1V3V33 HODUOOVWUHCJvooHsowe) HVHHouuoo OHHHL) De) e) 3uoe) ou &lt; 333 JA / X 3V3 b〇6rH page 50 2002.06.26.050 1247040_ Case No. 89122618 Yuelu _ Six, the scope of application patent ΐοςροecn〇〇ςΓΟ 66 7 cfoaJu-u34-)u55(T3fuo4Ju664J-u)rD65ecn4Je4J4J4-)eu64Ju4J4Jufc-p:;uoueeo4J4Ju4Jeeu:;e65:;pe6ufo5epfne-IJ -peeeuee64Jo6u〇Γ\1πΓΟ 6 11; cfr'g3fouu4Jft5n1fc4-Ju6£&gt;euu4J4J£&gt;54-)e6rocn6-u4J4-&gt;cn:;54J4J654Je6u4-&gt;ou64J4J5efoee4J5cntp6eu4Jeuuucn4-)on3:;roon34Joe4Je6:;u◦ πεε 6 εΓηΡΊunn4J4-)6p6e:;cnf&gt;ee6e6ef&gt;4Je-pou-pic:;n366e4-)4Je£&gt;eu:;4Je6eu4J4J:;foee4Je:;e4-)5u4Jp54J6fo5u5en3eiT354J4J5e54J-p4J4JeeowCNJro 6Lncslc p5u3ee6£i4J4Jp56-p4Joee5-p-p65- p4J4Je4J5-IJoe4Jue4Jeouecn4-)e6ee(I36e664J:;6fo54-)u4J-IJtn64J:;-pe:;e4J6u:;upuueee£&gt; 〇8ΐε 6 /.ΓΗΡΟunJeu64-)u4J4Joen3eecne ? U6u6eeoeeecnee4J64- &gt; u4J4Jecn6ue4Jeepn3eoraeuefI34Juo4Jecn6u34- &gt; u4Je6u6fT3o6ot u :; e4-) o6e 〇〇Irn 6 6 0C gou4J4J6:; e £ &gt; 4J:} 54J:; eu554J4Je4Jf &gt;:;:; 4J4J54Jfr5ueee5eef &gt; eee4Je4Ju4Je56eu56eue4J4- &gt;:; u-p4J6fI355u54Jcn-p56 &lt; x3u363o4J〇CNJ〇C6ΐ〇εfnfocnw ^ wflJtJ'-pucpwpcncp-pufofouuueeeEiuewyuupeeecneu-pcnaJeuutneecnpeebefopcnfoeu ^ ucnwuueuucntneucneuuJJ-ptr'〇176C \ J 6ΡΊ6 2JJu55XJa34Jeuuo-poee £ &gt; 6-p4J-purneu5n3eo4J4J4Je3uu6ecn5e6u66uoun3-l- &gt;:; eun3e6oecno4Jeu4Jl?fo6:Duee6e64J64Jee6fd09 8CSJ6LO8S u34Je6cncn£&gt;3iJfce6ee6cn4-)4J4-&gt;fo64-)ecn4J£J6ucne4-)o65355u4-)65-po5cn5-p4-)64-}:i5cn-pn3-perD6cnn34-)up4-&gt;:;faeun3eue5:;fI35u6◦00&gt;" 6 ΔΓ-Ν 5uuee6ee4Juee4Jeuuo6e:;4Je(I3n3-p54-&gt;eu-pe5e5o-p6ecnf&gt;4Joa3eefcup:;64-)4-)n36eu£&gt;64-3n[J5uroeue- p-pen3p4Jee5e4-)4_&gt;4-)u◦0 卜&lt;N 6 69CNIu^flJ^cnwfcCJ'afofofcforocnc^u-pJJrocpCJ'-piJuumafD^uwuupeecpuoaJwuecnb-pu-iJcnecpeewe^bsooo-peuu-tJcpcneuuaJ-peueeecn〇CSJ9C\J 619CNIgg4-J6su3-p4Jue5ul?62-IJ suue:; 4Ju4-) n354J4-) cnsun3ee4Jucnro4J4J4Jsses6o4-) 4-) n3 &amp; a3fDu4- &gt;64J:;! e4Jeecn4 _) - l-) cncn-l_ &gt; o4J〇πς &lt; Ν 6POLOS4J5wfI3uww4Jfc u5a3u5n3 ^ 5rofo4J5fnft3fo4Jn3o4Jn3n34J4J4J4Jo4-) 54J4J4J4Ju buckle 0- P4-)54J4J04J4J£&gt;e6-ppn36:;n3e65-p6e:;64Jeu6:;4J4J4JufoiJ〇vx)7OSI181-fMas8LrH 54JufT34-&gt;4J4-)4J55cn4Ju4-)4JfO(I3fo6cnwpefde-p664Jun3ee4J£&gt;w5-pcnua-) 4Jcn564J4J:;4J6556ee4-)ee4Je^4J65 VVHVWCJV3 V3H ποοεΓΝΙLr~l VM &gt; a 0 S 匕^ οΜ3 a 0 &gt; 3 Μ Η Μ 0e)8LOI ρί8£2 &lt;00 OHO Ivoovulolow DOVSVCJ03⁄4 OSCJVOODS llowe)swoov 〇WSV3 000 T7c\Jec\! ε 丨CNi Page 51 2002.06. 26.051 1247040 _ Case No. 89122618_Yearly revision _ 6. Patent application scope where T can also be U; (b) Nucleic acid complementary to (a) nucleic acid sequence a sequence; (c) a nucleic acid sequence substantially homologous to the (a) or (b) nucleic acid sequence; (d) a nucleic acid sequence identical to the (a) (b) or (c) nucleic acid sequence; (e) in strict hybridization A nucleic acid sequence that hybridizes to (a) (b) (c) or (d) a nucleic acid sequence. 7. The method of claim 1, wherein the seed specific priming gene consists of: (a) a nucleic acid sequence of nuclear ridge 1-417 as shown below Page 52 1247040 Docket No. 89122618 A_ correction six, patented range τ Shu ε 〇i7 (NutJIJJJJJJpu Mang JJucn Mang lJUJfI3aJcnu ^ JJeJJt7) uu &lt; T3iJfdfo (I3fdlJaJ ^ iJJJflJua3ufduuu4JJJp4Jtn4J4Jn3JJfducntnutnun3l4JIfdlfdlfol (TJIiJItrtplJIJJIfdlfdlpcnuuD) u: i X9X q3 * HJIehv 〇9XfcuJJ ^ iJJJoniufliJJcnaJfcetlJuuufrsfcJJfdcnfdioJJtndflJuucn ^ etnecnco ^ oDIilJeelJJJfofo ^ ouJJifdlfdlaJIfole'eppaJIfclp &amp; etn ^ coXJtJltJIBfliuutJltnueTHOO LP-HaEHv Ji aaui-HJLd, Ln 〇00CI3DlJ-) foJJfdp5JJcnx-) ptJ) cntnn1JJXJaJuu Mang -IJiJuJJfdouqaJ ^^ uJJJJiduufoucnDItnaJIJJIiJIJJIAJIidlfdluJJIJJIJJIfdluwnJuuJJ ^ laJIdoJJI &amp; trifdlJJItniJJIfdlaJIuduluJJII 〇CN3roiJtneuXJuoJJlJeu; Doue &amp; ueu: iufdufo (dlJ :; cne ^ n3lolCT1iJIioluluucneJJOTJJI5olHUC &gt; ufodt7) (TJfI3fdpuuuDlfdfdlJD) 4Jtnu ^ XJuroaJfddaJIf «l (T3lOTXJI ^ lrHqCN τ (Ν 08 jack 〇0" pdDIuppiJIlJIululfdloleulJJIuaJIulfdlcrluaJu ^ fdufouuufctnofdufduupuuup ^ 'euueiJJJuJJfopuuuuufouueuuufcfdlpJJIpaJIdJJIufouuXJrx u-HJ * Hua) ds-pa) (l) s xoq ϋ &gt;0: aAAIqJqJcyVLVAVVaswasvH ον οΕΗοοΗουΕΗνϋΗουΗΕΗοΕ- · υυΙη1ϋνοϋυ woovlLOuuovuuVILuoovoE-'vuEHuovwooue-'vfcdtlJd ^ uueuoe uIJfcfouu (τ) ^ auI-Had · ζ vxveh T TO lamp τζΓη τοτ &quot; lEHEH / vdqo / wdAOScvwooo ^ ocyMAAESH 9 〇S Bu Bu Bu νΗδ3νοονοδΗΗΗΟΗ3ϋν3ννο3Ηώ3νεν80νον3ννο30〇νοϋνοϋδ330ϋϋν33νν3νΙηΙνΗ3ν330ν3ν330 τ s Ln ouHoAMwMsdoouscc: .ίαΗ ϋϋΙϋαωοΛ 6 mouth lamp 〇S 8ϋ08νϋνυοδν ^ ^ 3νονο3υνυϋνουχνϋνοον30νουοδχονΓΗ①Ln 8 〇ν〇〇〇ΗοδοΗενο〇ν3οϋδ〇ν〇〇ν〇δυΕΗ lamp vvEHOVAHOOoHOcvsEHwwallAHhHASVCNJCN 〇9LT) uuvuDVuvsoovuoosowusvouxooosaoowuuwuuvCJvoovouvouSHSOSVuvuuvvsuuEHoCJCJEHvuorHoo set 8srHδ δ δ I30Hs0〇IV ^ Mn: aoc3s.LuHcivulsIS ST 00 8 vuovuovouEHwvoovusvoEHvwuuoousuuOXSOWOHEHuvoosvuoaLVCJuvuosCDoouuvuouoEHHWuovrHCNA LnLnToodqaMVIaMVaoiIMHo / AW δ ~ δ ~ δ ~ 5 ~ δ ~ δ ~ δ ~ 5 6 (Ντ 0 8 8u &lt; 〇8uuutuvc) OWHu8HVWCJvw30wuov8EHvoaLo〇v〇vuJnLowoc) vo〇v3〇vovooovoov30v CJvc)c)e)108 Page 532002.06.26.053 1247040_ Case No. 89122618 Revision of the date of the month 6. Patent application scope 〇9 6Γ3邙JJfolJJIaJIfolcnlullJIfdlOTqcrli3tnltni(T5lVOJLIULEHoc)LLVuc)H3EHw3ovCJovuue)o〇v3uEHEHovuoc)HWuoOVLLouovu(Juvue)uuoEHc)v Ϊ8 8 (CN) aa) UI-H.Id, Ln ^ MVSOoaoa ^ ooosdaVLHu VDLnT ◦09Τ-ΗcntnttDIfdcn ^ tnrotJIftJfofcefdJJfoeiJtnuupccaJJJmulJtnfoccaJJJJJaJcnJJDliJ ^ DI'BdJJ'efoJJfdtTlcn ^ JJfdtntnfodaJaJCJIJJtncnpJJatnJJufouecnefdfoJJplJTCNLnI osLnIaluJJfccnfccnJJm5uJJHcnJJDlD1JJcnprdDlJJJJJJJJtJ) cnJJfdutr) aJulJtnfdutn (ducniou & cncntnpuoqucy) (duutn4JfotnuutJ) coJJo3cnpuuufouDltnucnUJT m οππχcneufdcntJ) 5uuJJ :; uueD) Mang cnfdJJucnuiJcnfofou &lt; IJco (TJJJuaJn3 &lt; tJuJJ ^ uuuiJcncn4Jcrlcnn3cnfccniJ:;? tnio (TitJ1cncoucnfducnpufocntncnfoutnducnfouuaJΤ9ΓΟΤ 0 9ΓΟΤ pux cntnfouD1D1rctnJJfIJtn12u3D1tn3iJn3 (T3ucnlJcnuD) iocncnJJuecnD) D) cnrducrludu ^ uD) JJcnfI3cnutJ) ptncnfdtn4JaJfoputnpfdaJJJuaJd54JfcD1ut] nJJu T8CNT 〇8πΓΗ5aJu5eXJetno4JaJueutJ) (T3uucnetneofdpu5CJ) 5ictncnfctntn 4Jcnu3cn5fon3uoHfdop4JofdaJufoaJub1fou53utT) tnu5tJ) tr) e (I3tT) (TJouiJcnrd ^ r3TH〇 (NTH 〇〇STtofcD1cncnJJcniJuuJJJJ6cnucncnuJJ4JpiJiJfdfdtnuaJpJJuJJJJcncnlJD1JJ5uuucniJeoeutJ) foefcs5JJiofoeJJ (I3foefoJJlJJJXJiJtn5iJJJu: i4-) lJcnJJfI3aJtJ) THCNTI 〇NTTJJelJJ - &gt; cnJJefddcnUJetnlJutncnfdtneD1fdcn-etJ) n3cnptneD) rdDlecncdtnfotJ) fdtJ) fotndcnp5fdcnfd5fo6fI36H5 (dtJ ?) fdcnid5dtnpiJ) fdn3 ^ JJfoeJJcnJJutnrduTq〇T 〇C〇THfufoJJtJ) JJcn \ 4JqCJ) ^ eJ-JaJlJlJtJliJtniJcdfotnufoDlracnJJrdeiJ (T5n3JJfd (dJJ (o (daJfdfd: in3c7) tn4JfotTItnfcpaJJJDliJtntnfdaJucnJJu (T3ufdD1e (I3fcufdJJtnuaJecnrHaCTV 9Α9Τ uJJIdl:; u4JI4_) lD15cni4JItJ14JID1uJJIultnlaJa5opuD1fdfddtncn: i (I3eid4J4Jfd ^ fofo4J4J4JXJaJtncn4JaJulJq4JtnlJic4JD1JJn14JlJ1JJfd:;JJcnJJfd(Ti&amp;cnJJetnUJu T〇9T stone)αωΟΙ-ΓΗ^^ Page 542002.06.26.054 1247040 Case No. 89122618 Revision of the month _ 6. Patent application scope where τ can also be u; (b) and a) a nucleic acid sequence complementary to the nucleic acid sequence; (c) a nucleic acid sequence substantially homologous to the nucleic acid sequence of (a) or (b); (d) a nucleic acid sequence of the same type as the (a) (b) or (c) nucleic acid sequence; (e) a nucleic acid sequence which hybridizes to the (a) (b) (c) or (d) nucleic acid sequence under stringent hybridization conditions. By. 8. The method of claim 1, wherein the seed specific priming gene consists of: (a) a nucleic acid sequence of nucleoside 1 - 2 0 3 7 as shown below Page 55 1247040 Case No. 89126618 A_η Amendment 6. Patent Application Range - UJfoDOJ6-4U3OJ11l-u6u:l 601? eou 3-UU4J6 64-JeJ_)6u:i eue4-lu-u4-)e4Jeu4J(J6 e 6-U6 54 -Je 5-p4-J5u4-&gt;o4-&gt;4-Jw 6ee4-&gt;uu4-J4-):J4-Je 64-)cn4-&gt;4-Jw4-J4-)4-J4-)4J64 -)4-)6ro6 e 6ueXJJ-Je eu 〇02 06ί[ 〇8ΐΐορπ SITοςΐΐ o工ιοεττ SII qtu eijfjua_)cjrc)uu64-J64-)34-&gt;e3uoe 6 e eucn6fc6 w4-J64-)e4-Je 6e6fo4- Jl-&gt;e4-&gt;cnuucnu4-lJJu6 5 eucn6 6 uwcpOJcnue-Moe eucncnuo4-J4-&gt;e 5 5uoeueou4-Ju6 ecnwcnCJwb e bfcu 〇〇tl il 1Οετ-Η090T—IiT—Iir—Iosr-IirHΞΟΓΗ :^,4 :^0:^^4-)33506^85583120303600:0305360154-)^6^:^60:334-)^3^663^64-)63^04-)630:^9^960396:1(13030: 5 990306904-)64-34-)6^:^64-)^^6904-):106^66 OOOT066ooocnososoLncnOS0ΡΠ6 026 016 iJrv*ulCJJ-JeuJ-Jue6ee6-u54-&gt;4Je4_)uue56eucpe64-)4-)e: ;66ueuu:iuee4Jeuuee064J4-&gt;0e564Je4J4J6eeu6cn0ee6u:ue-peeeeu6uu4JucneiJ-Jue6uu4J6uu 〇〇6 〇68 088 CU8 Q9COos OS Qs Qs 018 0〇8 Q6Z.08 Bu 0 Guang Guang 09 Bu sz. 0? QroL OT Bu u:lq4- &gt;:} 6 5 6 5 e 6 e eu4J4-Juu-l-J4-)5u4Ju4Jcnue e4-»e e4Jeo64Jeu4J6uu e4J4JuJ-J6 e4-&gt;e e4J6 e eupcnJ-JueJJe P4J0 ew eu4J4J4-)u4-)ee4-&gt ;5 6 euecpe e 6 eucne e eue eeu os ososo 卜 1 SVDosososos 〇s SI SI E?uu:;eeu-uel?uuJ-)64-J6oeeu-UJ4J4J-l-&gt;4J4-)4J-uleofou64J6ee6u: ;eee6:t4-)e4Jcne64-&gt;u4Ju4JIecn&lt;ul4JI5ee666eeee5ecne4Juul:iul4JI4JIee6ul4JIe64-)4Juu^4-Jee4-Jq£&gt;:i 009 〇6ςocoLnQr-Lnο9ςolnLn03osoCNJLnorHLr) rauu4_)4-)u u4-lJ-)ucnecp4_)-uu6 e 6 e4-)4-)4-&gt;uucne e 64-)£&gt;4J0Jeuu4J:l 6 6 e u4J4J4J4J4_)eee 64-)4Jcn4J4Ju6 £&gt; euw-ucneuw w4-)ro6 u4-&gt;4Juecn-p4JiJe 6XJCH6 6-u-pcn6uuu-l-)u6e6 e4-&gt; 〇s 〇6Y Qs QG 〇9π0303 03os 017 7le6J_)o64-)aJi_)£J4-J6n:6 5 ecncne 6 64-J54-)ue4-&gt; e 5 5-p-ule 6J-Je 5ueu5JJ6u4Jeu5 e 6CP-PUUE βρίυϋδβυυ^^α-ιυυφu e e36-p4-Jo£&gt; e4-Jou4-)ue4-lou-UJe4-Ju4-JuJ-J£}cne e 00^ 〇6rnocopno rosrooLnfnOGocslro〇«—irn s THI 4-!:u6unJ6uraleul(JIl?3e3JJI:lCJ!4-)lue64-li&quot;Ben3l6:i3:;66e4--&gt;l4-)e U34_lu4-)eJ-&gt;u4Jroue4-&gt;o4-)cnuu6uucp-pcpu:;4-)u4_)6e6eo:l4-)4-J6-l-)564-Juu4-)aJuu£&gt;fO:luecncn4-) uu4Je:;-u 0〇eo6~o8c\'Qr-z scslos03oroCNJOCVJCNJOG uu-ue eu5 L〕-Ue £&gt;cp54_): 15cu-ucn5 e 6 ecnue e uul?CP65 U4-JUU6 6 e£&gt;eCP4- J4J6 e4-J(Jl-Ju54-)334-)CJ34-J:luu-Meuue 54-J64-)0Ju-u5 e4-J3o4_)fc4_J4-)(Ou4_)eoer3L) 6CPXJXJe4-)e00^061ocor—I0 two osoLnrHo二ΟΓΊΤ—IoCNJT—i〇r—lr—i UJ-J-U5 6 eu-uJ-Jeue 5 6 u e-uucneXJ-pe eeeee e-uetne eu6 ee 6 eo64-J6 eeee eoeee4-&gt;e e4-Jpuefa6eu (Jeo4-)cnrc!4-Je3ee4-Je e e4-Jcncn6eeura6 £J3e4Jrau6 eeu4-Ju 〇〇T 〇6 〇8 QL 09 〇ς 〇ro〇CN0ΓΗ TH丨吋第56页2002.06.26.056 1247040 Case No. 89122618 Amendment 6. Patent application scope CNI丨吋πΑ』α4^"1"Ιο&gt;ίβ3ΙΗΗΗΛΛνΛ3ν30^00^2: οαΜΛ3 00^^ C6S 08s 0922 0ς3 οε3ζ OIS Ι13ν::ΙνοΙ1&gt;ία^35ναΙα:αΙΟο32300^οοΗ3Ί 31S3V89G3WOV3SV331V8V_3S98SS331V3SOV81VSV3S315V3::05V8VVSSS3V3 :U1W33V89V5SH:U 〇〇s Q6I2 0812 OLIS Q9C 0512 OKS OCTS ST2 OIU ωυυθησφωrHeucn-Hs SSH i Ί IV 5~ί~5~~^~~§^~~~^~~^~~5~~§~§~§~~5~~^~ ~^~ CJH 313 V 3 3H1o13 H1V 3ooum 1V 3313 lovoJLol 3ΗHo011 Huo3e)wOE-V 3 Jivuv JL 3 DSH vuueuuue 4 ecne ee euu-ue uu4-)e4-)4-Ju 64-J4-)3e4-)ueuJJ 〇 〇c 0602080CSJOOCVJOSCNIoscslQSCSIcrooCSIocsls os^ vsl J.VV3 Turifue e 6 ea-JuueuwAJueo:! euoouu eueee ?T?^u5uuu4JuT^ue 04-)4J4Je υ u4-)euue 6u564-)cn4Je4J4Ju4-J-u4-)euu4J3ouu4-)4Juuuero5 e Eu6u5 6-ue ecn 0002 Q66I Q86I Q/.61:0961ος6ΐ i 0ΓΟ6Τ ϋ QT61: ϋ·Ηχ·Ηυ·Η&gt;uyicpQJT; ee 54-131? i¥5^Ti3uTi5^i3ooe ee 6-ue ee eue4-)4 -)6XJ6 u eu)4-JeJ-)4-)uo4-J64-&gt;w eu4J4-Jueu54Juueue 6 e 6 e 邙:T4ue p ecpaJo4-Juuuu-pfo4Jeui?u34-l64_)u4-l4_lu 〇06I0681oCDODrHοεΐ0981οςοοΓΗOSIοεσοΙ QCSI8I0Ι8Ϊ aJXJuXJJ_) 63u6u4-)fOu4-JfOJ_)eeu4-Jeu3w4J4-)rDu36&4-)e6ewoeoeu4-)4Je6e4_&gt;ee6uueeo4Je4-l-peaJ6e4-)ueucn4-Jeeeeuucn6uee4_&gt;4-&gt;n1556ee64-&gt;:}eep4_)6eo64-) 〇〇 Ξο6α 〇8αoprH2 two oLn two 0= ΟΓΟ二S 二Ξ二bJ-Jqqcnfce 64Jue eoOJue-t-Jeeu-ue e-LJeeeu4Jee4-le4Ju(JfDe 6 eue-l-JJJwcn-pcnwweJ-Jcncn-uJ-Juforarc-urDrOe-uuJ-lCJuuowuwcpueu 6-u-u4- JeJ-)un3e e 6u4-Je4Je4-»4-)4-)eJJ4J 00二06910891 Q/.9T 099T 0SI . 0SI 0SI 0SI 0191 _^_________ s e-uuJ-tueuuee-pIU&amp;eeJ-JuerDweeJ-J-pXJJ -lcneiJleJ-JIrolXJIeu-l-JI-l-'lolecniea-JI-UJI-ulwulepXJuweeueefceeeeJJXJeeucnTUAJrDI-ule-l-JIQI-ulw-ululebe-lJI-ulJJIuluuuetp^cpq ee-ufuOJ OSI 〇6ςί n 3ςΐο9ςΐοςςΐ ,1 QSI QSI 2ςι L" b L]e'4,4υ:}υ4_)(Όυ{?:^ρ5π:5Γ3υίτ3e UU4-&gt;4Je 6 eu-p6 ee qJ_)e6cnuecne 64-»e 6J-J6 e 6 euue ee 6 6 wue ecnew4_) e 6 eJ-Jo-JeoXJJJfoeue eee 6 eu6 6-pw4-)u4-)-pe e euq 7 一〇οςΐ 〇6K 〇8 2οϊτ SKοςία s II OSI QSI οτπΐ ocn: one yu, 4J-)ue: one:一w Ceu4-Je 64^υι?υ^Ε5&quot;?Ε^ΒΉΒ&quot;^54_)65υυ4--)ΕΈ3¥Β^ΈϋΒ^ eOJ6 54-)95356U5UU4JU:! 6^6 6 64-)4-)0- ) 6 e 5a-J4-J6cnecn6XJ6 6 64-lp 533e4-):iu 00s 〇6εΐ 〇8ει OLrnI09ΓΟΙοςει 2ετOSI SCI οκ τ § CQV ^ , —]o64-&gt;6-uuu3 6a_)o65cn364-l664-J£&gt;64-J5cn-u-ueeeou5CJeu64-)rnu4Jcn-u6cne:iuuuJ-Jcneeuu64J6ouu-UJu36uu6u64-JI6ule3uaJeu64-JJJ4Je34J6uuu-pn3-ue5 -uu 〇〇e:T C6CSIIOCDOVJT Qd Q9CSJI sCSJrHϋopoCNJl:οΗΐ od IIH Page 57 2002.06. 26.057 1247040 Case No. 89122618 _η 曰Revised VI. Patent application scope ίπΗΛαϋνω^,Ι^Ιαν^οοα.αυΙΝωΙΊΗΣΒο^ιωωΛ QOS sg ss οαΓΟο9ΐεοςιε orodrnOCNJIC s (1) Γο ONSAAa:e)ODcr:e)D030s3 3oISE-'alda:&gt;Ial:H33&gt; 0QIPOQsc §εοεοη§rnolnopoirnornoroosc s〇rn £^ΛΙ03α:ΝαΝ35〇ΊΗβ:&lt;ΛΝ 3αΛΝ』ν3ν Ια&gt;ί5α Ie) 3 OOOHUOH&lt;n-&lt;ouoo&lt;n-5&lt;ssu«o&lt;n-oo&lt;06&lt;Huon-so«u8HOO«o&lt;oo&lt;n-OHOH«OHHOUn-^&lt;OOUOUH&lt;UHUO«OUHUSOH«on- Ow Q0〇c S6S Q86Z 〇L6S Q96CNJS3 3 S3 S3 sslHvd〇Jd3^a:e)Dic3e)3s3e)cr:sda:e)e)00s03LU3 ΗΗΟΗΗΟΗυυ«ο«υη-Ηυο«υΗΗΟΗυυ«08&lt;υοο&lt;ϋϋ&lt;ου&lt ;ϋοδη-§ΟΗΟ&lt;050ϋϋδυυϋδΗ08&lt;οοϋ&lt;-ϋ§υο&lt;υϋοΗ«υ&lt;5υΗΗϋ&lt;η- 〇〇6~ Q68S 0882 0ε2 09s 0ς8Γ\Ιci Qoos Ξ83 aHCINuvJAUJz 3&lt;:e)v3vo333wvoo\/oe)e)H.LovH3E-«Iu&lt;c&lt;cneu66AJ: Iw-p4-&gt;4-)uu4-J-u4-)4-J4-)uee4-»ee4-J34-)eJ_)cne34-J4-)4J:lewo4-)ueecn64-)J-Jeeueueu64_)J- Jeee4-JeeJ-iu64Jw6e 0〇s Q6LCNJSG Qr-r-e09 Bu CN1oLn Bu CNJofcslOPCNJCCSIG GdzMaaoMTHSSHaHAAIVSAdCJaNoaN oqlcnjoscn: oscnjoecvjoscslOSOJOSCSJOSCNoscslοΰΟΝ ASMHVAOVQJAVIAaeJtJ ^ i ^ GI parent OHOaossoooso &lt; ^ ΟΟΗϋ ^ ΗΟ &lt; οουο &lt; ΗΟΗΟϋουοΗΟΟΟΗΟΟΟΟΗΗ &lt; 05υδδο «ΟΗΟΟΟΗΗΟΟΟΟϋοοΗ &lt; ϋ« ο &lt; οο &lt; οϋ &lt; οο &lt; ϋ «ουοΗΗϋ &lt; Ηϋοοδ« ουοοο &lt; OSCNJSLT) C \ 1ocoLnCNJοί (ΝssoLnlnCNJOSCNJoroLnCSJOCNILOCSJor-lLncs 0e) 000s3:! 3iH3d0xdi2: IoE- &gt; DH3 CJvv3v3DVV3ov3e5vL) 331vve) ove) 3JLSov3ve) v3ole) IVe) M νυο31Η01νοΙΛΑ / 30νονΗ1ον9ο30νΙοπ euJ -J:; e4-Je4-)64-&gt;6-p-UJ64-J6J-Je4Jcn:;3uL]o64--&gt; 〇os 06s iCNJoiCSJssoLn夂CNJoiopns oi ^ oAIAIlodlN 00 3 srnCNJoooon Cslob onCNJovx)rnc\IoLnrnCNJOSCNJQroroCNJoCNJroCNl〇«-HroCSJ Page 58 2002.06. 26.058 1247040_ Case No. 89122618_Yearly Month_6, Patent Application Range q 0cu:lL)e 〇cCJwGef) 6UUU64-)ue4-JofO:lXJe e w4Je4-J4-Jn34Je4_)ueJ_Je e^Jue4Je4-&gt;u^ e4-&gt;:i e4-lroue ee 63Π3Ε eouu^Je £&gt; eeeo34J4-)6ue eucnecneue ecncnTOe 3 e eue 00Ϊ 06U Q8U QLIt/091^ oLnuom οετπ 03οτΐπ 00- ^ 〇6Sο8〇ποεπ 09s 〇Lns os^ 0S17 oCNJ〇>015 ueeuee6eecn6u:leeou4-)u4-)eeJJeeee4JeaJ4J:i4-JEee:;u4-)4-&gt;ee64-&gt;eu4-Jeee4-)- u-paJ4JJJ4J64-J6ue4-&gt;4-»4-»4J-p6cn4-&gt;5:;-l-&gt;4-J-pee64-)eu4-)eee4-Jeeo4-J64-J:;fD4-) 5u4Je4-J 000^o66rnipnogpo096ΓΟος6ε irnorocnrnoCNJcrtrnorHgpn 5,44-Jq111 erc,4CJ6 w & 54J6 £&gt;uu6e4J5 euucne 64JeeJ-J54-)5ije ee 6 6 6 5 ee 5 66 6 e 6J-Je e 6 e 64Jcne e eueuu6 ee eJ-Je eJ-le e4-)e e4-^e e4-)e e-ucn4-)ee4_)eee eu£&gt;cnu 〇06e iroosroοεΓΊosroosroosfnosfnospnosro + w&quot;ITMIA3&gt;i&gt;A2TQ:sdsHSoe)D:HS&lt;l 008ΓΟSGocog 0 Factory ¥09Ζ.ΓΟo Ifn0?^ οΓΟ/, ε cprn25 H130c:Nu,&gt;I&gt;cr:c:v33c3s&gt;c:s:VMV"l&gt;avd IVCAVSl Qs'rno69cο89εοερο099ΓΟolnVJDrnos^os£οΰΓηsgro ιΙϋ&lt;Ί3ΜΛΗνΝα2:,Ι&gt;Ι3νΛ^3^ α:3805Η&gt;ίΛΛν』Ν0 &lt;roo&lt;on-ouuo&lt;HUOUHU«ososoo^o«u&lt;^o«UUSSUH5un-^H8u5&lt;UHHBU&lt;u&lt;uuo&lt;o&lt;uuu50&lt;o&lt;«H005WO^UH^U« o&lt;o 〇09ε 〇6ς£ csroQGro2S csfnοΓΟςε ose Ξςε α,Λ1ΛΛ0330ΊΛ3α』Λ8Ν93:3ΝΛΙ0Λα:ν03ΗΙνΛ οοςεοϊΓηirlοίΓΟS3oLn忑oiopn忑OCSI忑ΟΓΗ忑ΛΙ8ΗνΝΙΝΜΗς3ΊΗΙ&lt;3 lD&lt;s3svov3v33o\A/ulv3we)013vCJe?3oox3c)e)&lt;31ve) O3vve)6e4J64J4-J:}J_)ee64-):i-u6£&gt;uoe5uoecp4-Ju4-le4_)ee&gt;3ueu-u4-)ee-u):iaJe4-JJJeeaJuuu4--)e 〇0忑ϋ61ΤocornrnosrosroroolnoornogrnororornOCSJS ΞρηΓΟ NAlADGSVSJOIMOlAdINHSN r^^^^ro^^u^u^^uurau^u^u^u^ovu^^^^^ro^^H«o&lt;HOHOH500^ss&lt;oououo&lt;HHUO&lt;UUHSOH«un-HUOHn-OOUOHUO« u&lt;uuu&lt;u&lt; (K)p' 〇6S 08s 03⁄4 SCSJCoLns 0^^ QCCSIrnss ΙΗΙΙΗ Page 592002.06.26.059 1247040 Case No. 89122618 Revised patent application scope Ln丨邛54-)aJ6uu66-UJeue:i6J_J4-leuu-p:;6eeu4Ju6uu6ueuu4-J6wwuuuu6uuuueu666ufnuuuu6eu66eueuu06u56664-)u4-)ucn6cnaJroucn4-Ju6u0u4-)e3eu066π 0867 QL67095 0to6eο多0ε5 QS6P 0167 J665uu4cuuu65u:iu: Ieiuchc66eu6:;4Jwuu64-)4-)euuew4-)4-!4Juuueueeue£&gt;6ueu5u:i6cnu4J:ieun3e65uern666efoueu:i6^cn6-pu£i5uuuecn66uuu〇〇6π 06? 088^ οεπ 098^ 0ς8= osq 0ε8π QS〉 0τ8π UUXJ6 e UCP6U uu 6 3CH6UU ecu ufcu4-)4-i6 5 ucnpucnecnuufOucnb υ ufofccn4_)eu8 £&gt;66π36 uucnuTOcueu :i4J:; Buu u ecnbeerDroe 6fccn6cne uu 6 uuu euu4-)-uc6 6 e 60〇8πo6i Q8i OLi095oLni 0?^ opns 025 0 ΐ i 5cnuuuu£&gt;e(Ou(Je e ecpu e 5 e4-J64-&gt;6 u UU4-J-P6 6 wuuuucnuuu 5 eu 5 u4-l6ecn6 6 6 5J-)ueXJe eΠ34~)υ:} £&gt;6 uu eaJw4-J4-l4-l£&gt; eue ecpu eu 6UUU e 5 uuq 6 5ue eu 64-JJ-le0〇i 0697 〇89π 〇Γ-9π 〇9S01097 0S7orns 〇S70197 b 6rc6 5rr'uce uueeu 6 6-4{?e4-Ju e e4-)4-Jefue 5cncnOJe ue 6 eee e-u4-&gt;4Je u e4J5u e uuu eeue UUJ-JO6J-JU 64Juu-uuuuJ_)-uu5ueu6 6 6 5UCPUUJ-J6 eu-u)eu6 6 6 64J4J〇〇9π 〇6ςπ Q8LO> 〇9ίοςςπ ss opns Qs〉 QIS: a 6UU 6 3-ucpuue ee 6 b 64J4- &gt;6ue 5 e eeuUu6e6 5 6 eu:}u6ij6 e 634-)34-)36 e4-Jcn4-)u4Jeu e uJ-Jcnee e4-Ju 5 6 5 e ecn4-)eu4-)4-)eu 5u6 £&gt eCp5uu4-J4-J:icnu4-Juuaj5ue 6〇〇ςπ 〇65 〇f 509卜5093 0ς5oi 〇cw S3 ub 616 6 6 ee,4 6UC6 6 u 6ee4-J6 e 邙5U6 6-p-UJuu U4J5 £&gt; UCH6U6 e eu5 eu4-J4-)£&gt; ecpcne4J6 e 6 64_)UU4J(JU5 6U6 ecne ecncncp6 ee 64-J5U6 6 6rcuu5 uuu euq : one 00? 〇6S083 0/L3ο9εποςΓΟπOK =οεεα oOSIro^roIi u,4 6 u 6n3ub e 6 we 6 64_)4JUU6 &amp;rc6(Jecnecn6u4-)3 ecn6u5 eucpe e 6 ecnu66u6 ucncnuJ-JecnaJ6 ee 5e6cru6cnu6 6-p4J64-»4-&gt;uucne eue4-lue eJ-J:; e uuowwe 6-ue e 6 003 06 s Q8Soz-s 09 sος203οε2 ocslCSJe 0T3 Page 60 2002.06. 26.060 Ι247〇4Ό_^π^ 89122618 ----—1^ — VI. The scope of application for patents may also be U; (b) and (a) a nucleic acid sequence that complements the nucleic acid sequence; (c) substantially and (a) Or (b) a nucleic acid sequence homologous to the nucleic acid sequence; (d) a nucleic acid sequence identical to the nucleic acid sequence of (a) (b) or (c); (e) under stringent hybridization conditions, for (a) (b) ( c) or (d) a nucleic acid sequence in which the nucleic acid sequence hybridizes. 9. The method of claim 1, wherein the beneficial nucleic acid sequence _ ^ t ^ Μ虱 Μ虱 fatty acid composition of the T-knife transformation gene flax plant cleavable method comprises:) preparing a chimeric nucleic acid construct, and operating the conjugate component ·· In the direction of transcription 5, to 3 (1) from the flax to the seed surname # # m古尹松 deficiency Ζ special mobilization gene; and hemp seed special mobilization gene is non-biological; ^ the beneficial nucleic acid sequence The performance of the column of '10' caused the change of the protein in the seed. Name &amp; f ^ (b) shellfish or fatty acid composition damage head heavy Korean shape 篡囡S β诘仏=... including &lt; (8) put ... nucleic acid construct 1 into the flax plant cells and (C) make the flax plant cell 3 in the = beneficial nucleic acid sequence, which is in the 2 hemp 5 = 2 mature flax plants. Under, in the seed performance. Control of sub-special priming genes 11. Species can be introduced into plants within the soil a) Nucleic acid sequence of nucleosides 2〇23 as shown below Page 61, consists of the following: a single nucleic acid sequence represented by a temple. 1247040 Case No. 89122618. Amendment 6. Patent application scope H—H Q9et—i^^uecn6ou66cn5:leeue64Juu4J5e4J4Jpe4J£&gt;4-)6u5e4-)4Ja34Je:;4Je:;4J64Ju4Je-p4-»4Jcn94Jen3r[3n3u4J4Jo64Je4J:;4J4Jfon3e4J4Joe6&lt;I3IooCSIrH 0 821u(T3r)rcee4-&gt;4-Jui?eu4J6fI34J4-)4Ju5eee3u4-)6:;:;euu4-)4-)6cn54J:Du664Jw54J655e4J4- )een364J665e4J4Je54J£&gt;65rc6e4Joeee4JuuΓΗ〇(ΝΓΗ 〇〇OSJI 3eaJfO9l?fOeuE^ou4-):lcpe6eu4J6e55-pu6-peo4J64J6u664-J4Je6o4-)ucnecn4J4J6CJ4Jcnuu6:;u4J:;4Jeuf&gt;4J4J6563fo654Jeeuu4JXCSJT-Il: IrHig: 〇C\'II :; U64-)4J4-)3uucnea1olebu5e5£u4Joe£&gt;uep4Jn3:;66eeu4Juw5cnu£&gt;4Ju4J4J4J6e:;-IJcnu4Jcou4J5-p4-3uo:;u5e6ou-pucneeo64Jo4-»ΓΗπ〇Ι 〇SI4J4Jcneu4-J56u64Je:;p4_)59ee4-&gt;e4J4-)ee4-&gt;4-):lw4J4Jee3e4-»u:;ee4-)4Je4-&gt;4Jf0eu:;4-&gt;en34Jee-pe:;ee:;ee-pee4Je4Jee:;e6:;e4JIepul19^ s 〇9 64JIpfnl3folg5aJ55ueu6:i4Jueue4-)p4-)uuee4J4Jeun3e4Je4-)u4-&gt;4Jee4J4J5u4Jeee4Jetnewfopue4Jeea34-&gt;-pee4J:;oe o:;ro:;4Jen3u4-)4JXCD3 s 〇8 84J4-Ju65eee4-&gt;4Jo-u4-)oe:;4Ju4Ju4J4Ju:;o4Jeue:;eu4Je4J64Ju4J4J4Ju4J4J4-)4Jcn4J4Juu4-)4J:;e4J:;4Jee4-&gt;4J :;4Jee4-&gt;4J:;eee4JIeee-pleeeTHQOO — s_ Π Π 〇〇00e4Jn3u3eetnee:;eueeio4Je:Di'i^ri&quot;i¥^¥i^4J4-&gt;e4Jeeefoe4Jn3eftJfofo:;n355u:;e:;peeJJ&lt;T35:19eee4Jun3e4J:;ern664J-p4-)e-urnCNJBus 〇CVJBu e54J54-Je64J:;66ueu4Jup4J4Jyeeef&gt;4J4Ju64JI4JI4-&gt;lf0lew4-)lul4JIeiu:;4Je£&gt;m54Jecnecn-p4Je4J4J4J4-J4J5e4-&gt;4J4-) N3cnuueee6:ieen35:;ecne Hvre 07 Mountain d4J4J4-)6ee4J4-)u-p4J4J4Je4J4J4Jecnuu6£&gt;4-)4J5uuu660u4Je4J:;4-)4-Juuf&gt;fo3ufo4J4-J4Jero4-)4Je4-Juee0ee4Je04J-pee4J4Jfo5e4J:;-pn3u-pΧ9ΙΓ ) ο9ς4-Jrc4Juu:;u64-)ueeu4Ju4-&gt;:;4Ju5eu4-)£&gt;65:;:;e:;o^4-&gt;6ee:De4J:;ecn-p64-lfoeuo-p:;4Jou4J4J4J -pn3e6e64Jfaeu4JrD64Jeeu4Je65efoΓΗοοπ 〇8 7-u)e4JJJ65uOJ3eeuu4J:iepo:iuou4J4-&gt;rau5e6eu6fo5oeee5u4J4J:;54-)6:}pe4Jeeuou4Je£&gt;:;4J64Jwe6ue£&gt;ee6JJ6£&gt;tpu4J-pK5rH〇7 s 00^ Sichuan:; —66ul:;e6:;4J4Jueeu4J66664J4J4Jufo4J6n3e6e 666£&gt;664J64J6£&gt;ee4-)u6£in354Je&gt;6-pp:;4Jue4Jcncn6pa35e£&gt;4Je5655ee5-p55rHOSJe oCNJrnn3cn6fo6cn4Jee54Jef&gt;£if&gt;u4Jroue6u4Jo4Je55cncoue4JufDe64-)cnoe4J4-)u6-pe4-)cn6fc6uu4Jn3focnefo5u4-&gt;54-&gt ;64Jfd:;4-&gt;uu6ecnu4Ju-perHvCNJ IH 072 5-tJioCT'ufO4-)5XJ4-&gt;5rOcn55gu4-)fD554-)u53u4-&gt;n3uraoeeeefD65u6ue566e4-»¥E5&quot;il&amp;5B¥EE4-)4Je-» -,5u-p6-M4-)ueueOOua4-)eeeuuΓΗ9 χ 〇9 X e:;6:l4-&gt;-pn3e6664-3-pcne6eueueuuu4-»:;cnuu4J-peo£&gt;fo4J3e6erouo6e4Jro6e6o6e£&gt;4Jecn6fo6656cn64J4J4J6uo64J554Jp5-tJ5T- HCO 〇CD54-)ro4Ju54-J5fc5u4-&gt;55 邙u4J54-&gt;fc5o4Je5e5ue634J4J6ee65cncn54Je4Je5efa54-&gt;4Je4Juoucn5365etnuuo4-J4Jecn3ooeeeeu4J4-)χ Page 622002.06.26.062 1247040 Case No. 89122618 曰Correction 6. Patent application scope OJ丨H οζπΓΝ!cn4Ju4Jcncnu4JuJJJJa3ucn4 -)rofI3fo4J4J4Jfu4J4JcnfocniT3foun3euuu:;u4-)e66:;euee64Je:i4J4Jp64-)u6ee:;ioue^pee(T34Je:;-p64J4-&gt;fIJ:;6fo4JΤΗ卜Γο3 6〇Γ—Ia ^ MSSTAHAVVAOJe)Lr)6οΓ-Γη&lt ;Ν0&lt; OHVOOHCJOHOH X 31D 33V 35CJOO38CJlovs 3HHse) 90ε (Νb6οενΊ ^ οΗΙΊΊοΛΗΙΊναΛΊΛςΓ 'ς〇ε (ΝOUHH3SHluHHle) e) ouu &lt; UH &lt; OHH UHUe) e) D 310uuxiuHV 3HUHusouu3HDHHUHHe) VDaCNICNJdshlAlT ^ HVIITSIAHVHTLnLnςπ (Ν (ΝHUL) uuvuHluHVuJLoHH3 UHU Hoo uo &lt; uuw &lt; H & lt 03⁄4 OHU &lt;UH UHO uu&lt; uoo ou&lt; HHU 98ICNs ΙΘο5ΊΛΙΊσ}οϋνχννΗννΜΛςε Ln8Tf\Iuhvohuloe)UOH013 3HVUH3 UOH &lt;00 103e)30uov 33⁄4 vooHov 330030owfuo9CSJICN1πε &lt;OASctdoaOOASHe)oooAsdLr)r-HLnSICSJe)L)e)〇&lt;uCJ)&lt;HH:u OSV 3uosvue)&lt;3e)vCJ0&lt;CJCJvHsEHv vCJ&lt;(Joe)e)e)c)3e)ooosEHVXosv SQCJ99〇C\JbIMOHHoVAHOKHOawΓΗ Ln9〇CSICJ^e)&lt;oe)u&lt;(JCJ&lt;lt;; &lt; ϋ00υ0υ &lt; Η &lt; 3ν0ν33 &lt; 303 &lt; 0 &lt; 3 JAfoDH &lt; 4-) meu6eu4Ju4- »4J:; en34J4Jecn4- &gt; 4Juen3rH〇〇c \ JHV3 s &lt; h &lt; h OOOCSJfOouuJJwfoyfDIpululeweJJJJueeuueEiuu ^ eeeuettstnuyuepfouuaJuoJJuppuupeeuJJIfoleulypeuleeueoupyeyueaJIJJuwoICSJ61§sv V3VUI billion (N6 I ueu4J-p6uueuoouoeu:;uueu4Jpu4Juueoo4-):;eoo4J64J6oeuu6uuu4Jue6e4Jeul554JI6uleuleeu4-)3 5 4Ju6erDe564Jeu6 χ ποοΐ 〇ποοχ4-)uuuoefou64-)6eeeu64Jeu54-)eue4-)ue5ee4Jo4J4Je4Jeueeero6eepee6(t!4J5:;ee4Je64Je4J4Je4J-p:;ufouee6uuun3£&gt;4-)4JeΓΗ9 I 09 ΔIcnfoeu4Jfc:;fc6ecn4-»6ufI3ucn:4n34-) e4J4J54J4- &gt; 54J4Jeuo6n3cnuJJ4- &gt; 4Jeuocne5u4J4J4J6cnl64JI4-) l65u4JIfol6u4Jueeeuoee £ &gt; 4-) 4Jep4J4J6ee 1891 〇89T-IuuueuufoeuouXJu4Juwe4J4J4-) uon3e64J:; e4Jee4Ju6e64J54-) e4Jue6cr.4J64J4-Jp4J4J64J6eeeo4J6eeu55eef &gt; o4J4J4-Je4-) 4Jee4Ju I〇9rHs _ thousand and 91 6eXJcnuo-pe6u4-)4J:;-peJJoeefo:l-lJe:;54J4J»T3e4Jo4Jeu4J4JeeiDu64Je4J4J4-)l4-JI:;(T3lfol4JI:;oi:;e4Jfo:;6e:;-p4J6e4-)e:lp4J4JJ-)4J :icnl4JIe4JIu!eT—lCNLnrH 9H s oCNJLnT—I4JIe(I!l4JI:l-plufI3le6:l4J4Jpeepo4J-p4J4Je:;364-&gt;lp-plule4JIefI3l-pl4JI4-)lule4-)u4-)4-&gt;4J4Jfo4J-p54J: ;:;n33fo4-)4J4Jueeeefa6J-)5-pfofo4-)u(lJ4-J6fop5oe I wrH 3ecncp-p4-Jn3-p-prDpe6uup6f&gt;4-)-peu6eu-p6eCOuu5-l-)CJpeo:;o6cn-pee4Jf&gt;4J6e4Jeuuu5ouu3J -) e5uouofDcnf&gt;cn3-p4-)etJ&gt;cn(Jro4-l6r-H1ro»-l page 63 2002.06. 26.063 1247040 Fee six, the scope of application for patents t 8912 2618, the date of revision 〇〇C PO rH CT ld vr) vc CM OJ Cs u -uc 〇U (ΐ ζΤ ο -ί- L〇cn Γ- rH J CM rH vd cn ch rH CPi 卜 00 od m co ui 〇) 〇OJ rH CM rH C\J m 4-J 4-) f〇OU Π3 O -PU 4J 0Λ CTi O') CT\ CT; CT^ cn CT\ rHCPir' LDmrHcnr-rH^HCMrO^TLDLn'vD fC4J4J〇^a3^fC(J OU-PfOUrcCn-U &lt;X3tnn3c^fCU4JU Π3 UC (ϋ -Ρ L cn &lt;Τ3 η 4~| cn C 4-) 4-) 4- 4J Γ3 π: 03 4J ίΐ 4J L ίϋ f〇4-f〇fD -U 〇ϋ 〇n &lt;e&gt; 5 0 0 o CJ oc &lt; CC U CP 4J U (J m OU 4J 4J &lt; Cn ϋ ίΰ ϋ Q fU jj cn Cn Cn re Ο -3 -P CT &lt; cn 4J re &lt; ^ (13 -pu 4J 4-) U &lt; U ^ ^ O i〇f〇-Pa3〇3CP4-JfTD- L-&gt; CHfI3Ur〇4J4J〇U d5n3-UCnri3UCnU UUfTJfOnSCT'fCfO fCfDCn4-Jf〇f〇f〇fC rH Cn Cn U f〇JJ 4-J 4-J f!3 CP fD cr&gt; (J Π3 (J CJI C 4J 4-3 Cncnro υ f〇fD tn 4J UU (ϋ CJ 4-J u 4J *H cn na 4J f〇〇f〇4J cn cn re (j Π3 cn ο u towel 4J r &gt; r \ r &gt ; r \ r \ mh UU -ί-ίΟ 〇3 4-•P ϋϋ 4-f〇(_ 4J U -l-4J f〇Π: CH 4-&gt; Π: 4J f〇UU fC ou (J CL, u &lt; on: ϋ &gt; H + 4J 4J 4J cc 〇H 4-J fU &lt; O -P 4J ο ω h (7) cr&gt; u 4-) ·Ρ O 〇U 4J ◦ U cn 4J &lt; 0: &lt; H 4J 4J L/1 w iw; L-/ v^/ fu 〇* &lt; 4J 4J O 4J i〇4J O 4J iTJCT'^tXJCJ'fOCT'C^ &gt;1 CJI ίϋ &lt;T3 f〇Π3 f〇4J 4J -HCnn3fl3f〇UUUCr&gt; 0 f〇Ο Π3 fT3 〇3 4J U 4J C1j U Cn 〇 r&gt; 4J ru. (JU fDCnOn34-)〇rifDU UU4-)4J〇4J〇3fC Cn 4J fti 4J 4J 4J 4J -P uc fd cn c Cn 4- tn fC 4-4J Cn 4- Π 〇O uao cn cn Ο O 4J JJ O &lt; cn f〇o &lt; u σ m cp fO 4-) 4J4J4J ίϋ Π3 -Jj 4-&gt; 4J 4J4J4-)^JUO〇4J fucn-pfomcp-paj fUc〇&lt;T3Cn4J^4JCn (DUCTin34-)tr»n3Cn 00 u ω fc I -U f〇LU 4J fC 〇oo O rt; 4J ίΰ 4 &lt; 4-3 &lt; ua -po (T3CT&gt;nDr〇racp4JCr» 4J4JUf〇(Cin4-&gt ;fC D^-PUfOniitiOCT' λΗ f \ /r&lt; 1 \ T \ ^rs ^r\ f \ CP Cn U -P 4--P Π: CT&gt;tr&gt; 4- &lt; E-« 〇&lt; Η υ m Ο O 4J 4J OOOOU tn P «p »U w 'U 4—1 w VJ* \J* KJ fOCnUUaJaJD^CT' C n 4-&gt; r〇4-J CP Π3 Cn cn U tn c〇r〇Cn tr> Cn 4-» Cn 03 4- υ cn c 4-)4-)4-tJ&gt; 4-) 4-cn 4J C 4J 4-) C cc υ c 〇 &lt; i H &gt; π n 〇 &gt; Ο O (Q *PO &lt; OO f〇cn Π3 VO &lt; 4J (〇Η O cn CP U ^ &lt; H 4-) (〇4-) Cn 4-) 4-J 〇0 CJ&gt; ΓΤ3 tJ&lt; 4-J U4JCT&gt;4-)f〇4JUi〇03 (J fC ί〇Π3 U C7&gt; O 〇3UUUU〇f〇 4J fOCOOtT'-UiTJfOfO UtJ&gt;Ufd-PUn3i〇U(J4-)n3U4J4-)f〇f〇UCnCT&gt;r〇4JUi〇f〇U Cl: υ Π3 cf〇4J 4~ UUD -P f〇4-; cp υ 4-σ« acu υ c 4J JJ ci Cn r&gt; r〇' f〇Π 4J ' ro &gt; 4-) π 4J no π 4-J 〇uu cr&gt;&lt; H CP &lt; ^ O &gt; cn 4J O cn O 卜 cn 03 O &lt;cr&gt; (ΰ H co u κ -υ υ cn U Ο OU 4J CnCJ&gt; CJn3n3 (JCnCri cni〇cr»uucr&gt;4-&gt;u UCn〇Jf〇4-) f〇U4J UCnjJfUiOUUU UV ϋ cn Cn (J 4J 4-) 4-) 4-&gt; f〇cn Π3 f〇UU4J4Jf〇U4J CnUtnOn3U^fT3 4J4J〇fD-POUCJt U -u: Π3 OC 4-) Π3 ft υ F〇c » tJ&gt; π CJ&gt; 1 cn 1 -PO &lt; 4J &lt; a: cj o 4-) cn 4J f〇Η O cr« (13 U CJ4J4JfD(X34JCT' 4-)4-)f〇tJ&gt;〇3fCUCJ Cnf〇Cnr〇f〇n3CT&gt;C7^ OUfOrOfOCPfOCT' cr« υ -μ f〇υ c tJ&gt; U TC -P uc -p tn c » cr&gt ; π 4J i 4-&gt; n n3 丨Cn υ &lt;c jj cn LD &lt; oou υ 4-) 4J ο &lt; -P m &lt; CJ 4-J (13 tP4JUCT&gt;r〇(nCnU -P4JmCn( JUFA4-J 4JCnfl34-&gt;4-)idOn3 (Ό (Ό -P Cn Π3 Π3 U -Pr〇U(J(〇n3CP4J 4-) 4J -PU (J Cn Π3 tr&gt; -p ft cn CP D 4J 4J fQ ' -P * fl3 CH CH i 4-&gt; Π 4J i (J (JO O &lt; cn 4J U CT> u υ &lt; H JJ cn (J) QH 氐U f!3 Cn Cn 4J - P f〇4-) (T3 4-) fUCnCPfOUUUU 4-&gt; 4-J 4-&gt; 03 Π3 JJ» CJ UOUUfOCn-Pro -UJ-P^J〇UU+J〇-U 4-) U uu ϋ 4J fC 4_) 4J 丨D&gt; ' -P 1 &lt;T3 i ϋ 1 U Ο O cn f〇H &lt;tT&gt; cn u ^ ο ω jj 4J 4J Cn (Π f Π rr&lt; UJ -M vj 4- ^ O' 4-^ (U r〇ft3CnU4Jf〇Cn〇3Cn 4J-PCnn3fDf〇f〇Cn 〇4-&gt;f〇f〇fT3fCCr&gt;4-) Cn f〇r〇O Cr CJ1 -P 4J f 1 , I \ 1 , rr^ 1 i Π3 U Cn tn Π3 Ο Π3 (13 -P f〇u U tP u 丨(7) ; 7 1 4-&gt; 丨03 丨r〇Vw/ \\j U CJ (13 fC£-^ CO H CO f〇4-) 4J CP Η O 4J 4-&gt;&lt; U CP U -Μ -P Γ〇Γ〇-P f〇UCH4J4J OU 4J 〇Cn4JCn(lSf〇n3UiU cncnfccn^jfdU( 〇cn υ tr&gt; υ cp -P ϋ·υ 〇3CnU4J4J4J〇〇05 4-JU rH rH t~1 L〇ΓΟ rH (ϋ \~fo O^i rH OQ C3 &lt; re cn r- o Bu 〇o 〇L〇CNJ tH ^ CO VD Π3 f〇f〇4-) 4-J Cn -P Π3 00000000 'TCMOCDV.Dr^ogo lD VD ii C\I CM CN OsJ TH 00 rH CO 〇\ CM CM CN (M 〇rH (\J CN cn KT LT) VD ΓΊΓΊΓΟΓΟΡΟΓΟΡΟρτ) I HI Page 64 2002.06.26.064 1247040 Case No. 89122618 Revision 6 Scope of application τ ς〇ΓΟπ 564J4Jn3oeu4J(T33u4J4J6ueecn4Jueeoecnue65e64J-p6u4Je4Jfo654J54Jfo6o:;e4Je64Jeuu4Jn3e4J64Je6e 0^^^ 5eCVJv 6e66roucnee6fafou6e6uu-pe36eu6uefo66uu4Jcnro4Jeueu3ucn4Ju:;:; eefou-p-peo3u4J4-34J4-3e4J:; oueeefd4Jcneecne4Jo:;:; 〇9ι-ιπ 5ςτ-I7 EE-pu4Jeroe64Jeee5e6foueu56e4Jon354Jecn554Jue4Jecnee4J4J4Jeeeu5u4-3e-pe6eeto6foufo6eue54Juuefoucneuee4J4J6 〇8〇 keep Bu 5 billion ▽ 4J64- &gt;:;64J4Jee64Ju-p4J63:;o4J-puu4J-pee66(TJou:;cncn4Je4-)ro6-pn36:;4Jupcne4-)64J4-)4Jfo4-»eu4J:;oeue5eu4J5uutn4-)65oe4-)4Jueo〇〇t7 66 6ΓΟ4Jcncpcp-lJu4J4Juefce66n3eee5eef&gt;4-)e4J4JiJ:iuucnou4-&gt;u4 -34JfDeu-pe6ueeu4Jcneeeuu:; ufoeeueuee6ee4Jeeeuuuueerou5 〇Γ \) 6ε 5 Χ6ΓΟ4Juufccneu64J6efou4Jeuu-tJu4-) 3eueou4Jeecncneuo6eucnu4-) 4-Jcneeue4J5u664J4Ju4Jueueoee6uucnu4-Juu4J5u54Jeeuoe square ¢ 700ΓΟ 6e8rnu4J4JCJ &gt; 4Jfu4- &gt; 4Jocncnn3uo4-) u4- &gt; 4- »ou4J4-) uo4Ju: ;i?3u4-)4J4Ju6e54-&gt;ueoo4Je:;64Jecn-puu4Jee6uu4Jo64J4Ju-pcnu54-)4-&gt;uu4J4-)ef&gt;4-&gt;5u5 〇9 卜 ε 6Ln ΓΊi!3cp-u)uCJ&gt;cnn3fI3uoeCJ- Ue4-)+-»4-&gt;-ue54J5cnee4-&gt;4-JCJ54Ju4-&gt;4-J4Joufduu64Jue4-)uiI3e34Jeocn5uu4J4Jeee564Jo4Jefon3e4-)a3oro4-)64J4-&gt;ou-p〇89ε Page 65 2002. 06. 26.065 1247040丄厶 案 891 821 821 891 891 891 891 891 891 891 891 891 891 891 891 891 891 891 891 891 六 六 六 六 六 六 六 六 六 六 六 六 六 六 、 、 、 、 、 、 、 、 、 、 、 、 、 、 b) a nucleic acid sequence homologous to the nucleic acid sequence; (d) similar to the nucleic acid sequence of (a) (b) or (c) Nucleic acid sequence; (e) a nucleic acid sequence which hybridizes to the (a) (b) (c) or (d) nucleic acid sequence under stringent hybridization conditions. 1 2. An isolated nucleic acid sequence capable of directing seed specific expression in a plant, consisting of: (a) a nucleic acid sequence of nucleoside 1 8 5 2 as shown below Page 66 1247040 Case No. 89122618 a_a. 曰 Amendment VI, Patent Application 〇9Γηΐ4-)eqe54Jw: iurDIeeful4JI4JIebeee54-)-p4J:;4-)-pee4Ju:;e4-)4J6uep4Juu4J4J4Je:;-p4Je4Je4J4-)4-»4 -)e4J6euu4J4-»4Jee4Jeee:;eee4-&gt;l:;ee4JIt-HcoCNJI: 〇8cnji 6ueuu:leu4J-u)un3u6e4J-p4J4-)4J4Jn3cn4J4J6ee4-J:;4Jee4J4-):;4Jui0uecn54J64Je5:;54-):; 4-)e5D&gt;:;e£&gt;4J664Jecn4J4J5e54Ju4-JJ-):;e6eu6rH〇CSJT—l 〇〇C\]T—Icnro66-lJ9:;34-)u64J4Ju0cn:;uu4J:;06fo6ufoee5eee4-»u55064-) 4Jp6n3u65065u6ro54Jptntnfoe6ee05e5ufo5ue6e65uu6e ICVJrHI 〇c \ JrHI ucno6ef &gt;6u5ucnn34JfDu4J4J:; ue564Jfc4Jeu5uuouu4Je4J4J5ocne4- &gt;u6uu5u4Jeeu:;: iu4-) cn9:; uuen334Juu4J4-) 4JefDo4Juuu4J £ &gt; forHvot-i 〇7〇I eu4Je54-) 4J64Juuw4- &gt; 65uuecn4J66u4-) 4Ju4 - »efo4Jn3n35u4Jeueun3ufauue5oueu4Jueecn5e (c4J55u4Jcocno5:; e5eee4-) 4Joeeuet-HvoQ 〇VD6oufouu4Jwo4Jfo4-) uu4Jeu55uu4J:;:; eeeuu £ &gt; o66tn34J-p4J4J4Juuuue4Ju6e4JfDe5ueu4Je £ &gt;eu3oeu34J:;:; 4J6u5epcn6eJJefdrHGDoo s 088cn4JJJ4Jrce6e4Je54Je4J4Ju6n364-) 4Jeoeu54Jeeuuue64JIfol5u l-pl54JI4JIfolol4J55cn6e:;u4J5e54J64J-p4Jeu:;ep:;4Jcneoeef&gt;-UJe64Jcn4Jx〇8 〇〇co5JJfI5u4Ju4JfDucn4Jee4J3oueu4-&gt;oe6e6eyueueeu4-)e(o£&gt;6u5io:i6o4J6:;:;4-Jcneu4Jeefoeco:Duoe4-&gt;6e :;u64-Jfo4-&gt;5u:iecnp:;66T-HCSJBu03bu5u5uuofon35eefou6uu4Ju66eue4-)u5e6u£&gt;4J64-&gt;fDe4-)uu4-&gt;4-)4J6eecn:;e534-)f&gt;nDu6efocnue4Jfo54Je4Jcnu4J54- ) 6uu5cn6-p4JeΓΗπα 〇794J6fo4-l6: D: ieuu:; u4Jo-pfo565eeeo-pn3ufo36n3 (Q £ &gt; eu4J3665u4J4Je: DU4Jiou5:; 64J64J4Jfo54Ju5eu4-) 4- &gt; u4Ju4J4J4J4J4-) 4J4Jo4J (tJe-lJ4JX9ln 〇9Ln4JfoeJJe6u4- »u4Juuo54J4Joe6ue54J: Ieu£&gt;66oen3ecr&gt;4-&gt;4-)4Jp:;eu4-)4-&gt;4J4-Ju6e55cn:;4-)4-)5n34Jccfou5efoe4Je4Jeueuoeupu4Jeuu χ g π ◦ 8πu4J54-)eue4Ju4-)fl36u54J5e5ueu4Je4Je4-)5oeeea34J4J: ; 64Jn3cn54Je4Jeooeu4J4Jueue5u4Ju:; 5e4Jfouuo4Jeua354-) 4J6eeu53 5 x〇π 00 ^ uf &gt;ee64J66u6:; 4-) n3eufo664J64Jcn4J4J664J4Ju4J3u6uoeuuu6u6a3uu5euue-pucn4Jo4J4Jf &gt; ^ e34J4-) ou54J4Ja-) 65eeeu6u4JfDuxCNrn square (N £ 55554Jfnu4JaJcnu4Jue4-) u4- &gt;6e56:;cnu5n366:;roueeuu4Ju£&gt;co4-)354-)ua3o6e4J£&gt;u64-)u5eu4J4Ju34-&gt;4-3u4-&gt;6en3u4Jfouuu4J4Jee4J4-)χπΓνι s 〇{7CSIcpfoouu4JfofOcn4-J4J4-)4J4Juucnun3cnou4-&gt;cn4-&gt;CJfo4-)4J4-Juu4-»- P554-)uu4-)5-p4-)G3fT3uuu4J34-)eo4-)4JIe5uly64-&gt;l4-)lfnluln34J4-)4Je4-&gt;4-)ueu-p-pcn-pe£&gt; Χ9ΓΗ s 〇9T-Ie6u4Jeee6cne34J £J4Ju-p65u4-)4-&gt;6n3o4J4J4J354-)邙tne4J4-)ca54-&gt;ef&gt;e6n3e5eee5e4J4-&gt;o-p4Jecn4-)ueeeueee6e4-)eefaleee-plye6erHoo IΙΓΗ1Ρ: 〇g cncn4J4-)4-&gt;fOfT3fIJ54-Jcnfo4-)£n3cnfD4-)mro&lt;T3cnn3en39euue3ep4-)oe5y4-Jeuppup3ee5roeeCJ4-»-plpn3lbul3pfdln3l-UJIeolp5-p4-&gt;4-)euiO5e4-)oJ-&gt;χ T 丨&lt;N 111111 Page 67 2002.06. 26.067 1247040 Case No. 89122618 Amendment 6. Patent application scope ΔΙ S6I OSI 09 ΔI OSI 〇〇9I OSI om c\l丨eg CJUcne4-&gt;J-)54-&gt;wue ee 4JuuCJcnae Eieeueo:! E4-)n3ocn4-&gt;n34Jo-u)CJ4-)4J(Je4-J4_)(J5 Uue-IJ-Uuuw:n 5 90334-):}4-)4J4-J4-)ooCJeoCJ4-)es ulul6e6eul6:; e5-tJiO55en3664J56ue6n3aJpe4Jeeeeuefduu65ueefau5n3fofoufceefdeuee-p964Jueee6fo ^ ufoeeeu4-) 4Jeus ueeOJeewfcw e e4 -) - p4Joroe 5 e e4Jecpee ecn4Je e4J4J6ue4Jeuicecn4J4Jeu4Je 6e54- &gt; 4- &gt; u6e e wue4J4J-pu4Je 64J4JUU Icr: e64-JIee6ul3n3lpn3l4JIfnlo4J4-) 6eo5eeeoee-uen1-pcn5n3eur3e4- &gt;uu4-Jun36m£&gt;4-&gt;ee54-J6em4-&gt;4J6efci6o4-&gt;cnue3efi4-)eu4-)ef}efoCJ65e ΗοΧΗΛσΛϋΗα4οΕ-··ΕΗΗανΗ ovuovuouvuvuUHOOVUoHe)wuovuvoCJe)vov3v VOVEHOOHVe)se)oEHv sesesJJuee 5eroo5e94Jocneueu4J4J6e-p: ;n3eeu-pl-J5efauuu-pu4J4J4-»eu54-)4Jo4Juoeuoeeeeeea3-prou4-)oeuefrieueu4Ju:;uuu4Juueus o6oeu3foouee6eee4J4J4J3o4J4-)-pu334-&gt;uo4-)u4J:;oeu-pe4-»u4-Joe4-)4J64-)6ueu ::&gt;fou6oufou:;56a3ou6u 4-)ue4-)4JuululCT1e5eu ISI 1891 ISI ICNLnI I5T—I Ι9ΓΟΪ 卜 L-nI WASVVaosHHMVOS^SadAoooroT-H eCVJpncs!03⁄4 hhue)δϋ06 03⁄4 υΰ ϋο&lt; ουο 0&lt;0 OS ΟΗΗ s&lt; HS οου 0Η0 οϋο SCNJCSJ Γ-ΓΟΐ AOADOOVOOeA^vdsslsEHTοοΓΗΐ rn9Ncsle)HCJ}ve)e)llDVOOovCJooe)Hu0e3v3e)v3e?H3 Hi 00&lt; ouo HHH OUH OHU n-UH uo&lt; 0HU 7〇C\JCSJ LI I Ίovsosvlh VSAVh S ΙΊΊ86 SCN1CSJ〇s V3V0HU0◦0υοϋe)HVe e)oϋυχ033ϋΗυHHH ουϋ 00&lt; OHO 333 mosouHVoluOHU? ICNJ L6 vvdAT:AdcnoIAcx4IdlE-'IVT:e)8r' rnKcslHou 000 suoΟΗΟVHUιΗϋΰοuovuDHCJHVCJle)lHHHlvsuouuv 33VOHV 80e)looou SOCNJ LL ΙΣΕ-ΗϋνΊΗΙονΊνΊΊΗοΟΙί3Ί8ιη ε8〇3 3HVe)H&lt;e)uve)c ) 0 JLCJOOHHUUVVHVOSOUUOOSHEHUUD HJLO3HUU3V 30SCJe) ouHvuuuCJluac \ J〇cvl LLnvlwAVTAKSVScuososooOHee esCNJe) auCJ3ve) HV 3H0V33VEHXOHSOW 03HH30VUHVU3 3e) 0 3ovue) e) vuHvoe) w3e) vu3vCJS6I LZ HdooMeooCJAHohvooE-'aJAHcoI C9 6T S3 S3 H09uoovwuluvs HDOWUHVH 53 000 OHH 130 se) o3SuuvuooSEHu &lt; 0 S6I Page 68 2002. 06. 26.068 T947040 Case No. 89122628 曰 _ _, the scope of application for patents ICOT 6Lnl / csl guangguang rn8eCSJ VMAaosMHOluooASME-HMOSοοςΐ vos WVOID IVDOVUHCJHe) we) ovov3 31ve) ve) e) vuSD JLHOWOOW 33ve) w 3V3 OS aCNJeCNI 64-)ue: n ^ncncpcp4Ju4J4-&gt;^s66yss4J564-)ueee4J£&gt;4-&gt;64J6u:nscr&gt;:;4J:n6555s4Jee4-)ecn4-J55 WEH MQS 8 Bu 1 /vCJvovol sroCNl IoLne Towel 6ooLne 66 π εicaJo4Ju4Jo55eeu4Ju664J4Jn366e64-)r34J4-) 4Jrou6:; u4J4Jun34J4Jouufoeu4-) 4Jo4- &gt; eeu4Jp564JiI3m64Jn3f &gt; eeee4J4Jeeeufon354-) o £ iu〇ΓΝ] πΓΟ Givefv3foofv3uu4Jeee4Jo66euu4J4Jcn5:; e6e664J4J4J £ &gt;4J64J:; 654Je £ &gt; u4Juo64J4J5eeee4Jf &gt;cncn6eu4Jeuuucn4Jue-peue4Jue:; e64Ju 〇t7ee 6ΓηεεCJe4J4-) 6e6e4J66eecne6n354 -)e4-)uu4-)e:;ro5£&gt;e^4-&gt;n35roo4-)4-)ecr&gt;eu:;4-)4Jeee:;e4-)p4-)5u4Je54JcnfD£&gt;u6n3eee54J4J5e64J4- ) 4J4Jee oVDCSJro 6LT)&lt;NCrOcpuueecpcnwlietT'cnwuopecnwucncnuywfoucnaJueJJue^fouuecnuecnefoebecncnJJutnetnJJou^D^cn^w-peaJeJ-lcnuuueoueeef}081ΓΟ 6 Lt-Πε 3eeu6:;uaJ4JueeefD6fou6u6ioeur3ee6n3e4J54Ju4-&gt;-pp65ufo4Jeeen 3eueeuee:; uo4Jecn5uo4-) u4Je4-) u: irD535eo £ &gt; ueo6e QoIro 6 6 0ΓΟtT3uo4Jwcn4Je64J4J54J4Jeu554J4-) e4-) f &gt; 4J4J4J4J64JeueEPcnn3e5eefD4Je4-) u4- &gt; e56eof &gt;6eue4J4J:; u4J4Jcne6cnu £ &gt; 4J64J5cpeou6uo4Joc \ 6 I l〇fo 〇e03etn4 -) n34JfI354Jucn4Je564Jupn34Ju4Jeeef &gt; ufd4-) 4Juu4-) eee5e34J54-Jeuu £ &gt; ee6fDee6efoa3cneeu ^ u54Juueuu56p06euu:; 4J6 〇i7 6f \ J 6fn6f \ lXJo554Jfcpfo4Juu4JufDio £ &gt;6p4J:;un3eo6fDeu4J:; 4Jeuuu6co66fo6u6cnuuoe4J4-) euen36ue6u4Jcau4Jfop6u3ee6e54Jcn4Jee5p 〇9 8CSJ 6lr ) 8CN0u:;fO655£&gt;u4Jeecnee66-p4J4Je64-)e5:J65u6e4J06£&gt;u6504J5cn4Ju6664J4J64-)4-)cn64Jp4-&gt;a3e56p4J0e4J-peeueeue54Je5ucn〇8r-OSJ 6卜卜c\!Cnuofofo6eeajorce4jeuou5fo4j4jn3ee:icn4-&gt;poye5e6o4- j6fo56:; ueeefoufo-p6w:; fo6e3564- &gt;e5ur3n3ue:; - pen3e:; ee6e4j4jyu〇〇 Bu (\ 1 6 6 9CSJufofI3g54Jn35fufnforDg9554- »4J4Jn5554-J4Juon36e:; 4J:; uueefI35: lu4J4-) uecn64Ju4J6fo6eeJJfo4Jcn6uoo4Jfouu4J55euu4J4Jeoeee5 〇C \ J9C \ J 6ΓΗ9ΓΝΙfOfu4J5fouuu4J4Joro63e6e-p4J66uCJe4-):;o4Jeeu4J:;6n3uufoee4Ju6ra4J4J4-&gt;eeeufoeu 5u4J4Jen35eeu-pf&gt;-p4Je4-)ee£&gt;4-)u65^o4J〇t7Lncsl 6cLnc\l4J^-pfI3uu4J-ppu6fno6eecnee4-&gt;6r3ero4Jeu4Jme4J4J4J4-)o4-)54J4-)4J4Ju:;o4J4-&gt;64J4-) U4-)4Jcnn354-&gt;ee£&gt;4-)ee55:;5fo4J64-)eucn4-)4-):;4Joe4J〇山17CS] Page 692002.06.26.069 ϊ24!04^, patent application scope.tb T -rV- rrr- λ 89122618 /, T «月兮彳·』季固固 where τ can also be υ; f complementary nucleic acid sequence; · (a) nucleic acid sequence dinucleotide homologous nucleic acid sequence, (c) substantially and (a ) or ^ . . . /f · (d) with the nucleic acid sequence W of the (a) (b) or (c) nucleic acid sequence, (〇 under strict hybridization conditions, for (a) (b) (c) or d) The nucleic acid sequence of the nucleic acid sequence is heterozygous. The species can be composed in the plant. The seed is composed of a single column. · A special expression of the isolated nucleic acid (a) nucleoside 1~417 如下 sequence &lt;nucleic acid sequence T947040, 1厶 案 891 8912 _ 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 申请 申请 申请 申请 申请 申请 申请 申请 申请 申请 申请 申请 A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Ι Jcaul-Had, e ViLVX 〇〇π efcBdlpfolA4JI:DUtI3lulfclulJJI3aJIulpcrluJJufI3flJufduaJu^cnofl3uiouufouuufde^u3(tJJJJJulJfoeuouuXJfouupuuufd^paJIrol4JIpJJIu(co::&gt;aJuΓΗζΓΟ υ·Η叫-Ηυθαιοιρ θωxoqos οζροJJ Mang fouXJ3uJJaJeuuourctJ) ueuJJupodfoiJaJtT) fcldpultJ14JI (oluoucnfoiJm4JIt7T (ulfcluoufoiccnfofocdiouuuc7) (oeJJcnJJcnufoJJuct5aJpelJIa3ln3lD1XJIpXH1CN 0 lamp CN0D) JJlJJJducnJJutntniJ: ifdqtnXJfdJJfdJJD) uufc4Jioe (cic4J4Jcc4JJJfcurou (x3uuulJaJfd4JDlXJ: ifo4JfcucncnucnufdllJIfdlen3lrol4JItrjiolJJIJJI &lt; TJIfolecnuucnu4JΓΗ Hill ΓΗ LP-HJC Hv 〇9 χ (T3uiJcn-u:; u (dufoJJcnJJescduuJJidelJfoDleidJJtJ )efooucntJ1etnfotJ)cciouD)icfcpaJJJ(ofo^uuudcdlqn3!folfdln3l(rllXJIidlfdlDldcnioio4-&gt;cncnro(IJuutncnuforHCXD q. · ^ Ehv {X) Jceul-Had, Ln 〇co ^ tJ1JJfT3JJdptnqtT) J_) ptncntnl lJJJqCJuCJ) JJJJuJJfduuXJJJdr3uJJ4-) fcuueucnD) cnJJIaJIJJIXJIJJIfole4JIJJIaJIJJIa3lu4Jeuu4Jn3lJJIfdlul4JItnlcnld4JID1aJIcdlJJIulfol:? DUXJIJ 8ΓΝ3Τ δ δ 5 IW0cc: K0OI V ^ Maaoc3stLu ^ dvuMS (N0rH0 0 8 v8v30v33HWVSV30UVOHVYV388HV33〇s30WOJaL3v〇 o〇〇v33〇JLV::ov3aLS883v380JULVV30v τ S 卜ΓΗοτ eEHEH&gt;hqc&gt;3dAo/sc&gt;wc)〇〇HOcyMAAHSH 9 卜S Δ VHH33v03v0UL0,LInLaL3〇v3vv03HH3vsv33〇v0v3vv03sv〇〇vsxs30sv33 W3VJULVSV38V3V330 T s Inb oOH&A&gt;IwMHcl .c&gt;c&gt;oscx:Tdacr:oc&gt;Icyc&gt;wo&gt;6 lamp 〇s 80D〇ovov;:OJLOVVVOVOOSJLOJAOLLL〇v30v330JOOV8vaL8JHL3vov80v30v:&gt;:XLVOV3〇v30vo:}aL:XLOV T 9 S8 vs. VVHov&gt;&gt;IOoc)HOaMHWWaIIAJ :,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, 〇50ν〇ν:ΧΙδννο〇ν30ν30ν3νοοο 30ν3ϋν3νοοο τ 0 8 Page 712002.06.26.071 T247040 ιζ,-t / yj-ryj Case No. 89122618, Year of the Pressure...: Amendment VI, Patent Application 〇9 6ίΰ54ϋ^ϊ¥Β5^¥Β^ε5ΕΒ¥νο,υηκΙϋυΕΗνοοχοΕ - · ννυονοϋνυο〇οϋνοοΕΗΕΗοναο〇ΗννοοονΕΗοοϋνοο3ν303οΟΗονTH8 8z-e lni (&lt; N) hauITh ^ Ln hMVSOOOOo / Jo / oasdaHHu 9LnT 9 BU 9τulJpiJuXJJJODDaJDJJDUaJUDJJcd; Dn3UDm (ofoDDJJ (T5tceaJ4J (TJa3aJeiJJJ4JiJJJDDJJ4JuaJlJ4JtTiJfd4JcriJ {Mang oJJCI4JB4JIJDlJJefoCTlCJlJJfntnJJuτ〇9τ 009 T tn (ocpfoCJ) ecneD) e (oeaiHJJflJ (caJ ^ uuen3JJJJeuiJtn ^ (oJJaJJJaJcniJD) JJ (IJtJ1 (IJpJJfcfdJJilJcntncnaJpcncnHPaJlJcnaJDlD1p:; utJ) aJufcuptnn3pn3JJeiJTCNLnT square &lt; NLnTD1u4Jecnr3tnJJecnuJJetnJJtnD1OJcnptlJD) JJUJ: J4JcncnJJiout7) JJulJDln3utnpu5idu Mang cnD) tnpuoiJucnpuucnJJfctnuutJ) e4JuuD) fcuuufcutr) cnoD1IJTan 0 ^ 7 lamp X Mang eufccncncnuuJJJJuufc5D1c7) (IJJJucnuaJD n3ioucdidH4JuaJBn3ulJfduuuXJtT)cn:lD1cnBcr)ioD1aJ4JCJ)p(T3cntT)(dutnfdutnrcailJD1cn邙foucnducn(T3uuJJTH9 ε Η 〇9rnx puecncncdocncnfccnJJfccnn1uucncnu4J (IJrdutnJJcnocn (dDltnJJupcntncnDltI3ut7) aJeurouD) iJD) foDlucnfdtncn &lt; I3tJ) lJaJeputnidfdJJJJuaJfcD) aJpcnucniJuTOOCNT 0 8CN3TD) XJucnfcJJ ^ cno4JJJueucnduu6ptJ1r3ocdn3ucncnD) (oDlcn {dcnc7) aJt71uucncn (dfouupfduicJJupJJu (o4JutnioucnuucnD) uDlD1CT) efoD) n1uuJJD) rappTHQCNTH o〇CN3TfcfccntJ1CJ) JJtJlJJuuiJlJDCJ1oD ) tJ) uaJiJBlJlJ (t5ptnuJJpJJ3UJaJD) tnJJD) aJCJ) oJJu Mang 4JicuBucneerocn-u (oeH4JfcioHBaJJJJJaJaJD) cn4J4JoXJJJ:} CJ) aJfdiJDlTCNII QCSJTTJJfclJJJ Mang aJfcdenJJutniJucncnnltJlfccnp ^ tctnfdDIdDInlcnfoDlilJcneDIecnrdcnfo ^ fdDIBcnpcnmDlaJ ^ iccn ^ cn'eDIHSPcnmcnH ^ iliionaaJtTJpJJDlJJuDIeoT0OI 〇a〇THfcpXJa) JJcn ^ JJJJcnfGeaJJJ4JJJtniJCJ1JJcoeallJiccncdcnXJpr3XJ (c !! (cJJfdeaJefdaJBeJJfotnD1JJfdtnt7) d (o4JJJD1iJcncnicJJucnJJoeu (I3tJ) eefdofoJJcnoiJ ^ cnrHVDm ((N) Jljad'e) JIpiJIu lJIJJIDtbbaJIbJJIcrtuaJIultnlJJcd;. Dn3ucnm (ofocncnJJ (T5tcBaJ4J (TJa3aJeiJJJ4JiJJJcncnJJ4JuaJlJ4JD1iJfd4JcniJ {oJJc7) 4JB4JIJCT) JJefoCT) DlJJfntnJJu page 72 docket No. 2002.06 26.072 III 1247040 8 Amendment 9 to 9122618. Patent application scope where T may also be U; (b) a nucleic acid sequence complementary to (a) the nucleic acid sequence; (c) substantially identical to the nucleic acid sequence of (a) or (b) a nucleic acid sequence; (d) a nucleic acid sequence identical to the (a) (b) or (c) nucleic acid sequence; (e) hybridizing to the (a) (b) (c) or (d) nucleic acid sequence under stringent hybridization conditions The nucleic acid sequence. 1 4. An isolated nucleic acid sequence capable of directing seed specific expression in plants, consisting of: (a) a nucleic acid sequence of nucleoside 1 - 2 0 3 7 as shown below Page 73 1247040 Case No. 89122618_Yearly Month. Amendment 6. Patent Application Range J-JrT3ua_) 6J-Juuwo-Jucpu:! 6oe eouuyuu 6 64Je-u6u4-&gt;eue4-)u4-J4Je-u)eu:lu6 e 6 w 6 54-Je 64-)4J6o4-»u4J4-&gt;u 6 e e4-)ou4-J4-&gt;:i4-»ecpJ_)cn4-J4-)4J4J4-J4-J4J-pcn4J4-J5m6 e 6ue4-)-u)e eu OOCNJIοξγ-ηsrHrHob t-lrHSIXος*—ιχ 0^^oc IT—IOCNJI Iom rcq6u:lueuu6q64-&gt;34--)euuoe6eeu66ecn4-)w6-pe4-&gt;e6fO6e4-&gt;4 -&gt;n34J6uu6u4-)4-&gt;u66eu6564-J4-&gt;6J_Jf&gt;ue4-JueeCJ65uu4-Jue65uueueuo:io6e6J-J6u4-)cnecneo 0011060IOCDOI Q/LS090»—IolnoIOsr-HOSIOSI 2 2 4-J4-JXJu4-JeaJuu5u5eeD&gt;6eueee5ueee5CJcnra5 :icn6cnaJcne3u4-&gt;cnue56un364-)eoeu4-&gt;euu:ieeecnuue64-)eeuueeeucneu4-Jcn-p4-&gt;664-»64-lee6eu4-J:iu5e66 0001 〇66 086 Qr-6osos QpocnoCNcnos J-Jeului-)euJ- &gt;ue6erD6aJ^4-)4JeXJu3e66eucne6:;4-ir34-&gt;56ueuuwuee4JeoueeCJ64-&gt;4-)ue664Je4-)4-J6eeu66ueecnu4-J4Je-peea3eo6uu4-)u6CT&gt;4Jue6uo:i&amp;u3 006068 ocoooοεosos OS Qsoosloo UXJU e euu6u4- &gt;u 6 ecnuucneu4-J64J6cne4Je4-)4-)4-Juu6a1-peu4 J54J4-&gt;CJ:44Ju-pJ-J6 6 p4-&gt;4-)4-)un3ecnfofob 5 6 e4J4-Je u 6ee e 54-Jeuwuu6 ep 6 uu uro5uee4J03uuJ-)eue 5 u 〇08op000 卜βΓ~snοί OZLCPZL 〇T 卜 criOJXJ6 5 6 6 e 6ceuXJaJuuJJp 6uiJu4J6ue e4Je e4Jeu6-u)eu4J&amp;uoe4-&gt;4JCJJJ6 eOJe e4J5 efoue 64Jue4Je4J4Jue :! eu w4Jwo4-)e eJ-)5cpeue £&gt; ee 6 eu6 ee eue eeu 〇〇 069 OS 0£§ OS OSosos 019 SI SI euuJ-)eeu:leeuu:;64J邙ueeu4J4-J:;:i4-)4-J4-&gt;4-Jeueu5-u5eef&gt;u4-Jeeecp4-Ju)e4-)crle54 -&gt;u:;oJ-)In3lcnlu!4_»lbeeDN55emee5e6e4-)uu-l-&gt;lul4-&gt;l4-&gt;lee6ul-u)le64-&gt;:;uu64-Jee4J4-&gt;6w 〇〇9o6lnoGDLnor -LnOS olnLnOS ornunoCNJLnQrHLn euoiJJ-)uu4J4-)ucne 5OJJJU6ro6 e P4J4JUU6 ee 54-)6-u4-Jeu U4-J4-J6 6 e u4J4J4J4J4-&gt;eee 64-&gt;4J64-)^u6cne u W4J6 euOJJJJJe 6U4J4-&gt Ue 6 p4-»JJe 64-)5cncn4JJ-J66uou4-Jucne 5 e4J 〇oLni οϊ oLnrri XJlrc6-uob-u4-JJ-J64J6n:6 5 e 6 5ΓΟ6 54J64-)ue4-)e 5 5OJXJe 6OJe 6 ueu64J5o4Jeu£&gt ; e 6 6J-)uue4Je eo6 W4-JU6 6 uuue ye eu64-)4Jo5 e4-)uu-uue4Juow eJ-Jou U4J5 6 ee 00^ο6ε 0ΟΟΓΟor-rn03 oLnrnornroOCNPO〇1—lrn ii-hhi_ H 4Ja-J:l63e6u&lt;OIeululeue〇:r4ol:i3e64Je6ee6aJIol4-)l66e4-)l4_&gt;eou4-Ju4Je4-&gt;u4Jeue4-&gt;u4J6uu£luu64Jcno4J4Ju4J6ecneu4Ju4J64J664Ju4-J4J4Juu6euue564Juu: ;e4J4J QornQ6CN3osOG gCNJoLnCSJ03OOOCSJOCNJCSJor—iCNJ 331Π36 eube uecnb 64-),460:04-)6 5 e 6 e 6ueeJ-Jurccnl554-J4-)uu6 60360364-)4-16 e-uo4-&gt;(J6J-Jou4-)uu -p-lJ3u-UJeoue 64-&gt;£q4-&gt;u4-&gt;6 e4-»ou:i p4J4Jeu4Jeue ee 6 64-)4_)e4-)fn oos 〇6I 〇8rH0卜1 09ΓΗoLnI 02 OCt OCNJI ot —it-H UOJU 5 6 e U-Ua-Jeoe 5cn4-»eaJu6 eJ-)4-&gt;eroe ee ee4-)e 6roeucne e 6 eo64-l5 eee efooee e4-)e e4-&gt;eoeecnn3uueu4-)6 eXJeoe e4-&gt;ee e4-)6cn6 e eurocn5ue4Jeu6 ee u-pu ϋοΓ—I〇6 〇8 Qr~oLnoroOCNJoT—1 page 742002.06.26.074 1247040 丄厶案号89122618_年月日_6, application for patent scope丨丨呀 SAide "l mouth OMd:3IlHD:A&gt;v&gt;〇vooiooCI:zoaM&gt;3 ooeCSJOCOCNJCNJobCNJCSJSCNJCNJoLnCNJCNJSOSJCNJoroCNJOSIOCSJONJOJ2CNICNJ I H3V 3&lt;0 I HMad3 sva IGa Ι033Μοοο』ΟΟΗ3Ί υΗ&lt;υο&lt;υ8ΗΟΟ«ο&lt;υϋϋ&lt;ουΗ&lt;υυ&lt;&lt;«οδοοοοδοοΗ&lt;οϋο&lt;ΟΟΗ&lt;οο&lt;ο&lt;ϋυΗ&lt;οδ85δυ«8^ϋ&lt;005υΗΗ«υοδοο&lt;500ΗυΗ OOCX'CNJ0612ocor-tCNJ03 srHCNoLnrHCNJo3 σΓΟτ—lCNoCNJrHCSJorHt—fCNJ a)uu(l)nba)sfHeucn-Hs SSH 3 1 IV 5~~ ί~~5~~^~§~^~^^~~5~~§~§~§~5~ ^ ~ ^ ~ CJ11313v33HH3H3HJA / 3CJD3mJAfue) xulovoHoHollCJ3HH.Lou3e) vvoHVCJlve) &lt; e6eeeeuu4Jeuu4Je4-J4Ju64J4- H3e) ci) HVuueuuue4-)) ue: iue (J: i 〇〇ICNJOSCNIOOOOCNOSCNoscslOSCNJOSCNoscslicslOr-HOCNJ &lt; SH SV3 euu euee6eJ_) 3ueu4J4_) ueuJJeuuooueoeeee :le4-JIu5u3o4-&gt;u4JIeulueu4-)4-&gt;4-Jeuu:Jeu3e63664J64-)e4-uo4-)JJ:ieuu4-)uuuuu:iuuuero6ee(J6ucn64Jee6 0002 scnrHooocnrHor-cnr-lS2oLns irHornchrHirHor-HcrlrH U-HJ-HU -H&gt; U-Huincneq ee64-)oeernlul64-»leuu4-)lrolCJI6we3uoeeecn:;eroee3e-tJ:i6:}6ue4-)4-&gt;eu4Ju3aJcn4-)4Jeu4-&gt;-pueu64Juoeuecne6e64-),4ueee64Ju4-&gt;uuuu4- &gt;e4-Jeueuu4J6-pu:i-pu 00610681082 0Ζ.8Ϊ0981οςοοΓΗi or Ns 0CNJ8I 0Ι8Ί J_)J-)uJ_&gt;4JcnuCJcnCJ4JeuJ-Je4Je e 34-)03uu4-J0J4-)euu6cnJ-Je 邙e uueoeu4-)4-Je 6 e ueecnuue eu^Je4-J4-&gt;eXJ6 e4Jue u 54-Je e erouu 6 6oe e4J4_)e 6 6 5 ee 54J4-)ee WJ-J6 eu 64-) 〇〇8ί—I06U08LI 〇PI09LIoLnLrHom 〇PIOCN IOUI 54_)JJaJcne e 6J-&gt;ue euuoeΕπ3υ4Je e4Je erau4-&gt;eee4- &gt;uuee 6 eus4-)4-&gt;4-&gt;64-&gt;64J4-)eJJ6 54-J4-)ue e eye e e4-)u4-Juu3u:;u4J64--&gt;e4-)54- &gt;4-):; e4_)ueeecnu4-)raaJe4-)-u-ue4-J4J 00二06 91 0 891 〇ει 0991 S9I OS! QC91: OST 0191: ss eJ_&gt;uaJueuuee4J4Jqcpee4JueE-pee4J4-l4J:;6e4JIfol4JIe4- )le:44JI4-)lule6e4JI4JIw4-&gt;lulee4J4J4Jee-pemeeeeeaJ4Jeeu64JaJ:;eaJIe4-JJe:;-l-»l:;ulel6e-plaJI4JIulluuuee-pcna_)roe:iee 〇Q9I 〇6ςΐ 08ςι οζ-ςΐ 092 OSI 2ςτ οεςτ QSI 〇 Ϊ́ςτ L)&amp;ee4-)J-JuJ_)u4-)roue4-)-u&rc6eueeuuu:^e6rcuJ-&gt;6ee:l4Je66(Je6e54-)e64-l6e6euueee664Juee5e4-)4Je6e4-J4-)eo4JaJeeueeee5e3 654-J^ J-)(JaJ4-)eeeoaJiJ ooLnI06 two 083om cml—Iotnta 1OSIocslK Oita IH s U6 : one uu-ua e - - pra pra ju - - - - 64-J4-J6 6 ecn6-u5 6 64-&gt;e£&gt;uue4-J4-)u 00s 〇6EIοοοεΙ—I0/..00109ΓΟΙoLOror-HsrnrHornrnr—IocslroIor—lrn(一) Iglg q4-Ju6-u)cp4-Juuucn4~ Jo66cnucp:i66-p664-&gt;cn5-u4-Jeeeuu63eo64-leo4-J54J66n3-poou4J6eeuo64J5uuu4Juu5u3cniul6-ul63eulu-ueucn-l-J4J4_)euXJ6uuu4Je-l-Je6:lu 〇〇pnI06CN1I 08CNJIodOsr-HoLnCNll—l5CSJI021OCNJS I OUT Page 75 2002.06. 26.075 1,247,040 docket No. 89,122,618 years said correction six patented range "Ι2ΗΛα: 3ν3ί3Η" lavalsdaeJINDaITacssoCJUHCJSA 〇srnss Q8Ifoc ^ rnS3olnT-lroornsOCSJIΓηοπrn oNSAAHLDsoHSooCJosCJCJOISE-'ddHAIaltJDCJA &lt; 0ϋΗ «0υΗ0 &lt; Η0 &lt; Η0ϋ000ϋδ0ΗϋϋΒ0Ηϋϋ &lt; 000 &lt; υ0 &lt; 0ϋ &lt; υ &lt; υΗ05ϋδϋ50Η &lt;5&lt;υυ&lt;00υΗυ0β&lt;0Ηϋ050δυΗ0η-&lt;ϋ0υ0«ϋ0Η0&lt; 〇〇tc §ΓΟ§ΓηοεΟΊ§pooLnoooipoornornQCNJQrnCHOC α:ΛΙο9α:ΝαΝ380Ία:β:&lt;ΛΝ3αΛΜ3ν3νΙΊ&&Ι;Ι5αΙ03OOOHOOH&lt;n-&lt;ooou&lt;05«usu«osoos5iooo&lt;B«OSHOO«^so&lt;005H«OHHOU8&lt;^UOUH&lt;UHOO«UOHOSUH«o^oo 〇0〇εOSJOSOVJο$Γ\ΙO^CNJoscvlosCNlorocnCNOSCNIoI-tcrlCNJ SSHHVd01d:Ha:a:c)HCJo3s3e)a:STa:e)e)00s03i3 ΗΗυΗΗΟΗΟυ«ο«υϋΗυυ«υΗΗΟΗΟΟ«οϋϋ&lt;οϋυ&lt;ϋϋδο&lt;οϋΗϋο«ΟΗΟ&lt;ϋβοϋοΗυυοϋ&lt;ϋΗυϋϋ&lt;υϋϋ&lt;ου«οο&lt;υοοΗ«υ «^υΗΗΟ&lt;υ 0062 QSCVJOOOOOCSI〇ε(Νoscs]olnooCSJiCNJ〇sc\)ocslcoCNorHcocvl acl:dND&lt;lAu42 Q〇8S 06Z.3 08G QLLZ09 bcslOPCSJornG QCSJ ΓΝΙSG a:a.22:aloMlHSSIaH&gt;&gt;IV2:&gt; cu3NoaN ^^υυ^^^^υ^ω^^^^^^^ϋϋδουυ«υ«ο&lt;οϋΗυ«οο«οδο&lt;οοο&lt;υοΗΗυ&lt;υ&lt;ΟΗδοδΗΗϋΗΗ&lt;οοϋϋΗδ5&lt;οο«ου«οϋη-δοο«υ OOLCS ]ss OSCNo£[OSOSIOSCNI'OSCNJOSCNJCSCSJοΰΝ ASMHV&gt;3vdAVIAaCJ3cl:ha:a:I&gt;loHoaossooooo &lt;^ΟΟΗΟΟ^υ&lt;ουυο&lt;ΗϋΗη-ϋυοοΗουοΗ^ουοΗΗ&lt;υΗοοδ5^«ΟΗΒυΗΗΟϋυοϋ ΗοΗδ«ο&lt;οοδϋ&lt;οο&lt;ο«ουυΗΗΟ&lt;Ηϋϋϋ&lt;ο«υοϋϋο&lt;〇〇92OSCNJoooLnCNJ〇卜^ OSCNJolnLnCNJ0 SCNJornLnCNJ〇c\]LOOSJo»—lLr)c\] 0e)000s:H3JIH3d3xdiwIe)I&gt;3Ho 3wov3DVV39voovuo3HVV3ovooHSove)v3vCJole5SD Parent vCJooE-'E-'oHVolwclovuvHIovoDDDVleJcneu-pa-JeweJ-Jcnycp-lJ-UJcnucnwewcnuuoeucny OSSoi0003OSCNIssoLn忑oiorn忑s 忑OSCNJ 0ΛΙΛΙΊ0α4ΙΝ fcpuJ-iefneeu^e-lJfoeeuuew-pJ-JeucnJ-JeecnuJJwueuueuueeJ-JecpJ-Jeeue-peuJ-JJ-Jcneu^ eeewaJeeelieucno^ivoHloCJsCJVHOlvuHoeJvCJHuouuvuv QS2ocnsocoroCNJornCSIsrocsloLnrnCSJsrnCNJoooroCNJsroCNJorHrnCNJ Page 762002.06.26.076 1247040 Case No. 89122618 Correction VI, Patent Application Area J-J3UU:IL)Γ3Ueu4-Je e 6 6UUU 6uue uue4-J:lfOe4-&gt;:; e-p4-)e4 -&gt;e4_)u e4-)e e4-)unD4-)e4Ju-pe4-&gt;:;fD:; euroe ecnue e TOuuu4-&gt;n36 eee uu4-)4-J6ue eub e 6 euee bcne eue eue 003 Q6U Q8U 0Z.U091^ οςιπ οεΐπ oOJIi^ 0IT7 fc-6 71efreft:a_)aJ'4u5eefaeu4-)uuu-un34Jueeu54-Ju4J4-J6euee5uueu4Jeu6ee5:;ecn£&g t;e6H64J4-&gt;34-&gt;u6e4Jo4-Jeeeuuoe4J4J4Ju4_J4J4J64Je£&gt;54-Jeuo4Je4Jeuu4JXJe 〇ϋιπ 〇60π 08soio9sOLOSoi οεοπ 0_ 25 3en:oee6l?e66uJ-Jeeuo:iuaJee:leeen3:}e:i4J4JaJfaee4J4J4J4-Jee64Jn3u4-)en3e4J4-) 4J4J4Jw4-J64J64-&gt;e4Ja-)4-&gt;4-)4J664-&gt;64J4Ju4Jee64Jeu-ueee4Jen3uJJ6w4-&gt;e4J6u-u)e4-J 〇os066ΓΠosrnosroS6PO〇Ln3ospnospoosrnosrn 6,4 lJ-JJ-'e eXJu64-lcn£ lJ-&gt;cn5uucne4_)5 euu 6 e 64-Je e4J64J54Je ee 6666 ee 66 66 e 6we e 6 e £&gt;OJ6 eeeu euu£&gt; ee eXJe e4Je e4Je e4-&gt;ee4-)e e4J64Je u eJJee e e4_l6 5U ο06ε 06 8CococnooοεΟΊinoosrooiosrooooooroorHcorn +ΗΊΊ2ΙΛ3 parent&gt;&gt;MqHsdscc:SODa:HS&lt;l ◦ 08ε Q6P 08Ζ.ε ο/^ε SG otnG Q^roορ[ ΗΧ30^Ν3ΜΛΗ:τ:ν33α.5Λα:3:ν2νΊΛανα4IVDCAvsl 〇〇&gt ;rnirnosfnοεΓΟsUDfnosroirnοΰεosroοΰΡΊ CT:e)&lt;&quot;isN&gt;wv2:aMCL&gt;i3v&gt;s:33cc:3soscr:&gt;I&gt;AV』NO 〇〇9ε SLOPOoCDLOpnoGrnsLnroolnLnpoosroornLnfnorslLnpoοΓΗςΟΊd&gt;l/\&gt;oe)301Ae)apu&gt;SN93: 3N&gt;IO&gt;H&lt; oe) HIVA 3333s93slslsv3SDWSSV81335v3SIVS31Ifu3931JAA / 93svvs3vs3vvsl9: uv9v3: u9sv3yvv3vgssxv038VJ ^ CISC 061 / ε 08ί ^ εοίΓΟS3oLngoioros sg Qi &gt; ISHVNIMMH &lt; 3qHI &lt; 3 J.OVHVODVOVovooowuHVCJvvuoHuvCJsCJoDHooDVCJE-'vooovvscpfn buckle 64-J4-J4-) 4-) rae64-) 4-) J_) 66uuecnoue64-)u:;e4Je6uueu4-)4-»fDe4-)XJ:le4-J4-)ee:iuuu4Je 00?, Q6LTooopornogrnsropnoLnoornornp srnc Ξρηρη ΜΛΊΛ3α:ωνοοΊΟΙ5:ΟΊΛ^ΊΜΗ8Ν οοΓΟε sCSIpnOCOCSIOOOGOOsCSJrnsCNJroSCNJOOAnother CNJrnOCSJCSJP&quot;)2CNpn ΙΙΙΗΙ1ΙΙ 77 Page 2002.06. 26.077 1247040 Case No. 89122618 Revision of the month 6. Application for patent scope Lr) Oops 64-JJ-)6uucn64-»e Ur3ij6-U4_)e UU4-J4J5 ee uOJucnuu 6 ufo3u4-)64-)4_&gt;uuuu3 6 uou ue ucncn6 uruuuuu 6 eu 6cne ueuuucnu 6 6 6 6J-»4-)4-) Ucn6 6 u eu64-Ju6uou4Jeue u 〇66π 085 oz.6"096=οιτ)6π οε6=osv 0167 4-)6 6 5uu4_)uuuu 6 邙U4-JU4-I5 uuu 5 5 eucn4-)4J4Juu64-J4Je uu e4J4J4J4Juuue ueeue 5 6 ueu 6 UJJ6 5 u4J4Jeue e 6 6 uee 6 5cpe eue U4JCP6CH64JU 6 6 uuue 6 邙cnuuu 006π 068= 085 0/.8^ 09s ost^ oi QT87 uuucne u 6 5 uuu 6utn5uu euu u eu4J4Jcn6 ucnyucne 6 uue4-&gt; 5 5UU ee 54-JfT33fo6 5 5 ecnuucnu euue u4J4-J4Jeuu ue 6 6 eeeee 5 e 6 5 6eu u 6 uuu euU4-Jp u 5 6fc6 008π Q6i 085 095 si05 ο3ί 0ΙΪ 5 6UUU u 5 e euu eee 6ue 5 e4-) 64-lcnuCJu4-l4-&gt;6cn4-)uu uocnu 3 u 6 eu 6 U4J6 e66666JJueJJe e e4J4J4Jcp6 uu e4J4-J4-J4J4Jcne uee 6 ue ucnuou e 5 UUJJ6cpue eu 6J-Ja-)e 0〇ί 〇69π 08s οεβo99e oLnsosv 0ε9πosv0197 55t?55rr.uueu4Jeeu65,4l?e4Juen34J4Jeee5564-)eue6eeeeJJp4-)eue4J5ueuuueeueuu4-&gt;u64-&gt;u54Juu4-Juuuw:;u5ueu66a'6u6uu4_)6eu -peuf&gt;656J_)4J 0〇9π 06LOP Q8S 0卜3o9s OLOS οεί oCNJLOt^ οτςπ JJa^uu 6UW 6uue ee 6 6 64-J4-J6UE? 6 eee uuucnrccn5 6 e uJJU64Jcne 6U:; u WU6 e4-)64-&gt ;u4_&gt;eu eoJ-)6 ee e4-&gt;4-J6 6 6 e ecn4-&gt;eu4-)4Je u 606 6ecpcnuu4J4-J:Jcnu4-)u 34-I6ue 6 〇〇i 063 083 0^^ 095 093 0517 0ε5 023 QTW u7i 6XJU bcnq 6 6 5 e eXJ6ufrcn5ucne e4J6 e 5cnucpb-uwuoJ-Ju 56 3 66U5 e eocneu4-»XJ6 e 6 6 e ^ ecn£&gt;4-JuaJ4Juu5 5U6 ecne e 6 6 邙5 ee 54- »cnu6 £&gt; 6 euu64_)3 u eXJq4J00? 065085 0/.S09SQLO503 οε^Qzs Qr-ls 3:1612 60:::1696:^036^:1:^00^60350^58^60:^365535030^ 9 6603^3660606^:5:^954-)51119^9660660664^:^64^4-)336(136394-)3^84-(:1^4^33:^:^03^4-39 86 0 〇3 06so8s Q/.S 092 ss03οε3 ss OTS _Circle I I Page 78 2002.06. 26.078 1247040 ιζ,-t / yj^yj Case No. 89122618_年月曰曰 _ 6. Patent application scope where T can also be U; (b) with (a) nucleic acid sequence a secondary nucleic acid sequence; (c) a nucleic acid sequence substantially homologous to the (a) or (b) nucleic acid sequence; (d) a nucleic acid sequence identical to the (a) (b) or (c) nucleic acid sequence; (e) A nucleic acid sequence that hybridizes to (a) (b) (c) or (d) a nucleic acid sequence under stringent hybridization conditions. 1 5. An isolated chimeric nucleic acid sequence consisting of: (a) a first nucleic acid sequence comprising a seed-derived seed-specific gene: (1) a nucleic acid sequence of nucleoside 2 2 2 2 as shown below Page 79 1247040 Case No. 89122618 曰Revised VI. Patent application scope τ—τ 09 e Icn£&gt;un3cn6uu66664Jeeue54Juul&amp;e:;4-)fDfI34J6w635e:;4Je4Je4J4Je4-&gt;4-)64Jo4-)e4J4-)4J5e4Jeemn3o4-) 4Jucn4Je4-»4J4J4J(IJfoe4J-pue5erHODCSIrH 0821ul?peee4-)4Jueeu4-)6e4-)4-&gt;4J4J5eeeuo4J64J4-)fT3uu4J:;cn554-)uu6cn4J4J64J65cne4J:leeecn4-)6cr»tna34J4-)e64-&gt;6tn5e6e4-)oeee4 -)uuXOCNX o〇c\JTueeeeeeeCJro4-)uu4-)4J6e5eu4J6e66:;u64-)eu4-)64Jcnucn6:;4-)e6u-pu5e64-):16u4-)6oucn4Ju4-»扣4-&gt;eucn4J4-Jcn66uro66wfoeua4JICN]It —ls 〇2ΐΐ4-)u5q4J:J33u£&gt;eblolebul5nDI65u:;uecnun3n34-)e4J66eeu4Ju4Jcn6:Dcn4JuJ-J4-&gt;4J6n34J4J6u4Jn3u4-J54J4-)uu4Ju5e5uo4Ju6epu54Jo4-JΓΗποΓΗ s 09 64JI-Take See£^65:}s5:; s I s_ ^ ^ 〇〇CDfo-ppfT30eecnee4Jeun3foe4Jeu(nle:;eee4-)lfoleee4-)l4J4-)e4-)en3en3e4Jeee(oe4Je66u4-)nD4-)ea3e4-&gt;(o6:;ee(I3e4JuefI34J4Jee664J4J4Je-pXCSJ s 〇 CNJ卜e64J6we64J4J5£&gt;oeu4Joew4-)4Jeee64-)4Ju5^5¥?5&quot;5^&quot;ie4J4Jfo6e6:;e£&gt;ecr»4J-pe4-) buckle-p4J6fo4J4 J4Je6uueeecn:;eee64Je6e1-Ηπν£3 〇794-)4J4-)4-)6en34J4-)u4-J4J4J4-&gt;e4-Jw4Jecnou邙cn4J4-J6uuu66ou:;fo4J4J-IJ4Juu6fouuio:i4J4Jen34J4Jfn:;ur3euem4Jeu4J4Jee4-)4Jecne4J:;4Jeu4JX9LO ο9ς4Jfn4J3u4Jucn4Jufoeu4Jo4J4Jwu6eo4J5664J4Je4J〇4J:; 6epun34J4Jp54Jcn4Jeeuu-p4J4Juu-p4-) 4-) 4Jeecnfo64Jefou4Je54-) n3eu4Jecn6eeΓΗοοπ 08 b4Jfo4J:} 66u4Jofoa3uu4-) 4Jeeu4Juuu4J4-) eu5e5pu6e6uefne5ow4J4J54J64Jn3n3:; foeouuJJe64J4J64J4- &gt; e £ &gt; oe £ &gt; ee6: 1656u4J-uFH 00 ^4JI4JIbmol4JIe64J4J-IJuforDo4J556cn4J4-&gt;4Jona4-&gt;6eecnfx35cn66664-&gt;6:;f&gt;cnee4J:D5cnn3cn4-)£&gt;54-lp4J4Jue4J6f&gt;cnefo6n3^:;e665cneef&gt;-u)6£&gt; xcsiro QCSIC £?5 £&gt;ρ£&gt;54_5ίτ3α354-&gt;9£&gt;5£&gt;ο:;ροΓΟ^υ:ιο4-)(ϋ£&gt;55π3υίΰ4-&gt;υίο964-)5υίο4-):;ο6:^( Ό4-&gt;66(υ6ϋυ:;ΓΟ96α3ρ£&gt;υ4-1£&gt;β54-)ίΰ:^4-&gt;υυ£&gt;ΓΟ6υβο:;ίΙ3ΓΗπΓΝ] s 〇7CNJ54Jfo5ue4-)64J4J69656eu4Je654-)4-&gt;6uo4JeueuiOeeee£&gt;5u6ue56f&gt;e4Je6ole5ul6e664-)-pe4-Jcnu:;64J4Jueueeuu4JefofouurH9 ◦ 9 Xn34- »5J_» a -) - pgfT35554-34-) 5fo5fdoinueuuu4-) 4J63u4- &gt; 4-) faucniI3:; ue6rarou: Dcnn34Je6e6u6n3cn4Jn366e5 £ J66664J4J4J5uu6u654Je64J6 χCD ◦CDf &gt; 4Ja34Ju54-) 5a3534J555u4J54Jp5upp5fo5up5u-p4J5eef &gt; 56664Jewe6en364J4Je4-) uuucn6u55e6uuo4J4- ) e5uuuen3eeu4-)4Jχ Page 80 2002.06. 26.080 1247040 Case No. 89122618 Amendment 6. Patent application scope ος t/cv6J-!u:166u4Ju4J4Jeu5:;eee:i4J:;a3:i4Jcnfc6epuepuou4Ju4Jfo654Jeuee6:;fo4J:;:;e5:; U6eio:;eun3:;eeefo4-&gt;e:;4J54J-pfo4J6e4JIΓ-ΓΟΟΝΙ6QI HAIssl&gt;EHAVVAe)Je)Ln6 〇&gt;eOJs3e66:n Seven €256:156 ον Hvl 3HV SOI 331 £UX 310 ΰν 33⁄4 38 33S 35 vs Oil OS 90s ▽ 6osvlhoXIllDAE-iIlvdATALOL seCNIδ〇υοΗΗο3 HHO HHH οϋϋ uu &lt; 0¾ OHH OHU 000 UHO ou &lt; 0¾ UHU Huo oou UHO HHUH5 9 {7CSJCSI dsDUIATTdHVIIlsIAlvHTLnLn LOvCNlCNlHUL) on- &lt;? 3¾uHe) HHUUHCJ133υυνυοονΕ- · νuHVuluvoEHHHVU5CJuvuue) oovEHH3 9 8ICNJ K IqoSTAIasoovEHVVJLVVMALnro srHCN33⁄4 3131sυυΗοιυΗδ 3HVCJH3CJoHvc)oHe)e3e)3ouuvu3e)VCJOHUV 33oe)3e)e ) Wc) 5 9CS1IC \ Jπε VOASp ^ dooooASEHsuouAsdLnr-lLn (\ IIc \ J800 &lt; 0 χ3Ηο3 &lt; 8οοδονυονυ9νυυνΕ- · 9Ην V3V 89000oosUSHVHUOV 83 99〇cslπτΜΟΙΗϋνΛΙΟΗΕΗοαΣΓΗ ς9〇 (ΝΙow SV3 3UV υο &lt; so 33e) 3VHV3ve) vuUVCJe) uve) vuHvsoHv4Jrceu6eu: ; u4-) 4J4Jee4J:; e64-J4JueeΓΗ0〇 (Ν1 15 s vlvH 〇ooCSJfDuuu4- &gt; 4Jp4JIfDIeulue4-) fc4J4Jufoeuue6ouuioeeufoe5u4-) ue4Jeuu4Juu4Jun34-) uu4- &gt;foeu4JIn3ln3lul4JIpeula3leun3u4Je:; rni4JI4- &gt; le4JI4-) u4Ju ICNchrH uhcqv V3V3I 〇csi61ueu4J4J5uufouuuoun3o4Juueu4Jil3u :; uueuuu:; euu :; 64-) 6ueuocnuuu4Juecn03:; a3ul554JItnlulfdloleeu4- &gt; u64Ju6e (I3n35tn4Jeo6ΓΗποοΓΗ 〇17 8t4Jou3uepo5:; 6eeeucnweo54- &gt; n3ue-pue6ee4-) u:; we:; eueeefd6efon3eecne4J64Jee4Je54Je:;:; e4J-p4Jueuee6uoue64J4Je 19卜1 s 〇9 Δτ—I5en3u:; e4-)e6e54-)6u9u54-)e4Je4J4Jf&gt;:;4-)5-p4Jn3uu6e6u4-):;4Jfo4-3ucrlfo534J4J4-»65cpl:;4JI6bul4JIecnlu4-»on3eeuoee5:;aJee4-J4 -) 5eeΓΗ009ΓΗ 03 9 X 3:;CJeaurceo3o:lo:lu-l-JrD4-)4-)4Juuprocn4-)-pn34-)ee4-)u5ecn4-)cn:tro4-)ue5^4- 54J4Je4J4J54J6eiT3eCJ4J5efoo5cnee6u4J4J-IJe4-)4Jee4JuX09X s _ 9H s ◦ΓΝΙςΓ—I:ll?e4JIXJI-plulefo64J4J4-)eeeeu4J4J4J4Je4-)u64JIe:;ulfDI4JIee:;JJI4-3lulial4J34J4J4-)4-Je:;4J6:;4J4-&gt;eue4 -)4-)J-)urae(T3efc5wcn4-)ee4Jue:;6ee6on3ΓΗ5Τ—Ι 17 ί/r—I3966:1υπ3:14-ίπ3ωΓΌ£&gt;οοΓσ£}6:^4-)ωο6π3υ4-36Γσσ3υο64--&gt ;υ9ρο:^ο564-&gt;π3π3^64-3694-)σ3υου5υουυ4-)α35υοουΓα666υ4-34-)π366υρ:ι6 Χ9ΡΟΓ—Ι 04丨T Page 812002.06.26.081 1247040 Case No. 89122618 Λ_η 曰Amendment VI, Patent Application Scope 6 /.9 C04-Ju4Ju3ee4-)6eUJ64-)64J5:i6:Juue4J4J4-)e6cn£&gt;e6u£&gt;e64J6fcu:;eeee5u4Ju64-&gt;4-iecn£&gt;u55u4Jeu:;:;uueuecr&gt;f&gt;4J4Jiouee4Jua3ο09ε 6 6G εfu5lJeu6ee:;l?eu4JeeuCJ&gt;:iouoen34J4-)u4J4-&gt;p4J+Juf&gt;54-)56wu5eeB:iu54Juu4Jeu4Ju:;u5e5euio5e:}£l4J:;epn36:;y:;uuuu4-)oCSJLnpo cnr-llnpowrDuwJ- Ju694-)o3:;euu4Jfaeo:;n364J4J:;ocnft35cne&lt;Ocr.4Jn3e6cr&gt;4Juueo4J4-)u5n3uu£&gt;euocon3ecn(o3ee94Jufocnu4-&gt;6n3n36eun3e 4J4J6 0 wro 600π CfT3uecn4Jee eefoeuuuue 6 eo ^ 4- &gt; 4Ju4Jeufo4J ^ (oeeu4- &gt; 4J5 £ &gt; eeeu4- &gt;4Juen3o4Je5e:; n34- &gt; epeeeu4J6fDeufoeu5en3e6fDue ^ 64-) 4-) owpopo 6ςρηεcn &lt; I3fnfT3n3cnn34Juu5efo6u4-Jeeioe6e4Jee4Je59eeiD- p364J&lt;x354Jeu5ee6puee64-»4-)un34J5ee£&gt;6:;4-)u4-&gt;e6(Ju4J4Jioeo4J4-)e£&gt;u4J4Jo8CSJpo 6 卜CNPO4Jufn(TJu4Jfo5555o4J(I3uueeee6u:i4J:;4-)4Jfo5euun3ueeee5euou:;5o6fo4 ? - &gt; u4Ju6u4Jfo6pufceeu4-) 64Ju4-) uu5rofo4J4J6e5oe oocslro 661C4J4J6:; eeui 5e4-) ueuu4J6eeuu6u4-) 4J4Jcniou54J:; uf &gt;4J4J64J:; uue6oucne564J4Juo4Jo4Jeu4J4J5eecn54Ju4J4J54J4-) eu54J6u6e ocslrHc CTlT-IΧΓΊeueef &gt;eura4J54J:; 5e64-) e66e5eucn4-J4Jeeee4J5eeucnu4Juroforouue5 £ &gt;u4-)o.petn:;u-pcnu5-Ml-lp4-)cnp4-)4J4Jefd4Jucr&gt;-l-)4Jcn55ee Q7〇po YPU5-HS&lt;l Joal 6ΓΟ0ε gfo4J4-)(I34-&gt;fccnfI35fOu4-) ^lilJI4JIfI3lfol4JIuww4J4-&gt;tnpm54Jpcnucoio:;cn4-):;4Jf&gt;:;e£&gt;ecn£&gt;4-&gt;4J£&gt;efoou:;4Jcnn3e5opfoe-l-)cn4-)5eee54-)5ee4J54-) 4J509 6 3 6ln6c\I4J54J5u4Ju4Jcn4J4J4J4Juu4J4-)-p4J54Jo54J cn4J5(dfo-p4J4-&gt;4J34-&gt;u4Juion3^4J54-J-pu56u554J6uw4-&gt;4-&gt;64-)u:;4-)4-)5u4J4Ju4-)654Jueee4-&gt;4J5eoooaoCNJ 9Ln1 ♦cnHOoooE- 'AHOOVhDOsv 〇ία 6r &gt; 8CVJ4J34J84J5p5 & e wi HolouvovoW3 looδονον 35EHv3ov3e) vovoe) UJLJ, SVSoulss ΔΓΗ8 (Ν 6εΐ ΗαΜΛ3Ην ^ ο &lt; Ί &gt; Ι 2ΗνσαΊ5αooslI-H 9I8CS] ◦0 &lt; 0 &lt; 00 ^ 0e) vooovuuoow vsuuoOHOowOCJHSVJOO9VCJονϋsxuOOHHvo La plant Z 611e e)vdHe)sH&gt;A 〇Ιΐ 9PCS1sovssoe)ouCJovCJse)oe)0o3&lt;e)suvlocnsweJJJJusswfJcuecnyeEa-pofasu&yse T69CNJ 〇69c\!5giJ5us54Jms4J4J54J:;4Jo4-»ss6o:;4J4Jsse4-)e4Ju4Ju:^65oe54J6:;-p666 :; 6s4J6e6uJJuee5s-pueses3 3 I I9OV1 〇X9CSIiJuuuppfDcp-l-JfaJ-i-ufcfOJ-lufc ^ idu ^ JJfooucnfoecneeuwcnyEicncnecnwu-JJyuoeiJueuoo-p-puefouuoucnJJuJJwb-punDoaJJJ-pcneebJJICLnovl ◦ eLnCSJuu6 (TJe654 -): l4Jfc4Jee-pue-pe-p :; 6-IJu4-&gt;fo654Ju4-&gt;u6f&gt;u4J555u-pcn64Jefooeu4J66u4Jue:;:Dcr&gt;e6-p4-)4J4-)565-IJ4J6534-)e6u-porDrHLn^TCN ειτ 1111111 Page 82 2002.06. 26.082 T947040 / Case No. 89122618 Month, Amendment VI, Patent Application ςοεπtpcn4J:leoeu:ieou4J4J5uero54Jueeuca5:&gt;e55nDf&gt;-p4Jcnu+Je4Je664J54JflJ£&gt;u:;rD4Je6-IJeuo4Jee4-)64Je6e 〇{ 70 \ 17 6ροΓΝΙπtnn3cn6eo5fdefJerDu5n36uu4Jeo6n3u £ &gt; uee6cr &gt; uu4Jcne-peueuuo6 ^ u4-) 4- &gt; eeeu4J4Jeu3u4J4-34 -) :; e4J:; uueeee:; 6foecnfc:; o4J4J〇9ΓΗί7 6Lr) rH7coe4-) 34J9ee64Jfn) ee6e6eueu66m4Juetn4Je666:; on34Jn3cnee4Jw4Jeeeof &gt; u- (Jn34Je5eee6euco5eue54JuufI3eocneuerD4J4J6 〇〇〇0 ▽ aJcp4-J4-) cn4J4JfOe54Ju4Ju5u-pu4J:; ou:; 4Jee56eou4Jcnf &gt; 4Je4Je54Jecp ^ uue6a34Jcn4- &gt; y4Je4Jfou4J4J3eoecneu-pcnuu £ &gt; 4J6cnoe4J4Jurci0〇〇π 666ΓΠ4-Jt ^ cncn4J (J4J4-) ufDr3e66eeefo5n3e54Jn34- &gt;:; 4J4-) uo6uu4Jo-p4Jeeu4- »e6ueeo4J6eeeou4-) ofoeeoeoee5me4Jea3eouuueefcucp0Γ \ 16ε 6Ι6ΡΊ4-) 3ol 6eu6JJ6eeo:;? euo4Ju4Jueueuo4Jee6cnfnoo6ioucnoy4JcncaeuiT34J6u66-p:; o-pua3ueoee6uCJ6u:; ou:; 6 (J6:; eeuufo〇7 8ε 6ΓΟ8εo4J4_)54Je4J4-Ju£&gt;6eoo4Ju:;4-)uu4-&gt;4Jou4Ju4Jeoo4J:;4Ju6in6:;ueu34Je4J£&gt;4-)ef&gt;4Juu:;ee6uu:;o6-p4Jo4J63cn:;4-&gt;uu4-):;CI36:;6u509 Γηη 69卜£(I354-)ocncneeuueu4-&gt;fo-p4J4J: ;n364-Jcn£&gt;a3e4J4J3cn4Juu4-J4Juufouu6JJue4J3pe34Jiou66u3:;4Jpfoe654Jo4Jeiofoe:;fooro4J54J4Juuw 〇8900 τ page 83 2002.06. 26.083 1247040 _ case number 89122618_year 曰 revision _ 6. Patent application scope where T can also be ϋ; 2) a nucleic acid sequence which hybridizes to (a) a nucleic acid sequence under stringent hybridization conditions; (3) a nucleic acid sequence complementary to (a) the nucleic acid sequence; or (4) a nucleic acid substantially homologous to (a) the nucleic acid sequence a sequence; (b) a second nucleic acid sequence in which the gene for the linseed is specifically non-negative. 16. An isolated chimeric nucleic acid sequence consisting of: (a) a first nucleic acid sequence comprising a seed derived from a seed of flax. Page 84 1247040 Case No. 89126618 _a. Amendment 6. Patent application scope 09ΓΟΙ4JeOJe64Jw4Joeeee4JI:;e5folc3le6:;4-&gt;4J4J4-J4Jee4Jo4Je4J4J6ue4J4Juu4J4J4-Je4-)4-)-pe4-)e4J4J:;4Je4J6fouu4J4-)4-)efI3- peepwefale4JI4JIefol4JIICDCS1X 〇8CSII 邙ueu:l:leo4J4-)ufoucne4J4J4J4J4J4Jrc64J4Jtnee4J4J4Jee4J4-)4J:;uioue664J64Jp64-)64J4-J4-)e56-pfof&gt;4-&gt;56-pe54-)-p6m5:;u4-)-l-)4 -&gt;co6eu6THoCNlrH o〇c\]I 59664-)^4-)3:;06:;:^306:^034-&gt;4-&gt;060363(13(0036(00364-»06£&gt;05扣4-)03690653£&gt;50£&gt;035:;9650396(0^360560^50035(0£&gt;600邙(13T-H2XX 〇2ΐΐ4Jcnu5e56u5ucnn34Jeu4J4-)4Juecn54Je4-»eu6uuuuu4Je4Jy5u6epu5uu6uyeeu4J4-)u4J5e:;uufafou4Ju04J4-)4Jefou4Juu34J5e χ ποΙ 〇t7〇I eu:; rD5:; 4J64Jou4J4-) £ &gt;5uue64J6cnu4J4Jo:; ee4Jfoe5u4Jfoucdupun3oum6uufD34Jua3e65fofo4Jcn534Jn35u £ &gt;yn35eerT3-p:; ueeurDT-lTm 〇9 6uufcuo4Jwu4JeJJuu4Jeo6cn3uJJ4- &gt; 4-) eeeuu6u6 £ &gt; ^ o :; 4J:;4J-pu3uue4Jucnfc:;foe6upu4Je6n3uoueuu4J:;4J4Jcnu6ee66e4JeerHCDoo s 〇88CH:;-u4-)ee5e4Je64-)e4-)4Ju6fT3£&gt; 4J-peocoo64Jcoa3ouue £ &gt; 4JIe5ul4JI54JI4JIeul4J6666e4Ju4J6p54J54J4-) 4Jeu4Je4J4J:; 5euee £ &gt; 4Je54Jtp4Jx〇8 〇〇G35JJfT334Ju4Jn3o64Je9JJuuop: D4Jue6p5e:; ueoeeu4Jee £ i6u5e4-) f &gt; u: i54J4J:; cneo ^ eeefopuuue4J6e4- &gt; ucn4Je4-) 5o4 -) e5n34-) 66T-HCNJ Bu οονΙΔ e5u600ufae6eeeu6304Ju56eue4Jucne6u54-J6:; ee4-) u0:; 4J4- &gt; 6ee64- »e6u4J5iou6eecnue4Je54Jn34J6u4-) cn4Jcnu4- &gt; 6554J4JeΓΗπνο 〇π Hill JJcne4J6u4Jeuo4Ju: lo-pe5cn5en3n3u4Jn3ueCJ6en35foo: io5cncnu4J4- &gt; euu4Jeu6w £&gt;4J54J4Jecn4Ju5e3-p:;o4Ju4-&gt;4J:;4-)4-&gt;-p4Ju:;efo4-)4JX9LT) 〇9ς uiOfu4-)r3534Ju4-)uuu5u4Jup5ue5w4Jeu566on3eecn-p4J4Je4-)r3u4-&gt;4- ) 4J4Ju6ecn5cn4-) 4J4J6e4Jeeuf &gt; efcrd4Je4Jroufouueufou-peuuχ 3 π 〇grru4Jcn4-) eue4Ju4Je5u5:; 6etnueo4Je4Je4-) 5uefofoe4J4J4J £ &gt;4Jco55:; eu) fDuueo-p4Joeue6u4J34J5e4Jinoou4JeufI364J4-35ee35u5 x〇π 00 ^ ϋ69 9 6υ66υ6 ^:; ^ ίΰυίϋ56: ^ 6^6:;:;66^:^υ:;ϋυ5ϋυρυ3υ6υ6ίουϋ£&gt;ίουϋρ:;ϋ6:;υ4-):^£&gt;-ρπ3υ4-)4-)υυ54^4-)4-)£&gt;£&gt;π3π3ρυ6ϋ:;ΓΟυΓ ΗΓ \ 1ε 〇3ροcnCJ'cncnueuJ-l-IJcpoJJueuuJJcnecnb-IJcnucpixJcncnJJeufoeuuwubfouob ^ ueucnfDubufiJJocneuaJJJouuuu-iJcneeuueuuuyuefDaJJJχ πΓΝΙ S 〇πΓΝΙcr '^ uuuJ-JfcfocnaJ-uw-uw ^ ut ^ uecnuu-pCJ'uue-iJuwoowJJcncnwuuyf ^ wefouuoJ-Joueou-plebulucrluueuleyuJJeuJJoeuuycnyecnΓ-ΗαΓΗ S billion 9rHe5u-pfOeecn6eu-p6^u4J66o:;:;cneu4-&gt;4J:;u£&gt;4JtJ&gt;6e4J4Je64-)e£&gt;e6foe5epe5fo-p4Jo4J4Je5-IJuion3eueeef&gt;e4JfoeiolpilJIp4-)l:;p5mΓΗΟΟ I ΤΗ οαο cn54J4- »4-Jeen364-J5CO4J5e5e4Jeem5en3foera3orcoee4Jue54-J4-&gt;euepueCJee5en3a3u4-)4-)lppcr1ul3n3lpe4-»leule64J4-&gt;-proo95e4-Ju-pχ TICSI 1I1I1 Page 85 2002.06. 26.085 1247040 Case No. 89122618 Rev. 6 Scope of application Δ("Ι ov WAovvaosHHMVOwhsadAooorol; spncs!ϋΗν xvlss ιυϋΗοο ινϋονυOHVue)usvowe)CJe)e)vusve)ulEH5v HVe)e)uue).LosoSOSJ3 Lpol &gt;e)&gt;OOSVOOTAHVh2:STSHl 8ΙΓΗ scslCNJe5He)5e)lle)vsosvu3oe)EHue)slvL)e)vue)JO Hvl oov 8oEHHE-ie)e)EH8HDHue)CJ,L3uve)JO SCNCNJ ΔΐΙ ovwoSVTJVSAVh ο ΙΊΊ86 sCSJcslvov oluη- η-ϋCJoe)SHVe)s 3UX 33⁄4013 e)3e)oov oHe)uuf} se)UHV 310e)Hu?ICS1 L6 v&lt;cu&gt;T:AdsuI&gt;JIdxHIvle)8r' 5IC\1Ηυϋ uou uoouhovjohisehocjucjvuuloEHvulomEHILV 8333&lt;3υνυΕ-·ν 80e)JOOSe)S〇CN1 LL Ι2:χϋνΊΕ-·Ι9νΊνΊΊΗ30Ι&lt;3Ί8ςC8〇c\]CJHVOHV svos lCJouHHoov VH&lt;3S uoo OHH 000 HHOoluuCJvooe)use)3HVOUUUHUVSCNJ 卜LnvHsAvl&gt;Msvsdosc)se)oOH8e esCNοοϋουνοΗνυδ vue)\ale)lse ) w 3U1 133VUEHVU3 3S 3e)voe)e)v:uve)e)wue)5(JvuS6T LZ Ha.s(I)MTOe)3AHokvoCDxd&gt;HH8I ΓΟ96Ι HVUVUOEHODUSWV 33⁄4 vs le)owe)HVEH5CJusUHH X3e)e)e)e )ue)e}uuvuuuJAfHuvuS6T Bu IH01H &gt; 0A0Hd0xHHav2I S6ICJVOOVOυονυνουδονοοδννουδ VOCJOVOVOV V3VEH03 HVOSOOHV sesesJJus 1ST o79x 5eeucnrop4Jo5eueu:; 4- »5e:; - percpu4J4Jcneeouu4Ju4J4- &gt; 4Jeu54J4Ju4JuueCJueeeeeee4Jeo4Jueueeeueu4Jo4Juuu4Joueu19 〇9 Bu Bu I s 1 U5ueuoeooee Mang eee4Ju4Ju: D4-» 4- &gt; 4Jooo-puu4-) u4 -) 4J3e34JfO4Juwup4J4J64- &gt; 6ueuueu6uueu4Jcncneuu £ &gt;o:; ufo4J4-) uululbebeulΙ009Ϊ 039 Xa14JIfolu-u) afT34Jucn4J4Jofoefocn4J-IJuuuf &gt; oe5efouiT3: D4J034Jeu6:; e4Ju4Ju4J4Jufo4-) 4Ju64Jue4J4Juo4J4J4Jcnpuou4-) JJ4J4J4J-l-) uuufouu4Je I〇9 I s 0Q9Xululbeb9ulbaJIe54- ) e5tnee654J66ue5rD4Jee4-) eeeeuefouu55uepeu6eeeoen3foeeoee4Jfc64Jueee6e6ueeeeu4J4JeuT-HCNJLnrH s QCNJLnr-14Jf0eeeeue4-) ee4J-p4 -): Dn3ecnn3r3-pecneen3cn:; ee4-) 4J6up4JIefDIe:;:; ee:; e + - &gt; euee64-) 4Jeu4-) e6e6:; 4Ju6er0: ;ue4-)4J4Ju:;e54J4Juur-ft? bT-H IH q Wr-H&4-&gt;ls58s5s:n5s5es:}ee:is:}5cness:p::&gt;:p&e54-&gt;s54- J6ee:n6e&amp;:^53 5&amp;-ps:t&es55e Ι9ρη1-Ηeg丨Z Page 86 2002.06. 26.086 1247040 Case No. 89122618 _ 曰Revised patent application scope ε 丨eg r—i〇LOc ecn〇〇ςΓΟ 6 6 πΓΟe4Ju4J(J4Jo66eeo4Ju66:;4Jecn5etn4-)e4-l4J4Jeu54Ju:;wup4J4Juuueeu4-)4Jo4-&gt;eeu4Je£&gt;£&gt;:;ee64 -&gt;n35foen3e4J4-&gt;peeuee54-Juf&gt;u0&lt;\J7e 61 ben3^3fOuL)4-3a3fT3p4Jo6beuu:i:;554-Jecnecn54-J4J4-)tn:i614Jf&gt;54J96o4-)uu64J4-&gt;6efdefD-p6666fau4Jrauuo64Jue:; fn3n34Joe4Je64Ju〇t7ee 6ro£e 3^4^4-)5叼5 towel 4-)55^^邙^卬035^^^30:;9:^(06694-)4-&gt;95030 buckle:^0350504- 3:;:;0303034-)94^ towel buckle 53^036:;5^邙0603691?5:;:;5 towel 5 buckle 4-):;4-)(139 〇9c\le 6lnc\JciT35o3fofD554J4JfI3554J4JufofI354J4J554JiJ4Jfn4-) 64Jue4Joe:;n3ouecnwe5erofo6e£&gt;64J4J6e54Ju4Jp£&gt;cn:i4J4-&gt;e4Je:;6u4Jufo3opee6 〇8τε 6 Ipoun:r3ucp4Ju4-)-pu^pn3ix35a3u5u6eeupefo£&gt;ee4-J£&gt;4JuJ-)4-)n36f&gt ; u94Jn3ee ^ euen3uee4-) uu-pe6cnuu4-) u4Je4Ju:; e5ucneu £ &gt; ueo6e took office >> --0066 〇εft5uu4J:;! 5JJe £ &gt;:l4J54J:; eucntn4J4Je4J5-p4J4J4J54Jeuioee5ee6eee4Je4Ju4Je66euf &gt; 5eue4J4-) 4Jo4J4J6e55u54J54J55eoo5uu :; 0ΓΝ1〇 ε 6 ΐ 〇εfc TO5up4JfI36-pu64Je554-) uee4Ju4-) eee5oe4J4Juo4-) foeef &gt; eo4J ^ 4Jeuucnee6fdee6eeecneeu4Ju54Juueuu55eu6euow4J5 〇7 6CNJ 6ΡΊ62J-) u554Jfc4- »iOwuu4Juee554J4J4-) ueeo5erou4J:;:; euuu5ecn6e6u £ &gt;6uuue4J:;eun3e6ue5u:; eu4Jefocnuueecne54-J54Jefo6e QVDCDCVJ 6LO8CN1uo4Jecncncn6u: ifaecnee6cn :;:; 4Je64Jecn4J66o6e4J3cn6u6634J654Ju6664J4J64J4J66-pio-p1 n365fo4Jup4J4Jidfouioioue64Je5o6 〇8r-CSI β factory wide rj6uueecnee: 13ee4Jeuuo6e4J4Je (T3e4J64-ieo4- »ecne6u-p6e5f &gt;: iueeeeup4J54- &gt;4Je6eu564Je5ueroue:; 4JfT3ee4-)? ee6n3:; 4J:; u〇 0 Bu (\1 6 69CNJuf!3fccc5un35pn3fon3n3g554J4J4-)n3554J4-)3uecne4-J-p4-)uun3(oecn4-)u4-&gt;+-&gt;ue564-)o-pcnp6fT3e4Jfo4Jf&gt;£&gt;ouu-IJeuu4-)66euuw4 -) eucnpfo6 QCNJ9CN 6I9CSIefu, 4 6eou34J4Jue6ufc6e: i4J56uufc4-) 4JD:; eeu4- &gt;w5euDeee4Ju6e:; 4J4Jeeeueeu5u4-J4Je &lt; T36ee :: &gt;-p6:; 4Je4Jee54J4J6cn4Ju4Jol ^ Lncsl 6roLT) 24J54Jn3ow4J4- &gt; foo5go5n3fccnpfo4J5fofniO-ppo4Jfun34-J4J4- 4Ju4-)54-)4J-IJ4-)u4Ju4J4-)54-&gt;4Ju-p4-»5{I354JiT3m64Jpro554Jf&gt;e4Jcn4Jeu54J4J4-&gt;-pue4-)〇9 t?c\l 181 * &gt;ia S 8/.1 6UO7CNJ54J3^4-)4J4J4J5554Jo-UJ4Jfoil3e564Jeeee4-»664Juefae4-)6:;cn4-)cnu4J4-)cnf&gt;cn4-&gt;4J4-)4-)6656ee4-)efo4Jn354J55 WH WVOVOVCJH Π8ε3 LLA VM&gt;aosMHOI303/v3MJL&gt;ioo8Lr)rH 2εζ V8 VVV 310 HVD ss H3CL 3V CUV SV3 330 15 WS SW 33V 9V3 333 Page 87 2002.06. 26.087 1247040 _ Case No. 89122618_Yearly revision _ VI. Patent application scope Wherein T may also be U; (2) a nucleic acid sequence which hybridizes to (a) the nucleic acid sequence under stringent hybridization conditions; (3) a nucleic acid sequence complementary to (a) the nucleic acid sequence; or (4) substantially a) a nucleic acid sequence homologous to the nucleic acid sequence; (b) a second nucleic acid sequence to which the flavonoid-specific gene is non-essential. 1 7. An isolated chimeric nucleic acid sequence consisting of: (a) a first nucleic acid sequence comprising a seed-specific seeding base derived from flax (1) Nucleotide sequence of nucleoside 41 as shown below Docket No. 1,247,040 page 88 89122618 _η six correction, patent application range 8ΓΝ3Τ δ ~ δ ~ δ IwOHScyoIv ^ wqaocJsHCJHcivuMSST ο〇8 νυονοονουΗνννϋονοϋονϋΕΗνννουϋϋυΕΗνυοϋΕΗουοννϋΙηΙονϋοϋϋνυυΟΗνυυνυϋ, ΙοϋοϋουνυουΟΗΗννυϋνrHCN Bu ΓΗ〇Τ ΊΕΗΗΑ ^ Ίϋ3:. ΙΛα5ό: ΞΟϋϋΗοαΝΛΛΕ5Η 9 Bu ΟΖΓVJ.XBVSVoSHe'xosovowooE- ' JiovsvouovovuwousvoovoosooooovuuvvuVJnLVeHuvuuovovouc) T s Lr) Bu ϋϋ ^ ϋΛ &gt; ί3Μ2:. ΙαϋυωΗα.5αΗϋδΙα03οΛ s OS 8o08ve) vuCJswvovc) c) o3soEHsv3ovuussove) 〇voE-'uuHSVOV8c) vuovuo, LV〇voc) voov80 JosvrHVDLn 8 lamp vvEHov &gt; H〇oOHOaMEHwwaIIAEHJLcri &gt; sv (NCN 〇9Lnυϋ&lt;:ο〇&lt;ο&lt;〇οϋ&lt;υϋοΗϋ〇ννυϋ〇νοϋ1Ι〇ϋο〇οοουννουννοον〇νοονοονοοΗν1ΙηΙνϋΕΗϋνυναοννϋυ:λΙου:λΙν3ϋΓΗ8 Order TCN3QAAIaJahoEHVAVVasKaHVKrH 0 8ΚΓ0ν0〇Η00Η03ΕΗν0ώυυΙηΙ3Η00ΗΗ〇νυ〇0νν00νΗ〇υ00ν00νΕ-'000 〇Ην0ΕΗ30νγνυ0〇Ε- · νίΰίο (ΰίΰ (ΰυυίΰυυίΰϋ: ^ ΓΟΓσυυχ square Ding (T) aJJId &lt; seh 00 ^ fcn3cn ({dlen3lJJIlJIulufdlulfolulJJIulJJIufclD1uaJufd (TJu (du4Juecnufoufo;: &gt; un3uuufdfd (I5uu (daJJJ: DJJfopu3u3iJ &lt; I33upuuue (TJIfdl4JIa3lJJIfI3llJIupoulJu ΧΓΝ3ΓΟ U- H5 Juads-pss xoq 〇s billion (NroXJ Mang fouiJouJJUJfduuuunstnufouJJu-euidfdJJaJcppfdpulcnlaJIpuluucnfoiJtJIaJIdlolfdluoueptpfcfd ^ puuutpfdfdJJDlutnuilJJJCJfcJJppJJI-epsJJIpΓΗπΓΝ οπ (ΝutnJJ4Ja- &gt; rou5qu Mang cnXJaJidJJtnJJioJJeJJcrluueaJrdecdeJJXJidJJJJidofouiouaoJJXJfdaJcnJJJJiouducncnucnufdliJIfdlfdlpcdlJJIcnlidlqaJIefdl ^ ltnuucnulJX9TH ιρ · Η: Ιehv 〇9 x euJJcn4JaJufdupqtnaJfI3 «TJfouuaJn3fcJJpt7) fI3cdJJtJ1fo (TJuutntnfcD1 (dD) n3 (T3utnfdeidJJJJr3 (! dduoaJIid rolJJIn3ldn3lfdlpiJIicldcnecn ^ fdJJtJ) cnfd (TJuuDltnufcrHoo ιίυ-HJt Hv {T) hauIThft, Ln 〇oofoD1: JfoJJfdetnJJcn: l (T3cnD) cn (T3XJ4JJ_) ouD1qJ_) uaJeouJJ: lfdeuaJaJfduoeuDlcntJ) JJIqJ-) lqJJIiolfolXJIaJIJ_JIJJIfdloJ_) iouoJ_) p4JleulaJIt71D1m4-) lD1qil3l :lulpCJI ulJ-JII H丨ε LT)LnTood&quot;IaMVIc&gt;&gt;IVcyaIM^c&gt;A3 δ~5~δ~5~δ~δ~δ~^ 6(Ντ 0 8 8UVSU8CJSUVS wEHu8HVWuVWHuovvoc)vu:XLV〇〇s〇vovoJML 〇VYe)c)vo〇voovuvo〇e)voov8v3vooe)τ 〇8 painting hidden_1 page 89 2002. 06. 26. 089 1247040 Case number 89126618 Amendment 6. Patent application scope 09 6 SJJSOJI艮ΰδυ5β56βνοΕ-«ΕΗΗδΜνυ〇δχ $οϋνυϋνο3ϋοϋνυυΗδνυυο (1) wuoovhuu〇vouuvo8u〇eh〇v T 8 8 ϋΊΔτ (ζ) a(l)m*H:ld,Ln hMVSc&gt;c&gt;o〇o/Jc&gt;oosdc&gt;EHH(J 9LnT (CN) aauI-Had .e 9Γ-9Τ0laJIeaJI3lJIJJIbOTcriJ-) lD1u ^ ulXJIucn (JJ (du (dutna3foilit7) tnJJa3n3 (dw4Jfdrdid {c: iAJaJIJJJD) cnaJJJu4JJJ4JcniJITJ4JtnlJioaJcnaJcoAJiJcniJn3 (I5cn &amp; JJ (I3tJ1aJuτ〇9τ 〇〇9Itncnfo Mang rocnecne ^ cceiceeaJfo &lt; T3aJD10uioccJJXJHuJJD) fo (ox) aJ4JJJcnJJD) JJn3cndfo4Jfdn3JJpD) cntn4JictnD1erdJJJJcnJJ Mang cnelJucnJJofoufdcnfddpJJpUJTCNLnT oCNLnxcnuiJec7) «T3cniJpc71o4J (dD1XJcntnXJcr) eiccnaJaJ4J4JcncnJJfoucnaJuJJDliduDlioucnfootJltJ) D) D) euuJJucneuutnaJfoD) outTIeaJuuc7) fou oufcuD) tJ1uD1JJmTH tnfT3ufdtntn &amp; uulJ4JoufotnD1D) cd4JucnuJJt7) ioiou (o {c (T3JJu4Jfdn3 :: &gt; JJpuuuqDlcnqDltneDietT) aJJJcnrofcltntn (c: &gt; DlfcutJ) fo3rocncr) cnr3 :: &gt; cnpucn (oou4JΤ9ΓΟΤ 〇9rnrH ^ uetntneutncn (IJtniJdcnpuucntJ): DiJdpucnaJDlucnecncn ± JufdtntntntJ) idutJ) JJfoufoutn4Jtniocnutn ^ cnD1etnJJ: i (o ^ utnn3eaJJJu4JfdD) aJidD) ucniJuTOOCNT 0 8ΓΝ3ΤD) JJutJ) pJJpc7) uiJUJufouDleuuD) dtJ) idufdpucnCJ) tniotncn ^ tntniJcnuucncnfdfcuu (IJdufoaJufd:; u (T34JutneuD) uut7) cnutncnc7) p {oD1 ^ uuJJcn (T3p (cToCNrH o〇 (NTfcecncncnJJcnJJuuaJaJcncnotnt71uJJ4JfoaJJJp (dtnuJJr3aJuqJJD) tnaJcnaJcnuJJucnJJ (doputndioiocnqiofcp:! ifofQ (ofdaJXJaJXJaJD) cnJJiJuJJJ-) lJcn4JeJJcnrHCNrHTH 〇2TT JfcaJJ-) cnlJfcn3fcD) JJfl3cnaJutntT) dcn (dcnfdD) n3tnfc5eDliotJ) HCTifocnidD1 (ocnfl3tnidcnfctT) (T3tn (dcnfoD) (T3cnpcnfoD ) cdcncocn (T3cn (d5foD1cdfdfc4Jcdn3JJD) JJu5fduT pumping light 〇TfcfcJJCT 〇T 0) JJ ^ fcaJJJcndn5lJJJJJlJcnJJt7) JJdpcnaJfotn (ccn4-) n3eaJmfa4Jfdn34JeeJJpdaJ «XJtnD) JJn3cr) Dlfo (olJJJcnaJcncr» (oaJut71aJueueD) eefoupaJcnoiJfoCJ1THVDa section 90 Page 2002. 06. 26. 090 1247040 . Case No. 89122618, a 卑月曰曰 _ 6. Patent application scope where T can also be U; (2) Under strict hybridization conditions, it can hybridize with (a) nucleic acid sequence a nucleic acid sequence; (3) a nucleic acid sequence complementary to (a) a nucleic acid sequence; or (4) a nucleic acid sequence substantially homologous to (a) a nucleic acid sequence; (b) a second nucleic acid sequence, a special gene for the linseed For non-natives. 1 8 - an isolated chimeric nucleic acid sequence consisting of: (a) a first nucleic acid sequence comprising a seed-specific seeding base derived from flax Because: (1) The nucleic acid sequence of nucleoside 2 2 3 7 is shown below Page 91 1247040 Case No. 89122618 _η 曰 Amendment VI, Patent Application Range q ξ?υ'45α-)ϋυ:Γ4υ6υ:1 bunoeuuuXJuJ-Jcncnwe4-J6u4-Jeue4-&gt;u4_)4-ie4-Jeu^Ju£&gt; e 6OJCT&gt;6 we 64-Ju 6u4-)o4J4-JXJ6 e e4-)uu4-&gt;4JJ_)4-Jn3cn4-&gt;64-J4-)4-)4J4-J4-J4-)-p6 pw 6 e 6 ecnueJ-J4Je eu 002T ϋ6ΐι0811:OLII0911 olr)uomοεπOCNU om eXJ6u-uueuucn:i6JJu4_Jeuuue6ee066e64-)4J64-&gt;e4-&gt;e6e6e4J4-Je:i6uu634-&gt;4-»u66eu6664J4J6J_)6ue4Juroeu563u4JJ-Je560ueueuu4-&gt;u6ecn-pcnu4 -)6e5eu 0011 1 QOOQIοει—I0901οςοΐ ΟΟΊΞ ss SOI q4-):loJ-)e wuu6u5roe 6 6eue e ecnuee e 6 u 6 e 6AJ66 64J6 euuw 6 ue 6 5 ue 64Jeueu:; e uuOJe ee 6 uup 64-Je e uue Eeu£&gt;euJ-l6AJJ-J6 64J6+Je e 6 euwJ-JucneCJlcn 00〇ΐ 066 086 Q/.6 096 Qlr)6os QPO6 OS016 J-)euJ-Ju-ueuJ-)uecnee6-u64-J4Je4-)uue66eCJcne64J4Je4J6cnueuu4 -)uee4Jeuueeu64J4JCJe664e4-)4-J6eeu66ueecpu4-»4_)raweeee06uu4-Ju6cnuue630-l-)£&gt;CJu 006 〇68oooooοεosoLnooOS OSos OS un e euCJcnu-uucnecnuucneuw 6-ucrcnfO4-)n34-»4_):}ou6 64_ eu4-Jf&gt;4-)4-lu4J4-)u4-)4-)6cn4-&gt;4-»4Jwue e 6 5 6 e u-ueucne ee 6-pe(J4-)3u6 e ecnuuurncnue e : one euoweoe 6U 〇08 06 〇8L Qr-L 09 卜oLnr-ogopOCNJ 〇1—(Bu o, 4-u4-&gt;i-)6 56 6 e 6 e eu4J4Jouu4-l6 uJJu-pcnue e4Je e4-Jeu邙4Jeu4 -)6uue4J4-&gt;uOJcne we e4J6 e eue 64Jue4Je q4Joe4-Jeu4-)4J4Ju4-)e e4-)6 6 eoe 6 e ecneu6 ee eoee e υ 0〇/.069 089 OS 099 0ln9 OS 0C9os 019 SI SI euu4Jeeu: ;eeuu4-)64-J6ueeu4-J:;:;4J4-)4J4-)4-»eue3cn4-J6ee6u4-Jeee64-J4-&gt;e4-»6e64-&gt;u4-»34-)lral634-&gt;l6erDI566eepe6e6e4 -Ju3-pl34-&gt;l4-)lee6ulaJIe64-)4Juu64-lera4-J4-)64J 〇09 〇6ς G8G of Qs OS Qs Qs ΟΤζ eCJ34J4-luo4-J4Ju6ecnw WU6 e 6 e4-»4_)ajuu6 ee 64-J64 -J4JP UU4JU 6 6 eu4-&gt;4J4-Ju4-&gt;E ee 64-&gt;4J£&gt;4-):;u6cne uXJ4Jcneu4-l4-)4Jecnu4-)4-&gt;ue 64-&gt;4- J4-Jecn4-J66 64-)4J66uou4-Ju 6 e 5 e4J 〇ος 06π Qs Qi OS03 02 OS 03 4_Jwru54-)CJ6-u4-)a_)cn4-»6 ecncnecn邙e5 64-&gt;cn4Jue4-)e 6cn4 -J4Je 6OJe 6ueo6JJ6u4-)eucne £&gt;64-&gt;oue4-)eeu£&gt;ajuu6 6OJoueOJe eu 6J-)4-Ju5 e uuu4Jue4-)uo:l e4Ju4Ju4-)6cne e 007 〇6Coooroos srnoLnrnornrooONlroorHrn IHI_ H 4-)-u!:l5ue6ueeuloleuleul:r4ul4-!lue54Je6ep64JIol4-JI66e:iJ-»fou34Ju4Je4-)u4Jeue4-&gt;uaJcnuu6uu64-&gt;6u4J4-)uUJ6e6eu4-»wJ-)64J6cn4Ju4-i4-)4Juuf&gt;e4-)3ecn6^uu4Je:i4-) 〇orn03os QGosolocnjoroCNJOCNJCVJor-Hc\l Uoo-Jecneu6ro-UJe 6 6£T44-)6euXJ6 6 e 6 e 6ue e4-&gt;ue 6CT-5 w4-)uu6 6 e 6 e 64J4-&gt;£&gt;e4Ju:}o64-)uu-uua4J4-)uu4-&gt;eoue 64-j64j4-)u- Ij6 e4-)au4_)e4-J:; eu4-&gt;eue ee 6 64JOJe we Qoosi〇6I 081 CUT 〇9I otnT OK 〇ετOCSJI Oil uq4J邙6 euJ-iJJeue 6 54-&gt;e-uu& eJ-l -ue eeeee eXJe 6 e eu6 e eCPeo64J6 efoe e pue e e4Je e4-»eoepcneuueoij£&gt; eJJeue eJJe e e4J5cn6 e eue 6 6ue-peu6 ee υβυ ΟΟΓ—Ioch000Qr~〇v£)oLn〇ro〇CVJ〇r—l H丨画画__1 Page 92 2002.06. 26.092 1247040 Case No. 89122618 曰Revision 6. Patent application scope OJ'AJd7 "iae"&gt;id3IHQ:a:&gt;&gt;v&gt;sv00u.00a:N0aM&gt;3 00s 〇 6S 082000^3 scvlCNloLnCNJCNo忑CNJoonCSICSJogCSJ2OS ICVJ ΙΗον3ν0Ι1Μαί333ναΙα:αΙ033Μ300^00(χϋΊ 31v33sslc0w£}vc0sv33HV33ww3vs33e&gt;s33xv83v8HV39v3v81vov8SJ^V8wgsv33v3:u,LW::0v3svse^H:u 〇os 0612 0812o二20913 SGo工2oroIZ STS Ξτ2 (uuuanCTas&lt;-Hmu57s SSHJ Port IV 5~Ϊ~ 5~^~§~~^~^~^~5~§~g~§~5~~^~^~ ull313s3n31311v3381mv30JOX3v313,L3JLJLC&gt;3JixJO33sw31v3JISVJOSS,LV33s33eue6eeee33:ie33:Je:nu5:n3e:J3s:} 0012 0602OCOOOJo£ cnjoVDorv]OSCSJOSCSJOPOOCNJoscv}orHocvl V1V1 SV3 5 use e6eq〇3s iDsysooocJ seeei^ri^36333 Seven 53:; 3396366:16:^:^2:^ 53 Seven 8. i 〇33 esee363664ee6 00s G66T: 0861 CR6T S6I ss it 0C61 S6T 0T6I U-HJ-HU*H&gt; U7uin6a)q eecn4-)ueeeol6:;eu!u:leu64-JIeuluueee6wefaeeue4J4J64-)5ue4-)4-&gt;e4J4- &gt;3u:l64-)aJeo-u4-)urDu64-&gt;uueue6e5ecn:^4ueee5J-Ju4Juuou4Je4-&gt;eueuu4-J5JJ34-JaJu 0〇6I 0681 0881 QZ.8I0981oLnooTosrH0ΓΟ8Ϊ QSI 0181 -uuuuOJcpuucn34-leu4Je4-le e u4JfDuo4J4Ju euucncnJJe 5 E4-&gt;ueueu4-J4-»fo6 e4Jera5uoe eu4Je4-J4-Je4-&gt;6 e4-)CJeucnwe eee uucncnue e4-J4-&gt;etncp£&gt; ee 64J4Je e4J4J6 eu64J 〇Q8I Q6L108LIOPIo9z-rHoLntwo ornsOB Ξ II 6J -J-uq6eecp4-JuefOo:}um4-)fOeu4-Jee4-)een3u4-»ee4-)ewuuee6euew4Ju£&gt;4J64-&gt;4JeJJcn64Juueee4-ieee4-JCJ-puuuu4Ju4-J6-pe4-)6-l-J4-J -pe4-3ueee6o:ie4Je:l4_»le4J4-J I卜 I 0691089Ίom 0991 0ln9I · OST OS I QST019 I I____________________β________________ s rcJ_)uiJueuuee4-)4-)qf&gt;ee4Juee4-)ee4J4-)4-)4J6e:ie4JIe- L-ile4-)l4-)l4JIule6e4JI4-JIJJIiJIuee4_)4-)4-)efu4-&gt;eeeen3ee4-)4Jeeu£&gt;:;4-J:l e4-)le4-&gt;le4JI:;:Jue6e4JIq4JI3uuueew6J-) eeJ-)ee 0091 Q6 5i 〇8ςτ οζ,ςτ 092 αςςΐ 5ςτ οεςχ QSI Ξςΐ Lob e e4-J,,lu4_)u4-&gt;eue4-l-u6rc5roue euuww e 5 eu4-)6 e eJ-JJ-Jecncnue ^ e 64-&gt;e 64-)6 e 6fouue ee 6cn4Jue e 6 e4J4Je 6 e4-)4Jea-lJ4-)ee υeeee 6 e U56 u4J4JuJJ-ue eeu4J-u 〇〇ςι 〇6ta08K om093 οςί^ΐ fl 031 QSI oi II ub :J4_&gt; uJ-JXJueJ_J4-)4-)CL)3J-le54-)q e0660le6-ul4-II666wbw6cn4_l4-l-M660le64-)l4-JI6664JI6e4J66-pe6u66u6uu4Ju4J6666cn4-J4-&gt;4J6e6aJ:;6cpe664-J6654-)e6uue4-)4- ) u 〇0 2 062ο8ετo ΓΟΙο9εΐοςΓηΐ 5εΐοεεΐ SCIοΐει Iglg a-JaJ3 64-!64Juu36XJu655u&-u654J6&amp;4-&gt;6 邙4-&gt;4Jprceuu6ueucnXJeo:}5-l-)66e4J(JuuaJ6epuu64J6uou-u)uo6uo6ol6-l- Ll6oleuu:le35lJ:i4JeuXJ6uuu-pe-pe6-l_)u GOCI G6 2I 0821 QL2I 09 ZI odom QCSl: SSI od Page 93 2002.06. 26.093 1247040 Case No. 89122618 Amendment 6. Patent application scope, iscr:&gt;a:sv3culi IavHS&lt;3ae)IN3IT:H2:sL)iH33&gt; QOS Q6Uo8Ie QapoS3 ss0300QrnT-HrnoCNIrnorHg iDNSAAHe)De)a:e) e) 0: H0stJ30Isldda: AIa7393A vgsv8Gvl3vl3s3sl995fu8, L99s3v8s3v3v35v8s9s: uvsv335818VDV353IV3s313svs3s3vv8sv 〇OIC Qsc oooopoοεΓη§εοςοροirnornoroospoΞ〇ρο G &gt; IOoc: NaN3soJHc: v &gt; 23a &gt; Nu - '&lt; 3VIq &gt; isaIe) u 08s3sov38e) s5wCJsow3VD3so3VH3svc) e) w (Jsle) CJws8v851w31539s8c)8s3J,oe)w(J:u3voulw8oo 〇〇〇ε Q66S086CS1ohchCNJscnCNoLncnCNJiCNJoros S6CNJ sslHvc301D43ci:c:e)a:e)e)3s3e?cc:ST^e)e)00s03J3 ΗΗΟΗΗΜ-^υο&lt;δ«υϋΗου§ΟΗΗΟΗ005 ^0η-ο&lt;οουβϋ&lt;οοδοΗϋϋ«ΟΗΟ&lt;ϋ&lt;οϋϋοΗϋυοϋ&lt;ΟΗυϋο&lt;υ^ϋ&lt;ϋϋ«οο&lt;οϋοΗ§ο«ϋοΗΗΟ&lt;ο 0〇63 Q6S Q88S 0983 Qlns Gsosl another s OSS 0X92 ac:aNS&lt;TAJM uVDVD&lt ;e}CJCJ3wve)o&lt;33311u&lt;loHlu&lt;vcneu664J4-)4J:;4-)4-&gt;uu4-&gt;4-54-)4J4-&gt;uee:Jee4-Ju-l-»e4-}6e34 -l4-»4J4-&gt ;e4-Ju4-)uee664-&gt;4-)eeueueu64-J4Jeee4-Jee4Jo64J4J6e 〇〇8C\JoiCNJoco 卜CNOPOJs 卜CNoLn卜CN0?^ qpcnocnjgorHG HCL.M2aT0MlHSSHaH&gt;&gt;IVW&gt;a.32:oaN ^^οο^^ ^ωυ^^ω^ω^ω^^ϋο&lt;υοοο«ο«ο&lt;ΟΟΗΟ«οο«ΟΗΟΟ&lt;οοο&lt;υοΗΗΟ&lt;ο&lt;ΟΗ&lt;005ΗΗη-ΗΗ&lt;ουϋϋδη-5&lt;ου«ου«οουΗδο«ο 〇〇 ^ a:: cr: G 〇69s 089CSJO ^ CNJOSCNJoLns · os ^ QSCSJOSCN) ASsHV &gt;; 3vd & gt 3cr VIAae)! I &gt; 10H0a0sse) 00D0 〇〇9rs QcnLOCNJQooLnCNJ〇r ~ LOCNJoVDLnCNloLnLnCNJiCNJornunCSJoCNJLnCNJοΓΗιηζΝ ooooossCJUJltJaJuxdisIolAD ^ o 3w3vo3vv (Je) v3o &lt; L) oCJlvve e)ve)31HVCJvsve)v331uHVe)&gt;IV:}CJCJH13JA/31VVDe)&lt;CJvE-IoVDf}se)VCLScneu4-):;e4JeJ-J64-&gt;6-p4-)64Jcn4-Je4-)cn4-) uueucn4-l oscsiiCNIiCNloiCNlss QSCSJoi0ΓΟ3OSCNJor-H々c \ l oaiaiiocuhn rncnuwfcbweeuweJ-Jeeeu-pe-uII-l-Jeucn-UJeecnuJ-JJ-JueuueuueeaJebpeeueJ-IeuJ-JJ-JcneuaJeeeJ-JueeeJJeuEJSIVVoHHDolvuvE-'uHVCJloovuHouuuvov 00 ^ 06CCVJocoroCNJor-rnCNJsroCNJoLnrnCNIogCN} ornrnCNocvlrnCNJorHrnosl page 942002. 06. 26. 094 1247040 Case No. 89122618 曰Revised VI. Patent application scope 4_JUL'U:1L) eu{?u4_&gt;e E? 6 6 Duu64JufDXJue4-)uee4-Jw e-p4Je4-&gt;eOJ〇eue eOJue4 -)fO4Ju4Je4J4-)eeue ee5uc:e euuu4Je 5 eeeu u4-&gt;4J6ue eucne 6 eueecn6 e eue eue 〇QS0617 081-ςτ0卜1^ 091= οιπΙπ sr-ιποΓΟΙπ OCSJI^ QTT e 5 JtT:fT:ercJ-JXJ :}u5n3e e euJ-Juou4JeJJoe eucn4-)u4_)4-lcneuen35 uueuJ-Jeocpe ecpJ-Je 65e 6e64-)4-Ju4Jwcne4-&gt;u4-le e euuue4J-p-pu4-J4-)4-J64-&gt; e 6 54-Jeuu-l-Je4-&gt;e 3u4-)4-)rO 005 Q6C^ Q8S 095oLnsost^oros CIS ufue3er:6ern6cnu:leeuu4-lu4Jn:e4Jeeee4-)e:l4J4-J4-Jeee4-J4J4J4-&gt ;ee64-Jeu4»Jeee4-»4J4J4-J4J4J4J64J64Je4J4-JJ-&gt;4J:166:16-p4-&gt;4-J4_)ee64-&gt;e:;J4-Jrcee4Jeeu:i6-p4-Je4-)634Je4_J o 〇ot/ο66ε irnscrvrnoln6roirooroGrnΞ6ΓΟ 6-ul:r4rDro4-)u 6J-J5 5XJ5 6uu6n3JJ6 eou 5 e 64Je e4J5 w 54-»eee 6566 ee 6 5 5 6 ecnw ee 6 e 5OJ6 ee eueuub ep eJJe e4Je e4Je e4-&gt;erop e P4J5 y e-pp we eee4-Jcp5u 〇06c Q6S S8PO300ΓΟoiοςοοε Qi crns SCDPO ^ΝΊΊΜΙΛωΜΛΛζΊΗΟα,ΒΗοοΟΟ^ΗοονΊ s:ls:^ee6q663e6:i5:^eevvsJLV,LJO3J,JOVV3HV3IS3vsvv:us35IVVSH53s38338,L8v3313v38s9v8v::0vx33D,L13 〇〇8εοίΓηsgoipospoLOgo^rnoprnocgLroorHg Η1ωοο:Ν.3&gt;1Λβ:^&lt;33α4σ)Λβ :Μ&lt;ΜνΊΛανί3 IVUAVSH 0〇so$roirnocm§rooLOVDrniroοΓΟ9εoCNIVJDroΞ9ΡΊ α:3&lt;Ί5ΝΛΣ&lt;ΝαΝΗ&gt;1^νΛ2:3^^38〇$Η&gt;ίΛΛν3Νο 〇09ε 〇6ςε osc ο/,ςε csfo〇LOgfnS3 QsroQsroΞς (7) αΛΗΛΛ0330ΊΛ3α[^ Λ32:333ΝΛΙ0Λα:ν09ΗΙνΛ ουοοΗοου&lt;ΟΗΟΟΗΟϋ&lt;ο&lt;οο&lt;^οη-&lt;οϋΗοη~5&lt;οοδοοΗ5δουΗΗ«οοο«οο&lt;ου&lt;^ΟΗΟΟΗ&lt;ο&lt;ουΗϋδ&lt;ουΓο«υ&lt;ϋϋ&lt;ο&lt;υΗ&lt;οοηου&lt;Ηηο Osc 〇6S 08Κ 0^^^ο9πεosm03ΓΟΟΓΟ忑osm Q(一) g AlsHVNI2MHdlHIV3 Jbvs306vov3sw3s3WSI3v383DH3sss83w^5cn:n4-)ues:n 8&amp;33e64-)u4_)eEuguiee:ns4-)s-uc&gt;u:&gt;4Je 〇〇忑ocr .soCDrnpo03⁄4 srorooLnrnc ssororoooOCSJSor-ts ΜΛΊΛ3Η3νοοΊ0Ι3:0 ΊΛί3ΊΝΗ5Ν eb .4 q en:rc:lu-4ufueuocot}u eu-uueuJ-luJJe 6 eu e-ub J』vvovluH3H133e)e)vc)ve)vooCJo3D&lt;lloCJv3ol ve)e)l woc)133He)33331U3VV3 V333&lt;3 V ϋϋΓηε ssoooCNJrnOLCNJPOssoLnCNle sCNJroornCNJonsCNJrnsCSJpn Page 95 2002.06. 26.095 Τ947Π40 / Case number 89122618_年月日_6, patent application scope Ιο丨啼5JJaJcnuu66:ieue:i64J:ieuu4-J4-'6eeu4-&gt;u6uu6ueuu-p6u4-):&gt ;uuuu6u0uueu666ueuuuu6eu56eueuuu6u565cn4_)4J4Ju6cp6-ueu64-'36uuu4-JeufT:u 〇66π 0867 0965? 0ς6π 0 more 0ε6π S6 π 0I6V qcn55uuXJuuuu66u4-Ju:16uuu66eu64-)4J4Juu6-u:;euue4-l4-)4-J4-)uu3eueeue66ueu6c4-Jcn6u4 -J4Jeueecn5uee666eeueuAJ666 &amp; 4Ju66uuue66cnuuu 006π Q6S 088βοε々Q9S οςοοπ 0S7 OS> QIS ou-u6eue &gt; cnuuu £ &gt; CJ65uuIOuuueu4-Ju66u54Ju5ecnu3e4- »5cnuueecn4-Jeue6cn6e6uu6ueuueu4J-t-J4-le3uue66eeeee6e566euu6uuueou4- &gt; 4_) ucncne6 thousand and? 06Ϊ 08GOLG095οςί 55 ορπ QCNJ5 0U7 65uuuu5eeuueee6ue6e4J64Jcnuuu4-)4-)56:;uuuu6uuu5eu6u4-J6e66cncn54-Jueun1ee4-):i4-&gt;cn6uue4-&gt;4J4-J4-)4_J5eurDft6ueu6uuue5uu4-)5cn0peu£&gt;4-J-pe 〇〇 〇 〇69π 089 7 0997 S97 0S7 〇ε97 QS7 Ξ97 CT5e6cpeuueu-ueeu66-4ee4-Juee4-J4-)eee6554-)euecneeee4-»4J4-Jeue4J6ueuuueeueuu4-Ju6:iu6aJuuXJuuu4-J4-Ju5ueu6665u6u34Jtpeu:;eu6666-u4-)0〇9π 063 08ςπ ΟΔςπ09Sοςςπ03οΓηςπ QCSJS οΐςπ -4 631163:^633(139^6664-)-1^6303^03^81.13050366663:1354-16^63:^0:^06^4^6:^04-)^1193:168 003:1:^6569^64^9:34^4^91153^50661134-)4-)-1-1634-31.13:^63^600S 065 08W QL5 093 095 05Ρ 0ε3 OSW οι; ϋ71£Γ4υ6&α- )656ΕΓ3α_ι6οΓΓ65ϋ6εα34-)6ΓΟ£ί6υ564-)4-)υυυ4ϋ66υ65υ6α3&lt;τ3υ69υ:^4_)6π366ίΌ4-)6α3664-&gt;υ4-)4-)υυ66υ6α36(Ι3(Ό65απ6Ε95:;6υ66£&gt;ΓΌυυ6:;υυπ34^:^ 4-* 005063082 09Sοςεπ S3οΓη2οοννεε 012 3,4003693^^5:1(1)664-14-)3365035303^95534-13^553693^98^6506635361534-)66^69 6603653660664^:^6:^4-)3 0^9 6364-13038:14-)9:^334^4-)(1564-)8^^ 0〇3 〇6g Q8S OS Q9SoLns ss Qrns 013 Page 96 2002. 06. 26.096 1247040 Case No. 89122618, Amendment of the date of the sixth day, the scope of the patent application where τ can also be u; (2) a nucleic acid sequence that can hybridize with (a) the nucleic acid sequence under stringent hybridization conditions; (3) a nucleic acid sequence complementary to the (a) nucleic acid sequence; Or (4) a nucleic acid sequence substantially homologous to (a) the nucleic acid sequence; (b) a second nucleic acid sequence to which the flavonoid-specific gene is non-essential. Page 97