TWI244503B - Novel bone mineralization proteins, DNA, vectors expression systems - Google Patents

Abstract

The present invention is directed to isolated nucleic acid molecules that encode LIM mineralization protein, or LMP. The invention further provides vectors comprising nucleotide sequences that encode LMP, as well as host cell comprising those vectors. Moreover, the present invention relates to methods of inducing bone formation by transfecting osteogenic precursor cells with an isolated nucleic acid molecule comprising a nucleotide sequence encoding LIM mineralization protein. The transfection may occur ex vivo or in vivo by direct injection of virus or naked plasmid DNA. In a particular embodiment, the invention provides a method of fusing a spine by transfecting osteogenic precursor cells with an isolated nucleic acid molecule having a nucleotide sequence encoding LIM mineralization protein, admixing the transfected osteogenic precursor cells with a matrix and contacting the matrix with the spine. Finally, the invention relates to methods for inducing systemic bone formation by stable transfection of host cells with the vectors of the invention.

Description

1244503 A7 B7 V. Description of the invention (i. Background of the invention 1. Research scope The scope of the present invention is generally related to the formation of osteogenic cells and bone and bone tissue in mammals. Protein series, and nucleic acid encoding the protein, which can promote bone mineralization in vivo or in vitro. The present invention provides methods for treating various diseases related to bone and bone tissue, such as spinal union, fracture repair And osteoporosis. 2 · Related skills description Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (Please read the precautions on the back before filling in this page)

Osteoblasts are considered to be differentiated from pluripotent mesenchymal stem cells. The maturation of osteoblasts results in extracellular interstitial secretion that can mineralize and form bone. The regulation of this complex program is not fully understood, but is thought to be related to a group of signaling glycoproteins known as bone morphogenetic proteins (BMPs). These proteins have been shown to be related to the ventral-dorsal pattern of the embryo, limb bud development, and fracture repair in adult animals. B.L. Hogan, Genes ^ & Develop., 10: 1 580 (1996). This collection of beta transforming growth factor-secreted proteins has a range of activities in various cell types at different stages of differentiation; the differences in physiological activity between these closely related molecules have not yet been clarified. DM Kingsley, 10:16 (1994). In order to more fully distinguish the unique physiological roles of different bmp signaling proteins, we compared the efficacy of BMP-6 in inducing Gut cells in brown mice to BMP-2 and BMP-4. Boden et al., Endocrinology. 137: 3401 (1996). We need bmp or glucocorticoid to start

1244503

V. Description of the invention (2) / The first generation (secondary) subculture of the cranial crest of the sculpted juvenile mouse studies this process. In this model of membranous bone formation, glucocorticoid (GC) or BMP induces the differentiation of mineralized bone segments that secrete osteocalcin (osteoblast-specific protein). This primary culture system is specialized from primary brown rat osteoblasts that have spontaneously differentiated. In this secondary culture system, glucocorticoids finally induced ten-fold BMP-6 mRNA and protein expression for the promotion of osteoblast differentiation. Boden et al.? Endocrm〇l〇gy ^ 38: 2920 (1997) ° In addition to extracellular signals such as BMPs, intercellular signals or regulating knives also play an important role in guiding the cascade of new bone formation items Roles. One broad type of intercellular regulatory molecule is the LIM protein, which is named because they have a characteristic structural element known as the LIM domain. The LIM domain is a cysteine-rich structural element composed of two special zinc finger-like structures linked by a diamino acid spacer. Some proteins contain only LIM domains, while others may contain different functional domains. A variety of LIM proteins are formed, including transcription factors and cytoskeleton proteins. The main role of the LIM domain appears to be to print dimers via two identical or different UM domains of the Central Standards Bureau employee consumer cooperative, or to bind specific proteins to regulate protein-protein interactions influences. In proteins with LIM homology domains, that is, proteins with both domain and homology domain sequences, the UM domain functions as a negative regulator. UM homeodomain proteins are involved in the deterministic control of cell lineages and the regulation of differentiation. However, UM-only proteins may have similar functions. Since the array of genes thus encodes proteins and carcinogens 1244503

Because of the chromosomal shift, only the LIM protein is also related to the control of cell proliferation. Humans and other mammals are susceptible to illness and injury and require bone repair and / or regeneration methods. For example, fracture therapy can be improved by a new therapeutic approach that stimulates the natural fracture repair mechanism, thereby reducing the time required for broken bones to heal. Another example is an individual suffering from a systemic skeletal disease such as osteoporosis, which can be helped by a therapeutic approach that can cause systemic new bone formation. Such treatments will reduce the incidence of bone fractures that result from bone loss that is characteristic of the disease. For at least these reasons, extracellular factors such as BMPs have been studied for the purpose of using them in vivo to stimulate new bone formation. In addition to each of the earlier successes achieved by BMPs and other extracellular signaling molecules, their use raises several disadvantages. For example, a relatively large dose of purified BMPs is needed to promote the production of new bone, thereby increasing the cost of this treatment. Furthermore, intercellular proteins are susceptible to degradation when introduced into a host animal. In addition, since intercellular proteins are typically immunogenic, the possibility of an immune response to the input protein has also occurred. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. Because of this relationship, we expect to have a therapeutic approach that effectively uses intracellular signal molecules to cause new bone formation. Advances in the field of gene therapy today are made possible by the introduction of bone precursor cells (that is, cells involved in the formation of bone pathways), and nucleic acid fragments that encode intercellular signals (become part of the bone formation process) . Gene therapy for bone formation has raised some possible advantages: (丨) less product consumption; (2) compared with the extracellular therapeutic method, because it can prolong intercellular signals

1244503 A7

(3) It can avoid the possibility that the therapy using extracellular signals will be hindered due to the limited number of signal receptors present; () D-Dao directly conveys the passage through the dye Potential bone precursor cells to the point where local menstrual formation is required; (5) Tolerable _ systemic osteogenesis, to provide osteoporosis and other metabolic osteopathic diseases-therapeutic approach. SUMMARY OF THE INVENTION The present invention seeks to overcome the shortcomings of the known art by providing a novel composition and method for inducing bone formation, which uses an intercellular signalling molecule involved in the initial cascade of items that guide bone formation. The applicant discussed 10 4 / RLMP (Serial Identification Number No. 丨, Serial Identification Number No. 2). The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs printed a culture of the cranium of the cranial parietal bone of a brown rat that was originally isolated and stimulated Novel LIM gene sequence. The gene sequence was selected, sequenced, and analyzed for its ability to promote bone mineralization efficiency in vitro. The protein RLMp $ affects the mineralization of the skeletal matrix as it affects cell differentiation into osteoblastic systems. Unlike other known tissue mediators such as BMPs, RLMP is not a split / required protein but an intercellular signaling molecule. This feature not only helps to provide intercellular signal increments, but also makes it easier to measure cell penetration. It is also suitable for more efficient and specific applications in the living body. Appropriate clinical uses include promoting bone repair during fractures, bone defects, bone transplantation, and general hemostasis in patients with osteoporosis. The applicant has also selected, sequenced, and deduced the relevant human protein sequence, and named it human LMP-1 (human LMP-1). This human protein displays increased bone mineralization efficiency in vivo and in vitro. In addition, the applicant also describes a truncated (short) version of LMP-1, named __- up_ This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) '' a central standard of the Ministry of Economic Affairs Printed by the Consumer Cooperatives of the Bureau 1245503 A7 -------- B7 V. Description of the invention (5) " " ---- S This relatively new type comes from a point mutation of a cDNA colony source and provides One shortens the stop code of the protein. This shorter version of LMP Is is fully active in cell culture and in vivo. Other features and advantages of this month will be presented in the following description. Π is shown in a self-description of 15 months ^ month, or; I: By implementing the present invention ^ the goal of this month and other advantages The written descriptions here and the methods and compositions specified in the patent scope can be understood and achieved. To put it broadly, the present invention relates to an isolated nucleic acid knife comprising a nucleic acid sequence encoding any LIM mineralized protein, wherein a 3-nuclear obituary knife can be complementary to a sequence identification number under standard conditions. Nucleic acid molecules with a full length of No. 25 are hybridized, and under highly stringent conditions, the molecules can be hybridized with a nucleic acid molecule with a full length complementary to the sequence identification number No. 26. In a specific aspect, the isolated nucleic acid molecule encodes HLMP-1, HLMP-1S or RLMP. In addition, the present invention is directed to a vector containing the nucleic acid molecule and a host cell containing the vector. In another specific aspect, the invention pertains to the protein itself. In a second broad aspect, the invention relates to antibodies specific for LIM mineralized proteins, which include HLMp, jjLMp- and HLMp_ls. In another specific aspect, the antibody is a multiple strain antibody. In a third broad aspect, the present invention is related to the induction of bone, in which the bone progenitor cells are subjected to a nuclear transduction of nuclear I encoded by a nucleic acid sequence containing the LIM protein. With respect to a particular aspect, the isolated nucleic acid molecule is located in a vector that may be a plastid or a virus such as an adenovirus or a retrovirus. The dyeing can occur in vitro or by direct injection of the separated nucleus. The paper size is in accordance with Chinese National Standard (CNS) A4 (210X 297 mm).

1244503 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the invention (6) Acid molecules occur in the living body. The transfected isolated nucleic acid molecule can encode HLMP-1, HLMP-ls or RLMP. In a further aspect, the present invention relates to a spine-binding method, which involves transfecting a bone-producing cell with nucleic acid molecules that have been isolated by carrying a nucleic acid sequence with a LIM mineralized protein sequence, and mixing the punctured bone-producing cell with The cells are in contact with a matrix and the matrix is brought into contact with the spine. In another aspect, the present invention relates to a method for inducing systemic bone formation by stably penetrating host cells by the vector of the present invention. It must be understood that the previous general description and the following detailed description are for demonstration and explanation and are used to provide further explanation for the claimed invention. Abbreviations and definitions BMP Bone morphogenetic protein HLMP-1 Human LMP-1, also known as human LIM protein or HLMP HLMP-ls Human LMP-1 short (truncated) protein HLMPU Human LMP protein unique region LMP LIM mineralization Protein MEM Basic Medium Trm Fluoride Dehydrocortisol β-GlyP / 5 Glycerol RACE cDNA End Rapid Increase RLMP Brown Rat LIM Mineralization Egg Quality Also Known as RLMP-1 PLMPU Brown Rat LIM Protein Unique Regional RNAsin RNA degradation inhibitory enzyme ROB Brown domestic rat osteoblasts 10-4 cDNA clones containing RLMP (sequence identification number 2) UTR Untranslated region This paper applies Chinese National Standard (CNS) A4 specifications (210 X 297 mm) (Please read the precautions for ^ g before filling out this page)

, 1T

1244503 A7 B7 V. Description of the invention (Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. Detailed description of the invention. The invention relates to a novel LIM mammalian protein, which is named as LIM mineralization protein or LMp. The invention Related to human LMP, such as known HLMP or HLMP-1. Applicants have sought to promote bone mineralization of these proteins in mammalian cells grown in vitro. When produced in mammals LMP can also induce bone marrow cells, osteoblasts, or mesenchymal stem cells with multiple functions in vivo. After being transfected with nucleic acid molecules encoding LMP or HLMP in vitro, the cells can then be replanted. Transfection cells are used in the donor body to treat various bone-related diseases or injuries. For example, we can use this method to increase the recovery of long bone fractures and generate bones in segmental defects. , Used as a bone graft substitute in fractures, to accelerate fluid reconstitution or spinal union, and for weak or patella bone loss (such as hip, spine, carpal bone (Porphyria) Length: For local treatment (via injection). Transplantation of L μ p or HLMP-encoded nucleic acid molecules into the bone marrow skin injection to accelerate the repair of long bone fractures; treatment of delayed healing of long bone fractures or Artificial joints without healing, or spinal junctions; and inducing new bone formation in ischemic gangrene of the hip or knee. In addition to ex vivo-based gene therapy, recombinant DNA containing LMP or HLMP nucleic acid sequences The vector can also be transfected in vivo. When a DNA fragment encoding LMP or HLMP is inserted into an appropriate viral vector, such as an adenovirus, the virus composition can be injected directly into the cartilage-derived bone formation site in the body. With a direct skin injection please read the note first

Order

_____- 10- This paper size is in accordance with Chinese National Standard (CNS) A4 (21 × 297 mm) 1244503 A7 B7 V. Description of the invention (8) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs to introduce LMP or HLMP sequences This allows stimulation of bone formation without the need for surgical intervention to obtain bone marrow cells (for transfection in vitro) or to re-implant them into the patient's body where new bone formation is required. Aldenetal, M ^ iui ^ u ^^ (i998), has demonstrated the effect of direct injection of gene therapy with BMP-2 encoded cDNA cloned into an adenovirus. Gene therapy in vivo is also feasible by directly injecting a naked, ie, uncoated, recombinant plastid (which contains the encoded nucleic acid sequence) into the appropriate body part. In this embodiment of the invention, the transfection occurs when the naked plastid DNA is taken up or internalized by the appropriate target cell as described. As in the case of in vivo gene therapy using a virus, the direct injection of naked plastid DNA provides the advantage of requiring little or no surgical intervention. Direct gene therapy using naked plastid DNA encoding endothelial cell mitogen VEGF (vascular endothelial growth factor) has been successfully performed in human patients. Baumgartner et al., Circulation, 97 (12): 1 1 14-23 (1998). By transmitting LMP to osteoblasts through an adenoviral vector, a transient expression of LMP can be obtained. This phenomenon occurs because the adenovirus is not incorporated into the genome of the target cell that is being transfected. The transient manifestation of LMP is derived from the survival period of the target cell that is transfected, which is sufficient to achieve the objective of the present invention. However, the stable expression of LMP can occur when the vector is used as a delivery tool and incorporated into the target cell genome. For example, retrovirus-based vectors are also suitable for this purpose. The stability of LMP is manifested in the treatment of different systemic osteopathy-related diseases. I-_-11-This paper size applies the Zhongguanjia Standard (CNS) A4 specification (21〇χ297 mm) (please read the precautions on the back first) (Fill in this page)

Clothes · Order

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1245503 A7 --------- B7 V. Invention Lake (~ ^ ----- Such as osteoporosis or osteogenesis imperfecta. Especially useful in this invention In the examples, in addition to using a vector inserted into the genome of the target cell to deliver the LMP nucleus sequence to the target cell, the performance is also controlled by a regulatable promoter. For example, when exposed to an exogenous gene Elicitors such as tetracycline_promoted promoters are suitable. Using this method we can stimulate the new bone formation systemically by giving an effective amount of exogenous elicitor. When the bone mass reaches a sufficient amount, exogenous induction The administration of the agent can be interrupted. This procedure can be used repeatedly when it is necessary to replace the loss of bone, such as the effects of osteoporosis. Antibodies specific for HLMP are particularly suitable for the analysis of the possibility of osteoinduction of the affected cells, that is, the formation of the moon. By this method we can identify whether the patient is at risk of slow or difficult recovery. At the same time, HLMp_ specialized antibodies are also suitable for marker analysis to identify bone degenerative diseases such as bone Risk factors for osteoporosis. Inheriting well-known methods, the genes in the present invention are prepared by joining LMP fragments encoding other nucleic acid sequences such as selection and / or expression vectors. They are used to construct and Methods to analyze these recombinant vectors, such as restriction endonucleases, selection methods, induced mutations, organic synthesis of oligonucleotides and DNA sequences, have been described. In terms of sequencing, the dideoxy terminator method is preferred Many papers have been published on recombinant DNA methods, including Sambrook et al.? Molecular cloning; A Laboratory Manual,

Cold Spring Harbro Press, 2nd edition (1988), Davis et al., J ^ Asic_Methods in Moledular Biology, Elsevier (1986), -12- This paper size applies the Chinese National Standard (CNS) A4 specification (210x297 mm)

1244503 A7 B7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the Invention (1 ()) and Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience (198 8). These references are specifically incorporated herein by reference. Increment of primer-directed DNA or cDNA is a common step in gene expression in the present invention. It is usually performed as a polymerase chain reaction (PCR). PCR is described in Mullis et al. U.S. Patent No. 4,800,159 and other publications. The basic principle of PCR is to make an exponential multiple of the DNA sequence by successive cycles of primer extension. When an extended product of one primer hybridizes to another, it becomes a template for synthesizing another nucleic acid molecule. This primer-template complex acts as a substrate for a DNA polymerase, in which it performs its replication function, extending the primer. A conventional enzyme suitable for PCR use is a DNA polymerase isolated from the so-called "cws" or Taq DNA polymerase. There are many variations of the basic PCR method, and selecting a specific procedure in any given step required to construct the recombinant vector in the present invention can be easily performed by those skilled in the art. For example, measuring 10-4 / RLMP cell performance, RNA is extracted and reverse transcribed using standard and well-understood procedures. The resulting cDNA was analyzed by PCR synthesis with appropriate mRNA sequences. The gene encoding the LIM mineralization protein is expressed on a performance vector located in a recombinant expression system. Of course, the construction sequence does not need to be identical to the original or complementary sequence, but may be any sequence determined by the degeneracy of the DNA code without altering the bone-forming activity possessed by the LMP. Retained amino acid substitutions or other modifications, such as amine-terminated methionamine-13- This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) (This page)

1244503 A7 B7 5. Description of the invention (11) The occurrence of acid residues can also be used. The ribosome junction in the selected host expression system is activated to join to the 5 ' end ' of the chimeric LMP coding sequence to form a synthetic gene. The synthetic gene can be inserted into one of the many different vectors that can be expressed by binding to a common linear plastid. A regulatable promoter region, such as the lac promoter region of E. coli, is also suitable for the expression of the chimeric coding sequence. Other suitable promoters include the trp, tac, recA, T7 and lambda promoter regions. LMP-encoded DNA is transfected into recipient cells by one of several standard published procedures, such as calcium phosphate precipitation, dextran, electropenetration, or protoplast fusion to form stable Transform. The calcium phosphate precipitation method is preferred, especially when it is operated as described later. Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (Please read the precautions on the back before filling this page)

According to Graham and Van Der, Virology, 52: 456 (1973), DNA is co-precipitated with calcium phosphate before being transferred into the cell. A liquid volume of 40-50 // g DNA and salmon sperm or calf thymus DNA as a carrier were used for 0.5x106 cell plate culture in a 100 mm petri dish. The DNA was mixed with 0.5 ml of a 2X Hepes solution (2 80 mM NaCl, 50 mM Hepes and 1.5 mM Na2HP04, pH 7 · 0), and equal amounts of 2X CaC12 (250 mM CaCl2 and 10 mM Hepes, pH 7 · 0) were added. A white granular precipitate will be produced after 30-40 minutes. The cells will be evenly distributed on the cells and can be cultured at 37 ° C for 4 to 16 hours. The medium was removed and the cells were impacted with 15% glycerol in PBS for 3 minutes. After the glycerin was removed, the cells were supplied with Dulbeco's Minimal Essential Medium (DMEM) containing 10% calf serum. __-14-Private scale standard (CNS) A4 specification (21GX297 public attack) Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 1245503 A7 B7 5. Description of the invention (12) DNA can also be worn by the following methods Dye: Kimura et al., Virology, 49: 394 (1972) and Sompayrac et al., Proc. Natl.

Acad. Sci. USA 78: 7575 (1981) Dextran method; Potter, Proc. Natl. Acad. Sci. USA 81: 7161 (1984) Electropenetration method; and Sandri-Goddin et al.? Molec, Cell, Biol., 1: 743 (198 1) protoplast fusion method. Amidine chemistry in the solid phase is the preferred method for the organic synthesis of oligodeoxynucleotides and polydeoxynucleotides. In addition, many other organic synthesis methods are available. These methods can be easily modified by those skilled in the art to suit the particular sequence of the invention. The invention also includes nucleotide molecules that hybridize under standard conditions to any nucleic acid sequence encoding a LIM mineralization protein of the invention. "Standard hybridization conditions" will vary with probe size, background conditions, and nucleic acid reagent concentration, and the type of hybridization, such as in situ, south blotting, or DNA-RNA hybridization (northbound) Ink-spot dip method) will also affect. "Standard crossbreeding conditions" depends on the level of knowledge of the artist. See, for example, U.S. Patent No. 5,580,775 to Fremeau et al., Which is hereby incorporated by reference. See also Southern, EM, J. Mol. Biol., 98: 503 (1975), Alwine et al., Meth. Enzymol., 68: 220 (1979), and Sambrook et al., Molecular Cloning: A laboratory Manual , 2nd edition, pp. 7.19-7.50, Cold Spring Harbor Press (1989) o A set of better standard hybridization conditions for a diluent at 42 ° C, 50% formamidine, 5X SSPE (150nM NaCl, 10mM NaH2P04 [pH7.4], ___ Applicable for this paper size® National Standard (CNS) A4 Specification (210X297 mm) (Please read the precautions on the back before filling this page)

, 1T

1244503 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Invention Description (13)

ImM EDTA [pH8.0], 5X Denhardt's solution (20 mg Ficoll, 20 mg polyvinylpyrrolidone and 20 mg BSA per 100 ml of water), 10% dextran, 1% SDS and 100 // g / ml salmon sperm DNA, ex heterozygous for 2 hours. A radioactive phosphorus 32p-labeled cDna probe was added, and the heterofather continued for 14 hours. Afterwards, the stain was washed twice with 2χ sspE, 0.1% SDS at 22 C for 20 minutes. Then wash with 0.1 χ ssPE, 0.1% SDS for one hour. The stain was then dried and placed on a sensitizing screen to expose the X-ray film for 5 days. Under "stringent conditions", if the two sequences are substantially the same, the probe will hybridize to the target sequence. As in the case of standard hybridization conditions, it is known to have this technical level and specific experimental nature. The artist may determine an environment in which only substantially identical sequences can hybridize. Another aspect of the present invention includes a protein encoded by a nucleic acid sequence. In another embodiment, the present invention relates to the identification of such proteins with anti-LMP antibodies. In this example, a protein sample is prepared by thawing the cells and separating the protein by SDS-PAGE using a western blot analysis. The protein is such as Ausubel et al., Current Protocols

John Wiley and Sons. Was electromigrated to nitrocellulose filter paper. After masking the filter paper with instant low-fat milk powder (lgln in 100 mpbs), anti-LMP antibodies were added to the filter paper and incubated at room temperature for 1 hour. After the filter paper was thoroughly washed with phosphate buffered saline (PBS), it was incubated with horseradish peroxidase (HRP0) -antibody complex for one hour at room temperature. The paper was thoroughly washed again with PBS and the antibody bands could be identified by the addition of diamine benzene (dab). (Please read the notes on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1244503 A7 B7 V. Description of the invention (14) A single specific antibody is the reactant selected in the present invention, and is used to analyze the special characteristics of the cells in the affected area related to the expression of LMP. As used herein, a "single specific antibody" is defined as a single antibody species or a multiple antibody species with homologous binding characteristics to LMP. As used herein, "Homogeneous bind" means the ability of the antibody species to bind to a specific antigen or epitope, such as those associated with LMP as previously described. Monospecific antibodies to LMP are purified from mammalian antisera containing antibodies raised against LMP, or are prepared by reacting monoclonal antibodies with LMP using the techniques of Kohler and Milstein, Nature, 256: 495-97 (1975). In immunized animals such as mice, brown rats, guinea pigs, mice, and horses, the LMP-specific antibody will be increased at an appropriate concentration of LMP with or without an immune adjuvant. In this method, immune serum is collected before the first immune response is initiated. Individual animals receive 1 >] \ 4? From about 0.011 to about 1000 ?, and an acceptable immune adjuvant may be added if necessary. Such acceptable immune adjuvants include Freund's complete adjuvants, Freund's incomplete adjuvants, Mingli Shendian reaction, water-in-oil emulsions containing Corynebacterium and tRNA adjuvant. The initial immune response involves injecting LMP into several sites, either subcutaneously (SC) or intraperitoneally (IP) in a preferred adjuvant with Freund's complete adjuvant. Each animal is bled at regular intervals (preferably one week) to determine antibody titer. The animal may or may not require additional injections after the initial immune response. Those animals receiving additional injections are usually given the same amount of antigen in Freund's incomplete adjuvant in the same way. Additional injections are taken at intervals of about three weeks until the maximum is achieved. -17- This paper size applies the Chinese National Standard (CNS) A4 size (210X297 mm) (Please read the precautions on the back before filling this page)

, 1T

1244503 A7 ______B7_ 5. Description of the invention (15) Application after potency. Seven days after each additional immune response or approximately one week after a single immune response, the animals were bled, and serum was collected and stored at -20 ° C. Monoclonal antibodies (mAb) that react with LMP, printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, are prepared by immunizing pure mice (preferably Balb / c mice) with LMP. The mice were combined with 11 > and 8 (:: injected about 0.111 ^ to 1011 ^ (preferably 111 ^) 1 ^? In 0.51111 buffer or salt into an equal volume as discussed above. Among the accepted adjuvants, complete fat adjuvant is preferred. The mice receive an initial response at the 0th day and then continue for 3-30 weeks. The immunized mice are given one or more times of about 0 to 10 mg dissolved in For example, an additional injection of LMP in a buffer solution of phosphate buffered saline (IV). Lymph globules from antibody-positive mice, preferably spleen lymphocytes, are removed by mid-range with a conventional technique. Obtained from the spleen of mice. It is prepared by mixing spleen lymphocytes with an appropriate fusion partner, preferably myeloma cells, under conditions that allow it to form a stable fusion tumor. The fusion partner can include, but is not limited to, mouse myeloma P3 / NS1 / AG4-1; MPC-11; S-1 94 and Sp 2/0 'Sp 2/0 is preferred. Antibody-producing cells and fused tumor cells are fused in about 1000 mol.Wt · polyglycerol, Its concentration ranges from about 30% to 50%. Fusion fused tumor cells are grown by secondary methods in a manner known in the art. Dulbecco's Modified Eagles Medium (DMEM) supplemented with purine, adenosine, and aminopterin was selected as one of the choices. On the 14th, 18th, and 21st, there was growth on its own Supernatants were collected from the culture wells of the reaction and used for immunological analysis, such as solid-phase immunoradioassay with LMP as antigen to screen for antibody production. The culture fluid was also tested using Uchterlonynyl lake analysis _________ -18- The paper size is suitable for financial and financial counties (CNS) A4 size (210X297 mm) ------ 1244503 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of invention (16) to determine mAb Isotype antigens. Fusion tumor cells taken from antibody-positive reaction wells use soft agar technology such as MacPherson, "SoftAgar Technique" in Tissue Culture Methods and Applications, Kruse and Paterson (eds), Academic Press (1973). Also available See Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Laboratory (1988). Monoclonal antibodies can also be injected by injection of about 0.5 ml per mouse for about 2 x 106 to about 6 days after treatment. x106 fusion tumor cells to isoctadecane-treated Balb / c mice. Ascites was collected about 8-12 days after the cells were injected, and monoclonal antibodies were purified by methods known in the art. The production of anti-LMB mAb in vivo is performed by culturing the cell line in DMEM containing 2% calf serum to obtain a sufficient amount of specialized mAb. The mAb is purified by techniques known in this art. The antibody titer of ascites or fusion tumor culture fluid can be determined by different serum or immune tests, including Shen Dian method, passive agglutination method, enzyme linked immunoabsorption assay (ELISA) and radioimmunoassay (RIA) and other technologies . Similar analysis is used to determine the presence of LMP in body fluids or tissues and cell extracts. For those skilled in the art, the method described above for the production of a single specific antibody can also be used to make antibodies specific for LMP multiple fragments, full-length primary LMP multiple clones, or variants or dual genes. The 10-4 / RLMP sample stored in the vector named pCMV2 / RLMP (the vector pCMV2 / RLMP inserted into the 10-4 selection strain / RLMP) was deposited at the American Type Culture Center on July 22, 1997 ( ATCC), 12301 _-19- This paper size is applicable _ National Standard (CNS) A4 size (210X297 mm) (Please read the precautions on the back before filling this page) Order

1244503 A7 B7 V. Description of the invention (18) ~ all the time-Example 1: _ Guding cell culture of brown rat rat cranial apical cells, also known as brown rat rat osteoblasts ("R0B"), as described earlier by 20 days before delivery Obtained from the brown house rat, Bodenet al., 137 (8): 3401-07 (1996). When the primary culture cells grow to confluence (after 7th day), trypsinize them and transfer them to a six-well culture plate (lx105 cells / 35mm well) as the first subculture cells. At the 0th hour, it is fused to allow it to continue to grow at 7th day. At the beginning of the 0th day ', the culture medium was changed in a laminar flow purification table every 3 or 4 days and treated with Trm and / or BMPs. The standard culture procedure is as follows: days 1 to 7, mem, 10% FBS, 50 // g / ml ascorbic acid, soil stimulation; days 8 to 14, BGJb medium, 10% FBS, 5mM y3-GlyP (used as Source of inorganic phosphorus for mineralization). End point analysis of skeletal segment formation and osteocalcin secretion was performed on the 14th day. The BMP dose of 50 ng / ml was determined according to this system's guided trial showing moderate effects in the dose-response curves studied for all BMPs. Example 2: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economics of Anti-Information Processing and Cell Culture —: -I-; —- # 1— (Please read the precautions on the back before filling this page) The possible functional role of LMP-1 during the formation of osteoid bone. We synthesize anti-messaging nucleotides to block the transcription of mRNA, and then process it only through secondary osteoblast culture induced by glucocorticoids. Inhibition of RLMP expression is associated with a highly specific anti-message oligonucleotide (with no significant homology to the sequence of a known brown rat mouse), which is related to a 25bp sequence (sequence identification number 35). The cultures in the control group either received no oligonucleotides or received message oligonucleotides. The experiments were performed with or without Lip 〇feet amine (pre-cultivation) and without Lip Philip ___- 21 -__ This paper size applies the Chinese National Standard (CNS) A4 (210X297 mm) 1244503 A7 B7 Central Standard of the Ministry of Economic Affairs Printed by the Bureau's Consumer Cooperatives V. Description of Invention (19) It is implemented in the case of wheat. Briefly, 22 / g message or anti-message RLMP nucleotides were incubated in MEM for 45 minutes at room temperature. After incubation, either more MEM or pre-incubated Lipofime / MEM (7% v / v; incubation at room temperature for 45 minutes) was added to reach a nucleotide concentration of 0.2 // M. As a result, the mixture was incubated at room temperature for 15 minutes. The oligonucleotide mixture was then mixed with the appropriate medium (ie MEM / ascorbate / Trm) to reach a final oligonucleotide concentration of 0.1 μM. Cells are cultured in the appropriate medium (soil-stimulated) with or without the appropriate oligonucleotides. The culture originally cultivated with Lipophyllum was given for four hours (37 ° C; 5% C02) and then given a medium that did not contain Lipophyllum and oligonucleosides. All cultures, especially those with oligonucleopic acid, were replenished with culture medium every 24 hours to maintain the level of oligonucleotides. LMP-1 anti-mesosine nucleic acid inhibits the formation of mineralization segments and osteocalcin secretion in a dose-dependent manner, similar to the effects of BMP-6 oligonucleotides. Anti-message LMP-1 hindered osteoblast differentiation cannot be rescued by adding exogenous BMP-6. However, inhibition of BMP-6 anti-message nucleotides can be restored by adding BMP-6. This experiment further verified that LMP-1 is upstream of BMP-6 in the osteoblast differentiation pathway. The LMP-1 anti-message oligonucleotide also inhibits spontaneous osteoblast differentiation in primary brown rat osteoblast cultures. Example 3: Quantification of the formation of mineralized bone segments ROBs prepared according to Examples 1 and 2 were cultured and fixed in 70% ethanol overnight, and stained with von Kossa sliver stain. Applicable to China National Standard (CNS) A4 specification (21 OX297 mm) (Please read the precautions on the back before filling out this page) Clothing, 11 1244503 Printed by A7 B7, Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 20) Color. A semi-automated computerized image analysis system was used to measure the number of bars and area in each well, Boden et al., Endocrinology, 137: 3401 · 07 (1996). These values are divided by the area value that accounts for each bar. This automated process is effective compared to the manual calculation technique and presents a correlation coefficient of 0.92 (p < 0 0000001). All data calculated from 5 to 6 wells under the parent conditions are expressed as mean ± standard deviation (S.E.M) of the mean. Each test was confirmed at least twice using cells taken from different cranial preparations. 4: The level of osteocalcin in the culture medium of osteocalcin is measured by using a competitive radioimmunoassay method, which has been cultured in our laboratory as described in Nanes et al., 127: 588 (1990) Corresponding to a single specific polyclonal antibody (Pab) at the C-terminus of osteocalcin nonapeptide in brown mice. In short, i // g nonapeptide was basicized with lmCi125I-Na by the lactate peroxidase method. Test tubes containing 200 // 1 analysis buffer (0.02M sodium filling, lmM EDTA, 0.001% ethylmercury thiosalicylate, 0.025% BSA) were added to the cell culture sensation buffer in each test tube. 〇 Sichuan bone calcium standard solution (0-12,000 plus 016). Next, Pab (1: 40,000; 100 " 1) was added, and then an iodinated version (12,000 cpm; 100 chuan) was added. Non-specifically bound samples are prepared similarly but contain no antibodies. The bound and free Pabs were isolated by adding 700 // 1 goat anti-immunoIgG IgG 'and incubating at 4 ° C for 18 hours. After the samples were centrifuged at I200 rpm for 45 minutes, the supernatant was decanted and the pellet was counted in a gamma counter. The value of osteocalcin is put forward as fmole / 1〇〇 // 1, _ -23- This paper size applies the National Standard (CNS) A4 size (210x297 mm) (Please read the precautions on the back before filling (This page)

(5) Invention description (21) It can be converted to pmole / ml medium (three-day yield) by dividing these values by 100. The value of three tests in 5 to 6 wells taken under each condition is expressed as the average technique. Each-test uses cells from different cranial preparations and is confirmed at least twice. The effects of unstimulated cell culture lines, in-system messages, or anti-message oligos on the total production of bone segments have a significant effect. However, when the ruler was stimulated by Trm, the anti-message sequence inhibited the mineralization of RLMp by more than 95 / 〇. Exogenous addition to the nucleotide-treated culture failed to restore mineralization of the RMLP-anti-message nucleotide_treated bone segment. Osteocalcin has long been synonymous with bone mineralization, and osteocalcin levels have also been linked to bone segment production and mineralization. The RLMp_reverse message nucleotide significantly reduced the production of osteocalcin, but the number of bone segments did not change significantly in the reverse message-processing. In this case, the addition of exogenous BMP-6 only restored 1 (M 5% of the production of osteocalcin in the RLMp_anti-message-processing culture. This implies that the role of RLMP is downstream of BMp_6 and the driver is more efficient. Example 6: Collection and purification of RNA from ROBs (prepared in a six-well culture dish according to Examples 1 and 2) The RNA in the cells in the culture wells was treated with 4M isothiocyanate guanidine (GIT) solution. A triple solution was generated and collected. In short, the culture supernatant was aspirated from the wells, and then the harvest of each two wells was covered with a 0.11 solution of 0.61111. After the GIT solution was added, the culture was swirled for 5 to 10 seconds (consistent as much as possible). Samples should be stored at -70 ° C for up to 7 days before proceeding to the next step. __- 24- This paper size is suitable for wire cutting (CNS) A4 size (210X297) (B) Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1244503 A7 B7 V. Description of invention (22) RNA based on Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd ED ·, chapter 7.19, Cold Spring Harbor The Press (1989) standard method was purified with minor modifications. The iced samples were added with 60 // 1 2.0M sodium acetate (Ph4.0), 550 / d phenol (water saturation), and 150 // 1 chloroform: isoamyl alcohol (49: 1). After shaking, The sample was centrifuged (1000xg; 20 minutes; 4 ° C), the liquid phase was transferred to a new tube, 600 // 1 isopropanol was added to the RNA precipitate at -20 ° C overnight. After overnight incubation, the samples were centrifuged (10,000 xg; 20 minutes) and the supernatant was gently aspirated. The pellet was resuspended in 400 // 1 DEPC-treated water with phenol: chloroform (1: 1) Extract once, then extract with isoamyl alcohol (24: 1), add 40 // 1 sodium acetate (3.0M; Ph5.2) and 1.0ml of absolute alcohol, and then overnight at -20 ° C. In order to collect cellular RNA The sample was centrifuged (10000 X g; 20 minutes), washed once with 70% ethanol, air-dried for 5-10 minutes, and then resuspended in 20 // 1 of 0 £? (3 treated water. ^^ eight concentration Calculated from the optical density measured with a spectrophotometer. Example 7: Total RNA heated by reverse transcription polymerase chain reaction (5 / ig dissolved in 10.5 // 1 total capacity of DEPC-H20 at 65 ° C for 5 Minutes) was added containing 4 // 1 5X MMLV-RT buffer, 2 with 1 dNTPs, 2 // l Dtl7 primers (10 pmol / ml), 0.5 / d RNAsin (40 U / ml) and 1/1 MMLV-RT (200 units / μΐ). The sample was incubated at 37 ° C for 1 hour and then at 95 ° C for 5 minutes to activate MMLV-RT. The sample was diluted with 80 // 1 of water.

The reverse transcribed samples (5 // 1) were subjected to polymerase chain reaction using standard methods (50 // 1 total volume). In short, the sample is added with water and an appropriate amount of PCR -25- _ This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions for ^ Ag before filling this page) Order 1244503 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the Invention (23) Buffer, 25mM MgCl2, dNTPs, which can be used for glyceraldehyde 3-phosphate dehydrogenase (GAP, internal gene) and / or BMP-6 forward and reverse primers, 32P-dCTP and Taq polymerase. Unless otherwise mentioned, primers will be standardized for a continuous 22 cycles (94 ° C, 30 "; 5 8 ° C, 30"; 72 ° C, 20 >. Example 8: By Polyacrylamide Gel Quantify RT-PCR products by electrophoresis (PAGE) phosphorescence image analysis. Add 5 chuanxiong to each tube and mix the dye with the RT-PCR product, mix, heat at 65 for 10 minutes and centrifuge. Take 10 // 1 of each reaction at PAGE was performed under standard conditions (12% Polyacrylamide: bis; 15V / well; stable current). The gel was placed in storage buffer (10% v / v glycerol, 7% v / v acetic acid, 40% methanol, 43% deionized water) for 30 minutes, dried in vacuum (80 ° C) for 1_2 hours and then developed with an electron-enhanced phosphorescence imaging system for 6-24 hours. Visible bands are analyzed. Each The count of one band will be plotted. Example 9: Differential display PCR RNA was extracted from cells stimulated with glucocorticoids (Trm, 1 nM). Total RNA (5 // g) treated with DNase was heated DEPC-water dissolved in a total volume of 10.5 // 1 was heated to 65 ° C for 5 minutes) reverse transcription was performed as described in Example 7, but Η-ΤηΜ (sequence discrimination No. 4) was used as the MMLV-RT primer. As a result, the cDNA was PCR-amplified as described above, but using different commercial primer combinations (eg, Η-ΤηΜ (sequence identification number 4) and Η-ΑΡ-10 ( Sequence identification number 5); GenHunter Corp, Nashville, TN). Radiolabeled PCR products were gel electrophoresed on -26- This paper is sized to the Chinese National Standard (CNS) A4 (210 X 297 mm)丨 丨. ^ (Please read the notes of Beishu before filling this page)

1T 4 1244503 A7 B7 V. Description of the invention (24) DNA sequencing gel separation. After electrophoresis, the gel was dried in vacuum and then autoradiographed and exposed overnight. The difference that appeared was that the cDN A band was removed from the gel by PCR using the method of Conner et al., Proc. Natl. Acad. Sci. USA, 88: 278 (1983). The PCR-increased product was cloned into the vector PCR-II (TA clonning kit, InVitrogen, Carlsbad, CA). Example 10: UMR 106 Brown Rat Mice Skull Parietal Cell cDNA Gene Bank. Please read the precautions on the back before filling this page) UMR106 gene library (2.5xl010pfu / ml) 5xl04 pfu / ml Cover the agar plate (LB-based agar), and the culture plate is incubated overnight at 37 ° C. The filter paper film was laid on the chassis for two minutes. The filter paper was removed and immediately denatured, rinsed, dried, and UV crosslinked. The filter paper was incubated in a pre-hybridization buffer (2X PIPES [pH 6.5], 5% formamidine, 1% SDS and 100 / g / ml denatured salmon sperm DNA) at 42 ° C for 2 hours. A radiolabeled probe with 260 base pairs (sequence identification number 3, randomly labeled as 32P) was added to the entire hybridization mixing / filter paper, followed by hybridization at 42 ° C for 18 hours. The film was washed once at room temperature (10 minutes, lx SCC, 0.1% SDS) and then three times at 55 ° C (15 minutes, 0.1x SCC, 0.1% SDS). After cleaning, the film was washed as described above. Analysis of automatic development methods. The positively-selected colony is the part that is phagocytosed. This step was repeated with a second filter paper for four minutes to reduce false positive reactions. The plaque-culled selection strains were collected as lambda SK (-) phage bodies. The selected cDNA was sequenced as described below. Example 11: Sequencing of selected plants-27- This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 1245503 A7 A7 B7 V. Description of the invention (25) The selected cDNA inserts were sequenced using standard methods. Ausubel et al., Current Protocols in Molecular biologv, Wiley Interscience (1988). In short, the final mixture, model, and reaction mixture at appropriate concentrations go through an appropriate cycle step (95 ° C, 30s; 68 ° C, 30s; 72 ° C, 60s; x 25). The termination mixture was added to end the sequence reaction. After heating to 92 ° C for 3 minutes, the sample was packed into a 6 ° / ° polypropylene aramid sequencing gel (29: Γ polypropylene gel: bis-polypropylene gel). The samples were electrophoresed at 60 volts for 4 hours under steady current. After electrophoresis, the gel was dried in vacuum and automatically radiographed. Autoradiography is performed by hand for analysis. The result sequences were screened and compared using the BLASTn program with default parameters compared to the database maintained by the National Center for Biotechnology Information (NIH, Bethesda, MD; http: /www.ncbi.nim.nih.gov/) . Based on the sequence data, new sequence primers are prepared and the procedure is repeated until the entire gene has been sequenced. All sequences were confirmed at least three times in both directions. Nucleic acid and amino acid sequences were also analyzed using the p C GENE software package (version 16.0). The nucleotide sequence homology percentage value is calculated by the program NALIGN, using the following parameters: unpaired nucleotide weight, 丨 0; unpaired gap weight '10; maximum number of related nucleotides, 50; Minimum number of related nucleotides, 50. Percent homology values for amino acid sequences are calculated in PaLIGN. A value of 10 is selected as both the open gap value and the unit gap value. (Please read the notes before filling in this page)

, 1T

1244503 A7 B7 printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the Invention (26) Example 12: jH of RLMP cDNA Band. This sequence was used to screen the cDNA library of the brown rat osteosarcoma (UMR 106). Positively selected clones were subjected to set primer analysis to obtain primer sequences that must be used to increment the full-length cDNA (Sequence Identification Numbers 11, 29, 30, and 31). One of the positive-response colonies selected for further research was named colony 10-4. Sequence analysis of the full-length cDNA in the selection strain 10-4 was analyzed by using a set of primers, and it was shown that the selection strain 10-4 contained the original 260 base pair fragment identical to the differential expression PCR. The selected strain 10-4 (1969 base pairs; sequence identification number 2) contains an open read frame of 1371 base pairs which encodes a protein (sequence identification number 1) of 457 amino acids. The termination code, T (JA, was born at 1444-1446. The polyadenosine signal is located at nucleotides 1675-1680 'and is adjacent to the poly (A) + tail appears at the 3, terminal region. There are two The possible N-glycosylation positions, Asn_LyS_Thl ^ Asn_Arg-Thr, are located at the amino acid positions 113-116 and 257-259 in the sequence identification number, respectively. Two possible () eight] ^? And (^) ^ [? Dependent protein kinase phosphorylation positions, Ser and Thr, were found at amino acid positions 191 and 349, respectively. There are five possible protein kinase c phosphorylation positions, Ser and Thr 'are located at the amino group. The acid position is 3, 11 5, 166, 21, 9, 442. A possible ATP / GTP binding position structural element, Gly-Giy_Ser-Asn-Asn-Gly-Lys-Lys-Thr, is at the amine position 272-279 In addition, two putative LIM domains and other known LIM proteins retained in this newly identified cDNA clone of the brown house mouse _ -29- (CNS) A4 Specification (210X297 Meal) (Please read the notes on the back before filling this page) Order 4 1244503 A7 B7 27 V. Invention The LIM domain shows considerable homology. However, the overall homology is less than 25% compared to other brown domestic rat LIM proteins. RLMP (also known as 10-4) has a human engima The protein has 78.5% amino acid homology (see U.S. Patent No. 5,504,192), but its closest brown house mouse homologs, 0 ^ -3 6 and 1111 ^ 18, have only 24.5% and 22.7% amines, respectively. Homology of amino acids.: Analysis of RLMP-emerged northbound blotting staining. Prepared according to Examples 1 and 2. Take 30 / ig from the total RNA of ROBs on a 1% agar plate gel and separate by formaldehyde gel electrophoresis according to size. Osmotically transferred to the nylon film. The stain was detected with a 600 base pair, and the test base pair was an EcoRl fragment of a full length 10-4 cDNA labeled with 32P_dCTP by chance primer method. Stain analysis showed that a class of 17 kb mRNAs could hybridize with RLMP probes. RLMP was increased by about 3.7-fold in ROB 24 hours after exposure to bmP-6. No increase in RLMP was demonstrated by BMP-2 or BMP- 4 Observed in ROBs 24 hours after stimulation. F _1 column 14: Unified to each proposed bone segment / Calcium results. Data from 5-6 wells from a typical test are used to calculate the mean ± SEM. The graph can be used to show the data after normalizing the maximum value of each parameter to allow the number of bone segments, The area of mineralization and the mapping of osteocalcin exist simultaneously. For each of the reports submitted for RT-PCR, RNase protection assay or western blot analysis, obtained from three repeated sample data from a typical test (please read the precautions on the back before filling this page)

Printed by 1T Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs

1244503 A7 B7 5. Description of the invention (28) It is used to determine the average value S.E.M. The graph can show the normalization of day 0 or negative control and it can be expressed as a multiple of the control value. Statistical significance was corrected using Bonferroni's one-way analysis of variance and post-hoc duplex comparison correction. DV Huntsberger, "The Analysis of Virance", in Elements of Statistical Variance, P. Billingsley (ed.), P. 298-330, Allyn & Bacon Inc., Boston, MA (1997) and Sigmastat, Jahdel Scieiitific, Corte Madera, CA. Significant Alpha is defined as p < 0.05. Example 15: Detection of LIM mineralization protein in brown domestic rat by Western blot analysis. According to England et al "Biochim. Biophys. Acta, 623: 171 (1980) and Timmer et al.m J. Biol · Chem · , 268: 24863 (1993). Preparation of multiple antibodies. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). HeLa cells were transfected with PCMV2 / RLMP. ). According to the method of Hair et al ·, Leukemia Research, 20: 1 (1996), the protein produced from the transfected cells was collected. The original western blot analysis of RLMP such as Towbin et al ·, Proc · Natl · Acad · Sci · The method described in USA, 76: 4350 (1979) was performed. 6: Synthesis of human PCR product derived from LMP-Unique (RLMPU) derived from Mus musculus, according to the sequence of Mus musculus LMP-1, forward and reverse PCR Primers (Sequence Identification Numbers 15 and 16) were synthesized and a unique 223 base pair sequence was amplified by PCR using the brown rat LMP-1 cDNA. A similar PCR product was isolated from human MG63 flesh with the same PCR primers Nodules ___ -31-This paper size applies to the national standard (CNS) a4 specifications ( 210X297 mm) 1244503 A7 B7 V. Description of invention (29) cells. RNA obtained from MG63 osteosarcoma cells was grown in T-75 flasks. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back first) (Fill in this page again) The culture supernatant was removed by extraction and the flask was filled with 3.0 ml of GIT solution / each copy, vortexed for 5-10 seconds, and then the solution was transferred to a 1.5 ml eppendof test tube ( 5 test tubes, 0.6ml / test tube). RNA was purified by a slightly modified standard method, see, for example, Sambrook et al., Molecular Coining: A Laboratory Manual, chapter 7, page 19, Cold Spring Harbor Laboratory Press (1989) And Boden et al., Endocrinology, 138: 2820-28 (1997). In short, '60ml / 1 sample was added with 2.0M sodium acetate (Ph4.0) at a concentration of 60 // 1, saturated at 55 0 / d. Combined phenol and 150 / d chloroform: isoamyl alcohol (49: 1). After adding these reactants, the sample was shaken and the liquid phase was centrifuged (10,000 x g; 20 minutes; 4C) and transferred to a new tube. Isopropanol (600 chuan) was added and the RNA was at .20. (3 sediments were left overnight. After centrifugation (10,000 xg; 20 minutes), the supernatant was gently aspirated. Shen Dianwu was resuspended in 400 Sichuan DEPC-treated water and extracted once with phenol: chloroform (1: 1). Extraction by gas imitation: isoamyl alcohol (24: Ό, extract once at -20. (3 times at 40 with 1 sodium acetate (3.〇] ^;? 115.2) and 1.〇1111 in absolute alcohol overnight. After the sinking, the sample was centrifuged (100 × g; 20 minutes), washed once with 70% alcohol, air-dried for 5-10 minutes and resuspended in 20 / d DEPC-treated water. The RNA concentration was derived from the optical density. Total RNA (5 // g dissolved in 10.5 μί total volume of DEPC-H20) was heated to 65 ° C for 5 minutes' and then added to 4 " 1 5X MMLV-RT buffer, 2 " 1 dNTPs, 2 / / 1 dtl7 primer (10 pmol / ml), 0.5 " 1 RNAsin -32- National National Standard (CNS) A4 specification (210X297 male diamond) 1244503 A7 B7 V. Description of the invention (30) (40U / ml) and l / zlMMLV-RTpOOunits / el) in a test tube. The reaction was incubated at 371 for one hour. Then, heated to 95 ° C for 5 minutes to inactivate MMLV-RT. Samples were added to 80 pL of Water dilution. Transcription samples (5 chuan) were subjected to polymerase chain reaction using standard methods (50 // 1 total volume). Boden et al., Endocrinology, 138: 2820-28 (1997); Asubel et al., "Quantitation of rare DNAs by the polymerase chain reaction ", in Current Protocols in Molecular Biology, chapter 15.31-1. Wiley & Sons, Trenton, NJ (1990). In short, the sample was added to a PCR buffer containing water and an appropriate amount (25 mM MgCl2, dNTP, forward and reverse primers (for RLMPU, sequence identification numbers 15 and 16) 32P-dNTPs and DNA polymerase. Primers are designed to continuously perform 22 cycles for radioactive bands Measured and 33 cycles of PCR product increments were used as a screening probe (94 ° C, 30 seconds; 58 ° C, 30 seconds; 72 ° C, 20 seconds) ° Agar gel purified MG63 meat Osteoma-derived PCR product sequencing Given a sequence, it has more than 95% homology to the RLMP PCR product. This sequence was named HLMP unique region (HLMPU; sequence identification number 6). Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). Example 17: Screening of MG63 cDNA derived from inverse enzyme using specific primers as described in Example 7 (sequence identification number 16 and 17) PCR performed screening. The 717 base pair product was purified on agarose at 063 to 0 feet and sequenced with the given primers (sequence identification numbers 12, 15, 16, 17, 18, 27, and 28). The sequence is confirmed at least twice in both directions. The MG63 sequence maps to each other and maps the full-length L. musculus LMPcDNA sequence to obtain a portion of the human LMPcDNA sequence (Sequence Identification-33- This paper is in accordance with the Chinese National Standard (CNS) A4 specification (21 ×: 297 mm) ) 1244503 A7 B7 V. Description of the invention (31) Identification number 7). Example 18: Screening of the human heart CDNA library (please read the precautions on this page before filling out this page) Based on the north-point smear staining test 'The wrong organization determines the performance of LMP-1 at different levels, including Human heart cells. The human heart cDNA library was examined accordingly. The gene bank 5x104 pfu / 1 was placed on an agar culture plate (LB-based agar) and the culture plate was grown at 37 ° C. Filter and paper film were covered on the culture plate for two minutes. After that, the filter paper was denatured, rinsed, dried, UV crosslinked and pre-hybridized buffer (2χ pipes [ρΗ6.5 · 5; 5% formaldehyde, 1% SDS, 100 g / ml denatured salmon sperm DNA) at 42 ° C was incubated for two hours. A radiolabeled LMP-unique 223 base pair probe (32P, primer-initiated; sequence number 6) was added and hybridized for 18 hours at 42C. After hybridization, the film was washed once at room temperature (10 minutes, lx SCC, 0.1% SDS) and three times at 55 ° C (15 minutes' 0.1 x SCC, 0.1% SDS). The autologous radiographs were used to identify clones of the dual 1¼-response plaque purification gene bank. Lambda bacterial bodies were collected according to the manufacturer's manual (Stratgene, La Jolla, CA) 〇 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Cleavage of positively-selected clones resulted in cDNA insertions of different sizes. Inserted genes greater than 600 base pairs in length were selected to screen the starting position by a sequencing method. These inserted genes were sequenced using standard methods as described in the examples. The selected plant of No. 7 was also subjected to automatic sequence analysis using the primers of sequence identification numbers 11-14, 16 and 27. The sequence obtained in this way has a conventional homology of 97-100%. Colony No. 7 (part of human LMP-1 cDNA from the heart gene bank; sequence identification number 8) __ -34- This paper size applies to Chinese National Standard (CNS) A4 (210X297 public director) A7 1244503 B7 V. Description of the invention (32) Contained sequence which has greater than 87% homology to the sequence of the mouse LMP cDNA in the transcribed region. (Please read the note of ^ before filling this page) Example 19: Determination of the full-length human LMP-1 cDNA MG63 human osteosarcoma cell cDNA sequence and human heart cell gene bank cDNA clone 7 By arranging these two sequences, a complete 1644 base pair human cDNA sequence was derived. A program NALIGN in the PCGENE software package was used to arrange these two sequences. The two overlapping regions make up about 360 base pairs and have complete homology except one located at nucleotide position 672 of MG63 cDNA (sequence identification number 7) and the selected nucleotide 7 at related nucleotide position 516 (Sequence ID No. 8) There is a single nucleotide substitution of "A" in place of "G". Using another PCGENE subroutine SEQIN and replacing the "G" of the MG63 osteosarcoma cDNA clone, these two aligned sequences were linked. The resulting sequence is shown in sequence identification number 9. The alignment of this novel human-derived sequence with the brown rat MMP-1 cDNA was achieved by NALIGN. The full-length human LMP-1 cDNA sequence (sequence identification number 9) has 87.3% homology to the transcribed portion of the brown rat LMP-1 cDNA sequence. Example 20: Determination of the amino acid sequence of human LMP-1 The printed amino acid sequence of human LMP-1 by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs is determined by the subroutine TRANSL in PCGENE. A protein containing 457 amino acids (sequence identification number 10) is encoded in the open readable frame of sequence number 9. Using the PCGENE subroutine Palign, the human LMP-1 amino acid sequence was found to have 94.1% homology to the brown rat LMP-1 amino acid sequence. Example 21: Determination of the 5 'start untranscribed region of human LMP cDNA -35- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 1244503 A7 B7 V. Description of the invention (33 Please read the back first Note MG63 5 'cDNA is nested RT-PCR increments for MG63 using the 5' cDNA Rapid Increment (5'RACE) operating procedure. This method involves the use of anchor oligo (dT) primers and two at the 3 'end. First-strand cDNA synthesis of degenerate nucleic acid positions (Chenchik et al., CLONTECHniques X: 5 (1995); Borson et al.? PC Method of Gulber et al. 5 Gene 25: 263 (1983), and E. coli DNA Polymerase I, Rnase H, and E. coli ligase. After the blunt ends were created with T4 polymerase, the double-stranded cDNA was ligated to the fragment (5'_ CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGG GCAGGT-3,) (Sequence ID No. 19) Prior to RACE, the additional ligated cDNA was diluted to a concentration suitable for the Marathon RACE reaction (1:50). The additional ligated double-stranded cDNA can then be specially colonized. Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs System first The PCR uses the additional ligated oligonucleotide 5'CCATCCTAATACGACTCACTATAGGGC-3, (AP1) (^? J identification number 20) as the message primer and a unique region from the unique region described in Example 16 (HLMPU) Gene specific primers (GSP) are implemented. The second round of PCR uses nested primers GSP1-HLMPU (anti-message / reverse primer) (sequence identification number 23) and GSP2-HLMPUF (sequence identification number 24 (see example 16; message / forward primer) to perform. PCR uses a commercial set (Advantage cDNA PCR core kit; Clone Tech Laboratories Inc., Palo Alto, CA) which uses antibody-regulated but otherwise standard hot-start operating procedures to Implementation. The PCR conditions for MG63 cDNA include the initial thermal initiation of denaturation (94 ° C, 60 seconds), then -36- This paper size applies to the Chinese National Standard (CNS) Α4 size (210 × 297 mm) 1244503 Α7 Β7 V. Description of the invention (34 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs: 94 ° C, 30 seconds; 60 ° C, 30 seconds; 68 ° C, 4 minutes; 30 cycles ° The first round of PCR products Selected to be cloned into the linear pCR2.1 vector (3.9 Kb). This insert uses Ml3 forward and reverse primers (sequence identification number 11; sequence identification number 12) to sequence in both directions simultaneously. Example 22: Determination of the full-length human LMP-1 cDNA with 5 'UTR overlapping cDNA sequence 5'-UTR (sequence identification number 21) of MG63 human osteosarcoma cell, MG63 7Γ7 base pair sequence (real column 17; Sequence identification number 8) and human heart cDNA clone 7 sequence (Example 18) were arranged to derive a novel human cDNA sequence of 1704 base pairs (sequence identification number 22). This arrangement is done by NALIGN (PCGENE and OMIGA; 11 ^ 611 丨 86111: 丨 〇8). The overlapping sequences constitute a nearly complete region of 717 test base pairs (Example 17) with 100% homology. The alignment of the aligned sequences is done with SEQIN. Example 23: Construction of LIM protein expression vector Construction of the pHIS-5ATG LMP-ls expression vector was performed using the sequences described in Examples 17 and 18. This 717 base pair clone (Example 17; sequence identification number 7) was cut by Clal and EcoRV. Small fragments (~ 250 base pairs) are gel purified. Clonal strain 7 (Example 18; sequence identification number 8) was cut with Clal and Xbal and a 1400 base pair fragment was gel purified. The isolated 250 base pair and 1400 base pair restriction sites were ligated to form a ~ 1650 base pair fragment. As a result of the single nucleotide substitution (relating to the 717 base pair PCR sequence and the original brown house mouse sequence) in selection line 7, a terminator appeared at transcribed base pair 672. Due to this terminator, a truncated (short) protein is encoded. Because • 37- This paper size applies to the Chinese National Standard (CNS) A4 specification (210 X 297 mm) Please read the note page on the back 1245503 A7 B7 V. Description of the invention (35) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs This is called LMP-Is. This is the construct used in the expression vehicle (sequence identification number 32). A cDNA sequence with the full length of the 5'-end UTR (sequence identification number 33) was created by aligning sequence identification numbers 32 and 5, and the raCE sequence (sequence identification number 21). The amino acid sequence of the [ΜΡ-1S (sequence identification number 34) was then deduced into a 223 amino acid protein and confirmed by the westward blotting method (such as Example 15) that it would swim to ~ 23 7kD. Molecular weight position. 'pHis-ATG vector (InVitrogen, Carlsbad, CA) was cleaved with EcoRV and. The vector was retracted and the 1650 base pair restriction fragment was then ligated to the linear pHis_ATG. The ligated product is selected and then increased. This pHis-ATG-LMP-ls expression vector, also called pHIS-A with inserted HLMP-ls, was purified by standard methods. Yi J column 24: Bone with LMP expression vector in vitro and initiation of bone formation and mineralization 1 Induction of Guding cells from brown rat Mice according to Example 1 and growth in secondary culture. As described in Example 1, the culture was either unstimulated or stimulated with glucocorticoid (GC). According to Example 25-A modified SuperfectReagent (Qiagen, Valencia, CA) transfection procedure was used to transfect the vector 3 / ig / wells into the culture of the secondary brown house mouse gutal bone cells. The mineralization section was made visible as described in Example 3 using the Fanksha silver staining method. The product of overexpression of the human LMP-Is gene triggered the formation of bone nodules in vitro alone (~ 203 bone nodules / well). The level of the bone segment is almost 50% controlled by the GC (~ 412 bone segment / well). Other positive controls include pHisA-LMP-Rat expression vector (~ 152 bone segments / well) and pCMV2 / LMp_ -38- Please read the note item first

Revision: This paper size applies the Chinese National Standard (CNS) Α4 specification (210X 297 mm) 1244503 A7 B7 V. Description of the invention (36 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

Rat-Fwd expression vector (~ 206 bone segments / well), on the other hand negative control includes pCMV2 / LMP-Rat-Rev expression vector (~ 2 bone segment / well) and untreated (NT) culture plate (~ 4 Bone joint / well). These data show that human cDNA is at least as osteogenic as the brown house mouse cDNA. This effect is less than that observed in GC stimulation, most likely due to a suboptimal dose of the performance vector. Example 25: LMP-induced cell differentiation in vivo and in vitro LMP cDNA from brown house mouse was cloned in clone 10-4 (see Example. 12) by Notl and Apal at 37 ° C overnight with double-cleaving self-selection The plant cuts it. The vector pCMV2 MCS (InVitrogen, Carlsbad, CA) was cleaved with the same restriction enzyme. Linear cDNA fragments from selected strains 10-4 and pCMV2 were gel purified, extracted and ligated with T4 ligase. The ligated DNA was gel purified, extracted, and used to increase the number of transf.co./JM109 cells. Agar-selected strains with a positive reaction were selected, cut with Notl and Apal, and the cut at this restricted site was detected by gel electrophoresis. Stock cultures were prepared with positive-response selection strains. An opposite vector was prepared in a similar manner, except that the restriction enzymes used were Xbal and HINDIII. Because such a restriction enzyme was used, the LMP cDNA fragment from 0-4 was inserted into pRc / CMV2 in the opposite direction (that is, non-transcriptable). The resulting recombinant vector is called PCMV2 / RLMP. An appropriate volume of pCMV 10-4 (a final volume of 60 nM is most suitable for [3 / ig]; a concentration of 0-600 NM / well [0-3 0 // g / well] is better for this experiment) was Resuspend in minimal Iggs medium (MEM) to a final volume of 450 // 1 and shake for 10 seconds. Add Superfect (7.5 // l / ml final solution), 39 paper sizes are applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) Please read the note page 1245503 A7 B7 V. Description of the invention (37) This solution Shake for 10 seconds and incubate for 10 minutes at room temperature. After incubation, 10% FBS-containing MEM (1 ml / well; 6 ml / plate) was added and mixed with a pipette. As a result, the solution was then added dropwise (1 ml / well) with a pipette to the washed ROB culture. This culture was incubated at 37 ° C for two hours in humid air containing 5% CO2. The cells were then washed once with sterile PBS and the appropriate general medium was added. 'The results showed that pCMV 10-4 induced significant bone nodule formation in all brown house mouse cell cultures. For example, pCMV 10-4 transfected cells produced 429 bone nodules / wells. Positively controlled cultures exposed to Trni produced 460 bone nodules / wells. In contrast, no negative control of the treatment resulted in only 1 bone nodule / well. Similarly, no bone nodules were observed when the culture was transfected with pCMV 10-4 (reverse). In order to show the formation of new bones in the living body, bone marrow was extracted from the hind limbs of normal brown house rats (rnu / +; heterozygous recessive athymic conditions) 4-5 weeks old. The extracted bone marrow cells were washed in alaph MEM, centrifuged, and the pellet was resuspended in 10 mM Tris (Ph 7.4) 0.83% NH4C1 to be printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs.

..--------- Cloth — (Please read the precautions on the η side before filling in this page. J • Order · RBCs are lysed. The remaining bone acoustic cells are washed three times with MEM, and then every 3xl06 cells 9 // g pCMV-LMP-ls (forward or reverse) was transfected for two hours. The transfected cells were then washed twice with MEM and then reconstituted to a suspension of 3xl07 cells / ml. The cell suspension (100 chuan) was used to drop a sterile 2x5 mm type I bovine collagen disc (Sulzer Orthopaedics, Wheat Ridge, CO) with a sterile pipette. The disc was surgically implanted -40- A7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 1245053 ___ B7 V. Description of the invention (38) Enter the 4-5 week old athymic brown rat (rnu / rnu) under the skull, chest, and abdomen. It was cut after 3-4 weeks, at which time the disc or surgical site was removed and fixed in 70% ethanol. The fixed samples were stained with a Goldner Trichrome 5 // 1 thick section for radiography and were not removed. Histological analysis of calcification. The experiment also used deactivated (guanidine-extracted) demineralization bone matrix (Qs Tetech, Sherwsbury, NJ) was performed instead of collagen discs.. Radiography revealed a high level of mineralized bone formation consistent with the original collagen discs containing bone marrow cells transfected with LMP-ls. Under negative control (with no encoding) Non-mineralized bone formation was observed in the reversed version of a transcribed protein (LMP-ls cDNA cells were transfected), and the uptake of this carrier appeared to proceed smoothly. Histological methods revealed a new in LMP-ls transfection transplantation Skeleton trabeculae is full of osteoblasts. In the negative control group, no bone pathway was observed along with partial absorption of the carrier. In a further test of radiography in 18 groups of transplanted (9 groups of negative control pCMV-LMP -REV and 9 experimental groups (pCMV-LMP-ls) were added to one of the lumbar spine or thoracic spine of athymic mice, showing no skeletal formation (spine binding) between the spines in the 9 negative control transplants. PCMV_LMP- In all 9 groups treated with ls, solid bone fusions appeared between the spines. The sequence of PHIS-5 'ATG LMP-ls edge-generating vector shape shown in Examples 2 and 3 is shown in Figure 5 and 71. Selected strains (Example 17) with Clal and EcoRV ( New

England Biological, city, MA). A small snippet (~ 250 test basis one) 丨-_-41-This paper size is $? ^ National Standard (CNS) A4 specification (21〇χ297 mm)-aBMmm, a— · —— mu tm—β 11 1 · _Ϋ— immMmml i ^ i ^ i MammemB .ϋ- · —ΒΒϋ 一 > immt > ϋϋ Mmmmmt mu > 1 · — ·· — 11 · ttMKMf amMl ^ ϋ · — (Please read the note of ^ s first (Fill in this page again) f _ Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 1245503 A7 B7 V. Description of the invention (39) Pair) Gel purified. Breeding strain No. 7 (Example 18) was cut at ^ 1 and ^ 1. A fragment of 1400 test pairs was gel purified from this cut. The 250-base-pair and 1400-base-pair cDNA fragments that have been separated are joined by standard methods to form a 1,650-base-pair fragment. The pHIS-A vector (InVitrogen) was cleaved with and. The linear vector was collected and joined to a 1650 base pair chimeric cDNA fragment. The conjugation product was selected and increased in a standard manner, and the pHis-A-5, ATG LMP expression vector, also known as the pHis-A vector with the insertion segment HLMP-ls, was deposited with the ATCC as previously described. Example 27: Induction of bone nodule formation and in vivo tritiation of pHis_5, ATG LMP-Is expression vector in vivo. According to Example 1, Gut cells were isolated and grown in secondary culture. The culture was stimulated or not stimulated with glucocorticoid (GC) according to Example 1. This culture was grown as in Example 25 and transfected with recombinant pHis-A vector DNA 3 / ig per well. The mineralized section according to Example 3 can be observed with the Fanksha silver staining method. Individual overexpression of the human LMP-ls gene product in vivo (i.e., without GC stimulation) caused significant bone nodule formation (~ 203 nods / well). This is approximately 50% of Tsukishiro:!: Produced by exposing cells to positive control of GC (~ 412 bar / well). Similar results were obtained from cultures stained with pHisA-LMP-Rat expression vector (~ 152 bars / well) and pCMV2 / LMP-Rat-Fwd (~ 206 bars / well). In contrast, negative control of pCMV2 / LMP-Rat-Rev production (~ 2 Xiaolang / well) was observed in untreated culture plates, however, approximately 4 bone shouts / wells were observed. These data show that human LMP-1 cDNA is at least as osteogenic in this model system as the L. musculus LMP-1 cDNA. The effect in this experiment is less than that observed in the GC stimulation; but in some cases (please read the note of the noodles first * then this page)

, 1T

2445〇3 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. 5. Description of the invention (40: The effect of this place can be compared. UiH: LMP transparent ^ soluble bone rabbit hair factor ^^ As described in Example 24 in the brown home The overexpression of p. 1 or HLMP-ls in the culture of rat skull osteoblasts produced significantly more bone segment formation than that observed in negative immobilization. To study the activation mechanism of LIM mineralization protein At different time points, the conditioned medium was collected, concentrated to MX, sterile filtered, diluted to its original concentration in a medium containing fresh serum 'and used for unstained cells for 4 days. Taken from RLMP-i or On the fourth day, the conditioning medium of HLMP- 丨 transfected cells was approximately equivalent to the direct overexpression of rLMP-1 in transfected cells. Stained cells were conditioned in osteoblasts with no apparent potency. Conditioning media taken from LMP-1 transfection did not have osteoblasts. These data suggest that the expression of ^^ caused the synthesis of soluble factors and / or Secreted, the factor An influential quantity will not appear in culture until four days after dyeing. Due to the overexpression of rLMP-1, an osteoinductive factor is secreted into the culture medium. Westward blot analysis is used to determine whether rLMP-1 appears In culture medium. RLMP-1 protein was quantified using antibodies specific for LMP-1 (QDPDEE) and detected by conventional methods. LMP-1 protein was found in the cultured cell layer and not detected in the culture medium Partial purification of bone-induced soluble factors can be accomplished by passing standard 25% and 100% amine sulfate through a DE52 anion exchange batch chromatography (100 mM * 500 mM NaCl). Under high amine sulfate and high NaCl content All of the -43- only in the base (please read the precautions on the t side and then this page) The private paper size applies the Chinese National Standard (CNS) A4 specification (21 × 297 mm) 1244503

V. Description of the invention (factoriality was observed. Such a configuration is consistent with the possibility of adjustment. ≪ All of the citations from this time have been fully presented for reference. Although the explanation is used to provide explanation The examples teach the principle of the present invention. 'A variety of changes in form and details learned by the artist after reading this disclosure are not selected from the scope of the present invention. (Please read the precautions of the poor side before this page ) ▲ Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs -44-

1244503 V. Description of the invention (43) Arg Leu Gin Gly Gly Gly Lys Asp Phe Asn Val Pro Leu Ser lie Ser Arg 20 25 30 Leu Thr Pro Gly Gly Lys Ala Ala Gin Ala Gly Val Ala Val Gly Asp 35 40 45 Trp Val Leu Ser lie Asp Gly Glu Asn Ala Gly Ser Leu Thr His lie 50 55 60 Glu Ala Gin Asn Lys lie Arg Ala Cys Gly Glu Arg Leu Ser Leu Gly 65 70 75 80 Leu Ser Arg Ala Gin Pro Ala Gin Ser Lys Pro Gin Lys Ala Leu Thr 85 90 95 Pro Pro Ala Asp Pro Pro Arg Tyr Thr Phe Ala Pro Ser Ala Ser Leu 100 105 110 Asn Lys Thr Ala Arg Pro Phe Gly Ala Pro Pro Pro Thr Asp Ser Ala 115 120 125 Leu Ser Gin Asn Gly Gin Leu Leu Arg Gin Leu Val Pro Asp Ala Ser 130 135 140 Lys Gin Arg Leu Met Glu Asn Thr Glu Asp Trp Arg Pro Arg Pro Gly 145 150 155 160 Thr Gly Gin Ser Arg Ser Phe Arg lie Leu Ala His Leu Thr Gly Thr 165 170 175 Glu Phe Met Gin Asp Pro Asp Glu Glu Phe Met Lys Lys Ser Ser Gin 180 185 190 Val Pro Arg Thr Glu Ala Pro Ala Pro Ala Ser Thr lie Pro Gin Glu 195 200 205

-46- 1244503 V. Description of the invention (44) Ser Trp Pro Gly Pro Thr Thr Pro Ser Pro Thr Ser Arg Pro Pro Trp 210 215 220 Ala Val Asp Pro Ala Phe Ala Glu Arg Tyr Ala Pro Asp Lys Thr Ser 225 230 235 240 Thr Val Leu Thr Arg His Ser Gin Pro Ala Thr Pro Thr Pro Leu Gin 245 250 255 Asn Arg Thr Ser lie Val Gin Ala Ala Ala Gly Gly Gly Gly Thr Gly Gly 260 265 270 Gly Ser Asn Asn Gly Lys Thr Pro Val Cys His Gin Cys His Lys lie 275 280 285 lie Arg Gly Arg Tyr Leu Val Ala Leu Gly His Ala Tyr His Pro Glu 290 295 300 Glu Phe Val Cys Ser Gin Cys Gly Lys Val Leu Glu Glu Gly Gly Phe 305 310 315 320 Phe Glu Glu Lys Gly Ala lie Phe Cys Pro Ser Cys Tyr Asp Val Arg 325 330 335 Tyr Ala Pro Ser Cys Ala Lys Cys Lys Lys Lys lie Thr Gly Glu lie 340 350 345 350 Met His Ala Leu Lys Met Thr Trp His Val Pro Cys Phe Thr Cys Ala 355 360 365 Ala Cys Lys Thr Pro lie Arg Asn Ar g Ala Phe Tyr Met Glu Glu Gly 370 375 380 Ala Pro Tyr Cys Glu Arg Asp Tyr Glu Lys Met Phe Gly Thr Lys Cys 385 390 395 400 -47- 1244503 V. Description of the invention (45)

Arg Gly Cys Asp Phe Lys lie 405

Leu Giy Phe Ser Trp His Asp 420 lie Asn Leu Glu Gly Lys Thr

Asp Ala Gly Asp Arg Phe Leu Glu 410 415

Thr Cys Phe Val Cys Ala He Cys 425 430

Phe Tyr Ser Lys Lys Asp Lys Pro

Ala Gin Leu 445 435 440

Cys Lys Ser His Ala Phe Ser His Val 450 455 &lt; 210〉 2 &lt; 211 &gt; 1696 &lt; 212〉 DNA &lt; 213〉 Brown House Mouse &lt; 400〉 2 gcacgaggat cccagcgcgg ctcctggagg ccgccaggca gccgcccagc cgggcatcta cggggggtga gggggta gggggca ttggggcttc 120 cgtctgcaag ggggcaagga cttcaacgtg cccctctcca tctctcggct cactcctgga 180 ggcaaggccg cacaggccgg tgtggccgtg ggagactggg tactgagtat cgacggtgag 240 aacgccggaa gcctcacaca cattgaagcc cagaacaaga tccgtgcctg tggggagcgc 300 ctcagcctgg gtcttagcag agcccagcct gctcagagca aaccacagaa ggccctgacc 360 cctcccgccg accccccgag gtacactttt gcaccaagcg cctccctcaa caagacggcc 420 cggcccttcg gggcaccccc acctactgac agcgccctgt cgcagaatgg acagctgctc 480 agacagctgg tccctgatgc cagcaagcag cggctgatgg agaatactga agactggcgc 540 ccgcggccag ggacaggcca gtcccgttcc ttccgcatcc ttgctcacct cacgggcaca 600 gagttcatgc aagacccgga tgaggaattc atgaagaagt caagccaggt gcccaggaca 660 gaagccccag ccccagcctc aaccataccc gcccccccccccccccccccccc gcat ttgctgagcg ctatgcccca 780 gacaaaacca gcacagtgct gacccgacac agccagccag ccacacctac gcctctgcag 840 aaccgcacct ccatagttca ggctgcagct ggagggggca caggaggagg cagcaacaat 900 ggcaagacgc ctgtatgcca ccagtgccac aagatcatcc gcggccgata cctggtagca 960 ctgggccacg cgtaccatcc tgaggaattt gtgtgcagcc agtgtgggaa ggtcctggaa 1020 -48- 1244503 five described (46) invention gagggtggct tcttcgagga gaagggagct atcttttgcc cctcctgcta tgatgtgcgc 1080 tatgcaccca gctgtgccaa atgcaagaag aagatcactg gagagatcat gcatgcgctg 1140 aagatgacct ggcatgttcc ctgcttcacc tgtgcagcct gcaaaacccc tatccgcaac 1200 agggcjttct acatggagga gggggctccc tactgcgagc gagattacga gaagatgttt 1260 ggcacaaagt gtcgcggctg tgacttcaag atcgatgccg gggaccgttt cctggaagcc 1320 ctgggtttca gctggcatga tacgtgtttt gtttgcgcaa tatgtcaaat caacttggaa 1380 ggaaagacct tctactccaa gaaggacaag cccctgtgca agagccatgc cttttcccac 1440 gtatgagcac ctcctcacac tactgccacc ctactctgcc agaagggtga taaaatgaga 1500 gagctctctc tccctcgacc tttctgggtg gggctggcag ccattgtcct agccttggct 1560 cctggccaga tcctggggct ccctcctcac agtccccttt cccacacttc ctccaccacc 1620 accaccgtca ctcacaggtg ctagcctcct agccccagtt cactctggtg tcacaataaa 1680 cctgtatgta gctgtg 1696 &lt; 210> 3 &lt; 211 &gt; 260 &lt; 212> DNA &lt; 213 &gt; Rattus norvegicus &lt; 400> 3 ttctacatgg aggagggggc tccctactgc gagcgagatt acgagaagat gtttggcaca 60 aagtgtcgcg gctgtgactt caagatcgat gccggggacc gtttcctgga agccctgggt 120 ttcagctggc atgatacgtg ttttgtttgc gcaatatgtc aaatcaactt ggaaggaaag 180 accttctact ccaagaagga caagcccctg tgcaagagcc atgccttttc ccacgtatga 240 gcacctcctc acactactgc 260 &lt; 210 &gt; 4 &lt; 211> 16 &lt; 212 &gt; DNA &lt; 213> artificial sequence &lt; 220> &lt; 223> Difference display PCR primers <400> 4 aagctttttt tttttg 16 -49-1244503 V. Description of the invention (47) &lt; 210 &gt; 5 &lt; 211> 13 &lt; 212 &gt; DNA &lt; 213 \ artificial sequence &lt; 220 > &Lt; 223> differential display PCR primers &lt; 400> 5 aagcttggct atg 13 &lt; 210 &gt; 6 &lt; 211 &gt; 223 &lt; 212> DNA &lt; 213> brown house mouse &lt; 400> 6 atccttgctc acctcacggg caccgagttc atgcaagacc cggatgagga gcacc ag 60 aaatcaagcc aggtgcccag gacagaagcc ccagccccag cctcatctac accccaggag 120 ccctggcctg gccctaccgc ccccagccct accagccgcc cgccctgggc tgtggaccct 180 gcgtttgccg agcgctatgc ccacacagacc

&Lt; 210 &gt; 7 &lt; 211 &gt; 717 &lt; 212> DNA &lt; 213> human (Homo sapiens) &lt; 400> 7 atggattcct tcaaggtagt gctggagggg ccagcacctt ggggcttccg gctgcaaggg 60 ggcaaggact tcaatgtgcc cctctccatt tcccggctca ctcctggggg caaagcggcg 120 caggccggag tggccgtggg tgactgggtg ctgagcatcg atggcgagaa tgcgggtagc 180 ctcacacaca tcgaagctca gaacaagatc cgggcctgcg gggagcgcct cagcctgggc 240 ctcagcaggg cccagccggt tcagagcaaa ccgcagaagg cctccgcccc cgccgcggac 300 cctccgcggt acacctttgc acccagcgtc tccctcaaca agacggcccg gccctttggg 360 gcgcccccgc ccgctgacag cgccccgcaa cagaatggac agccgctccg accgctggtc 420 ccagatgcca gcaagcagcg gctgatggag aacacagagg actggcggcc gcggccgggg 480 -50- 1244503 V. invention is described in (48) acaggccagt cgcgttcctt ccgcatcctt gcccacctca caggcaccga gttcatgcaa 540 gacccggatg aggagcacct gaagaaatca agccaggtgc ccaggacaga agccccagcc 600 ccagcctcat & ctacacccca ggagccctgg cctggcccta 212 gccgccltga ccccccgcc ccgccgcc ccctccgcc &Gt; DNA &lt; 213 &gt; human &lt; 400> 8 atcgatggcg agaatgcggg tagcctcaca cacatcgaag ctcagaacaa gatccgggcc 60 tgcggggagc gcctcagcct gggcctcagc agggcccagc cggttcagag caaaccgcag 120 aaggcctccg cccccgccgc ggaccctccg cggtacacct ttgcacccag cgtctccctc 180 aacaagacgg cccggccctt tggggcgccc ccgcccgctg acagcgcccc gcaacagaat 240 ggacagccgc tccgaccgct ggtcccagat gccagcaagc agcggctgat ggagaacaca 300 gaggactggc ggccgcggcc ggggacaggc cagtcgcgtt ccttccgcat ccttgcccac 360 ctcacaggca ccgagtteat gcaagacccg gatgaggagc acctgaagaa atcaagccag 420 gtgcccagga cagaagcccc agccccagcc tcatctacac cccaggagcc ctggcctggc 480 cctaccgccc ccagccctac cagccgcccg ccctgagctg tggaccctgc gtttgccgag 540 cgctatgccc cggacaaaac gagcacagtg ctgacccggc acagccagcc ggccacgccc 600 acgccgctgc agagccgcac ctccattgtg caggcagctg ccggaggggt gccaggaggg 660 ggcagcaaca acggcaagac tcccgtgtgt caccagtgcc acaaggtcat ccggggccgc 720 tacctggtgg cgttgggcca cgcgtaccac ccggaggagt ttgtgtgtag ccagtgtggg 780 aaggtcctgg aagagggtgg ettetttgag gagaagggcg ccatctt ctg cccaccatgc 840 tatgacgtgc gctatgcacc cagctgtgcc aagtgcaaga agaagattac aggegagate 900 atgcacgccc tgaagatgac ctggcacgtg cactgcttta cctgtgctgc ctgcaagacg 960 cccatccgga acagggcctt ctacatggag gagggcgtgc cctattgcga gcgagactat 1020 gagaagatgt ttggcacgaa atgccatggc tgtgacttca agategaege tggggaccgc 1080 ttcctggagg ccctgggctt cagctggcat gacacctgct tcgtctgtgc gatatgtcag 1140 atcaacctgg aaggaaagac cttctactcc aagaaggaca ggcctctctg caagagccat 1200 gccttctctc atgtgtgagc cccttctgcc cacagctgcc gcggtggccc ctagcctgag 1260 gggcctggag tcgtggccct gcatttctgg gtagggctgg caatggttgc cttaaccctg 1320 gctcctggcc cgagcctggg ctcccgggcc cctgcccacc caccttatcc tcccacccca 1380 ctccctccac caccacagca caccggtgct ggccacacca gccccctttc acctccagtg 1440 -51- 1244503 V. invention is described in (49) ccacaataaa cctgtaccca gctgaattcc aaaaaatcca aaaaaaaa 1488 &lt; 210> 9 &lt; 211 &gt;. 1644 &lt; 212〉 DNA &lt; 213〉 human &400; 9 atggattcct tcaaggtagt gctggagggg ccagcacctt ggggcttccg gctgcaaggg 60 ggcaaggact tcaatgtgcc cctctccatt tcccggctca ctcctggggg caaagcggcg 120 caggccggag tggccgtggg tgactgggtg ctgagcatcg atggcgagaa tgcgggtagc 180 ctcacacaca tcgaagctca gaacaagatc cgggcctgcg gggagcgcct cagcctgggc 240 ctcagcaggg cccagccggt tcagagcaaa ccgcagaagg cctccgcccc cgccgcggac 300 cctccgcggt acacctttgc acccagcgtc tccctcaaca agacggcccg gccctttggg 360 gcgcccccgc ccgctgacag cgccccgcaa cagaatggac agccgctccg accgctggtc 420 ceagatgcca gcaagcagcg gctgatggag aacacagagg actggcggcc gcggccgggg 480 acaggccagt cgcgttcctt ccgcatcctt gcccacctca caggcaccga gttcatgcaa 540 gacccggatg aggagcacct gaagaaatca agccaggtgc ccaggacaga agccccagcc 600 ccagcctcat ctacacccca ggagccctgg cctggcccta ccgcccccag ccctaccagc 660 cgcccgccct gggctgtgga ccctgcgttt gccgagcgct atgccccgga caaaacgagc 720 acagtgctga cccggcacag ccagccggcc acgcccacgc cgctgcagag ccgcacctcc 780 attgtgcagg cagctgccgg aggggtgcca ggagggggca gcaacaacgg caagactccc 840 gtgtgtcacc agtgccacaa ggtcatccgg ggccgctacc tggtggcgtt gggccacgcg 900 taccacccgg aggagtttgt gtgtagccag tgtgggaagg tcctggaa ga gggtggcttc 960 tttgaggaga agggcgccat cttctgccca ccatgctatg acgtgcgcta tgcacccagc 1020 tgtgccaagt gcaagaagaa gattacaggc gagatcatgc acgccctgaa gatgacctgg 1080 cacgtgcact getttacctg tgctgcctgc aagacgccca tccggaacag ggccttctac 1140 atggaggagg gcgtgcccta ttgegagega gactatgaga agatgtttgg cacgaaatgc 1200 catggctgtg acttcaagat cgacgctggg gaccgcttcc tggaggccct gggcttcagc 1260 tggcatgaca cctgcttcgt ctgtgcgata tgteagatea acctggaagg aaagaccttc 1320 tactccaaga aggacaggcc tctctgcaag agccatgcct tctctcatgt gtgagcccct 1380 tctgcccaca gctgccgcgg tggcccctag cctgaggggc ctggagtcgt ggccctgcat 1440 ttctgggtag ggctggcaat ggttgcctta accctggctc ctggcccgag cctgggctcc 1500 cgggcccctg cccacccacc ttatcctccc accccactcc ctccaccacc acagcacacc 1560 ggtgctggcc acaccagccc cctttcacct ccagtgccac aataaacctg tacccagctg 1620 aattccaaaa aatccaaaaa aaaa 1644 52- 1244503 V. invention is described in (50) &lt; 210 &gt; 10 &lt; 211 &gt; 457 &lt; 212 &gt; PRT &lt; 213〉 Human &400; 10

Met Asp Ser Phe Lys Val Val Leu Glu Gly Pro Ala Pro Trp Gly Phe 15 10 15

Arg Leu Gin Gly Gly Lys Asp Phe Asn Val Pro Leu Ser He Ser Arg 20 25 30

Leu Thr Pro Gly Gly Lys Ala Ala Gin Ala Gly Val Ala Val Gly Asp 35 40 45

Trp Val Leu Ser lie Asp Gly Glu Asn Ala Gly Ser Leu Thr His He 50 55 60

Glu Ala Gin Asn Lys lie Arg Ala Cys Gly Glu Arg Leu Ser Leu Gly 65 70 75 80

Leu Ser Arg Ala Gin Pro Val Gin Ser Lys Pro Gin Lys Ala Ser Ala 85 90 95

Pro Ala Ala Asp Pro Pro Arg Tyr Thr Phe Ala Pro Ser Val Ser Leu 100 105 110

Asn Lys Thr Ala Arg Pro Phe Gly Ala Pro Pro Ala Asp Ser Ala 115 120 125

Pro Gin Gin Asn Gly Gin Pro Leu Arg Pro Leu Val Pro Asp Ala Ser 130 135 140

Lys Gin Arg Leu Met Glu Asn Thr Glu Asp Trp Arg Pro Arg Pro Gly 145 150 155 160 -53- 1244503 V. Description of the invention (51) Thr Gly Gin Ser Arg Ser Phe Arg lie Leu Ala His Leu Thr Gly Thr 165 170 175 Glu Phe Met Gin Asp Pro Asp Glu Glu His Leu Lys Lys Ser Ser Gin 180 185 190 Val Pro Arg Thr Glu Ala Pro Ala Pro Ala Ser Ser Thr Pro Gin Glu 195 200 205 Pro Trp Pro Gly Pro Thr Ala Pro! Ser Pro Thr Ser Arg Pro Pro Trp 210 215 220 Ala Val Asp Pro Ala Phe Ala Glu Arg Tyr Ala Pro Asp Lys Thr Ser 225 230 235 240 Thr Val Leu Thr Arg His Ser Gin Pro Ala Thr Pro Thr Pro Leu Gin 245 250 255 Ser Arg Thr Ser lie Val Gin Ala Ala Ala Gly Gly Val Pro Gly Gly 260 265 270 Gly Ser Asn Asn Gly Lys Thr Pro Val Cys His Gin Cys His Lys Val 275 280 285 lie Arg Gly Arg Tyr Leu Val Ala Leu Gly His Ala Tyr His Pro Glu 290 295 300 Glu Phe Val Cys Ser Gin Cys Gly Lys Val Leu Gl u Glu Gly Gly Phe 305 310 315 320 Phe Glu Glu Lys Gly Ala lie Phe Cys Pro Pro Cys Tyr Asp Val Arg 325 330 335 Tyr Ala Pro Ser Cys Ala Lys Cys Lys Lys Lys lie Thr Gly Glu lie 340 345 350

-54- 1244503 V. Description of the invention (52)

Met His Ala Leu Lys Met Thr Trp His Val His Cys Phe Thr Cys Ala 355 360 365

Ala Cys Lys Thr Pro He Arg Asn Arg Ala Phe Tyr Met Glu Glu Gly 370 375 380

Val Pro Tyr Cys Glu Arg Asp Tyr Glu Lys Met Phe Gly Thr Lys Cys 385 390 395 400

His Gly Cys Asp Phe Lys He Asp Ala Gly Asp Arg Phe Leu Glu Ala 405 410 415

Leu Gly Phe Ser Trp His Asp Thr Cys Phe Val Cys Ala He Cys Gin 420 425 430 lie Asn Leu Glu Gly Lys Thr Phe Tyr Ser Lys Lys Asp Arg Pro Leu 435 440 445

Cys Lys Ser His Ala Phe Ser His Val 450 455 &lt; 210〉 11 &lt; 211 &gt; 22 &lt; 212〉 DNA &lt; 213> Artificial Sequence &lt; 220 &gt; &lt; 223> Sequencing Primer &400; 11 22 gccagggttt tcccagtcac ga &lt; 210> 12 &lt; 211 &gt; 22 -55- 1244503

V. Description of the invention (53) &lt; 212> DNA &lt; 213 &gt; Artificial sequence &lt; 220 &gt;. &lt; 223> Sequencing primer &lt; 400> 12 gccagggttt tcccagtcac ga 22 &lt; 210 &gt; 13 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213〉 Human &400; 13 tcttagcaga gcccagcctg ct 22 &lt; 210〉 14 &lt; 211〉 22 &lt; 212 &gt; DNA &lt; 213〉 Human &400; 14 gcatgaactc tgtgcccgtg ag 22 &lt; 210 〉 15 &lt; 211 &gt; 20 &lt; 212〉 DNA &lt; 213〉 Brown rat &lt; 400〉 15 atccttgctc acctcacggg 20 &lt; 210〉 16 &lt; 211〉 22 &lt; 212〉 DNA

-56- 1244503 V. Description of the invention (54) &lt; 213〉 Brown rat &lt; 400〉 16 gcact- ^ tgct ggttttgtct gg 22 &lt; 210 &gt; 17 &lt; 211〉 23 &lt; 212〉 DNA &lt; 213〉 human &lt; 400〉 17 catggattcc ttcaaggtag tgc 23 &lt; 210〉 18 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213〉 human &lt; 400〉 18 gttttgtctg gggcagagcg 20 &lt; 210 &gt; 19 &lt; 211> 44 &lt; 212 〉 DNA &lt; 213〉 Artificial sequence &lt; 220〉 &lt; 223 &gt; Sequencing primers &lt; 400〉 19 ctaatacgac tcactatagg gctcgagcgg ccgcccgggc aggt 44 &lt; 210〉 20 &lt; 211 &gt; 27 &lt; 212> DNA &lt; 213〉 artificial sequence

-57- 1244503 V. Description of the invention (55) &lt; 220> &lt; 223 &gt; Sequencing primers &lt; 400〉 20 ccatcctaat acgactcact atagggc 27 &lt; 210 &gt; 21 &lt; 211〉 765 &lt; 212〉 DNA &lt; 213〉 human &lt; 400> 21 ccgttgtttg taaaacgacg cagagcagcg ccctggccgg gccaagcagg agccggcatc 60 atggattcct tcaaggtagt gctggagggg ccagcacctt ggggcttccg gctgcaaggg 120 ggcaaggact tcaatgtgcc ctcctccatt tcccggctca cctctggggg caaggccgtg 180 caggccggag tggccgtaag tgactgggtg ctgagcatcg atggcgagaa tgcgggtagc 240 ctcacacaca tcgaagctca gaacaagatc cgggcctgcg gggagcgcct cagcctgggc 300 ctcaacaggg cccagccggt tcagaacaaa ccgcaaaagg cctccgcccc cgccgcggac 360 cctccgcggt acacctttgc accaagcgtc tccctcaaca agacggcccg gcccttgggg 420 gcgcccccgc ccgctgacag cgccccgcag cagaatggac agccgctccg accgctggtc 480 ccagatgcca gcaagcagcg gctgatggag aacacagagg actggcggcc gcggccgggg 540 acaggccagt gccgttcctt tcgcatcctt gctcacctta caggcaccga gttcatgcaa 600 gacccggatg aggagcacct gaagaaatca agccaggtgc ccaggacaga agccccagcc 660 ccagcctcat ctacacccca ggagccctgg cc tggcccta ccgcccccag ccctaccagc 720 cgcccgccct gggctgtgga ccctgcgttt gccgagcgct atgcc 765 &lt; 210> 22 &lt; 211 &gt; 1689 &lt; 212> DNA &lt; 213> Human &lt; 400 &gt; 22 cgacgcagag cagcgccctg gccgggccaa gcaggagccg gcatcatgga ttccttcaag 60 gtagtgctgg aggggccagc accttggggc ttccggctgc aagggggcaa ggacttcaat 120 gtgcccctct ccatttcccg gctcactcct gggggcaaag cggcgcaggc cggagtggcc 180 -58- 1244503 V. invention is described in (56) gtgggtgact gggtgctgag catcgatggc gagaatgcgg gtagcctcac acacatcgaa 240 gctcagaaca agatccgggc ctgcggggag cgcctcagcc tgggcctcag cagggcccag 300 ccggttcaga gcaaaccgca gaaggcctcc gcccccgccg cggaccctcc gcggtacacc 360 tttgc.accca gcgtctccct caacaagacg gcccggccct ttggggcgcc cccgcccgct 420 gacagcgccc cgcaacagaa tggacagccg ctccgaccgc tggtcccaga tgccagcaag 480 cagcggctga tggagaacac agaggactgg cggccgcggc cggggacagg ccagtcgcgt 540 tccttccgca tccttgccca cctcacagggg ccat cctgcacaccc cc taccgcc cccagcccta ccagccgccc gccctgggct 720 gtggaccctg cgtttgccga gcgctatgcc ccggacaaaa cgagcacagt gctgacccgg 780 cacagccagc cggccacgcc cacgccgctg cagagccgca cctccattgt gcaggcagct 840 gccggagggg tgccaggagg gggcagcaac aacggcaaga ctcccgtgtg tcaccagtgc 900 cacaaggtca tccggggccg ctacctggtg gcgttgggcc acgcgtacca cccggaggag 960 tttgtgtgta gccagtgtgg gaaggtcctg gaagagggtg gcttctttga ggagaagggc 1020 gccatcttct gcccaccatg ctatgacgtg cgctatgcac ccagctgtgc caagtgcaag 1080 aagaagatta caggcgagat catgcacgcc ctgaagatga cctggcacgt gcactgcttt 1140 acctgtgctg cctgcaagac gcccatccgg aacagggcct tctacatgga ggagggcgtg 1200 ccctattgcg agcgagacta tgagaagatg tttggcacga aatgccatgg ctgtgacttc 1260 aagatcgacg ctggggaccg cttcctggag gccctgggct tcagctggca tgacacctgc 1320 ttcgtctgtg cgatatgtca gatcaacctg gaaggaaaga ccttctactc caagaaggac 1380 aggcctctct gcaagagcca tgccttctct catgtgtgag ccccttctgc ccacagctgc 1440 cgcggtggcc cctagcctga ggggcctgga gtcgtggccc tgcatttctg ggtagggctg 1500 gcaatggttg ccttaaccct ggctcctggc ccg agcctgg gctcccgggc ccctgcccac 1560 ccaccttatc ctcccacccc actccctcca ccaccacagc acaccggtgc tggccacacc 1620 agcccccttt cacctccagt gccacaataa acctgtaccc agctgaattc caaaaaatcc 1680 aaaaaaaaa 1689 &lt; 210> 23 &lt; 211 &gt; 22 &lt; 212> DNA &lt; 213> Human &lt; 400> 23 gcactgtgct cgttttgtcc gg 22 &lt; 210〉 24 -59-1244503 V. Description of the invention (57) &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213〉 Human &lt; 400〉 24 tccttgctca cctcacgggc a 21 &lt; 210〉 25 &lt; 211 &gt; 30 &lt; 212 &gt; DNA &lt; 213〉 Human &400; 25 tcctcatccg ggtcttgcat gaactcggtg 30 &lt; 210〉 26 &lt; 211 &gt; 28 &lt; 212〉 DNA &lt; 213〉 human &lt; 220〉 &lt; 223 &gt; sequencing primer &lt;; 400> 26 gcccccgccc gctgacagcg ccccgcaa 28 &lt; 210> 27 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213> human &lt; 400 &gt; 27 tccttgctca cctcacgggc accg 24 &lt; 210 &gt; 28 &lt; 211 &gt; 22

-60- 1244503

V. Description of the invention (58) &lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence &lt; 220>-&lt; 223 &gt; Sequencing primers &lt; 400 &gt; 28 gtaatacgac tcactatagg gc 22 &lt; 210 &gt; 29 &lt; 211 &gt; 23 &lt;; 212 &gt; DNA &lt; 213 &gt; Brown house mouse &lt; 400〉 29 gcggctgatg gagaatactg aag 23 &lt; 210 &gt; 30 &lt; 211 &gt; 23 &lt; 212〉 DNA &lt; 213〉 Brown house mouse &lt; 400〉 30 atcttgtggc actggtggca tac 23 &lt; 210> 31 &lt; 211 &gt; 22 &lt; 212> DNA &lt; 213 &gt; Brown domestic rat &lt; 400> 31 tgtgtcgggt cagcactgtg ct 22 &lt; 210 &gt; 32 &lt; 211 &gt; 1620 &lt; 212> DNA -61- 1,244,503 V. invention is described in (59) &lt; 213> human &lt; 400> 32 atgga.ttcct tcaaggtagt gctggagggg ccagcacctt ggggcttccg gctgcaaggg 60 ggcaaggact tcaatgtgcc cctctccatt tcccggctca ctcctggggg caaagcggcg 120 caggccggag tggccgtggg tgactgggtg ctgagcatcg atggcgagaa tgcgggtagc 180 ctcacacaca tcgaagctca gaacaagatc cgggcctgcg gggagcgcct cagcctgggc 240 ctcagcaggg cccagccggt tcagagcaaa ccgcagaagg cctccgcccc cgccgcggac 300 cctccgcggt a cacctttgc acccagcgtc tccctcaaca agacggcccg gccctttggg 360 gcgcccccgc ccgctgacag cgccccgcaa cagaatggac agccgctccg accgctggtc 420 ccagatgcca gcaagcagcg gctgatggag aacacagagg actggcggcc gcggccgggg 480 acaggccagt cgcgttcctt ccgcatcctt gcccacctca caggcaccga gttcatgcaa 540 gacccggatg aggagcacct gaagaaatca agccaggtgc ccaggacaga agccccagcc 600 ccagcctcat ctacacccca ggagccctgg cctggcccta ccgcccccag ccctaccagc 660 cgcccgccct gagctgtgga ccctgcgttt gccgagcgct atgccccgga caaaacgagc 720 acagtgctga cccggcacag ccagccggcc acgcccacgc cgctgcagag ccgcacctcc 780 attgtgcagg cagctgccgg aggggtgcca ggagggggca gcaacaacgg caagactccc 840 gtgtgtcacc agtgccacaa ggtcatccgg ggccgctacc tggtggcgtt gggccacgcg 900 taccacccgg aggagtttgt gtgtagccag tgtgggaagg tcctggaaga 960 gggtggcttc ggccttctac 1140 atggaggagg tttgaggaga agggcgccat cttctgccca ccatgctatg acgtgcgcta tgcacccagc 1020 tgtgccaagt gcaagaagaa gattacaggc gagatcatgc acgccctgaa gatgacctgg 1080 cacgtgcact gctttacctg tgctgcctgc aagacgccca tccggaacag gcgtgcccta ttgcgag cga gactatgaga agatgtttgg cacgaaatgc 1200 catggctgtg acttcaagat cgacgctggg gaccgcttcc tggaggccct gggcttcagc 1260 tggcatgaca cctgcttcgt ctgtgcgata tgtcagatca acctggaagg aaagaccttc 1320 tactccaaga aggacaggcc tctctgcaag agccatgcct tctctcatgt gtgagcccct 1380 tctgcccaca gctgccgcgg tggcccctag cctgaggggc ctggagtcgt ggccctgcat 1440 ttctgggtag ggctggcaat ggttgcctta accctggctc ctggcccgag cctgggctcc 1500 cgggcccctg cccacccacc ttatcctccc accccactcc ctccaccacc acagcacacc 1560 ggtgctggcc acaccagccc cctttcacct ccagtgccac aataaacctg tacccagctg 1620 &lt; 210> 33 &lt; 211 &gt; 1665 &lt; 212 &gt; DNA &lt; 213> human-62- 1244503 5. Description of the invention (6) &lt; 400 &gt; 33 cgacgcagag cagcgccctg gccgggcccc gcatggggggcaggaggggcaggaggg aggatgcc accttggggc ttccggctgc aagggggcaa ggacttcaat 120 gtgcccctct ccatttcccg gctcactcct gggggcaaag cggcgcaggc cggagtggcc 180 gtgggtgact gggtgctgagcca gggccggccgcatgccggcatgcca ag 300 ccggttcaga gcaaaccgca gaaggcctcc gcccccgccg cggaccctcc gcggtacacc 360 tttgcaccca gcgtctccct caacaagacg gcccggccct ttggggcgcc cccgcccgct 420 gacagcgccc cgcaacagaa tggacagccg ctccgaccgc tggtcccaga tgccagcaag 480 cagcggctga tggagaacac agaggactgg cggccgcggc cggggacagg ccagtcgcgt 540 tccttccgca tccttgccca cctcacaggc accgagttca tgcaagaccc ggatgaggag 600 cacctgaaga aatcaagcca ggtgcccagg acagaagccc cagccccagc ctcatctaca 660 ccccaggagc cctggcctgg ccctaccgcc cccagcccta ccagccgccc gccctgagct 720 gtggaccctg cgtttgccga gcgctatgcc ccggacaaaa cgagcacagt gctgacccgg 780 cacagccagc cggccacgcc cacgccgctg cagagccgca cctccattgt gcaggcagct 840 gccggagggg tgccaggagg gggcagcaac aacggcaaga ctcccgtgtg tcaccagtgc 900 cacaaggtca tccggggccg ctacctggtg gcgttgggcc acgcgtacca cccggaggag 960 tttgtgtgta gccagtgtgg gaaggtcctg gaagagggtg gcttctttga ggagaagggc 1020 gccatcttct gcccaccatg ctatgacgtg cgctatgcac ccagctgtgc caagtgcaag 1080 aagaagatta caggcgagat catgcacgcc ctgaagatga cctggcacgt gcactgcttt 1140 acctgtgctg cctgcaagac gcccatccgg aacagggcct tctacatgga ggagggcgtg 1200 ccctattgcg agcgagacta tgagaagatg tttggcacga aatgccatgg ctgtgacttc 1260 aagatcgacg ctggggaccg cttcctggag gccctgggct tcagctggca tgacacctgc 1320 ttcgtctgtg cgatatgtca gatcaacctg gaaggaaaga ccttctactc caagaaggac 1380 aggcctctct gcaagagcca tgccttctct catgtgtgag ccccttctgc ccacagctgc 1440 cgcggtggcc cctagcctga ggggcctgga gtcgtggccc tgcatttctg ggtagggctg 1500 gcaatggttg ccttaaccct ggctcctggc ccgagcctgg gctcccgggc ccctgcccac 1560 ccaccttatc ctcccacccc actccctcca ccaccacagc acaccggtgc tggccacacc 1620 agcccccttt cacctccagt gccacaataa acctgtaccc agctg 1665 &lt; 210〉 34 &lt; 211 &gt; 223 &lt; 212 &gt; PRT &lt; 213〉 human &lt; 400> 34 63- 1244503 Met Description Lys Val Val Leu Glu Gly Pro Ala Pro Trp Gly Phe 1 5 10 15 Arg Leu Gin Gly Gly Lys Asp Phe Asn Val Pro Leu Ser lie Ser Arg 20 25 30 Leu Thr Pro Gly Gly Lys Ala Ala Gin Ala Gly Val Ala Val Gly Asp 35 40 45 Trp Val Leu Ser lie Asp Gly Glu Asn Ala Gly Ser Leu Thr His lie 50 55 60 Glu Ala Gin Asn Lys lie Arg Ala Cys Gly Glu Arg Leu Ser Leu Gly 65 70 75 80 Leu Ser Arg Ala Gin Pro Val Gin Ser Lys Pro Gin Lys Ala Ser Ala 85 90 95 Pro Ala Ala Asp Pro Pro Arg Tyr Thr Phe Ala Pro Ser Val Ser Leu 100 105 110 Asn Lys Thr Ala Arg Pro Phe Gly Ala Pro Pro Pro Ala Asp Ser Ala 115 120 125 Pro Gin Gin Asn Gly Gin Pro Leu Arg Pro Leu Val Pro Asp Ala Ser 130 135 140 Lys Gin Arg Leu Met Glu Asn Thr Glu Asp Trp Arg Pro Arg Pro Gly 145 150 155 160 Thr Gly Gin Ser Arg Ser Phe Arg lie Leu Ala His Leu Thr Gly Thr 165 170 175 Glu Phe Met Gin Asp Pro Asp Glu Glu His Leu Lys Lys Ser Ser Gin 180 185 190 -64- 1244503 V. Description of the invention (62)

Val Pro Arg Thr Glu Ala Pro Ala Pro Ala Ser Ser Thr Pro Gin Glu 195 200 205

Pro Trp Pro Gly Pro Thr Ala Pro Ser Pro Thr Ser Arg Pro Pro 210 215 220 &lt; 210〉 35 &lt; 211〉 25 &lt; 212 &gt; DNA &lt; 213 &gt; Brown House Mouse &lt; 400 &gt; 35 gcactacctt gaaggaatcc atggt 25- 65-

Claims (1)

124 #o |: g amendment /. \ / 4 ': -Jr 兔兔' A-口 本 &quot; VI. Application for Patent Scope No. 0871 19193 Patent Reexamination Application for Scope of Patent Application Amendment Date: 8/94 1. A vector comprising an isolated nucleic acid molecule, the isolated nucleic acid molecule comprising a nucleotide sequence encoding a human LIM mineralization protein (LMP), wherein the nucleic acid molecule is in a solution containing 5X SSPE, 42 Under the standard culture condition of ° C, it will hybridize to a nucleic acid molecule complementary to the full-length sequence number 25 (tcctcatccg ggtcttgcat gaactcggtg), or when the molecule is substantially the same in a probe and its target sequence Under highly stringent conditions where the needle hybridizes to its target sequence, it will hybridize to a nucleic acid molecule complementary to the full-length sequence number 26 (gcccccgccc gctgacagcg ccccgcaa), and the molecule includes a sequence shown in sequence number 25 and The nucleic acid sequence in SEQ ID NO: 26. 2. The vector according to item 1 of the patent application scope, wherein the isolated nucleic acid molecule comprises a sequence identification number 33, sequence identification number 33, cgacgcagag cagcgccctg gccgggccaa gcaggagccg gcatcatgga ttccttcaag 60 gtagtgctgg aggggccggg agggg acctggggc ttccggctgcgggt agggg cggcgcaggc cggagtggcc 180 gtgggtgact gggtgctgag gcccggccct ttggggcgcc 420 1244503 f, the scope of patented cccgcccgct catcgatggc gagaatgcgg gtagcctcac acacatcgaa 240 gctcagaaca agatccgggc ctgcggggag cgcctcagcc tgggcctcag cagggcccag 300 ccggttcaga gcaaaccgca gaaggcctcc gcccccgccg cggaccctcc gcggtacacc 360 tttgcaccca gcgtctccct caacaagacg gacagcgccc cgcaacagaa tggacagccg ctccgaccgc tggtcccaga tgccagcaag 480 cagcggctga tggagaacac agaggactgg cggccgcggc cggggacagg ccagtcgcgt 540 tccttccgca tccttgccca cctcacaggc accgagttca tgcaagaccc ggatgaggag 600 cacctgaaga aatcaagcca ggtgcccagg acagaagccc cagccccagc ctcatctaca 660 ccccaggagc cctggcctgg ccctaccgcc cccagcccta ccagccgccc gccctgagct 720 gtggaccctg cgtttgccga gcgctatgcc ccggacaaaa cgagcacagt gctgacccgg 780 cacagccagc cggccacgcc cacgccgctg cagagccgca cctccattgt gcaggcagct 840 gccggagggg tgccaggagg gggcagcaac aacggcaaga ctcccgtgtg tcaccagtgc 900 cacaaggtca tccggggccg ctacctggtg gcgttgggcc acgcgtacca cccggaggag 960 tttgtgtgta gccagtgtgg gaaggtcctg gaagagggtg gcttctttga ggagaagggc 1020 gccatcttct gcccaccatg ctatgacgtg cgctatgcac ccagctgtgc caagtgcaag 1080 aagaagatta caggcgagat catgcacgcc ctgaagatga cctggcacgt gcactgcttt 1140 acctgtgctg cctgcaagac gcccatccgg aacagggcct tctacatgga ggagggcgtg 1200 ccctattgcg agcgagacta tgagaagatg tttggcacga aatgccatgg ctgtgacttc 1260 aagatcgacg ctgg ggaccg cttcctggag gccctgggct tcagctggca tgacacctgc 1320 ttcgtctgtg cgatatgtca gatcaacctg gaaggaaaga ccttctactc caagaaggac 1380 aggcctctct gcaagagcca tgccttctct catgtgtgag ccccttctgc ccacagctgc 1440 cgcggtggcc cctagcctga ggggcctgga gtcgtggccc tgcatttctg ggtagggctg 1500 gcaatggttg ccttaaccct ggctcctggc ccgagcctgg gctcccgggc ccctgcccac 1560 ccaccttatc ctcccacccc actccctcca ccaccacagc acaccggtgc tggccacacc 1620 agcccccttt cacctccagt gccacaataa acctgtaccc agctg 1 665 ° 3 The vector as claimed in the scope of the patent application, wherein the isolated nucleic acid molecule contains a sequence identification number 22 9 1244503 6. The scope of the patent application sequence identification number 22 cgacgcagag cagcgccctg gccgggccaa gcaggagccg gcatcatgga ttccttcaag 60 gtagtgctgg aggggccagc accttgggggggcg ggacttcaat 120 gtgcccctct ccatttcccg gctcactcct gggggcaaag cggcgcaggc cggagtggcc 180 gtgggtgact gggtgctgag catcgatggc gagaatgcgg gtagcctcac 300gctcgca tggggggggggcgggggg gttcaga gcaaaccgca gaaggcctcc gcccccgccg cggaccctcc gcggtacacc 360 tttgcaccca gcgtctccct caacaagacg geccggccct ttggggcgcc cccgcccgct 420 gacagcgccc cgcaacagaa tggacagccg ctccgaccgc tggtcccaga tgccagcaag 480 cagcggctga tggagaacac agaggactgg cggccgcggc cggggacagg ccagtcgcgt 540 tccttccgca tccttgccca cctcacaggc accgagttca tgcaagaccc ggatgaggag 600 cacctgaaga aatcaagcca ggtgcccagg acagaagccc cagccccagc ctcatctaca 660 ccccaggagc cctggcctgg ccctaccgcc cccagcccta ccagccgccc gccctgggct 720 gtggaccctg cgtttgccga gcgctatgcc ccggacaaaa cgagcacagt gctgacccgg 780 cacagccagc cggccacgcc cacgccgctg cagagccgca cctccattgt gcaggcagct 840 gccggagggg tgccaggagg gggcagcaac aacggcaaga ctcccgtgtg tcaccagtgc 900 cacaaggtca tccggggccg ctacctggtg gcgttgggcc acgcgtacca cccggaggag 960 tttgtgtgta gccagtgtgg gaaggtcctg gaagagggtg gcttctttga ggagaagggc 1020 gccatcttct gcccaccatg ctatgacgtg cgctatgcac ccagctgtgc caagtgcaag 1080 aagaagatta caggcgagat catgcacgcc ctgaagatga cctggcacgt gcactgcttt 1140 acctgtgctg cctgcaaga c gcccatccgg aacagggcct tctacatgga ggagggcgtg 1200 ccctattgcg agcgagacta tgagaagatg tttggcacga aatgccatgg ctgtgacttc 1260 aagatcgacg ctggggaccg cttcctggag gccctgggct tcagclggca tgacacctgc 1320 1244503 τ, patented scope ttcgtctgtg cgatatgtca gatcaacctg gaaggaaaga ccttctactc caagaaggac 1380 aggcctctct gcaagagcca tgccttctct catgtgtgag ccccttctgc ccacagctgc 1440 cgcggtggcc cctagcctga ggggcctgga gtcgtggccc tgcatttctg ggtagggctg 1500 gcaatggttg ccttaaccct ggctcctggc ccgagcctgg gctcccgggc ccctgcccac 1560 ccaccttatc ctcccacccc actccctcca ccaccacagc acaccggtgc tggccacacc 1620 agcccccttt cacctccagt gccacaataa nucleus contains a molecule that contains a nucleic acid. The nucleic acid isolate contains a molecule of 1688. The actctaccc agctgaattc caaaaaaa aaaa 1680 a Nucleotide sequence, in which the isolated nucleic acid molecule hybridizes to a nucleic acid molecule sequence complementary to the full length sequence identification number 2 under a standard culture condition of 42 ° C in a solution containing 5X SSPE. Identification number No. 2 gcacgaggat cccagcgcgg ctcctggagg ccgccaggca gccgcccagc cgggcattca 60 ggagcaggta ccatggattc cttcaaggta gtgctggagg gacctgcccc ttggggcttc 120 cgtctgcaag ggggcaagga cttcaacgtg cccctctcca tctctcggct cactcctgga 180 ggcaaggccg cacaggccgg tgtggccgtg ggagactggg tactgagtat cgacggtgag 240 aacgccggaa gcctcacaca cattgaagcc cagaacaaga tccgtgcctg tggggagcgc 300 ctcagcctgg gtcttagcag agcccagcct gctcagagca aaccacagaa ggccctgacc 360 cctcccgccg accccccgag gtacactttt gcaccaagcg cctccctcaa caagacggcc 420 cggcccttcg gggcaccccc acctactgac agcgccctgt cgcagaatgg acagctgctc 480 agacagctgg tccctgatgc cagcaagcag cggctgatgg agaalactga agactggcg 41244503 six, patented scope ccgcggccag ggacaggcca gtcccgttcc ttccgcatcc ttgctcacct cacgggcaca 600 gagttcatgc aagacccgga tgaggaattc atgaagaagt caagccaggt gcccaggaca 660 gaagccccag ccccagcctc aaccataccc caggaatcct ggcctggccc caccaccccc 720 agccccacca gccgcccacc ctgggccgta gatcctgcat ttgctgagcg ctatgcccca 780 gacaaaacca gcacagtgct gacccgacac agccagccag ccacacctac gcctctgcag 840 aaccgcacct ccatagttca ggctgcagct ggagggggca caggaggagg cagcaacaat 900 ggcaagacgc ctgtatgcca ccagtgccac aagatcatcc gcggccgata cctggtagca 960 ctgggccacg cgtaccatcc tgaggaattt agtgtgggaa gtgtgcagcc atcgatgccg gggaccgttt cctggaagcc ggtcctggaa 1020 gagggtggct tcttcgagga gaagggagct atcttttgcc cctcctgcta tgatgtgcgc 1080 tatgcaccca gctgtgccaa atgcaagaag aagatcactg gagagatcat gcatgcgctg 1140 aagatgacct ggcatgttcc ctgcttcacc tgtgcagcct gcaaaacccc tatccgcaac 1200 agggctttct acatggagga gggggctccc tactgcgagc gagattacga gaagatgttt 1260 ggcacaaagt gtcgcggctg tgacttcaag 1320 ctgggtttca gctggcatga tacgtg tttt gtttgcgcaa tatgtcaaat caacttggaa 1380 ggaaagacct tctactccaa gaaggacaag cccctgtgca agagccatgc cttttcccac 1440 gtatgagcac ctcctcacac tactgccacc ctactctgcc agaagggtga taaaatgaga 1500 gagctctctc tccctcgacc tttctgggtg gggctggcag ccattgtcct agccttggct 1560 cctggccaga tcctggggct ccctcctcac agtccccttt cccacacttc ctccaccacc 1620 accaccgtca ctcacaggtg ctagcctcct agccccagtt cactctggtg tcacaataaa 1680 cctgtatgta gctgtg 1 696 ° 5. - host species A cell comprising the vector according to any one of claims 1 to 4, wherein the host cell line is selected from the group consisting of prokaryotic cells, yeast cells and mammalian cells. 1244503 Range ~~ 6 · -Single antibody, specific for _ human LIM mineralization protein edited by an isolated nucleic acid molecule, the nucleic acid molecule is composed of 5XSSPE; Rong> Ye, 42. Under the standard culture conditions of C, a heterogeneous parent will be added to a nucleic acid molecule complementary to the full-length sequence identification number U (tcctcatccg ggtcttgcat gaactcggtg), or if the molecule is substantially the same as a probe and its target sequence, a Under the severe conditions under which the probe hybridizes to its target sequence, it will hybridize to a nucleic acid molecule complementary to the full length sequence with the identification number 26 (gcccccgccc gctgacagcgccccgcaa). 7. The monoclonal antibody of item 6 in the patent application scope, wherein the human LIM mineralization protein is HLMP-1 sequence identification number 10, sequence identification number 10, Met Asp Ser Phe Lys Val Val Leu Glu Gly Pro Ala Pro Trp Gly Phe 1 5 10 15 Arg Leu Gin Gly Gly Lys Asp Phe Asn Val Pro Leu Ser lie Ser Arg 2〇25 30 Leu Thr Pro Gly Gly Lys Ala Ala Gin Ala Gly Val Ala Val Gly Asp 35 40 45 Trp Val Leu Ser lie Asp Gly Glu Asn Ala Gly Ser Leu Thr His lie 50 55 60 Glu Ala Gin Asn Lys lie Arg Ala Cys Gly Glu Arg Leu Ser Leu Gly 65 70 75 80 Leu Ser Arg Ala Gin Pro Val Gin Ser Lys Pro Gin Lys Ala Ser Ala 85 90 95 Pro Ala Ala Asp Pro Pro Arg Tyr Thr Phe Ala Pro Ser Val Ser Leu 100 105 110 Asn Lys Thr Ala Arg Pro Phe Gly Ala Pro Pro Ala Asp Ser Ala 115 120 125 Pro Gin Gin Asn Gly Gin Pro Leu Arg Pro Leu Val Pro Asp Ala Ser 130 135 140 Lvs Gin Arg Leu Met Glu Asn Thr Glu Asp Trp Arg Pro Arg Pro Gly 145 150 155 160 Thr Gly Gin Ser Arg Ser Phe Arg lie Leu Ala His Leu Thr Gly Thr 1244503 Application scope 165 170 175 Glu Phe Met Gin Asp Pro Asp Glu Glu His Leu Lys Lys Ser Ser Gin 180 185 190 Val Pro Arg Thr Glu Ala Pro Ala Pro Ala Ser Ser Thr Pro Gin Glu 195 200 205 Pro Trp Pro Gly Pro Thr Ala Pro Ser Pro Thr Ser Arg Pro Pro Trp 210 215 220 Ala Val Asp Pro Ala Phe Ala Glu Arg Tyr Ala Pro Asp Lys Thr Ser 225 230 235 240 Thr Val Leu Thr Arg His Ser Gin Pro Ala Thr Pro Thr Pro Leu Gin 245 250 255 Ser Arg Thr Ser lie Val Gin Ala Ala Ala Gly Gly Val Pro Gly Gly 260 265 270 Gly Ser Asn Asn Gly Lys Thr Pro Val Cys His Gin Cys His Lys Val 275 280 285 lie Arg Gly Arg Tyr Leu Val Ala Leu Gly His Ala Tyr His Pro Glu 290 295 300 Glu Phe Val Cys Ser Gin Cys Gly Lys Val Leu Glu Glu Gly Gly Gly Phe 305 310 315 320 Phe Glu Glu Ly s Gly Ala lie Phe Cys Pro Pro Cys Tyr Asp Val Arg 325 330 335 Tyr Ala Pro Ser Cy s Ala Lys Cys Lys Lys Lys lie Thr Gly Glu lie 340 345 350 Met His Ala Leu Lys Met Thr Trp His Val His Cys Phe Thr Cys Ala 355 360 365 Ala Cys Ly s Thr Pro lie Arg Asn Arg Ala Phe Tyr Met Glu Glu Gly 370 375 380 Val Pro Tyr Cys Glu Arg Asp Tyr Glu Lys Met Phe Gly Thr Lys Cys 3 8 5 390 395 400 His Gly Cys Asp Phe Lys lie Asp Ala Gly Asp Arg Phe Leu Glu Ala 405 410 415 Leu Gly Phe Ser Trp His Asp Thr Cys Phe Val Cys Ala lie Cys Gin 420 425 430 lie Asn Leu Glu Gly Lys Thr Phe Tyr Ser Lys Lys Asp Arg Pro Leu 4 3 5 440 445 Cy s Ly s Ser His Ala Phe Ser His Val 〇450 455 8 . For example, the single antibody of item 6 in the scope of patent application, wherein the human LIM mineralization protein is HLMP-ls 1244503 t such as sequence identification number 34, and the sequence identification number 34 in the patent application range Met Asp Ser Phe Lys Val Val Leu Glu Gly Pro Ala Pro Trp Gly Phe 15 l〇15 Arg Leu Gin Gly Gl y Lys Asp Phe Asn Val Pro Leu Ser lie Ser Arg 20 25 30 Leu Thr Pro Gly Gly Lys Ala Ala Gin Ala Gin Vala Ala Val Gly Asp 35 40 45 Trp Val Leu Ser lie Asp Gly Glu Asn Ala Gly Ser Leu Thr His lie 50 55 60 Glu Ala Gin Asn Lys lie Arg Ala Cys Gly Glu Arg Leu Ser Leu Gly 65 70 75 80 Leu Ser Arg Ala Gin Pro Val Gin Ser Lys Pro Gin Lys Ala Ser Ala 85 90 95 Pro Ala Ala Asp Pro Pro Arg Tyr Thr Phe Ala Pro Ser Val Ser Leu 100 105 110 Asn Lys Thr Ala Arg Pro Phe Gly Ala Pro Pro Pro Ala A'sp Ser Ala 115 120 125 Pro Gin Gin Asn Gly Gin Pro Leu Arg Pro Leu Val Pro Asp Ala Ser 130 135 140 Lys Gin Arg Leu Met Glu Asn Thr Glu Asp Trp Arg Pro Arg Pro Gly 145 150 155 160 Thr Gly Gin Ser Arg Ser Phe Arg lie Leu Ala His Leu Thr Gly Thr 165 170 175 Glu Phe Met Gin Asp Pro Asp Glu Glu His Leu Lys Lys Ser Ser Gin 180 185 190 Val Pro Arg Thr Glu Ala Pro Ala Pro Ala Ser Thr Pro Gin Glu 195 200 205 Pro Trp Pro Gly Pro Thr Ala Pro Ser Pro Thr Ser Arg Pro Pro 210 215 220 9 Strain antibody ' Specific for a human LIM mineralization protein composed of an isolated nucleic acid molecule, where the nucleic acid molecule is in a solution containing 5X SSPE, and will hybridize to a complementary complement intact under 42 ° C culture standard conditions A nucleic acid molecule of the sequence identification number 25 (tcctcatccg ggtcttgcat gaactCggtg), or when the molecule is substantially the same as a probe and its target sequence, it can be detected 1245503 6. Scope of patent application Under the severe conditions of the needle chain and its target sequence, it will hybridize to a nucleic acid molecule with the identification number% (gc (: cccgccc gctgacagcgccccgcaa) which is complementary to the full-length sequence. 10. If applying for a patent The multi-strain antibody of the scope item 9, wherein the human LIM mineralization protein is the HLMP-1 of the sequence identification number 10 as described in the scope of the patent application scope item 7. 11 · The scope of the patent application scope item 9 Multiple strains of antibodies, wherein the human LIM mineralization protein is HLMP-ls with sequence identification number 34 as described in item 8 of the patent application scope. 12. A single antibody against a brown house mouse LIM mineralization protein has specificity, the protein is sequence identification number No. 1 sequence identification number No. 1: Thr Glv Gin Ser Arg Ser Phe Arg lie Leu Ala His Leu Thr Gly Thr 1244503 6. Application scope 165 170 175 Glu Phe Met Gin Asp Pro Asp Glu Glu Phe Met Ly s Ly s Ser Ser Gin 180] 85 190 Val Pro Arg Thr Glu Ala Pro Ala Pro Ala Ser Thr lie Pro Gin Glu 195 200 205 Ser Trp Pro Gly Pro Thr Thr Pro Ser Pro Thr Ser Arg Pro Pro Trp 210 215 220 Ala Val Asp Pro Ala Phe Ala Glu Arg Tyr Ala Pro Asp Ly s Thr Ser 225 230 235 240 Thr Val Leu Thr Arg His Ser Gin Pro Ala Thr Pro Thr Pro Leu Gin 245 250 255 Asn Arg Thr Ser lie Val Gin Ala Ala Ala Gly Gly Gly Gly Thr Gly Gly 260 265 270 G 1 y Ser Asn Asn Gly Ly s Thr Pro Val Cys His Gin Cys His Ly s lie 275 280 285 lie Arg Gly Arg Tyr Leu Val Ala Leu Gly His Ala Tyr H ^ is Pro Glu 290 295 300 Glu Phe Val Cy s Ser Gin Cys Gly Ly s Val Leu Glu Glu Gly Gly Phe 305 310 315 320 Phe Glu Glu Ly s Gly Ala lie Phe Cys Pro Ser Cys Tyr Asp Val Arg 325 330 335 Tyr Ala Pro Ser Cys Ala Ly s Cys Ly s Ly s Ly s lie Thr Gly Glu lie 340 345 350 Met His Ala Leu Ly s Met Thr Trp His Val Pro Cys Phe Thr Cys Ala 355 360 365 Ala Cy s Ly s Thr Pro lie Arg Asn Arg Ala Phe Tyr Met Glu Glu Gly 370 375 380 Ala Pro Tyr Cy s Glu Arg Asp Tyr Glu Ly s Met Phe Gly Thr Ly s Cys 385 390 395 400 Arg Gly Cy s Asp Phe Ly s lie Asp Ala Gly Asp Arg Phe Leu Glu Ala 405 410 415 Leu Gly Phe Ser Trp His Asp Thr Cys Phe Val Cys Ala lie Cys Gin 420 425 430 lie Asn Leu Glu Gly Ly s Thr Phe Tyr Ser Ly s Ly s Asp Ly s Pro Leu 435 440 445 Cy s Ly s Ser His Ala Phe Ser His Val 450 455 〇1 3-a variety of antibodies, which are used for the sequence identification of item 4 in the scope of 4: σ patent application 10 1244503 VI. Scope of patent application The browning rat LIM mineralization protein described in No. 1 has specificity. 14. The use of an isolated nucleic acid molecule containing a nucleic acid sequence encoding a LIM mineralization protein for the manufacture of a composition for transfection into the original tending cells of bone to induce bone formation. The use as claimed in claim 14 wherein the isolated nucleic acid molecule is located in a vector. 16. For the purpose of claim 15 in the scope of patent application, the carrier is a manifestation carrier. A quality 17. The use as claimed in item 16 of the patent application, wherein the carrier is a unit. The body is a disease 18. If the application in the scope of the patent application number 16 is used, the drug-carrying agent 0 19 If the application in the scope of the patent application 18 is used, the D. tetradentis body is an adenovirus. 20. The use of item 18 in the scope of patent application, in which viruses are recorded. 21. The use of item 14 in the scope of patent application, which is dyed in vitro. 22. The use of item 14 in the scope of patent application, wherein by direct injection of the isolated nucleic acid molecule, the vector is a reversed bone original tending cell and the bone original tending cell is transfected in vivo. 1244503 VI. Application scope of patent 23. If the application of scope of patent application No. 14 is used, the negative protein of LIM mineralization is HLMP-1 of sequence identification number No. 10 as described in the scope of patent application No. 7. 24. As for the application in the scope of patent application No. 14, wherein the UM mineralization protein is the HLMP-U of sequence identification number No. 34 as described in the scope of patent application No. 8. 25. As for the application in the scope of patent application No. 14, wherein the UM mineralization protein is RLMP of sequence identification number No. 1 as described in the scope of patent application No. 丨 2. 26. A method of manufacturing an article for joining the spine, comprising: (a) transfection of bone precursor cells with an isolated nucleic acid molecule comprising a nucleotide sequence encoding a UM mineralization protein; And (b) mixing the transfected bone progenitor cells with a matrix; wherein the expression of the nucleotide sequence encoding the LIM mineralization protein in the matrix causes the formation of mineralized bone. 27. The method of claim 26, wherein the bone progenitor cells are transfected in vitro. 28. The method of claim 26 of the patent scope, wherein the LIM mineralization protein is selected from the group consisting of HLMP-1 of sequence identification number 苐 10 as described in the scope of patent application No. 7; HLMp_ls of the sequence identification number 34 described in item 8 and RLMp of the sequence identification number ^ number described in item 12 of the patent application range. 12 1244503 t. Application patent scope 29 · An isolated nucleic acid molecule containing a nucleotide sequence encoding a LIM mineralization protein is used to manufacture a bone marrow precursor cell for use in transfection to overexpress the separation The use of nucleic acid molecules to stimulate the production of osteogenic soluble factors. 30 · —An anti-message that can hybridize to a nucleic acid encoding a LIM mineralization protein. Nucleotides are used to make a composition for transfection into cells in which LIM mineralization protein is expressed to inhibit the expression of the mineralization. The use of things. 31. For the purpose of claim 30, wherein the counter-message nucleotide i has the nucleotide sequence listed in sequence identification number 35 (gcactacctt gaaggaatcc atggt). 32. The method of claim 22, wherein the isolated nucleic acid molecule is located on a vector selected from the group consisting of plastids and viruses. 33. If the method according to item 32 of the patent application, wherein the carrier is a plastid, the 13