TWI241346B - Hog cholera tissue culture live vaccine virus, the tissue culture method of the same and hog cholera tissue culture live vaccine comprising the same - Google Patents

Abstract

The present invention relates to a hog cholera tissue culture live vaccine virus and a tissue culture method of the same. The invention also relates to a hog cholera tissue culture live vaccine comprising said hog cholera virus, which exhibits an excellent protective effect against hog cholera.

Description

1241346 (ii) Description of the invention: [Technical field to which the invention belongs] This case is about a breeding pig weaving culture live virus vaccine strain and its tissue culture method. The present Japanese gentleman _ face ^ containing the rabbitized pig face strain, which shows a good protective effect against pig cover. [Prior technology]-Hog cholera (classic swine fever) is caused by a virus.-A type of highly contagious septicemia, with signs of total miscellaneous bleeding and Wei granules. Pig fatigue first occurred in Tennessee in the United States in 1810, but the first diagnosed cases of lean cases were in ^ years. Occurred in the United States in Iowa ’’s, causing bribery.丨 spread to Europe ’and spread to other parts of the world. In Taiwan, Meiji has been called out and is a blessing. It is still one of the most important pig infectious diseases in Taiwan, and it is classified as a Class A animal infectious disease under the Animal Infectious Diseases Control Ordinance. Classical swine fever virus belongs to the family of Flaviaceae and pestivims. It is an RNA virus with a molecular weight of about 4 x 6 channels and its nucleic acid is infectious. Porcine fatigue virus is the most stable among PGs, and is more stable in particular. At ρΗ 3, the virus will be destroyed. In addition, because it has a lipid component, it is sensitive to radon, aerobic or deoxycholin, and it is also sensitive to detergents such as Tween 80, egg autoenzyme and egg autotransformer. The main symptoms of pig-mutual infection are persistent high temperature and hunger), and full-heartedness. Feelings and death are mixed. -Record M acute axis course, but can be changed to chronic. In very acute cases, only very slight lesions are seen, or even death without lesions, while in severe and subacute cases, quite severe lesions can be seen, such as edema degeneration and necrosis of vascular endothelial cells, damage to the money mechanism, and age and organization. Extensive descriptions of turtles, special lymph nodes, and blood (blood of the Executive Yuan Agricultural Committee, Animal and Plant II 1241346, ancient bad f η disease mother disease I have quite different virulence, and virulent strains can cause acute cases and cause _ : ^ Kianov and chronic silk, the weak virus system may cause insignificant but the weak strain may cause the death of the fetus and the charm piglet. Because the pig fatigue virus only has the clear type ', immunoserological methods such as immunodiffusion method or camp The cursor does not have antibodies against wood-colored scales, which can't distinguish between the pancake external virus and the rabbit chemical vaccine. Although some foreign scholars have sent single-source antibodies of fine strains to compete with the binding method and antigen capture method to distinguish the pig wild virus and the system. Zhulai County, but the method is more complicated. In 1952, Dr. Newson and Dr. Li Chongdao introduced the rovavac strain of rabbitized swine scar virus from the Philippines. Later Dr. Lin Zaichun obtained Lpc_chi from rabbits. It has been widely used after making vaccines. _Taiwanese pig cakes are well controlled. However, the rabbit rabbit pig vaccine is used to mix the materials used to inoculate rabbits, and the operation is more troublesome in the process of preparing vaccines. In addition, the breeds of rabbits inoculated with vaccinated rabbits are very messy and the commission varies greatly, which leads to the quality control of the manufactured vaccines; therefore, 'it is indeed necessary to develop a swine fever vaccine that has good effects in protecting pigs and does not have the above-mentioned disadvantages. [Summary of the Invention] In order to solve the problems existing in the swine fever vaccine of the prior art, the inventors of this case have conducted detailed studies on the traits of the LPC-China strain virus in tissue cells, and have tried to develop tissue culture vaccines using tissue culture methods. After comparing the proliferative traits of LPC-China strain virus in porcine kidney, pig testis primary cells, and various strains of pig-derived strains, it has been found that Lpc_china pig virus has the best proliferation in PK-CL pig-derived strains, so it was successfully developed LPC-TS strain virus domesticated from tissue culture cells. In addition, the LPC-TS strain virus and lactose and polyethylene, which were not propagated in PK-15-KL cells contaminated with type 1 porcine circular virus (pcv), were used. The freeze-dried vaccine prepared by the mixture of leaf drolidone (PVP) also showed complete immunoprotective effect on pigs. The present invention provides a novel rabbitized swine fever tissue culture vaccine virus strain, namely LPC-TS Strain of virus, characterized in that it is a rabbit strain of lean pig strain LPC-China strain 812 6 1241346. The batch of pig lean virus strains were subcultured to the seventeenth generation in PK-15 strain cells. The light-labeled antibody staining technique was used to select each strain by the limiting dilution method, and it was obtained after the eighteenth generation of subculture and was proliferated in cells not contaminated by type 1 porcine circular virus. After reverse transcription polymerase chain reaction After the technology and nucleic acid sequence analysis and comparison, it has been found that the LPC-TS strain virus of the present invention has 12 to 15 thymidine (poly-X) insertions on its 3, untranslated region nucleic acid, which is not seen in other studies. Known in rabbit strain of swine scar vaccine virus. That is to say, with the LPC rabbitized pig fatigue vaccine continental strain hclv (accession number: AF0915〇7), the car parent 'corresponding nucleic acid sequence of the LPC-TS strain virus of the present invention has a segment of 1214 bp at 12 to 15 T The insertion can be used to confirm the genetic marker of the LPC_TS vaccine virus strain. In addition, the LPC-TS strain virus has a good protective effect on piglets with low migration antibodies, but the virus content of i04G TCID50 must be under the southern migration antibody (1: 32 ~ 1: 214). Can overcome the interference of migration antibodies. The PK-15 strain cell line used in the present invention was assigned by Dr. Kelly M. Lager of the National Animal Disease Center (NADC) of the U.S. Department of Agriculture. The cells were not contaminated with Porcine Circovirus I (pcvi) and mycoplasma, so this PK-15 cell was also named pK-15-kl cell to distinguish it from other PK-15 cells. The invention relates to a tissue culture method for preparing a rabbitized swine fever virus tissue culture vaccine virus strain, which comprises administering the LPC-China rabbit strain of Xuzheng vaccine virus strain to PK-15 contaminated by type 1 swine circular virus. Subcultured cells proliferated in subsequent generations. After the eighteenth generation, the virus was propagated in PK-15-KL strain-free cells contaminated with type 1 porcine circular virus, and the lpc_ts strain virus was obtained. In the method of the present invention, the LPC_China system_vaccine virus strain was subcultured to rabbits 812 times. Compared with the previous rabbit swine fever vaccine, the spleen and lymph nodes of rabbits must be inoculated as a vaccine manufacturing material. The method for preparing the LPC_TS tissue culture vaccine virus strain of the present invention adopts a tissue culture method, which can make the virus proliferation more convenient and easy to operate. It is simpler and easier to control the quality of 1241346 vaccine. The present invention also contains a live tissue culture live virus vaccine virus spleen dwarf disk culture tissue live vaccine, which is characterized in that it is produced by proliferation in PK-1KL cells that are not contaminated by type 1 porcine circular virus. LPC-TS Classical Swine Fever Virus Strain. Bensmin's pig lean tissue culture live virus vaccine can be in the form of Lengkang dry, and it can additionally contain a protective agent. Preferred protective agents include lactose and polyvinylpyrrolidone (pvp ). According to the present invention, the protective agent used is composed of lactose and polyvinylpyrrolidone. Preferably, the protective agent is from about 5 to about 12% weight / volume of lactose and about 0 to the total volume of the vaccine. .2 to about 0.5% weight / volume of polyvinylpyrrolidone. More preferably, the protective agent consists of about 10% weight / volume of lactose and about 0.3% weight / volume of polymer relative to the total volume of the vaccine. It is composed of vinylpyrrolidone. The cold ✓ East dry porcine toxin vaccine is mixed with diluent a before immunization of animals. The diluent used for this purpose can be known to those skilled in the art. Preferably, the diluent used in the present invention is a phosphate buffer solution (P BS), mineral oil (0E), pure water or 5% glucose. More preferably, the diluent is phosphate buffered saline, mineral oil or pure water. Most preferably, the diluent used in this invention is Dish salt buffer solution. In the present invention, about 40 ml of the freeze-dried swine fever tissue culture live virus vaccine containing about 2 ml of a mixture of LPC-TS virus liquid and a protective agent can be added The diluted solution is used for vaccination of animals. In addition, the inventors of the present case have successfully designed primers specific for rabbit swine fever vaccine virus specificity for the differences between the virus nucleic acids of the swine fever field virus and the swine fever vaccine virus. Therefore, when using this primer to perform reverse transcription polymerase chain reaction (RT-PCR) on a test sample, if a rabbit swine fever vaccine virus is present in the sample, a specific 2RT_pCR product must be present, but there is no such product in the wild swine fever virus It appears that “specific” primers of the present invention can be effectively used to distinguish wild swine fever virus from classical swine fever vaccine. The mixed fresh fever virus vaccine of the present invention can be used to inoculate pigs by muscle or subcutaneous injection. The inoculation site can be Back ear, neck, back, buttock muscles Or subcutaneously. Preferably, the inoculation is performed by intramuscular or subcutaneous injection behind the ear and neck. Generally speaking, the present invention borrows: Toxicosis 1241346: the use of prescription, piglet immunization methods, the following two methods, depending on the situation Choose among them-seed = preventive injection ··-, after the sow has completed the basic immunization, and the immunization is about a long time before breeding, and the person who is no longer immunized will be born at the third week and the sixth week. The first shot and the first dose of pig cancer vaccine were shot at the time; and the second and sow pigs were vaccinated every year at the time of working babies after completing the basic immunization, and the piglets born were around the sixth and ninth weeks of age. The Zhuang shot and the first dose of pig scar vaccine are separately. In addition, the rabbitized pig lean vaccine of the present invention is used for sows. The immunization method is as follows: Shoot-sewing, no more immunizations will be given in the future; 3 and 2, once a year, a single dose will be injected when the fetus is empty. [Embodiment] The following examples are used to explain the technical content and achievable effects of the present invention but not to limit the present invention. Any equal changes and modifications made in accordance with the present invention are all within the scope of the patent application scope of the present invention. Swine lean tissue culture live virus vaccine virus strain and vaccine preparation

LPC-TS swine fatigue tissue. Receiving vaccine seed volume is first dissolved in Eagle's MEM (EMEM) cell maintenance solution (containing 2% bovine fetal serum) from the 812 batch of Lpc china rabbit pigs. Cancer vaccine 'Take the virus solution and inoculate PK-15 strain cells, soak it in a listening incubator for 90 to ⑽ minutes, and then wash her PK seven cells with EMEM three times before adding human emeiv cell maintenance solution. Place it in a 37 ° C warm box towel for three to four days, and place the aged pupal cells in a cold bed in a -8 ° C freezer. This culture is performed in the first to seventh generation of the culture method. The towels are all the same, but changed after the first generation _ without the first type strain of circular virus g-infected PK-15-KL strain cells to proliferate the virus and obtain [pc 丁 § 广 主 1241346 LPC-China virus first generation During the subculture period from the 17th generation, END (Exaltation of Newcastle Disease) and fluorescently labeled antibody staining techniques were used, and the clones were selected by limiting dilution method, in which the LPC-TS virus was used as EMEM cells. The maintenance solution was diluted 10-fold, and the 10-fold dilution was seeded into PK-15 cells in a 24-well culture plate. After 3 to 4 days, collect the virus solution, and then use fluorescent labeling antibody staining technology to determine the presence of fluorescence in the cells in the wells. Take the virus solution inoculated with the highest dilution of the virus solution and the fluorescence appears as seed poison to make LPC. -TS virus. Cell culture. PK-15-KL strain cells were cultured in cell culture flasks at a temperature of 36.5-37 C (50-80 ml of bovine fetal serum per 1000 ml, 0.7 g of NaHC03). And Eagle's MEM) for 72 to 96 hours, then discard the cell culture solution in the flask, and add an appropriate amount of PBS solution to wash the cell layer and discard the PBS. Then, after adding an appropriate amount of Trypsin Versene (TV) digestion solution, Place the culture flask into a 3r &c; c incubator to round the cells, shake or tap the culture flask to detach the cells. Pour the cell liquid into a sterile centrifuge tube and centrifuge at 300 X g for five minutes. Remove the supernatant After that, add a small amount of growth culture solution and disperse it with a sterile injection syringe, and then use cell culture solution to prepare a cell suspension of 30,000 cells / ml. The proliferation of the virus strain will have formed 60% -70% Monolayer of the above-mentioned pK_15_kl cell culture The liquid was discarded, and a seed virus (working seed vims) for LPC-TS production was inoculated into the cells with a virus amount of about 〇 丨 MOI (multiplicato 〇f infection), and the culture bottle was placed in a 37 ° C constant temperature chamber to make The cells were aspirated for 1.5 hours, and then a culture medium for virus proliferation (containing 10-20 ml of bovine fetal serum, 0.7 g of NaHC03 and Eagle, s MEM per 1,000 ml) was added, and the culture was continued at 37 ° c After 3 to 4 days in the thermostatic chamber, the infected cells are frozen and thawed once, and then the cells are separated by looo to remove cell debris. The supernatant was collected, and then filtered through a filter of 45 ° C. The obtained filtrate was the silk stock solution for vaccine production, and the virus stock solution was stored in a thief freezer for future use. LPC-TS virus potency test $ 1241346 diluted in cell growth medium (Eagle's MEM, which contains 5% bovine fetal serum (Hyclone), 100 u / ml penicillin, 100 pg / ml streptomycin and 10 mM HEPES, And PK-15-KL cells in 7.5% NaHC0 3) were first cultured in a 96-well plate, the next day when the cell monolayer reached 60-70% full, the cell culture solution was discarded, and then 10 The diluted virus solution was added to each well in an amount of 50 microliters per well, and placed on a rocker, so that the seeded cells were sucked in a warm box containing 5% CO2 for 60 minutes, and then 100 times per well was used. Replenish microliters of cell growth fluid. After 72 hours, the virus titer was determined according to the method described in the reference (Zhong Minghua et al., 199, LPC tissue culture and rabbit swine fever vaccine immunity comparison, Provincial Guarding Animal Trial Report 26: 15-22). The secondary antibody was changed to goat anti-pig IgGFITC labeled antibody. As a result, it was found that the proliferation of LPC-TS virus in PK-15-KL cells without PCV1 contamination had a virus power value of 1078TCID50 / ml, which was much higher than before. Preparation of vaccine The virus stock solution was taken out from the -80C freezer. After thawing, the virus was centrifuged at 600xg for 10 minutes. The supernatant was thoroughly mixed with the protective agent (lactose and PVp-K90) to make the final composition 10. % Is lactose and 0.3% is PVP_9G. The final semi-finished product is dispensed into a vacuum-dried vaccine bottle, and then frozen and vacuum-dried to make a finished vaccine product. Example 2 LPC_TS tissue vaccine preservation test Take four LPC-TS tissue vaccines and place them in a 37 ^ warm box. After seven days, two of them were taken out and placed in a 4C refrigerator, and two of them were taken out on the 14th day. The two vaccines treated as described above and the two untreated vaccines were each dissolved by adding 2 ml of pBS. After mixing the two vaccines of the same treatment, the virus titer was determined according to the method in Example 1. / Results found that LPC-TS was cold; after the East dry vaccine was abused in a 3rc incubator for one week and two weeks, its virus potency was 4. 8 and 3. 9 10 g of Ding Li 1 ml, and untreated Compared with this, it has dropped a lot (as shown in Table 1). 1241346 Table 1: Seven-valent period of vaccine after freeze-drying and 37 ° C TCID50 / ml 6.2 4 · 8 3.9 Example 3 Primer sequence for PCV 1 detection in LPC-TS tissue vaccine The primer sequence was designed to amplify a PCR product of 688 φ bp against the sequence of PCV 1. The primer sequences are shown below: F41: 5, ATACGGTAGTATTGGAAAGGTAGGG3, B42: 5, ACACTCGATAAGTATGTGGCCTTCT3. The viral nucleic acid was taken according to the DNA Mini Kit developed by QUIGEN, and 100 microliters of samples were added to 100 microliters of ATL buffer (Buffer ATL) and 20 microliters of Proteinase K ('56 ° C until tissue dissolves completely ') and then add 200 microliters of al buffer '70 ° C for 10 minutes' and then add 200 microliters Rise in absolute alcohol and shake for 15 seconds. Then, place the sample in the QIAamp_clumn (including 2ml collection tube) provided by QUIGEN, centrifuge at 6,000 X g for about one minute, and place the QIAamp spincolumin in a new 2ml collection tube. Add 500 microliters of AW1 buffer, centrifuge at 6,000 X g for about one minute, then place the QIAamp spin column into a new 2 ml collection tube, and add 500 microliters of AW2 buffer to ultracentrifuge for about one minute. Minutes, then put QIAamp spin cohlmn into a new h5 ml collection tube, add 2000 μl of AE buffer for _min, centrifuge it at 6,000 xg for about one minute, and finally extract the extracted Viral nucleic acid is stored in. Polymerase chain reaction · 1241346 The polymerase bond reaction is based on Mankertz et al. 1998. Identification of a protein essential for replication of porcine circovirus. J. Gen. Virol. 79: 21-227 and Meeban et al. 1007. Sequence of porcine circovirus DNA: affinities with plant circovirus · J · Gen · Virol · 78: 221-227. 6 microliters of the extracted DNA solution were premixed in various reaction solutions in a 65-mL centrifuge tube (primers 20 μM 0.5 μl, 1.25 μM dNTP 8 μl, 10 × Taq buffer 5 μl, and 2.5U Taq DNA polymerase), and add DDW to make up a total volume of 50 microliters, and directly put it into the temperature controller for PCR reaction. The reaction conditions are as follows: 〇 12 minutes, then 95 ° C, 20 seconds, 57 ° C, 20 seconds, 72 ° C, 45 seconds, for a total of 42 cycles; finally, 72 minutes for 10 minutes. The reaction product of ιχ TAE buffer solution was subjected to 2% agarose gel electrophoresis analysis. After the electrophoresis was completed, it was immersed in ethidium bromide (EtBr) and observed under the outside line and photographed. After dissolving the LPC-TS tissue vaccine in 2 ml of PBS, the procedure as described above was performed, and the PCR electrophoresis pattern was observed (Fig. 1), which confirmed that the pcv 1 in the lpc-TS tissue culture vaccine was not obsessed with the test standard. Example 4 LPC-TS tissue culture live virus vaccine and the immunoprotective effect of LPC-China rabbit swine fever vaccine _ comparison of the eleven-week-old second-generation speciflc pathogen free (SpF) Twenty-two pigs were divided into seven groups. The first group of four animals was immunized with 1/100 doses of LPC-TS vaccine diluted with PBS; the second group of four animals was immunized with 1/5 of pBS diluted. 〇 dose of LPC-TS vaccine; the third group of two-headed immunization was diluted with mineral oil 1/1100 dose of LPC-TS vaccine; the fourth group of two-headed immunization was diluted with mineral oil 1/100 In the 500-dose LPC-TS epidemic field, the fifth group of four-headed immunizations was diluted with pBs and the eight-dose dose of LPC-Chma vaccine; the sixth group of four-headed immunizations was diluted with pBs at / 5/5. The dose of 13 1241346 LPC-China vaccine; the second group of the seventh group was the control group, and each was injected with pBs or mineral oil (as shown in Table 2). Rabbit 2: Experimental design of efficacy evaluation of LPC-TS and LPC-China vaccines

Number of pigs in the group: vaccine 1 4 diluted 1/100 LPC-TS in PBS-2 4 diluted 1/500 LPC-TS 3 in PBS 3 2 diluted 1/100 LPC-TS 4 in OE 1 2 diluted 1/100 in OE 500 LPC-TS 5 4 1/100 LPC-China 6 4 diluted in PBS 1 4/500 LPC-China 7 2 diluted in PBS or OE Two weeks after vaccination, ALD swine fever (from (Supplied by the Animal Medicine Testing Branch of the Agricultural Committee of the Executive Yuan and the Animal Health Test Institute) Attacked 22 pigs, measured the anal temperature and observed the symptoms daily after the challenge, and on 3, 7, 10, and 17 days Blood was collected and oral swabs were taken to detect viremia or shedding. Experimental results Two days after challenge, except for pigs immunized with LpC-TS vaccine at 1/100 and 1/500 doses, the body temperature increased slightly (<40.5.00, all other pigs were It remained normal and showed tolerance to challenge. However, the temperature of the two pigs in the control group rose to 41.5 C four days after challenge, and the control group of pigs injected with PBS died and died on the 13th day after challenge. There are severe symptoms' on the verge of death, as shown in Figure 2. In addition, all pigs immunized with LPC_TS or LPC_China vaccine, no matter whether the dose is 1/100 or 1/500, did not develop viremia after re-challenge. The virus could not be isolated from the saliva of the pigs either. The control group of pigs could detect the disease from three days after challenge (3 Dpc) f., 14 1241346 Toxemia and detoxification (as shown in Table 3) Table 3: Number of viremia and detoxification found in pigs immunized and control group after challenge. Pig vaccine_Number of toxins / Number of detoxification_Number of challenge_ 0 DPC 3 DPC 7DPC 10DPC 17DPC Results

〇 / 〇 0/0 NT / 0 0 / NT 4 S

4 diluted 0/0 1/100 LPC-TS in PBS 4 diluted 1/500 LPC-TS in PBS 2 diluted 1/100 LPC-TS in OE 2 diluted 1/500 LPC-TS in OE 4 diluted in 1/100 LPC-China 4 of PBS Diluted 1/500 LPC-China of PBS 0/0 0/0 0/0 0/0 0/0 0/0 0/0 0/0 0/0 0/0 0 / 0 0/0 0/0 0/0 0/0

NT / 0 0 / NTP 4S NT / 0 0 / NTP 2S NT / 0 0 / NT 2S NT / 0 0 / NT 4S NT / 0 0 / NT 4S

The results showed that the immune pigs that had not been inoculated with the LPC-TS tissue culture vaccine of the present invention diluted in pBS or oE emulsion at a 1/100 or 1/500 dose were all tolerated, and they were completely protected without any occurrence. With clinical symptoms and no viremia, ^^ (3) was not detected in the organ tissues, which showed an immunoprotective effect comparable to that of the palpitative age vaccine. By the way, warships have died of illness, and only-pigs who have shot the vaccine diluted in OE emulsion seem to have a slight non-specific resistance.

15 1241346 Neutralizing antibodies produced by pigs vaccinated with LPC-China rabbit swine fever vaccine and LPC-TS tissue culture live virus vaccine Determination of the above-mentioned pigs one week and two weeks after immunization with LPC-TS or LPC-China vaccine And two weeks after challenge, the neutralizing antibodies in the serum of pigs (including the control group) were detected. The detection method was the indirect fluorescent labeling antibody detection method, based on references (Zhong Minghua et al., 1990, LPC tissue culture and rabbits). Comparison of immunity against swine fever vaccine, Provincial Trial Animal Research Report 26: 15-22; and Terpstra, C., et al "1984. The neutralizing peroxidase-linked assay for detection of antibody against swine fever virus. Vet. Microbiol. 9 : 113-120), and the second antibody was changed to goat anti-pig IgGFITC labeled antibody. The experimental results showed that one week after the immunization with the LPC-TS and LPC-China vaccines (pvw 1), no neutralization was detected. The production of antibodies, but the antibodies can be measured two weeks after the vaccine immunization (PVW2), and the antibody produced by the pigs immunized with the vaccine at a rate of 1/100 is higher than those with a dose of 1/500. Two weeks after the challenge, the immunization Large neutralizing antibodies produced by pigs The increase, as shown in Table 4. Table 4 • Serum neutralizing antibody titers of pigs after vaccination and challenge challenge Geometric number of pigs SN titer Geometric mean PVW0 * PVW1 PVW2 PCW2 4 Diluted in PBS 1 / 100 LPC-TS 0 0 32.2 197.2 4 1/500 LPC-TS diluted in PBS 0 0 17.7 2,041.7 2 1/100 LPC-TS diluted in OE 0 0 53.7 609.5 2 1/500 LPC-TS diluted in OE 0 0 8.1 305.5 4 1/100 LPC-China diluted in PBS 0 0 41.2 609.5 4 1/500 LPC_China diluted in PBS 0 0 12.4 609.5 1 Control group (PBS) 0 0 0 16 * PVW: Weeks after immunization ; PCW: Weeks after challenge Φ-, 16 1241346 Pigs tested for pestilence virus nucleic acid were sacrificed 17 days after challenge, including 22 immunized pigs and dying control pigs All were sacrificed, the macroscopic lesions were dissected and observed, and the spleen, lung, brain, tonsil, and intestinal lymph nodes were taken to make an emulsion. The swine fever virus was isolated by PK-15-KL cells and reverse transcription polymerase chain reaction ( RT-PCR) detection of classical swine fever virus nucleic acid (ALD strong). For the test method, refer to Greiser-Wilke et al. 2000. Molecular epidemiology of a large classical swine fever epidemic in European Union in 1997-1998. Vet.

Microbiol. 77: 17_27 and Lorena et al. 2001. Classical swine fever virus (C strain) distribution in organ samples of inoculated piglets. Vet. Microbiol. 81: 1-8. ⑴ Primer sequence: Based on the swine fever virus gene sequence published by Genbank, after comparing the differences between different genotype viruses, select the NS5B region to design the amplified primers. This primer is universal primers, that is, it can be applied to all Genotype of swine fever virus. Primer sequences such as F: GACACAACCAACTTCCACC R: TTCTGCTTCACCCACTTATA (2) Nucleic acid stroke: 200 microliters of the emulsion prepared from the organs or tissues of the above pigs was added to 1 ml of Trizoi total RNA extraction reagent, and mixed with a shaker Fifteen seconds, after standing at room temperature for five minutes, add 200 microliters of chloroform, mix for 15 seconds and let stand for three minutes, and then centrifuge at 4 ° C for 15 minutes at 2.00 (). The supernatant was extracted and placed in a clean micro-centrifuge tube, and an equal volume of isobutanol was added, and the mixture was shaken up and down to mix uniformly, and then allowed to stand at room temperature for ten minutes. Then, set it at 4 at 12,000 卬 111 / min. (: After 15 minutes of centrifugation, remove all solutions, and dry at room temperature for 10 to 15 minutes. Add an appropriate volume of secondary water-soluble 17 1241346 to dissolve the sediment and refrigerate for future use. (3) Reverse transcription polymerase Chain reaction (RT-PCR) Take 3-5 microliters of the prepared nucleic acid sample, add-pair of specific primers (202, reaction solution, Rnasin (Promega) 2U, AMV reverse transcriptase, listening valve offender, Polymerase and dNTP (25 mM) 'Fill up the treated secondary water to 50 microliters. In the orbital reactor_ 9600), the reaction is performed after receiving the reaction for 45 minutes, and the condition is 94. After 30 seconds at 30 ° C, 30 seconds at the pit, and 丨 minutes at the hunger, the reaction solution was subjected to electrophoresis analysis with 1.2% agar gelatin to detect the products after continuous cycling. The results of the test showed that all the vaccines were not immunized. Porcine fatigue virus was not isolated from the organ tissues of Xuzhi, and the results of RT-PCR were all negative; Porcine scar virus could be isolated from the two riding photos _ only in the age of _, and the RlVpCR result was also positive, However, the virus content in the viscera of the control group of pigs injected with 0E was much less than that of the other group injected with PBS. The results of RT-PCR of the interstitial lymph nodes were also negative, and the nucleic acid of gangrene virus could not be detected by RT_pCR, as shown in Tables 5 and 6. 18 1241346 Table 5: Isolation from challenged pigs after immunization and control Number of virus pigs positive / negative number of spleen, lung, brain, tonsil, and intestinal lymph nodes 4 diluted 1/100 in PBS LPC-TS 0/4 0/4 0/4 0/4 0/4 4 diluted 1 in PBS / 500 LPC-TS 0/4 0/4 0/4 0/4 0/4 2 1/100 diluted in OE LPC-TS 0/2 0/2 0/2 0/2 0/2 2 diluted in OE 1/500 LPC-TS 0/2 0/2 0/2 0/2 0/2 4 diluted 1/100 LPC-China 0/4 0/4 0/4 0/4 0/4 4 diluted in PBS 1/500 LPC in China PBS 0/4 0/4 0/4 0/4 0/4 1 Control group (PBS) +++ * +++ +++ +++ NT 1 Control group (OE) ++ + + + + • * Scores of the number of fluorescent spots • NT: 1241346 RT-pcR pair has not been detected for the swine fever virus nucleus of ^ complex organs ^ Negotiation of pig vaccines __ Positive number of spleen, lung, brain, almond fl ----- Lymph node 0 4 1/100 LPC-TS diluted in PBS 0 0 0 0 4 1/500 LPC-TS diluted in PBS 0 0 0 0 0 2 1/100 LPC-TS diluted in OE 0 0 0 0 0 2 1/500 LPC-TS diluted in OE 0 0 0 0 0 4 1/100 LPC-China diluted in PBS 0 0 0 0 0 4 1/500 LPC-China diluted in PBS 0 0 0 0 0 1 Control group (CPBS) 1 1 1 1 1 1 Control group ( OE) 1 1 1 1 1 Π — The results of the above experiments are all old, and the rabbits of the LPC_TS strain that failed to produce the virus were not contaminated with type-like virus (PCV 1), and pigs immunized with the vaccine After being attacked by ALD, its neutralizing antibodies increased significantly, no viremia occurred, and no swine fever virus nucleic acid was detected in its organs. Compared with the LPC-China rabbit swine fever vaccine, the LPC_TS tissue culture vaccine of the present invention shows quite good protective effect. jtfeLll. The effect of the dilution on the LPC-TS rabbit swine fever vaccine 20 1241346 \, the LPC-TS strain virus and the protective agent were mixed in the proportion of j · · *, and 2 ml of each bottle was dispensed in cold tumble dry, Then cold and dry. Take out six trial vaccines, divide pure water, PBS ^ 5% glucose and dissolve each of the two vaccines. After thorough mixing, the two vaccines are divided into two, and the knife is placed in a 5c refrigerator and a 32oC warm room. The positivity of positivity and virus was measured after 4 hours. Results-The pH change of the present LPC-TS rabbitized pig scar vaccine dissolved in pure water, pBS and 5% glucose at different levels is shown in Table 7. The pH values of pure water, pBS and 5% glucose stock solutions are 5.75, 716, and 3 86. The positive value of the vaccine diluted with pure water is lower, but the positive value of = 5 / 〇 glucose as the diluted solution is even more. low. The vaccine dissolved with pBs can maintain a fairly stable pH value in U.S.J .; the pH value of the vaccine dissolved in pure water and 5% glucose is higher than the original solution, but the positive value of the latter is still low, and It lowers to pH 5.51 after 12 hours, which may have an adverse effect on the virus. From the results of measuring the viability of the virus according to the fluorescent antibody staining method (as shown in Table 8), it can be seen that the LPC-TS strain virus was reduced by 0.7 · 10 μ㈤ in the freeze-drying process, and purified water and bath were used. The virus titer only decreased by 0.1 logioTCHV ml within 12 hours after lysis, and remained stable. However, for those who dissolve with 5% glucose, the virus valence at room temperature (R ° C) is 4 · 05 lOg10 TCHV ml, which is lower than those dissolved with pure water and pBS. Within u hours, it will be greatly reduced to $ 2.80GgiQ TCID5 () / ml. ❿ —: LPC-TS vaccine dissolved in diluent at different pH values. Diluent 5 ° C 32 ° 0 hours 4 hours 12 hours 4 Xiaoriji 12 hours DDW 6.80 7.10 6.96 6.71 6.39 PBS 7.20 7.24 7.18 7.25 7.12 5% Glucose 5.26 5.64 5.68 5.32 5.15 21 1241346 _____ 4 hours 32 ° C 12 hours 4.05 4.18 4.05 4.18 &lt; 2.80 &lt; 2.80 Table 8Stability of LPC-TS vaccine dissolved in different dilutions under different conditions (viral potency) , Expressed as a test promotion) '

Diluted at 5 ° C for 4 hours and 12 hours 4.18 4.18 4.18 4.18 3.55 3.55 DDW 4.30 PBS 4.30 5% glucose 4.05 From the above results, it can be seen that the pH value after dissolving the freeze-dried swine fever vaccine with 5% glucose is extremely low 'and LPC-TS Tissue vaccine is the most unstable in 5% glucose solution. Therefore, phosphate mash and pure water can be used as the dilution of LPCVrs tissue vaccine, but in order not to affect the physiological condition of tissue cells at the injection site, phosphate buffer is used as the dilution. Liquid is most suitable. Paste Example 6: LPC-China Rabbit Swine Fever Vaccine and LPC_TS Tissue Culture Vaccine Field Comparative Test The safety of the serocarcinoma vaccine was selected as the second pig farm in the area under the control of Yunlin Siguhe Prevention and Treatment Center. three

Two ages of immunizations at six weeks of age plus six-time immunizations and six-time-second immunizations, respectively, were injected with LPC_TS and LPC_China rabbitized pig fatigue vaccine; in another session, two immunizations at six weeks of age before breastfeeding and The two immunization methods of pre-lactation-primary immunization were also injected with LPC_TS and LPC_china traditional pig slaves. _ Growth of pigs immunized by the four methods described above. As a result, no adverse reactions were found in the LPC-TS and LPC_China rabbit pig strain vaccines (12,000 piglets) after immunization, including some purebred piglets. Chang Fa Niu grows up, so the age of LPC_TS series culture vaccine extremely female full 0 22 1241346 40 shirts once inoculated with vaccination at the age of three weeks plus six weeks of age-once and six weeks Γ = Γ Temple from the above pig farm Squat back, during the adaptation period before the challenge, _______________, 38 other main and control pigs were intramuscularly injected with a strong bone attack of 20 × 104, and the body temperature of the pigs was measured on the mother day. And observe the clinical — ^ Oral swabs and blood were taken when Chu was too high, and poisonous and poisonous; Toxemia 0 The test results showed that after the ALD poisoning attack, the test pig Lu Wei died 4 and 3 4 heads withstand. All four dead pigs developed fever (40m, after the dissection, they were determined to have died of AP, and had viremia, but no lean lesions in the pigs. Part of the fever phenomenon, after the dissection, it was found that the beta pigs had only Ap lesions, and the pigs had only viremia, but no pig disc lesions were found; in addition, the b pigs were normal and no diseased filamentous virus disease was found. However, The Shilinzhao group had a high fever (more than 411) and a strong onset of Lu Ji. All of them had county bloodemia, but their three positions only showed typical reading surface-focal, and the other pig had no pig-marked lesions (Table 9) Table 9: Social results of pigs vaccinated with LPC-Chma and LPC-TS swine fever vaccine after challenge

Use vaccine to count day __ number of pigs (with viremia)

Death due to AP is normal AP death due to swine fever 0 0 0 0

LPC-TS 3 weeks + 6 weeks 1 (1) 4 (3) 4 LPC-TS 6 weeks 1 8 (1) 1 LPC-China 3 weeks + 6 weeks 1 5 (2) 4 LPC-China 6 weeks id) 2 6 23! 241346 迦 I ^ LPC-China epidemic bud pair _ charm_qianli this fun IL cover immunized piglets once immunized with the same effect as the previous test, 40 pigs were vaccinated before breastfeeding plus six weeks of age Piglets once inoculated and immunized before breastfeeding-followed by piglets were repurchased from the above-mentioned breeding ground at 2.5 months of age, but injections were given in the only place before the day of repurchase, the day of transport, and the day after arrival. (Baytril, Rugao) ml / 10 kg body weight 'is used to prevent AP infection. Pigs and Lai Yu f are attacked with ald strong poison of 20 x 104 LD50, and the temperature of the pigs is measured by Wei Ri attack and Observe clinical symptoms'-When the body temperature of the pigs exceeds 40.5 ° c, oral swabs and blood are taken to determine detoxification and viremia. The results of the test show that all vaccinated ( The pigs including LPC-Chma rabbit pig pupae vaccine and LPC_TS tissue culture live virus vaccine) were all normal wealth, and had not developed toxemia and detoxification. Ershan Park paid the temperature in the second day of the attack. The temperature rose to 41 ° C, and all died of disease. The virus was also detected from the blood and oral cavity, and typical swine fever lesions were found after dissection (as shown in Figure 3 and Table 10). Table 10 Chma and LPC-TS swine fever vaccine

Results LPC-TS + 6 weeks before lactation 10 LPC-TS before lactation 10 LPC-China before lactation + 6 weeks 10 LPC-China before lactation 10 Control group 2 Number of pigs survived and died of viremia 10 0 0 10 0 0 10 0 0 10 0 0 0 2 2 24 1241346 Immunizations at dft age in sue—once and once in six-week-old vaccination—less than the average ap lesions in test pigs and their body temperature changes, foot temperature change = foot = And the pigs 'resistance to the venom is greatly reduced.' It is impossible to prevent the venom from losing weight. Although the virus still only has virus A disease, the test pigs can tolerate it. In addition, pre-lactation ^ week-old immunization-times and feeding-vaccination-second piglets were injected with Baytnl for two consecutive days before challenge to properly prevent Ap, so they were not infected with Ap after challenge. All tests have maintained a positive body temperature. "All of them have been resistant, and viremia and detoxification have occurred in the silk. She has been infected with vaccines in pigs, and all pigs that have been exposed to it have a high fever and have viremia. In this case, in actual field test towels, the Lpc_Ts Tissue Culture Squamous Vaccine Symptom # 相 # in Lpc_china Rabbit Chemical Vaccine has an immunoprotective effect on the animals. Example 7: LPC-TS tissue culture live virus, Differentiation of LPC-China Rabbit Swine Fever Virus and Swine Fever Field Virus According to the method for detecting swine disk virus nucleic acid in Example 4, the LpC-T; s of the present invention, including native and foreign swine fever field virus (HCV) , LPC-China, LPC-CN and LPC-PRK perform reverse transcription polymerase chain reaction, but the specific primers used to amplify classical swine fever virus use primers CP-3F and CP derived from the virus of the LPC-TS strain of the present invention -6, which has the following sequence: CP-3F: 5, -ACCCTRTTGTARATAACACTA-3 ,, CP-6: 5'-AAAGTGCTGTTAAAATGAGTG-3 ,. RT-PCR electrophoresis pattern of 12,140 bp nucleic acid in the 3 'untranslated region of viral nucleic acid (shown in Figure 4), swine fever field virus and rabbits of different origin The plague vaccine virus (LPC) can be clearly distinguished by the difference in the length of the RT-PCR products. Therefore, the specific primers CP-3F and CP-6 of the present invention can effectively distinguish swine fever field virus from rabbit swine fever (LPC-China). ) And tissue culture 25 1241346 Feeding virus (LPC-TS) vaccine virus. [Schematic description] Figure 1 is a PCR electrophoresis map of the LPC_TS tissue vaccine used to detect the presence of PCVi. Figure 2 is 0 to 0 after challenge The average body temperature curve of the 17th day of the year. Figure 3 is a graph of the average rectal temperature of pigs vaccinated with LPC-China or LPC-TS swine fever vaccine under different immunization plans: after Qin Dynasty. Figure 4 RT-PCR electrophoresis map of 12,140 bp nucleic acid in the 3 'untranslated region of classical swine fever field virus (HCV) and rabbit-derived swine fever vaccine virus (LPC) from different sources.

26

Claims (1)

Mouth 41346 The tenth application for the patent application was read. The patent application No. 92134947 was revised (revised) in the original patent application No. 92134947 ^ C ROC Patent Appln. No. 92134947 Amended unlined application patent scope Chinese text replacement page-Attachment (1) Amended Claims in Chinese-Encl. (7) (Submitted on July g? 2005) L〆 light pig lean tissue culture live virus vaccine strain, the deposit number is bcrc 970036 . 2. The tissue culture vaccine virus strain according to item 1 of the stated patent scope, which has a virus potency of i078TCID50 / mk. 3. A tissue culture method for preparing a swine fever tissue culture live virus vaccine strain such as item i of the patent application scope, which comprises the LPC-China rabbit swine fever vaccine virus strain 15 Virus-contaminated PK_15 strain-proliferated cells were proliferated. After the eighteenth passage, the virus was proliferated in PK-15-KL strain-contaminated cells that were not contaminated by type 1 porcine circular virus. 4. As described in item 3 of the scope of patent application *, the LPC_China virus strain fine rabbit was subcultured 812 times. 5. A live swine fever tissue culture vaccine containing swine fever tissue culture live virus vaccine strain, characterized in that it contains LPC-proliferated in PK-15_KL cells not contaminated by type 1 circular viruses. TS strain virus (registered number BCRC 970036). 6. ^ Applicable to the scope of the patent No. 5 vaccine, in which the virus power of Lp⑽ reached ι0.7 · 8 ταιν house liter. 7. The vaccine according to item 5 of the patent application, further comprising a protective agent. 25 8. If the vaccine in the scope of the patent application is applied for item 7, the protective agent includes lactose and polyvinyl-based bite 0¾ 〇9 · = The vaccine in the scope of the patent application for item 8, wherein the protective agent is relative to the total volume of the vaccine Composition of 5 u / ο reset / volume of lactose and 0.2 to 0.5% weight / volume of poly (vinyl) hexyl collar 0 27 1241346 10. The vaccine according to item 9 of the application, wherein the protective agent is composed of 10% weight / volume lactose and 0.3% weight / volume polyvinylpyrrolidone relative to the total volume of the vaccine. 11. The vaccine according to any one of claims 5 to 10, which is in freeze-dried form. 12. For the vaccine in the scope of patent application No. 11, it is mixed with the diluent before use. 5 13. The vaccine according to item 12 of the patent application, wherein the diluent is phosphate buffered saline, mineral oil or pure water. 14. The vaccine of claim 13 in which the diluent is phosphate buffered saline. 28