TWI230734B - Control of the T7 expression system by L-arabinose - Google Patents

Abstract

The present invention is drawn to processes for biologically controlling T7 expression system in Recombinant Escherichia coli strain BL21 (BAD) by using L-arabinose to active T7 promoter. The strain BL21 (BAD) are useful to produce a variety of heterologous proteins. Also disclosed is abiologically large scale operations of the strain BL21(BAD), it is convenient to carry out the culture in a fermentation tank with two-stages carbon source and stage input system.

Description

1230734 IX. Description of the invention: [Technical field to which the invention belongs] The present invention relates to a method for controlling gene tables and expression vectors in Escherichia coli with inducers. More specifically, the second invention is an induction with L-arabinose Control method for controlling the T7 expression system in a way 'This method is supplemented with a two-stage carbon source and a feed batch fermentation strategy for segmented feeding to achieve the purpose of mass production of recombinant protein. [Prior Art] Background of the Invention The production of recombinant proteins with commercial value or medical use from biological cells is an extremely important and economically prospective biotechnology industry. In general, biological cells that can be used as protein shells include microorganisms, insects, animals, and plant cells. Among them, the method of using microbial cells to produce recombinant proteins is more economically competitive, because microbial cells are more likely to be large in number. The nutrient matrix formulation required for culturing, rapid growth, and culturing is simple and inexpensive. In the past decades, as many scientific researches have used Escherichia coli as the core theme, the academic community has accumulated a large and detailed knowledge about the biochemistry of this species. No doubt, the development of E. coli to manufacture recombinant Protein production systems are also relatively more successful than systems developed using other biological cells. 1230734 For the purpose of using biological cells to effectively produce proteins, gene expression vectors are an indispensable weapon. There are many gene expression vectors developed in E. coli for different needs (Markides, Microbiol · Rev ·, 60: 512-538, 1996), among them, the most popular T7 expression system used in laboratories. The T7 expression system includes T7 RNA polymerase and one that can be polymerized by T7 RNA.酉 T7 promoter per drive. T7 RNA polymerisation is a product of phage T7 gene 1 (T7 gene 1). Compared to E. coli RNA polymerisation, it has extremely superior transcription capabilities for cloned genes. (Colomb and Chamberlin, J. Biol · Chem ·, 249: 2858-2863, 1974), and it is specific to the T7 promoter (Tabor and Richardson, Proc. Natl. Acad · Sci · USA, 82 : 1074-1078, 1985), based on the specific selectivity and superior transcription ability of T7 RNA polymerisation, Studier et al. (Studier and Moffatt, J. Mol. Biol. 189: 113-130, 1986; Studier et al., US patent 4,952,496, 1990) first developed the T7 expression system accordingly. This system contains a recombinant strain BL21 (DE3) and a gene expression plastid containing the T7 promoter, while the chromosome of the recombinant strain BL21 (DE3) contains a T7 gene controlled by the acUV5 promoter 1230734 at T7 In the expression system, although the method of slicing protein is extremely: it is easy to know that the production of the target substance is expensive and it is easy to know as 'however, the added chemical function of the protein is: and Γ yeast solution' is not conducive to the production of medical protein shellfish and cannot achieve uniform Induced per-cell. —The conventional technology is based on the production of a large amount of recombinant protein 化 galact〇pyran〇si / 3 丄) as a strict “material” gene expression plastids that enable bacteria to produce protein # 和 ”, MODE use There are important requirements ... that is, it has “infermentation regulations” and economical induction methods and high gene expression capabilities cannot reach 4%, and the Japanese t-type expression system is obviously used for industrial purposes. The reason is ⑴IPTG's shell '(2) | PTG is not metabolized by bacterial cells, but easily causes the fermentation broth to stain and makes the fermentation product difficult to purify' (3) IPTG is potentially toxic 'and therefore is not suitable for the production of medical products, ⑽' 52: 713-722, 1988), (4) Due to the insufficient regulation of the acUV5 promoter, the strain BL21 (DE3) produced a small amount of T7 RNA polymerization under non-induced conditions. The target gene product whose expression is controlled by the T7 promoter is thus produced, especially when the target gene product is potentially toxic to the host cell, the cell growth will be inhibited, and the plastid containing the target gene will be unstable (S tudier et al_, Methods in Enzymology, 185: 60-89, 1991) 'These shortcomings obviously limit the industrial applicability of the T7 expression system. 1230734 In another well-known technology, Wycuff and Mattews (Anal. Biochem., 277: 67-73, 2000), he developed the araBAD promoter to regulate the T7 gene 1, and then control the expression of target genes selected under the T7 promoter. . However, this conventional technique is to clone the T7 gene 1 regulated by the araBAD promoter on a plastid with a pACYCI 84 origin of replication, so it leads to excessively uninduced protein production and is not suitable for production. Potentially toxic recombinant protein. 1230734 [Summary of the Invention] Summary of the Invention Past research has found that the araSAD promoter, which can be induced by L-arabinose, has tight regulation, prompt activation and high-level expression. And other characteristics (Guzman et al., J. Bacteriol., 177: 4121-4130, 1995), so the present invention is particularly applied to the control of the T7 expression system with L-arabinose as an inducer. The main object of the present invention is to provide a method for controlling the T7 expression system in E. coli with an inducer in order to improve the T7 expression system and make it industrially applicable. Another object of the present invention is to use L-arabinose as an inducer to control the T7 expression system and cooperate with a two-stage carbon source and segmented feed fermentation strategy to achieve the mass production of recombinant protein by the strain. The present invention is to construct a recombinant strain BL21 (BAD) capable of inducing the production of T7 RNA polymerization using L-arabinose. The chromosome clamp of this strain contains the T7 gene 1 controlled by the ara ^ AD promoter and araC control. Gene (regulatory gene). Basically, the complex protein formed by the combination of AraC regulatory protein and L-arabinose can drive the activation of araS / \ D promoter, while AraC control protein 1230734 white matter itself has the ability to inhibit the araS / AD promoter, so recombination The production of strain T7 RNA aggregates depends on the presence or absence of L-arabinose, and the expression of target genes selected downstream of the T7 promoter is naturally controlled by L-arabinose. In a preferred embodiment of the present invention, taking the production of the carbamoylase protein of Agrobacterium radiobacter NRRL B11291 as an example, carbamoylase is scarcely produced in the strain BL21 (BAD) when it is not induced by the addition of L-arabinose. When L-arabinose is induced, the strain BL21 (BAD) produces carbamoylase up to 30% of the total cellular protein mass. This result shows that the system developed by the present invention has the potential for industrial fermentation to produce recombinant proteins. Fermentation with a high cell density feed batch and induction with a sufficient amount of L-arabinose, the strain BL21 (BAD) can produce more than 1000 times the amount of protein produced by shake flask fermentation. The "two-stage carbon source method" is applied throughout the entire feed batch fermentation step. Glucose is used in the initial fermentation stage to stabilize the recombinant plastids, while in the feed stage, a mixture of glucose and glycerol is used to induce efficiency and reduce costs. . In addition, in order to achieve the purpose of mass production of recombinant proteins, the present invention further develops the "segmented feeding method" at the feeding stage to achieve high cell density fermentation. Induced by the addition of an appropriate amount of L-arabinose or soybean extract, the strain BL21 (BAD) can produce more than 1,000 times the amount of protein produced by the flask-scale production of 1230734. In summary, the system developed by the present invention has the following advantages: (1) L-arabinose can be induced to produce recombinant proteins. The source of L-arabinose can be taken from plants such as soybean extract, which is not only economically competitive but also economically competitive. For bacterial metabolism and decomposition without causing contamination of fermentation broth. (2) The araBAD promoter is extremely sensitive. 10 # μ of L-arabinose can induce recombinant strains to produce large amounts of protein. (3) The strain BL21 (BAD) of the present invention is extremely stable and can maintain 100% stability of the ca "bam〇y | ase gene plastids to 100 cell generations, and the relative strain BL21 (DE3) Only the same plastid stability can be maintained for only 20 cell generations. (4) The "r-segment feed type" fermentation strategy developed by the present invention can culture the strain of the present invention at a fermentation tank scale to a high cell density, with a cell density of up to L 37. 5 9 dry weight cells. (5) The "two-stage carbon source method" strategy developed by the present invention can effectively maintain the stability of the recombinant plastids. The bacterial strains developed by the present invention are induced by 1-2% soybean extract, and the strains can be higher than the shake flask. Recombinant eggs with a scale of 10,000 times ^ 'This shows that the combination of the fermentation method developed by the present invention and the strain BL21 (BAD) constructed by the present invention can be used to mass-produce recombinant proteins, which has industrial practicality. 1230734 [Embodiment] Detailed description of the invention The method for controlling the T7 expression system by means of L-arabinose induction in the present invention includes the following steps: Construct a recombinant strain of the strain, the recombinant strain contains a 7 promoter And the chromosome of the recombinant strain contains the T7 gene 1 and arac control gene controlled by the 卩 promoter; the recombinant strain is cultured by a feed batch fermentation method, and the fermentation broth provided in the batch fermentation stage Contains glucose as a carbon source, and in the feeding stage, the feed liquid towel provided contains glycerin and carbohydrate as carbon sources to achieve high cell density fermentation; and after the cells reach-fixed high density, add humans containing L-arabin A sugar inducer 'causes the recombinant strain to produce a recombinant protein. The control method of the present invention further includes: the recombinant strain BL21 (BAD) induced by L-arabinose is produced, and a heterogeneous protein (hetero, ogous prôtejn) is produced in a shake flask scale, and the production of heterogeneous protein is selected here. The source protein line is used as the detection mode. Other aspects and advantages of the present invention will be disclosed in detail below with reference to the related drawings and the principle of the present invention through the illustration '. (1) Construction of recombinant strain BL21 (BAD) 12 1230734 In order to develop a T7 expression system controlled by L-arabinose, a recombinant strain was first constructed so that its chromosome contains a T7 gene regulated by the araBAD promoter. 1 and araC control genes. A. Selection of T7 gene 1 (1) The strain used for gene selection and the shake flask culture method used E. coli DH5a (deoR endA1 g yr96 hsdR17 supE444 thi △ ( lacIZYA-argF 169) rec A1 lacZM15), when culturing bacteria in liquid state, first take a few colonies from a solid culture solitary midpoint into a nutrient-based shake flask, and spin in a water bath at 37 ° C, 200 rpm Cultivate overnight in a culture tank, take out the bacterial solution in a 100-fold dilution volume every other day and inoculate it into a shake flask containing fresh nutrient substrate, and continue to cultivate according to the same culture conditions. The composition of the nutrient substrate is determined by the requirements. Bertani (LB) was cultured underneath. The antibiotics were also added to the medium as needed. In this case, the antibiotic ampicillin was added in an amount of 0.1 mg / mL. (2) Selection of T7 gene 1

Based on the published sequence of T7 gene 1 (Grachev and Pletnev, Bio org. Chem., 1 0: 824-843, 1984), we design a set of oligos that cover the coding region of T7 gene 1 but exclude the promoter region Ku Sman, its sequence is as follows-CGGAATTCCCAACCGCGTGGCA 13 1230734 CAAC and CCGGATCCTCGAGCTAACTCACATTAATTG C, and commissioned by GENSET Singapore Biotech company. Relevant breeding techniques are referred to Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laborat ory Press, Cold Spring Harbor, N.Y. (1982) —Book. The pMR_7wt (Mallet et al., Gene, 1 99: 149-156, 1997) plastid containing T7 gene 1 was used as a DNA template, and polymerase chain reaction (PCR) was used according to a reaction condition. Reaction) reaction to amplify and produce a 2.7 kb T7 gene 1 DNA product, where the reaction conditions are: 50 # L reaction solution contains template DNA (10 ng / mL), 2_5 active unit Pfu polymerization, each pair of oligo For oligonucleotide (0.5 // M) and four nucleotides (200 // M), first heat the reaction solution to 94 ° C for 3 minutes, then repeat 28 cycles under the following conditions: at 94 ° C heating for 1 minute, 55 ° C for 4 minutes, and 72 ° C for 1 minute. After all the cycles are completed, the heating is maintained at 72t for 10 minutes. The PCR products were subsequently purified using a NucleoSpin Nucl eic Acid Purification Kit (Clontech Lab., Inc.), and EcoRI and Hindi were used for restriction enzyme cleavage and re-purification. Finally, T4 DNA was used to bind each ( T4 DNA ligase) spots the DNA product into pKF2 (Hashimoto-Gotoh et al., Gene, 1 37: 211-216, 1993). Then, using Ecomm and Hindlll restriction enzyme 1230734, the DNA fragment containing T7 gene 1 was cut and recovered, and then bonded to pBAD18 (Guzman et al., J. Bacteriol., 177: 4121 • 4130, 1995). Subsequently, Cla and HindiII restriction enzymes were used to cut the D ΝA fragment containing a raC gene and T7 gene 1 selected downstream of the araBAD promoter, and then bonded to plastid pACYC177 to obtain plastid pACY C-G1 or pACYC184 to obtain pACYC. -G2. The T7 gene 1 selected for plastid p ACYC-G1 or pACYC-G2 is located downstream of the araBAD promoter, and the upstream region of the promoter contains the araC gene. · B. Selective gene fragments are clamped into the chromosome of the strain (1) P1 factor transduction (P1 transduction). Shaker cultured donor cells containing LB and 5 mM calcium gasified nutrients. When the cells grow to OD55Q (wavelength 550 nm absorbance) reaches 0.3, add about 108 P1vir phage lysate per milliliter, continue to culture until the cells are completely degraded ®, recover the decomposition solution and add 0.1 mL of air Centrifuge at 4500 g for 10 minutes and recover the supernatant. On the other hand, the gene receiving cells were cultured overnight in a shake flask containing LB nutrient base. The cells were recovered by centrifugation at 150 00 g for ten minutes, and then re-reconstituted with 2.5 mL of 10 mM magnesium sulfate and 5 mM calcium carbonate. Lyse the recovered cells. Take out 0-ΐ mL of the bacterial solution into a test tube, add an equal volume of the decomposition solution, react at 37 ° C for 30 minutes, and finally add 0.1 mL of 15 1230734 sodium citrate with a concentration of 1 M, and remove it from the test tube 0.1 mL of the mixed solution was sprinkled on the selection medium. (2) Recombinant strain construction In order to clamp the selection gene fragment into the strain chromosome, the DNA fragment containing the T7 gene 1 downstream of the araBAD promoter and the araC gene upstream of the araBAD promoter was replaced by plastid P ACYC-G1. HindlH and Xhol restriction enzymes were excised and recovered, and finally inserted into plastid pBRINT-Cm (Baibas et al., Gene, 172: 65-69, 1996) to obtain plastid PBRINT-G1. Then, pBRINT-G1 was transformed into calcium chloride-treated strain JC7623 (recBC sbcBC). The procedure for plastid transformation was to use the method of preparing elevated cells (competent ce 丨 丨). With reference to Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1982). The spear 1J clamped the gene on the plastid into the chromosome of the strain using homologous, gene weight, and homologous recombination methods. The transformed strain was then cultured in a chloramphenic solution containing 0_005 mg / mL 〇1) and 0.004% 5-bromo-4-chloro_3-indoly Bu / 5 -D_galacto-pyranoside (X-gal) on agar culture medium. One of the white colonies was cultured in shake flasks as a gene for the phage P1 factor transfer method. 16 1230734 was given to the cells. The decomposition solution was prepared according to the method (1) of B and the gene-receiving cell E. coli BL21 was infected. The cells were sprinkled on a broth containing 0.005mg / mL aeromycin and 0.004% X_ga 丨, and a white-colored cell was selected and the pCR method was used to check whether the chromosome contained the T7 gene1. The strain thus obtained was named BL2 1 (BAD). C). Shake flask-scale detection mode using strain BL21 (BAD) To test the feasibility of recombinant strain BL21 (BAD) to produce heterologous recombinant protein, we choose to produce carbamoyase as the detection mode. The biggest challenge in producing heterologous protein is that σ protein can easily form an inclusion body and possess the characteristics of poisonous cells, while carbam〇yase is derived from A "a⑴〇 (^ 8 "It is a heterologous protein" and it is easy to form endosomes and potential toxicity. Therefore, as a production mode, this protein shell is sufficient to provide the most rigorous detection method for the system constructed by the present invention. Α · Cultivation method and nutrition matrix and construction recombination The culture method of item A in the strain BL21 (BAD) is the same, and the shake flask is used to cultivate the bacteria. The S_M9 matrix formula contains 9 sodium persulfate per liter, 3 / potassium potassium, Q5 g gas sodium, and g gas ammonia. , 〇〇1 _ gasification conversion, 1 _ sulfur lock, 1 mg of vitamin B1 and 5 1230734 g yeast extract. B. Carbamoylase enzyme activity analysis

Carbamoylase enzyme activity analysis is mainly based on previously published methods (Chao et al_, Biotechnol. Prog., 15: 603-607, 199 9), and a unit enzyme activity (U) is defined as one millimolar product per minute, The specific enzyme activity unit is U / mg dry weight cells, and the volume enzyme activity is obtained by the product of the measured specific enzyme activity and the obtained cell concentration, and the unit is U / mL. C. The analysis of protein electrophoresis gel is mainly based on the method published in the past (Chao and Liao, J. Biol · C hem., 269: 5122-5126, 1994). The cells collected by centrifugation are processed with a French Press. After breaking, centrifuge at 15000 g for 5 minutes, recover the supernatant, and use Bradford analysis (Bio-Rad) to measure the protein concentration. Put 20 mg of protein samples into the electrophoresis gel one by one. D. L-arabinose-induced production of recombinant proteins will contain pTAHLIO (Chao et al., Appl. Microbiol. Biotechnol., 1230734 54: 348-353 (2000)), a plastid that regulates carbamoylase gene expression with the T7 promoter and PAR3-GR0-Km, a plastid that regulates gro ELS gene expression with the araBAD promoter, was simultaneously transfected into strain B L21 (BAD) to obtain recombinant strain BL21 (BAD) / pTAHL10 / pAR3-GR0-Km. The plastid pAR3-GRO-Km is derived from pAR3-GR 〇 (Perez and Gutierrez, Gene, 158: 141-142, 1995). A kanamycin-resistant gene fragment is composed of pKRP11 (Reeceand Philip, Gene , 165: 141-142, 1995) was cut with EcoRI restriction enzyme and recovered, and then adhered into plastid pAR3-GR0 to obtain plastid pAR3- # GR0-Km. First, culture the recombinant bacteria with different nutrient substrates and shake flasks. When the cells grow to 0D55 and 0.5, add 300 // M-L-arabinose, and then continue to culture the cells to the stage of stagnant growth. Centrifuge at 15 000 g for 10 minutes. The cells were recovered and the enzyme activity was measured. The results are summarized in Table 1. Compared with non-inducing strains, strains induced with L-arabinose can produce 50-100 times more soluble carbamoylase. Containing glucose in the nutrient base can effectively reduce the amount of protein produced during non-induction, but it is difficult to induce the production of a large amount of recombinant protein even with the addition of L-arabinose. This is because the araBAD promoter is subject to a substrate inhi bition effect. The result. On the other hand, the quality of proteins produced during non-induction is also higher in richer nutrient bases such as LB. Among them, we have found that tryptone contained in LB nutrient bases causes high protein production during non-induction. The main cause. These results show that the 19 1230734 strain developed by the present invention can use the L-arabinose induction method to control the T7 expression system to produce recombinant proteins, and has the effect of tight regulation and high protein production. As can be seen from Table 1, the strains developed by the present invention can induce the production of recombinant protein by using L-arabinose, and different concentrations of L-arabinose will produce the amount of protein produced by the bacteria. Therefore, recombinant strains BL21 (BAD), PTAHL1〇 / PAR3_GR0-Km were cultured in shake flasks at 3rc with LB as the nutrient base. When the cells grew to 0.055 and reached 0.5, add different concentrations of L-arabin Sugar, and then continue to culture the cells to the stage of stagnant growth. Centrifuge at 15,000 g for 10 minutes to recover the cells and determine the enzyme activity. As shown in Figure 1 (a), the amount of protein produced by the strain increases with the increase in the concentration of L-arabinose $. When the concentration reached 300 / zM, the protein yield reached saturation. Refer to Figure 1 (b) for protein electrophoresis analysis, where: []: protein standard; diameter 2: uninduced; diameter 3: induced with 10 / zM-L-arabinose; diameter 4: induced by M-L-arabinose; Path 5: Induced by 50 # Μ L-arabinose; Path 6: Induced by 100μ μ L-arabinose; Path 7: Induced by 300 ′ Μ L-arabinose; Path 8: 2000_L-arabinose Induction. L-arabinose can be induced by protein electrophoresis analysis and image analysis (GAS9000, UVltec ^ UK). The most soluble protein can be quantified to reach 30 / ° of total cell protein =, and a small amount of L-arabinose Such as 1 ο # Μ can induce the strain to produce total cellular protein equivalent to the township. These results show that the expression system developed by the present invention has superior protein production efficiency and high sensitivity of 20 1230734. E. Recombinant bacterial plastids Stability test: Recombinant strain BL21 (BAD) / pTAHL10 / pAR3-GRO-Km contains 20 mL shake flasks without antibiotic nutrient matrix and cultured at 37 ° C, 200 rpm overnight, and 0.2 mL of bacterial solution is removed. Inoculate to another containing In a 20 mL shaker flask with fresh substrate, continue to cultivate the next day under the same conditions to complete a culture cycle. At the end of each culture cycle, take a 0.1 mL sample and inject it into a test tube containing 1 mL of sterile physiological saline. After a series of serial dilutions in this manner, take out a 0.1 mL sample and sprinkle it on the agar culture medium. After incubating at 30 ° C for 16 hours, select 100 colonies to mark one agar culture medium and another antibiotic-containing culture medium. The number of colonies produced on each medium after incubation at 30 ° C for 16 hours on agar-pepper Yankee, and plastid stability is defined as the number of colonies on the agar-pepper Yankee containing antibiotics divided by the number of The number of colonies formed in the culture medium. The same culture cycle is continued as necessary to the end, and each culture cycle is estimated to pass about 10 cell generations. Similarly, we plastid pTAHLIO and pAR3-GR0-Km were simultaneously transplanted to the past The recombinant strain BL21 (DE3) / pTAHL1 0 / pAR3-GR0-Km was obtained from the strain BL21 (DE3) developed by the invention, and the stability of the strain bL21 (DE3) to the plastid was tested in the manner described above. The results are shown in the table. two It was shown that the strain BL21 1230734 (BAD) can maintain a plastid stability of 100/0 for 100 cell generations in the tested nutrient matrix, and the strain BL21 (DE3) has passed 50 cell generations under the LB nutrient base. Only 50% of plastid stability is maintained, and only 50% of plastid stability is maintained after 50 cell generations under the s_M9 nutrient base. It can be seen that the strain BL21 (BAD) developed by the present invention has extremely high plastid stability . (3) Fermentation of BL21 (BAD) by feed batch fermentation to achieve high cell density. The practicality of a gene expression system is still feasible when scaling up. In addition, when industrialized mass production of recombinant proteins, high The yield of protein is an inevitable consideration, and the key to its success is that it can obtain high cell density and high enzyme specific activity at the same time after the fermentation of recombinant strains is induced. Based on this, in the feeding stage of the feed batch fermentation, the present invention first develops the so-called "segmented feeding method" to achieve the purpose of high cell density culture. A · Segmented feeding method. The batch fermentation method is the best method for culturing high cell density. The basic theory is to use the amount of feed to control the specific cell growth rate, so that the bacteria cannot or can reduce the production of fermentation products. Such as acid. The section feeding method of the present invention is to divide the feeding into i sections (i = feeding sections at a constant flow rate F to feed in minutes: meaning: get formula ⑴ 'cell specific growth rate definition to get formula 22 1230734 (1) (2) The formula (3) can be used. The formula (3) shows that under the conditions of the specific cell growth rate and growth rate to be controlled, the feed flow of each section can be calculated. (1) (2) ) (3) Y = (Vi Xi. \ / I-1 Xj-1) / (F At S) d (Vi Xi) / dt = u (Vi Xi) F = (Vi-1 Xi ^ i [exp ( // At)-1]} / (YSAt) F · Feed flow rate (mL / min) S: Feed concentration (mg / mL) ® △ t: Stage feed time (min) m: Specific growth rate (V : Fermentation tank volume (mL) Ya-AX / ^ S: Growth rate (mg / mg) X ·· Cell concentration (mg / mL)

Vi_1, Vi: starting volume and final volume of the i-th segment

Xi-1, Xi · Initial cell concentration and final cell concentration in section i _ B · High cell density culture

A 5 L laboratory-scale fermentation tank (Bj0Stat, β · Braun Ger many) was used for the cultivation of scale-up strains. The conditions for the operation of the fermentation tank were set at 37 ° C, pH 6.5-7.0, and saturated oxygen at 15%. 300 mL of BL21 (BAD) / pTAHL1〇 / pAR3-G 23 1230734 R〇 " Km strain was used as inoculum (Example-item A), and the nutrient matrix was s = 0.2% glucose , When the cells are cultured to the end of the coffee, inoculation of jin = bacterial solution into a fermentation tank containing 15 L of nutrients, and the fermentation tank 1 medium composition contains 3 · 3 g potassium phosphate, 15 · 3 g per liter of solution Phosphorus, dipotassium, 3 46 9 gasified ammonia, 0.19 g of magnesium sulfate, 0.12 / l of iron gasified by 9 gasification | bow, 0.03 mg of vitamin B1, 5 g of yeast extract and 115 g glucose. When the cells grow in the batch fermentation stage and enter the stagnant growth stage, the feed liquid of Q_5 L will then use the A program (similar to the speed of the pump to use the pump to enter the fermentation tank until the end of the feed. The nutrient matrix component of the liquid For each liter of solution containing 6 g of ferric chloride ammonium sulfide, 20 g of yeast extract, and 300 g =, as shown in Figure 1, after the batch fermentation is completed, it will be fed in a segmented method. The final fermentation result can obtain the total cell stem. Weighs 75g. /

BL21 (BA Si-Left & Arabinose-Induced High Cell Density D) Produces fermenter-scale recombinant proteins. Monthly = batch batch fermentation system applies "two-stage carbon source method" to source A: Dufa— yeast. In the batch fermentation stage, glucose is used as: modified; the plastids in the recombinant strains, and in the section feed fermentation stage I = picking a mixture of Γ sugar and glycerin as a carbon source, with a view to-aspects; = = pull; 6 sugar induction One failure to promote a large number of recombinant eggs is to reduce fermentation costs. 24 1230734 A. High-cell-density fermentation by stage carbon source method and segmented feed method A 5 L laboratory scale fermentation tank (B, 0, 细, ⑽, 作为 many.) Was used as a large-scale culture. Setting conditions for fermentation tank operation

C PH 6.5 7.0, saturated oxygen with a dissolved oxygen of π%. 300 mL of BL21 (BAD) / pTAHL10 / _3 G RO-Km strain was used as inoculum in the previous flask culture (Example 18 items), and the nutrient matrix was $ -M9 plus 0.20 / 0 glucose. When the cells are cultured to 0 d5, the bacterial solution is inoculated into a fermentation tank containing 1.5 L of nutrients, and the medium in the fermentation tank contains 3.3 g potassium phosphate per liter of solution, 15 3 g scales , Dipotassium, 3.46 g of ammonia chloride, 0.19 g of magnesium sulfate, 012 g of iron taurine, 0.09 g of chloride, 0.03 mg of vitamin B1, 5 g of yeast extract, and 11.5 g of glucose. #Cells grow in the batch fermentation stage. Into the growth stage ’1 L of feed solution is then pumped into the fermentation tank at the flow rate determined by formula (3) until the end of the feed. The nutrient matrix components of the feed solution contained 12 g of gasified ammonia, 14 g of magnesium sulfate, 0 g of iron sulfide, 40 g of yeast extract, 100 g of glucose, and 0 g of glycerol per liter of solution. The broth used throughout the fermentation process excludes the use of antibiotics. B_ Induction of a large amount of recombinant protein with a trace amount of L-arabinose 25 1230734 Induction of L-arabinose at the end of the feeding stage of the batch fermentation of the above-mentioned recombinant strain BL21 (BAD) / pTAHL1 0 / pAR3-GR0-Km . When the cell density is 18g dry weight cells per liter, it is induced with "L-arabinose per liter". On the other hand, to reduce the fermentation cost, plant extracts rich in L-arabinose such as soybean extract are also used as inducers. In addition, according to the fermentation curve in Figure 2, the appropriate induction time is selected, such as 10 hours or 16 hours after the section feeding. The result is that the induction condition is 10 hours or 6 hours after the section feeding, and the estimated L-arabinose is used as the induction saturation. Induced by the amount of 0.10.2% soybean extract, the cell density of fermentation culture can reach about 35g dry weight cells per liter, and the enzyme volume activity reaches 2.92 U / mL. The total recombinant protein produced by the fermentation has a total of 8 760 U This yield is 100% of the protein quality obtained in the shake flask method. In addition, the stability of the plastids contained in the tested strains after the end of fermentation has also reached 100%. These results show that the strains developed by the present invention have High stability and scale-up production of a large number of recombinant proteins, which is extremely industrially practical. Efficacy of the invention According to the present invention, the T7 table is controlled by means of L-arabinose induction. The control method of the system requires only a trace amount of L-arabinose or the use of inexpensive plant extracts such as soybean extract to achieve the effect of inducing the production of a large amount of recombinant protein, which is particularly economical. In addition, in order to effectively utilize the present invention, The strains reach the goal of industrial mass production of recombinant protein 26 1230734. The present invention develops a high-cell-density fermentation strategy and successfully mass-produces recombinant proteins on a fermentation scale, the yield of which exceeds 1,000-fold flask-scale production.

27 1230734 [Brief description of the drawings] Further preferred features of the present invention are independent items in the scope of the patent application and the subsequent description of the embodiments, which refer to the following drawings: Figure 1 (a) shows the implementation of the present invention The graphs of the examples illustrate the quality of protein produced by L-arabinose-inducing bacteria at different concentrations. FIG. 1 (b) is a diagram showing a protein electrophoresis analysis example according to the present invention. FIG. 2 is a graph showing an example of the present invention, illustrating the feeding stage of the feed batch fermentation using the segmented feeding method (long strip-shaped area) for the recombinant strain BL21 (BAD) / pTAHL10 / pAR3-GR 〇-Km high cell density fermentation. Table 1 shows the effects of different nutritional matrices on recombinant protein production. Table 2 shows the stability of plastids in recombinant strains BL21 (BAD) and BL21 (DE3). [Description of main component symbols]

28 1230734 Table 1. Specific activity of nutrient matrix enzymes (U / mg dry weight cells) Induced non-induced LB 0.202 0.004 LB + glucose 0.033 0.003 S-M9 + glycerol 0.191 0.002 S-M9 + glucose 0.021 0.001 Note: The carbon source concentrations listed in the table are all 0.4%. 1230734 Table 2 cell generation BL2KBAD) BL2KDE3) LB S-M9 LB S-M9 10 100% 100% 100% 100% 30 100% 100% 70% 84% 50 100% 100% 50% 68% 100 96% 100% 20 % 35% Notes · S-M9 contains 0.4% glucose.

Claims (1)

1230734 The recombinant protein. 4 .: Shen: The control method described in item 1 of Fan, wherein the fermentation broth supplied in the fermentation stage ^ θ contains glucose as a carbon source to stabilize the shell. 5. The control method described in item 2 of the scope, wherein the feed liquid of the feed stage 1 contains glycerol and glucose as carbon sources, so as to facilitate the production of the product of the selected gene by the Arabidopsis And stabilize the plastid. 6. According to the control method described in item 2 or 5 of the application scope, the product of the gene is the recombinant protein. ^, Colonization • The control method according to item 1 of Shen ^ ㈣, wherein the high density reached by the cells is 18 g dry weight cells per liter. 8. The control method according to item 1 of the application scope, wherein the feeding method used in the feeding stage includes a section feeding method. 9. The control method according to item 1 of the scope of application, further comprising a detection method, which increases the number of the recombinant strains on a small scale, and adds L-arabinose to induce the production of a heterologous protein 30 1230734 (heterologous protein) 〇10. The control method according to item 9 of the application scope, wherein the heterologous protein easily forms an inclusion body and has potential toxicity for detecting the feasibility of the T7 expression system. 31