TW581809B - Genetic engineering toxoid admixed bacterin vaccine of actinobacillus pleuropneumoniae - Google Patents

Abstract

This patent is concerned with a genetic engineering toxoid Apxl admixed bacterin vaccine of Actinobacillus pleuropneumoniae including serotype 1, 2 and 5. The major component of this vaccine is a recombinant Apxl polypeptide made from A pleuropneumoniae serotype 1 by inserting the Apxl gene into the expression vector pET32a and being expressed in Escherichia coli BL21 (DE-3). This Apxl is a nonhemolytic fusion polypeptide with a molecular weight of 130 kDa and is a potent immunogen.

Description

581809 at ______ B7 V. Description of the Invention (/) Field of the Invention The present invention relates to a mixed vaccine of toxin ApxI and dead bacteria of genetic engineering of actinobacillus pleuropneumoniae, especially a vaccine against swine pleuropneumonia caused by actinobacillus pleuropneumoniae. Background of the Invention: In 1964, Shope [J. Exp. Med., 119: 357-368] first reported the outbreak of swine pleurisy pneumonia in Argentina, and it was possible to isolate ^ ⑽PPne pleuropneumoniaei ^ H ^ jActinobacilluspleuropneunioniae (referred to as Ap). After that, other similar reports in Switzerland include Nicoiet and Koning [Vorl. Mitt. Path. Microbiol. 29: 301-306 (1966)]. Nielsen [IPVS, pl03 (1984)], Little [Vet. Rec. 87: 399-402 (1970)] in Denmark, Switzerland, the United Kingdom, Canada, and Australia, Schiefer et al. [_Can. J · Comp · Med · 38 : 99-104 (1974)] and 仏 乂 1 ^ & et al.] ≫ 15 __ > VII. J. 50: 255-259 (1974)]. In Japan, Kume et al. [Jpn · J. Vet. Sci. 48: 965-970 (1986)], Nakai and Kume [Jpn · J. Vet. Sci. 49: 1141-1144 (1987)] and Suzuki et al. [ Jpn. J. Vet. Sci. 50: 1264 -1267 (1988)]. Gunnarsson et al. [Am. J. Vet. Res. 38: 1111-1114 (1977)] in Korea also reported this disease. The first outbreak in this province was reported by Xu and others in July 1975 [Taiwan Livestock Research Institute 64 / 65-year Research and Experimental Report, 191-197]. Most of the pigs were 3 to 6 months old. It can cause disease even in suckling pigs at 4 weeks of age for many years [Qiu Hongying Master's Thesis, National Chung Hsing University Veterinary Research Institute, Taichung, Taiwan (1987)], and the serotype is the most common serotype 5 from 1975 to 1985 In addition to type 5, there are still serotypes such as type 1, 2 and 3, and many drug-resistant strains have appeared, especially the first serotype is used as the paper standard. China National Standards (CNS) A4 Specifications (210X297 mm) HH- n ^ i ml —ϋ —.I ϋ-in (Please read the notes on the back before filling out this page)-Ding, printed by the Intellectual Property Bureau of the Ministry of Economic Affairs, Consumer Cooperatives, 581809 Wisdom of the Ministry of Economic Affairs Printed by the Consumers' Cooperative of the Property Bureau V. Description of Invention (2) [Zhang, Journal of the Republic of China Veterinary Association, 22: 129-135 (1996)], causing considerable economic losses to the pig raising economy. Because this disease is mostly an acute infection, it is often violent because it is too late to treat. Therefore, even if an effective drug is not used in a timely manner, it will lead to an irrecoverable situation, thus highlighting the need to develop an effective vaccine for epidemic prevention. Ap is a Gram-negative bacterium and has 12 serotypes. The secreted exotoxin ♦ 'Mi is in Actinobacillus pJeuroprwumoniae RTl toxin, which is called Αρχ, and is divided into Αρχ I, Αρχ 11 and Αρχ IΠ, whose molecular weights are 1.05. kDa, 103 kDa, and 120 kDa [Kampetal ·, Infect · Immun. 59: 3079-3085 (1991)], but the new and old classification methods are different, and the recent literature mostly adopts unified naming (ie Αρχ I, Αρχ II, Αρχ III) . Αρχ I can be taken from serotypes 1, 5a, 5b, 10, 11, etc., and has cytotoxicity and hemolytic effect; Αρχ 11 can be taken from serotypes 1, 2, 3, 4, 6, 7, 8, 9, 1 12, etc., with cytotoxicity and weak hemolysis; Αρχ III can be taken from serotypes 2, 3, 4, 6, 8, etc., has cytotoxicity, but no hemolysis [Kamp et al., Infect. Immun. 59 : 3079-3085 (1991); Chang et al., DNA 8: 635-647 (1989); Chang et al., J. Bacteriol. 173: 5151-5158 (1991) and Frey etal., Infect. Immun. 60 : 167 Bu 1676 (1992)]. In past literature reports, many Gram-negative bacteria have secreted some high molecular weight (100 kDa ~ 110 kDa) cytotoxins. This cytotoxin requires cytotoxicity to produce cytotoxicity and has a close relationship with alpha-hemolysin (HlyA) in immunology and its genes. These toxins were later classified as the RTX family. The RTX family was named based on the repeated arrangement of glycine / aspartic acid found in the C-terminal third of the toxin proteins. Therefore, RH is Indicate (read the precautions on the back before you fill in this page). Binding * Staple-line paper size applies Chinese National Standard (CNS) A4 specification (21〇 > < 297mm) 581809 Employees of Intellectual Property Bureau, Ministry of Economic Affairs Printed by Consumer Cooperatives 5. Description of Invention (3) Repeat Toxin [Forestier et al., Infect. Immun. 59: 4212-4220 (1991); Strathdee and Lo., J. Bacteriol. 171: 916-928 (1989)] . In addition, there are four genes related to these RTX toxins: C, A, B, D, etc. (Except the B and D genes of Aρχ II may disappear during the evolution process, so Aρχ II does not have B and D genes) A gene It is a structural gene of toxin. The product of gene C deactivates gene A through acylation reaction, that is, gene C is an activator gene, and gene B and D are related to the secretion process of RT1 toxin, that is, B and D genes have the role of transporter [Jansen etal ·, Infect. Immun. 61: 3688-3695 (1993)]. In the past 20 years, there are Weng et al. [Journal of the Republic of China Veterinary Society, 2: 67-71 (1976); 65 / 66-year research and experimental report of the Taiwan Sugar Livestock Research Institute, 219-224 (1977)], Xu et al. [ 65-66 year research experiment report of Taiwan Sugar Animal Research Institute, 147-155 (1978)] and Zhang Shi et al [67-68 year research experiment report of Taiwan Sugar Animal Research Institute, 163-173 (1979); 68 / 69-year research and field test report, 103-11 (1980); 70 / 71-year research and experimental report of Taiwan Sugar Livestock Research Institute, 83-87 (1982)] Explore issues. Roche [Journal of the Republic of China Veterinary Society, 13: n9_126 (1987)] also performed immunization on pigs immunized with serotype 5 pod serotype antigen, and the above authors have achieved considerable success. However, to date, no literature has reported the use of genetic engineering methods to make toxins secreted by Ap into subunit vaccines as a precaution against this disease. Our years of experience are well aware of the deep potential of Αρχ 丨 G05 kDa), although Zhang Gannan (one of the inventors) has previously used toxins (104 kDa) secreted by Ap serotype to make toxoids and dead bacteria Mixed vaccine (has obtained the patent right, the patent certificate of the Central Standards Bureau of the Ministry of Economic Affairs, the number of patent rights: invention No. 504 丨 5) $ Paper size suitable for China National Standard (CNS) A4 specification (2ι〇χ 297 public Seam) — (Please read the precautions on the back before filling out this page) • Binding · Threading · 581809 V. Description of the invention (minutes) Its immunological protection rate is over 8% 2% 'Because the first serotype of Ap is in the province region It is the most toxic and drug resistant strain. The toxin is obtained from AP of the first serotype. However, the traditional method of extracting Ap exotoxin requires expensive NAD (Nicotinamide adenine dinucleotide), which leads to high manufacturing costs. Using the genetic recombination method to make a subunit vaccine can reduce the cost by about 10 times, thereby improving the efficiency and practicability, and can benefit the pig industry. SUMMARY OF THE INVENTION The present invention relates to a novel actinobacillus pleuropneumoniae vaccine, particularly a vaccine against porcine pleuropneumonia. Including the recombinant ΑρχΙ polypeptide obtained from the ΑρχΙ gene of Ap 1 serotype by molecular colonization, and a mixed vaccine of Ap serotype 1, serotype 2 and serotype 5 dead bacteria. Different from Frey and Nicolet [Infect. Iirnnun. 56: 2570-2575 (1988)] and Frey et al. [Infect. Immun. 57: 2050-2056 (1989) found in the cell culture supernatant of Ap 1 serotype Of heat-resistant hemolysin with a molecular weight of 105 kDa and a pI value of 4.3, and cohaemolysin with a molecular weight of only 27 kDa '. The inventor of this case used a 50% to 70% ammonium sulfate salting-out method from Ap The protein was separated and purified in the upper layer of cell culture, and a heat-resistant polypeptide mainly containing a molecular weight of kDa 'pi and a value of 7.1 was obtained without initial hemolysis [Chang and Chen,

Proceedings, The 8th Seminaron Science and Technology, p. 103-115 Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs (1988)]. The inventors of the present case further found that when the newly isolated dopeptide was used to infect the respiratory system of mice and pigs by artificial inoculation, the tissue lesions caused by the lungs of mice and pigs were similar to those performed with Ap live bacteria. Infected people, the lung damage caused by the infiltration of monocytes and polymorphonuclear cells, bleeding, edema and so on. In addition, when porcine anti- ° Ap serum ^ was used for antigen-antibody reaction, it was found that the anti-serum would bind to this polypeptide, so these experimental results should prove that this newly isolated polypeptide was the target of Ap The second secreted hemolysin may be related to the toxicity or pathogenicity of AP. The role of this polypeptide as a vaccine for immune pigs not infected with Ap or its active ingredient should be feasible. & The inventors of the present case then further studied whether the vaccine can be formulated with the above-mentioned novel genetically engineered recombinant polypeptide-mixed Ap dead bacteria to produce immunoprotective effects on pigs. Eight people were excited. The test results found that the mixed vaccine composed of Ap Αχχ1 toxin and Ap bacterium of blood type π and g can provide more immune protection than the traditional type of dead bacteria vaccine (Table 2 ). ~ The inflammation foot selection is suitable for the preparation of the pleural pneumonia actinomycin toxin human Yang 丨 mixed with dead bacteria ^ 8r 1X 8-The adjuvant of the invention description (r) should be within the scope known to those skilled in the art, and cooperate with In the manner of administering the vaccine, the adjuvants may include aluminum hydroxide aqueous adjuvant, mineral oil, alum, synthetic polymers, and complete or incomplete Freund's adjuvant, etc., especially incomplete Freund's adjuvant is preferred. The composition of the mixed vaccine in this case can be 1 ml of dead bacteria vaccine, in which the dead bacteria are made by mixing equal amounts of dead bacteria of serotypes Ap, 1, 2 and 5, and the dead bacteria concentration of each type is 50 mg / ml. It is better to add 1 ml of Ap toxoid, and the concentration is 2mg / ml. 1 ml of incomplete Freund's adjuvant can be added to this vaccine when preparing this vaccine. It should be noted that the method of administering the vaccine of the present invention is not limited to those taught herein, and it can be divided into intramuscular, subcutaneous or mixed with feed or made into lozenges and administered orally depending on the type of preparation. The present invention will be further illustrated by the following examples and drawings. However, as will be understood by those skilled in the art, these examples are only used to briefly describe the features of the invention of this case, not to & make the invention. (Please read the precautions on the back before filling out the equipment. Printed experimental case of the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs. I. Gadget: (1). Field strains: isolated from cases in pig farms in southern Taiwan, the following The antiserum obtained after immunizing rabbits with the standard strain is identified. The field strain is further used as a component of a dead bacteria vaccine made by the inventor of the present case. (2) Standard strain (for the identification of the above field strains): Know 1 , 2 and 5 types of Jinqing were assigned by Dr. Zhang Jingnan of Taiwan Sugar Animal Production Institute. Case two: Preparation of Hemolysin Aρχΐ of Actinobacillus pleuropneumoniae (Ap): (1) Preparation of bacterial genomic DNA : Bacterial genomic DNA was prepared according to the method of Roussei and Chabbert [J Gen. Microbiol, 104: 269-276 (1978)] with a slight modification: the Ap serotype Ap field strain (CH 9800) was cultured in 200 ml BHI culture medium containing 0.01% NAD (nicotinamide adenine dinucleotide, Sigma) for 18 hours' at 4 ° C, 10, 00, and 30 minutes after centrifugation, and the precipitate was added to 15 ml of TE (10 mM Tris -HCl, 1 μM EDTA, pH 8.0) Mix and centrifuge at 10, _xg for 15 minutes, take the precipitate and mechanically te, and add 100 μΐ of lysosome (10 mg / ml in TE) and 100 μΐ of RNase A (10 mg / ml in 0.15 Μ) at the same time. NaCl) After 30 minutes at 37 ° C, add 200 μΐ of 20% sodium lauryl sulphate and proteinasek at a final concentration of 100 pg / ml, and then incubate at room temperature for 18 hours, then at 12, OOOxg, at 4 ° Centrifuge for 30 minutes, take the supernatant and add an equal volume of this paper. The size of the paper is applicable to Chinese National Standard (CNS) A4 (210X297 mm). Order-line _581809 B7 Printed by the Consumer Cooperative of Intellectual Property Bureau of the Ministry of Economic Affairs (彡) Extraction solution of phenol: chloroform: isoamylacohol (25: 24: 1), uniformly mix, centrifuge at 10,000 × g for 10 minutes, take the supernatant, repeat the extraction once, and then slowly add the same amount of ether. After centrifuging for 10 minutes, take the bottom solution (containing genomic DNA) and place it in a 68 ° C water bath until there is no B & E taste. Add 1/25 volume of 5M NaCl and 2.5 times the volume of 1.0. 〇% alcohol, placed at -70 ° C for 15 minutes, and then with 12,000, leave at 4X After 30 minutes, discard the supernatant, add 5 ml of 70% alcohol, and centrifuge at 12,000 × g for 10 minutes at 4 ° C. Discard the supernatant and dry the precipitate in a vacuum dryer. J5 Min., Add the appropriate amount of TE solution to fully dissolve the genomic DNA. (2) Polymerase chain reaction (PCR) Synthesis of two primers (ApxI-Bl: 5'GCG ^ AI ^ ATGGCTAACTCTCAGCTCGA3, ApxI-XS: 5) 'AAG £££ ^ I ^ TTAAGCTGCTTGTGCTAAAGAATA3, where · (jGATCC is the restriction enzyme restriction site' CCCGGG is the restriction enzyme restriction site and gQGAG is the restriction enzyme restriction site.) Use these two primers and the first serotype Ap Genomic DNA is used as a template to perform a PCR reaction to obtain a DNA product with 3072 nucleotides (3.072 kbp). The reaction process of PCR is as follows: the two strands of DNA are separated at 94 ° C for 5 minutes (the so-called denaturation) ) Then repeat the following reaction 35 times; 94. (: After 1 minute of denaturation at 50 ° C, make the primer stick to the complementary position on the DNA, and then let the DNA polymerase perform DNA at 68 ° C, 1.5 minutes After synthesis, the reaction time at 68 ° C was increased by 3 seconds from the previous time, and 35 minutes and then reacted at 68 ° C for 5 minutes. (3) Performance vector pET32a The performance vector pET32a was purchased from Novagen Corporation (Novagen, USA). , WI, USA). This vector can express a large number of genes cloned on it, and The expressed fusion protein carries 6 X His · Taq to facilitate the subsequent purification of the protein. (4) Construction of the recombinant expression vector The above polymerized strand reaction DNA product is used to limit the enzyme 5 lake? Η I and then adhered after treatment ( ligated) to the expression vector pET32a treated with the same restriction enzyme and dephosphorized. The recombined vector dm was transformed to £ co // BL21 (DE-3), and the transformed bacterial solution was homogenized. It was smeared on an LB agar plate containing ampici 11 in (100 // g / ml) and chloramphenicol (34 // g / ml) and cultured for 18 hours. After that, individual colonies were selected from the culture medium in 4ml, containing ampicillin (100 // g / ml) and chloramphenicol (34 / zg / ml) in LB liquid medium, after 37 (please read the precautions on the back before filling in. t ·)-binding · book size applicable to China Standard (CNS) A4 specification (210X297 public celebration) 581809 Α7 Β7 V. Description of invention (7) Printed by the Consumer Cooperative of Intellectual Property Bureau of the Ministry of Economic Affairs

After 8 hours of C culture, plasma was extracted. The extracted plastids, A, were treated with restriction enzyme recipe I and // ^ 1, and then analyzed by agarose electrophoresis to determine whether the vector in the selected colony strain contained the inserted exogenous ΑρχΙ gene (3.07721). ^^), and sequence the 0 heart to determine the nucleotide sequence of the human 0 gene. (5) The determination of the DNA sequencing nucleotide sequence is performed using a DNA automatic analyzer (DNA antomated sequencer, ABI Prism, model 337, version 3.0, Applied Biosystems, USA). During the sequencing process, the primers used are based on Designed with the previously resolved nucleotide sequence. (6) The expression of ΑρχΙ protein. The successfully cloned strain was placed in 4 ml of LB liquid medium containing ampicillin (100 // g / ml) and chloramphenicol (34 // g / ml) at 37 ° C. (: 18 hours of culture, take 1 ml of bacterial solution and add 9 ml of the same medium and incubate at 37 ° C for 2.5 hours, add 10 # 1 of IPTG (IM), and incubate at 37 ° C for 4 hours. After centrifuging the bacterial solution at 10,000 × g for 15 minutes at 4 ° C, the precipitate was taken and 2 ml of 10% glycerin-containing PBS (137 mM NaCl, 2.7 mM KC1, 4.3 1%) was added. 1.4 1 ^ 1 (sec. 04, 117.3) solution, break the cells with sonicator, centrifuge at 12, OOOxg for 15 minutes, remove the supernatant and add Shen Dianwu to 0.8 ml protein extraction buffer: 1. 5% N ~ lauryl sarcosin, 25 mM Tris-HC1, 1 mM EDTA, pH 8.0), or 8M urea (urea) dissolved in 0 · 1M phosphate buffer solution (ρΗ8 · 0), placed at 4 ° C After 18 hours of action, centrifuge at 12,000xg for 15 minutes and take the supernatant. This extract was loaded into a dialysis membrane and placed in PBS for 18 hours to obtain crude protein. (7) Purification of protein Purification of protein It is performed with Ni-NTAcolumn (QUAGENGmbH, Hilden, Germany). First, the column attached to Ni-NTA is combined, and 600 // 1 buffer solution B (8M Urea, O.lMNa-phosphate, 0.01M) is added. Tris-HCl, pH 8.0) in column, centrifuge at 2,000 × g for 2 minutes, discard the centrifuged liquid, recombine the column and add the extracted protein supernatant 600 # 1 (treated with buffer B) After centrifugation at 2, OOGxg for 2 minutes, save the centrifuged liquid (this is part a), and then reassemble the Ni-NTA column and add 600 # 1 buffer C (8M Urea, 0.1M Na_phosphate, 0 · 01M Tris-HCl, pH 6.3), after centrifugation at 2,000xg for 2 minutes, save the liquid under centrifugation (this is part b), and then reassemble Ni-NTA column into 200 # 1 buffer E ( 8M Urea, 0 · 1M Na-phosphate, 0 · 01M Please read the note above η The size of the paper is applicable to China National Standard (CNS) A4 specification (2 丨 〇'〆297mm) 581809 A7 B7 V. Description of the invention ((F) Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs

Tris-HCl, pH 4 · 5). After centrifugation at 2,000 × g for 2 minutes, save the liquid under centrifugation (this is part c). Take appropriate amounts of a, b, and c for SDS-PAGE electrophoresis analysis and interpret the results. . (8) SDS-PAGE electrophoresis analysis According to the method of Sambrook et al. [Molecular Cloning, ρ 18.47-18.48 (1989)], the expressed purified protein and the SDS sample buffer were mixed in equal amounts and cooked at 100 ° C for 2.5 After 15 minutes, electrophoresis was performed at 150 volts on 12/0 SDS-PAGE for 1.5 hours, and then stained with 0.2% Coomassie brilliant blue, and the results were decolorized with 7% acetic acid solution to see the results. Case 3: Preparation of dead bacteria: Culture the Actinobacillus pleuropneumoniae serotypes 1, 2 and 5 in the above for 6 hours, then centrifuge at 4 ° C, 10,000Xg for 30 minutes, and take the precipitated bacteria (The supernatant is used for the preparation of exotoxin), washed three times with 0.9% NaC1, and then adjusted the appropriate amount of each serotype bacterial solution with 0.9% NaC1, and added 0.2% formalin to After 37 hours at 37 ° C, the cells were washed three times with 0.9% NaC1, and then the bacterial solution was adjusted to 50 mg / ml (wet weight). Bacterial liquids of type 1, 2 and 5 (50 mg / ml) were mixed into equal volumes and stored at 20 ° C until use. Case IV. Preparation of a mixed vaccine of genetically engineered toxoid and dead bacteria of Actinobacillus pleuropneumoniae · As in the case of the dead bacteria prepared in Case 3 above, that is, 50 mg each of Ap serum type 丨, 2 and 5 dead bacteria and the above two molecules Crude ΑρχΙ protein 2 expressed by genetic selection was mixed into 1 ml (0.2% formalinized), and then "Fruit's incomplete" was used to "immunize" pigs. When immunizing ’, the muscles of the pigs are lined with a case penta« «material, which is carried out. Taiwan Act of Management (Preparation and Promulgation of Decree No. 82 of the President of the Republic of China on August 16th (60), First (-) Yizi)-Article 48 Article 8 = pig ^ =; The provisions stipulate that [Peng Xuangui, veterinary regulations (as described below) are carried out: Article ^ 8 Examined ejection rod activated material_ Foreign body and abnormal odor. (―) Type 5 test without thorium · It must not contain any possible detectable activity. (Iv) Preservative content test: The content of thallium in carbolic acid must be less than 5%, thl_sal = 7, (1) Safety Test: s 顼 有 is less than 0.01%. Please read the precautions on the back of this page before iRr.-Binding-Threading M-sheet scale Shicaiguanjia 581809 A7 B7 Invention Description (7) (a) Choose 10 ~ 15 grams of healthy white mice, each with a copy Intraperitoneal inoculation of 05 was taken, and another 40 were taken as a control. Observed for two weeks, there was no need to react. (B) Two healthy guinea pigs weighing about 350 grams were selected. God must survive without any reaction. (c) Select 2 piglets of Haemophilus antibody negative (6 to 8 weeks of age), and use 5 swords of each type according to usage. Observe for 2 weeks without any adverse recurrence! (2) Efficacy test: Safety test Later immunized mice were divided into four groups. Each group was inoculated intraperitoneally with a 10 ° to 103 dilution of the culture solution of the virulent strain. The control mice were also divided into four groups, each with 10-1 to 10. -4 Four dilutions of the bacterial solution were inoculated into the abdominal cavity and observed for one week, and then the two groups calculated the LD5 according to the Beherens-Karber method. As a result, the price of its defensive power is more than 10 times. Case 6: Experimental animals and feeds: The experimental animals are mice weighing 20 grams (BALB / C) and six-week-old pigs (LYD three breeds); the main ingredients of the feed are corn, soybean meal, fish meal, calcium, phosphorus, and vitamins. , Wait. Case 7: Determination of antibodies: The bacterial agglutination test [611111 ^ 58〇1161 & 1, human 111.]. '\ ^ 1: .1 ^ .38: 1111-1114 (1977)] was used, and the positive control group was artificially Infected pig serum, while SPF pig serum was used in the negative control group. Case eight: Western Blotting Assay [Towbin et al ·,

Proc. Natl Acad. Sci. USA 76: 4350-4354 (1978)]: Immediately after the protein was electrophoresed on the SDS plate, the SDS-polyacrylamide film was transferred using Bio-Rad. Crush to Nitrocellulose paper (0.2 nanometers), the implementation conditions are 1 A, 150 V, 1 hour, and there is ice-water cooling circulation system. The first antibody used Ap exotoxin to immunize pigs or the sera of Ap-infected pigs, and the second antibody used a combination of rabbit anti-pig IgG antibody and hydrogen peroxide. The matrix was 0.1% H2O2 and the coloring agent was Diamino-benzidine ( DAB, Sigma). Case IX. Determination of protein concentration: determined by Bio-Rad system [Zhang Gannan, Journal of the Republic of China Veterinary Society, 13: 4b 56 (1976)]. Case X. Isoelectric Focussing (IEF): Implemented with Pharmacia phastsystem, pH 3-10 gradient polypropionic acid film, conditions are 2000 V, 2.5 mA, 3.5 W, 410 Vh, staining and decolorization SDS-plate electrophoresis as described above. Case XI: Pathological tissue section: This paper size applies to Chinese National Standard (CNS) A4 (210 X297 mm) ϋ —ml-I -------- pack-(Please read the precautions on the back first ^^ 舄 This page) Order 581809 A7 ________B7 V. Description of the invention (/ Even) After the artificial inoculation attack, and the lungs are removed by naked eyes to determine the number of lung lesions [Zhang Gannan, Zhongmin Min, Journal of Veterinary Society, 17: 45_57 (1991) In addition, the diseased or necessary tissues such as trachea, hilar lymph, and lung tissues were fixed in 1 马 formalin solution, and then embedded with paraffin, made into sections, stained with HE, and examined microscopically. The present invention uses histopathology to evaluate the efficacy of the vaccine because after the attack, it is not objective to evaluate the efficacy of the vaccine based on its survival rate only if the lung has histopathological changes, so the immune pigs are challenged after the challenge. All survivors who had survived for one week were culled and examined for histopathological changes in order to obtain the true immune protection effect. Results: The present invention uses genetic engineering methods, which will be taken from Αρ (允

By using 9 / 7_ / from) serotype bacterial DMA (genomicDNA) as a template, a pair of specific primers were designed and amplified by the polymerase chain reaction (PCR) method. The ApxI gene (3.0 kb in size) was used as the embedded DNA (insert DNA), and pET32a was used as the vector (vect〇r, 5.9 kb in size) for DNA recombination. After the breeding procedure, A cloned strain (clone) of recombinant DNA was obtained and named ApxI-9864. The recombinant DNA vector, ρΑρχΙ-9864 was cut with fe / wHI and MI restriction enzymes, and analyzed by 1.2% agarose plate (agarose) electrophoresis. Indeed, an embedding of 3.0 kb and a vector of 5.9 kb can be obtained (see Figure 1). The recombination structure of pET32a and ΑρχΙ developed by the present invention is shown in FIG. 2. '' After the recombinant DNA (Figure 2) was transfected into E. coli BL2KDE-3), protein expression was induced by 1 mM IPTG. According to SDS plate electrophoresis analysis, it was found that its main component was ApxI hemolyzed with a molecular weight of 130 kDa. The fusion peptide of serotonin is different from the 104-kDa hemolysin obtained from the supernatant of the 6-hour culture medium of Ap serotype 1 (see Figure 3), but the analysis of Western blot analysis shows that it was obtained from ApCH9864 recombinant The fusion protein has a strong binding reaction with the hemolysin-specific antibody of Ap serotype 1 (see Figure 4). Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs. The results of the analysis of the nucleotide sequence of DNA and the amino acid sequence of the protein of the selected plant ApxI-9864 applied for patent of the present invention are shown in Figure 5. In the present invention, 50 mg of each of the serotypes of Ap serotypes 1, 2, and 5 are mixed with the crude protein ApxI 2 mg expressed by the above-mentioned selected plant ApxI-9864 into 1 ml, and then the same amount of Freund's is incomplete. The adjuvant (Freund's incomplete adjuvant) is mixed. After emulsification, it is an immunization dose for each pig. When immunizing pigs, intramuscular injection is used. As for the immunization route of mice, it is carried out in accordance with the regulations of the "Animal Drug Administration Law". The results after immunization are shown in Table 1, Table 2 and Table 3. The paper size applies to the Chinese National Standard (CNS) A4 (210X297 mm) 581809 A7 B7 V. Description of the invention Table 1: Pig pleura pneumonia Efficacy test of actinomycete genetic engineering toxoid ΑρχΙ and dead bacteria mixed vaccine. The protective effect of the attacking ethics before the challenge b The amount of defense bacteria in the control group of the immunization group a (total number of mice) (total number of mice) (mouse death / total number) (mouse death / total number) Force value 10 ° 10 — 10/10 — 101 10 10 1/10 10/10 1019 ΗΓ2 10 10 0/10 7/10 IO-3 10 10 0/10 3/10 (74.9) ΗΓ4-10 — 0/10 a: of attack The bacterial amount is three types of Ap serotypes 1, 2, and 5. The bacterial solution after 18 hours of culture is mixed in an equal amount. The bacterial amount is 4X109 / ml. The amount of challenge bacteria is continuously diluted by the 10-fold dilution method. . (Please read the notes on the back before ^ this page)

Order b: According to the regulations of the Animal Drug Administration Law, observe one week after the challenge, and then calculate the LDs of the immunization group and the control group according to the Beherens-Karber method. , To find its defense price must be more than 10 times to be eligible. The defense price of this test is LD50 in the immunization group / LD50 in the control group = 10_ ° Vl (r26 = 1019 = 74.9). Therefore, according to "The Animal Drug Administration Law" section 58 138 Article 6 efficacy test, the defense force price is more than 10 times, that is, a qualified vaccine. 0 Printed on the paper by the Consumers' Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs, this paper applies the Chinese National Standard (CNS) A4 specification (210X 297 mm). 581809 A7 B7 V. Description of the invention (/ The table «㈣ deleted from the chest item commercial dead bacteria vaccine a genetically engineered toxin ΑρχΙ and dead bacteria mixed vaccine b Number of pigs immunized 100 / PUi \ J v3? 64 Cough after immunization Symptom head number 72 15 Number of heads of illness and death after immunization 37 9 Protective efficacy a: Φ ^ ^ τ, Αί, 63% (63/100) 85.9% (55/64) • ,, ~~ · 江 柯 一二 又, Intramuscular injection), the clinical symptoms and death situation were tracked at the absence site, and the observation period was eight weeks (ie, until the pigs reached the 17th and 17th weeks of age). B. The pigs who died were brought back to the laboratory. Perform pathological dissection and perform Αρ bacteria analysis

Ap, please read the notes on the back first, then this page) -Packing. -Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economics and Paper This paper is suitable for the country U ^^ 7 ^ _7 ^ Grid (10χ 297 mm) 581809 Α7 — ------------ B7____ V. Description of the invention (Λ3) Table II. Genetically engineered toxin ΑρχΙ of actinobacillus pleuropneumoniae pneumoniae mixed with dead bacteria vaccine or dead vaccine after immunizing pigs The attack was only tested for protection effectiveness. Item Pig number ΑρχΙ toxoid mixed with dead bacteria Vaccine group 0 12 3 4 11 11 11 11 11

Lung lesions after artificial attack a

(Please read the note on the back of the book first-notes and then on this page) Dead bacteria vaccine group 5 6 7 8 11 lx IX 11 〇 · 3 (average) 0 1 2 0 ++ ++ 0.75 (average) control group QU 1ί 12 2 2 3.75 (average) Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs a: Live bacterial strains of Actinobacillus pleuropneumoniae (Ap) serotypes 1, 2, and 5 (each serotype ΐχιο9) 3X109 / ml Each pig was artificially attacked with a point-nose method. Lung lesions were counted 3 to 3 days after the challenge. b: Interpretation of lung lesion points (lesión scores): 〇 ·· normal, 丨: minor lesions, 2: moderate, 3: severe, 4: death. c: Bacterial recovery test was performed from the lung lesions, each lung was separated with four chocolate media, and the Api system was used for bacterial identification, and standard serum was used for serotype identification. + · Separate to Ap '-: Ap cannot be separated. It can be known from Table 1 that the defense power of the mixed vaccine of genetically engineered toxin AρχΙ of P. pleuropneumoniae and dead bacteria of the present invention is 74.9 times (more than 10 times), and this result is in accordance with the paper standard of the Agricultural Committee of the Executive Yuan. Chinese National Standard (CNS) A4 Specification (210 × 297 mm) 581809 A7 B7 V. Provisions of the "Animal Drug Administration Law" published by the Invention Description (β). From the table-bacillus pig farm, if the invention is used Genetically engineered ^^ === pigs that have been put on the line, their protective effect is as high as 85.9% (55/64), excellent ^ ΑσΡχΐxi, ==,% pigs after immunization will be carried back to the laboratory for 3X109 live The bacteria were tested, and the results showed that the genetic engineering toxoid ApxI was mixed with dead bacteria. ^ The test recovery test results showed that the genetic engineering toxin Apxl 't bacteria recovery rate was 10% (3/30)' dead bacteria vaccine Immunization group (commodity 'dr 83.33% (10; ^') is lower than the commercially available dead bacteria vaccine. The efficacy of the vaccine is different when the serotype of the commercially available Erjiang vaccine is different from the strains circulating on the spot. ί :: And genetically engineered toxoid ApxI stimulates pigs to produce antibodies against fine I1 Troubles of serotypes 'Because Αρχί toxin has many very different protective effects, as for the toxoid _ mixed dead porcine pleuropneumoniae actinomycete toxin ΑρχΙ and antigenicity of mixed vaccine vaccine: preparation = ㈣11' ί the test process of the invention Zhongte uses histopathology to evaluate the pathological changes of ㈣9 viable bacteria nose nose printed by the Consumers ’Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs, and calculate the number of relies points (lesi 及 number and two Λ2 strikes one" live " This is an illusion, and the true efficacy of the vaccine should be determined based on the fact that the disease site of the lung is actually tested for the disease name of the disease. Only after the immunization of the genetically engineered toxoid Apxi with the dead bacteria vaccine can be determined. Qian Γ has no specific lesions in the lungs (as shown in Figure 7), and pigs immunized with dead bacteria vaccine (commercial field) still have lesions in the lungs such as bleeding and edema (see Figure 8). Significant lesions of P. pleuropneumoniae (see Figure 9) Group II. Single-core fine coffee paper size Applicable national standard (CNS) A4 (210 > < 297 public envy 581809 A7 B7 V. Description of the invention (Λί Icon Ming: Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs. 1. Description: Apxl PCR DNA fragment and carrier pET32a DNA 1. · λ / # // 2 (1ΠΙ molecular designation 2. Apxl PCR DNA fragment (3.0 kbp) 3 · Vector pET32a DNA (5.9 kbp) Figure 2. Explanation: Screening results of Apxl-9864 DNA cut with / zzHI and / ΛοΙ U: λ / cal ndlll molecular designation 1: Apxl DNA fragment (3.0 kb) And Vector pET32a MA (5.9 kb) Figure 3, Description: Restructuring construction diagram of pET32a and Apxl developed by the present invention. Figure 4. Description: SDS plate electrophoresis analysis result M: molecular weight indicator 1: Apxl (from selected strain CH9864) crude protein extracted with 8M urea 2 ~ 6: stages of separation and purification of Ni-NTA affinity column ( fraction), of which 5 and 6 can be purified, recombinant Apxl recombinant protein 7 with a molecular weight of 130 kDa: Apxl (104 kDa) taken from Ap 1 serotype (control group) Figure 5, description: Western method Analysis results: Μ: Molecular weight indicator 1: Apxl (taken from selected strain AρχΙ-9864) recombinant fusion protein with a molecular weight of 130 kDa 2: Hemolysin from Ap serotype 1 (molecular weight of 104 kDa) 3: Protein expressed by pET32a in A BL21 (DE-3) (control group) Figure 6. Explanation: Clone of Apxl-9864: ΑρχΙ-9864 gene nucleotide and amino acid Of the sequence. Figure 7. Explanation: Pigs immunized with the genetically engineered toxoid Apxl and dead bacteria mixed vaccine with 3 × 109 live bacteria (Aρ diploid 2, 5 serotypes were each mixed with 1 × 10 09), and the lungs There was no specific change in histopathology. Figure 8. Explanation: Pigs immunized with commercial dead bacteria only use 3 × 109 viable bacteria (Aρ serotypes 1, 2, and 5; this paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm)) Note | § | $ τ Order I line 581809 V. Invention description (printed from the Intellectual Property Bureau's Employees' Cooperatives of the Ministry of Economic Affairs) After a nasal attack, the lung tissue will still show water maps and diagrams. Ο Pig Only serotypes 9 and 2 and serotypes 2 and 5 were ψ々 ′, respectively. After nasal attack (Fig. 9), macroscopic lesions, swelling of the lungs, and L-shaped lesions: and (Fig. 10) Histopathological changes, showing hemorrhage, aquatic cells (or oat-type, cells) in a spiral-like arrangement, that is, the typical lesions of actinomyces pleuropneumonia. L, Liu Jianrong: 1976, porcine parahaemolytic haemophilus Immune effect of decathlon bacteria from pneumonia on pigs, Chinese Republic of Veterinary Society, 2: 2 ί Yu Zhong, f 'Zhou Ning ^, John King, Han Helen: 1976, Haemophilus suis II Taiwan epidemic report, Taiwan Sugar Livestock Research Institute 64/65 research 4 inspection report , 191-197. 3. Xu Xinglu 'Luo Luohua Shen Yunmei, Liu Fuyin: 1977, Parahemolyticity in pigs. Research on sero-clonitis serum and immunology, Taiwan Sugar Animal Research Test Report, 219-224. 4. Xingxing Zhang Jingnan, Luo Lihua, Hu Daguang, Lin Baizhu: 1978, Research on Parahaemolyticus Pseudomonas pneumoniae pneumonia, Effect of Formalin Dead Bacteria on Pig Grade, Report of Phase 66/67 Research and Test of Taiwan Institute of Sugar Industry 147-155. 5 ΐΐ 'Luo Lihua, Zhu Xianzhu, Shen Yongmei · 1979, Improvement of Porcine Parahaemolytic Haemophilus Vaccine and Discussion on Various Immunological Problems, 67/68 Research Test Report of Taiwan Sugar Livestock Research Institute, 163-173 6. Male, Chen Hongwen, Yan Jiaqing, Shen Yongmei: 1980, Porcine Parahaemolytic Vaccine: A Study of Interim Application, Taiwan Sugar Livestock Research Institute, 68/69, 103-111. • Qiu Hongying: 1981 'Piglet Bloodthirsty Establishment of bacillus pleuropneumoniae enzyme binding immunosorbent test ^ Master's thesis, National Institute of Veterinary Medicine, Chung Hsing University, Taichung, Taiwan. Zhang Jingnan, Shen Yongmei, Li Xianzhang, Yu Baohua: 1982, Prevention and Control of Swine Pneumonia, Taiwan Sugar Livestock Research Institute 70/71, 83-87. 9. Zhang Gannan: 1987, Development and Application of Toxoplasma gondii Toxoid Vaccine, Chinese Journal of Veterinary Association, 13: 41-56. '10. Luo Lihua: 1987 Immunoprotective effects of Haemophilus capsularium vaccines, Journal of Chinese Veterinary Society, 13: 119-126. Π · Zhang Gannan: 1991, please read the back of the vaccine vaccine for mixed vaccines of Haemophilus pleuropneumoniae toxin and dead bacteria. Precautions on this page.

Α4 specifications (21 0 χ 297 mm) 581809 A7 B7 5 Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs Invention description (/ 7) Research on immune efficacy, Journal of the Republic of China Veterinary Society, 17: 45-57. 12. Zhang Gannan: 1996, Study on plastids and drug resistance of Actinobacillus pleuropneumoniae serotype 1, Journal of Republic of China Veterinary Society, 22: 129-135. 13. Peng Xuangui: 1999, Handbook of Veterinary Regulations, Counseling and Funding by the Animal and Plant Epidemic Prevention and Quarantine Bureau of the Agricultural Commission of the Executive Yuan, Printed by Taiwan Pig Research Institute, ρβ 482. 14. Chang, GN and SC Chen. 1989. Study on the toxicity and antigenicity of a heat-stable extracellular product of H. pleuropneu / noniaeiSerotYDe I), Proceedings, The 8th seminar on science and technology: Respiratory and Reproductive System of Swine, p. 103-115. 15. Chang, YF, R. Young and DK Struck. 1989. Cloning and characterization of a hemolysin gene from Ap. DNA 8: 635-647. 16. Chang, Y. F., R. Young and DK Struck. 1991. The Ap hemolysin determination: unlinked AppCA abd AppBD loci flanked by pseudogenes. J. Bacteriol. 173: 5151-5158. 6. Forestier, C ·, and R · A. Welch. 1991. Identification of RTX toxin target cell specificity domains by use of hybrid genes. Infect. Immun. 59: 4212-4220. 17. Frey, J., R. Miere, D. Gygi, and J. Nicolet. 1992. Identification of a second hemolysin in Ap serotype 1 and expression of the gene in E. coll. Infect. Immun. 60: 1671-1676. 18. Frey, J., J. Nicolet. 1988. Regulation of hemolysin expression in Actinobacillusj) leuropne umoniae serotype I by Ca +. Infect. Immun. 56: 2570-2575. 19. Frey, J., J. Perrin, and J. Nicolet. 1989. Cloning and expression of a cohemolysin, the cAMP factor of Actinobacillus pleuropneumoniae Infect. Immun. 57: 2050-2056. 20. Gunnarsson A., EL Biberstein, and B. Hurvell. 1977. Serologic studies on porcine strain of Haemophilus parahaemolyticus {pleuropneumoniae): Agglutination reaction. Am. J. Vet. Res. 38: 1111- 1114. 21. Jansen, R., J. Briaire, EM Kamp, and LJ Giolkens. 1993. Structure analysis of the Ap RTX-toxin I operon · Infect. Immun. 61: 3688-3695. The paper dimensions are applicable to Chinese national standards (Cns) A4 size (210x297 mm) (please read the note on the back page first) • Binding line 581809 Printed by the Consumers ’Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs A7 B7 V. Invention Description (β) 22. Kamp, EM, J. KK. Popma, J. Anakota, and MA Smith. 1991. Identification of hemolytic and cytotoxic proteins of Ap by using monoclonal antibodies. Infect. Immun. 59: 3079-3085. 23. Kume KK., I. Nagano, and T. Nakai. 1986. Bacteriological, serological, and pathological examination of Haemophilus pleuropneumoniae infection in 200 slaughtered pigs. Jpn. J. Vet. Sci. 48: 965-970. 24. Little, TWA 1970. Hemophilus infection in pigs Vet. Res. 87: 399-402. 25. Mylrea PJ, G. Fraser, P. macqueen, and DA Lambourne. 1974. Pleuropneumonia in pigs caused by Haemophilus parahaemolyticus. Austr. Vet. J. 50: 255-259. 26. Nakai, T., and K. Kume. 1987. Serological and bacteriological survery of Haemophilus pleuropneumoniae serovar 5. Jpn. J. Vet. Sci. 49: 1141-1144. 27. Nielsen, R. 1984. Serodiagnosis of Haemophilus pleuropneumoniae as a basis for rational prevention and control. IPVS, 103. 28. Nicolet, J., and H. Konig, 1966. Zur Haemophilus pleuropneumoniae be i mschwe in bacter i ο1og i sche, pathologisch-anatomische and histologische befunde. Vorl. Mitt Path. Microbiol. 29: 301-306. 29. Roussel, AF, and YA Chabbert. 1978. Taxonomy and epidemiology of gram-negative bacterial. plasmids studied by DNA-DNA filter hybridization in formamide. J. Gen. Microbiol. 104: 269-276. 30. Sambrook, J., EF Fritsch, and T. Man i at is. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 18.47-18.48. 31. Schiefer, B., RE Moffatt, J. Greenfield, JL Agar, and JA Majka. 1974. Porcine Haemophi 1 us parahaemolyticus pneumonia in Saskatchewan 1. Natural occurrence and findings. Can. J. Comp. Med. 38: 99-104. 32. Shope, RE 1964. Porcine cotagious pleuropneumonia. 1. Experimental transmission, etiology and pathology. J. Exp. Med. 119: 357-368. Please read the notes on the back 舄 This page)-Binding-Binding-Thread · This paper size is applicable to China National Standard (CNS) A4 (21 OX297 mm) 581809 A7 _B7__ V. Description of the Invention (Η) 33. Strathdee, CA, and RYC Lo. 1989. Cloning, nucleotide sequence, and characterization of genes encoding the secretion function of the Pasteurella haemolytica leukotoxin. J. Bacteriol 171: 916-928. 34. Suzuki S., T. Takahashi, M. Muramatsu, K. Ohishi, M. Nakajima, and M. Yamashita. 1988. Serotyping of Actinobacillus {Haemophilus) pleuropneumoniae isolates from pigs in slaughter-house Jpn. J. Vet. Sci. 50: 1264-1267. 35. Towbin, H., LT Staehelin, J. Gordon. 1978. Electrophoretic transfer of proteins from polyacylamide gels to nitrocellulose sheets: Procedure and some applications. Proceedings of the national Academy of Science. USA 76: 4350-4354. Printed Paper (CNS) A4 Specification for Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs

Claims (1)

GIyAIαΑIαΑIaThrG i ySerLeuVaIGIyAIaProVaI A IaAIaLeuVaISerAI a I IeTh rGIyI lei IeSerGIyI Ie LeuAspAIaSerLysGInAIalIePheGIuArgVaI A IaThrLysLeuAIaAsnLysI IeAspGIuTrpGIuLysLysH i s GIyLysAsnTyrPheGIuAsnGIyTyrAspAIaArgH i sSerAIaPheLeuGIuAspThrPheGIuLeuLeuSerGInTyr AsnLysGIuTyrSerVaIGIuArgVaIValAlalleThrGInGInArgTrpAspVaIAsnI IeG1yGIuLeuAIaGIyI Ie ThrArgLysGIySerAspThrLysSerGIyLysAIaTyrVaIAspPhePheGIuGIuGIyLysLeuLeuGIuLysGIuPro AspArgPheAspLysLysVaIPheAspProLeuGIuGIyLysI IeAspLeuSerSerI IeAsnLysThrThrLeuLeuLys PheVaIThrProVaIPheThrAIaGIyGIuGIuI IeArgGIuArgLysGInThrGIyLysTyrGIuTyrMetThrGIuLeu PheValLysGlyLysGluLysTrpValValThrGiyValGInSerHisAsnAlalIeTyrAspTyrThrAsnLeuIleGIn LeuAlalIeAspLysLysGIyGIuLysArgGInVaIThrI IeGIuSerHisLeuGIyGIuLysAsnAspArglleTyrLeu SerSerGlySerSerlIeVaITyrAIaGIyAsnGIyHisAspVaIAIaTyrTyrAspLysThrAspThrGIyTyrLeuThr PheAspGIyGInSerAlaGInLysAlaGIyGluTyrlIeVaIThrLysGIuLeuLysAIaAspVaILysVaILeuLysGIu VaIVaILysThrGInAspIIeSerVaIGIyLysArgSerG! ULysLeuGIuTyrArgAspTyrGIuLeuS erProPheGIu LeuGIyAsnGIyI IeArgAIaLysAspGIuLeuH i sSerVaIGIuGIuI IeI IeGIySerAsnArgLysAspLysPhePhe GIySerArgPheThrAspI IePheH i sGIyAIaLysGIyAspAspGlulleTyrGIyAsnAspGIyH i sAspI IeLeuTyr GlyAspAspGIyAsnAspVa! I IeHisGIyGIyAspGIyAsnAspHisLeuVaIGIyGIyAsnGIyAsnAspArgLeuIle GlyGlyLysGlyAsnAsnPheLeuAsnGlyGlyAspGIyAspAspGIuLeuGInValPheGluGlyGInTyrAsnValLeu LeuGlyGlyAlaGlyAsnAspIIeLeuTyrGIySerAspGIyThrAsnLeuPheAspGIyGIyVaIGIyAsnAspLysIle TyrGlyGIyLeuGlyLysAspIIeTyrArgTyrSerLysGIuTyrGIyArgHisI lei lei IeGIuLysGIyGIyAspAsp AspThrLeuLeuLeuSerAspLeuSerPheLysAspVaIGIyPheI IeArgI IeGIyAspAspLeuLeuVaIAsnLysArg I IeGIyGIyThrLeuTyrTyrH i sGIuAspTyrAsnGIyAsnAIaLeuThrI IeLysAspTrpPheLysGIuGIyLysGIυ GIyGInAsnAsnLysI IeGIuLysI IeVaIAspLysAspGIyAIaTyrVaILeuSerGInTyrleuThrGIuLeuThrAI a ProGlyArgGlyHeAsnTyrPheAsnGlyLeuGluGluLysLeuTyrTyrGlyGluGlyTyrAsnAlaLeuProGInLeu ArgLysAspIIeGIuGI η I lei IeSerSerThrGIyAIaPheThrGIyAspH i sGIyLysVaISerVaIGIySerGlyGly ProLeuValTyrAsnAsnSerAlaAsnAsnValAlaAsnSerLeuSerTyrS erLeuAlaGInAlaAla 4. The hemolysin Apxl according to item 1 of the scope of the patent application, which is genetically selected from the bacterial DNA of the first serotype of Actinobacillus pleuropneumoniae, constructed in the expression vector pET32a, and transformed into E. coli Toxins obtained in large quantities. 5. According to the hemolysin ΑρχΙ of the first patent application scope, the genetically engineered toxoid ΑρχΙ is a fusion protein with a molecular weight of 130kDa, which does not have hemolytic effect, but can be specific to the hemolysin of the first serotype of Actinobacillus pleuropneumoniae with a specificity of 104 kDa. The antibody produces a strong binding reaction. 6. —A vaccine for preventing and treating warm-blooded animal infections, which comprises hemolysin Aρχ1, actinobacillus pleuropneumoniae serotype, serotype 2 and serotype 5 dead bacteria according to the scope of the patent application, and manufacturing Adjuvants and excipients allowed by vaccines. 7. The vaccine according to item 6 of the scope of the patent application, which contains a toxoid ΑρχΙ at a concentration of 2 mg / ml. 0. The vaccine according to the scope of the patent application, item 6, wherein the dead strain is composed of Ap 1 serotype, 2 serotype or 5th gold clear type, and mixed with 0.2% formalinized dead bacteria vaccine equal amount, the dead bacteria crossing rate is 50mg / ml. 9. Vaccine as claimed in item 6 of the patent scope, including adjuvants such as water gas oxide, mineral oil, alum, synthetic polymers such as poly (I), poly (A), poly ( U) or poly (C), Freund's incomplete adjuvant and Escherichia coli heat-labile enterotoxin LT (LTA2 / B or LTB). The vaccine according to item 6 of the scope of the patent application, the immunization route is administered by intramuscular injection, subcutaneous injection, intraperitoneal injection, mixed with animal feed, or made into tablets for oral administration. A method for manufacturing hemolysin ΑρχΙ in the first patent application scope, which comprises: ⑴ constructing the ΑρχΙ gene in the expression plastid of pET32a to obtain clone ΑρχΒ9864 (that is, CCRC940326) to allow induction by the inducer after 4 After shaking at 37 ° C for 10 hours, it was treated with 10% glycerol phosphate buffer solution and then treated with protein extraction buffer solution (1.5% N-iaUryi sarcosin, 25mM Tris-HCl, lmMEDTA, pH 8.0) or 8M urea (Urea) in 0 · IM phosphoric acid. Toxoid Apxl was obtained in a buffer solution (pH 8.0). (ii) According to item 5 of the scope of the patent application, the toxin AρχΙ can be calibrated with a titer of 2 mg per thread.