TW571098B - Biochip and method for producing the same - Google Patents

Abstract

The present invention provides a convenience, effective and cost-saving biochip and a method for producing the biochip. The biochip comprises an organic polymer substrate wherein the substrate has a nude surface comprised of the organic polymer, and a number of biological molecules wherein the biological molecules are stably bonded to (covalent bonding or tonic bonding) and directly fixed in the nude surface of the substrate, thereby the biological molecules can be fixed in the substrate stably and directly to perform various biochemical reactions.

Description

571098 A7 Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs. 5. Description of the invention (1. The present invention relates to a biochip and its manufacturing method, more specifically, to a direct bonding of biomolecules in a stable bonding manner. The biochip on the bare surface of the organic polymer matrix and its manufacturing method are used to perform various biochemical reactions, especially biochemical detection reactions. 2. Description of the previous technology In recent years, the biotechnology industry will need There are more and more products with detection reagents fixed on the substrate, especially in the diagnosis of diseases, and the related technical requirements required are also increasing. The reagents mentioned here mainly refer to protein nuclei & cells, drugs and Small molecule haptens. The matrix includes plastic, glass, silicide, carbon fiber, cellulose and other substances. Among them, plastic is the most widely used, mainly because plastic has a high degree of biocompatibility and excellent plasticity and optical properties. In addition, plastic can be covered with certain chemicals on its surface to change the characteristics of the plastic surface to meet special needs. Glues are commonly used in this regard as cups, discs, tubes, spheres, fibers, membranes, or particles. The type has high variability. There are many types of plastics, and the materials commonly used as substrates include polypropylene, polystyrene, polyethylene, and polyvinyl chloride. , Polysulfone, polycarbonate, cellulose acetate, etc. Among these materials, polystyrene, polyvinyl chloride, and polycarbonate have the best optical transparency. -4 -This paper size is applicable to China National Standard (CNS) A4 (210 X 297 mm). Packing ---- (Please read 'Notes on the back of the reading: fill in this page first') Order --------- 4 ^ 571571

In the past, plastic materials will be used as a substrate for biomolecule fixation. # Most use the properties of molecular adsorption, such as polystyrene and polyvinyl chloride because of the attractive force of static electricity, which is beneficial for larger molecular adsorption This kind of fixing fruit C ^ is not good, and it is easy to peel off molecules. For small molecules such as oligos to be fixed on the substrate, the larger molecules that have been coated on the substrate beforehand are used as mediators, so that these small molecules can be fixed on the plastic substrate smoothly. For this reason, there are many methods to modify the surface of plastics to increase the static electricity and binding ability of the surface. The pretreatment of the substrate reduces the convenience of plastic substrate application. In the past, in molecular biotechnology, nucleic acids were usually fixed on nitrocellulose membrane and nylon membrane (nylon). Adhesion and covalent bonding were carried out during the fixation. The chemical reaction of covalent binding occurred between the nucleic acid and the AminOgrOup on the substrate. Free amines on bases such as adenine, guanme and cytosine in single-stranded DNA, RNA and oligo. These amine groups can be used for covalent fixation. In the past, it has been theoretically concluded that when these free amine groups are used for fixing, the hydrogen bonds required when the two strands of nucleic acids are paired are not easy to form, so it is not conducive to hybridization, so Generally, an additional amine group is added synthetically to the 5, or 3 'end of a nucleic acid, and then this amine group is used to perform a fixing reaction with the modified solid matrix, but this will cause an increase in cost. In molecular biology research, nylon membranes have been used as a substrate for nucleic acid fixation for a long time, mainly because of its microporous characteristics, which help nucleic acid molecules to adsorb to the membrane, and then heated at 80 for 2 hours. square Or this paper size applies Chinese National Standard (CNS) A4 specification (210 X 297) (please read the notice on the back first ----------------- ^^^^ 1 The gangster wrote this page) Printed by the Employees 'Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs Printed by the Employees' Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 571098 A7 _____B7 V. Description of the invention (3) Irradiate ultraviolet light to make the nucleic acid covalently bonded Nylon membrane, so this fixing method strictly has two steps: first, the adsorption of nucleic acids, and then heating at 80 ° C for 2 hours or irradiating UV light. In fact, if not After heating at 80 ° C for 2 hours or irradiating ultraviolet light to form a covalent bond, some nucleic acids will still be adsorbed on the nylon membrane. Among plastic materials, polystyrene-made orifice disks are currently the most common in commercial biomolecules. Fixation matrix, and most of these wells are surface-treated first. This type of well is a kind of utensil widely used in immunoassay. In addition, there are also some products that use pre-treated wells as a method of polymerisation. Polymerase chain reaction (PCR) product Vessel, whose method is to hybridize the PCR product with a specific probe fixed on a microtiter plate, and then develop the color. As the use of polystyrene as a substrate is becoming more and more widespread, it has improved the old Fixation methods make nucleic acid fixation more efficient, convenient, time-saving, and money-saving. It is very important. At present, there are many methods for fixing oligo nucleic acids and proteins to the substrate, but these methods are more Expensive or time-consuming. These fixing methods can be roughly divided into two types: one is non-covalent bonding, and the other is covalent bonding. Generally, the bonding strength of non-covalent bonding is weak. For covalent binding, the oligo nucleic acid itself or the surface of the substrate must be modified in order to increase the reactivity when the two are bonded. It can even make the nucleic acid have directionality when it is fixed, that is, 5 is fixed at the end. End free, or vice versa. A common modification method for oligonucleotides is to add an amino or thio group to the 5, or 3, terminus. US Patent No. 5 663 3 1 8 of Pegg et al. is coated with heterobifunctional crosslinked agents with hydrophilic and hydrophobic groups. 6- This paper is in accordance with Chinese national standards (CNS ) A4 size (210 χ 297 mm) Packing ---- (Clearly ¾ 璜 璜 璜 璜 事 ¾ ¾ writing clothes page) 1 Order----- 571098 Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs A7 — ___B7_ 5. Description of the invention (4) It acts on polymers including vinyl ethylene, propylene, sulfone, carbonate or a composite plastic matrix of these monomers, and then includes biological molecules such as nucleic acids, antibodies or antigens, enzymes, and drugs. The active group in this intermediate reagent reacts to achieve a fixed effect. U.S. Patent No. 480,663, Carrico et al. Treats nylon plastics with an alkylating agent. Nucleic acid molecules act in a suitable buffer solution-adsorption and fixation after a period of time. U.S. Patent No. 5 5 1 4 7 8 5 of Van Ness et al. First coated an amine group-containing polymer such as polyethyleneimine, polyallylamine or polyvinylamine on a nylon pellet, and the 5, or 3, ends were modified into amines. The nucleic acid molecule is then anchored to the polymer. U.S. Patent No. 574 7244 to Sheri dan et al. Is to fix the 5, modified amine-based nucleic acid to the modified polystyrene. The research by Holmstrom et al. (Anal · Biochem. 209: 278-283 (1993)) is based on the specific binding between biotin (biotin) and avidin (avidin). Therefore, the avidin / streptavidin streptavidin was first adhered to the surface of the solid matrix, and the nucleic acid labeled with biotin was then reacted with the avidin / streptococcal avidin on the solid substrate. In order to achieve the purpose of fixation. Poly-L-lysine (pdy — ^ Lys) or poly-L-lysine phenylalanine (poly-L-Lys-Phe) is currently more commonly used for pretreatment. The method is to coat glass or polystyrene first. Poly-L-type lysine or poly-L-type lysine-phenylalanine can be modified by the amino group (amin0_) or hydrogenthio group (sulfhydryi_) in the presence of dual-functional biological media reagent and solid state. The amino group k on the substrate is conjugated, and the US patent of G ad ow et al. * 6 $ 7 3 Pack ------ (please read the notice on the back first and fill in this page) Order ---- -----

571098 A7 __ B7 V. Description of the invention (5) The invention uses phenylalanine and lysine as a medium to fix nucleic acids. Another type of fixation is to use me t h y 1 i m i n e as a medium (N U N C,

Naperville, 111). Bienarz et al., U.S. Patent No. 5002883, is modified on the plastic surface to have amine groups as a fixing medium. U.S. Patent No. 56 1 0287 to Nikiforov et al. Is a method for fixing nucleic acids to the surface of polyphenylene ether containing hydrophilic groups in a non-covalent manner in the presence of a salt or a cationic detergent. The methods mentioned above have the common inconvenience, that is, the nucleic acid needs to be modified first and the solid matrix needs to be processed in advance. As for direct fixation, Kawai et al. Once directly coated the oligo nucleic acid on the surface of polystyrene, and adsorbed the nucleic acid to the surface of the modified polystyrene in the presence of MgCl2 & NaC1. Nucleic acids are fixed on polystyrene by UV irradiation (Kawai, S. et al., Anal. Biochem. 209: 63-6 9 (1 993)). An appropriate salt concentration is required for fixing by this method, and Nucleic acid takes longer to adsorb to the surface of polystyrene ^ Rasmussen et al. (Anal. Biochem. 1 98: 1 3 8- 142 (199 1)) is a 5 The chemical nucleus was fixed on the modified polystyrene in a concentrated reaction under a water-soluble carbodiinide, and its fixation was directional. Mask〇s et al. (Nucl · Acids Res · 20: 1679-1 684 (1 992)) is a Hnker with an oligo nucleic acid attached to a hydroxy group and a hydroxyl group. GlycidOXypr〇pyi silane reaction to perform direct fixation. These methods are quite time-consuming, often require a day of action, and require the presence of other reagents to facilitate the fixation of nucleic acids. Some currently known nucleic acid fixation methods are intended to be used in the preparation of biochips.

Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs V. Invention Description (6) The preparations will face several problems. First, although there is also an oligo nucleic acid with an unmodified 5, or 3 'end as a -0H group, which is fixed on a modified solid substrate (such as US Patent No. 59 1 9626), it is generally desired to fix. The modified nucleic acid needs to be modified to become a molecule with ammo or th10 group. Secondly, bifunctional biomedical reagents used to connect nucleic acids to substrates are generally more expensive, and these reagents are quite sensitive to air and humidity. Modifications on the surface of plastics often change their surface to hydrocarbon amines, hydroxyl groups, or hydrogen sulfide groups as the fixing medium, but it is easy to cause undesirable phenomena such as reduced plastic transparency. Finally, most of the solid substrates used to hold nucleic acids need to be pretreated to make their surfaces hydrophilic.

Church et al., Natl. Acad Sci USA 8i i99i_ 1 995 (1 984) taught the study of fixing nucleic acids on nylon membranes, and believed that the covalent fixation of nucleic acids was due to ultraviolet light causing thymine residues and membranes on nucleic acids. Caused by the amine-based reaction; nylon membranes have micropores, which are conducive to the adsorption of nucleic acid molecules, so they can be used for fixing nucleic acids in an unmodified form. Of course, the smooth surface is considered to be unfavorable for directly fixing biomolecules on it. Furthermore, the nylon film is used as a substrate, and its material is flexible, which is not suitable for use as a biochip, and it is not light-transmissive and is only suitable for Chemical coloration read with the naked eye. The biological research of Mujing knife still often uses nylon membrane as the substrate for nucleic acid fixation. It mainly uses the microporous characteristics of nylon membrane and the ability of monomers with amine groups to interact with bases in nucleic acids, but nylon membranes do not have Transmittance is not easy to apply to biological wafers. In recent years, the development of biochip technology has been quite rapid, and the substrates used are mainly glass materials. # The reason is that glass has good biocompatibility and good light transmission, while plastic and glass have high -9-The size of this paper is applicable to Chinese National Standard (CNS) A4 (210 X 297 mm). Packing ---- (Please read the notes on the back first and fill in this page) Order ------------ 571098 A7 B7 Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs. 5. The description of the invention (The stopping point of the valley = light transmission: and 'plastic has another—something broken glass does not have. 2. High plasticity, many color changes and cheap. In addition, the most important thing is that glass must be modified before it can be used for fixing nucleic acids. The present invention discloses that plastic t-side can be used for nucleic acid fixing without modification. Its fixing mechanism is different from that of nylon membrane. With its fixing principle of amine-based monomers and test groups in nucleic acids, 'It is not limited to plastics that require amine-containing monomers, such as polyethylene and polypropylene, which can be used for nucleic acid fixation. Therefore, compared to glass, Plastic will be more convenient as a substrate for nucleic acid fixation in biochips Economics. It can be known from the above conventional technologies that when plastic was used as the substrate, the role played by plastic was a supporting substrate, and the original chemical molecular monomers in plastic did not directly participate in the fixation of biomolecules. When fixing, it mainly reacts with the chemical medium coated on the plastic surface or the plastic surface knife with changed characteristics to achieve the purpose of fixing. Because it must be coated or the surface characteristics are modified, the manufacturing process is more complicated, It is time-consuming and costly. The feature of the present invention is to use an unmodified material as a biologically fixed substrate, and the biomolecules directly bond with the components on the surface of the substrate to achieve the purpose of fixing, so it is more convenient and convenient. The cost is low. SUMMARY OF THE INVENTION The object of the present invention is to provide a simple, effective and cost-effective biochip and a method for manufacturing the biochip, wherein the biomolecules are directly bonded to the organic polymer matrix in a stable manner. On the modified bare surface, it can improve the previous technology. The bare surface of the substrate must go through the tedious process of modification and The shortcomings of the biomolecules that are not sufficient to stably adhere to the surface of the substrate due to adsorption are not sufficient. -10- This paper ruler is applicable to the Chinese National Standard (CNS) A4 specification (210 X 297). Please read · Back

571098 A7 Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs _____ B7 _V. Description of the Invention (8) Another object of the present invention is to provide a biochip, which includes an organic polymer-based substrate. The naked surface directly composed of the organic polymer and a plurality of biomolecules fixed on the substrate, wherein the biomolecules are directly fixed on the naked surface of the substrate in a stable bonding manner. Molecules can be stably fixed directly on the uncoated bare surface of the substrate, and can perform various biochemical reactions, which can achieve the above purpose and avoid the disadvantages of the conventional technology. A second object of the present invention is to provide a method for manufacturing a biochip, comprising the following steps: (a) providing an organic polymer substrate having a bare surface directly composed of the organic polymer, (b) providing A plurality of biomolecules on the bare surface of the substrate, and (c) irradiating the biomolecules with the substrate with ultraviolet light, so that the biomolecules and the bare surface of the substrate are chemically bonded and fixed on the substrate, Thereby, the biomolecules can be stably and directly fixed on the substrate, and various biochemical reactions can be performed. Description of a preferred specific example In order to simplify the biochemical detection reaction, the present invention provides a biochip, comprising: an organic polymer matrix having a bare surface directly formed by the organic polymer; and a plurality of substrates fixed to the biopolymer. Biomolecules on the substrate; wherein the biomolecules are directly fixed to the bare surface of the substrate in a stable bonding manner by means of energy supply, whereby the biomolecules are stably and directly fixed to the substrate The substrate is untreated on the bare surface and is able to undergo various biochemical reactions. Please read ― Notes for Reading

Fill out the book page I I order

-11-This paper size is in accordance with Chinese National Standard (CNS) A4 (210 X 297 mm) 571098 A7 Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 5. Description of the invention (9) Organic polymer matrix of the biochip of the present invention It is a single polymer or mixed polymer selected from acrylic, acrylic, styrene, ethyl acetate, vinyl chloride, sulfonamide, carbonate, or cellulose acetate, or rubber or latex, and the preferred one is Acrylic. The organic polymer matrix may be in the form of a sheet, a cup, a disc, a tube, a sphere, or a pellet. In the application, the shape of the organic polymer matrix has great variability, and different additives can be added to change its color. This color change will help the interpretation of the results. For example, a white matrix is favorable for chemical coloration. The "color view" transparent substrate is suitable for color observation during chemical coloration and observation under the microscope during fluorescent color development, and the black substrate is suitable for observation of fluorescent color development. Children's biomolecules are selected from proteins, nucleic acids, cells or haptens, and more preferred are nucleic acid molecules. Furthermore, the biomolecules react with the bare surface of the substrate and are fixed on the substrate by means of energy administration. The methods of energy administration include irradiation with ultraviolet light or other energy treatment, such as 4, ' 'x 外', spring irradiation, water treatment or heating, the more preferable is ultraviolet light irradiation. " In the organic polymer matrix used in the present invention, biomolecules can be fixed by being irradiated with ultraviolet light or in the presence of other energy. As for the single core of organic polymers, S, the monomer composition of each polymer is different from that of nylon. Due to its microporous properties, the Nissei boat can facilitate the adsorption of nucleic acid molecules before they are fixed, and can be used for the fixing of nucleic acids in the form of unmodified materials. The so-called stable bond in the present invention refers to the cleaning under the minimum critical condition (Stringent) after hybridization reaction in the presence of 1N NaOH at a temperature of 4 ^ 0 ° C. _ _-12-This paper scale Specifications (21G x 297 Public Love 7 Pack ------ (Please read the Zhuyin on the back of If first? Matters ^ Fill out this page) · 1111111.

A7

(Please read and read the note on the back ·

IJ equipment ------ Fill in this page) Order --------- 571098 A7 B7 V. Description of invention (11) Printed by the Consumer Cooperative of Intellectual Property Bureau of the Ministry of Economic Affairs

The probe used in the embodiment of the present invention is provided with 25 thymidines at the 5 end, so as to fix the nuclear fe. When biotin-labeled oligoadepinoline ribonucleotide, oligothymosin oligonucleotide, tyrannosaurus nucleophilic acid, and oligocytosine nuclear acid are directly fixed to the acrylic matrix for verification It was found that the ability of fixation was best with oligothymidine and oligoguanine nucleotides, followed by oligoadenylate and oligocytosine. Subsequent experiments further verified that the nucleic acid probe does not need to add multiple thymines at the 5 'end. The nucleic acid probe can be composed of any series of bases, and can be directly and effectively fixed to the substrate after irradiation with ultraviolet light. The main advantage of the present invention is that the biomolecules are fixed by using the bare surface of the substrate. Since the substrate surface does not need to be subjected to modification before treatment, it saves time and money compared with the previous f operation. On the other hand, the use of «compound bases» has the advantages of being easily available and inexpensive. In addition, the embodiment of the present invention uses ultraviolet light as a source for fixing, which is more convenient and shorter than the prior art for fixing with a reagent in the prior art. In the present invention, organic polymer materials are used as a matrix, so that biomolecules are combined. This has the following advantages: First, the nucleic acid can be covalently thought of on the surface of the unmodified organic polymer. The organic polymer is a strong and sturdy material, which is enough to withstand the chemical two: useful temperature and ionic strength during cleaning; χ 〖Reaction made of non-porous surface material, so that the amount of impurities can be reduced. 'As a result, the probe and the target nucleic acid are added as a cross-buffer solution because the surface is non-porous, so the background axis will ride lower. Finally, another aspect of the present invention is to provide a method for manufacturing a biochip, including

JL system may be required

The size of this paper is fresh ((JNS) A4 specification? 297 public love) Pack ------ (Please read the precautions on the back before filling this page}

Printed by tT · Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 571098 A7 B7 V. Description of the Invention (12) The following steps: (a) Provide an organic polymer matrix with a bare substrate formed directly from the organic polymer. The surface; (b) providing a plurality of biomolecules on the bare surface of the substrate; and (c) chemically bonding the biomolecules to the bare surface of the substrate and affixed to the substrate by means of energy application In this way, the biomolecules can be stably and directly fixed to the substrate, and various biochemical reactions can be performed. According to the step (C) of the present invention, the energy is given by means of irradiation with ultraviolet light or treatment with other energy, such as infrared irradiation, microwave treatment, or heating, and UV radiation is preferred. Example 1: Nucleic acid probe selection A nucleic acid sequence selected from the untranslated region of the 5 'end of the enterovirus genome, with 25 5 thymines at the 5' end of the probe. Three probes were designed in total, with the sequences cEVprobe 1 : 5, (T) 25 TCCTCCGGCCCCTGAATGCGGCTAATC -3 '52mer cEVprobe 2: 5'_ (T) 25TGTCGTAACGG (/ C) GCAAC (/ G) TCT (/ C) GC (/ T) A (/ G) GCG GAACCGAC -3 '58mer cEVprobe 3: -15- This paper size is in accordance with Chinese National Standard (CNS) A4 (210 x 297 mm) Packing-(Please read the precautions on the back # (fill out this page) first f 571098 A7 B7 V. Description of the invention (13 Printed clothing by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs 5. One (T) 25TACTTTGGGTGTCCGTGTTTCT (/ C / A) TTTTAT -3 '53mer Nucleic acid primer selection is selected from the 5' untranslated region of the enterovirus genome The nucleic acid sequence of the primer is 5 'terminated with biotin. The forward and reverse primers are: f- cEV 2: 5'-biotin CAAGCACTTCTGTT (/ A / C) T (/ A / C) CCCCGG-3 '21mer r- cEV 2: 5'-biotin ATTGTCACCATAAGCAGCCA -3' 20mer nucleic acid probe is fixed to the acrylic substrate. The acrylic material is used as the nucleic acid-fixed substrate. The acrylic board was cut to a size of about 8 X 1 5 mm. The probes used were dissolved in 0.5% SDS and adjusted to 2 // M. The probes were spotted on a plastic substrate with a volume of 0.33 per spot. # [, 4 points of each type of 4 wooden needles. In addition, a negative control of M 1 3 uni ν ersa 1 primer is used as a negative control. After the probes are air-dried, the ultraviolet light with a wavelength of 24 5 nm is 1. 5 cm irradiation for 3 minutes. Preparation of target DNA reverse transcription friend PCR Take appropriate amount of enterovirus RNA 10 // L and put it in reverse transcription-polymerization chest: RT-PCR reverse transcription-polymerase chain reaction) (Ready-TO-GO, Amersham Pharmacia Biotech.), 2 // M r · cEV 2 1 // L was added, and it was heated at 70 ° C for 10 minutes and then put in Incubate on ice for 2-3 minutes, add water to make the volume in the tube 50 / L. Reaction at 42 ° C for 45 minutes, and then at 70t: reaction for 10 minutes, -16 This paper size applies Chinese National Standard (CNS) A4 specification (210 X 297 meals)

I I order

571098 A7 --- B7 V. Description of the invention (14) After cooling, perform PCR. Add another primer f_ CEV 2 before PCR. The reaction conditions were: after 94 minutes at 3 minutes, 94t: 40 seconds, 54 ° C at 40 seconds, and 72 ° C at 40 seconds for 35 cycles, and finally 72 minutes at 10 minutes. Hybridization reaction. First, place the probed plastic chip in a container of appropriate size, and place the hybridization buffer (5 X s SC, 0.1% N-lauroylsarcosine, 0.02% SDS? 1% blocking reagent). (Boehringer Mannheim)), warmed to 45. (: .. Add the PCR product produced above 2.5 // L (about 10 ng /// L) to 5mL of hybridization buffer, add this buffer to the container carrying the wafer, and perform the hybridization reaction at 4 5 ° C 20 Minutes. After the hybridization is completed, wash 2x 8 8 (: /0.1% 808 twice for 1 minute each time. With maleic acid buffer (ma 1 eicacidbuffer) (0.1 M maleic acid '0.1 5 Μ Na a C1, p Η 7 · 5) wet. Then streptococcal avidin-conjugated alkaline phosphatase (stock solution 2000-fold diluted in 0.1 Μ cis butene-1 '0.15 M NaCl, 1% blocking, ρΗ7.5 ·) for 20 minutes and then washed with maleic acid buffer twice for 1 minute each time. When coloring, first use a color development buffer (100 mM Tris-HCl, 100 mM NaCl, 50 111 was equilibrated at 1 \ / ^ (^ 12,? 119.5) for 2 minutes. The coloring solution was prepared by adding 200 // L nitroblue tetrazolium (NBT) / 5_bromo, 4_chloro-3- to the 101111 color development buffer. indolylp_hosphate (BCIP) (Boehringer Mannheim), the reaction was performed for 10 minutes after adding the coloring solution, and then the coloration was terminated by washing with water for 5 minutes. As a result, hybridization signals appeared in all three probes However, the negative control group did not have a signal, indicating that the positive result of the three probes was a specific result. The three repeated points made by each probe have strong signals-17. (210 X 297 mm) (Please read the notes on the back before filling this page)

ϋ — I ϋ «ϋ ϋ > I I · 1-ϋ H ϋ ϋ I · Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 571098

15 V. Description of the invention (to, when Table π uses this material as the fixation of nucleic acid, the employee's cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs and the Ministry of Economic Affairs printed a good cooperative example 2: if only Example 1 is used but the UV radiation is changed Time to understand the effect of the length of UV radiation on nucleic acid fixation. UV irradiation time is called 20 minutes, 30 seconds, 1 minute, 3 minutes, and 5 minutes. As a result, only 0 hours of UV light is used ^ Ren Heza's signal appeared again, and the hybrid signal strengthened with the increase of the irradiation time ^, which means that the irradiation of ultraviolet light helps the fixation of nucleic acids. Example 3: As in Example 1 ', but with different wavelengths of ultraviolet light The effect of irradiation on nucleic acid solidification was understood. The 254-wavelength ultraviolet light and UVB_wavelength ultraviolet light belonging to UVC were used as the energy source for nucleic acid fixation. The ultraviolet light exposure time was 6 minutes. As a result, it can be seen that both wavelengths are It can help nucleic acid fixation. Three kinds of probes can be effectively fixed when ^ wavelength is irradiated for 6 minutes, but 312 wavelength is irradiated ^ clock, cEVprobe 2 cannot be fixed yet, but in other experimental results, three kinds of The probes can be fixed. Example 4: A 9-well plate with a polystyrene material, rubber, 澍 〇 孑 dagger, pp, pE, 3 M Scotch tape was used as a nucleic acid fixing material. Only 7 operations in Example 1 were used for probe fixing. The results of the above fixation. The materials and nucleic acids can have a female Example 5: the protein fixation effect on plastic. The serum / t was taken with Pr < (phosphate-buffered saline) 1 〇 Times thin ^ '" release' diluted i pack ------ (Please read the precautions on the back before filling this page)

Order --------- 18 571098 A7 V. Description of the invention (16 The Intellectual Property Bureau Employee Consumer Cooperative of the Ministry of Economic Affairs printed and counted 5 / L on acrylic, after air-drying, a group of 254 nm8 long Ultraviolet light was irradiated at 1.5 cm for 3 minutes, and the other group was not irradiated with ultraviolet light. The mouse anti-pig antibody (50% diluted in 0.1% maleic acid, 0.15 M NaCl) was conjugated to a mouse anti-pig antibody to detect the phosphoenzyme. (1% blockmg, pH 7.5) at 37 C for 30 minutes, and then washed twice with maieic acid buffer solution. Each knife is colored with a color development buffer solution (100111) ^ 148-HC1. , 100 mM NaCl, 50 mM MgCl2, pH 9.5) Equilibrium 2 cents ° The main color solution is prepared by adding 2 〇〇 # L nitroblue tetrazolium (NBT) /5.bromo- 4-chloro-3 -indolylp-hosphate (BCIP) storage solution. After adding the coloring solution, the reaction was 10%, and then the coloring was stopped by washing with water for 5 minutes. As a result, the protein could be fixed to acrylic with or without UV light. The strength of the signal is strong, but the intensity of the signal will be stronger for those who irradiate ultraviolet light. A biochip obtained by the disclosure of the present invention and its The manufacturing method can provide an effective and simple solution to solve the shortcomings of the prior art, and is more convenient and cost-saving in the extraction of Kibe. It also provides chemical bonding to stabilize and fix biomolecules on the substrate without modification. The above-mentioned advantages have a forward-looking contribution to the development of the industry. The detailed descriptions mentioned above are only the preferred aspects of the present invention, and are not intended to limit the scope of protection of the present invention; Derivations or changes under the spirit should be defined by the scope of patent application stated below. Equipment-(Please read the precautions on the back before filling this page)

1T --------- -19-

Claims (1)

Claims Patent Scope-1 · A biochip, comprising:-an acrylic substrate 'the substrate has a bare surface formed directly from the organic polymer; and a plurality of biomolecules, the biomolecules, fixed to the substrate It is selected from the group consisting of proteins, nucleic acids and haptens. Among them, biomolecules such as m are directly fixed to the bare surface of the substrate in a stable bonding manner by means of ultraviolet light irradiation, infrared irradiation, microwave treatment or heating. In this way, the biomolecules can be stably and directly fixed on the bare surface of the substrate without surface treatment, and can perform various biochemical reactions. 2 · The biochip according to item 丨 of the scope of the patent application, wherein the biodiversity is an energy-giving method through ultraviolet light irradiation, infrared irradiation, microwave treatment or heating to react with and fix the bare surface of the substrate On the substrate. 3. A method for manufacturing a biochip, comprising the following steps: (a) providing an acrylic substrate having a bare surface directly formed by the organic polymer; (b) providing a plurality of biomolecules on the substrate On the naked surface of the organism, the organism is a group consisting of free proteins, nucleic acids, and haptens described in the sub-system; and (c) the biomolecules are given energy by means of ultraviolet irradiation, infrared irradiation, microwave treatment, or heating. Chemical bonding with the bare surface of the substrate and fixation on the substrate; thereby 'the biomolecules can be stably and directly fixed to the basic paper size Applicable to China National Standard (CNS) A4 (210 X 297) Dong) 571098 A8 B8 C8 D8 Patent application Fanyuan · Quality, and can perform a variety of biochemical reactions. 4. The method for manufacturing a biochip according to item 3 of the scope of the patent application, wherein the biomolecules are reacted with and fixed to the bare surface of the substrate by means of energy irradiation by ultraviolet light irradiation, infrared irradiation, microwave treatment or heating. On the substrate. -2- This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) ..... No. JJ ^ 858 patent application. Supplementary instructions (December 1990) Figl (Example 1) Fixation test of nucleic acid probe on acrylic cEVprobe 1 cEVprobe 2 cEVprobe 3 Negative (M13 primer) Figure 2 (Example 2) Effect of UV irradiation time on nucleic acid fixation 10 sec 20 sec 30 sec min 3 min 5 min i I cEVprobe 1 cEVprobe 2 cEVprobe 3 Negative (M13 primer) Fig 3 (Example 3) Fixation effect of ultraviolet light with different wavelengths 254 nm 312 cEVprobe 1 cEVprobe 2 cEVprobe 3 Negative (M13 primer) cEVprobe 1 cEVprobe 2 cEVprobe 3 Negative (M13 primer) -Λ '· * · * ·: wewm. ------- g 571098., 1 i 丨 公 晋. 尽 j _ 年 网 f Fig4 (Example 4 ) Fixing effect of different organic polymer materials Polystyrene cEVprobe 1 (P1) cEVprobe 2 (P2) cEVprobe 3 (P3) Acrylic] 〇 c 'P1 〇 〇 0 P2 © _ @ P3 N Negative (N) (M13 primer ) Rubber P1 μ ', ίυ PI P2 [Ί, P2 P3 P3 NN PP Latex PE 3M Scotch tape PI P2 P3 N PI o © -r P2 # · # P3 N Ρ1 Ρ2 Ρ3 Ν See Hg 5 (Example 5) Fixation effect of protein on organic polymer material No UV irradiation ϋν irradiation t 2 -Bamboo Month 丨 Day ---_ Supplementary Patent Application No. 088119858_Chinese Supplementary Specification (92) 〇 The embodiment of the abundance antigen cuts a white PE plastic plate with a thickness of about 1 mm into 1xlcm square plastic crystals彳, rinse with water and alcohol and air-dry for later use. Two groups of probes of 10uM Biotin-WdUTP (Roche) and the control group were applied to the surface of the aforementioned plastic chip. After air-drying, the samples were dried at 254nm UV light with a wavelength of 0.8 joules was added to the aforementioned plastic wafer with biotm (biotm), and a streptavidin-linked alkaline phosphatase buffer solution (stock solution (Promega) was diluted 2000 times with Maleic acid Buffer (ingredient) : 0.1 μ Maleic acid, 0.15 M NaQh 1% Blocking Reagent (Roche), pH 7.5)]. After reacting at room temperature for 20 minutes, rinse thoroughly with Maleic acid Buffer at pH 7.5. Reaction completed wafer. After washing the wafer, add a coloring buffer (100m Tris-HCl, 100mM NaCl, 50mM MgCl2, pH9.5) to the equilibrium pH for 2 minutes and remove it. Add a coloring solution (NBT / BCIP (Roche)) to the coloring buffer The solution was diluted 50 times) and then reacted at room temperature for 10 minutes. The wafer was rinsed with water to stop the reaction. The results showed that the experimental group of biotin spots on the wafer showed a strong blue-black signal, while the control group with the secondary water spot had no Any signal is generated. Therefore, it is proved that biotin as a steroid (a hapten-like material) can be fixed on a plastic chip. P: \ SYC \ CHINESE \ 60798EXAMPLE.DOC \ LAN