TW202400187A - Oligonucleotide - Google Patents

Abstract

The invention relates to the field of oligonucleotides binding to a polyomavirus RNA. Such oligonucleotides may be used for the treatment of any disease or condition caused by or associated with such virus.

Description

Oligonucleotides

The present invention relates to the field of oligonucleotides that bind to polyomavirus RNA. Such oligonucleotides may be used to treat any disease or condition caused by or associated with such viruses.

Polyomaviruses are small, non-enveloped double-stranded DNA viruses whose natural hosts are usually mammals and birds. Infections in adults are mostly asymptomatic but may become pathological when the immune system is compromised. Examples of human polyomaviruses are BK virus (BKV), JC virus (JCV) and Merkel cell virus (MCV).

Both JCV and BKV are opportunistic pathogens that infect humans in early childhood (Leploeg, M.D. et al., Clinical Infectious Diseases, 2001). Seroprevalence in adults is high. Both viruses are thought to lie dormant in the host's kidney cells (Wunderink, H.F. et al., American Journal of Transplantation, 2017). For example, reactivation may occur in immunosuppressed individuals (Wunderink, H.F. et al., American Journal of Transplantation, 2017; Parajuli, S. et al., Clinical Transplantation, 2018; Gard, L. et al., PLoS One [PLoS One], 2017).

Polyomaviruses share a common genome structure. They have genes that are expressed in both early and late stages of the infection cycle. Both early and late genes produce RNA from which a variety of proteins can be translated through differential splicing. Late genes typically encode three capsid proteins, whereas early genes encode small and large T antigens and often include one or more alternatively spliced coding regions (Helle, F. et al., Viruses, (2017) , 3; 9(17): 327, 1-18).

WO 2019/168402 describes antisense oligonucleotides that modulate the splicing of polyomavirus large T antigen pre-mRNA (pre-mRNA). Such antisense oligonucleotides may have sequences complementary to splice donor sites and/or splice acceptor sites in the pre-mRNA.

However, there remains a need for new and improved antisense oligonucleotides to treat diseases or conditions caused by or associated with polyomaviruses.

In a first aspect, the invention relates to an oligonucleotide comprising a nucleobase sequence according to one of SEQ ID NO: 1 to 11 or comprising a sequence similar to SEQ ID NO: 1 to 11 The nucleobase sequence of any one of the SEQ ID NOs, characterized in that at least one nucleobase of the SEQ ID NO is replaced by a nucleobase analog having the same base pairing specificity as the replaced nucleobase.

In a second aspect, the invention relates to a vector comprising (i) an oligonucleotide as defined in the first aspect, (ii) the reverse of an oligonucleotide as defined in the first aspect. complementary sequence, or (iii) DNA capable of being transcribed into an oligonucleotide as defined in the first aspect.

In a third aspect, the invention relates to a pharmaceutical composition comprising an oligonucleotide as defined in the first aspect or a vector as defined in the second aspect.

In a fourth aspect, the present invention relates to an oligonucleotide as defined in the first aspect, a carrier as defined in the second aspect or a pharmaceutical composition as defined in the third aspect, for use as a medicine Use, in particular for use in the treatment of polyomavirus infection in a subject.

In a fifth aspect, the invention relates to ex vivo methods, including ex vivo methods for inhibiting polyomavirus replication in cells and ex vivo methods for generating grafts, both of which include using, as in the first aspect, An oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect.

Before the present invention is described in detail below, it is to be understood that this invention is not limited to the specific methods, protocols and reagents described herein, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which scope will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

Preferably, the terms used herein are as defined in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, H.G.W, Nagel , B. and Kölbl, H., editors (1995), Helvetica Chimica Acta [Swiss Journal of Chemistry], CH-4010 Basel, Switzerland.

Several documents are referenced throughout this manual. Each document (including all patents, patent applications, scientific publications, manufacturer's instructions, instructions for use, etc.) cited herein (whether supra or below) is hereby incorporated by reference in its entirety.

In the following, elements of the invention will be described. These elements are listed with particular embodiments, however, it is understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed as limiting the invention to the expressly described embodiments. This specification is to be understood as supporting and encompassing embodiments that combine the specifically described embodiments with any number of disclosed and/or preferred elements. Furthermore, unless the context dictates otherwise, any permutations and combinations of all described elements in this application shall be deemed to be disclosed by the description of this application.

Throughout this specification and the following claims, unless the context otherwise requires, the word "comprise" and variations such as "comprises" and "comprising" will be understood to imply the inclusion of stated integers or steps. or a group of integers or steps, but not to the exclusion of any other integer or step or group of integers or steps. In a preferred embodiment, "comprising" can mean "consisting of." As used in this specification and the appended claims, the singular forms "a/an" and "the" include plural referents unless the content clearly dictates otherwise.

In a first aspect, the invention relates to an oligonucleotide, in particular an oligonucleotide comprising a nucleobase sequence having a nucleobase according to one of SEQ ID NOs: 1 to 11 Base pairing specificity of the base sequence.

Typically, the oligonucleotide comprises a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that At least one nucleobase of the SEQ ID NO is replaced by a nucleobase analog having the same base pairing specificity as the replaced nucleobase. Oligonucleotide, basic structure

The oligonucleotide of the present invention can specifically bind to polyomavirus pre-mRNA ("target RNA") produced after human cells are infected with polyomavirus. Therefore, it may also be described as a polyomavirus oligonucleotide or antisense oligonucleotide ("ASO") or a polyomavirus antisense oligonucleotide. The portion of the target RNA that the oligonucleotide can specifically bind to (i.e., a stretch of contiguous nucleobases) is referred to herein as the "target region."

In preferred embodiments, at least a portion of the oligonucleotides are at least substantially complementary to the target region. Thus, the oligonucleotide contains at least 12 contiguous nucleobases whose sequence is the reverse complement of the at least 12 contiguous nucleobase sequence of the target region. Preferably, the length of the target area is 12 to 30, that is, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29 or 30 nucleobases, or 12 to 28 nucleobases. More preferably, the length of the target region is 17 to 26, that is, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleobases. Even better, the target region is 18 to 22, ie 18, 19, 20, 21 or 22 nucleobases in length. Most preferably, the target region is 20 nucleobases in length.

Typically, the target region contains polyomavirus pre-RNA. The target region is preferably a splice donor site including intron 1 (or part thereof) and/or exon 1 (or part thereof) of the large T antigen of the corresponding polyoma virus. Preferably, the target region includes up to 30 contiguous nucleobases of intron 1 and/or (preferably and) exon 1, wherein 0 to 30 of the 30 contiguous nucleobases, That is, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases belong to the splice donor site of intron 1, and the remaining contiguous nucleobases belong to exon 1. In preferred embodiments, the target region contains one or two intronic nucleobases adjacent to the splice donor site. In a preferred embodiment, the target region includes 1-28 adjacent splicing donor sites, that is, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 intron nucleobases. In another preferred embodiment, the target region includes 1-28 adjacent to the splice donor site, that is, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 exon nucleobases.

It is understood that the sum of the number of nucleobases in the introns and exons does not exceed the total number of nucleobases in the oligonucleotide.

In embodiments, the oligonucleotide may comprise one or more nucleobases that are incapable of specifically binding to the target RNA, and specifically are not reverse complementary to the target RNA (in the case of a contiguous sequence that is reverse complementary to the target RNA Down).

Oligonucleotides are up to 200, up to 175, or up to 150, preferably up to 100, and more preferably up to 50 nucleobases (including nucleotides and nucleotide analogs) in length ) long, such as 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobases. When the length of the oligonucleotide is greater than 50 nucleotides (for example, when the length is 75 or 100 or 150 or 200 nucleotides), the oligonucleotide may also be called a polynucleotide. In a preferred embodiment, the length of the oligonucleotide is 12 to 27, preferably 12 to 22, that is, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 Or 22 nucleobases, more preferably from 17, 18, 19 or 20 to 22 nucleobases, that is, 17, 18, 19, 20, 21 or 22 nucleotides. In a preferred embodiment, the oligonucleotide is 20 nucleobases in length.

In particular, the first aspect relates to an oligonucleotide comprising a nucleobase sequence (or nucleotide sequence) having a sequence according to SEQ ID NOs: 1 to 11 The base pairing specificity of a nucleobase sequence. This means that the nucleobase sequence of the oligonucleotide comprises a nucleobase sequence according to one of SEQ ID NOs: 1 to 11, or that it contains a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11 sequence. "Similar" means characterized in that at least one nucleobase of the SEQ ID NO is replaced by a nucleobase analog having the same base pairing specificity as the nucleobase being replaced. Nucleobase analogs are modifications explained below. Preferred embodiments relate to SEQ ID NO: 5, 6, 7, 8 and 10, with SEQ ID NO: 8 being preferred. The oligonucleotide embodiments described above are applicable (so long as they are compatible). In a preferred embodiment, the nucleobase sequence (or nucleotide sequence) of the oligonucleotide consists of a nucleobase sequence according to one of SEQ ID NOs: 1 to 11, or wherein the oligonucleotide The nucleobase sequence consists of a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11. Oligonucleotides, modifications

Oligonucleotides can be modified (referred to herein as "modified oligonucleotides"). This is expected to improve stability, particularly resistance to nucleases. This is advantageous when the oligonucleotide is administered unchanged (i.e., naked) to the patient.

Thus, in embodiments, the oligonucleotide is a modified oligonucleotide. In embodiments, the modifications of the oligonucleotide are compared to (natural) RNA oligonucleotides. Modified oligonucleotides contain modified internucleotide linkages and/or modified nucleotides. Modified nucleotide is a synonym for nucleotide analog.

In a preferred embodiment, the oligonucleotide comprises modifications that render the RNA duplex resistant to nucleases, preferably exonucleases, in particular RNase H, wherein the RNA duplex Comprised of the oligonucleotide and an oligonucleotide that is at least partially complementary to it (complementary oligonucleotide, ie target RNA). In other words, the oligonucleotide provides resistance to nuclease degradation of an RNA duplex comprising the oligonucleotide and an oligonucleotide that is at least partially complementary thereto. This is preferably provided by inter-nucleotide bond modifications (e.g. phosphorothioate modified nucleotides and/or sugar (scaffold) modifications (e.g. 2'-O-modified sugar modifications)) as described above . Therefore oligonucleotides preferably comprise regions with modifications that provide duplex nuclease resistance (i.e. at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 modified nuclei). glycosides).

Modified oligonucleotides may contain nucleotide analogs and/or modified internucleotide linkages. When each internucleotide bond is modified, an oligonucleotide is said to have "backbone modifications."

Nucleotide analogs preferably include base modifications ("modified bases") and/or sugar modifications ("modified sugars", also known as scaffold modifications). In embodiments, the base modifications are modified versions of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, pseudouracil, pseudocytosine (pseudocytosine), 1-methylpseudouracil, orotic acid, agmatine, lysine, 2-thiopyrimidines (such as 2-thiouracil, 2-thiothymine), G-clip ( G-clamp) and its derivatives, 5-substituted pyrimidines (such as 5-halogenated uracil, 5-halogenated methyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5 -Proparnylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5'-methylcytosine, 5'-methylcytosine, 5 -Hydroxymethylcytosine, Super T or, for example, Kumar et al. J. Org. Chem . [Organic Chemistry Journal] 2014, 79 , 5047; Leszczynska et al. Org. Biol. Chem . [Organic Biochemistry] 2014, 12 , 1052), pyrazolo[1,5-a]-1,3,5-tri𠯤C-nucleoside (such as Lefoix et al. J. Org. Chem . [Journal of Organic Chemistry] 2014, 79 , 3221), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza- 7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, boronated cytosine (e.g. Nizioł et al . Bioorg. Med. Chem . [Biology] Organic and Medicinal Chemistry] 2014, 22, 3906), pseudoisocytidine, C(Pyc) (as e.g. Yamada et al. Org. Biomol. Chem . [Organic and Biomolecular Chemistry] 2014, 12, 2255) and N4-ethylcytosine or its derivatives; ^N2 -cyclopentylguanine (cPent-G), ^N2 -cyclopentyl-2-aminopurine (cPent-AP) and ^N2 -propyl- 2-aminopurine (Pr-AP), carbohydrate-modified uracil (e.g., Kaura et al. Org. Lett . [Organic Letters] 2014, 16, 3308), amino acid-modified uracil (e.g., e.g. Guenther et al. Chem. Commun. [Chemical Communications] 2014, 50, 9007); or derivatives thereof; or degenerate or universal bases (like 2,6-difluorotoluene), or no bases (like abasic site) (e.g. 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the epoxy is replaced by nitrogen (nitrogen azaribose))). Examples of derivatives of Super A, Super G and Super T can be found in US Patent 6,683,173 (Epoch Biosciences). When incorporated into siRNA, cPent-G, cPent-AP, and Pr-AP were shown to reduce immunostimulatory effects (Peacock H. et al. J. Am. Chem. Soc . [Journal of the American Chemical Society] 2011, 133 , 9200). Further examples of modified bases are described, for example, in WO 2014/093924.

Preferred modified bases are 5'-methylcytosine and 5'-methylcytosine. In preferred embodiments, all cytosines of the oligonucleotide are modified (i.e., replaced with) 5'-methylcytosine or preferably 5'-methylcytosine.

Typically, nucleobase analogs are used to replace nucleobases with the same base pairing specificity in at least the portion of the oligonucleotide that is complementary to the target region. "Base pairing" means that two nucleobases are bonded to each other through hydrogen bonds. In particular, nucleobase analogs that replace cytosine can base pair with guanine, nucleobase analogs that replace guanine can base pair with cytosine, and nucleobase analogs that replace adenine can base pair with uracil. Base pairing, and nucleobase analogues that replace uracil are able to base pair with adenine.

The oligonucleotide may comprise at least 1, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 base modifications. These may all be the same type of modification, or they may contain two or more different modifications.

The sugar (scaffold) modification may be a modification of the ribosyl moiety, such as a 2'- O -modified RNA nucleotide, such as a 2'- O -alkyl or a 2'- O- (substituted)alkyl, such as a 2' - O -methyl, 2'- O -(2-cyanoethyl), 2'- O -(2-methoxy)ethyl (2'-MOE), 2'- O -(2-thio Methyl)ethyl, 2'- O -butyl, 2'- O -propargyl, 2'- O -acetal ester (such as Biscans et al . Bioorg. Med. Chem . [Bioorganic and Medicinal Chemistry] 2015 , 23 , 5360), 2'- O -allyl, 2'- O -(2S-methoxypropyl), 2'- O -(N-(aminoethyl)aminomethyl) Methyl) (2'-AECM), 2'- O -(2-carboxyethyl) and aminoformyl derivatives (Yamada et al. Org. Biomol. Chem . [Organic and Biomolecular Chemistry] 2014, 12 , 6457), 2'- O -(2-amino)propyl, 2'- O -(2-(dimethylamino)propyl), 2'- O -(2-amino)ethyl , 2'- O -(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'- O -(haloalkoxy)methyl (Arai K. et al . Bioorg. Med . Chem . [Bioorganic and Medicinal Chemistry] 2011, 21 , 6285) For example, 2'- O -(2-chloroethoxy)methyl (MCEM), 2'- O -(2,2-dichloroethoxy methyl)methyl (DCEM); 2'- O -alkoxycarbonyl, such as 2'- O -[2-(methoxycarbonyl)ethyl] (MOCE), 2'- O -[2-(N -methylaminoformyl)ethyl] (MCE), 2'- O -[2-(N,N-dimethylaminoformyl)ethyl] (DCME), 2'- O - [2-(Methylthio)ethyl] (2'-MTE), 2'-(ω-O-serinol);2'-halo, such as 2'-F, FANA (2'-F Arabinol) Glycosyl nucleic acid); 2',4'-difluoro-2'-deoxy; carbocyclic sugar and aza sugar modification; other modified RNA nucleotides are 3'-O-substituted (such as 3'- O-methyl, 3'-O-butyl, 3'-O-propargyl), 4'-substituted (e.g. 4'-aminomethyl-2'-O-methyl or 4'-amino Methyl-2'-fluoro;5'-substituted, e.g. 5'-methyl) or CNA (Østergaard et al. ACS Chem. Biol . 2014, 22, 6227). Derivatives of the above are also contemplated.

Additionally, sugar (scaffold) modifications may include bicyclic nucleic acid monomers (BNA), which may be bridged nucleic acid monomers. Each occurrence of said BNA may result in a monomer independently selected from the group consisting of: conformationally restricted nucleotide (CRN) monomer, locked nucleic acid (LNA) monomer, wood-LNA monomer, alpha -LNA monomer, α-L-LNA monomer, β-D-LNA monomer, 2'-amino-LNA monomer, 2'-(alkylamino)-LNA monomer, 2'-(遯Amino)-LNA monomer, 2'-N-substituted-2'-amino-LNA monomer, 2'-thio-LNA monomer, (2'-O,4'-C) constrained ethyl (cEt) BNA monomer, (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, 2',4'-BNA ^NC (NH) monomer, 2', 4'-BNA ^NC (N-Me) monomer, 2',4'-BNA ^NC (N-Bn) monomer, ethylene bridged nucleic acid (ENA) monomer, carba LNA (cLNA) monomer, 3,4- Dihydro-2H-piranucleic acid (DpNA) monomer, 2'-C-bridged bicyclic nucleotide (CBBN) monomer, heterocyclic bridged BNA monomer (such as triazolyl or tetrazolyl linked), chelate Amino-bridged BNA monomer, urea-bridged BNA monomer, sulfonamide-bridged BNA monomer, bicyclic carbocyclic nucleotide monomer, TriNA monomer, α-L-TriNA monomer, bicyclic DNA (bcDNA) monomer, F- bcDNA monomer, tricyclic DNA (tcDNA) monomer, F-tcDNA monomer, oxetane nucleotide monomer, locked PMO monomer derived from 2'-amino-LNA, guanidine bridged nucleic acid (GuNA ) monomer, spirocyclopropene bridged nucleic acid (scpBNA) monomer and its derivatives.

Preferred sugar modifications are selected from the group consisting of: 2'- O -modification, preferably 2'- O -alkyl or 2'- O- (substituted)alkyl, more preferably 2' -O -methyl or 2'- O- (2-methoxy)ethyl (2'-MOE) and modification of BNA monomer (preferably CRN monomer or locked nucleic acid (LNA) monomer) . Even more preferred is a combination of 2'- O -methyl sugar modification and modification of LNA. Even better is 2'- O -methyl as the only sugar modification.

The oligonucleotide may comprise at least 1, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 sugar modifications. These may all be the same type of modification, or they may contain two or more different modifications.

Internucleotide bond modifications may be selected from the group consisting of: modified phosphodiesters of RNA such as phosphorothioate (PS), chiral pure phosphorothioate, (R)-phosphorothioate, (S)-Phosphorothioate, phosphorodithioate (PS2), phosphoryl acetate (PACE), phosphoryl acetamide (PACA), phosphorothioate (thio PACE), phosphorothioate acetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl thiophosphonate, methyl phosphate, methyl phosphorothioate, ethyl phosphate , Ethyl phosphorothioate, borophosphate ester, phosphorothioate ester, methyl phosphorothioate, methyl phosphorothioate, methyl phosphorothioate, methyl phosphorothioate, phosphoric acid ester, triester phosphate, amine Alkyl phosphate trysters and their derivatives. Another modification includes guanidine phosphate, phosphoramidite, aminophosphonate, N3'àP5'aminophosphatide, diaminophosphate, thiodiaminophosphate, amidosulfonate, diacetate Methylene, amide, sulfonate, siloxane, sulfide, sulfonate, methylacetyl, thiomethylacetyl, methylenemethylacetyl, alkenyl, methylenehydrazino, sulfonamide , amide, triazole, oxalyl, carbamate, methyleneimine (MMI) and thioacetamide-based nucleic acids (TANA) and their derivatives. Examples of chirally pure phosphorothioate bonds are described, for example, in WO 2014/010250 or WO 2017/062862 (WaVe Life Sciences). Examples of guanidine phosphate bonds are described in WO 2016/028187 (Noogen). Also included are various salts, mixed salts and free acid forms, as well as 3’à3’ and 2’à5’ linkages.

The oligonucleotide may comprise at least 1, eg, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or at least 10, internucleotide linkage modifications. These may all be the same type of modification, or they may contain two or more different modifications.

Preferred inter-nucleotide bond modifications are PS, PS2, aminophosphonate or diaminophosphate, with PS being preferred. In a preferred embodiment, all internucleotide linkages of the oligonucleotide are PS linkages. In other words, the backbone of the oligonucleotide is PS.

In one embodiment, one of the nucleotides at the 5' end of the oligonucleotide and/or one of the nucleotides at the 3' end of the oligonucleotide is modified (i.e., is a nucleotide analog and/or have modified internucleotide linkages), and the nucleotides in the central portion of the oligonucleotide are not modified. The "5' or 3' end nucleotides" cover 20% of the nucleotides of the corresponding end of the oligonucleotide, and the "central portion" covers the remaining nucleotides of the oligonucleotide. For example, if the oligonucleotide has a sequence consisting of 20 nucleotides, then the 4 nucleotides at the 5' end of the oligonucleotide are the 5' end nucleotides and the 4 nucleotides at the 3' end of the oligonucleotide are The acid is the nucleotide at the 3' end, and the remaining 12 nucleotides are the nucleotides in the central portion of the oligonucleotide. If the number of nucleotides based on a percentage is not a whole number, it is rounded to the nearest whole number (the first decimal point up to 4 is rounded down, the first decimal point at least 5 is rounded up). Thus, in one embodiment, at least one nucleotide and/or at least one internucleotide linkage present at the 5' end and/or 3' end of the oligonucleotide is modified, while other nucleotides and other nucleosides The interacid bond is not modified.

Covered modifications are defined herein. It is expected that modification of the oligonucleotide at such positions may help improve its stability or resistance to exonucleases. This is advantageous when the oligonucleotide is administered unchanged (i.e., naked) to the patient.

In embodiments, the last 1, 2, 3, 4 nucleotides and/or inter-nucleotide linkages 5' to the oligonucleotide are modified.

In embodiments, the last 1, 2, 3, 4 nucleotides and/or inter-nucleotide linkages 3' to the oligonucleotide are modified.

In embodiments, the last 1, 2, 3, 4 nucleotides and/or inter-nucleotide linkages at the 5' and 3' of the oligonucleotide are modified. Preferably, 2 nucleotides and/or 2 inter-nucleotide linkages at 5' and 3' of the oligonucleotide are modified. Preferably, the three nucleotides 5' and 3' of the oligonucleotide and/or the inter-nucleotide linkage are modified. Preferably, the four nucleotides 5' and 3' of the oligonucleotide and/or the inter-nucleotide linkage are modified.

For example, for SEQ ID NO: 1 to 10, the oligonucleotide includes an unmodified internucleotide linkage between nucleotides 5 to 16 of SEQ ID NO: 1 to 10, and the oligonucleotide A modified internucleotide linkage between at least two 5'most nucleotides and between at least two 3'most nucleotides of the oligonucleotide. For example, for SEQ ID NO: 11, the oligonucleotide includes an unmodified internucleotide linkage between nucleotides 5 to 15 of SEQ ID NO: 11, and at least two of the last two nucleotides of the oligonucleotide. Modified internucleotide linkages between the 5' terminal nucleotides and between the at least two 3' terminal nucleotides of the oligonucleotide.

Preferably, at least 1, and preferably 2 to 4, more preferably 4 nucleotides at the 5' and/or 3' end of the oligonucleotide, and optionally all nucleotides are Modified, particularly by having modified internucleotide linkages.

Modifications (especially modifications of the 5' and/or 3' end nucleotides) preferably comprise modified inter-nucleotide linkages, more preferably PS. Furthermore, the nucleotide is preferably a nucleotide analog. This nucleotide analog is characterized by containing a modified sugar (preferably 2'- O -methyl), a modified base (preferably 5'-methylcytosine) and/or a system LNA monomer. For example, the following combinations are contemplated to characterize nucleotide analogs: modified sugar only; modified sugar and modified base; LNA monomer only; LNA monomer and modified base.

In a preferred embodiment, all internucleotide linkages of the oligonucleotide are PS linkages, and all nucleotides of the oligonucleotide have 2'- O -methyl bases. Among them, preferably, all cytidines of the oligonucleotide are modified to 5-methylcytidine (that is, the oligonucleotide does not contain cytidine, but contains 5-methylcytidine, especially when combined with at the position where the guanosine pairs in the target RNA).

Therefore, in embodiments, when referring to modifications at the 5' and/or 3' end of an oligonucleotide, such modifications are: - the modified internucleotide bond is PS, and/or -Modified sugar is 2'-O-methyl -The modified base is 5-methylcytosine and/or -The modified nucleotides are locked nucleic acid (LNA) monomers.

Therefore, in embodiments, when referring to modifications at the 5' and/or 3' end of an oligonucleotide, such modifications are: -The modified internucleotide bond is PS, -The modified sugar is 2'-O-methyl, -The modified base is 5-methylcytosine and/or -The modified nucleotides are locked nucleic acid (LNA) monomers.

Preferably, such modifications are: - the modified internucleotide bond is PS and -The modified sugar is 2'-O-methyl.

Preferably, such modifications are: -The modified internucleotide bond is PS, -The modified sugar is 2'-O-methyl and -The modified base is 5-methylcytosine.

Preferably, such modifications are: - the modified internucleotide bond is PS and -The modified nucleotides are locked nucleic acid (LNA) monomers.

Preferably, such modifications are: -The modified internucleotide bond is PS, - the modified nucleotide is a locked nucleic acid (LNA) monomer and -The modified base is 5-methylcytosine.

In embodiments, the oligonucleotide is as follows: the internucleotide linkages in the central portion of the oligonucleotide are unmodified, and preferably the 2 to 4 most 5' ends of the oligonucleotide and/or the 2 to The 4 most 3' end inter-nucleotide bonds are modified, preferably these inter-nucleotide bonds are phosphorothioate inter-nucleotide bonds.

In embodiments, the oligonucleotide is modified such that each internucleotide linkage is a phosphorothioate linkage and all nucleotides have a 2'-O-methyl base.

In a preferred embodiment, the oligonucleotide is modified such that each internucleotide linkage is a phosphorothioate bond, all cytidines are 5'-methylcytidines, and all nucleotides are Has 2'-O-methyl base.

Examples of preferred oligonucleotides are characterized as follows: - Each internucleotide linkage is a phosphorothioate linkage and all nucleotides have a 2'- O -methyl base, for example: having An oligonucleotide having a sequence or a nucleotide sequence consisting of: SEQ ID NO: 12 (nucleobase sequence of SEQ ID NO: 1), SEQ ID NO: 13 (nucleobase sequence of SEQ ID NO: 2 sequence), SEQ ID NO: 14 (nucleobase sequence of SEQ ID NO: 3), SEQ ID NO: 15 (nucleobase sequence of SEQ ID NO: 4), SEQ ID NO: 16 (nucleobase sequence of SEQ ID NO: 5 SEQ ID NO: 17 (the nucleobase sequence of SEQ ID NO: 10), SEQ ID NO: 18 (the nucleobase sequence of SEQ ID NO: 7), SEQ ID NO: 19 (the nucleobase sequence of SEQ ID NO: 7) ID NO: 8), SEQ ID NO: 20 (Nucleobase sequence of SEQ ID NO: 9), SEQ ID NO: 21 (SEQ ID NO: 10), or SEQ ID NO : 22 (nucleobase sequence of SEQ ID NO: 11) - Each internucleotide bond is a phosphorothioate bond, all cytidines are 5'-methylcytidines, and all nucleotides have 2'- O -methyl base, for example: an oligonucleotide having a nucleotide sequence comprising or consisting of the following sequence: SEQ ID NO: 26 (nucleobase sequence of SEQ ID NO: 11), SEQ ID NO: 30 (nucleobase sequence of SEQ ID NO: 6) or SEQ ID NO: 34 (nucleobase sequence of SEQ ID NO: 7).

Therefore, in a preferred embodiment, the oligonucleotide comprises a nucleotide sequence according to one of SEQ ID NO: 12 to 22, 26, 30 and 34. In a more preferred embodiment, the nucleotide sequence of the oligonucleotide consists of a nucleotide sequence according to one of SEQ ID NOs: 12 to 22, 26, 30 and 34. In these embodiments, SEQ ID NO: 17-19, 26, 30 and 34 are preferred; among them, SEQ ID NO: 19, 26, 30 and 34 are preferred, especially SEQ ID NO: 19 .

Accordingly, in embodiments, the oligonucleotide consists of SEQ ID NO: 19, 34, 17, 18, 30 or 26 and exhibits attractive therapeutic activity as demonstrated in the experimental section (see e.g. Figure 4 , Figure 5, Figure 6). In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

Thus, in embodiments, the oligonucleotide comprises SEQ ID NO: 19 or 8. In embodiments, such oligonucleotides are 20 to 100 nucleotides in length. In embodiments, the oligonucleotide consists of SEQ ID NO: 19 or 8. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

Thus, in embodiments, the oligonucleotide comprises SEQ ID NO: 34 or 18 or 7. In embodiments, such oligonucleotides are 20 to 100 nucleotides in length. In embodiments, the oligonucleotide consists of SEQ ID NO: 34 or 18 or 7. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

Thus, in embodiments, the oligonucleotide comprises SEQ ID NO: 30 or 17 or 6. In embodiments, such oligonucleotides are 20 to 100 nucleotides in length. In embodiments, the oligonucleotide consists of SEQ ID NO: 30 or 17 or 6. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

Thus, in embodiments, the oligonucleotide comprises SEQ ID NO: 26 or 16 or 5. In embodiments, such oligonucleotides are 20 to 100 nucleotides in length. In embodiments, the oligonucleotide consists of SEQ ID NO: 26 or 16 or 5. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

In embodiments, an oligonucleotide is provided comprising one of SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 and having a length of 20 to 100 nucleotides, or the oligonucleotide consists of one of SEQ ID NO: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

In embodiments, an oligonucleotide is provided, the oligonucleotide comprising one of SEQ ID NO: 34, 30 or 26 and being 20 to 100 nucleotides in length, or the oligonucleotide consisting of SEQ ID NO: one of 34, 30 or 26. In this embodiment, the oligonucleotide may be further modified as defined earlier herein.

In embodiments, oligonucleotides are provided that comprise SEQ ID NO: 19 or 34 and are 20 to 100 nucleotides in length, or the oligonucleotide consists of SEQ ID NO: 19 or 34 composition. In this embodiment, the oligonucleotide may be further modified as defined earlier herein. Oligonucleotide, conjugated

In some embodiments, an oligonucleotide is conjugated to one or more ligands. The ligand is preferably capable of targeting and/or delivering the oligonucleotide to (or into) an organ, tissue and/or cell, such as the kidney, renal tissue or kidney cells, or the bladder, bladder tissue or bladder cells, in particular bladder epithelial cells.

Examples of ligands are, for example, peptides, vitamins, aptamers, carbohydrates or mixtures of carbohydrates (Han et al., Nature Communications, 2016, doi:10.1038/ncomms10981; Cao et al., Mol. Ther. Nucleic Acids [Molecular Therapeutics Nucleic Acids], 2016, doi:10.1038/mtna.2016.46), proteins, small molecules, antibodies (or antigen-binding fragments thereof), polymers, drugs. Examples of carbohydrate conjugate group ligands are glucose, mannose, galactose, maltose, fructose, N-acetylgalactosamine (GalNac), glucosamine, N-acetylglucosamine, glucose-6 -Phosphate, mannose-6-phosphate and maltotriose. The carbohydrate may be present in a variety of forms, such as as terminal groups linking the carbohydrate to dendritic or branched head portions of the components of the composition. Carbohydrates can also be included in carbohydrate cluster moieties, such as GalNAc cluster moieties. The carbohydrate cluster moiety may include a targeting moiety and optionally a conjugate linker. In some embodiments, the carbohydrate cluster moiety contains 1, 2, 3, 4, 5, 6 or more GalNAc groups. As used herein, "carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a scaffold or linker group (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting [Synthesis of antisense oligonucleotides conjugated to multivalent carbohydrate clusters for cellular targeting],” Bioconjugate Chem. [Bioconjugate Chemistry], 2003, (14): 18-29; Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor Design and synthesis of galactosamine-capped glycolipids],” J. Med. Chem. [Journal of Medicinal Chemistry] 2004, (47): 5798-5808). In this context, "modified carbohydrate" means any carbohydrate that has one or more chemical modifications relative to naturally occurring carbohydrates. As used herein, "carbohydrate derivative" means any compound that can be synthesized using carbohydrates as starting materials or intermediates. As used herein, "carbohydrate" means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. Both types of excipients can be combined together to form a single composition as identified herein. Examples of trivalent N-acetylglucosamine clusters are described in WO 2017/062862 (Inspur Life Sciences), which also describes sulfonamide small molecule clusters. Examples of single conjugates of the small molecule sertraline are also described (Ferrés-Coy et al., Mol. Psych . [Molecular Psychiatry] 2016, 21, 328), as well as conjugates of protein-binding small molecules. , including iprofen (e.g., US 6,656,730 ISIS/Ionis Pharmaceutical), spermine (e.g., Noir et al., J. Am. Chem Soc . [Journal of the American Chemical Society] 2008, 130, 13500) , anisidamide (e.g., Nakagawa et al., J. Am. Chem. Soc . [Journal of the American Chemical Society] 2010, 132, 8848) and folic acid (e.g., Dohmen et al., Mol. Ther. Nucl. Acids [Molecular Therapy Nucleic Acids] ] 2012, 1, e7).

In embodiments, the oligonucleotide is conjugated to lithocholic acid or eicosapentaenoic acid.

In embodiments, the oligonucleotide (preferably via its 5' or 3' end, more preferably via its 3' end) is combined with a peptide, vitamin, aptamer, carbohydrate or mixture of carbohydrates, Proteins, small molecules, antibodies, polymers, drugs, lithocholic acid, eicosapentaenoic acid or cholesterol moieties are conjugated.

In preferred embodiments, the oligonucleotide is conjugated to a small molecule, aptamer or antibody (or antigen-binding fragment thereof). Preferred antibodies (or antigen-binding fragments thereof) are specific for CD71 (transferrin receptor) (e.g. as described in WO 2016/179257 (CytoMx)) or against equilibrating nucleoside transporters (ENTs) such as 3E10 Antibodies, as described, for example, in Weisbart et al., Mol. Cancer Ther . 2012, 11, 1.

In another preferred embodiment, the oligonucleotide is conjugated to a GalNac moiety and/or a cholesterol moiety. For example, the oligonucleotide is conjugated to a cholesterol moiety at its 3' end and to a GalNac moiety at its 5' end.

Typically, the conjugation is at the 5' or 3' end of the oligonucleotide, preferably the 3' end. oligonucleotide, effect

Functionally, oligonucleotides (optionally modified and/or conjugated as described above) are characterized by being able to exhibit at least one of the following effects: 1) Regulate the splicing of T antigen pre-mRNA, 2) Reduce the production of T antigen mRNA, 3) Reduce VP1 mRNA and preferably VP1 protein production, 4) inhibit viral replication, preferably by reducing the number of viral particles produced by cells, and 5) Limit the ability of the virus to reinfect, that is, limit the ability of infected cells to produce infectious virus particles.

1) Regulation of T antigen pre-mRNA splicing can be assessed by monitoring the formation of a given splicing product of the pre-mRNA; the aim is to target lower amounts of a given splicing product as it indicates inhibition of polyomaviruses. Lower amount may mean at least 5% lower, or at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70% lower than the amount of the same spliced product at the beginning of treatment with the oligonucleotide. %, 80%, 90% or 95%. This can be assessed using PCR.

2) The reduction in T antigen mRNA production can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of the initially produced mRNA at the start of treatment with the oligonucleotide , 95% or 99%. Preferably, T antigen mRNA is no longer detectable. mRNA production can be detected using techniques known to those skilled in the art, such as RT-PCR or Northern blotting.

3) The reduction in VP1 mRNA (and preferably VP1 protein) production can be at least 10%, 20%, 30%, 40%, 50% of the initially produced mRNA (or protein) at the start of treatment with the oligonucleotide , 60%, 70%, 80%, 90%, 95% or 99%. Preferably, VP1 mRNA (or protein) is no longer detectable. mRNA and protein production can be detected using techniques known to the skilled artisan, including RT-PCR or Northern blotting for mRNA and Western blotting for proteins.

4) Can inhibit viral replication, reducing the amount of viral DNA to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, of the initial viral DNA at the beginning of treatment with oligonucleotides 90%, 95% or 99%. In embodiments, viral DNA is no longer detectable. The number of viral particles can be reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the initial number of viral particles at the beginning of treatment with the oligonucleotide %. In embodiments, the viral particles are no longer detectable. Viral replication or the number of viral particles produced can be assessed using techniques known to those skilled in the art. For example, PCR can be used to detect viral replication or the number of viral particles produced (viral load). The Experimental section of the instructions provides exemplary methods for detecting viral load.

5) Limitations in the reinfection capacity of viruses can be quantified such that the number of cells infected by virus produced by one infected cell treated with an oligonucleotide is compared to the number of cells infected by virus produced by an infected cell that was not treated with the oligonucleotide. The number of cells infected by the virus is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99%

Preferably, the oligonucleotide exhibits at least effect 1. This effect on splicing is shown in the Examples. Without wishing to be bound by theory, it is believed that the oligonucleotide inhibits the use of the splice site it targets. The resulting reduction in large T antigen production affects the expression of capsid proteins and thus virus production. Without being bound by theory, it is believed that the imbalance of T-antigen-specific splicing products induced by oligonucleotides has a more pronounced effect on viral propagation than the reduction of T-antigen mRNA by RNAi-like methods.

In one embodiment, the oligonucleotide exhibits at least (i) Effect 1 and/or Effect 2, and (ii) Effect 4; or the oligonucleotide exhibits at least (i) Effect 1 and/or Effect 2, and (ii) role5. Preferably, the oligonucleotide exhibits at least (i) Effect 1 and/or Effect 2, (ii) Effect 4 and (iii) Effect 5.

In another embodiment, the oligonucleotide exhibits at least (i) Effect 3 and (ii) Effect 4; or the oligonucleotide exhibits at least (i) Effect 3 and (ii) Effect 5. Preferably, the oligonucleotide exhibits at least (i) Function 3, (ii) Function 4 and (iii) Function 5.

Therapeutic effects are defined below in the context of medical use. polyomavirus

In the context of the specification, a polyomavirus may be any polyomavirus. In embodiments, the polyomavirus is a human polyomavirus, including all genera, such as alpha, beta, and delta. In a preferred embodiment, the polyomavirus is an alpha or beta virus, preferably a beta virus. Non-limiting examples of human polyomaviruses are listed in Table 1 below. In a preferred embodiment, the polyomavirus is BK polyomavirus (or BK virus, also referred to herein as BKPyV or BKV), JC polyomavirus (or JC virus, also referred to herein as JCV) or Merkel cell polyomavirus Oncovirus (MC polyomavirus, MC virus, or also referred to herein as MCV). In particularly preferred embodiments, the polyomavirus is BK virus or JC virus, preferably BK virus. Table 1: Examples of human polyomaviruses Abbreviation Login number 3' splice site target region 5' splice site target region ikB NC_001538 4537-4596 4881-4940 wxya NC_001699 4397-4456 4741-4800 ikV NC_009238 4299-4358 4686-4745 wxya NC_009539 4477-4536 4876-4935 MCPyV NC_010277 4693-4752 5124-5183 HPyV6 NC_014406 4264-4323 4654-4713 HPyV7 NC_014407 4272-4331 4677-4736 tV NC_014361 4352-4411 4765-4824 HPyV9 NC_015150 4408-4467 4760-4819 MWp NC_018102 4303-4362 4658-4717 SV NC_020106 4159-4218 4504-4563 HPyV12 NC_020890 4392-4451 4791-4850 nnJV NC_024118 4471-4530 4859-4918

In a second aspect, the invention relates to a vector comprising (i) an oligonucleotide as defined in the first aspect, (ii) the reverse complement of an oligonucleotide as defined in the first aspect sequence, or (iii) DNA capable of being transcribed into an oligonucleotide as defined in the first aspect.

In a preferred embodiment, the vector system is a nucleic acid vector. Therefore, the vector according to (i) and (ii) is preferably an RNA vector, and the vector according to (iii) is preferably a DNA vector. Nucleic acid vectors include plastid vectors, myxoid vectors, phage vectors (such as lambda phage) and viral vectors. Viral vector systems are preferred, and in some embodiments, the viral vector may be selected from the group consisting of: adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and lentiviral vectors. The preferred viral vector system is adeno-associated virus vector (AAV). Examples are AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), serotype 6 AAV of serotype 7 (AAV7), AAV of serotype 8 (AAV8), AAV of serotype 9 (AAV9), AAV of serotype rh10 (AAVrh10), AAV of serotype rh8 (AAVrh8) , AAV of serotype Cb4 (AAVCb4), AAV of serotype rh74 (AAVrh74), AAV of serotype DJ (AAVDJ), AAV of serotype 2/5 (AAV2/5), AAV of serotype 2/1 (AAV2 /1), AAV of serotype 1/2 (AAV1/2) and AAV of serotype Anc80 (AAVAnc80). AAV2 series is a better example.

However, non-nucleic acid vectors are also encompassed, and include, for example, virus-like particles (VLPs), or "VLPs" referring to non-replicating empty viral capsids. VLPs typically consist of one or more viral proteins, such as, but not limited to, those proteins known as capsid proteins, coat proteins, shell proteins, surface proteins, and/or envelope proteins. They contain functional viral proteins responsible for viral penetration into cells, thus ensuring efficient cellular entry. Methods for producing specific VLPs are known in the art.

In a third aspect, the invention relates to a composition comprising an oligonucleotide as defined in the first aspect or a vector as defined in the second aspect. In a preferred embodiment, the composition is a pharmaceutical composition.

The pharmaceutical composition preferably contains one or more pharmaceutically acceptable excipients, such as fillers, preservatives, solubilizers, carriers, diluents, excipients, salts, auxiliaries and/or solvents, such as For example, Remington: The Science and Practice of Pharmacy, 20th ed. Baltimore, MD: Lippincott Williams & Wilkins, 2000 stated.

Excipients can enhance the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics, cellular uptake and intracellular transport of oligonucleotides. In particular, they can enhance the stability, solubility, absorption, bioavailability, activity, cellular uptake and intracellular transport of oligonucleotides. Rice particles, microparticles, nanotubes, nanogels, hydrogels, poloxamer or pluronic, polymersome, colloids, microvesicles, vesicles, micelles, lipids excipients for lipoplexes and/or liposomes. Examples of nanoparticles include polymer nanoparticles, (hybrid) metal nanoparticles, carbon nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, Protein nanoparticles and peptide nanoparticles. An example of a combination of nanoparticles and oligonucleotides is a spherical nucleic acid (SNA), as for example in Barnaby et al. Cancer Treat. Res . 2015, 166, 23.

Preferred excipients are targeting excipients capable of targeting and/or delivering the oligonucleotide to (or into) organs, tissues and/or cells, such as the kidney, renal tissue or kidney cells, or the bladder. , bladder tissue or bladder cells, especially bladder epithelial cells. Many of these excipients are known in the art (see, for example, Bruno, K. et al., (2011), Adv. Drug. Deliv. Rev, 63(13): 210-1226 ), examples include polymers (such as polyethyleneimine (PEI), polypropyleneimine (PPI), dextran derivatives, butyl cyanoacrylate (PBCA), hexyl cyanoacrylate (PHCA), poly( Lactic-co-glycolic acid) (PLGA), polyamines (e.g. spermine, spermidine, putrescine, cadaverine), chitosan, poly(amidoamine) (PAMAM), poly(esteramine), Polyvinyl ether, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrin, hyaluronic acid, polyacetylneuraminic acid (colominic acid and its derivatives), dendrimers ( For example, poly(amide amine)), lipids (such as 1,2-dioleyl-3-dimethylammonium propane (DODAP), dioleyl dimethyl ammonium chloride (DODAC), phospholipids Base derivatives [e.g. 1,2-distearyl-sn-glycero-3-phosphocholine (DSPC)], lysophosphatidylcholine derivatives [e.g. 1-stearyl-2-hemolys-sn -glycerol-3-phosphocholine (S-LysoPC)], sphingomyelin, 2-{3-[bis-(3-amino-propyl)-amino]-propylamino}-N-bis-deca Tetraalkylaminoformylmethylacetamide (RPR209120), glycerol phosphate derivatives [such as 1,2-dipalmitoyl-sn-glycerol-3-glycerol phosphate sodium salt (DPPG-Na)], phospholipids Acid derivatives [1,2-distearyl-sn-glycerol-3-phosphatidic acid sodium salt (DSPA)], phospholipidylethanolamine derivatives [such as dioleyl-L-R-phosphatidylethanolamine (DOPE), 1,2-distearyl-sn-glycerol-3-phosphoethanolamine (DSPE), 2-distearyl-sn-glycerol-3-phosphoethanolamine (DPhyPE)], N-[1-(2 ,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N ,N,N-trimethylammonium (DOTMA), 1,3-dioleyloxy-2-(6-carboxy-sperminyl)-propanamide (DOSPER), 1,2-dimyristin Oxypropyl-3-dimethylhydroxyethylammonium (DMRIE), N1-cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), dimethyl Dioctadecyl ammonium bromide (DDAB), 1-palmitoyl-2-oleyl-sn-glyceryl-3-phosphocholine (POPC), b-L-sperminyl-2,3-L- Diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride (AtuFECT01), N,N-dimethyl-3-aminopropane derivatives [such as 1,2-disulfide Fattyoxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleoxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]- Dioxolane (DLin-K-DMA)], phospholipid serine derivative [1,2-diolelenyl-sn-glycerol-3-phosphate-L-serine sodium salt (DOPS)]) , proteins (e.g. albumin, gelatin, atellocollagen) and linear or cyclic peptides (e.g. protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG, cell-penetrating peptides (CPP), targeting peptide, cell translocation peptide, endosomal escape peptide). Examples of such peptides have been described, such as muscle-targeting peptides (e.g. Jirka et al., Nucl. Acid Ther. 2014, 24, 25), CPPs (e.g. the Pip series, including WO 2013/030569 and Oligo Arginine series, such as US 9,161,948 (Sarepta), WO 2016/187425 (Sarepta) and M12 peptides, such as Gao et al., Mol. Ther. [Molecular Therapy] 2014, 22 , 1333), or blood-brain barrier (BBB) crossing peptides such as (branched) ApoE derivatives (Shabanpoor et al., Nucl. Acids Ther. 2017, 27, 130). Carbohydrates and carbohydrate clusters, as described above with respect to oligonucleotide conjugation, are also suitable for use as excipients.

The pharmaceutical composition is formulated to contain a pharmaceutically effective amount of the oligonucleotide. It may be formulated for administration via local, systemic and/or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, genitourinary, intradermal, cutaneous, enteral, Intravitreal, intracavernous sinus, intracerebral, intrathecal, epidural, or oral routes.

Preferably, the pharmaceutical compositions are formulated as emulsions, suspensions, pills, tablets, capsules or soft gels for oral delivery, or as aerosols or dry powders for delivery to the respiratory tract and lungs.

In embodiments, the pharmaceutical composition further comprises another active ingredient for the treatment of polyomavirus infection.

In a fourth aspect, the present invention relates to an oligonucleotide as defined in the first aspect, a carrier as defined in the second aspect or a pharmaceutical composition as defined in the third aspect, for use as a medicine , specifically for use in the treatment of polyomavirus infection in a subject.

For the sake of brevity, oligonucleotides, vectors, and pharmaceutical compositions are collectively referred to below as "drugs."

Therefore, although the drug is typically used to treat polyomavirus infections in subjects, it is preferably also used to treat polyomavirus-related diseases. Polyomavirus has the meaning as defined above with respect to the first aspect. "Polyomavirus-related diseases" include cystitis (especially hemorrhagic cystitis, such as in recipients of bone marrow transplants), ureteritis, interstitial nephritis (also called nephropathy; especially transplant nephropathy), and Sexual multipartite leukoencephalopathy (especially in immunocompromised subjects).

As used herein, the term "infection" refers to a viral infection in which a virus enters and replicates within at least one cell of a host. The infection may be acute (i.e. active) or latent (i.e. inactive, latent, dormant) (as in the case of polyomaviruses, for example). In an acute infection, the virus is replicating, infecting cells and possibly causing symptoms, whereas in a latent infection, the virus does not replicate independently of the host cell genome and infect more cells, but "hide" within the cell. Latent infection can be interrupted by acute infection, in which the hidden virus begins to replicate and infect additional cells. In the case of a pre-existing latent infection, the use of treating the infection preferably involves preventing the acute infection by preventing the hidden virus from infecting other cells (ie, spreading). In other words, this can be described as treatment of latent infection, where the treatment is not necessarily curative (but can control the virus). In other words, subjects treated with the drug may be asymptomatic. In embodiments, the subject treated with the drug is asymptomatic and seropositive. In another embodiment, the subject treated with the drug is asymptomatic and seronegative.

Administer the drug in a therapeutically effective amount. The induction of such therapeutic effects can be assessed in vitro (ie, cell-free or in cells) or in vivo (ie, in animals (eg, animal models) or in patients). It can be assessed at the molecular level and/or the cellular level.

"Therapeutic effect" particularly refers to the effects 1) to 5) defined above in relation to the first aspect of the present invention, that is, these effects are also referred to as therapeutic effects 1) to 5) respectively. Further therapeutic effects include: 6) Prevent infection-related cellular effects, 7) Alleviating the cellular effects associated with infection, 8) Prevent disease in infected subjects, and/or 9) Slow, preferably stop, and better yet reverse disease progression.

6) and 7): The cellular effect associated with the infection may be cell death (e.g. by apoptosis or cell lysis) and its mitigation would be a reduction in cell death. The reduction in such cell death may be at least 5% compared to the level of cell death at the start of treatment. Preferably, reduction in cell death means at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 80%, at least 90% or 100% . Cell death can be determined by directly detecting cell death or by detecting cell survival, for example by harvesting cell populations and (immuno)staining for cell cycle markers, by FACS analysis or by PCR (for cell cycle RNA level of performance) to determine one or more cell cycle phases using appropriate markers.

8) and 9): Whether disease is prevented or whether progression is slowed, stopped, or reversed can be determined by assessing symptoms or parameters of the disease associated with polyomavirus infection. Such symptoms are known in the art. For example, to assess the progression of kidney disease, parameters such as glomerular filtration rate or creatinine levels can be determined.

Additional parameters that may be assessed under 8) or 9) as (molecular) markers of the presence or status or progression of a disease or disorder include: Cyclin E2 (CCNE2), Cell Division Cyclin 6 (CDC6), Cell Cycle Protein E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51-associated protein-1 (RAD51AP1), BRCA1-interacting protein C-terminal helicase 1 (BRIP1) and lipoprotein B mRNA editing Enzyme 3B (APOBEC3B).

Treatment with oligonucleotides, as defined herein, can increase the downregulation or decrease of at least one of these genes (Abend, J. et al. (2010) Global effects of BKV infection of gene expression in human primary epithelial cells [BKV infection on Global impact of gene expression in human primary epithelial cells]; 397 (1): 73). In embodiments, downregulation or reduction is induced upon infection or reinfection of cells with BKV.

In embodiments, the downregulation or reduction is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% of the initial expression level of the gene at the beginning of treatment with the oligonucleotide , 90%, 95%, 99%. In embodiments, the manifestation is no longer detectable. Performance can be evaluated using techniques known to those skilled in the art. In embodiments, performance is assessed using Northern blotting or PCR.

Accordingly, in embodiments, an oligonucleotide, vector or pharmaceutical composition as defined herein may be used as a pharmaceutical, preferably for the treatment of polyomavirus infection in a subject, wherein the oligonucleotide The glycolic acid, carrier or pharmaceutical composition can exhibit at least one of the following effects: 1) Regulate the splicing of T antigen pre-mRNA, 2) Reduce the production of T antigen mRNA, 3) Reduce VP1 mRNA and preferably VP1 protein production, 4) Inhibit virus replication, 5) Limit the ability of the virus to reinfect, that is, limit the ability of infected cells to produce infectious virus particles, 6) Prevent infection-related cellular effects, 7) Alleviating the cellular effects associated with infection, 8) prevent disease in infected subjects, and 9) Slow, preferably stop, and better yet reverse disease progression.

In embodiments, the oligonucleotide, vector or pharmaceutical composition as defined herein is for use as a medicament, preferably for the treatment of a polyomavirus infection in a subject, wherein when combined with said polyomavirus Infection-related disease has been prevented (8) or its progression has been slowed, stopped or reversed (9) when at least one parameter of the disease has been reduced, selected from: glomerular filtration rate, creatinine level, cell cycle proteins E2 (CCNE2), cell division cyclin 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51-associated protein-1 (RAD51AP1), BRCA1-interacting protein C -Terminal helicase 1 (BRIP1) and lipoprotein B mRNA editing enzyme 3B (APOBEC3B).

It is envisaged that the therapeutic effect includes at least one of therapeutic effects 1) to 5) as defined above with respect to the first aspect, and preferably also includes at least one of therapeutic effects 6) to 9).

Effects are assessed by comparison with the status at the start of treatment.

Preferably, the test subject is a human. Typically, polyomaviruses infect and replicate in permissive hosts (that is, hosts that allow the virus to bypass its defenses and replicate, such as immunocompromised hosts). This is also described by the term immunodeficiency, a state in which the immune system's ability to fight infectious diseases and cancer is impaired or completely lost. This state may be temporary or permanent. In one embodiment, the immunodeficiency is acquired ("secondary"), usually due to extrinsic factors that affect the patient's immune system. Examples of such external factors include HIV infection, (extreme) age and environmental factors such as malnutrition. Immunosufficiency can also be induced by drugs such as glucocorticoids, cytostatics, antibodies, and compounds that act on immunoaffinity proteins (eg, calcineurin inhibitors, belatacept (an extracellular drug with CTLA-4 immunoglobulin-like molecules) and similar molecules). This may be a desired effect, such as in organ transplant surgeries as an anti-rejection measure, and in subjects with overactive immune systems, such as in autoimmune diseases. However, sometimes this desired effect has the additional effect of reducing the subject's ability to resist polyomavirus infection. Subjects suffering from any type of immunodeficiency are said to be immunocompromised. In another embodiment, the immunodeficiency is inherited. For example, it may be a genetic defect (often recessive) that affects B-cell or T-cell lymphocyte development, phagocytes, complement, interleukins or their receptors, antibodies, or other components of the innate or adaptive immune system. .

Thus, in embodiments, the subject is immunocompromised, for example due to one of the above factors and/or another infection, cancer, or use of a drug administered to the subject to treat another condition or disease. In one embodiment, the other condition is organ, tissue or cell (especially kidney) transplantation. Accordingly, in one embodiment, the subject is a recipient of an organ, tissue or cell transplant (also collectively referred to herein as a "transplant").

In a fifth aspect, the invention relates to ex vivo methods, including ex vivo methods for inhibiting polyomavirus replication in cells and ex vivo methods for generating transplants.

An ex vivo method of inhibiting polyomavirus replication in a cell includes (i) providing a cell infected with a polyomavirus and contacting the cell with an oligonucleotide as defined in the first aspect, an oligonucleotide as defined in the second aspect contacting a carrier or a pharmaceutical composition as defined in the third aspect; or (ii) providing an oligonucleotide comprising an oligonucleotide as defined in the first aspect, a carrier as defined in the second aspect or a pharmaceutical composition as defined in the third aspect cells of the defined pharmaceutical composition and brought into contact with the polyomavirus. Ex vivo methods of producing a graft include providing one or more donor organs, tissues or cells (preferably comprising kidney cells), and allowing cells of the one or more donor organs, tissues or cells to react in a first aspect The oligonucleotide as defined, the carrier as defined in the second aspect or the pharmaceutical composition as defined in the third aspect is contacted. general definition

Unless otherwise stated, all technical and scientific terms used herein have the same meanings as commonly and commonly understood by one of ordinary skill in the art to which this invention belongs and are read in light of this disclosure.

A "nucleobase", sometimes called a base, is usually adenine, cytosine, guanine, thymine or uracil or their derivatives. Cytosine, thymine and uracil are pyrimidine bases and are usually linked to the scaffold via their 1-nitrogen. Adenine and guanine are purine bases and are usually linked to the scaffold via their 9-nitrogen. The RNA nucleobases as referred to herein are adenine, cytosine, guanine and uracil.

Unless otherwise indicated, "nucleotides" as referred to herein represent RNA nucleotides, preferably naturally occurring RNA nucleotides. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate. They consist of the pentose ribose sugar, a 5'-linked phosphate group and a 1'-linked base linked via a phosphate ester. Sugars link bases and phosphates, and are therefore often referred to as the scaffolding of nucleotides. Therefore, modifications in pentose sugars are often called scaffold modifications. Therefore, sugar modification can be called scaffold modification. For severe modifications, the original pentose sugar may be completely replaced by another moiety that similarly connects the base and phosphate. It can therefore be understood that although a pentose sugar is often the scaffold, the scaffold is not necessarily a pentose sugar. Nucleotides are typically linked to adjacent nucleotides via condensation of their 5'-phosphate moiety with the 3'-hydroxyl moiety of the adjacent nucleotide monomer. Similarly, its 3'-hydroxyl moiety is usually linked to the 5'-phosphate of the adjacent nucleotide monomer. This forms a phosphodiester bond. The phosphodiester and scaffold form alternating copolymers. The bases are grafted onto this copolymer, that is, onto the scaffold portion. Because of this characteristic, the alternating copolymer formed by the linking monomers of an oligonucleotide is often referred to as the backbone of the oligonucleotide. Because phosphodiester bonds link adjacent monomers together, they are often called backbone bonds. It should be understood that when the phosphate group is modified so that it becomes a similar moiety (such as a phosphorothioate), such moieties are still referred to as the backbone bonds of the monomer. This is called skeleton bond modification. Therefore, typically, the backbone of an oligonucleotide consists of alternating scaffolds and backbone bonds.

In the context of an oligonucleotide, the term "specifically binds" means that the oligonucleotide is capable of annealing to its target. The term "binding" may be replaced by "hybridizing", "targeting", "against", "antisense to" or "complementary to". Binding of the oligonucleotide to its target pre-mRNA can be assessed using EMSA (Electrophoretic Mobility Shift Assay) using the oligonucleotide and incubating it with polyomavirus RNA.

When applied to oligonucleotides, the term "annealing" is understood to mean the bonding of the oligonucleotide to an at least substantially complementary sequence (for base pairing involving hydrogen bonding), which base pairing may be Watson- Watson-Crick, Hoogsteen or reversed Hoogsteen base pairing. Stringent hybridization conditions involve hybridization in 5x SSC/5x Denhardt's solution/1.0% SDS at 68°C and washes in 0.2x SSC/0.1% SDS at room temperature, or their art-recognized equivalents (e.g., Hybridize in 2.5 x SSC buffer at 60 °C, followed by several wash steps at low buffer concentration at 37 °C and maintain stable conditions). Moderate conditions involve washing in 3x SSC at 42°C, or its art-recognized equivalent. The parameters of salt concentration and temperature can be varied to achieve optimal levels of identity between probe and target nucleic acid. Guidance on such conditions is available in the art, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, New York; and Ausubel et al. (eds.) , 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y., New York) Unit 2.10.

Hybridization of complementary strands typically improves with sequence length. Specific hybridization of the two strands is achieved using a contiguous segment of 12, 13, 14, 15, 16, 17, 18, 19 or 20 (preferably 18, 19 or 20) or more complementary nucleobases . The sequence of an oligonucleotide can, but does not have to, be 100% complementary to the target sequence to which it hybridizes. Additionally, oligonucleotides can hybridize to one or more segments such that intervening or adjacent segments are not involved in the hybridization event. For example, the oligonucleotide contains at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity to the target region within the pre-mRNA. For example, an oligonucleotide in which 18 of the 20 nucleobases of the oligonucleotide are complementary to the target region and therefore hybridize specifically will represent 90% complementarity. When the sequence of the 18-nucleotide oligonucleotide is the reverse complement of a contiguous segment of at least 12 nucleobases of the polyomavirus large T antigen pre-mRNA, the remaining 6 complementary nucleobases may be identical to the 12-nucleobase sequence. clustered or discontinuous with the 12. Use the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program known in the art (Altschul et al., J. Mol. Biol. [Journal of Molecular Biology], 1990, 215, 403-410; Zhang and Madden, Genome Res. [Genome Research], 1997, 7, 649-656) The percent complementarity of an oligonucleotide to the target pre-mRNA region can be routinely determined.

Preferably, the oligonucleotide is capable of annealing to the target if a contiguous stretch of at least 12 nucleobases of the sequence is at least substantially complementary to the target. "Substantially complementary" means substantially identical to the reverse complement of the target sequence. "Substantially identical" means that the oligonucleotide need not be 100% identical to the reference sequence and may contain mismatches and/or spacers as defined herein. Preferably, substantially identical oligonucleotides (if not 100% identical) contain from 1 to 3, i.e. 1, 2 or 3 mismatches and/or spacers, preferably per oligonucleotide nucleotide a mismatch or spacer so that the intended annealing does not fail due to mismatches and/or spacers. In order to anneal (despite the presence of mismatches and/or spacers), it is preferred that the oligonucleotide does not contain more than 1 mismatch per 10 nucleotides (if the first decimal is 5 or higher, Then enter it upward, otherwise round it down). As used herein, the term "spacer" refers to a non-nucleotide spacer molecule that, when connecting two nucleotides, increases the distance between the two nucleotides to about one nucleotide distance (i.e. The distance that two nucleotides would separate if they were joined by a third nucleotide). Non-limiting examples of spacers are inosine, d-uracil, halobase, amine-dT, C3, C12, Spacer 9, Spacer 18 and dSpacer.

Oligonucleotides may contain 3' and/or 5' overhangs, ie, contiguous stretches of nucleobases that are not substantially complementary to the target region. Such overhangs do not prevent the oligonucleotide from binding specifically to its target region.

The terms "complementary sequence" and "reverse complement" are used similarly because the complementary sequence of a target nucleic acid has the sequence of the reverse complement of the target sequence. Among them, "reverse" reflects that the sequence is usually described starting from the 5' end of the nucleic acid.

"Pre-mRNA" or "pre-mRNA" is the immature single strand of messenger ribonucleic acid (mRNA). Polyomavirus T antigen pre-mRNA is synthesized by transcription from a polyomavirus DNA template in the nucleus. Pre-mRNA contains one or more introns, which are spliced during the maturation of pre-mRNA into mRNA. The splicing process removes introns from the transcript and joins the exons together. Introns are typically flanked by donor sites (5' end of the intron) and acceptor sites (3' end of the intron). Splice sites are required for splicing and typically include a nearly invariant sequence GU at the 5' end of the intron and a splice acceptor site with an often invariant AG sequence at the 3' end of the intron. GU and AG sequences as well as insert sequences are spliced out of the pre-mRNA. A characteristic feature of the polyomavirus T antigen pre-mRNA is that it can be alternatively spliced or unspliced, resulting in the production of at least two, and usually 3, 4, or 5 different spliced mRNAs. Viral propagation depends on the availability of viral genomes, the presence of viral proteins, cellular machinery and, in particular, subtle interactions between various stages and components. The splicing process of viral RNA is an important way to regulate the viral reproduction process and affects the levels and possibly the timing of certain products formed in the cell. The term "splice site" refers to the sequence that defines the splicing locus (the "splice sequence").

As used herein, "capable of being transcribed" means that the DNA nucleobase sequence is the same as the RNA nucleobase sequence, except that DNA has thymine at all uracil positions of RNA.

With regard to the effect of oligonucleotides, reference herein to "initiation of treatment with oligonucleotides" means a treatment involving contacting infected cells with oligonucleotides. Treatment can be in vitro (eg, cell culture) or in vivo (in non-human animals or humans).

In its broadest sense, "ex vivo" means outside the body. In a preferred embodiment, it refers to experiments or measurements performed in or on the tissues of an organism in an external environment with minimal changes in natural conditions. Example Example 1 Results ASO nanowalk and candidate modifications

Previously, we developed antisense oligonucleotides (ASOs) that target the exon-intron junction of the pre-mRNA of the early coding region of BKV, which results in the generation of large T antigen, small T antigen Antigen and truncated T-antigen mRNA (WO 2019/168402). These studies yielded several ASOs that demonstrated the ability to attenuate: 1) large T antigen and VP1 mRNA; 2) VP1 protein; and 3) viral DNA production. In the BKV early coding region pre-mRNA, most 5' ASOs have only 1 nucleobase in the intronic region of the large T antigen sequence, while most 3' ASOs have only one nucleobase in the exon 1 of the large T antigen. Part has only 1 nucleobase. As shown in Figure 2, the positioning of the ASO continuously shifts 2 nucleotides downstream of SEQ ID NO: 1 in the 5' to 3' direction, allowing the entire exon 1-intron junction to be aligned with that described herein. SEQ ID NO: 1 to 11 (RNA sequence) and the corresponding 2'-OMe modified ASO (SEQ ID NO: 12 to 22) were efficiently spliced. Therefore, for these studies, 11 additional ASOs (SEQ ID NO: 12 to 22) were generated and screened for activity in human PTEC.

Surprisingly, several of these new 2'-OMe modified ASOs (Figure 2) showed superior targeting activity to the large T antigen exon 1 and/or intron donor sites (Figure 3 to Figure 4).

This insight was gained through screening studies on human proximal tubule epithelial cells (hPTEC), which resulted in effective efficacy on 1) TAg and VP1 mRNA; 2) VP1 protein; and 3) viral particle production, as shown in Figure 3 shown. Subsequently, we synthesized oligonucleotides modified with 5-methylcytidine (SEQ ID NO: 26, 30, 34, and 38) and different percentages of 2'-methoxy-ethyl (MOE) (SEQ ID NO: 23, 24, 25, 27, 28, 29, 31, 32, 33, 35, 36, 37) Various modifications of these leading candidates were extensively tested by replacing 2'OMe-cytosine. These studies consistently showed that ASOs with 2'-O-methyl modification caused the greatest reduction in VP1 protein and BKV DNA replication (Fig. 4). This information, as well as our previous studies in which we varied the amount of phosphorothioate incorporated into the ASO backbone, prompted us to proceed with the use of fully 2'-OMe and phosphorothioated ASOs. ASO targeting BKV limits “re-infection”

Based on the observed reduction in viral DNA in response to treatment with our BKV-targeting ASO, we elected to conduct a "reinfection" study. To this end, we treated hPTEC with SEQ ID NO: 26, SEQ ID NO: 17, SEQ ID NO: 34 or SEQ ID NO: 19 and infected the hPTEC with BKV 16 h later. Cells were incubated in culture medium for 7 days and then conditioned medium containing active and inactive viral particles was harvested. Conditioned medium was then diluted 10-fold and plated onto untreated hPTEC. After 72 h, cells were fixed and immunostained for large T antigen positivity (Fig. 5), showing treatment with SEQ ID NO: 19 (and HYB_03 (SEQ ID NO: 68)) relative to control cells (left panel) The number of large T antigen-positive cells was significantly reduced. Furthermore, the degree of positivity after treatment with SEQ ID NO: 19 (and HYB_03 (SEQ ID NO: 68)) was lower than that observed with control cells (and cells treated with SEQ ID NO: 26 and SEQ ID NO: 17) . As shown in Figure 6, assessment of TAg and VP1 mRNA levels showed the greatest reduction after pretreatment with SEQ ID NO: 19, as was assessment of VP1 protein. After treatment with SEQ ID NO: 19, viral DNA levels and the number of reinfected cells were significantly reduced. ASO targeting BKV induces abnormal splicing of BKV early coding region pre - mRNA

Subsequently, we studied the ability of our BKV-targeting ASO to disrupt proper splicing of BKV early coding region pre-mRNA in pRPc cells. To do this, we administered our ASO to pRPc cells and harvested RNA 24 hours post-transfection. As shown in Figure 7, these studies showed that cells treated with lipofectamine and scrambled control ASO did not display altered splicing characteristics (lanes 1-3). In contrast, both HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 resulted in a decrease in large T antigen mRNA levels (product 1) and a slight increase in small t antigen mRNA (product 3, lanes 4-5) transfer. At the same time, clear evidence shows that there is an abnormal splicing product between products 1 and 3, as well as an mRNA product smaller than product 1. In addition, we introduced mismatched nucleobases into SEQ ID NO: 19 at position 10 (SEQ ID NO: 39), positions 5 and 10 (SEQ ID NO: 40) and positions 5, 10 and 15 (SEQ ID NO: 41 ), resulting in a gradual titration of the splicing effect (Fig. 7, lanes 6-8). These studies clearly demonstrate that SEQ ID NO: 19 mediates the elimination of large T antigen mRNA in a hybridization-dependent manner. Next, we similarly evaluated whether SEQ ID NO: 19, designed as a gapmer (RNA-DNA-RNA hybrid antisense oligonucleotide), could lead to similar or higher levels of large T antigen in an RNase H-dependent manner (Pre)mRNA degradation. As shown in Figure 8 (lane 3), SEQ ID NO: 19 GapmeR (SEQ ID NO: 42) did not produce an efficient reduction in large T antigen mRNA levels (product 1), whereas targeting the exoexpression of early coding region pre-mRNA Additional GapmeRs of subunit 1 (SEQ ID NOs: 42 to 45) similarly did not result in significant reductions in large T or small t antigen mRNA expression levels. Exposure of PBMC to BKV- targeting ASOs does not affect viability

We next evaluated whether exposure to increasing levels of BKV-targeting ASO affects cell viability, whereby peripheral blood-derived mononuclear cells (PBMC) were exposed to 1 or 10 μM ASO for 48 h. As shown in Figure 9 , multiple controls for cell viability were introduced, including exposure to 65˚C for 30 min before culture for 48 h (triggering a decrease in cell viability) and treatment with R848 (TLR3 agonist) to enhance PBMC viability (Doyle SL , et al. (2007), J. Biol Chem. [Journal of Biological Chemistry] 282 (51): 36953-36960). Exposure to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 (without increasing their concentration) does not appear to affect PBMC viability. Exposure of PBMC to BKV - targeting ASOs results in mild activation of interleukin production

To control for the potential activation of pro-inflammatory cytokine expression of monocytes and macrophages in response to exposure to increasing levels of BKV-targeting ASO, we treated PBMC with 1 or 10 µM ASO for 48 h and harvested the culture medium for use in the cells Multiplex ELISA analysis of interleukin production. As shown in Figures 10 and 11, exposure to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 did not show a significant increase in pro- or anti-inflammatory cytokine production. Clotting times are not affected by BKV - targeting ASOs

ASO is sometimes described as affecting the time it takes for blood to physiologically clot. This may be detrimental in patients receiving oligonucleotide-based therapies, including BKV-targeting ASOs after kidney transplantation. Therefore, we chose to evaluate whether exposure of blood to increasing concentrations of our BKV-targeting ASO would increase clotting time by determining activated partial thromboplastin time (aPTT). For this purpose, human plasma is collected and exposed to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 at concentrations of 1 µM and 10 µM. As shown in Figure 12, clotting times increased slightly upon exposure to higher concentrations of BKV-targeting ASOs, and BKV - targeting ASOs showed excellent biodistribution in the kidney.

Since BKV is primarily found in the tubular epithelium of the kidney (and bladder epithelium), we conducted four intravenous dosing studies (day 0, day 3, day 7, and day 10 concentrations) with five candidate ASOs. at 40 mg/kg and sacrificed on day 14, Figure 13 left panel) to examine the biodistribution of our BKV-targeting ASO in the kidney (and specifically in proximal and distal tubular epithelial cells). As shown in Figure 13 (left and middle images), the oligonucleotide with SEQ ID NO: 19 clearly shows uptake in the proximal tubule, where weak uptake was observed in the distal compartment of the renal segment. Staining (Fig. 13, right image). We developed a hybrid ELISA (hELISA) probe for determining SEQ ID NO: 19 levels in various organs in a quantitative manner. As shown in Figure 14, these studies show that the kidney is the main organ ingested by SEQ ID NO: 19 (on a per gram basis per organ), and its uptake is approximately 2.75 times that of the liver and 4 times that of the spleen. These extrarenal organs are widely considered to be excellent reservoirs for ASO uptake, clearly revealing the superior distribution of ASO in the kidney. BKV - targeting ASO regimen does not affect kidney or liver function

We did not observe any significant Signs of renal or hepatotoxicity/injury. As shown in Figure 15, after treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19, the serum levels of creatinine and blood urea nitrogen and the urinary albumin level were completely within the normal range. within. Similarly, serum aspartate aminotransferase and alanine aminotransferase after 4 administrations of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 The levels and their ratios did not produce any evidence of hepatotoxicity. BKV - targeting ASO regimen does not cause significant renal injury

Immunohistochemical staining (for evidence of kidney injury) after four administrations of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, or SEQ ID NO: 19 showed no evidence of overt/acute kidney injury. Initial evaluation with KIM-1 and picrosirius red staining did not clearly indicate renal injury or collagen deposition (see Figure 16). Materials and Methods Accession numbers used for phylogenetic analysis

The complete genome sequences of BK polyomavirus isolates were downloaded from the publicly available NCBI database. From these records, only isolates reporting complete genomes were used to preserve splice sites in the large T antigen. The Dunlop strain was used as the reference genome. Isolates “MM” and “FNL-9” were removed due to large deletions in introns or duplications overlapping the receptor splice site, respectively. Accession numbers for 245 unique genome sequences are provided below: AB211369.1; AB211370.1; AB211371.1; AB211372.1; AB211373.1; AB211374.1; AB211375.1; AB211376.1; 382. 1;AB211383.1;AB211384.1;AB211385.1;AB211386.1;AB211387.1;AB211388.1;AB211389.1;AB211390.1;AB211391.1;AB213487.1;AB217917.1;AB217918.1; AB217919.1; AB217920.1; AB217921.1; AB260028.1; AB260029.1; AB260030.1; AB260031.1; AB260032.1; 915. 1;AB263916.1;AB263917.1;AB263918.1;AB263919.1;AB263920.1;AB263921.1;AB263922.1;AB263923.1;AB263924.1;AB263925.1;AB263926.1;AB263927.1; AB263928.1; AB263929.1; AB263930.1; AB263931.1; AB263932.1; AB263934.1; AB263935.1; AB263936.1; 828. 1; AB269829.1; AB269830.1; AB269831.1; AB269832.1; AB269834.1; AB269836.1; AB269837.1; AB269838.1; AB269840.1; AB269841.1; AB269844.1; AB269845.1; AB269846.1; AB269847.1; AB269848.1; AB269849.1; AB269850.1; AB269851.1; 856. 1;AB269857.1;AB269858.1;AB269859.1;AB269860.1;AB269861.1;AB269862.1;AB269863.1;AB269864.1;AB269865.1;AB269866.1;AB269867.1;AB269868.1; AB269869.1; AB298941.1; AB298942.1; AB298945.1; AB298946.1; AB298947.1; AB301086.1; AB301087.1; 093. 1; AB301094.1; AB301095.1; AB301096.1; AB301097.1; AB301099.1; AB301100.1; AB301101.1; AB365130.1; AB365132.1; AB365133.1; AB365137.1; AB365138.1; AB365139.1; AB365140.1; AB365141.1; AB365142.1; AB365144.1; 151. 1; AB365153.1; AB365154.1; AB365156.1; AB365157.1; AB365158.1; AB365159.1; AB365160.1; AB365162.1; AB365164.1; AB365165.1; AB365168.1; AB365170.1; AB365173.1; AB365174.1; AB365175.1; AB365176.1; AB365178.1; 093. 1; AB369094.1; AB369095.1; AB369096.1; AB369097.1; AB369098.1; AB369099.1; AB369101.1; AB464960.1; AB464961.1; AB464962.1; AB485695.1; AB485696.1; AB485697.1; AB485698.1; AB485699.1; 707. 1; AB485709.1; AB485710.1; AB485711.1; AB485712.1; AY628224.1; AY628225.1; AY628226.1; AY628227.1; AY628232.1;AY628233.1;AY628234.1;AY628235.1;AY628236.1;AY628237.1;AY628238.1;DQ305492.1;EF376992.1;FR720308.1;FR720309.1;FR720310.1;FR7 20311. 1; FR720312.1; FR720313.1; FR720315.1; FR720317.1; FR720318.1; FR720320.1; FR720321.1; JF894228.1; JN192431.1; JN192432.1; JN192433.1; JN19243 5.1; JN192437.1; JN192438.1; JN192439.1; JN192440.1; JQ713822.1; KF055891.1; KF055892.1; 3.1; KY132094. 1; KY487998.1; LC029413.1; LC309239.1; LC309240.1; LT960370.1; M23122.1; V01108.1.

Similarly, the complete genome sequences of 13 different prototype human polyomaviruses were downloaded. The accession numbers are as follows: NC_001538; NC_001699; NC_009238; NC_009539; NC_010277; NC_014406; NC_014407; NC_014361; Conservation of the large T antigen splice site

Whole-genome nucleotide sequences from all reference human polyomaviruses were downloaded from the NCBI website (https://www.ncbi.nlm.nih.gov/nuccore) on February 20, 2018, and analyzed with WebPrank using default settings ( Available online: https://www.ebi.ac.uk/goldman-srv/webprank/) comparison. A phylogenetic UPGMA tree was constructed and sequence identities were created for each splice site to show conservation among different human polyomaviruses. All downloaded refseq accession numbers are provided below:

Reference sequences: NC_001538, NC_001699, NC_009238, NC_009539, NC_010277, NC_014406, NC_014407, NC_014361, NC_015150, NC_018102, NC_020106, NC_020890, NC_024118

The complete genome nucleotide sequences of human polyomavirus isolates were downloaded from the NCBI website on February 20, 2018. Full gene sequences of the large T antigen were retrieved from unique genomic sequences only and aligned with WebPrank using default settings. Sequence identifiers were created for each splice site in the large T antigen to show conservation within and between different human polyomaviruses.

The accession numbers for all downloads are as follows: BKPyV: AB211369.1, AB211370.1, AB211371.1, AB211372.1, AB211373.1, AB211374.1, AB211375.1, AB211376.1, AB211377.1, AB211378.1 , AB211379.1, AB211380.1, AB211381.1, AB211382.1, AB211383.1, AB211384.1, AB211385.1, AB211386.1, AB211387.1, AB211388.1, AB211389.1, AB211390.1, AB2 11391 .1, AB213487.1, AB217917.1, AB217918.1, AB217919.1, AB217920.1, AB217921.1, AB260028.1, AB260029.1, AB260030.1, AB260031.1, AB260032.1, AB260033.1 , AB260034.1, AB263912.1, AB263913.1, AB263914.1, AB263915.1, AB263916.1, AB263917.1, AB263918.1, AB263919.1, AB263920.1, AB263921.1, AB263922.1, AB2 63923 .1, AB263924.1, AB263925.1, AB263926.1, AB263927.1, AB263928.1, AB263929.1, AB263930.1, AB263931.1, AB263932.1, AB263933.1, AB263934.1, AB263935.1 , AB263936.1, AB263937.1, AB263938.1, AB269822.1, AB269823.1, AB269824.1, AB269825.1, AB269826.1, AB269827.1, AB269828.1, AB269829.1, AB269830.1, AB2 69831 .1, AB269832.1, AB269833.1, AB269834.1, AB269835.1, AB269836.1, AB269837.1, AB269838.1, AB269839.1, AB269840.1, AB269841.1, AB269842.1, AB269843.1 , AB269844.1, AB269845.1, AB269846.1, AB269847.1, AB269848.1, AB269849.1, AB269850.1, AB269851.1, AB269852.1, AB269853.1, AB269854.1, AB269855.1, AB2 69856 .1, AB269857.1, AB269858.1, AB269859.1, AB269860.1, AB269861.1, AB269862.1, AB269863.1, AB269864.1, AB269865.1, AB269866.1, AB269867.1, AB269868.1 , AB269869.1, AB298940.1, AB298941.1, AB298942.1, AB298943.1, AB298944.1, AB298945.1, AB298946.1, AB298947.1, AB301086.1, AB301087.1, AB301088.1, AB3 01089 .1, AB301090.1, AB301091.1, AB301092.1, AB301093.1, AB301094.1, AB301095.1, AB301096.1, AB301097.1, AB301098.1, AB301099.1, AB301100.1, AB301101.1 , AB301102.1, AB301103.1, AB365130.1, AB365131.1, AB365132.1, AB365133.1, AB365134.1, AB365135.1, AB365136.1, AB365137.1, AB365138.1, AB365139.1, AB3 65140 .1, AB365141.1, AB365142.1, AB365143.1, AB365144.1, AB365145.1, AB365146.1, AB365147.1, AB365148.1, AB365149.1, AB365150.1, AB365151.1, AB365152.1 , AB365153.1, AB365154.1, AB365155.1, AB365156.1, AB365157.1, AB365158.1, AB365159.1, AB365160.1, AB365161.1, AB365162.1, AB365163.1, AB365164.1, AB3 65165 .1, AB365166.1, AB365167.1, AB365168.1, AB365169.1, AB365170.1, AB365171.1, AB365172.1, AB365173.1, AB365174.1, AB365175.1, AB365176.1, AB365177.1 , AB365178.1, AB369087.1, AB369088.1, AB369089.1, AB369090.1, AB369091.1, AB369092.1, AB369093.1, AB369094.1, AB369095.1, AB369096.1, AB369097.1, AB3 69098 .1, AB369099.1, AB369100.1, AB369101.1, AB464953.1, AB464954.1, AB464955.1, AB464956.1, AB464957.1, AB464958.1, AB464959.1, AB464960.1, AB464961.1 , AB464962.1, AB464963.1, AB485694.1, AB485695.1, AB485696.1, AB485697.1, AB485698.1, AB485699.1, AB485700.1, AB485701.1, AB485702.1, AB485703.1, AB4 85704 .1, AB485705.1, AB485706.1, AB485707.1, AB485708.1, AB485709.1, AB485710.1, AB485711.1, AB485712.1, AY628224.1, AY628225.1, AY628226.1, AY628227.1 , AY628228.1, AY628229.1, AY628230.1, AY628231.1, AY628232.1, AY628233.1, AY628234.1, AY628235.1, AY628236.1, AY628237.1, AY628238.1, DQ305492.1, EF 376992 .1, FR720308.1, FR720309.1, FR720310.1, FR720311.1, FR720312.1, FR720313.1, FR720314.1, FR720315.1, FR720316.1, FR720317.1, FR720318.1, FR720319.1 , FR720320.1, FR720321.1, FR720322.1, FR720323.1, JF894228.1, JN192431.1, JN192432.1, JN192433.1, JN192434.1, JN192435.1, JN192436.1, JN192 437.1, JN192438 .1, JN192439.1, JN192440.1, JN192441.1, JQ713822.1, KF055891.1, KF055892.1, KF055893.1, KP412983.1, KP984526.1, KY114802.1, KY114803.1, KY13 2094.1 , KY487998.1, LC029411.1, LC029412.1, LC029413.1, LC029414.1, LC309239.1, LC309240.1, LT934539.1, LT960370.1, M23122.1, MF627830.1, MF627831.1, V01 108 .1. V01109.1 splice site conservation and genetic relationship tree

The full gene sequences (including intronic sequences) of the large T antigen of 13 different polyomavirus reference sequences and all unique BK polyomavirus isolates were aligned using clustalW (the “msa” package in R). Kinship trees were constructed using the UPGMA method ("phangorn" and "ggtree" packages in R). Construct sequence markers for acceptor and donor splice sites to show nucleotide-specific conservation between isoforms (‘msa’ package in R). ASO design

Antisense oligonucleotides (ASOs) were designed to target the donor splice site of the BK virus large T antigen (SEQ ID NO: 1 to 10). Additional ASOs were designed to be derived from SEQ ID NOs: 1 to 10 and have improved chemical properties. They contain 2′-O-methyl bases, are 20 nucleotides in length, and are further modified with a perthiophosphate backbone (*) and optionally with 5-methylcytidine (position indicated). Use RNA structure to predict the secondary structure and binding energy of ASO. All ASO sequences are shown below: Table 3 : Oligonucleotides with modified RNA chemistry Name sequence Target splice site in large T antigen SEQ ID NO: 12 oC*oC*oU*oC*oU*oG*oA*oG*oC*oU*oA*oC*oU*oC*oC*oA*oG*oG*oU*oU Donor (exon 1) SEQ ID NO: 13 oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*oU*oA*oC*oU*oC*oC*oA*oG*oG Donor (exon 1) SEQ ID NO: 14 oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*oU*oA*oC*oU*oC*oC*oA Donor (exon 1) SEQ ID NO: 15 oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*oU*oA*oC*oU*oC Donor (exon 1) SEQ ID NO: 16 oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*oU*oA*oC Donor (exon 1) SEQ ID NO: 17 oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*oU Donor (exon 1) SEQ ID NO: 18 oA*oA*oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG Donor (exon 1) SEQ ID NO: 19 oA*oA*oA*oA*oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG Donor (exon 1) SEQ ID NO: 20 oG*oG*oA*oA*oA*oA*oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC Donor (exon 1) SEQ ID NO: 21 oG*oA*oG*oG*oA*oA*oA*oA*oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC Donor (exon 1) SEQ ID NO: 22 oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*oU*oA Donor (exon 1) SEQ ID NO: 23 mA*mG*mC*mA*mC*oA*oA*oA*oC*oC*oU*oC*oU*oG*mA*mG*mC*mT*mA Donor (exon 1) SEQ ID NO: 24 mA*mG*mC*mA*mC*mA*mA*mA*mC*mC*mT*mC*mT*mG*mA*mG*mC*mT*mA Donor (exon 1) SEQ ID NO: 25 mA*mG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*oC*mT*mA Donor (exon 1) SEQ ID NO: 26 oA*oG*o C *oA*o C *oA*oA*oA*o C *o C *oU*o C *oU*oG*oA*oG*o C *oU*oA Donor (exon 1) SEQ ID NO: 27 mT*mC*mA*mG*mC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*mG*mA*mG*mC*mT Donor (exon 1) SEQ ID NO: 28 mT*mC*mA*mG*mC*mA*mC*mA*mA*mA*mC*mC*mT*mC*mT*mG*mA*mG*mC*mT Donor (exon 1) SEQ ID NO: 29 mT*mC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*oA*oG*mC*mT Donor (exon 1) SEQ ID NO: 30 oU*oC*oA*oG*o C *oA*o C *oA*oA*oA*o C *o C *oU*o C *oU*oG*oA*oG*o C *oU Donor (exon 1) SEQ ID NO: 31 mA*mA*mT*mC*mA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*mC*mT*mG*mA*mG Donor (exon 1) SEQ ID NO: 32 mA*mA*mT*mC*mA*mG*mC*mA*mC*mA*mA*mA*mC*mC*mT*mC*mT*mG*mA*mG Donor (exon 1) SEQ ID NO: 33 mA*mA*oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG*mA*mG Donor (exon 1) SEQ ID NO: 34 oA*oA*oU*o C *oA*oG*o C *oA*o C *oA*oA*oA*o C *o C *oU*o C *oU*oG*oA*oG Donor (exon 1) SEQ ID NO: 35 mA*mA*mA*mA*mT*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*mC*mT*mC*mT*mG Donor (exon 1) SEQ ID NO: 36 mA*mA*mA*mA*mT*mC*mA*mG*mC*mA*mC*mA*mA*mA*mC*mC*mT*mC*mT*mG Donor (exon 1) SEQ ID NO: 37 mA*mA*oA*oA*oU*oC*oA*oG*oC*oA*oC*oA*oA*oA*oC*oC*oU*oC*mT*mG Donor (exon 1) SEQ ID NO: 38 oA*oA*oA*oA*oU*o C *oA*oG*o C *oA*o C *oA*oA*oA*o C *o C *oU*o C *oU*oG Donor (exon 1) SEQ ID NO: 39 oA*oA*oA*oA*oU*oC*oA*oG*oC*oU*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG Donor (exon 1) SEQ ID NO: 40 oA*oA*oA*oA*oC*oC*oA*oG*oC*oU*oC*oA*oA*oA*oC*oC*oU*oC*oU*oG Donor (exon 1) SEQ ID NO: 41 oA*oA*oA*oA*oC*oC*oA*oG*oC*oU*oC*oA*oA*oA*oC*oA*oU*oC*oU*oG Donor (exon 1) SEQ ID NO: 42 oA*oA*oA*oA*oU*dC*dA*dG*dC*dA*dC*dA*dA*dA*dC*oC*oU*oC*oU*oG Donor (exon 1) SEQ ID NO: 43 nA*nC*nA*dT*dC*dC*dT*dG*dC*dT*dC*dC*dA*nT*nT*nT Donor (exon 1) SEQ ID NO: 44 nG*nG*nT*dG*dA*dA*dA*dT*dT*dC*dC*dT*nT*nA*nC Donor (exon 1) SEQ ID NO: 45 nG*nG*nG*dT*dG*dA*dA*dA*dT*dT*dC*dC*dT*nT*nA*nC Donor (exon 1) Note: * represents phosphorothioate bond; C represents 5-methylcytidine; oA, oC, oU, oG and oT represent 2'-O-methyl modified ribonucleic acid; mA, mC, mU, mG, mT Represents 2'-methoxyethyl modified ribonucleic acid; dA, dC, dU, dG, and dT represent deoxyribonucleic acid; nA, nC, nU, nG, and nT represent locked nucleic acid residues. Here, any modification to C can be applied to C and expressed accordingly. cell culture

Immortalized proximal tubule renal epithelial HK2 cells (ATCC® CRL-2190™) were obtained from ATCC and maintained at 37°C, 5% _CO2 , Dulbecco's Modified Eagle's medium-F12 1:1 mixture (With 15 mM Hepes, 2.5 mM L-Glutamine (Lonza), supplemented with Triiodothyronine, Epidermal Growth Factor (EGF), Insulin-Transferrin-Se-Ethanolamine ( ITS-X), hydrocortisone, and 100 U/mL penicillin-streptomycin). Human renal proximal tubule epithelial cells (PTEpiC) (Sciencell, #4100) were maintained in complete epithelial medium (Sciencell, #4101) consisting of 500 ml of basal medium, 2% fetal calf serum, and 1X Epithelial Cell Growth Supplement. )middle. hPTEC experiments were performed between passages 4 and 6. pRPc cells, a mouse cell line transformed with the early coding region of BKV (Negrini, M. et al., Cancer Research, 1992), constitutively express the BKV large T antigen. pRPc cells were maintained in Dulbecco's modified Eagle medium supplemented with 10% FCS. All cells were _cultured at 37°C and 5% CO in the presence of 100 U/mL penicillin, 100 μg/mL streptomycin solution (Invitrogen, Breda, The Netherlands).

BK polyomavirus (ATCC® VR-837™) was obtained from ATCC and diluted in complete HK2 medium to reduce infection load. For treatment experiments, cells were seeded in 6- or 12-well plates (Corning) at a density of 32,000 cells/ ^cm and grown overnight. ASO treatment was performed by incubating cells with lipofectamine 3000 (Thermo Fisher) at an ASO concentration of 50 nM for 5 h, and then the lipofectamine was washed away. BK polyomavirus infection was performed 24 h after washing the cells by incubating the cells with BK polyomavirus-containing medium for 2 h, and then washing the cells three times to remove excess viral particles. Supernatants were collected after these initial washes and at days 3, 5, and 7 post-infection to determine viral particle production using PCR. Viral load samples are collected prior to infection to determine infectious load. RNA and protein were harvested on day 7 to determine the expression of large T antigen and VP1. Viral load determination

To determine the viral load in the culture supernatant, 200 µL was collected from each well at each time point. Pierce Universal Nuclease was added to each sample to degrade unpackaged DNA for 15 min at room temperature and then inactivated with 5 mM EDTA. Viral DNA was isolated from the supernatant using a DNA minikit (Qiagen), and viral load was determined using Taqman PCR as described below ( Wunderink, HF , et al., J. Clin. Virol .[Journal of Clinical Virology], 2017).

To monitor the quality of DNA extraction and potential PCR inhibition, we added low concentrations of phocine herpesvirus to the lysis buffer. Elute DNA in a final volume of 100 μL of elution buffer, of which 10 μL is used as input for real-time quantitative PCR (qPCR). Use primers 440BKVs 5′-GAAAAGGAGAGTGTCCAGGG-3′ (SEQ ID NO: 46) and 441BKVas 5′-GAACTTCTACTCCTCCTTTATTAGT-3′ (SEQ ID NO: 47) and Taqman probe 576BKV-TQ-FAM FAM 5′-CCAAAAAGCCAAAGGAACCC-3′ -BHQ1 (SEQ ID NO: 48), amplifies a 90-bp fragment within the BKPyV VP1 gene (sequence provided by LUMC Department of Medical Microbiology). BKPyV qPCR and seal herpesvirus PCR were used dually to monitor DNA quality and potential PCR inhibition. In addition, BKPyV qPCR was validated to detect BKPyV genotypes I-IV.

Quantitative PCR reactions were performed in a total volume of 50 μL containing 25 μL HotStarTaq Master Mix (Qiagen, Hilden, Germany), 0.5 μmol/L of each primer, 0.35 μmol/L BKPyV probe, and 3.5 mmol/ L MgCl ₂ . Reactions were performed using the CFX96 Instant Detection System (Bio-Rad, Hercules, CA, USA) under the following cycling conditions: 15 min at 95°C, followed by 45 cycles of amplification (95°C 30 s at 55℃; 30 s at 72℃). For quantification, quantitative standards of BKPyV-positive urine samples were used. The analytical sensitivity of BKPyV qPCR is approximately 10 copies/mL. On each plate, include 3 negative controls; these controls tested negative in all PCR assays. PCR results with a cycle threshold ≥ 40 were considered negative. Antibodies and Western blotting

Determine protein concentration using the BCA method. Run samples on a 4%-15% TGX gel and transfer to nitrocellulose or PVDF membrane. Antibody systems used: rabbit polyclonal anti-actin HRP (loading control), rabbit polyclonal anti-SV40 VP1 (ab53977, Abcam), mouse monoclonal anti-SV40 T antigen [PAb416] (ab16879 , Abcam Company), mouse monoclonal anti-SV40 T antigen (PAb108, Thermo Fisher Company), rabbit multi-strain anti-SV40 VP1 (Abcam Company, ab53977), biotinylated lotus bean lectin (Lotus Tetragonolobus Lectin (LTL; Vector Laboratories, B-1325), sheep polystrain anti-slittin (AF4269, R&D Systems), purified mouse anti-E-cadherin (Beidi (Becton Dickinson, 610181), rabbit polyclonal anti-GAPDH (Cell Signalling, D16H11), and rabbit polyclonal anti-phosphorothioate (by Jonathan Watts, University of Massachusetts Medical School Courtesy of Dr.). Primary antibodies for large T antigen and VP1 were incubated overnight at 4°C, and primary antibodies for actin were incubated for 30 min at room temperature. The secondary antibodies used for large T antigen and VP1 were goat polyclonal anti-mouse HRP (P044701-2, Agilent) and goat polyclonal anti-rabbit HRP (P044801-2, Agilent), respectively. In addition, goat anti-rabbit 488 (Life Technologies, A-11008), donkey anti-rabbit 488 (Invitrogen, A21206), donkey anti-rat 647 (Invitrogen, ab150155), donkey anti-sheep 647 (Invitrogen) , A21448), donkey anti-mouse IgG2a 647 (Invitrogen, A31571), streptavidin 568 (Invitrogen, S11226), and isotype control rabbit IgG (Dako, X0936). The membrane was incubated with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and protein bands were visualized using the ChemiDoc MP Imaging System (Bio-Rad). Nuclei were counterstained with Hoechst. Immunohistochemistry

After the mice were sacrificed, the kidneys, liver, lungs, spleen, bladder, and heart were excised and perfused with PBS and fixed in 10% buffered formalin and embedded in paraffin. Kidney tissue was cut into 4 μm thick sections and placed on glass slides. Freshly sectioned sections were deparaffinized in xylene for 10 min, and then the sections were rehydrated in a graded ethanol series and placed in PBS. Subsequently, sections were stained for ASO (using antibodies that detect phosphorothioate scaffolds or by fluorescent in situ hybridization with RNA-based probes) and, for renal injury, by renal tubular renal injury marker-1. (KIM-1) staining, or for interstitial collagen, by Sirius red staining. real-time qPCR

ASO-treated and BKV-infected cells were lysed in Trizol, and RNA was isolated using the RNeasy kit (Qiagen). DNase I (Qiagen) treatment was added during the isolation process to remove excess DNA, and Promega reverse transcriptase, DTT, dNTPs and random primers were used to synthesize cDNA. Real-time PCR was performed on the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad) using SYBR™ Select Master Mix (Thermo Fisher Scientific) and the following primers: Table 4 : Primers Gene forward reverse GAPDH ACAACTTTGGTATCGTGGAAGG (SEQ ID NO:49) GCCATCACGCCACAGTTTC (SEQ ID NO: 50) TAg GAGGAGGATGTAAAGGTAGCTCA (SEQ ID NO: 51) ACTGGCAAACATATCTTCATGGC (SEQ ID NO: 52) VP1 TGCAGGGTCACAAAAAGTGC (SEQ ID NO: 53) AGCACTCCCTGCATTTCCAA (SEQ ID NO: 54) Activated partial thromboplastin time ( aPTT ) measurement

Magnetic beads were added to StartMax cuvettes (Diagnostica Stago). Plasma was diluted with Owren-Koller diluent (Stage Diagnostics, Inc.), and then 50 μL of aPTT reagent (TriniClot) was added to each cuvette. Subsequently, 50 μL of diluted plasma containing 5 uL of ASO solution was added to the aPTT reagent and incubated at 37°C for 170 seconds. Next, the cuvette is placed in a magnetic field, which is activated to activate clotting. At 180 seconds, 50 μL of 25 mM CaCl ₂ was added to each cuvette using a repeater pipette, and clotting time measurements were automatically recorded with each pipetting operation. Peripheral blood mononuclear cell interleukin production assay

PBMC were thawed and added to the culture medium for 5 minutes and collected by centrifugation. The cells were resuspended and the initial viability was assessed by trypan blue exclusion method, and then the cells were diluted to 1.67 × 10 ⁶ cells/mL. Subsequently, negative control (medium) and positive control were prepared in culture medium (R848 (Invivogen Inc., USA)). Assess interleukin production in response to exposure to 1 μM or 10 μM ASO by adding 20 μL of negative or positive control or appropriate ASO concentration to round-bottomed wells, then adding 180 μL of medium containing PBMC and incubating at 37 Incubate at ℃ (5% CO ₂ ) for 48 h. Subsequently, the culture medium was pipetted into Eppendorf tubes, centrifuged at 1200 rpm for 6 min, and the supernatant was transferred to a custom-made multiplex elisa plate to detect GM-CSF, IFN-γ, IL-6, IL- 12 (p70 subunit), MIP-1b, TNF-α, G-CSF, IFN-α2, IL-1b, IL-2, IL-10 and IL-17.

Cell viability was assessed by adding negative or positive control material or ASO to flat-bottomed wells and 190 μL of medium containing PBMC, and incubating at 37°C (5% CO ₂ ) for 48 h. Subsequently, CellTiter-Blue reagent was added to each well, the wells were mixed for 4 h and incubated for 4 h, and then the fluorescence was measured at 555/585 nm. Hybrid ELISA ( hELISA )

Tissue harvested from mice was placed in lysis buffer and diluted to non-saturating concentrations. Subsequently, dilute the standard curve and tissue sample 1:50 in sample buffer by adding 1 µL of standard curve or tissue sample to 49 µL of sample buffer in a single well of a 96-well plate. Next, add 50 μL of probe mix (consisting of 20 nM capture probe and 20 nM detection probe) per well, and then cover the 96-well plate with a photorefractive seal. Next, hybridize the probe in a thermal cycler at 95°C for 5 minutes, 40°C for 30 minutes, and finally at 12°C. Next, MSD Gold plates (Mesoscale) were prepared by washing with KPL wash buffer, and hybridization samples were transferred from the 96-well plate to MSD Gold plates (in duplicate). Cover the MSD Gold plate with the photorefractive seal and incubate it on an orbital shaker at 650 rpm for 30 min at room temperature. Next, each well was washed 3 times with KPL buffer, and 0.5 µg/mL SULFO-tagged anti-digoxigenin antibody (in 1% Blocker A buffer) was added to each well. Seal the plate with a photorefractive strip and incubate it on an orbital shaker at 650 rpm for 60 min. The plate was then washed 3 times with KPL buffer, then MSD Gold buffer was added to each well and the plate was read spectrophotometrically. animal

C57Bl6 wild-type mice were housed in the Leiden University Medical Center animal facility. Mice received food and water ad libitum. For biodistribution and preliminary safety studies, ASO (40 mg/kg) was administered intravenously via the tail vein on days 0, 3, 7, and 10. After sacrifice (day 14), blood (and urine) was collected from each mouse and allowed to stand at room temperature for 30 minutes, then centrifuged at 6,000 rpm at 4°C to collect the upper serum. Creatinine, blood urea nitrogen (BUN or urea), albumin, aspartate aminotransferase (AST), and alanine aminotransferase (ALT) were determined in LUMC's clinical chemistry laboratory. Example 2 Results ASO according to the invention has improved antiviral activity

To illustrate the antiviral activity of the ASO according to the present invention, the antiviral activity of the ASO according to SEQ ID NO: 8 (ASO8) was compared with the structures of SEQ ID NOs 23 and 24 (ASO23 and ASO24) according to WO 2019/168402, respectively. The antiviral activities of similar ASOs were compared. ASO23 and ASO24 differ from ASO8 only in that their 20-nucleotide target region in the polyomavirus large T antigen pre-mRNA begins one nucleotide upstream or downstream.

Human proximal kidney epithelial cells (PTEC) were treated with 50 nM ASO 24 h before infection with BKV, and BKV RNA and protein expression were quantified on day 5 post-infection. In this in vitro model, treatment with ASO8 resulted in a 93.8% and 96.5% reduction in T-Ag and VP1 mRNA, respectively, relative to untreated controls. These reductions are superior to those achieved with ASO23 (T-Ag: 91.9% and VP1: 92.0%) and ASO24 (T-Ag: 92.4% and VP1: 90.4%). See Figure 17A. The improvement provided by ASO8 was confirmed by the measurement of downstream VP1 protein expression. ASO8 (92.5%) was more effective in inhibiting VP1 protein expression after treatment, compared with 80.7% and 89.4% for ASO23 and ASO24 respectively. See Figure 17B. Overall, these results indicate that ASO8 is effective in inhibiting BKV replication and is improved compared to structurally similar ASOs. This improvement was completely unexpected given the similar structures and therefore almost identical target areas. Materials and Methods Transfection and Infection of Cells

Human kidney proximal epithelial cells (PTECS, Sciencell Inc., catalog number: 4100) were maintained at 37°C and 5% CO in REBM basal _medium (Lonza, catalog number: CC-3191) (supplemented with REGMTM SingleQuotsTM (Lonza, catalog number: CC-4127, referred to herein as REGM) supplemented to 0.5% FCS). Prior to transfection, PTEC were seeded in 12-well plates (Corning Incorporated Cat. No.: 3512) at a density of 21,000 cells/cm ^overnight . Transfection of 50 nM ASO was achieved using Lipofectamine 3000 (Invitrogen, catalog number: L3000075) according to the manufacturer's instructions. After 5 h of incubation, all REGM was replaced with fresh REGM and the cells were maintained overnight, after which the cells were infected with BKV (ATCC, catalog number: VR-837; diluted 1:3000 from the original stock solution) for 2 h. Aspirate the virus-containing REGM and wash all wells 3 times before adding fresh REGM. Cells were maintained in culture medium for 5 days post-infection and REGM was supplemented on day 3 post-infection. Untreated cells served as controls. Quantitative real-time PCR

Use the RNeasy kit (Qiagen, catalog number: 74106) following the manufacturer's instructions with RLT buffer and 1% 2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148-100 mL ) and DNase I treatment (Qiagen, catalog number: 1010395) to isolate RNA. An additional DNA removal step was included after RNA elution to remove any excess BKV DNA using a TURBO DNA-free™ kit (Thermo Fisher Scientific, Cat. No. AM1907). Use M-MLV Reverse Transcriptase (Cat. #: M1708) in M-MLV RT 5X Buffer (Cat. #: M531A), 10 mM dNTP Mix (Cat. #: U1518), RNasin® Ribonuclease Inhibitor (Cat. #: M531A), N2518), oligo(dT) 15 primer (Cat. No. C110A), and 0.1 M molecular grade DTT (all Promega, Cat. No. Y00147). Quantitative real-time PCR analysis of BKV RNA expression was performed on a CFX Opus real-time PCR system (Bio-Rad) using SYBR Select Master Mix (Thermo Fisher Scientific, Cat. No. 4472908) and the following primers according to the table below: T-Ag: GAGGAGGATGTAAAGGTAGCTCA (forward, SEQ ID NO: 70) and ACTGGCAAACATATCTTCATGGC (reverse, SEQ ID NO: 71); VP1: TGCAGGGTCACAAAAAGTGC (forward, SEQ ID NO: 72) and AGCACTCCCTGCATTTCCAA (reverse, SEQ ID NO: 73); GAPDH: ACAACTTTGGTATCGTGGAAGG (forward, SEQ ID NO: 74) and GCCATCACGCCACAGTTTC (reverse, SEQ ID NO: 75). Changes in mRNA expression were determined using the ΔΔCt method. steps ℃ time 1 50 2 minutes 2 95 2 minutes 3 95 10 seconds 39x 4 61 20 seconds 5 72 45 seconds 6 95 10 seconds 7 65-95 melting curve Increment 0.5 + plate reading 8 4 Keep VP1 protein quantification using Simple Western analysis

On day 5 post-infection, cells were treated with 1:100 Pierce Protease and Phosphatase Inhibitor Minitablets (Thermo Fisher Scientific, Cat. No. 89901) in RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific, Cat. No. 89901). No.: A32959), the cells were lysed, and the protein concentration was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Cat. No.: 23225). VP1 protein expression was quantified using the Jess Simple Western system (Biotechne). Briefly, 0.5 mg/mL protein was analyzed using the 12-230 kDa separation module (ProteinSimple, catalog number: SM-W004-1) and the anti-rabbit detection module (ProteinSimple, catalog number: DM-001) Lysate sample. If necessary, dilute the antibody in antibody diluent. VP1 protein was detected using 1:20 anti-SV40 VP1 antibody (Abcam, catalog number: ab53977) and 1:20 goat anti-rabbit immunoglobulin/HRP (Agilent, catalog number: P044801-2). β-Actin expression was used as a loading control using 1:20 β-actin mouse monoclonal antibody (Cell Signaling Technology, Cat. #3700S) and 1:20 goat anti- Mouse immunoglobulin/HRP (Agilent, catalog number: P044701-2) was used as the secondary antibody. The assay consists of a 30-minute separation time at 375 V, followed by a 5-minute antibody dilution time, a 60-minute primary antibody time, and a 30-minute secondary antibody time. Peak area calculations were performed using the dropped line of the high dynamic range chemiluminescence signal. Adjust the peak finding threshold and width on a capillary-by-capillary basis to ensure appropriate fit of the signal.

without

Figure 1 : The BKV T-Ag splice site is conserved between genotypes, allowing a “one -size-fits-all ” ASO approach. Publicly available complete genome sequences of BKV isolates were downloaded, and whole-gene T-Ag sequences were aligned and conservation between genotypes studied. Genotypes were identified using reference isolates described in the literature. Findings indicate that donor splice sites in T-Ag are primarily conserved between genotypes, whereas acceptor splice sites are more variable in non-coding intronic regions. Based on these findings, we identified a stretch of nucleotides that overlapped with a donor splice site that showed 100% sequence conservation between genotypes. Concise BKV T-Ag phylogeny tree (left) with sequence identification depicting splice site conservation for each genotype (right). The size of the letter (nucleotide) indicates the relative occurrence of the nucleotide present at that position for each genotype. Deletions are described as empty regions or gaps in the sequence identity. The sequences are given in Table 1. SEQ ID NO describe sequence 55 Donor site I, IV GAACTGGAGTAGCTCAGAGGTTTGTGCTGATTTTCCTCT 56 Donor site II, III GAACTGGAATAGCTCAGAGGTTTGTGCTGATTTTCCTCT 57 shared donor site GAACTGGARTAGCTCAGAGGTTTGTGCTGATTTTCCTCT 58 receptor site I TAATTATTTKTTTTMTAGGTGCCAACCTATGGAACAGA 59 receptor site II TAATTATTTTTTTKTTATAGGTGCCAACCTATGGAACAGA 60 receptor site III TAATTATTTTTTTTTTATAGGTGCCAACCTATGGAACAGA 61 Receptor site IV, no gap TAATTATKTTTTTTTTATAGGTGCCAACCTATGGAACAGA 62 Receptor site IV, there is a vacancy TAATTAKTTTTTTTTATAGGTGCCAACCTATGGAACAGA 63 Shared receptor sites, no gaps TAATTATKTTTKTTTTMTAGGTGCCAACCTATGGAACAGA 64 Shared receptor sites, with 1 vacancy TAATTATTTTKTTTTMTAGGTGCCAACCTATGGAACAGA 65 Shared receptor sites, with 1 vacancy TAATTAKTTTKTTTTMTAGGTGCCAACCTATGGAACAGA 66 Shared receptor site, with 2 vacancies TAATTATTTKTTTTMTAGGTGCCAACCTATGGAACAGA

Figure 2 : Design of multiple ASOs to target the exon 1- intron donor site of the BK virus large T antigen. The large T antigen donor splice sites targeted were defined as SEQ ID NO: 1 to 10 and designed using an in-house developed design algorithm. Briefly, this algorithm takes into account antisense oligonucleotide (ASO) GC content (40%-60%), melting temperature (>48°C), and absence of CpG motifs. Each potential ASO is assigned a score, which increases when requirements are not met. Generally, ASOs with low scores are preferred over those with high scores, but the predicted secondary structure of the target RNA and ASO, as well as binding to splicing (RESCUE) enhancers and/or silencers in the target RNA, are also considered. Importantly, the score takes into account whether design requirements are met but does not predict efficacy. Finally, targetable sequences need to contain at least 1 exon or intron nucleotide. The light box definition is a 2'-OMe-fully modified ASO (SEQ ID NO: 12 to 21) derived from each of SEQ ID NOs: 1 to 10, and the dark box definition GapmeR oligonucleotides targeting the exon-intron junction (SEQ ID NO: 42) or the exon 1 sequence SEQ ID NO: 43 to 45. The truncated ASO is represented by SEQ ID NO: 11. The ASO represented by SEQ ID NO: 11 contains a portion of SEQ ID NO: 5. The ASO represented by SEQ ID NO: 11 has been further modified into a 2'-OMe fully modified ASO (all nucleotides have 2'-O-methyl bases), and each internucleotide bond is Phosphorothioate bond. This further modified ASO is represented by SEQ ID NO: 22.

Figure 3 : Chemically modified ASOs targeting the BKV large T antigen exon 1- intron junction mediate 10- to 100 -fold inhibition of BKV parameters. Human primary renal tubular epithelial cells (PTEC) were treated with the novel candidate 2'-OMe modified ASO (SEQ ID NO: 12 to 21) and subsequently infected with BKV. BKV mRNA and protein expression and viral particle release in supernatants were studied using PCR or Western blotting (n = 3 replicates). The graph shows the fold change of each individual ASO relative to the scrambled control on various outcome measures: T-Ag mRNA, VP1 mRNA, VP1 protein, and viral production. The thick dark gray line represents the average overall reduction observed for HYB_03 (20-mer, 2'O-methyl nucleotide and phosphorothioate backbone, represented by SEQ ID NO: 68), which was used as a reference. SEQ ID NO: 67 is the native RNA sequence from which SEQ ID NO: 68 is derived. SEQ ID NO: 67 is represented by 5'-CAGCACAAACCUCUGAGCUA-3'.

Variability in SEQ ID NO: 12 activity is due to poor nuclear localization and viability of cells from different replicates. The new candidate sequences selected (SEQ ID NO: 16 to 19) stood out for their high potency in inhibiting BKV mRNA and protein expression and virus production. Typically, treatment with these new 2'-OMe-modified ASO candidates resulted in at least a 10-fold inhibition of viral particle mRNA expression and production and a 100-fold reduction in protein expression compared to 2'-OMe-modified scrambled controls. times.

Figure 4 : 2'-OMe chemistry produces greater reductions in BKV parameters when targeting exon 1- intron junctions than ASOs with 2'-MOE chemistry . Human primary renal tubular epithelial cells (PTEC) were treated with chemical variants of the novel candidate ASO (SEQ ID NO: 16 to 19) and subsequently infected with BKV. Study BKV protein expression and viral particle release in supernatants using PCR or Western blotting. FAM labeled scrambling control, HYB_03 with FAM conjugate (i.e. SEQ ID NO: 68 (+FAM)) and unlabeled HYB_03 (-FAM) (i.e. SEQ ID NO: 68 (-FAM)) As reference or control (n = 3 replicates). The graph shows the fold change of each individual ASO relative to the FAM-labeled scrambled control on various outcome measures (VP1 protein and virus production). Interestingly, ASOs containing MOE-PS (SEQ ID NO: 23, 24, 25, 27, 28, 29, 31, 32, 33, 35, 36, 37, 38 or 69) showed comparable efficacy in inhibiting BKV low activity, while the OMe-PS variant (SEQ ID NO: 17, 18, 19, 22, 26, 30, 34, 38 and 68, HYB_03) showed strong inhibition of protein expression and virus production. The presence of 5'-methylcytidine does not appear to interfere with ASO efficacy. In addition to HYB_03 (SEQ ID NO: 68), the 4 most potent ASOs were selected as the most promising candidates, namely SEQ ID NO: 30, 18, 34 and 19.

Figure 5 : Oligonucleotide with SEQ ID NO: 19 produces an efficient reduction of BKV- infected cells after "re-infection". Reinfection assays were performed to determine whether ASOs limit the production of active virus, whereby human proximal tubule epithelial cells were treated with a scramble control and several ASOs exhibiting anti-BKV activity (HYB_03 (SEQ ID NO: 68), SEQ ID NO. : 26, SEQ ID NO: 17, SEQ ID NO: 34, SEQ ID NO: 19) processing. Human PTEC were pretreated with ASO (24 h before infection) and infected with BKV, after which the cells were incubated for a period of 7 days. Culture supernatant was harvested on day 7 and plated at a 10-fold dilution onto freshly plated PTEC for 3 days. Cells were stained for expression of nuclei (DAPI) and large T antigen protein.

Figure 6 : Oligonucleotide with SEQ ID NO: 19 produces efficient reduction of BKV- derived RNA , protein and viral DNA after "re-infection". Reinfection assays were performed to determine whether ASOs limit the production of active virus, whereby human proximal tubule epithelial cells were treated with a scramble control and several ASOs exhibiting anti-BKV activity (HYB_03 (SEQ ID NO: 68), SEQ ID NO. : 26, SEQ ID NO: 17, SEQ ID NO: 34, SEQ ID NO: 19) processing. Human PTEC were pretreated with ASO (24 h before infection) and infected with BKV, after which the cells were incubated for a period of 7 days. Culture supernatants were harvested on day 7 and plated at 10-fold dilutions on freshly plated PTEC for 3 days, at which time we assessed the levels of large T mRNA, VP1 mRNA, and protein and viral DNA production.

Figure 7 : ASO targeting splicing induces abnormal splicing of pre-mRNA in the early coding region and simultaneously switches from large T antigen to small T antigen. Mouse Balb/c cells were transformed with the pRPc vector containing the early coding region of the Gardner BK strain (Negrini, M. et al., Cancer Research, 1992). This drives the constitutive expression of the early coding region of BKV in these cells, as evidenced by the abundant expression of large T-antigen mRNA (product 1) and small t-antigen mRNA (product 3). Scrambling control, HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 were administered by lipofectamine at a concentration of 25 nM, and RNA was harvested 24 hours after treatment. Mismatch controls of SEQ ID NO: 19 (single mismatch at nucleobase 10 (SEQ ID NO: 39), double mismatch at nucleobases 5 and 10 (SEQ ID NO: 39)) were administered by lipofectamine at a concentration of 25 nM. ID NO: 40) and three mismatches at nucleobases 5, 10, and 15 (SEQ ID NO: 41)), and RNA was harvested 24 h after treatment. Note: These cells were kindly provided by Professor Massimo Negrini (University of Ferrara, Italy). Treatment with HYB_03 and SEQ ID NO: 19 significantly affects the splicing and expression levels of early coding region pre-mRNA, resulting in a clear shift from the large T antigen as the main product (band 1) to various RNA products, including the small t antigen (band 3) increase. Introduction of a single mismatch resulted in partial restoration of normal splicing, whereas 2-3 mismatches almost completely restored splicing of the large T antigen as the predominant RNA species. These data provide clear evidence of target engagement and specificity.

Figure 8 : GapmeR targeting large T antigen splicing does not induce aberrant splicing and does not mediate a nonsignificant reduction in large T antigen mRNA . Mouse Balb/c cells were transformed with the pRPc vector containing the early coding region of the Gardner BK strain ( Negrini, M. et al., Cancer Research [Cancer Research], 1992 ). This drives the constitutive expression of the early coding region of BKV in these cells, as evidenced by the abundant expression of large T-antigen mRNA (product 1) and small t-antigen mRNA (product 3). In contrast to antisense oligonucleotides that use steric hindrance to modulate splicing, GapmeR was designed to be derived from the sequence of SEQ ID NO: 19 and administered by lipofectamine at a concentration of 25 nM, with RNA harvested 24 hours after treatment . The GapmeR version of SEQ ID NO: 19 was administered with lipofectamine at a concentration of 25 nM and RNA was harvested 24 h after treatment (SEQ ID NO: 42), but it did not exhibit expression levels for large T or small t antigen RNA. Any significant activity. Additional GapmeR (SEQ ID NO: 43 to 45) targeting exon 1 of early coding region (pre)mRNA did not mediate significant reduction of early coding region mRNA. Therefore, the effect of GapmeR on T-antigen splicing is not as great as previously observed with the splice site-targeting ASOs HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19. These findings indicate that although GapmeR can degrade target mRNA, the splicing of target mRNA is essentially unaffected. Note: These cells were kindly provided by Professor Massimo Negrini (University of Ferrara, Italy).

Figure 9 : PBMC viability is not affected by treatment with SEQ ID NO: 30 , SEQ ID NO: 18 , SEQ ID NO: 34 and SEQ ID NO: 19 . Healthy human peripheral blood mononuclear cells (PBMC) were isolated from the skin-colored hemocyte layers of 4 different donors and incubated in the presence of increasing concentrations of ASO for 48 hours. After incubation, cell viability was measured using the Cell titer Blue viability assay. PBMC were incubated at 65°C for 10 minutes as a positive control. As an additional control, PBMC were activated with 1 µM R848 (TLR7/8 agonist) and all conditions were compared to saline-treated controls. Cell viability was expressed as percentage relative to saline-treated control. As shown, after 48 hours, no viable cells were detected in the positive control incubated at 65°C, while no significant effect on cell viability was observed in ASO-treated PBMC.

Figure 10 : Treatment with SEQ ID NO: 30 , SEQ ID NO: 18 , SEQ ID NO: 34 and SEQ ID NO: 19 mediates minimal activation of pro-inflammatory cytokine responses in PBMC . Healthy human peripheral blood mononuclear cells (PBMC) were isolated from the skin-colored hemocyte layers of 4 different donors and incubated in the presence of increasing concentrations of ASO for 48 hours. After incubation, the supernatant was harvested to measure interleukin production. As a positive control, PBMC were activated with 1 µM R848 (TLR7/8 agonist, data not shown) and all conditions were compared to saline-treated controls. The relative production and release of 6 interleukins in response to exposure to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 is shown on the left. A slight transient increase in some interleukin levels was observed in response to ASO treatment, but never to the same extent as in R848-treated controls. Data represent interleukins within detection limits for all 4 donors.

Figure 11 : Treatment with SEQ ID NO: 30 , SEQ ID NO: 18 , SEQ ID NO: 34 and SEQ ID NO: 19 mediates minimal activation of pro- and anti-inflammatory cytokines in PBMC . Healthy human peripheral blood mononuclear cells (PBMC) were isolated from skin-colored hemocytes of 4 different donors and prepared at increasing concentrations of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34, and SEQ ID NO : Incubate it for 48 hours in the presence of 19. After incubation, the supernatant was harvested to measure interleukin production. As a positive control, PBMC were activated with 1 µM R848 (TLR7/8 agonist, data not shown) and all conditions were compared to saline-treated controls. The relative production and release of 6 interleukins in response to treatment with SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 is shown on the left. A slight transient increase in some interleukin levels was observed in response to ASO treatment, but never to the same extent as in R848-treated controls. Data represent interleukins within detection limits for 2 of 4 donors.

Figure 12 : Exposure of human plasma to oligonucleotides having SEQ ID NO: 19 , SEQ ID NO 30 , SEQ ID NO: 18 or SEQ ID NO: 34 has minimal effect on plasma clotting time. Increasing concentrations of ASO were added to normal human plasma, and the intrinsic pathways that activate the coagulation cascade were tested using activated partial thromboplastin time (aPTT). ASO conditions were compared to saline-treated control plasma. Activation of the intrinsic coagulation cascade in saline-treated control plasma resulted in a clotting time of 33.8 seconds. Addition of SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 and SEQ ID NO: 19 to plasma resulted in a dose-dependent prolongation of clotting time. Data indicate n = 1.

Figure 13 : ASO targeting BKV was significantly absorbed by proximal and distal tubules of mouse renal cortex. A) 9-week-old male C57BL6 mice received 40 mg/kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, and SEQ ID NO: 18 on days 0, 3, 7, and 10 , SEQ ID NO: 34 or SEQ ID NO: 19 for intravenous injection. The mice were compared to saline-treated animals. Group size was 5 mice per group per time point. B) Visual evidence of high levels of SEQ ID NO: 19 distributed to the kidney, and specifically proximal tubule epithelial cells, as demonstrated by staining with a specific Cy5-labeled FISH probe (SEQ ID NO: 19). The individual segments of the nephron are defined as the glomerulus (glom), the proximal tubular epithelium (prox) and the distal tubular epithelium (dist), and the collecting duct epithelium ("coll") based on the schizotypyrin ("glom") ”), LTL (“prox”), E-cadherin (“dist”), and aquaporin-2 (“coll”). B) (right image), trace levels of SEQ ID NO: 19 were detected in the medullary portion of the kidney (see arrow).

Figure 14 : Hybrid ELISA analysis of SEQ ID NO: 19 uptake in kidneys and high blood flow organs . 9-week-old male C57BL6 mice received 40 mg/kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ on days 0, 3, 7, and 10 ID NO: 34 or SEQ ID NO: 19 and compared to saline-treated animals (n = 5 mice per group). Results of experiments performed with SEQ ID NO: 19 are shown. Left panel: shows quantification of SEQ ID NO: 19 levels in two kidneys (left and right), liver, spleen and lung, indicating that the (relative) uptake per gram of kidney tissue is approximately 2.5 times that per gram of liver tissue . Similarly, greater relative uptake was observed in the kidney compared with the lung and spleen. Right panel: depicts the level of individual mouse tissues, demonstrating consistent tissue distribution characteristics in vivo.

Figure 15 : Multiple administration of SEQ ID NO: 30 , SEQ ID NO: 18 , SEQ ID NO: 34 or SEQ ID NO: 19 over 2 weeks did not result in signs of renal or liver damage in the serum of mice. 9-week-old male C57BL6 mice received 40 mg/kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ on days 0, 3, 7, and 10 ID NO: 34 or SEQ ID NO: 19 and compared to saline treated animals. Serum levels of renal and liver function markers were studied 14 days after the first dose (n=5 mice per cohort). Upper panel: Serum levels of renal (creatinine, urea, and albumin) and hepatic (AST and ALT) biomarkers indicating organ function and/or injury. Although some minor differences were detected between some groups, all levels were well within the normal range and therefore no signs of renal or liver damage were observed.

Figure 16 : Repeated administration of SEQ ID NO: 30 , SEQ ID NO: 18 , SEQ ID NO: 34 or SEQ ID NO: 19 over 2 weeks did not result in signs of renal injury. 9-week-old male C57BL6 mice received 40 mg/kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ on days 0, 3, 7, and 10 ID NO: 34 or SEQ ID NO: 19 and compared to saline-treated animals (n = 5 mice per group). Representative images of Sirius red (upper panel) and KIM-1 staining (lower panel) in kidneys after sacrifice. It is clear from the above figure that administration of saline (0.9% NaCl) or ASO does not result in signs of ASO-related renal injury. Images were compared with positive control (ischemia-reperfusion injury; IRI). B. Quantification of Sirius red staining in kidneys on day 14. Three animals that received ASO showed increased renal collagen content (HYB_03, n = 2, SEQ ID 34, n = 1), but this cannot be clearly attributed to the administration of ASO and may be due to changes in the images used for quantification. Potentially higher number of major blood vessels.

Figure 17 : ASOs according to the invention have improved antiviral activity. PTEC were treated with ASO 24 h before infection with BKV, and BKV RNA expression was quantified on day 5 postinfection. A) Relative T-Ag and VP1 RNA of cells treated with ASO8 (SEQ ID NO: 8), ASO23 (SEQ ID NO: 23 of WO 2019/168402) and ASO24 (SEQ ID NO: 24 of WO 2019/168402) Performance. B) Relative VP1 protein expression in cells treated with ASO8, ASO23 and ASO24.

without

TW202400187A_112116791_SEQL.xml

Claims (17)

An oligonucleotide comprising a nucleobase sequence according to one of SEQ ID NO: 8, 1, 2, 3, 4, 5, 6, 7, 9, 10 and 11 or comprising a sequence similar to The nucleobase sequence of any one of SEQ ID NO: 1 to 11, characterized in that at least one nucleobase of the SEQ ID NO is replaced by a nucleobase having the same base pairing specificity as the replaced nucleobase. Base analog substitution. The oligonucleotide of claim 1, wherein the nucleobase sequence of the oligonucleotide consists of a nucleobase sequence according to one of SEQ ID NO: 1 to 11, or wherein the oligonucleotide The nucleobase sequence is composed of a nucleobase sequence similar to any one of SEQ ID NO: 1 to 11, characterized in that at least one nucleobase of the SEQ ID NO has the same nucleobase as the replaced nucleobase. Base-pairing-specific nucleobase analog substitutions. The oligonucleotide of claim 1 or 2, wherein the oligonucleotide comprises a modification capable of rendering the RNA duplex resistant to RNase H, wherein the RNA duplex comprises the oligonucleotide and An oligonucleotide that is complementary to it (complementary oligonucleotide). The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide contains modified internucleotide linkages, preferably phosphorothioate internucleotide linkages. The oligonucleotide of claim 4, wherein the oligonucleotide comprises a nucleotide sequence according to one of SEQ ID NO: 12 to 21 or a nucleotide sequence according to SEQ ID NO: 22, whichever Preferably, the nucleotide sequence of the oligonucleotide consists of a nucleotide sequence according to one of SEQ ID NOs: 12 to 22. The oligonucleotide of claim 5, wherein the oligonucleotide comprises a nucleotide sequence according to SEQ ID NO: 19, preferably wherein the nucleotide sequence of the oligonucleotide is according to SEQ ID NO. The nucleotide sequence composition of NO: 19. The oligonucleotide of claim 4, comprising an unmodified internucleotide bond between nucleotides 5 to 16 of SEQ ID NO: 1 to 11, and at least two of the oligonucleotide A modified internucleotide linkage between the 5'-most nucleotides and between at least two 3'-most nucleotides of the oligonucleotide. A vector, preferably a viral vector, comprising (i) an oligonucleotide as described in any one of claims 1 to 7, (ii) an oligonucleotide as described in claim 1 or 2 Reverse complementary sequence, or (iii) DNA capable of being transcribed into an oligonucleotide as described in claim 1 or 2. A pharmaceutical composition comprising the oligonucleotide as described in any one of claims 1 to 7 or the carrier as described in claim 8. The oligonucleotide according to any one of claims 1 to 7, the vector according to claim 8, or the pharmaceutical composition according to claim 9, for use as a medicine. An oligonucleotide as described in any one of claims 1 to 7, a vector as claimed in claim 8 or a pharmaceutical composition as described in claim 9 in the treatment of polyomavirus infection in a subject use. The use of the oligonucleotide, vector or pharmaceutical composition as described in claim 10 or 11, wherein the oligonucleotide, the vector or the pharmaceutical composition is administered to a subject with low immune function. The use of oligonucleotides, vectors or pharmaceutical compositions as described in claim 12, wherein the immunocompromised subject is a transplant recipient, preferably a kidney transplant recipient. An in vitro method for inhibiting polyomavirus replication in cells, the method comprising (i) Provide polyomavirus-infected cells, and combine the cells with an oligonucleotide as described in any one of claims 1 to 7, a vector as described in claim 8, or a vector as described in claim 9 Contact with pharmaceutical compositions; or (ii) Provide a cell containing an oligonucleotide as described in any one of claims 1 to 7, a vector as described in claim 8, or a pharmaceutical composition as described in claim 9, and allowing the cell to interact with Polyomavirus exposure. An ex vivo method of producing a graft, the method comprising providing one or more donor organs, tissues or cells, preferably comprising kidney cells, and contacting the cells of the one or more donor organs, tissues or cells with, as requested The oligonucleotide according to any one of items 1 to 7, the carrier according to claim 8 or the pharmaceutical composition according to claim 9 are contacted. An oligonucleotide as described in any one of claims 1 to 7, a vector as described in claim 8 or a pharmaceutical composition as described in claim 9 as defined in claim 11, 12 or 13 purposes, which can exhibit at least one of the following effects: 1) Regulate the splicing of T antigen pre-mRNA, 2) Reduce the production of T antigen mRNA, 3) Reduce VP1 mRNA and preferably VP1 protein production, 4) Inhibit virus replication, 5) Limit the ability of the virus to reinfect, 6) Prevent infection-related cellular effects, 7) Alleviating the cellular effects associated with infection, 8) prevention of disease in infected subjects, and 9) Slow, preferably stop, and better yet reverse disease progression. Use of an oligonucleotide, vector or pharmaceutical composition as claimed in claim 16, wherein the disease has been prevented (8) or progressed when at least one parameter of the disease associated with the polyomavirus infection has been reduced Slow down, stop or reverse (9), the parameter is selected from: glomerular filtration rate, creatinine level, cyclin E2 (CCNE2), cell division cyclin 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51-associated protein-1 (RAD51AP1), BRCA1-interacting protein C-terminal helicase 1 (BRIP1), and lipoprotein B mRNA editing enzyme 3B (APOBEC3B).