TW202338101A - Primers and probe for detecting presence of bladder cancer - Google Patents

Abstract

The present invention provides a primer set for detecting the presence of bladder cancer in a specimen, said primer set containing a pair of primers that are oligonucleotides targeting a PLEKHS1 promoter mutation and having a length of 16-21 bases inclusive, and one or more pairs of primers targeting a TERT promoter mutation.

Description

Primers and probes for detecting the presence of bladder cancer

The present invention relates broadly to primers and probes for detecting the presence of bladder cancer.

Liquid bioassays that detect tumor-derived gene mutations in circulating DNA (cell-free DNA: cfDNA) in the blood are low-invasive tests. In recent years, there have been reports that they are useful in post-operative follow-up observation and treatment effect determination. Effective.

Examples of cfDNA analysis methods include next generation sequencer (NGS) and digital PCR (Polymerase Chain Reaction). Digital PCR has the advantage of being able to perform analysis at a lower cost than NGS. [Prior technical literature] [Non-patent literature]

Non-patent document 1: Clinical significance of hotspot mutation analysis of urinary cell-free DNA in urothelial bladder cancer (Frontiers in oncology, 2020)

[Problem to be solved by the invention]

In many cancers such as bladder cancer, point mutations occur in the promoter region of TERT (telomerase reverse transcriptase), and primers for detecting such point mutations are known.

In bladder cancer, there are hot spots of gene mutations in the promoter region of not only TERT but also PLEKHS1 (pleckstrin homology domain-containing S1, Pleckstrin homology domain-containing S1), which is found in multiple patients. There is a possibility of common mutations, but when cfDNA is used as the sample, detection using quantitative PCR is difficult. In addition, there is also a problem that previous primers or probes cannot detect cfDNA with sufficient accuracy. [Technical means to solve problems]

In order to detect the presence of bladder cancer, primers targeting TERT promoter mutations and PLEKHS1 promoter mutations were designed using a different approach than usual. As a result, the detection coverage of the previous detection targeting TERT promoter mutations was improved. Increased by about 40%.

That is, this case includes the following inventions. (1) A primer set for detecting the presence of bladder cancer in a specimen, comprising: 1 pair of primers, which are oligonucleotides with a length of more than 16 bases and less than 21 bases targeting the mutation of the PLEKHS1 promoter; and One or more pairs of primers, which target the mutation of the TERT promoter. (2) For example, in the primer set described in (1), the mutation in the PLEKHS1 promoter is the substitution from G (Guanine, guanine) to A (Adenine, adenine) at positions 115, 511, and 590 of chromosome 10. Replacement of C (Cytosine) to T (Thymine) at positions 115, 511, and 593 of chromosome 10, or both. (3) The primer set described in (1) or (2), wherein the primer targeting the mutation of the PLEKHS1 promoter has the base sequence described in SEQ ID NO: 1 and/or 2. (4) Such as the primer set described in any one of (1) to (3), in which the primer targeting the mutation of the TERT promoter is the substitution from C to T at positions 1, 295, and 228 of chromosome 5, Replacement from C to T at positions 1, 295, 250 of chromosome 5, or both. (5) A probe for detecting the presence of bladder cancer in a specimen targets the mutation of the PLEKHS1 promoter. (6) The probe described in (5) has the base sequence described in SEQ ID NO: 4 or 5. (7) A set including the introduction set described in any one of (1) to (4). (8) A kit as described in (7), which further includes a probe as described in (5) or (6). (9) A method for detecting the presence of bladder cancer in a specimen, comprising using a primer set as described in any one of (1) to (4), or a probe as described in (5) or (6). Steps to detect mutations in the PLEKHS1 promoter. (10) The method described in (9), wherein the nucleic acid amplification method used in the detection step is digital PCR. (11) The method described in (9) or (10), wherein the specimen is a body fluid specimen. (12) The method according to any one of (9) to (11), wherein the sample contains circulating DNA (cfDNA) in blood. [Effects of the invention]

As mutations in the PLEKHS1 promoter, there are substitutions from G to A at positions 115, 511, and 590 of chromosome 10, and substitutions from C to T at positions 115, 511, and 593 of chromosome 10. When designing the probe, the inventors placed the position corresponding to the mutations near the center of the probe so that the Tm value would be the highest. Specifically, the probe is usually designed as a 20-mer, with a minimum length of 18-mer, and a maximum length of 25-mer. In the present invention, the probe is set to 25-mer to maximize the Tm value.

The introduction is also designed with a different idea than usual. Usually, the length of the primer is designed to be about 20 to 25 mers. Although there is a possibility that if the length of the primer is less than 20 mers, there will be an increase in sequences that non-specifically bind to base sequences other than the target, but the forward primer for detecting mutations in the PLEKHS1 promoter is designed to be 16 mers. This takes into account the need to lower the Tm value to a lower value than for wild type/mutant probes. Although the region containing hotspots in the PLEKHS1 promoter region is an AT-rich sequence, the primer design region is not an AT-rich sequence, so the Tm value is increased and the sequence needs to be shorter than usual. If you want to further avoid GC, for example, designing A or T at the 3' end of the primer, there is a possibility that the specificity to the template DNA will be reduced. However, by conducting verification experiments, it was achieved that the Tm value was lower than the usual design, and the design was carried out with a shorter length.

Furthermore, compared with the Tm value of the forward primer, the Tm value of the mutant probe is lower. As a result, the order of annealing was wild-type probe (53.92), forward primer (52.61), mutant probe (52.28), and reverse primer (50.66).

Furthermore, since the fragment of cfDNA does not reach 200 bp, it is carefully designed in such a way that the size of the amplified amplicon does not reach 200 bp.

In addition to the previous primers targeting the mutation of the TERT promoter, the primers targeting the mutation of the PLEKHS1 promoter, which were designed based on a different idea than usual, were also used, thereby covering previous coverage in the detection of bladder cancer. Patients who don’t have access to it can also get coverage.

Hereinafter, embodiments of the present invention (hereinafter referred to as "this embodiment") will be described, but the scope of the present invention should not be construed as being limited to the following embodiments.

(introduction group) In a first aspect, a primer set for detecting the presence of bladder cancer in a specimen is provided, which includes: 1 pair of primers, which are oligonucleotides with a length of more than 16 bases and less than 21 bases targeting the mutation of the PLEKHS1 promoter; and One or more pairs of primers, which target the mutation of the TERT promoter.

The sample is not particularly limited as long as the mutation of the PLEKHS1 promoter and the mutation of the TERT promoter that indicate the presence of bladder cancer can be detected. However, since the primer set of the present invention is suitable for use in liquid biopsy, the sample Preferably, a body fluid sample containing cfDNA is used, such as blood or other body fluids. More specifically, the specimen is preferably body fluids such as blood, serum, plasma, urine, feces, saliva, sputum, tissue fluid, marrow fluid, swab fluid, or their dilutions, and particularly preferably plasma.

Specimens were collected from subjects suspected of having bladder cancer. Bladder cancer can be non-muscle invasive or muscle invasive. The number of collections can be one time or multiple times for prognostic observation after bladder cancer treatment.

Since the ratio of bladder cancer-derived DNA (ctDNA) contained in cfDNA obtained by liquid biopsy is very small, depending on the type of specimen, the step of extracting or removing ctDNA from the specimen before nucleic acid amplification can be performed. Steps for inclusions, etc. Taking blood as an example, the recovery rate of ctDNA can be increased by performing known methods such as plasma separation and exchange.

In one embodiment, the mutation of the PLEKHS1 promoter can be a substitution from G to A at positions 115, 511, and 590 of chromosome 10 (hereinafter also referred to as "590G>A"), and a substitution at position 115, 511, and 590 of chromosome 10. Replacement from C to T at positions 115, 511, and 593 (hereinafter also referred to as "593C>T"), or both.

Primers are oligonucleotides with a length of more than 16 bases and less than 21 bases. Among them, one with a lower Tm value is preferred. Specifically, by setting the Tm value of the reverse primer to be 1 to 3°C higher than that of the probe, the probe anneals to the template DNA first, and then the reverse primer anneals.

Furthermore, the primer can be designed so that the size of the amplified amplicon does not reach 200 bp.

As an example of a primer based on the design concept described above and amplifying a sequence including a probe for detecting both 590G>A and 593C>T mutations, a sequence with a base length of 16 bases can be exemplified. The forward primer (gacctcttggcttcca) described in Sequence Number 1 and the reverse primer (ctgcaaaattttccatttcca) described in Sequence Number 2 are 21 bases in length. It is preferable to use the primer set including the sequences described in sequence numbers 1 and 2. These primers can be combined with a well-known primer set for amplifying the PLEKHS1 promoter region.

In one embodiment, the mutation of the TERT promoter can be a C to T substitution at positions 1, 295, and 228 of chromosome 5 (hereinafter also referred to as "228C>T"), and a substitution at position 1, 295, and 228 of chromosome 5. 1. Replacement from C to T at position 295 or 250 (hereinafter also referred to as "250C>T"), or both. It is known that 228C>T has a high detection rate in bladder cancer, and 250C>T has a high detection rate in non-muscle invasive bladder cancer.

The primers that amplify the sequences containing probes for detecting both 228C>T and 250C>T mutations can be designed within 113 bp upstream or downstream of the respective mutations, that is, for the former. The primers and probes that target mutations can be designed in the region from positions 1, 295, and 115 to 1, 295, and 341. The primers and probes that target the latter mutation can be designed in the region from position 1, 295, and 115 to positions 1, 295, and 341. Within the area from 1st, 295th and 237th to 1st, 295th and 363rd. Refer to the sequence at the 5' upstream of the coding strand of the TERT promoter region disclosed in GenBank (sequence number 6) (ref|NC_000005.9|:1295115-1295374 Homo sapiens chromosome 5, GRCh37.p13 Primary Assembly) for the design method As an example, this sequence is converted into a sequence on the sense strand side, and if mutations of both 228C>T and 250C>T are reflected, the sequence becomes the sequence shown in SEQ ID NO: 7. For primers and probes that detect 228C>T, the corresponding numbers from 1, 295, 115 to 1, 295, and 341 in Sequence Number 7 are 1, 295, 341 to 1, 295 , the 227 bp sequence of position 115 (sequence number 8), design the appropriate primers and probes required. The same applies to primers and probes for detecting 250C>T, which can be designed based on the 127 bp sequence from positions 1, 295, and 363 to positions 1, 295, and 237 (sequence number 9). Examples of such primers include primers manufactured by BioRad (TERT C228T_113: dHsaEXD72405942, TERT C250T_113: dHsaEXD46675715) (amplicon size: 113 bp) (see also J Mol Diagn. 2019 Mar; 21 (2) 274-285). This primer can be combined with a well-known primer set for amplifying the TERT promoter region.

Sequences of sequence numbers 6 to 9 are shown below. Serial number 6: Serial number 7: Serial number 8: Serial number 9:

The nucleotides constituting the base sequence such as primers may be ribonucleotides or deoxyribonucleotides. These oligonucleotides can be synthesized by known methods. For example, they can be synthesized by any nucleic acid synthesis method such as the solid-phase phosphoramidite method and the triester method according to the base sequence.

By using the nucleic acid amplification reaction of the above primers, sequences containing hotspot regions associated with bladder cancer can be amplified.

As a nucleic acid amplification method, there is a PCR method. In addition to ordinary PCR, examples include digital PCR, multiplex PCR, LAMP (Loop-mediated isothermal AMPlification) method, and ICAN (Isothermal and Chimeric Amplification). primer-initiated Amplification of Nucleicacids, chimeric primer-initiated nucleic acid isothermal amplification) method, RCA (Rolling Circle Amplification, rolling circle amplification) method, LCR (Ligase Chain Reaction, ligase chain reaction) method, SDA (Strand Displacement) Amplification, strand displacement amplification) method, etc.

When mutations in cfDNA are targeted, the nucleic acid amplification method is preferably digital PCR. By using digital PCR, the ratio of mutant to normal types of cancer genes (MAF: Mutation Allele Frequency) can be determined. Digital PCR may be droplet digital PCR.

(probe) In a second aspect, a probe for detecting the presence of bladder cancer in a specimen is provided, which targets a mutation in the PLEKHS1 promoter.

The sequence constituting the probe is not limited as long as it can detect the mutation of the PLEKHS1 promoter. For example, a probe that can detect the 590G>A mutation or the 593C>T mutation is preferable.

In one embodiment, the probe for detecting the 590G>A mutation has the sequence described in SEQ ID NO: 4 (tgcaattgtttaattgcaaaaaagc). The probe preferably contains the sequence described in SEQ ID NO: 4.

In one embodiment, the probe for detecting the 593C>T mutation has the sequence described in SEQ ID NO: 5. The probe preferably contains the sequence described in SEQ ID NO: 5 (tgcaattattcaattgcaaaaaagc).

A part of the probe may be modified, and examples thereof include those in which the terminals are aminated, and those in which a part of the bases are modified with bases serving as linkers. In addition, other bases may be inserted into part of the base sequence, part of the base sequence may be deleted, or substituted with other bases, or substituted with substances other than bases.

Furthermore, the probe may be modified with a labeling substance or the like, for example, it may have a fluorescent dye and its quencher. A commercially available labeling substance can be used. The quencher is not particularly limited as long as it can quench the fluorescence derived from the fluorescent dye. The nucleotide residues constituting the probe may themselves be modified, for example, may be replaced with artificially modified nucleotide residues.

(set) In a second aspect, a kit including a primer set for detecting the presence of bladder cancer in a specimen is provided. The introduction group can use the above ones.

The panel may further include probes targeting mutations in the PLEKHS1 promoter. Examples of probes for detecting mutations of 590G>A and 593C>T include those having the base sequences described in SEQ ID NO: 4 and 5, respectively.

The kit may further include one or more pairs of primers and probes targeting mutations in the TERT promoter. As mutations in the TERT promoter, there are 228C>T and 250C>T. For primers and probes with 228C>T as the target, they can be designed in the area from positions 1, 295, 115 to 1, 295, and 341. For primers and probes with 250C>T as the target, they can be designed Designed in the area from No. 1, 295, and 237 to No. 1, 295, and 363.

When a nucleic acid is amplified by digital PCR, a reaction solution including the above primer set, probe, sample, and DNA polymerase can be prepared. After the reaction solution is distributed into wells or droplets, the amplification reaction is performed.

In the detection of amplification products obtained from nucleic acid amplification reactions, labeling substances that can specifically identify the amplification products can be used. Examples of such labeling substances include fluorescent dyes, biotin, digoxin, and the like. When fluorescence is used as a label, a fluorescence microscope, a fluorescence plate reader, etc. can be used to detect the fluorescence.

Substances embedded in the amplification product can also be used as labeling substances. The intercalating agent is not particularly limited as long as it is a fluorescent substance embedded in the double-stranded DNA.

Alternatively, detection can be performed by known methods such as electrophoresis using polyacrylamide or agarose gel. For example, in electrophoresis, the presence of an amplified product can be identified based on its mobility relative to a marker of known molecular weight.

(Detection method) In a third aspect, a method for detecting the presence of bladder cancer in a specimen is provided, which includes the step of using the above primer set or the above set to detect mutations in the PLEKHS1 promoter.

The primer set preferably includes primers targeting the mutation of the TERT promoter, and the mutation of the TERT promoter is also detected in the detection step. Other steps may be included before and after the detection step. For example, samples may be collected from subjects suspected of having bladder cancer. The detection step can be performed multiple times. For example, samples from the same subject can be collected regularly, and the detection step can be performed each time the sample is collected.

When a mutation in the PLEKHS1 promoter is detected, the presence of bladder cancer in the specimen can be determined. This can assist doctors in diagnosing bladder cancer or determining subsequent treatment methods. For subjects diagnosed with bladder cancer, surgery (surgical treatment) such as transurethral bladder tumor resection and radical cystectomy, preoperative chemotherapy, postoperative chemotherapy, and chemotherapy (anticancer agent treatment) such as recurrence chemotherapy, can be performed. Radiation therapy.

For example, myometrial invasion can be diagnosed based on the results of transurethral resection of bladder tumors. If there is no muscle invasion, only transurethral resection of the bladder tumor can end the treatment, and follow-up observation will be performed thereafter.

If muscle invasion is diagnosed based on the surgical results of transurethral bladder tumor resection, preoperative chemotherapy will be initiated. When recurrence and metastasis are confirmed after completion of treatment, recurrence chemotherapy will be introduced.

Although preoperative chemotherapy can improve the prognosis, it may not be performed depending on the tissue type of the tumor or the patient's wishes. Postoperative chemotherapy is more often added when residual disease is suspected based on intraoperative signs. When radical cystectomy is considered difficult due to age or general condition, radiation irradiation may be performed instead.

The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these. [Example]

1.1. Primer / probe design 1) Determine the recognition site of the probe. Obtain the base sequences surrounding PLEKHS1 115, 511, 590 and 115, 511, 593 from NCBI (National Center for Biotechnology Information, American Biotechnology Information Center) and others. , set the recognition site of the detection probe at the location containing the mutation. The recognition position and base length of the probe are determined taking into account the GC content rate and Tm value.

2) Introduction design Design multiple primer pairs to amplify the sequence containing the probe, confirm whether non-specific amplicons are formed in gDNA and cfDNA through PCR electrophoresis, evaluate primer dimers, and confirm each primer by quantitative PCR For PCR efficiency. Since cfDNA is used as the target, the amplicon is set in the range of 80 to 150 mers. The sequence and number of bases of the primer take into account the Tm value calculated from the probe. Taking into account PCR efficiency, primer dimers, and non-specific bands, the most efficient primer pair was determined, and Sanger sequencing was used to confirm accurate amplification of the target region.

3) Determine probe sequence Compare the Tm value of each primer with the Tm value of the probe, and determine the base sequence of the probe by binding to the sense strand side or binding to the antisense strand side.

The sequences to be determined in the above procedure are shown in the table below. [Table 1] Introduction name sequence Tm value Fw1 gacctcttggcttcca(serial number 1) 52.61 Re3 ctgcaaaattttccatttcca (serial number 2) 50.66 Probe name sequence Tm value WT tgcaattgttcaattgcaaaaaagc (serial number 3) 53.92 Mut 590G>A tgcaattgtttaattgcaaaaaagc (serial number 4) 52.28 Mut 593C>T tgcaattattcaattgcaaaaaagc (serial number 5) 52.28

2. Preparation of specimens. Tumor tissues and blood specimens from patients with bladder cancer (whether non-muscle invasive or muscle invasive) were collected as target specimens (26 specimens). Furthermore, bladder cancer is targeted at first-time patients with no previous treatment. For patients diagnosed with muscle-invasive bladder cancer, blood samples will be collected every 3 months after treatment.

Sampling of blood specimens is usually performed by collecting peripheral leukocytes and plasma using blood collection tubes (EDTA (Ethylene Diamine Tetraacetic Acid, ethylenediaminetetraacetic acid)). For tumor tissue, the surgically removed tumor tissue is cryopreserved. Each sample was frozen and stored at -80°C until extraction and analysis.

For the obtained sample, DNA derived from tumor tissue was designated as tDNA (tumor DNA), DNA derived from somatic cells (peripheral leukocytes) was designated as gDNA (genome DNA, genomic DNA), and blood circulating in the plasma was DNA was analyzed separately as cfDNA.

3. Experimental method 3.1. The experimental process is as follows to confirm the effectiveness of the designed introduction. (i) Fragment amplification by PCR. (ii) DNA purification. (iii) Confirm the target fragment and primer dimer by electrophoresis. (iv) Sequence confirmation by Sanger sequencing of fragments.

Next, a plasmid for verification is produced according to the following procedure. (i) Extract genomic DNA from patient tumor samples. (ii) A DNA fragment containing regions 115, 511, 590 to 115, 511, and 593 of wild-type PLEKHS1 was amplified by PCR. (iii) Insert the PLEKHS1 fragment into the vector. (iv) Introduce the vector into Escherichia coli, separate into about 10 to 20 colonies and culture them in large quantities. (v) Recover vectors by mini prep, and confirm whether each vector is wild type or mutant by Sanger sequencing. (vi) When only the wild type is recovered, the 590G>A and 593C>T mutations are introduced using the mutagenesis kit using the wild-type PLEKHS1 introduced into the plastid as a template. (vii) Obtain mutant PLEKHS1 and introduce it into plastids.

Use the verification plasmid in the following order to confirm the detection accuracy of the primer/probe. (i) For the wild-type PLEKHS1 introduced plasmid and the mutant PLEKHS1 introduced plasmid, the detection was confirmed by dPCR (Digital PCR, digital PCR) using the wild-type primer/probe set and the mutant primer/probe set respectively. Accuracy. Furthermore, the one containing the sequence (gacctcttggcttcca) described in SEQ ID NO: 1 was used as a forward primer for detecting wild-type PLEKHS1 and mutant PLEKHS1, and the one containing the sequence (ctgcaaaaattttccatttcca) described in SEQ ID NO: 2 was used as a reverse primer. . A probe containing the sequence described in SEQ ID NO: 3 (tgcaattgttcaattgcaaaaaagc) was used as a probe for detecting wild-type PLEKHS1. A probe containing the sequence described in SEQ ID NO: 4 (tgcaattgtttaattgcaaaaaagc) was used as a probe for the mutation of 590G>A, and a probe containing the sequence described in SEQ ID NO: 5 (tgcaattattcaattgcaaaaaagc) was used as a probe for detecting the mutation of 593C>T . (ii) Prepare a 0.1% mutant plasmid at a ratio of wild type: mutant type = 999:1. (iii) Confirm the detection accuracy of 0.1% mutant plasmid.

TERT and PLEKHS1 mutations were detected by dPCR using patient samples. (i) Use verified wild-type PLEKHS1 primers/probes and mutant PLEKHS1 primers/probes to conduct mutation detection and confirmation using tDNA and gDNA (26 specimens each) as samples. (ii) Also use TERT primers/probes to conduct mutation detection and confirmation using tDNA and gDNA (26 samples each) as samples. In addition, commercially available TERT primers/probes (primer/probe set manufactured by BioRad (TERT C228T_113: dHsaEXD72405942, TERT C250T_113: dHsaEXD46675715) (amplicon size: 113 bp)) were used. Although their sequences are unknown, since the sizes of the two amplicons are both 113 bp, and primers are usually designed with the mutation site as the center, and probes are designed to hit the mutation site, it is believed that C228 Or C250 is the starting point, and there are primers and probes within 113 bp upstream or downstream. You can also start from the above mutation site and design within the range of 50 to 200 bp upstream or downstream. (iii) In cases where mutation-positive cases can be confirmed in tDNA and mutation-negative cases can be confirmed in gDNA, cfDNA is used as a sample for mutation detection and MAF is calculated. When the frequency in tumors is low, it is expected to be difficult to detect in blood, so those with a mutation rate of 10% or more in tDNA are regarded as mutation positive.

The materials and methods used in digital PCR are described below. Material: Sample DNA(-20℃) 2x ddPCR Supermix(No dUTP) for probe (4℃) 20x Primer/Probe: Restriction enzyme: HaeIII

Method: 1. Adjust the DNA solution to <50 ng/well (to 7 μL) (additional 15 ng can be added in the case of 10-50 replication). 2. Dissolve, vortex, centrifuge and shield at room temperature. 3. Prepare the mixture (restriction enzyme is 10 U/μL stock solution). [Table 2] Element Amount(μL) final concentration 2x ddPCR Supermix for probes 10 1x 20x mutant primers/probes 1 1x 20x wild type primer/probe 1 1x restriction enzyme 0.5 2-5 U/reaction DNA sample + water 1-7 <50ng total 20 - 4. Vortex, centrifuge, and place at room temperature for 3 minutes. 5. Add 20 μL of the mixture to the sample well of the DG8 (registered trademark) Cartridge, and add 70 μL of Droplet Generation Oil to the oil well. 6. Add to the Droplet Generator to create droplets in the solution. 7. Add 40 μL droplets into the 96-well PCR plate (PCR 96well) and seal (aluminum foil). [table 3] Cycle steps Temperature(℃) time Number of cycles enzyme activation 95 10 minutes 1 modified 94 30 seconds 40 Annealing/elongation 55 1 minute 40 enzyme inactivation 98 10 minutes 1 8. Analyze with Droplet Reader.

4. Prepare plasmids (WT, Mut) for verification from the results and confirm the detection accuracy. The results are shown in Figure 1. Regarding the detection of PLEKHS1 590G>A, the detection accuracy of WT and Mut are 99.98% and 100.00% respectively. Regarding the detection of PLEKHS1 593C>T, the detection accuracy of WT and Mut are 99.99% and 100.00% respectively. Furthermore, when a DNA solution in which Mut was diluted 1000-fold with WT was tested, 0.1% mutation was significantly detected (590G>A: p=0.0031, 593C>T: p<0.001).

When trying to perform dPCR on mutation-positive patient samples (tDNA, cfDNA), the detection signals of both WT and Mut were good, and positive droplets and negative droplets could be clearly separated in each sample (Figure 2).

As shown in Figure 3, when MAF of cfDNA of mutation-positive patients was analyzed over time, an increase in MAF could be detected before metastasis diagnosis based on the images. In addition, even when the same sample is analyzed using TERT promoters other than PLEKHS1, different changes may be seen depending on the mutation. For example, the arrow in Figure 3 indicates the relapse stage, that is, the specific stage where the MAF detects 0.00% of mutations (or samples containing them), although "ctDNA is present and can be judged positive with other mutations". The results show that for bladder cancer surgery, it is necessary to observe the process of multiple mutations during follow-up observation.

As shown in Figure 4, when dPCR was used to detect the tumor DNA of 26 specimens, 50.0% (13/26) and 42.3% (11/26) of the patients were positive for the TERT promoter and the PLEKHS1 promoter respectively. . Furthermore, patients with repeated mutations in the PLEKHS1 promoter were counted as 1. Only TERT promoter could observe 50.0% of the target patients. In contrast, by adding PLEKHS1 promoter, the number improved to 57.7% (15/26). In addition, multiple mutations could not be observed in the same patient in 0.0% (0/26) using the TERT promoter alone. In contrast, by adding the PLEKHS1 promoter, it was possible to detect multiple mutations in 34.6% (9/26) of the patients. Multiple mutations were observed.

5. Discussion : Similar to the TERT promoter that can be detected by previous methods, the PLEKHS1 promoter mutation detected this time is also positive in multiple patients and can be used as a hotspot. It is believed that by detecting this MAF as cfDNA, the patient's condition can be assessed. Among the mutation detection accuracy of PLEKHS1 promoter, WT and Mut are both highly accurate, and can also be used for low-frequency analysis such as MAF analysis of cfDNA.

The reason why slight misannealing occurs in WT is considered to be that the Tm value of the probe changes due to a change in GC% due to mutation. It can be judged that in studies using patient samples, tDNA and cfDNA also have similar signal detection capabilities, which is also helpful for analysis of cfDNA.

As an advantage of being able to perform mutation analysis using dPCR not only in the TERT promoter but also in the PLEKHS1 promoter, firstly, the number of patients that can be analyzed by the same assay is increased. Since bladder cancer tumors have diverse mutations, the method of analyzing the different mutations of each patient over time is the mainstream. Compared with this method, detecting hot spots can help reduce the cost of analysis. Secondly, by analyzing multiple MAFs, the patient's condition can be assessed more accurately. Multiple instances of undetectable MAF despite the diagnosis of systemic metastasis have been identified, suggesting the risk of false negatives when tracking individual mutations. It is believed that by observing multiple MAFs, the possibility of false negative assessment can be reduced.

The clinical significance of multiple tests is that it can be monitored economically and therefore contributes to early assessment of the disease. However, unlike NGS, dPCR that observes a single mutation is susceptible to erroneous disease assessment caused by false negatives. Any mutation The evaluation of a single mutation in the detection is accompanied by the risk of erroneous evaluation, so it is more ideal to perform the detection and evaluation of multiple mutations.

Figure 1 shows the detection accuracy (top) and mutation rate (bottom) of the plasmids used for verification (wild type (WT), mutant type (Mut)). The mutation rate was calculated by mixing plastids (WT/Mut) at 999:1 (n=3). Figure 2 shows the results of positive and negative microtiters for mutation-positive patients. Ch1 in each figure represents Mut droplets, Ch2 represents WT droplets, the lower left box represents WT and Mut negative droplets, the lower right box represents WT positive droplets, the upper left box represents Mut positive droplets, and the upper right box represents WT and Mut negative droplets. Mut positive droplets. Figure 3 shows the time-dependent changes in mutation allele frequency (MAF) after initial treatment (transurethral bladder tumor resection) in mutation-positive patients. The arrow in the figure indicates the recurrence stage, that is, although "circulating tumor DNA (ctDNA) is present and can be judged positive by other mutations", MAF detects 0.00% of mutations (or samples containing it) specific stage. The left graph shows the results for patient number 03 (Pt03), and the right graph shows the results for patient number 21 (Pt21). Also shown are the DCC (Deleted in Colorectal Carcinoma) gene (left) and FGFR (Fibroblast Growth Factor Receptor) 3 (right) that sometimes show mutations in bladder cancer. (Figure) changes over time as a reference. Figure 4 shows the coverage of bladder cancer patients achieved by the primer/probe of the present invention.

TW202338101A_112103135_SEQL.xml

Claims (12)

A primer set for detecting the presence of bladder cancer in a specimen, comprising: 1 pair of primers, which are oligonucleotides with a length of more than 16 bases and less than 21 bases targeting the mutation of the PLEKHS1 promoter; and One or more pairs of primers, which target the mutation of the TERT promoter. Such as the primer set of claim 1, in which the mutation of the PLEKHS1 promoter is a substitution from G to A at positions 115, 511, and 590 of chromosome 10, and a substitution from C to position 115, 511, and 593 of chromosome 10. Replacement with T, or both. Such as the primer set of claim 1 or 2, wherein the primer targeting the mutation of the PLEKHS1 promoter has the base sequence described in SEQ ID NO: 1 and/or 2. For example, the primer set of any one of the claims 1 to 3, in which the primer targeting the mutation of the TERT promoter is the substitution from C to T at positions 1, 295, and 228 of chromosome 5, and the substitution from C to T in chromosome 5 Replacement of positions 1, 295, 250 from C to T, or both. A probe for detecting the presence of bladder cancer in a specimen targets the mutation of the PLEKHS1 promoter. For example, the probe of claim 5 has the base sequence described in SEQ ID NO: 4 or 5. A set including a set of primers according to any one of claims 1 to 4. Such as the set of claim 7, which further contains the probe of claim 5 or 6. A method for detecting the presence of bladder cancer in a specimen, comprising the step of using a primer set according to any one of claims 1 to 4, or a probe according to claim 5 or 6 to detect mutations in the PLEKHS1 promoter . The method of claim 9, wherein the nucleic acid amplification method used in the detection step is digital PCR. The method of claim 9 or 10, wherein the sample is a body fluid sample. The method of any one of claims 9 to 11, wherein the sample contains circulating DNA (cfDNA) in blood.