TW202304493A - Chinese medicine fermentation liquid and its uses for refreshing, improving fatigue, protecting liver, boosting immunity, and lowering blood lipids - Google Patents

Abstract

Chinese medicine fermentation liquid is obtained by fermenting a Chinese medicine extract with multiple strains. The Chinese medicine extract is obtained by water extraction of Cordyceps militaris, ginseng (Panax ginseng), auricularia (Cynanchum auriculatum), and Poria cocos, and the plural strains include yeast, lactic acid bacteria and acetic acid bacteria. In addition, the traditional Chinese medicine fermentation liquid has the effects of refreshing, improving fatigue, protecting the liver, boosting immunity, and lowering blood lipids.

Description

Traditional Chinese medicine fermented liquid and its uses for refreshing, improving fatigue, protecting the liver, enhancing immunity, and lowering blood lipids

The present invention relates to a fermented liquid of traditional Chinese medicine, in particular to a fermented liquid of traditional Chinese medicine prepared from Cordyceps militaris , Panax ginseng , Cynanchum auriculatum and Poria cocos . , Improve fatigue, protect the liver, enhance immunity and lower blood fat and other purposes.

Foods fermented by microorganisms have the advantages of easier digestion, increased flavor, and improved storage time. For example: kimchi, natto, fruit vinegar, etc. are all popular fermented foods.

Fermented beverages are also becoming more and more popular among consumers. Fermented drinks are often made from dairy products, vegetables, fruits, beans, herbs, etc., and then processed by different types of microorganisms.

In some embodiments, a traditional Chinese medicine fermented liquid is obtained by fermenting a traditional Chinese medicine extract with multiple bacterial strains. Among them, the traditional Chinese medicine extract is obtained by extracting Cordyceps militaris , Panax ginseng , Cynanchum auriculatum , and Poria cocos with water, and the plural strains include yeast, Lactic acid bacteria and acetic acid bacteria.

In some embodiments, the total saponin content of the traditional Chinese medicine fermentation broth is at least greater than 6000ug/mL.

In some embodiments, the total saponin content of the traditional Chinese medicine fermentation liquid is at least 6.43 times the total saponin content of the traditional Chinese medicine extract.

In some embodiments, the solid-to-liquid ratio of Cordyceps militaris, ginseng, Pseudominis auricularis, Poria cocos and water is 1:1:1:1:50.

In some embodiments, a traditional Chinese medicine fermented liquid is used to prepare a refreshing and fatigue-improving composition. Among them, the traditional Chinese medicine fermentation liquid is obtained by fermenting the Chinese medicine extract liquid through multiple strains. Acetobacter.

In some embodiments, a traditional Chinese medicine fermentation broth is used to prepare a liver-protecting composition. Among them, the traditional Chinese medicine fermentation liquid is obtained by fermenting the Chinese medicine extract liquid through multiple strains. Acetobacter.

In some embodiments, the traditional Chinese medicine fermentation liquid is used to increase the expression level of interleukin-10 (IL-10) gene, thereby achieving anti-inflammatory effect.

In some embodiments, the traditional Chinese medicine fermentation broth is used to inhibit the formation of fatty liver.

In some embodiments, the traditional Chinese medicine fermentation liquid is used to reduce the bilirubin content of the recipient's blood.

In some embodiments, the traditional Chinese medicine fermentation liquid is used to improve the sallow skin of the recipient.

In some embodiments, a traditional Chinese medicine fermentation broth is used to prepare a composition for improving immunity. Among them, the traditional Chinese medicine fermentation liquid is obtained by fermenting the Chinese medicine extract liquid through multiple strains. Acetobacter.

In some embodiments, the traditional Chinese medicine fermentation liquid is used to increase the expression of at least one gene of the receptor: interleukin-1B (IL-1B) gene, interleukin-6 (IL-6) gene and interleukin -8 (IL-8) gene.

In some embodiments, a traditional Chinese medicine fermentation broth is used to prepare a blood lipid-lowering composition. Among them, the traditional Chinese medicine fermentation liquid is obtained by fermenting the Chinese medicine extract liquid through multiple strains. Acetobacter.

In some embodiments, the traditional Chinese medicine fermentation broth is used to reduce the content of low-density lipoprotein cholesterol in the recipient.

In summary, according to any embodiment of the traditional Chinese medicine fermentation liquid, it can be used to prepare compositions for refreshing and improving fatigue, compositions for protecting the liver, compositions for enhancing immunity, compositions for reducing blood fat, or combinations thereof . Among them, the traditional Chinese medicine fermentation liquid is obtained by fermenting the Chinese medicine extract liquid through multiple strains, and the Chinese medicine extract liquid is obtained by extracting Cordyceps militaris, ginseng, auricularia chinensis, and Poria cocos with water, and the plural strains include yeast, Lactic acid bacteria and acetic acid bacteria. And, the total saponin content of the traditional Chinese medicine fermentation broth of any embodiment is at least greater than 6000ug/mL. In some embodiments, the traditional Chinese medicine fermentation broth can be used to refresh oneself and improve fatigue. In some embodiments, the traditional Chinese medicine fermentation liquid can be used to increase the expression level of the interleukin-10 (IL-10) gene of the recipient, thereby preventing the liver and other organs in the recipient from causing pathological changes due to long-term inflammation. In some embodiments, the traditional Chinese medicine fermentation liquid can inhibit the expression of genes related to liver fat synthesis (such as SREBP-1c gene, SCD1 gene), thereby inhibiting the formation of fatty liver. In some embodiments, the traditional Chinese medicine fermentation broth can be used to reduce liver cell damage and reduce the release of glutamate pyruvate transaminase (GPT). In some embodiments, the traditional Chinese medicine fermentation liquid can be used to protect the liver and reduce the bilirubin content of the recipient's blood, thereby achieving the effect of improving the sallow skin of the recipient. In some embodiments, the traditional Chinese medicine fermentation liquid can increase the interleukin-1B (IL-1B) gene, interleukin-6 (IL-6) gene, interleukin-8 (IL-8) gene or The performance of their combination, thereby enhancing the immunity of the recipient. In some embodiments, the traditional Chinese medicine fermentation liquid can reduce the content of low-density lipoprotein cholesterol in the recipient, thereby achieving the function of lowering blood lipids.

In the description of the following embodiments, unless otherwise stated, the symbol "%" refers to percentage by weight.

In some embodiments, the traditional Chinese medicine fermentation liquid is obtained by fermenting the Chinese medicine extract by multiple strains, and the Chinese medicine extract is made of Cordyceps militaris , Panax ginseng , Cynanchum auriculatum ; also known as Polygonum multiflorum), and Poria cocos ( Poria cocos ) are extracted with water, and the multiple strains include yeast (Yeast), lactic acid bacteria ( Lactobacillus ) and acetic acid bacteria ( Acetobacter aceti ).

For example, the part used by Cordyceps militaris is its fruiting body, the part used by ginseng is its root, the part used by Pseudomonas auricularia is its tuber root and stem leaves, and the part used by Poria cocos is its dried sclerotia . In some embodiments, the solid-to-liquid ratio of Cordyceps militaris, ginseng, Pseudominis auricularis, Poria cocos and water is 1:1:1:1:50.

In some embodiments, the Chinese medicine extract is obtained by adding Cordyceps militaris, ginseng, Pseudoria auricularis and Poria cocos into water for extraction to form a Chinese medicine base solution, and then adding glucose. Here, the traditional Chinese medicine base liquid is firstly subjected to the leaching procedure, which helps to reliably release the active ingredients of each component in the traditional Chinese medicine base liquid.

In some other embodiments, the Chinese medicine extract is prepared by adding glucose to the Chinese medicine base liquid formed by Cordyceps militaris, ginseng, auricularia, Poria cocos and water, and then undergoes an extraction process to form a Chinese medicine extract. Here, before the leaching procedure, the added glucose in the traditional Chinese medicine base liquid is completely dissolved or not completely dissolved. Therefore, the leaching process helps to completely dissolve the glucose in the traditional Chinese medicine base solution and also avoids contamination.

In some embodiments, the leaching procedure is standing at 95° C. for 1 hour. For example, the extraction procedure refers to heating the traditional Chinese medicine base liquid to 95°C and keeping it at 95°C for 1 hour.

In some embodiments, the Chinese medicine extract comprises 10% of the total weight of the Chinese medicine base liquid and the glucose of the Chinese medicine base liquid. And, after adding 10% glucose, the sugar content of the Chinese medicine extract will be greater than 7°Bx. Here, sufficient sugar content can ensure the smooth progress of subsequent fermentation and allow the bacteria to have sufficient nutrients to grow.

Then, adding a plurality of strains to the traditional Chinese medicine extract and fermenting for 7 days to obtain the traditional Chinese medicine fermentation liquid. Among them, the plural strains include 0.01%~0.5% of yeast, 0.01%~0.25% of lactic acid bacteria and 3~10% of acetic acid bacteria. In some embodiments, the solid matter in the traditional Chinese medicine extract (ie, Cordyceps militaris, Panax ginseng, Niudixiao and Poria cocos after the extraction procedure) is not filtered before fermentation. In other words, the bacteria are directly added to the traditional Chinese medicine extract for fermentation, so as to use the bacteria to further extract the active ingredients in the solid.

For example, the yeast can be a commercially available brewer's yeast ( Saccharomyces cerevisiae ), for example, the brewer's yeast with the deposit number BCRC20271 (international deposit ATCC26602) strain purchased from the Food Work Development Institute of the Foundation. For example, the lactic acid bacteria can be commercially available Lactobacillus plantarum ( Lactobacillus plantarum ) or Lactobacillus plantarum TCI999 using the strain of deposit number BCRC910808 (international deposit DSM33106). For example, the acetic acid bacteria can be commercially available acetic acid bacteria, such as acetic acid bacteria purchased from the American Type Culture Collection (ATCC) with deposit number ATCC15973 (domestic deposit number BCRC11688).

In some embodiments, 0.1% yeast is added to the traditional Chinese medicine extract to ferment for 1 day to form the first primary fermentation liquid. Based on this, by first adding yeast to the traditional Chinese medicine extract, alcohol can be produced during the yeast fermentation process, and it is beneficial to extract different active ingredients in Cordyceps militaris, ginseng, psoriasis and Poria cocos. In addition, during the fermentation process, the pH value (pH value) of the Chinese medicine extract will also gradually decrease. This process can also provide a solution environment with different pH values to facilitate the extraction from Cordyceps militaris, ginseng, auricularia and Poria cocos. different active ingredients. In some embodiments, the pH value (pH value) of the first primary fermentation broth is less than 4, and its Brix is about 9°Bx.

Add 0.05% lactic acid bacteria to the first primary fermentation liquid and ferment for 1 day to form the second primary fermentation liquid. Based on this, by adding lactic acid bacteria to the first initial fermentation broth, the glucose in the first initial fermentation broth can be further consumed to reduce the sugar content, and lactic acid can be produced to lower the pH value of the first initial fermentation broth. Moreover, lowering the pH value is conducive to further extracting different active ingredients in Cordyceps militaris, ginseng, auricularia nigrum and Poria cocos. In some embodiments, the pH of the second primary fermentation broth is less than 3.5±0.5, and the Brix is about 6±0.5°Bx.

Add 5% acetic acid bacteria to the second initial fermentation liquid and then ferment for 5 days to form the third initial fermentation liquid. Based on this, by adding acetic acid bacteria to the second primary fermentation broth, the alcohol in it can be consumed and the glucose content can be further reduced. In some embodiments, the pH value of the third initial fermentation broth is 3.4±0.5, and its sugar content is less than 3.5°Bx.

In some embodiments, the third primary fermentation broth is filtered and concentrated to obtain a traditional Chinese medicine fermentation broth. For example, the filtration method may be 200 mesh filtration, and the concentration method may be concentration under reduced pressure at 55°C-65°C.

In some embodiments, oligosaccharides are added to the traditional Chinese medicine fermentation broth to make the sugar content reach 40±2°Bx to form a traditional Chinese medicine fermented drink. For example, oligosaccharides refer to oligosaccharides polymerized from 3 to 10 monosaccharide molecules. Among them, the oligosaccharides can be fructooligosaccharides, galactooligosaccharides, xylooligosaccharides, isomaltooligosaccharides and the like. In some embodiments, the added oligosaccharides may be an oligosaccharide solution containing 60% isomaltooligosaccharides. Here, the pH value of the traditional Chinese medicine fermented drink is 3.5±0.5.

Due to the poor solubility of saponin in water, the alcohol environment formed during the fermentation process is conducive to the extraction of saponin. In some embodiments, the total saponin content of the traditional Chinese medicine fermentation broth is at least greater than 6000ug/mL. For example, the total saponin content of traditional Chinese medicine fermentation broth is at least 6967.22 µg/ml.

Here, the traditional Chinese medicine fermented liquid contains active components of saponins, so it has anti-fatigue, refreshing and anti-aging effects, and can increase the anti-oxidation and anti-inflammation ability of the recipient cells. In some embodiments, the traditional Chinese medicine fermentation liquid can be used to prepare a refreshing and fatigue-relieving composition.

In some embodiments, the traditional Chinese medicine fermentation broth has the ability to protect the liver. For example, traditional Chinese medicine fermentation broth can be used to increase the expression of anti-inflammatory genes (such as interleukin-10 (IL-10) gene), so traditional Chinese medicine fermentation broth can achieve anti-inflammatory effects, thereby preventing the recipient's liver, etc. Organs become diseased due to prolonged inflammation. For example, traditional Chinese medicine fermentation broth can inhibit the expression of genes related to liver fat synthesis (such as SREBP-1c gene, SCD1 gene), thereby inhibiting the formation of fatty liver.

In some embodiments, the traditional Chinese medicine fermentation liquid can be used to reduce liver cell damage, thereby achieving liver protection function. For example, traditional Chinese medicine fermentation broth can reduce the release of Glutamate Pyruvate Transaminase (GPT; also known as ALT), which is an indicator of liver damage, which means that traditional Chinese medicine fermentation broth can reduce the possibility of liver cell damage. For example, when the liver cells are damaged or the bile ducts are blocked, the bilirubin in the blood of the recipient will increase, and the fermented Chinese medicine can reduce the bilirubin content in the blood of the recipient, so that the index returns to the normal range, which represents the The fermentation broth reduces the possibility of liver cell damage. In this way, the traditional Chinese medicine fermentation liquid can also improve the sallow skin of the recipient and make the recipient's complexion better.

In some embodiments, the traditional Chinese medicine fermentation liquid can be used to improve the immunity of the recipient. For example, the traditional Chinese medicine fermentation liquid can increase the expression level of at least one of the following genes in the body of the recipient: interleukin-1B (IL-1B) gene, interleukin-6 (IL-6) gene and interleukin -8 (IL-8) gene. Based on this, by increasing the expression level of IL-1B gene, the traditional Chinese medicine fermentation liquid can activate the activity of white blood cells in the recipient and promote the dilation of blood vessels to help immune cells enter the infected site to kill germs. By increasing the expression of IL-6 gene, the traditional Chinese medicine fermentation broth can activate the lymphocytes in the recipient and increase the production of antibodies. By increasing the expression level of IL-8 gene, the traditional Chinese medicine fermentation broth can promote the differentiation of white blood cells in the recipient and enhance the immunity of the recipient.

In some embodiments, traditional Chinese medicine fermentation broth can be used to lower blood lipids. For example, traditional Chinese medicine fermentation broth can reduce the content of low-density lipoprotein cholesterol (LDL-C) in receptors, and reduce the ratio of total cholesterol/high-density lipoprotein cholesterol (T.CHOL/HDL), which is an index of arteriosclerosis, to Reduce the recipient's risk of cardiovascular disease and prevent an increased risk of arteriosclerosis.

Based on this, the traditional Chinese medicine fermented liquid of any embodiment can effectively reduce the content of biliary red in the recipient's blood, reduce the content of low-density lipoprotein cholesterol, and improve the sallowness of the skin and the feeling of fatigue after the recipient takes it. In other words, the fermented Chinese medicinal liquid in any of the examples has the effects of protecting the liver and gallbladder, regulating blood lipids, improving complexion and reducing fatigue. Moreover, the traditional Chinese medicine fermented liquid can be used to prepare a composition for refreshing and improving fatigue, a composition for protecting the liver, a composition for improving immunity, a composition for lowering blood fat, or a combination thereof.

In some embodiments, the composition can be liquid (eg, traditional Chinese medicine fermented drink, etc.) or solid (eg, powder, lozenge, etc.). In some embodiments, the dosage of the liquid composition is 5 ml/day, and the dosage of the solid composition is 0.65 g/day.

In some embodiments, any of the aforementioned compositions can be a pharmaceutical. In other words, the medicine contains an effective amount of traditional Chinese medicine fermentation liquid.

In some embodiments, the foregoing pharmaceutical products may be formulated for parenteral, parenteral, oral, or topical administration using techniques well known to those skilled in the art. Dosage form.

In some embodiments, the dosage form for enteral or oral administration can be, but not limited to, tablet, troche, lozenge, pill, capsule , dispersible powder or granule, solution, suspension, emulsion, syrup, elixir, slurry or the like. In some embodiments, the dosage form for parenteral or topical administration may be, but not limited to, injection, sterile powder, external preparation or the like. In some embodiments, the injection can be administered by subcutaneous injection, intraepidermal injection, intradermal injection or intralesional injection.

In some embodiments, the above-mentioned pharmaceuticals may include pharmaceutically acceptable carriers (pharmaceutically acceptable carriers) that are widely used in pharmaceutical manufacturing technology. In some embodiments, the pharmaceutically acceptable carrier can be one or more of the following carriers: solvent, buffer, emulsifier, suspending agent, disintegrating agent ( decomposer), disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent ), gelling agents, preservatives, wetting agents, lubricants, absorption delaying agents, liposomes, and the like. The type and amount of carrier to be used is within the expertise and routine skill of those skilled in the art. In some embodiments, the solvent as the pharmaceutically acceptable carrier can be water, normal saline, phosphate buffered saline (PBS), or aqueous solution containing alcohol (aqueous solution containing alcohol).

In some embodiments, any of the foregoing compositions may be an edible product. In other words, the edible product contains a specific content of traditional Chinese medicine fermentation liquid. In some embodiments, the edible product can be general food, health food or dietary supplement.

In some embodiments, the aforementioned edible products can be manufactured into dosage forms suitable for oral administration using techniques well known to those skilled in the art. In some embodiments, the aforementioned general food may be the edible product itself. In some embodiments, general foods may be, but not limited to: beverages, fermented foods, bakery products or seasonings.

In some embodiments, the obtained traditional Chinese medicine fermentation liquid can be further used as a food additive to prepare a food composition containing the traditional Chinese medicine fermentation liquid. Here, the traditional Chinese medicine fermentation liquid of any embodiment can be added during raw material preparation by conventional methods, or the traditional Chinese medicine fermentation liquid of any embodiment can be added during the food production process, and prepared with any edible material into edible products (i.e. food compositions) intended for consumption by humans and non-human animals.

example 1 : Preparation of traditional Chinese medicine fermentation liquid

First, prepare 1 part by weight of Cordyceps militaris, 1 part by weight of ginseng, 1 part by weight of Psaudotium auricularis, 1 part by weight of Poria cocos and 50 parts by weight of water, and mix them uniformly to form a traditional Chinese medicine base liquid. Next, after adding 10% glucose of the total weight of the Chinese medicine base liquid to the Chinese medicine base liquid, the Chinese medicine base liquid containing glucose was heated to 95° C. and left at 95° C. for 1 hour to form a Chinese medicine extract. Here, the above-mentioned Cordyceps militaris, ginseng, auricularia niaupixiao, and Poria cocos are all dried Chinese medicinal materials purchased from a Chinese medicine store.

After standing still, add 0.1% beer yeast ( Saccharomyces cerevisiae ) (registration number: BCRC20271) to the traditional Chinese medicine extract after cooling down to less than 38°C, and ferment at 30°C for 1 day to form the first primary fermentation liquid. 0.05% of Lactobacillus plantarum TCI999 ( Lactobacillus plantarum TCI999) (registration number BCRC910808, international deposit number DSM33106) was added to the first primary fermentation broth, and fermented at 30°C for 1 day to form a second primary fermentation broth. Next, 5% of acetic acid bacteria ( Acetobacter aceti ) (registration number BCRC11688) was added to the second primary fermentation liquid, and fermented at 30° C. for 5 days to form a third primary fermentation liquid. Here, the pH value of the third primary fermentation broth is 3.4±0.5, and its sugar content is less than 3.5°Bx.

Next, after filtering the third primary fermentation liquid with 200 mesh, it was concentrated under reduced pressure at 60° C. to obtain a traditional Chinese medicine fermentation liquid.

example 2 :total Saponin content test

Here, the solution used as a standard product is 1000ppm oleanolic acid (Oleanolic acid, brand: Sigma, number: O5504-100MG) solution, which is dissolved in methanol (Methanol, brand: JT Baker) and prepared with The serial dilution of methanol is 0ppm, 100ppm, 200ppm, 400ppm, 600ppm, 800ppm and other concentrations.

Take 100 μL of oleanolic acid solutions of various concentrations into microcentrifuge tubes, and dry the oleanolic acid solutions of various concentrations in an oven at 70°C to 85°C to make them completely dry. Next, add 100 μL of 5% vanillin (vanillin, brand: Sigma, number: A11169) to each microcentrifuge tube, and add 400 μL of perchloric acid (brand: Sigma, number: 30755-1L) and mix well , placed in a 65°C water bath for 15 minutes to form a mixed solution. Here, the 5% vanillin used is formulated with acetic acid (Acetic acid, brand: JT Baker, serial number: 9508-03).

Next, take 40 μL of the mixed solution to a 96-well plate, add 200 μL of acetic acid to each well and mix well to form a test solution, and measure its absorbance at 531 nm. Herein, a standard curve was drawn according to the measured absorbance value versus the concentration of the oleanolic acid solution.

Here, the Chinese medicine extract obtained in Example 1 was used as the test sample of the control group, and the Chinese medicine fermentation liquid prepared in Example 1 was used as the test sample of the experimental group.

Take 100 μL of the test sample into a microcentrifuge tube, and dry the test sample in an oven at 70°C to 85°C to make it completely dry. Next, 100 μL of 5% vanillin was added to each microcentrifuge tube, and 400 μL of perchloric acid was added to mix well, and then placed in a 65° C. water bath for 15 minutes to form a mixed solution.

Take 40 μL of the mixed solution to a 96-well plate, add 200 μL of acetic acid to each well and mix well to form a test solution, and measure its absorbance at 531 nm. Then, the total saponin content of the control group and the experimental group will be calculated by interpolation method according to the standard curve, as shown in FIG. 1 .

See Figure 1. The total saponin content of the control group was 1083.89 mg/mL, while that of the experimental group was 6967.33 mg/mL. In other words, the total saponin content of the experimental group was 6.43 times that of the control group. It can be seen that the total saponin content of the traditional Chinese medicine fermentation broth can be significantly increased after fermentation by multiple strains. Therefore, compared with taking the traditional Chinese medicine extract, when the recipient takes the traditional Chinese medicine fermented liquor or the composition prepared therefrom, it is helpful for the recipient to resist fatigue, refresh, anti-aging, anti-oxidation and anti-inflammation.

example 3 : Anti-inflammatory gene experiment

Here, the detected anti-inflammatory gene is IL-10 (GeneID: 3586) gene.

First, take ^1.5x105 human primary epidermal keratinocytes (Primary Normal Human Epidermal Keratinocytes, adult; ATCC PCS-200-010 ^TM ; hereinafter referred to as HEKa cells) into a six-well cell culture plate containing 2 ml of cell culture medium per well Incubate at 37°C for 24 hours. Here, the cell culture medium used is Dermal Cell Basal Medium (Dermal Cell Basal Medium; ATCC PCS-200-030 ^TM ) supplemented with Keratinocyte Growth Kit (ATCC PCS-200-040TM ).

HEK cells were divided into experimental group and control group. The cell culture medium of each group was removed and replaced with 2 mL of experimental culture medium per well, and then cultured at 37°C for 6 hours respectively. Wherein, the experimental medium of the experimental group is the cell culture medium containing the Chinese medicine fermentation liquid obtained in Example 1 of 0.25vol%. The experimental culture medium of the control group was simple cell culture medium (that is, no traditional Chinese medicine fermentation broth).

The HEK cells of each group were collected, and the RNA of each group was extracted with RNA extraction reagent kit (purchased from Geneaid Company, Taiwan, Lot No. FC24015-G). Next, each group took 1000 nanograms (ng) of RNA as a template, and reverse-transcribed the RNA into corresponding cDNA by SuperScript ^® III reverse transcriptase (purchased from Invitrogene, USA, No. 18080-051). Then by ABI StepOnePlus ^TM real-time PCR system (ABI StepOnePlus ^TM Real-Time PCR system (Thermo Fisher Scientific, USA)), KAPA SYBR FAST (purchased from Sigma, USA, number 38220000000) and the primers in Table 1 (SEQ ID NO:1 to SEQ ID NO:2) Quantitative real-time reverse transcription polymerase chain reaction (quantitative real-time reverse transcription polymerase chain reaction) was performed on the cDNA of each group to observe the expression level of IL-10 gene in HEK cells. Quantitative real-time reverse transcription-polymerase chain reaction was performed at 95°C for 20 s, followed by 95°C for 3 s, 60°C for 30 s, and 40 repeat cycles, and the 2-ΔCt method was used for genetic analysis. Quantitatively, as shown in Figure 2. Here, quantitative real-time reverse transcription polymerase chain reaction can be performed by cDNA to indirectly quantify the mRNA expression level of the gene, and then infer the expression level of the protein encoded by the gene.

It should be noted that the gene expression in Figure 2 is presented as a relative expression magnification, where the standard deviation is calculated using the STDEV formula of Excel software, and the statistically significant difference between the groups is statistically analyzed by the Student's t-test . In Fig. 2, "***" means that the p-value is less than 0.001 compared with the control group.

Table 1 target gene Primer name serial number sequence Primer length IL-10 IL-10_F SEQ ID NO:1 TCAAGGCGCATGTGAACTCC 20 IL-10_R SEQ ID NO:2 GATGTCAAACTCACTCATGGCT twenty two

In Table 1, F is Forward primer, and R is Reverse primer.

See Figure 2. The relative expression level of each group of IL-10 genes in the control group was regarded as 1.00 (that is, the expression level of each group of genes in the control group was 100%). Compared with the control group, the relative expression of IL-10 gene in the experimental group was 11.47. Here, the expression level of the IL-10 gene in the experimental group was significantly increased, which means that the traditional Chinese medicine fermentation broth can effectively increase the expression level of the IL-10 gene. In other words, when the recipient takes the traditional Chinese medicine fermented liquid, it can increase the expression of IL-10 gene, thereby achieving the anti-inflammatory function, and preventing the liver and other organs in the recipient from causing pathological changes due to long-term inflammation and achieving the effect of protecting the liver.

example 4 : Liver fat synthesis related gene experiment

Here, the detected genes related to liver fat synthesis include SREBP-1c (SREBF1; GeneID: 6720) gene and SCD1 (SCD; GeneID: 20249) gene. These two genes are genes that promote liver fat synthesis.

The cell culture medium used was DMEM medium ( Dulbecco's modified Eagle's medium; Gibco, No. 11965-092). The cell culture medium used to promote the formation of oil droplets (OA-BSA conjugated medium; hereinafter referred to as OA medium) is a cell culture medium containing oleic acid (Oleic acid; Sigma; Cat. O1088-5G) solution (hereinafter referred to as OA solution) , where the OA solution is oleic acid dissolved in dimethylsulfoxide (DMSO).

First, ^2x105 human liver cancer cells (ATCC; Cat. HB-8065; hereinafter referred to as HepG2 cells) were inoculated into six-well cell culture plates containing 2 ml of cell culture medium per well, and cultured at 37°C for 24 hours.

After the HepG2 cells were attached to the bottom of the six-well culture dish, the HepG2 cells were divided into the experimental group and the control group. The cell culture medium of each group was removed and replaced with 2 mL of experimental culture medium per well, and then cultured at 37° C. for 24 hours. Wherein, the experimental culture medium of the experimental group is the cell culture medium containing the Chinese medicine fermentation liquid obtained in Example 1 of 0.025 mg/mL. The experimental culture medium of the control group was simple cell culture medium (that is, no traditional Chinese medicine fermentation broth).

Next, the experimental medium of each group was removed and replaced with 2 mL of OA medium per well to promote the formation of oil droplets in HepG2 cells, and then cultured at 37°C for 24 hours.

The HepG2 cells of each group were collected, and the RNA of each group was extracted with the RNA extraction reagent kit (purchased from Geneaid Company, Taiwan, Lot No. FC24015-G). Next, each group took 1000 nanograms (ng) of RNA as a template, and reverse-transcribed the RNA into corresponding cDNA by SuperScript ^® III reverse transcriptase (purchased from Invitrogene, USA, No. 18080-051). Then by ABI StepOnePlus ^TM real-time PCR system (ABI StepOnePlus ^TM Real-Time PCR system (Thermo Fisher Scientific company, the United States)), KAPA SYBR FAST (purchased from Sigma company, the United States, No. 38220000000) and the primers in Table 2 (SEQ ID NO:3 to SEQ ID NO:6) Quantitative real-time reverse transcription polymerase chain reaction (quantitative real-time reverse transcription polymerase chain reaction) was performed on the cDNA of each group to observe the expression of SREBP-1c gene and SCD1 gene in HepG2 cells . Quantitative real-time reverse transcription-polymerase chain reaction instrument set-up conditions were 95°C for 20 seconds, followed by 95°C for 3 seconds, 60°C for 30 seconds, and repeated 40 cycles, and the gene was performed using the 2-ΔCt method Quantitatively, as shown in Figure 3. Here, quantitative real-time reverse transcription polymerase chain reaction can be used to quantitatively quantify the mRNA expression level of a gene, and then infer the expression level of the protein encoded by the gene.

It should be noted that the gene expression in Figure 3 is presented as a relative expression magnification, and the standard deviation is calculated using the STDEV formula of Excel software, and the statistically significant difference between the groups is statistically analyzed by the Student's t-test . In Figure 3, "*" means that the p-value is less than 0.05 compared with the control group, and "***" means that the p-value is less than 0.001 when compared with the control group.

Table 2 target gene Primer name serial number sequence Primer length SREBP-1c SREBP-1c_F SEQ ID NO:3 GCCATCGACTACATTCGCTTTC twenty two SREBP-1c_R SEQ ID NO:4 CCTCCATGAGCACGTCTGTGT twenty one SCD1 SCD1_F SEQ ID NO:5 CAGCCCCCTGGAAAGTGAT 19 SCD1_R SEQ ID NO:6 CGTCTCCAACTTATCTCCCCATT twenty four

In Table 2, F is Forward primer, and R is Reverse primer.

See Figure 3. The relative expression level of each group of liver fat synthesis-related genes in the control group was regarded as 1.00 (that is, the expression level of each group of genes in the control group was 100%). Compared with the control group, the relative expression of the SREBP-1c gene in the experimental group was 0.72, and the relative expression of the SCD1 gene in the experimental group was 0.23. Here, the expression levels of SREBP-1c gene and SCD1 gene in the experimental group were significantly suppressed compared with the control group, which means that the traditional Chinese medicine fermentation broth can effectively inhibit the genes related to liver fat synthesis. In other words, when the recipient takes the traditional Chinese medicine fermentation liquid, the expression of SREBP-1c gene and/or SCD1 gene can be suppressed, thereby avoiding the occurrence of fatty liver symptoms.

example 5 : Liver damage index experiment- GPT release detection

When liver cells are damaged, glutamate pyruvate transaminase (GPT) will be released into the blood, so it can be used as an indicator of liver damage.

The cell culture medium used was supplemented with 10% fetal bovine serum (FBS; Gibco Company, No. 10437-028), 1% antibiotic-antimycotic (Gibco Company, No. 15240- 062) DMEM medium (Dulbecco's modified Eagle's medium; Gibco, No. 11965-092).

First, ^5x103 human hepatocellular carcinoma cells (Human hepatocellular carcinoma cell; ATCC; Cat. HB-8065; hereinafter referred to as HepG2 cells) were inoculated into a 96-well cell culture plate containing 0.2 ml of cell culture medium in each well, and cultured at 37°C 24 hours.

Then, HepG2 cells were divided into blank group, experimental group and control group. The cell culture medium of each group was removed and replaced with 0.2 mL of experimental culture medium per well, and then cultured at 37° C. for 24 hours respectively. Wherein, the experimental culture medium of the experimental group is the cell culture medium of the traditional Chinese medicine fermentation broth obtained in Example 1 containing 100 μM ethanol (Ethanol) and 0.025 mg/mL. The experimental medium of the control group was the cell culture medium (without traditional Chinese medicine fermentation broth) added with 100 μM alcohol. The experimental medium of the blank group was pure cell culture medium (without alcohol and traditional Chinese medicine fermentation liquid).

After the experimental medium of each group was removed and the HepG2 cells were washed with 1XPBS (Gibco; Cat. 14200-075), 0.2 mL of the first reaction solution of 500 μM hydrogen peroxide (H ₂ O ₂ ) was added to each well, and then placed at 37 °C for 6 hours. Here, the first reaction solution used is 500 μM hydrogen peroxide (H ₂ O ₂ ).

Next, 100 μL of the first reaction solution (excluding HepG2 cells; hereinafter referred to as the test solution) after the reaction was collected from each group. And, use the ELISA kit of alanine aminotransferase (ELISA Kit for Alanine Aminotransferase (ALT); USCN. Company; Cat. SEA207Hu) to measure the content of alanine aminotransferase (ALT) contained in the test solution of each group (also That is, the amount of GTP released), as shown in Figure 4.

It should be noted that the relative release of GTP in Figure 4 is presented as a percentage, and the standard deviation is calculated using the STDEV formula of the Excel software, and the statistically significant difference between the groups is statistically analyzed by the Student's t-test . In Fig. 4, "*" means that the p-value is less than 0.05 compared with the control group.

See Figure 4. The relative release of GPT in the blank group was regarded as 100%. Compared with the blank group, the relative release of GPT in the control group was 119.0%, while the relative release of GPT in the experimental group was 110.8%. Here, the control group represents the release of GPT from HepG2 cells that were injured and died under the action of alcohol, and the experimental group represents the release of GPT after the death of HepG2 cells under the action of traditional Chinese medicine fermentation broth. Therefore, the relative release of GPT in the experimental group was significantly lower than that in the control group, which means that the traditional Chinese medicine fermentation broth can reduce the death rate of HepG2 cells, thereby reducing the release of GPT. In other words, when the recipient takes traditional Chinese medicine fermentation liquid, it can protect liver cells and reduce the possibility of liver damage (such as alcohol damage to liver cells when the liver is hangover), thereby avoiding diseases such as chronic hepatitis caused by long-term liver damage, and Achieve liver protection effect.

example 6 : Immunity related gene experiment

Here, the detected immunity-related genes include IL-1B (GeneID: 3553) gene, IL-6 (GeneID: 3569) gene and IL-8 gene (GeneID: 3576).

First, take ^1.5x105 human primary epidermal keratinocytes (Primary Normal Human Epidermal Keratinocytes, adult; ATCC PCS-200-010 ^TM ; hereinafter referred to as HEKa cells) into a six-well cell culture plate containing 2 ml of cell culture medium per well Incubate at 37°C for 24 hours. Here, the cell culture medium used is Dermal Cell Basal Medium (Dermal Cell Basal Medium; ATCC PCS-200-030 ^TM ) supplemented with Keratinocyte Growth Kit (ATCC PCS-200-040TM ).

HEK cells were divided into experimental group and control group. The cell culture medium of each group was removed and replaced with 2 mL of experimental culture medium per well, and then cultured at 37°C for 6 hours respectively. Wherein, the experimental medium of the experimental group is the cell culture medium containing the Chinese medicine fermentation liquid obtained in Example 1 of 0.25vol%. The experimental culture medium of the control group was simple cell culture medium (that is, no traditional Chinese medicine fermentation broth).

The HEK cells of each group were collected, and the RNA of each group was extracted with RNA extraction reagent kit (purchased from Geneaid Company, Taiwan, Lot No. FC24015-G). Next, each group took 1000 nanograms (ng) of RNA as a template, and reverse-transcribed the RNA into corresponding cDNA by SuperScript ^® III reverse transcriptase (purchased from Invitrogene, USA, No. 18080-051). Then by ABI StepOnePlus ^TM real-time PCR system (ABI StepOnePlus ^TM Real-Time PCR system (Thermo Fisher Scientific, USA)), KAPA SYBR FAST (purchased from Sigma, USA, number 38220000000) and the primers in Table 3 (SEQ ID NO:7 to SEQ ID NO:12) Quantitative real-time reverse transcription polymerase chain reaction (quantitative real-time reverse transcription polymerase chain reaction) was performed on the cDNA of each group to observe the IL-1B gene, IL-6 gene and Expression of IL-8 gene. Quantitative real-time reverse transcription-polymerase chain reaction was performed at 95°C for 20 s, followed by 95°C for 3 s, 60°C for 30 s, and 40 repeat cycles, and the 2-ΔCt method was used for genetic analysis. Quantitatively, as shown in Figure 5. Here, quantitative real-time reverse transcription polymerase chain reaction can be performed by cDNA to indirectly quantify the mRNA expression level of the gene, and then infer the expression level of the protein encoded by the gene.

It should be noted that the gene expression in Figure 5 is presented as a relative expression magnification, and the standard deviation is calculated using the STDEV formula of Excel software, and the statistically significant difference between the groups is statistically analyzed by the Student's t-test . In Fig. 5, "***" means that the p-value is less than 0.001 compared with the control group.

table 3 target gene Primer name serial number sequence Primer length IL-1B IL-1B_F SEQ ID NO:7 TCTTCATTGACCAAGGAAATCGG twenty three IL-1B_R SEQ ID NO:8 TCCGGGGTGCATTATCTCTAC twenty one IL-6 IL-6_F SEQ ID NO:9 CCACGGCCTTCCCCTACTTC 19 IL-6_R SEQ ID NO:10 CAGATTGTTTTCTGCAAGTGCAT twenty three IL-8 IL-8_F SEQ ID NO: 11 TTTTGCCAAGGAGTGCTAAAGA twenty two IL-8_R SEQ ID NO:12 AACCCCTCTGCACCCCAGTTTTTC twenty one

In Table 3, F is a forward primer, and R is a reverse primer.

See Figure 5. The relative expression of IL-1B gene, IL-6 gene and IL-8 gene in the control group was regarded as 1.00 (that is, the expression of each gene in the control group was 100%). Compared with the control group, the relative expression of the IL-1B gene in the experimental group was 5.95, the relative expression of the IL-6 gene in the experimental group was 5.15, and the relative expression of the IL-8 gene in the experimental group was 3.83. Here, the expression levels of the IL-1B gene, IL-6 gene and IL-8 gene in the experimental group were all significantly increased, which means that the traditional Chinese medicine fermentation broth can effectively increase the IL-1B gene, IL-6 gene and IL-8 gene. gene expression. In other words, when the recipient takes the traditional Chinese medicine fermented liquid, the expression level of at least one gene among IL-1B gene, IL-6 gene and IL-8 gene can be increased, and then the immunity of the recipient can be improved.

example 7 : human experiment

Here, 40wt% of the traditional Chinese medicine fermentation broth prepared in Example 1 was mixed with 60wt% isomaltooligosaccharide to form a traditional Chinese medicine fermentation solution, and 5mL of the plant fermentation solution was prepared with water to prepare 50mL of a Chinese medicine fermented beverage.

Subjects: 10 subjects (male and female aged 20-55). Among them, the age of the subjects ranged from 20 to 55 years old, and their daily routines were those who often stayed up late, were prone to fatigue, or had a high liver index (blood measurement AST > 39 or ALT > 41).

Test items: total bilirubin in blood (liver function index), low-density cholesterol content in blood (blood lipid index), total cholesterol/high-density lipoprotein cholesterol ratio (also known as arteriosclerosis index; blood lipid index), sallow skin color, Somatosensory questionnaire.

Test method: 10 subjects drank 5mL of traditional Chinese medicine fermented drink every day, and drank it continuously for 4 weeks. Before drinking (i.e. week 0), after drinking for 2 weeks (i.e. the 2nd week) and after drinking for 4 weeks (i.e. the 4th week), blood samples were taken from the subjects to detect the liver function indicators and blood lipids of the subjects Index values, and use a smart 3D skin detector (Antera3D ^® instrument, Miravex company; the detection accuracy is within ±5% error value) to detect the subject's skin, and use a questionnaire to evaluate the subject's body sensation.

It should be noted that "*" in the graph means that the p value is less than 0.05 compared with week 0. "**" means that the p-value compared with week 0 is less than 0.01, and "***" means that the p-value compared with week 0 is less than 0.001.

Please refer to Figure 6. The average total bilirubin measured in the blood of the 10 subjects decreased from 1.1 mg/dL (week 0) to 1.0 mg/dL (week 2) to 0.9 mg / Gonghe (week 4). In other words, the total bilirubin in the blood of these subjects can be reduced by 18.2% compared with before taking it (week 0) after drinking the traditional Chinese medicine fermented drink containing traditional Chinese medicine fermented liquid for 4 weeks. Generally speaking, the reference value of total bilirubin as an index of liver function is 0.3 mg/deg to 1.0 mg/deg, so taking Chinese herbal fermented drinks can restore the subject's liver index to the normal range. It can be seen that long-term use of Chinese herbal fermented liquid can improve the condition of the recipient's liver, that is, Chinese herbal fermented liquid has the effect of protecting the liver.

See Figure 7. The average sallowness of the skin detected by the smart 3D skin detector of 10 subjects before taking it (week 0) is regarded as 100%. After 2 weeks of continuous drinking, the average skin sallowness of the subjects was 94.3%, and after 4 weeks of continuous drinking, the average skin sallowness decreased to 92.8%. In other words, compared with before taking it (week 0), continuous drinking of Chinese herbal fermented drinks containing Chinese herbal fermented liquid for 4 weeks can reduce the sallowness of the skin of these subjects by 7.2%. It can be seen that the long-term use of traditional Chinese medicine fermented liquid can reduce the total bilirubin of the subjects, and improve the subjects' sallow skin, poor complexion and other problems, that is, the traditional Chinese medicine fermented liquid has the functions of protecting the liver, nourishing the mind, and improving the complexion.

Please refer to Figure 8. The average low-density lipoprotein cholesterol levels in the blood detected by the 10 subjects dropped from 113.43 mg/dL (week 0) to 111.25 mg/dL (week 2), and then decreased to 109.18 mg/kg (4th week). In other words, compared with before taking it (week 0), drinking the traditional Chinese medicine fermented drink containing traditional Chinese medicine fermented liquid for 4 weeks can reduce the low-density lipoprotein cholesterol content in the blood of these subjects by 3.7%. It can be known that long-term use of traditional Chinese medicine fermented liquid can reduce the level of low-density lipoprotein cholesterol in the recipient's blood, and prevent the level of low-density lipoprotein cholesterol from exceeding the standard, that is, the traditional Chinese medicine fermented liquid has the effect of lowering blood lipids.

Please refer to Figure 9. The mean total cholesterol/HDL cholesterol ratio in the blood measured by the 10 subjects decreased from 4.17 (week 0) to 3.89 (week 2) and 3.92 at week 4 (week 4). In other words, compared with before taking (week 0), continuous consumption of Chinese herbal fermented drinks containing Chinese herbal fermented liquid for 4 weeks can reduce the ratio of total cholesterol/high-density lipoprotein cholesterol by 0.25 (ie 4.17-3.92=0.25). It can be seen from this that long-term use of traditional Chinese medicine fermented liquid can reduce the ratio of total cholesterol/high-density lipoprotein cholesterol in the recipient's blood, and prevent the risk of arteriosclerosis from increasing, that is, the traditional Chinese medicine fermented liquid has the effect of lowering blood lipids.

In addition, the subjects filled out the somatosensory questionnaires at week 0, week 2, and week 4, which included surveys on living habits and physical conditions. The subjects first passed the survey of living habits (for example: whether they drink sugary drinks, whether they have drinking habits, whether they take drugs, whether they take liver-protecting health food, whether they have a family history of liver disease or have suffered from liver-related diseases, whether they have After staying up late, the length of sleep, etc.), then according to the physical condition (such as: fatigue level, mental condition after rest, work efficiency, sleep quality, mood, eye white color, skin color, appetite condition, digestive condition, oral condition, skin condition , urine color, etc.) for severity assessment, as shown in Table 4.

Table 4 Physical Condition Survey symptom severity None (1) slight (2) Obvious (3) severe (4) very serious (5) 1. Often feel tired 2. Having plenty of rest but still lacking energy 3. Poor sleep quality (difficulty falling asleep, dreaming more, waking up easily) 4. Reduced work efficiency 5. Emotional abnormalities (irritability, easily irritable, anxious) 6. The whites of the eyes are yellowish 7. Yellowish and itchy skin 8. Loss of appetite, less able to eat 9. Indigestion, feeling that food accumulation is difficult to digest 10. Feel nauseous, nauseous, or want to vomit easily 11. Dry mouth easily 12. Distinct odor in the mouth 13. Spider nevus and erythema appear on the skin 14. The color of the urine becomes darker and darker in color

In Table 4, "none" represents 1 point, "slight" represents 2 points, "obvious" represents 3 points, "severe" represents 4 points, and "very serious" represents 5 points.

See Figure 10. Before taking it (week 0), the average severity score of "reduced work efficiency" among the 10 subjects was 2.10. The severity score was 2.11, and after 4 weeks of continuous drinking (that is, week 4), the average severity score for "reduced work efficiency" dropped to 1.80. In other words, compared with before taking it (week 0), after drinking the Chinese herbal fermented drink containing Chinese herbal fermented liquid continuously for 4 weeks, 10 subjects could reduce their feeling of "reduced work efficiency" to below "slight", which means Traditional Chinese medicine fermentation liquid can improve the spirit of the recipient and improve the work efficiency of the recipient.

Before taking it (week 0), the average severity score of "poor sleep quality" among the 10 subjects was 2.20. The average severity score dropped to 2.11, and after 4 weeks of continuous drinking (that is, the 4th week), the average severity score of "poor sleep quality" dropped to 1.70. In other words, compared with before taking it (week 0), after drinking the Chinese herbal fermented drink containing Chinese herbal fermented liquid continuously for 4 weeks, 10 subjects could reduce their perception of "poor sleep quality" to below "slight", that is, Representative traditional Chinese medicine fermentation liquid can improve the sleep quality of the recipient.

Before taking it (week 0), the average severity score of the 10 subjects for "enough rest but lack of energy" was 2.70. The average severity score of "no energy" was 2.67, and after 4 weeks of continuous drinking (that is, the 4th week), the average severity score of "enough rest but no energy" dropped to 1.90. In other words, compared with before taking it (week 0), after 4 weeks of continuous drinking of Chinese herbal fermented beverages containing Chinese herbal fermented liquid, the feeling of "enough rest but no energy" in 10 subjects can be reduced from close to "obviously" To "slight", it means that the traditional Chinese medicine fermentation liquid can improve the mental state of the recipient.

Before taking it (week 0), the average severity score of "frequently feeling tired" among the 10 subjects was 3.20. The severity score dropped to 2.89, and after 4 weeks of continuous drinking (that is, the 4th week), the average severity score of "frequently feeling tired" dropped to 2.20. In other words, compared with before taking it (week 0), after 4 weeks of continuous consumption of Chinese herbal fermented beverages containing Chinese herbal fermented liquid, the feeling of "frequently feeling tired" in 10 subjects can be reduced from "significant" to "slight" , which means that the traditional Chinese medicine fermentation liquid can improve the fatigue of the recipient.

It can be seen that long-term use of traditional Chinese medicine fermentation liquid can improve the fatigue of the recipient and improve the spirit of the recipient.

In summary, according to any embodiment of the present invention, the traditional Chinese medicine fermentation liquid can be used to prepare refreshing and fatigue-improving compositions, liver-protecting compositions, immunity-enhancing compositions, blood-lipid-lowering compositions or combinations thereof . In other words, the aforementioned composition has one or more of the following functions: increase the expression of IL-10 gene to resist inflammation, reduce the expression of genes related to liver fat synthesis (SREBP-1c gene and SCD1 gene) to inhibit the formation of fatty liver, reduce the total Bilirubin content, improve skin sallowness, increase IL-8 gene expression to promote leukocyte differentiation, increase IL-1B gene expression to activate leukocyte activity, increase IL-6 gene expression to activate lymphocytes and increase antibody production, and reduce lipid density Protein cholesterol content, lower total cholesterol/high-density lipoprotein cholesterol ratio, and improve fatigue. And, the total saponin content of the traditional Chinese medicine fermentation broth of any embodiment is at least greater than 6000ug/mL.

Although the technical content of the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any modification and modification made by those skilled in the art without departing from the spirit of the present invention should be covered by the present invention. Therefore, the scope of protection of the present invention should be defined by the scope of the appended patent application.

none

Fig. 1 is the data graph of the total saponin content in the traditional Chinese medicine fermented liquid; Figure 2 is a diagram of the experimental results of anti-inflammatory genes; Fig. 3 is a graph showing experimental results of fatty liver synthesis-related genes; Figure 4 is an experimental result diagram of the relative release of GPT after liver cell damage; Figure 5 is a diagram of the experimental results of immune-related proteins; Fig. 6 is the experimental data diagram of the content of total bilirubin in recipient's blood; Fig. 7 is the experimental data diagram of the sallowness degree of the skin of the receptor; Figure 8 is an experimental data diagram of the low-density lipoprotein cholesterol content in the recipient's blood; Figure 9 is an experimental data graph of the ratio of total cholesterol/high-density lipoprotein cholesterol in the recipient's blood; and Fig. 10 is a data analysis diagram of the fatigue scoring questionnaire.

Claims (15)

A traditional Chinese medicine fermented liquid, which is obtained by fermenting a Chinese medicine extract with multiple strains, wherein the Chinese medicine extract is composed of Cordyceps militaris , Panax ginseng , Cynanchum auriculatum , and Poria cocos ( Poria cocos ) obtained by leaching with water, and the multiple strains include yeast, lactic acid bacteria and acetic acid bacteria. The Chinese medicine fermented liquid as described in Claim 1, wherein the total saponin content of the Chinese medicine fermented liquid is at least greater than 6000ug/mL. The Chinese medicine fermented liquid as described in Claim 1, wherein the total saponin content of the Chinese medicine fermented liquid is at least 6.43 times of the total saponin content of the Chinese medicine extract. The traditional Chinese medicine fermentation liquid as described in Claim 1, wherein the solid-to-liquid ratio of the Cordyceps militaris, the ginseng, the auricularia pachyrhiza, the Poria cocos and the water is 1:1:1:1:50. A traditional Chinese medicine fermented liquid is used to prepare a refreshing and fatigue-improving composition, wherein the traditional Chinese medicinal fermented liquid is obtained by fermenting a traditional Chinese medicine extract with multiple strains, and the traditional Chinese medicine extract is composed of Cordyceps militaris, ginseng, and auricularia oxhide Xiao and Poria cocos are extracted with water, and the multiple strains include yeast, lactic acid bacteria and acetic acid bacteria. A Chinese medicine fermented liquid is used to prepare a liver-protecting composition, wherein the traditional Chinese medicine fermented liquid is obtained by fermenting a Chinese medicine extract through multiple strains, and the Chinese medicine extract is composed of Cordyceps militaris, ginseng, auricularia chinensis and Poria cocos is extracted with water, and the plurality of strains include yeast, lactic acid bacteria and acetic acid bacteria. The use as described in Claim 6, wherein the traditional Chinese medicine fermentation liquid is used to reduce liver cell damage, thereby reducing the release of Glutamate Pyruvate Transaminase (GPT). The use as described in claim 6, wherein the traditional Chinese medicine fermentation broth is used to increase the expression of interleukin-10 (IL-10) gene, thereby achieving anti-inflammatory effects. The use as described in claim 6, wherein the traditional Chinese medicine fermentation broth is used to inhibit the formation of fatty liver. The use as described in claim 6, wherein the traditional Chinese medicine fermentation liquid is used to reduce the bilirubin content of a recipient's blood. The use as described in claim 10, wherein the traditional Chinese medicine fermentation liquid is used to improve the sallow skin of the recipient. A traditional Chinese medicine fermented liquid is used to prepare a composition for improving immunity, wherein the traditional Chinese medicinal fermented liquid is obtained by fermenting a traditional Chinese medicine extract through multiple bacterial strains, and the traditional Chinese medicine extract is composed of Cordyceps militaris, ginseng, and auricularia psoriasis and poria cocos are obtained by extracting with water, and the plurality of strains include yeast, lactic acid bacteria and acetic acid bacteria. The use as described in claim 12, wherein the traditional Chinese medicine fermentation liquid is used to increase the expression of at least one of the following genes of a receptor: interleukin-1B (IL-1B) gene, interleukin-6 (IL- 6) Gene and interleukin-8 (IL-8) gene. A Chinese medicine fermented liquid is used to prepare a composition for lowering blood lipids, wherein the traditional Chinese medicine fermented liquid is obtained by fermenting a Chinese medicine extract through multiple strains, and the Chinese medicine extract is composed of Cordyceps militaris, ginseng, auricularia psoriasis and Poria cocos is extracted with water, and the plurality of strains include yeast, lactic acid bacteria and acetic acid bacteria. The use as described in claim 14, wherein the traditional Chinese medicine fermentation broth is used to reduce the content of low-density lipoprotein cholesterol in a receptor.

Images