TW202245809A - Combination therapy for treating hepatitis b virus infection - Google Patents

Abstract

Described are RNA interference (RNAi) agents for inhibiting the expression of Hepatitis B Virus (HBV) used in combination with nucleic acid molecules encoding HBV surface antigens, HBV core antigens, and HBV polymerase antigens, and methods of administering same. The HBV RNAi agents and nucleic acid molecules are administered to effectively inhibit HBV gene expression and to treat HBV infections.

Description

Combination therapy for the treatment of hepatitis B virus infection

The present invention generally relates to compositions and kits comprising RNA interference (RNAi) components and RNA replicon vaccines, and their use for treating hepatitis B virus infection or inhibiting the expression of at least one hepatitis B virus gene.

Hepatitis B virus (HBV) is a hepatotropic double-stranded DNA virus. While DNA is the genetic material, the replication cycle involves the step of reverse transcription that copies pregenome RNA into DNA. Hepatitis B virus is classified as a member of the hepatitis virus family and belongs to the family Hepadnaviridae. Adult humans infected with hepatitis B virus for the first time cause acute hepatitis, with symptoms of organ inflammation, fever, jaundice and increased liver transaminase in the blood. Patients who are unable to overcome viral infection suffer from a chronic disease progression over many years, with an increased risk of developing cirrhosis or liver cancer. Perinatal transmission from hepatitis B virus-infected mothers to newborns also causes chronic hepatitis.

After uptake by hepatocytes, the nucleocapsid translocates to the nucleus and releases the DNA. There DNA strand synthesis was completed and the gap was repaired, resulting in a 3.2 kb covalently closed circular (ccc) supercoiled DNA. cccDNA serves as a template for transcription of five major viral mRNAs that are 3.5, 3.5, 2.4, 2.1 and 0.7 kb in length. All mRNAs were 5'-capped and polyadenylated at the 3' end. There is sequence overlap at the 3' end between all five mRNAs.

A 3.5 kb mRNA serves as a template for core protein and polymerase production. Additionally, the same transcript acts as a pregenome replication intermediate and allows viral polymerases to initiate reverse transcription into DNA. Core protein is required for nucleocapsid formation. Another 3.5 kb mRNA encodes the pre-core, secreted e-antigen (HBeAg). In the absence of replication inhibitors, the abundance of e-antigen in the blood correlates with hepatitis B virus replication in the liver and serves as an important diagnostic marker for monitoring disease progression.

The 2.4 and 2.1 kb mRNAs carry open reading frames ("ORFs") pre-S1, pre-S2 and S for viral large, medium and small surface antigen presentation. The s antigen is associated with infectious, intact particles. In addition, the blood of infected patients also contains non-infectious particles derived only from the s antigen, without genomic DNA or polymerase. The function of these particles is not yet fully understood. Complete and sustained depletion of detectable s antigen in the blood is considered a reliable indicator of hepatitis B virus clearance.

0.7 kb mRNA encoding protein X. This gene product is important for the efficient transcription of viral genes and also acts as a transactivator of host gene expression. The latter activity appears to be important for hepatocyte transformation during liver cancer development.

Patients with detectable s-antigen (HBsAg), e-antigen (HBeAg), and/or viral DNA in blood for more than 6 months were considered chronically infected. Chronic HBV infection can be classified into five stages: (I) HBeAg positive chronic infection, (II) HBeAg positive chronic hepatitis, (III) HBeAg negative chronic infection, (IV) HBeAg negative chronic hepatitis and (V) HBsAg negative stage. Depending on host and viral factors, all patients with chronic HBV infection are at increased risk of progression to cirrhosis and hepatocellular carcinoma (HCC) (Lampertico et al., J Hepatol ., 2017, 67(2):370-398 ). Currently, a complete sterilizing treatment (ie eradication of the virus from the host) is not feasible (Lok et al., J Hepatol ., 2017, 67(4):847-861). The main goal of therapy is to improve survival and quality of life by preventing disease progression and thus HCC development. Induced long-term suppression of HBV replication represents the main evaluation index of current treatment strategies, and HBsAg loss is the best evaluation index.

Nucleoside analogs that are inhibitors of reverse transcriptase activity are often the first treatment option for many patients. Long-term administration of lamivudine, tenofovir, and/or entecavir has been shown to inhibit HBV replication, sometimes to undetectable levels, with concomitant improvements in liver function and Reduction of hepatitis is often seen as the most important benefit. However, only very few patients achieve complete and sustained remission after treatment ends. In addition, HBV develops drug resistance with increasing duration of treatment. This is especially difficult for patients co-infected with hepatitis B and human immunodeficiency virus (HIV). Both viruses are sensitive to nucleoside analogue drugs and can simultaneously develop resistance.

Pegylated interferon-alpha (IFN) has been used to treat patients with mild to moderate chronic hepatitis B. However, current treatments for chronic hepatitis B have limited efficacy (Erha et al., Gut . 2005 Jul; 54(7): 1009-1013). For example, Asian genotype B produced a very poor response rate. Co-infection with hepatitis D virus (HDV) or human immunodeficiency virus has been shown to render interferon-alpha therapy completely ineffective. Patients with severe liver damage and severe fibrotic conditions are not suitable for interferon-α therapy.

Certain hepatitis B virus-specific RNA interference (RNAi) agents have previously been shown to inhibit the expression of HBV gene expression. For example, U.S. Patent Application Publication No. 2013/0005793 to Chin et al., incorporated herein by reference in its entirety, discloses certain double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of hepatitis B virus genes .

Several combinations of treatments for HBV have been attempted in various settings (Paul, Curr Hepat Rep . 2011 Jun; 10(2): 98-105). However, various combination therapies for HBeAg-positive chronic HBV or HBeAg-negative hepatitis B have not yet developed a benefit over monotherapy. Ditto.

There is a need for improved HBV therapies that overcome at least one of the disadvantages of existing treatment options, such as toxicity, mutagenicity, lack of selectivity, poor efficacy, poor Bioavailability and Synthetic Difficulty.

The disclosures of all publications, patents, patent applications, and published patent applications mentioned herein are hereby incorporated by reference in their entirety.

Provided herein is a method for treating hepatitis B virus (HBV) infection in an individual, enhancing the immune response of an individual suffering from hepatitis B virus (HBV) infection, reducing viral replication in an individual suffering from hepatitis B virus (HBV) infection, reducing Expression of one or more hepatitis B virus (HBV) polypeptides (more specifically one or more polypeptides selected from HBsAg and HBeAg) and/or increased hepatitis B virus (HBV) infection in individuals in need A method of targeted killing of liver cells comprising integrated viral DNA or extrachromosomal DNA in an individual of the present invention, wherein the method comprises administering to the individual: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense stock comprises the nucleotide sequence of any one of the following: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 111; (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

In some embodiments, the method further comprises administering to the individual another agent that treats an infection caused by the hepatitis B virus HBV. The other agent may be a nucleoside analog. In some embodiments, the nucleoside analog is entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide, lamivudine , telbivudine, or a combination thereof.

In some embodiments, the other agent is a nucleic acid polymer (NAP). The NAP may eg be selected from REP2139 or REP2165. REP2139 has the sequence (A,5'MeC) ₂₀ with each bond phosphorothioated and each ribose 2'0 methylated (which is disclosed in WO2016/04525, the contents of which are incorporated herein by reference in its entirety as SEQ ID NO: 10). REP2165 has the sequence (A,5'MeC) ₂₀ where the ribose is 2'OH with each bond phosphorothioated and 2'0 methylated on every ribose except the adenosine at positions 11, 21 and 31 (It is disclosed as SEQ ID NO: 13 in WO2016/04525).

NAP can also be other exemplary nucleic acid polymers, including but not limited to REP2006, REP2031, REP2055, STOPS ^™ (oligonucleotide polymers that inhibit S-antigen transport), and disclosed in Patent Application Publication No. WO200424919, WO201221985 and WO202097342 and US Patent Nos. 7,358,068, 8,008,269, 8,008,270 and 8,067,385, the contents of each of which are incorporated herein by reference in their entirety.

In some embodiments, the individual has chronic HBV infection.

Another general aspect of the application relates to a combination or kit for use in individuals in need with or without viral co-infection (for example with or without HDV and/or HCV and/or HIV co-infection, more particularly with or without at least HDV co-infection) for the treatment of HBV infection, such as chronic HBV infection (CHB), and/or for the treatment of chronic HDV infection (CHD), the combination or kit comprising: (a) a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense stock comprises the nucleotide sequence of any one of the following: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 111; (b) A pharmaceutical composition comprising an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising, ordered from the 5' end to the 3' end: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

In some embodiments, the combination or kit is for use in individuals with hepatitis B virus (HBV) infection, more specifically chronic HBV infection (CHB), with or without viral co-infection Enhance immune response, reduce viral replication and/or reduce expression of one or more hepatitis B virus (HBV) polypeptides, more particularly one or more polypeptides selected from HBsAg and HBeAg.

In some embodiments, the combination or kit further comprises another agent for treating an infection caused by the hepatitis B virus HBV. The other agent may be a nucleoside analog. In some embodiments, the nucleoside analog is entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide, lamivudine, telbivudine or a combination thereof.

In some embodiments, the other agent is a nucleic acid polymer (NAP). The NAP may eg be selected from REP2139 or REP2165. REP2139 has the sequence (A,5'MeC) ₂₀ with each bond phosphorothioated and each ribose 2'0 methylated (which is disclosed in WO2016/04525, the contents of which are incorporated herein by reference in its entirety as SEQ ID NO: 10). REP2165 has the sequence (A,5'MeC) ₂₀ where the ribose is 2'OH with each bond phosphorothioated and 2'0 methylated on every ribose except the adenosine at positions 11, 21 and 31 (It is disclosed as SEQ ID NO: 13 in WO2016/04525).

NAP can also be other exemplary nucleic acid polymers, including but not limited to REP2006, REP2031, REP2055, STOPS ^™ (oligonucleotide polymers that inhibit S-antigen transport), and disclosed in Patent Application Publication No. WO200424919, WO201221985 and WO202097342 and US Patent Nos. 7,358,068, 8,008,269, 8,008,270 and 8,067,385, the contents of each of which are incorporated herein by reference in their entirety.

Also provided herein are effective amounts of RNAi components and nucleic acid molecules comprising non-naturally occurring polynucleotides (optionally nucleoside analogs) for use in the manufacture of a medicament for the treatment of hepatitis B virus in a subject ( HBV) infection, enhancing the immune response of individuals suffering from HBV infection, reducing viral replication in individuals suffering from HBV infection, reducing one or more HBV polypeptides (more specifically selected from one or more of HBsAg and HBeAg) in individuals in need thereof Multiple polypeptides), regulate hepatitis B virus (HBV) capsid assembly or dissociation in individuals with HBV infection, and/or increase hepatocytes containing integrated viral DNA or extrachromosomal DNA in individuals with HBV infection Targeted killing of which: (a) the RNAi component comprises: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence comprising, ordered from the 5' end to the 3' end: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens It is HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen; and (c) The nucleoside analog is preferably entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide, lamivudine, telbivudine or a combination thereof.

In other embodiments, the treatment comprises a first phase followed by a second phase, and a) The first phase involves administering to the individual an RNAi component thereby reducing HBsAg to a level sufficient to allow restoration of T cell function, preferably to a serum HBsAg level of less than 1000, 100, 10 or 1 IU/mL; and b) The second stage comprises administering to the individual a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence.

In certain embodiments, the second phase does not comprise administering the RNAi component to the individual. In other embodiments, the second phase further comprises administering the RNAi component to the individual. The first treatment period may last for about 1 to 24 months, such as 1 to 12 months, 1 to 3 months, 4 to 6 months, 7 to 9 months, 10 to 12 months, or any period therebetween. The second treatment period may last from about 1 to 24 months, such as 1 to 12 months, 4 to 6 months, 7 to 9 months, 10 to 12 months, 13 to 18 months, 19 to 24 months, or any period in between. In some embodiments, the second phase comprises administering to the individual a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence and administering the RNAi component within the same treatment period. In other embodiments, the second phase comprises administering to the individual a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence and administering the RNAi component over different treatment periods, wherein administration of the RNAi component is stopped first and continued Administering a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence, e.g., for an additional month, 2 to 3 months, 4 to 5 months, 6 or more months, or any period therebetween, until until the end of the second phase.

In some embodiments, the RNAi component is administered subcutaneously or intravenously (preferably subcutaneously) in an amount of about 40-1000 mg per dose, more specifically about 40-250 mg per dose, such as about 100-200 mg, more specifically about 200 mg per dose, and it is every week, every two weeks, every 4 weeks, every month, every 2 months or every 3 months, preferably every 4 weeks or every Monthly investment.

In some embodiments, the individual achieves at least one of the following characteristics a) to e) during or after treatment with a combination according to an embodiment of the present application, more specifically one of the following characteristics a) to e) More than one, more particularly at least features a), b) and c), more particularly all of features a) to d): a) HBV replication is reduced as measured by serum HBV DNA levels, preferably serum HBV DNA levels are undetectable; b) reduced expression of one or more HBV polypeptides, preferably reduced expression of HBsAg as measured by serum HBsAg levels, preferably undetectable serum HBsAg levels; c) Enhanced HBV-specific T cell response; d) If the individual was HBeAg positive prior to treatment, HBeAg loss or HBeAg seroconversion; and e) HBsAg seroconversion, Preferably, the individual achieves a functional cure following treatment; More preferably, a clinical comparison CHB patient population (e.g., about 30-50 % of CHB patients achieve functional cure after treatment), when administered to a group of CHB patients, a greater proportion of CHB patients achieve at least one of a) to e) after treatment.

In certain embodiments, a combination according to an embodiment of the present application is used to reduce viral replication in an individual suffering from CHB, as measured by serum HBV DNA, wherein the individual is slightly affected by nucleoside/nucleoside Nucleic acid analog therapy for inhibition. The combination can also be used to reduce the expression of one or more HBV polypeptides, such as HBsAg in the serum of an individual with CHB. This combination can further be used to generate an enhanced HBV-specific T cell response in individuals with CHB, which can be enhanced in a quantitative and/or qualitative manner. An enhanced T cell response in an individual with CHB can result in one or more of the following: a) The number of HBV-specific T cells increases; b) The breadth of HBV-specific T cells increases because T cells recognize more HBV antigens; c) Enhanced function of HBV-specific T cells, because when restimulated with HBV antigens (such as HBV peptide pools), T cells secrete greater numbers of cytokines, such as multifunctional T cells; d) increased clearance of HBV-infected cells (such as cells containing cccDNA) or non-infected cells with integrated HBV DNA; and e) Individuals with CHB are functionally cured by enhancing the immune response, especially the HBV-specific T cell response.

In some embodiments, a combination according to an embodiment of the present application is used to treat an individual co-infected with CHB and another chronic infection of at least one of: hepatitis D virus (HDV); hepatitis C virus (HCV); or human immunodeficiency virus (HIV). The combination can be used in a method of reducing serum levels of HDV RNA in individuals chronically co-infected with both HBV and HDV; in a method of normalizing alanine transaminase (ALT) levels in individuals chronically co-infected with HBV and HDV; or in eradicating chronic co-infection. Methods of HDV infection of individuals infected with HBV and HDV.

In any of the methods herein or other disclosures, in one variation, the first or second RNAi agent comprises at least one modified nucleotide or at least one modified internucleoside linkage. In another variation, substantially all of the nucleotides in the first and second RNAi agents are modified nucleotides. In another variation, the first or second RNAi agent further comprises a targeting ligand that binds to the first or second RNAi agent. In one aspect, the targeting ligand comprises N-acetyl-galactamine sugar. In a particular aspect, the targeting ligand is selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), ( NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39) and (NAG39)s. In one variation, the targeting ligand is (NAG25), (NAG25)s, (NAG31 ), (NAG31 )s, (NAG37) or (NAG37)s. In another variation, the targeting ligand binds to the sense strand of the first or second RNAi agent. In another variation, the targeting ligand binds to the 5' end of the sense strand of the first or second RNAi agent. In another variation, the first and second RNAi agents further comprise a targeting ligand that binds to each of the first and second RNAi agents. In one aspect, the targeting ligand comprises N-acetyl-galactamine sugar. In a particular aspect, the targeting ligand is selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), ( NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39) and (NAG39)s. In one variation, the targeting ligand is (NAG25), (NAG25)s, (NAG31 ), (NAG31 )s, (NAG37) or (NAG37)s. In another variation, the targeting ligand binds to the sense strand of each of the first and second RNAi agents. In another variation, the targeting ligand binds to the 5' end of the sense strand of each of the first and second RNAi agents. In yet another variation, the first and second RNAi agents independently comprise a duplex selected from the group consisting of: an antisense strand comprising SEQ ID NO: 93 and a sense strand comprising SEQ ID NO: 102; comprising Antisense shares of SEQ ID NO: 94 and meaningful shares comprising SEQ ID NO: 103; antisense shares comprising SEQ ID NO: 95 and meaningful shares comprising SEQ ID NO: 103; Antisense shares and sense shares comprising SEQ ID NO: 104; Antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 108; Antisense shares comprising SEQ ID NO: 100 and comprising SEQ ID NO: 100 The sense stock of ID NO: 109; the antisense stock comprising SEQ ID NO: 94 and the sense stock comprising SEQ ID NO: 105; and the antisense stock comprising SEQ ID NO: 100 and the antisense stock comprising SEQ ID NO: 110 There are righteous shares. In a specific variation, the first and second RNAi agents are each independently bound to a targeting ligand comprising N-acetyl-galactamine sugar, and the first and second RNAi agents independently comprise A double helix comprising groups: comprising the antisense strand of SEQ ID NO: 94 and the sense strand comprising SEQ ID NO: 103; comprising the antisense strand of SEQ ID NO: 96 and the sense strand comprising SEQ ID NO: 104 ; Antisense shares comprising SEQ ID NO: 100 and Sense shares comprising SEQ ID NO: 108; Antisense shares comprising SEQ ID NO: 94 and Sense shares comprising SEQ ID NO: 105; and Sense shares comprising SEQ ID NO: 105; : the antisense stock of 100 and the positive stock containing SEQ ID NO: 110. In yet another variation, the weight ratio of the first RNAi agent to the second RNAi agent is in the range of about 1:2 to about 5:1. In another variation, the weight ratio of the first RNAi agent to the second RNAi agent is about 2:1. In yet another variation, the molar ratio of the first RNAi agent to the second RNAi agent is in the range of about 1:2 to about 5:1. In another variation, the molar ratio of the first RNAi agent to the second RNAi agent is about 2:1. In certain aspects, first and second RNAi agents each independently bind to (NAG37)s, the first RNAi agent comprising an antisense strand comprising SEQ ID NO: 94 and a sense strand comprising SEQ ID NO: 103 strand, and the second RNAi agent comprises an antisense strand comprising SEQ ID NO: 100 and a sense strand comprising SEQ ID NO: 108.

In any of the methods herein or other disclosures, one of the first or second HBV antigen is an HBV core or HBV pol antigen.

In any of the methods herein or other disclosures, ordering the non-naturally occurring polynucleotide sequence from the 5' end to the 3' end further comprises: (4) a second IRES element or a polynucleotide sequence encoding a second self-protease peptide, which is operably linked to the 3' end of the polynucleotide sequence encoding the second HBV antigen, and (5) A polynucleotide sequence encoding a third HBV antigen, the third HBV antigen is independently selected from the group consisting of HBV core antigen, HBV pol antigen and HBV surface antigen.

In any of the methods herein or other disclosures, ordering the non-naturally occurring polynucleotide sequence from the 5' end to the 3' end further comprises: (6) a third IRES element or a polynucleotide sequence encoding a third autoprotease peptide, which is operably linked to the 3' end of the polynucleotide sequence encoding the third HBV antigen, and (7) A polynucleotide sequence encoding a fourth HBV antigen, the fourth HBV antigen is independently selected from the group consisting of HBV core antigen, HBV pol antigen and HBV surface antigen.

In any of the methods herein or other disclosures, each of the first, second, third and fourth HBV antigens are different from each other.

In any of the methods herein or other disclosures, each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a first HBV Pre-S1 antigen comprising at least 98% identity to the amino acid sequence SEQ ID NO: 1, such as at least 98%, 98.5%, 99%, 99.1 to the amino acid sequence SEQ ID NO: 1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (ii) a second HBV Pre-S1 antigen comprising at least 98% identity to the amino acid sequence SEQ ID NO: 3, such as at least 98%, 98.5%, 99%, 99.1 to the amino acid sequence SEQ ID NO: 3 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (iii) HBV PreS2.S antigen comprising at least 98% identity to the amino acid sequence of SEQ ID NO: 5, such as at least 98%, 98.5%, 99%, 99.1%, to the amino acid sequence of SEQ ID NO: 5 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (iv) HBV core antigen comprising at least 90% identity to SEQ ID NO: 7, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96 to SEQ ID NO: 7 %, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% consistent The amino acid sequence of, preferably consists of the amino acid sequence; and (v) HBV polymerase antigen comprising at least 90% identity to SEQ ID NO: 9, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% a consensus amino acid sequence, preferably consisting of the amino acid sequence, Preferably, each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to a signal peptide, and the HBV PreS2.S antigen comprises an internal signal peptide.

In any of the methods herein or other disclosures, the HBV core antigen comprises at least 98% identity to at least one of SEQ ID NO: 84, 85 or 86, such as to SEQ ID NO: 84, 85 or 86 An amino acid sequence that is at least 98%, at least 99% or 100% identical, preferably consists of the amino acid sequence. In some embodiments, the last five C-terminal amino acids of the HBV core antigen comprise a VVR amino acid sequence, more specifically a VVRR (SEQ ID NO: 91 ) amino acid sequence, more specifically a VVRRR (SEQ ID NO: 92) Amino acid sequence.

In any of the methods herein or other disclosures, each of the HBV surface antigen, the HBV core antigen, and the HBV pol antigen comprises: (i) Consensus sequences of HBV genotypes A, B, C and D; and/or (ii) One or more of HLA-A*11:01, HLA-A*24:02, HLA-A*02:01, HLA-A*A2402, HLA-A*A0101 or HLA-B*40:01 an antigenic determinant.

In any of the methods herein or other disclosures, each of the HBV surface antigen, the HBV core antigen, and the HBV pol antigen comprises one or more epitopes of HLA-A*11:01.

In any of the methods herein or other disclosures, each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) the first HBV Pre-S1 antigen consisting of the amino acid sequence of SEQ ID NO: 1; (ii) the second HBV Pre-S1 antigen consisting of the amino acid sequence SEQ ID NO: 3; (iii) HBV PreS2.S antigen consisting of amino acid sequence SEQ ID NO: 5; (iv) HBV core antigen consisting of the amino acid sequence of SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86; and (v) HBV pol antigen consisting of the amino acid sequence of SEQ ID NO: 9, Preferably, each of the first and second HBV Pre-S1 antigen, HBV core antigen and HBV pol antigen is independently operably linked to a signal peptide, such as a signal comprising the amino acid sequence of SEQ ID NO: 77 peptide.

In any of the methods herein or other disclosures, each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a polynucleotide sequence encoding a first HBV Pre-S1 antigen having at least 90% identity to SEQ ID NO: 2, such as at least 90%, 91%, 92%, 93% to SEQ ID NO: 2 , 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9% or 100% identical sequences; (ii) a polynucleotide sequence encoding a second HBV Pre-S1 antigen having at least 90% identity with SEQ ID NO: 4, such as at least 90%, 91%, 92%, 93% with SEQ ID NO: 4 , 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9% or 100% identical sequences; (iii) a polynucleotide sequence encoding the HBV PreS2.S antigen having at least 90% identity with SEQ ID NO: 6, such as at least 90%, 91%, 92%, 93%, 94 with SEQ ID NO: 6 %, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical sequences; (iv) a polynucleotide sequence encoding HBV core antigen having at least 90% identity with SEQ ID NO: 8, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , 99.9% or 100% identical sequences; and (v) a polynucleotide sequence encoding an HBV pol antigen having at least 90% identity to SEQ ID NO: 10, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , 99.9% or 100% identical sequences; Preferably, the polynucleotide sequences encoding each of the first and second HBV Pre-S1 antigens, the HBV core antigen and the HBV pol antigen are independently operably linked to a polynucleotide encoding a signal peptide Nucleotide sequence, and the HBV PreS2.S antigen contains an internal signal peptide.

In any of the methods herein or other disclosures, each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a polynucleotide sequence encoding the first HBV Pre-S1 antigen consisting of the sequence SEQ ID NO: 2; (ii) a polynucleotide sequence encoding a second HBV Pre-S1 antigen consisting of the sequence SEQ ID NO: 4; (iii) A polynucleotide sequence encoding HBV PreS2.S antigen consisting of the sequence SEQ ID NO: 6; (iv) a polynucleotide sequence encoding HBV core antigen consisting of any one of the sequences SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89; and (v) a polynucleotide sequence encoding HBV pol antigen consisting of the sequence SEQ ID NO: 10; Preferably, the polynucleotide sequence encoding each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to a polynucleotide encoding a signal peptide Nucleotides, such as polynucleotides comprising the sequence SEQ ID NO: 90.

In any of the methods herein or other disclosures, each of the first, second, and third autoprotease peptides independently comprises a peptide sequence selected from the group consisting of: Sigiriya virus -1 2A (porcine teschovirus-1 2A; P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (Equine Rhinitis A Virus; virus 2A; T2A), cytoplasmic polyhedrosis virus 2A (cytoplasmic polyhedrosis virus 2A; BmCPV2A), silkworm softening disease virus 2A (Flacherie Virus 2A; BmIFV2A) and combinations thereof. Preferably, each of the first, second and third autoprotease peptides comprises a peptide sequence of P2A, such as the P2A sequence of SEQ ID NO: 11.

In any of the methods herein or other disclosures, each of the first, second and third IRES is derived from encephalomyocarditis virus (EMCV) or enterovirus 71 (EV71). Preferably, each of the first, second and third IRES comprises the polynucleotide sequence of SEQ ID NO: 13 or 14.

In any of the methods herein or other disclosures, the ordering of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence from the 5' end to the 3' end comprises: (1) coding has the polynucleotide sequence of the HBV Pre-S1 antigen of amino acid sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11 or has polynuclear An IRES with a nucleotide sequence of SEQ ID NO: 13 or 14, and a polynucleotide sequence encoding the HBV PreS2.S antigen with an amino acid sequence of SEQ ID NO: 5; (2) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, or the polynucleotide sequence with the polynucleotide sequence The IRES of the sequence SEQ ID NO: 13 or 14, and the polynucleotide sequence encoding the HBV Pre-S1 antigen with the amino acid sequence of SEQ ID NO: 1 or 3; (3) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding polynucleotide sequence with amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 or 3 The polynucleotide sequence of HBV Pre-S1 antigen; (4) The polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, the encoding having the amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 or 3 The polynucleotide sequence of HBV Pre-S1 antigen; (5) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, the encoding having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 84 , the polynucleotide sequence of any one of the HBV core antigens in 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the polynucleotide sequence having the amino acid sequence SEQ ID NO: 9 The polynucleotide sequence of the HBV polymerase antigen; (6) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, the encoding having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the HBV polymerase antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of HBV core antigen; (7) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, has the IRES of polynucleotide sequence SEQ ID NO: 13, coding has the amino acid sequence SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (8) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 13, the encoding having the amino acid sequence of SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (9) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen with the sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 13, the encoding with the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of any HBV core antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the HBV polymerase encoding the amino acid sequence SEQ ID NO: 9 the polynucleotide sequence of the antigen; (10) The polynucleotide sequence encoding the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the IRES having the polynucleotide sequence of SEQ ID NO: 13, the HBV polymerase encoding having the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV core having any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of the antigen; (11) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, has the IRES of polynucleotide sequence SEQ ID NO: 14, coding has the amino acid sequence SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (12) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 14, the encoding having the amino acid sequence of SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (13) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen with the sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 14, the encoding with the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of any HBV core antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the HBV polymerase encoding the amino acid sequence SEQ ID NO: 9 the polynucleotide sequence of the antigen; (14) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 14, the HBV polymerase encoding the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV core having any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of the antigen; (15) coding has the polynucleotide sequence of the HBV PreS2.S antigen of amino acid sequence SEQ ID NO: 5, has the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, codes has the amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV polymerase antigen of 9, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of any of the HBV core antigens; (16) The polynucleotide sequence encoding the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, the IRES having the polynucleotide sequence of SEQ ID NO: 14, encoding the polynucleotide sequence having the amino acid sequence of SEQ ID NO : the polynucleotide sequence of any one of the HBV core antigen in 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO : the polynucleotide sequence of the HBV polymerase antigen of 9; (17) The polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of any one of the HBV core antigens in SEQ ID NO: 84, 85 or 86, the IRES with the polynucleotide sequence of SEQ ID NO: 13 or 14, and the coded polynucleotide sequence with the amino acid sequence of SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5; (18) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding have the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and coding have the polynucleotide sequence of amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5; (19) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of the HBV polymerase antigen of sequence SEQ ID NO: 9, the polynucleotide sequence of encoding P2A amino acid sequence SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 84, 85 or the polynucleotide sequence of the HBV core antigen of any one of 86; (20) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of any one of the HBV core antigen in the sequence SEQ ID NO: 84, 85 or 86, the polynucleotide sequence of the coding P2A amino acid sequence SEQ ID NO: 11, and the coding sequence having the amino acid The polynucleotide sequence of the HBV polymerase antigen of sequence SEQ ID NO: 9; (21) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of any one of the HBV core antigens in SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen of SEQ ID NO: 5; or (22) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen of SEQ ID NO: 5, Preferably, the polynucleotide sequences encoding each of the first and second HBV Pre-S1 antigen, HBV core antigen and HBV pol antigen are independently operably linked to an encoding signal peptide, such as comprising the amino acid The polynucleotide sequence of the signal peptide of sequence SEQ ID NO:77.

In any of the methods herein or other disclosures, the nucleic acid molecule comprises any of the non-naturally occurring polynucleotide sequences SEQ ID NO: 15-54.

In any of the methods herein or other disclosures, the present application is directed to a vector comprising the non-naturally occurring polynucleotide sequence of the present application.

In any of the methods herein or other disclosures, the vector is a DNA plasmid. In another embodiment, the vector is a DNA viral vector or an RNA viral vector.

In any of the methods herein or other disclosures, the application relates to an RNA replicon sequenced from 5' to 3' comprising: (1) 5' untranslated region (5'-UTR) required for non-structural protein-mediated amplification of RNA viruses; (2) a polynucleotide sequence encoding at least one, preferably all, nonstructural proteins of the RNA virus; (3) The subgenome promoter of the RNA virus; (4) the non-naturally occurring polynucleotide sequence of this application; and (5) The 3' untranslated region (3'-UTR) required for nonstructural protein-mediated amplification of the RNA virus.

In any of the methods herein or other disclosures, the application relates to an RNA replicon sequenced from 5' to 3' comprising: (1) Alphavirus 5' untranslated region (5'-UTR), (2) 5' copy sequence of alpha virus non-structural gene nsp1, (3) downstream loop (DLP) motifs of viral species, (4) a polynucleotide sequence encoding a fourth autoprotease peptide, (5) polynucleotide sequences encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3 and nsp4, (6) alpha virus subgenome promoter, (7) The non-naturally occurring polynucleotide sequences of this application, (8) alphavirus 3' untranslated region (3' UTR), and (9) Optional polyadenosine sequence.

In any of the methods herein or other disclosures, the DLP motif is from a virus species selected from the group consisting of Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (EEEV), equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki forest virus (SFV), Pichuna virus ( Pixuna virus (PIXV), Middleburg virus (MTDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (Ross River virus; RRV), Barmah Forest virus (BF), Getah virus (GET), Lushan virus (Sagiyama virus; SAGV), Bebaru virus (BEBV), Mayaro virus ( Mayaro virus (MAYV), Una virus (U AV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV) , Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (Highland J virus; HJV), Fort Morgan virus (FMV), Ndumu (NDUV) and Buggy Creek virus.

In any of the methods herein or other disclosures, the fourth autoprotease peptide is selected from the group consisting of: Porcine Tesguvirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A ), Equine Rhinitis A Virus (ERAV) 2A (E2A), Rhinoplasty Virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Silkworm Malacia Virus 2A (BmIFV2A) and combinations thereof. Preferably, the fourth autoprotease peptide comprises the peptide sequence of P2A.

In any of the methods herein or other disclosures, the application relates to an RNA replicon sequenced from 5' to 3' comprising: (1) have the 5'-UTR of polynucleotide sequence SEQ ID NO: 55, (2) have the 5' copy sequence of polynucleotide sequence SEQ ID NO: 56, (3) DLP motif comprising polynucleotide sequence SEQ ID NO: 57, (4) a polynucleotide sequence encoding the P2A sequence of SEQ ID NO: 11, (5) Polynucleotide sequences encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3 and nsp4, respectively having nucleic acid sequences of SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 and SEQ ID NO: 61 , (6) having the subgenome promoter of polynucleotide sequence SEQ ID NO: 62, (7) the non-naturally occurring polynucleotide sequence of this application, and (8) have the 3' UTR of polynucleotide sequence SEQ ID NO: 63.

In any of the methods herein or other disclosures, the polynucleotide sequence encoding the P2A sequence comprises SEQ ID NO: 12 and the non-naturally occurring polynucleotide sequence comprises the polynucleotide sequence SEQ ID NO: 15 to any of 54, and the RNA replicon further comprises a polyadenylation sequence at the 3' end of the replicon. Preferably, the polyadenosine sequence has the sequence SEQ ID NO: 64.

In any of the methods herein or other disclosures, the application relates to an RNA replicon comprising any one of the polynucleotide sequences SEQ ID NO: 65-72.

In any of the methods herein or other disclosures, the present application relates to a nucleic acid molecule comprising a DNA sequence encoding the RNA replicon of the present application. Preferably, the nucleic acid further comprises a T7 promoter operably linked to the 5' end of the DNA sequence. More preferably, the T7 promoter comprises the nucleotide sequence of SEQ ID NO: 73.

In any of the methods or other disclosures herein, the present application relates to a pharmaceutical composition comprising the nucleic acid molecule, vector or RNA replicon of the present application, and a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition further comprises: (1) a polynucleotide sequence encoding an HBV core antigen having an amino acid sequence of any one of SEQ ID NO: 84, 85 or 86, encoding a P2A amino group The polynucleotide sequence of the acid sequence SEQ ID NO: 11 or the IRES having the polynucleotide sequence of SEQ ID NO: 13 or 14 and the coding sequence having the amino acid sequence of SEQ ID NO: 9 (preferably consisting of it) A polynucleotide sequence of an HBV polymerase antigen; or (2) a polynucleotide sequence encoding an HBV polymerase antigen having an amino acid sequence of SEQ ID NO: 9 (preferably consisting of it), encoding a P2A amine group Acid sequence SEQ ID NO: the polynucleotide sequence of 11 or have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14 and code have any one in amino acid sequence SEQ ID NO: 84,85 or 86 The polynucleotide sequence of the HBV core antigen.

In any of the methods herein or other disclosures, the present application relates to a method for vaccinating an individual against HBV comprising administering to the individual a combination of pharmaceutical compositions of the present application. In one embodiment, the method comprises administering to the individual a first composition comprising an RNAi component, a second composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens, and A third composition comprising nucleic acid molecules encoding at least one identical HBV antigen, wherein the second and third compositions comprise a prime-boost regimen. In some embodiments, the prime-boost regimen comprises a priming composition comprising the RNA replicon of the present application and a priming composition that is not an RNA replicon and encodes at least one identical HBV epitope (preferably at least one is identical to the priming composition) The enhanced composition of the carrier of the HBV antigen). In one embodiment, the boosting composition comprises Modified Vaccinia Ankara (MVA) vector, adenovirus vector or plastid vector. In some embodiments, the prime-boost regimen comprises a boosting composition comprising an RNA replicon of the present application and comprising a booster composition that is not an RNA replicon and encodes at least one identical HBV epitope (such as at least one identical HLA epitope, Preferably at least one priming composition of the carrier of the same HBV antigen as the boosting composition. In one embodiment, the priming composition comprises Modified Vaccinia Ankara (MVA) vector, adenovirus vector or plastid vector.

In another general aspect, the present application is directed to an isolated host cell comprising the nucleic acid molecule, vector or RNA replicon of the present application.

In another general aspect, the present application relates to a method for in vivo or in vitro production of an RNA replicon comprising transcripts of the nucleic acid of the present application.

Other aspects, features and advantages of the present invention will be apparent from the following disclosure, including the detailed description and preferred embodiments thereof, as well as the appended claims.

Cross References to Related Applications

This application claims priority to U.S. Provisional Application No. 63/127,430, filed December 18, 2020, the disclosure of which is incorporated herein by reference in its entirety.

The following description is presented to enable one of ordinary skill in the art to make and use various embodiments. Descriptions of specific compositions, techniques and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Accordingly, the various embodiments are not intended to be limited to the examples described and shown herein, but rather fall within scope consistent with the scope of the claims.

Prior Art Various publications, articles and patents are cited or described throughout this specification; each of these references is incorporated herein by reference in its entirety. The discussion of documents, acts, materials, devices, articles and the like contained in this specification is for the purpose of providing a context for the invention. Such discussion is not an admission that any or all of these matters form part of the prior art with respect to any invention disclosed or claimed.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition, certain terms used herein have the meanings as set forth in this specification. All patents, published patent applications and publications cited herein are hereby incorporated by reference as if fully set forth herein.

As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

Unless otherwise indicated, the term "at least" preceding a list of elements should be understood as referring to each element in the list. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The present invention is intended to cover such equivalents.

Throughout this specification and subsequent claims, unless the context requires otherwise, the word "comprise" and variations such as "comprising" and "comprising" are to be understood as implying the inclusion of a stated integer or step or A set of integers or steps does not exclude any other integer or step or any other set of integers or steps. When used herein, the term "comprising" may be replaced with the term "comprising" or "including", or sometimes when used herein, with the term "having".

When used herein, "consisting of" excludes any element, step or ingredient not specified among the claimed elements. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed item. Whenever used herein in the context of aspects or embodiments of the present application, any of the preceding terms "comprises", "comprising", "including" and "having" may be used with the term "consisting of" or "Consisting essentially of" is substituted to change the scope of the invention.

As used herein, the connective term "and/or" between multiple described elements should be understood to encompass both individual and combined options. For example, when two elements are linked by "and/or", the first option refers to the applicability of the first element, excluding the second element. The second option refers to the applicability of the second element, excluding the first element. The third option refers to the applicability of the first element together with the second element. Any of these options should be understood to be within that meaning, and thus satisfy the requirements of the term "and/or" as used herein. Simultaneous applicability of more than one of these options should also be understood within the scope of this meaning, and thus satisfy the requirements of the term "and/or".

Unless otherwise indicated, any numerical value, such as a concentration or concentration range described herein, is to be understood as modified in all instances by the term "about". Accordingly, a numerical value generally includes ±10% of the stated value. For example, a concentration of 1 mg/mL includes 0.9 mg/mL to 1.1 mg/mL. Likewise, a concentration range of 1 mg/mL to 10 mg/mL includes 0.9 mg/mL to 11 mg/mL. Unless the context clearly dictates otherwise, as used herein, the use of numerical ranges expressly includes all possible subranges, all individual values within that range, including integers within such ranges and fractions of such values.

"Conditional" or "contingent" means that the subsequently described event may or may not occur. This term covers circumstances in which an event may or may not occur.

An "epitope" as used herein is a collection of amino acid residues that form a site for recognition by an immunoglobulin, T cell receptor, or human leukocyte antigen (HLA) molecule.

HLA proteins are encoded by a group of genes that form a region called the major histocompatibility complex (MHC) located on chromosome 6 to identify the important role of proteins encoded by the MHC locus in transplant rejection. Therefore, HLA proteins are also called MHC proteins. HLA or MHC proteins are cell surface glycoproteins that bind peptides at intracellular locations and deliver them to the cell surface, where the incorporated ligands are recognized by T cells. MHC class I proteins are found on almost all nucleated cells in the body. Class I MHC proteins bind peptides present on the cytosol and form peptide-MHC protein complexes present on the cell surface, where these complexes are recognized by cytotoxic CD8+ T cells. MHC class II proteins are usually only found on antigen presenting cells such as B lymphocytes, macrophages and dendritic cells. Each MHC class I receptor consists of a variable α chain and a relatively conserved β2-microglobulin chain. Three distinct highly polymorphic class I alpha chain genes have been identified. These genes are called HLA-A, HLA-B and HLA-C. Variations in the alpha chain generate all the different MHC class I genes in the population.

As used herein, half maximal effective concentration (EC ₅₀ ) is intended to be consistent with its usual meaning in the art. More specifically, it may refer to the concentration of compound that generally induces a response between baseline and the midpoint of maximum after a specified exposure time. _EC50 values are generally used as a measure of a compound's potency, with lower values generally indicating higher potency.

As used herein, a "non-naturally occurring" nucleic acid or polypeptide refers to a nucleic acid or polypeptide that does not occur in nature. A "non-naturally occurring" nucleic acid or polypeptide may be synthesized, manipulated, manufactured and/or otherwise manipulated in a laboratory and/or manufacturing setting. In some cases, a non-naturally occurring nucleic acid or polypeptide may comprise a naturally occurring nucleic acid or polypeptide that has been treated, processed, or manipulated to exhibit properties not found in the naturally occurring nucleic acid or polypeptide prior to the treatment. As used herein, a "non-naturally occurring" nucleic acid or polypeptide can be a nucleic acid or polypeptide that is isolated or separated from the natural source in which it is found and which does not have a covalent bond to a sequence with which it is related in the natural source. A "non-naturally occurring" nucleic acid or polypeptide can be prepared recombinantly or by other means, such as chemical synthesis.

As used herein, the terms "priming composition", "priming immunization" or "priming immunization" refer to initial antigenic stimulation by using the first composition of the present invention. Specifically, as used herein, the term "priming" or "potentiating" an immune response refers to a first immunization with an antigen that induces an immune response to the desired antigen and subsequent vaccination with the same antigen. Re-immunization restores a greater degree of immune response to the desired antigen. As used herein, the terms "boosting composition", "boosting immunization" or "boosting immunization" refer to an additional immunization administered to or effective against an initial immunization to a mammal. In particular, as used herein, the term "boosting" an immune response refers to the administration of a composition that delivers the same antigen encoded in the primed immunization.

The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents , and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. It is contemplated for use in pharmaceutical compositions unless any conventional media or agent is incompatible with the active ingredient. Supplementary active ingredients can also be incorporated into the pharmaceutical compositions.

The term "pharmaceutically acceptable salt" refers to a salt of any compound or composition herein which is known to be non-toxic and which is commonly used in the pharmaceutical literature. In some embodiments, pharmaceutically acceptable salts of the compounds retain the biological effectiveness of the compounds described herein and are not biologically or otherwise undesirable. Examples of pharmaceutically acceptable salts can be found in Berge et al. Pharmaceutical Salts, J. Pharmaceutical Sciences , January 1977, 66(1), 1-19. Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric, hydrobromic, sulfuric, nitric, and phosphoric acids. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, lactic acid, oxalic acid, malic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid , benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, p-toluenesulfonic acid, stearic acid and salicylic acid. Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese and aluminum. Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines; substituted amines, including naturally occurring substituted amines; cyclic amines; and base ion exchange resins. Examples of organic bases include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine and ethanolamine. In some embodiments, the pharmaceutically acceptable base addition salt is selected from ammonium, potassium, sodium, calcium and magnesium salts.

Pharmaceutically acceptable salts according to the present invention can be prepared from parent compounds containing acidic or basic groups by conventional chemical procedures. In general, such salts can be prepared by reacting the free acid or base form of the compound with a stoichiometric amount of the appropriate base or acid in water, an organic solvent, or a mixture thereof. In general, non-aqueous media such as diethyl ether, ethyl acetate, ethanol, isopropanol, acetonitrile, etc. are preferred.

The terms "patient" and "individual" refer to a human or an ape (eg, chimpanzee, orangutan, bonobo, gorilla). In some embodiments, a patient or subject is a human being who has been or will be the subject of treatment, observation or experimentation. The combinations, compositions and methods described herein are applicable to human therapy and veterinary applications in species that may be chronically infected with HBV. In some embodiments, the individual has HBV infection, more specifically chronic HBV infection (CHB). Individuals can have CHB with or without viral co-infection. As used herein, "viral co-infection" refers to infection with at least two types of viruses. "Viral co-infection" means simultaneous infection with at least two types of viruses. A "viral co-infection" can also be a superinfection in which infection with one or more types of virus is added to a pre-existing infection with one or more other types of virus. In some embodiments, the individual has HBV-HDV co-infection, HBV-HIV co-infection, or HBV-HCV co-infection. Preferably, the individual has CHB-HDV co-infection, CHB-HIV co-infection or CHB-HCV co-infection. More preferably, the individual has a viral co-infection of CHB and chronic HDV.

As used herein, "hepatitis B virus" or "HBV" refers to a specific virus of the hepadnaviridae family. HBV is a small (eg 3.2 kb) hepatotropic DNA virus encoding four open reading frames and seven proteins. Seven proteins encoded by HBV include small (S), medium (M) and large (L) surface antigen (HBsAg) or envelope (Env) proteins, precore protein, core protein, viral polymerase (Pol) and HBx protein. HBV exhibits three surface antigens, or envelope proteins, namely L, M and S, among which S is the smallest and L is the largest, and M is medium. The L protein is encoded by the Pre-S1-Pre-S2-S domain, the M protein is encoded by the Pre-S2-S domain, and the S protein is encoded by the S domain only. The core protein is a subunit of the viral nucleocapsid. Pol is required for the synthesis of viral DNA (reverse transcriptase, RNase H and primer), which occurs in the nucleocapsid located in the cytoplasm of infected hepatocytes. PreCore is a core protein with an N-terminal signal peptide and is proteolytically processed at its N- and C-termini to the so-called hepatitis B e-antigen (HBeAg) before secretion from infected cells. The HBx protein is required for efficient transcription of covalently closed circular DNA (cccDNA). HBx is not a viral structural protein. All viral proteins of HBV have their own mRNA except for the core and polymerase which share mRNA. Except for the precore protein, none of the HBV viral proteins undergoes post-translational proteolytic processing.

HBV virions contain a single copy of the viral envelope, nucleocapsid, and part of the double-stranded DNA genome. The nucleocapsid consists of 120 core protein dimers and is covered by a lipid membrane embedded with S, M and L viral envelope or surface antigen proteins. After entry into the cell, the virus is uncoated and capsid-containing loose circular DNA (rcDNA), covalently bound to the viral polymerase, migrates into the nucleus. During this process, phosphorylation of the core protein induces structural changes that expose nuclear localization signals, enabling the capsid to interact with so-called importins. These importins mediate the association of the core protein with the nuclear pore complex, following which the capsid dissociates and the polymerase/rcDNA complex is released into the nucleus. In the nucleus, rcDNA becomes deproteinized (polymerase is removed) and converted by host DNA repair machinery into covalently closed circular DNA (cccDNA) gene bodies (further converted into minichromosomes by the addition of histones and other host factors ), where overlapping transcripts encode HBeAg, HBsAg, core protein, viral polymerase and HBx protein. Core protein, viral polymerase, and pregenomic RNA (pgRNA) associate in the cytoplasm and self-assemble into immature pgRNA-containing capsid particles that are further converted into mature rcDNA-capsid and serve as a common intermediate , are coated and secreted as infectious virions, or transported back into the nucleus to replenish and maintain a stable cccDNA pool.

So far, HBV has been divided into four major serotypes (adr, adw, ayr, ayw) based on the antigenic epitopes present on the envelope protein and into eight genotypes (A, B , C, D, E, F, G and H). HBV genotypes were distributed in different geographical regions. For example, the most prevalent genotypes in Asia are genotypes B and C. Genotype D is mainly found in Africa, the Middle East and India, while genotype A is more common in Northern Europe, sub-Saharan Africa and West Africa.

As used herein, a patient or individual suffering from "chronic hepatitis B virus (CHB) infection", "CHB", "CHB infection" or "CHB virus infection" refers to the general meaning in the art, more specifically Refers to patients or individuals chronically infected with HBV who have detectable HBsAg (with or without HBeAg) in blood six or more months after HBV detection. CHB infection can be classified into four stages, which usually, but not always, progress from one stage to the next: (I) HBeAg-positive chronic infection (formerly known as immune tolerance), (II) HBeAg-positive chronic hepatitis (formerly known as immunocompetent), (III) HBeAg-negative chronic infection (previously called inactive carrier), and (IV) HBeAg-negative chronic hepatitis (previously called reactivation). The different phases of chronic HBV infection can also be characterized by differences in viral load, liver enzyme levels (necroinflammatory activity), HBeAg or HBsAg load, or the presence of antibodies to these antigens. Even though viremia can vary significantly, cccDNA levels remain relatively constant in untreated individuals, approximately 10 to 50 copies per cell, but can be as low as per cell when suppressed by nucleoside (nucleotide) analog therapy 1 to 2 copies. Persistence of cccDNA species causes chronicity. In some embodiments, chronic HBV infection can be characterized by laboratory guidelines published by the Centers for Disease Control and Prevention (CDC), such as: (i) IgM antibodies to hepatitis B core antigen (IgM anti-HBc) negative and a positive hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), or hepatitis B virus DNA nucleic acid test, or (ii) a positive HBsAg or HBV DNA nucleic acid test, or Two HBeAg positive tests at least 6 months apart.

As defined herein, the term "therapeutically effective amount" or "effective amount" refers to an amount of each component of a combination disclosed and/or described herein sufficient to effectuate such treatment when administered to a subject in need thereof. A therapeutically effective amount will vary depending on, for example, the individual being treated and the disease condition, the weight and age of the individual, the severity of the disease condition, the particular combination and/or composition, the dosing regimen to be followed, the timing of administration, the ways, which can be easily determined by those skilled in the art. The therapeutically effective amount can be determined experimentally, for example, by analyzing the blood concentration of each component of the combination, or theoretically by calculating the bioavailability according to the present invention by those skilled in the art.

In certain embodiments of the present application, a therapeutically effective amount refers to an amount of a composition or therapeutic combination sufficient to achieve one, two, three, four or more of the following effects: (i) reducing or improving (ii) reduce the duration of HBV infection or its related symptoms; (iii) prevent the progression of HBV infection or its related symptoms; (iv) make the HBV infection or its related symptoms subside; ( v) preventing the development or onset of HBV infection or its associated symptoms; (vi) treating or combating chronic HBV infection or its associated symptoms that recurs after achieving a functional cure due to relapse; (vii) preventing HBV infection or recurrence of its associated symptoms; (viii) reduce hospitalization of individuals with HBV infection; (ix) reduce length of hospitalization of individuals with HBV infection; (x) prolong survival of individuals with HBV infection; (xi) Eliminate HBV infection in the individual; (xii) inhibit or reduce HBV replication in the individual; and/or (xiii) enhance or improve the prophylactic or therapeutic effect of another therapy.

A therapeutically effective amount may also be an amount sufficient to achieve the following combinations and/or compositions: reduction of HBsAg levels consistent with development of clinical seroconversion; sustained HBsAg clearance and reduction of infected hepatocytes by the individual's immune system; induction of HBV antigens A specifically activated T cell population; and/or a durable loss of HBsAg is achieved during or after treatment, which is then preferably maintained for 6 months or more after the end of treatment, and optimally for a lifetime. Examples of target indicators include serum HBsAg levels below a threshold such as 100 IU/mL HBsAg and/or a greater number or multipotency of HBV-specific CD8 T cell responses than, eg, at the start of treatment. Additional examples of target indicators include, but are not limited to: serum HBV DNA levels below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL, more specifically below 10 IU/mL ; serum ALT concentration less than 3 times the upper limit of normal, or less than 129 U/L in the case of a male individual, or less than 108 U/L in the case of a female individual, more specifically serum ALT A concentration of less than 120 U/L in the case of a male individual or less than 105 U/L in the case of a female individual, more specifically a serum ALT concentration of less than 90 U in the case of a male individual /L or less than 57 U/L in the case of a female individual; HBeAg negative serum; serum HBsAg level of 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, more specifically 10 IU/mL or less, which should be considered normalized; HBs seroconversion; and/or core-associated antigen (crag) below LLoQ.

The phrase "inducing an immune response" when used with reference to the methods described herein encompasses providing therapeutic immunity against a pathogen such as HBV for treatment. In one embodiment, "inducing an immune response" means generating immunity in an individual in need, eg, to provide a therapeutic effect against a disease such as HBV infection. In certain embodiments, "inducing an immune response" refers to causing or improving cellular immunity, such as HBV-specific CD4+ and CD8+ T cell responses. In certain embodiments, this T cell response results in functional cure of treated patients with CHB. In certain embodiments, "inducing an immune response" refers to causing or improving a humoral immune response against HBV infection. In certain embodiments, "inducing an immune response" refers to eliciting or improving cellular and humoral immune responses against HBV infection.

As used herein, the term "protective immunity" or "protective immune response" means that a vaccinated individual can control infection by a vaccinated pathogen. Typically, individuals who mount a "protective immune response" develop only mild to moderate clinical symptoms or are completely asymptomatic. Typically, individuals with a "protective immune response" or "protective immunity" against a pathogen will not die from infection with that pathogen.

As used herein, the term "functional cure" or "FC" refers to the state of an individual with CHB in which the individual's serum remains free of detectable HBV DNA and HBsAg after the individual ceases all HBV therapy for at least 6 months . Six months after cessation of HBV therapy, serum of FC individuals was undetectable for HBV DNA and negative for HBsAg. HBsAg loss in FC individuals may or may not be accompanied by HBsAg seroconversion. In some embodiments the FC lasts for at least 1 year, preferably at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 years. Optimally, FC lasts a lifetime.

As used herein, the term "restoration of T cell function" refers to the reactivation of exhausted and otherwise non-functional HBV-specific T cells such that they are able to perform their normal effector functions. Examples of restored HBV-specific T cell responses include, but are not limited to, killing or non-lytic control of HBV-infected hepatocytes, killing of hepatocytes with integrated HBV DNA expressing HBsAg, and once FC is achieved, subsequent Monitoring and killing of infected cells reactivated over time. The net effect is to keep the serum free of viral products such as HBV DNA, HBsAg and other HBV proteins.

As used herein, the terms and phrases "combined," "combined with," "co-delivered," and "administered with" are used in the context of administering two or more therapies or components to a subject. Refers to the simultaneous or sequential administration of two or more therapies or components, such as two vectors, eg DNA plasmids, peptides or therapeutic combinations and adjuvants. "Simultaneous administration" can be the administration of two or more therapies or components on at least the same day. When two components are "administered together" or "administered in combination", they may be combined within a short period of time, such as within 24, 20, 16, 12, 8, or 4 hours, or in separate combinations within 1 hour. The compounds are administered sequentially, or they may be administered simultaneously in a single composition. "Sequential administration" can be the administration of two or more therapies or components on the same day or on separate days. Use of the term "in combination with" does not limit the order in which the therapies or components are administered to an individual. For example, a first therapy or component (e.g., an RNAi component) can be administered before (e.g., 5 minutes to one hour before) a second therapy or component (e.g., a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence). hours), concomitantly or simultaneously with, or after (eg, 5 minutes to one hour after) administration. In some embodiments, a first therapy or component (eg, an RNAi component) and a second therapy or component (eg, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence) are administered in the same composition. In other embodiments, a first therapy or component (eg, an RNAi component) and a second therapy or component (eg, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence) are in separate compositions (such as two administered in separate compositions).

Accordingly, in another general aspect, the present application relates to a method for treating HBV infection in an individual in need thereof, comprising administering to the individual an RNAi component as described herein under 1) and as described herein A nucleic acid molecule described under 2) comprising a non-naturally occurring polynucleotide sequence.

In another general aspect, the application relates to an RNAi component as described herein under 1) for use with a non-naturally occurring polynucleotide sequence as described herein under 2) A combination of nucleic acid molecules for the treatment of HBV infection in individuals in need.

In another general aspect, the application relates to the use of an RNAi component as described herein under 1) for the manufacture of a medicament for the treatment of hepatitis B virus (HBV) infection, wherein the medicament is administered with Nucleic acid molecules comprising non-naturally occurring polynucleotide sequences as described herein under 2) are administered or will be administered in combination.

To assist readers of this application, the embodiments are divided into multiple paragraphs or sections, or refer to various embodiments of this application. Such separation should not be considered as unrelated to the gist of one paragraph or portion or embodiment from the gist of another paragraph or portion or embodiment. Rather, those skilled in the art will understand that the embodiments have broad application and encompass all conceivable combinations of various parts, paragraphs, and sentences. Discussion of any examples is intended to be illustrative only, and is not intended to limit the scope of the invention, including claims, to these examples. For example, although the embodiments of RNAi components described herein may contain certain components arranged in a particular order, those of ordinary skill in the art will appreciate that the concepts disclosed herein are equally applicable to those arranged in other orders. Other components that can be used in the RNAi of the present application. This application contemplates the use of any applicable components that can be used in this application in any combination, whether or not a particular combination is explicitly recited. The present invention generally relates to a therapeutic combination comprising one or more HBV RNAi, and a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence. combination

Provided herein is a combination comprising an effective amount of an RNAi component and an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising one or more HBV antigens, or a pharmaceutically acceptable salt thereof.

The combination of an effective amount of an RNAi component and an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence containing one or more HBV antigens can be used in an individual in need with or without viral co-infection (e.g. with or without HDV and/or HCV and/or HIV co-infection, more particularly with or without at least HDV co-infection) for the treatment of HBV infection, such as chronic HBV infection (CHB), and/or for the treatment of chronic HDV infection (CHD).

In some embodiments, the combination is used to enhance the immune response in individuals with hepatitis B virus (HBV) infection, more particularly chronic HBV infection (CHB), with or without viral co-infection , reducing viral replication and/or reducing expression of one or more hepatitis B virus (HBV) polypeptides, more particularly one or more polypeptides selected from HBsAg and HBeAg.

In some embodiments, an RNAi component is provided for use in combination with a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising one or more HBV antigens to treat Type B with or without viral co-infection Hepatitis virus infection, more specifically chronic HBV infection (CHB), and/or treatment of chronic hepatitis D virus (HDV) infection, wherein the RNAi component and comprises non-naturally occurring polynucleotides containing one or more HBV antigens A nucleic acid molecule of sequence is as defined herein, and wherein the RNAi component is optionally administered simultaneously, sequentially or separately with the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising one or more HBV antigens.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising one or more HBV antigens is provided for use in combination with an RNAi component to treat type B with or without viral co-infection Hepatitis virus infection, more particularly chronic HBV infection (CHB), and/or treatment of chronic hepatitis D virus (HDV) infection, comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising one or more HBV antigens and the RNAi component are as defined herein, and wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence comprising one or more HBV antigens is optionally administered simultaneously, sequentially or separately from the RNAi component. Hepatitis B virus (HBV)

As used herein, "hepatitis B virus" or "HBV" refers to a virus of the hepadnaviridae family. HBV is a small (eg 3.2 kb) hepatotropic DNA virus encoding four open reading frames and seven proteins. Seven proteins encoded by HBV include small (S), medium (M) and large (L) surface antigen (HBsAg) or envelope (Env) proteins, precore protein, core protein, viral polymerase (Pol) and HBx protein. HBV exhibits three surface antigens, or envelope proteins, namely L, M and S, among which S is the smallest and L is the largest. The extra domains in the M and L proteins are named Pre-S2 and Pre-S1, respectively. The core protein is a subunit of the viral nucleocapsid. Pol is required for the synthesis of viral DNA (reverse transcriptase, RNase H and primer), which occurs in the nucleocapsid located in the cytoplasm of infected hepatocytes. Precore protein is a core protein with an N-terminal signal peptide and is proteolytically processed at its N- and C-termini to the so-called hepatitis B e-antigen (HBeAg) before secretion from infected cells. The HBx protein is required for efficient transcription of covalently closed circular DNA (cccDNA). HBx is not a viral structural protein. All viral proteins of HBV have their own mRNA except for the core and polymerase which share mRNA. Except for the precore protein, none of the HBV viral proteins undergoes post-translational proteolytic processing.

HBV virions contain a single copy of the viral envelope, nucleocapsid, and part of the double-stranded DNA genome. The nucleocapsid consists of 120 core protein dimers and is covered by a capsid membrane embedded with S, M and L viral envelope or surface antigen proteins. After entry into the cell, the virus is uncoated and capsid-containing loose circular DNA (rcDNA), covalently bound to the viral polymerase, migrates into the nucleus. During this process, phosphorylation of the core protein induces structural changes that expose nuclear localization signals, enabling the capsid to interact with so-called importins. These importins mediate the association of the core protein with the nuclear pore complex, following which the capsid dissociates and the polymerase/rcDNA complex is released into the nucleus. In the nucleus, rcDNA becomes deproteinized (polymerase removed) and converted by host DNA repair mechanisms into a covalently closed circular DNA (cccDNA) gene body with overlapping transcripts encoding HBeAg, HBsAg, core protein, viral polymerase Enzyme and HBx protein. Core protein, viral polymerase, and pregenomic RNA (pgRNA) associate in the cytoplasm and self-assemble into immature pgRNA-containing capsid particles that are further converted into mature rcDNA-capsid and serve as a common intermediate , are coated and secreted as infectious virions, or transported back into the nucleus to replenish and maintain a stable cccDNA pool.

So far, HBV has been divided into four serotypes (adr, adw, ayr, ayw) based on the antigenic epitopes present on the envelope protein, and eight genotypes (A, B, C, D, E, F, G and H). HBV genotypes were distributed in different geographical regions. For example, the most prevalent genotypes in Asia are genotypes B and C. Genotype D is mainly found in Africa, the Middle East and India, while genotype A is more common in Northern Europe, sub-Saharan Africa and West Africa. HBV antigen

As used herein, the terms "HBV antigen", "antigenic polypeptide of HBV", "HBV antigenic polypeptide", "HBV antigenic protein", "HBV immunogenic polypeptide" and "HBV immunogen" all refer to Peptides for the immune response to HBV. The induced response may be a humoral and/or cell-mediated response. The HBV antigen can be a polypeptide of HBV, a fragment or an epitope thereof, or a combination of multiple HBV polypeptides, parts or derivatives thereof. HBV antigens can generate a protective immune response in the host, e.g., induce an immune response against viral disease or infection, and/or immunize (i.e., vaccinate) the individual against viral disease or infection, thereby protecting the individual against Affected by viral illness or infection. For example, HBV antigens may comprise any HBV protein from any HBV genotype (e.g., genotypes A, B, C, D, E, F, G, and/or H), such as HBeAg, precore protein, HBsAg (S, M or L protein), core protein, viral polymerase or HBx protein, or a polypeptide of a combination thereof or an immunogenic fragment thereof. (1) HBV core antigen

As used herein, the terms "HBV core antigen", "HBcAg" and "core antigen" all refer to HBV antigens capable of inducing an individual's immune response against HBV core protein. The immune response induced can be a humoral and/or cell-mediated response. The terms "core", "core polypeptide" and "core protein" all refer to the core protein of HBV virus. A full-length core antigen is typically 183 amino acids in length and includes an assembly domain (amino acids 1 to 149) and a nucleic acid binding domain (amino acids 150 to 183). This 34-residue nucleic acid-binding domain is required for pregenome RNA encapsidation. This domain is also used as a nuclear input signal. It contains 17 arginine residues and is relatively basic, consistent with its function. HBV core protein exists as a dimer in solution, and the dimer self-assembles into an icosahedral capsid. Each core protein dimer has four alpha-helical bundles flanked by one alpha-helical domain on either side. A truncated HBV core protein without the nucleic acid binding domain is also capable of forming capsids.

In one embodiment of the present application, the HBV antigen is a truncated HBV core antigen. As used herein, "truncated HBV core antigen" refers to an HBV antigen that does not contain the full-length HBV core protein but is capable of inducing an immune response in an individual against the HBV core protein. For example, the HBV core antigen can be modified such that one or more of the heavily positively charged (arginine-rich) C-terminal nucleic acid binding domain in the core antigen typically contains seventeen arginine (R) residues amino acid deletion. The truncated HBV core antigen of the present application is preferably a C-terminal truncated HBV core protein that does not contain the HBV core nuclear import signal and/or a truncated HBV core protein that has deleted the C-terminal HBV core nuclear import signal. In one embodiment, the truncated HBV core antigen comprises a deletion in the C-terminal nucleic acid binding domain, such as deletion of 1 to 34 amino acid residues of the C-terminal nucleic acid binding domain, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34 amino acid residues, preferably 31 to 34 C-terminal amino acid residues of the C-terminal nucleic acid binding domain are deleted. In a preferred embodiment, the truncated HBV core antigen comprises a deletion in the C-terminal nucleic acid binding domain, preferably 31 C-terminal amino acid residues of the C-terminal nucleic acid binding domain.

In some embodiments, the HBV core antigen amino acid sequence is operably linked to a signal peptide for secretion. Any suitable signal peptide can be used. In one embodiment, the HBV core antigen is operably linked at its N-terminus to the cystin S precursor signal peptide to enhance secretion. In a specific embodiment, the cystin S precursor signal peptide has the amino acid sequence of SEQ ID NO: 77. In another specific embodiment, the coding sequence of the HBV core antigen is operably linked to the coding sequence of the cystin S precursor signal peptide having the polynucleotide sequence of SEQ ID NO: 90.

The HBV core antigen of the present application may be a consensus sequence derived from various HBV genotypes (eg genotypes A, B, C, D, E, F, G and H). As used herein, "consensus sequence" means an alignment based on the amino acid sequences of homologous proteins, eg, an artificial amino acid sequence determined by aligning the amino acid sequences of homologous proteins. Alignment can be performed using methods or algorithms known in the art, such as using Clustal Omega. It may be the order of the most common amino acid residues found at each position in the sequence alignment calculated based on the sequences of HBV antigens (eg core, pol, etc.) from at least 100 natural HBV isolates. The consensus sequence may be non-naturally occurring and different from native viral sequences. A consensus sequence can be designed by aligning multiple HBV antigen sequences from different sources using multiple sequence alignment tools, and selecting the most common amino acids at the aligned positions that vary. Preferably, the consensus sequence of HBV antigens is derived from HBV genotypes A, B, C and D. The term "common antigen" is used to refer to an antigen with a consensus sequence.

Exemplary truncated HBV core antigens according to the present application have no nucleic acid binding function and are capable of inducing an immune response in a mammal against at least two HBV genotypes. Preferably, the truncated HBV core antigen is capable of inducing a T cell response in a mammal against at least HBV genotypes A, B, C and D. More preferably, the truncated HBV core antigen is capable of inducing CD8 T cell responses against at least HBV genotypes A, B, C and D in human subjects.

In some embodiments, the HBV core antigen of the present application comprises one or more T cell epitopes of the MHC class I HLA alleles. In some embodiments, the HBV core antigen comprises one or more epitopes selected from the group consisting of: HLA-A*11:01 epitope, HLA-A*02:01 epitope, HLA-A *A0101 epitope and HLA-B*40:01 epitope. Preferably, the HBV core antigen comprises two or more, such as 2, 3 or 4, T cell epitopes selected from the group consisting of: HLA-A*11:01 epitope, HLA-A* 02:01 epitope, HLA-A*A0101 epitope and HLA-B*40:01 epitope. More preferably, the HBV core antigen comprises HLA-A*11:01, HLA-A*02:01, HLA-A*A0101 and HLA-B*40:01 T cell epitopes. More preferably, the HBV core antigen comprises one or more HLA-A*11:01 epitopes.

In some embodiments, the HBV core antigen of the present application is a common antigen, preferably a common antigen derived from at least two (preferably all) of HBV genotypes A, B, C and D, more preferably a source Truncated common antigen in HBV genotypes A, B, C and D. An exemplary truncated HBV core common antigen according to the present application is at least 90% identical to SEQ ID NO: 86, such as at least 90%, 91%, 92%, 93%, 94%, 95% to SEQ ID NO: 86 , 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9 % or 100% identical amino acid sequence composition. In some embodiments, the HBV core antigen comprises at least 98% identity to SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86, such as to SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO : 86 at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of this amino acid sequence. SEQ ID NO: 86 is the core common antigen derived from HBV genotypes A, B, C and D. SEQ ID NO: 7 contains a 34 amino acid C-terminal deletion of the heavily positively charged (arginine-rich) nucleic acid binding domain of the native core antigen. In some preferred embodiments, the HBV core antigen of the present application retains one or more of the C-terminal arginine residues, and has the amino acid sequence of SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86, so as to restore the HLA-A*11:01 epitope in the HBV core antigen. In some embodiments, the last five C-terminal amino acids of the HBV core antigen comprise a VVR amino acid sequence, more specifically a VVRR (SEQ ID NO: 91 ) amino acid sequence, more specifically a VVRRR (SEQ ID NO: 92) Amino acid sequence.

In a specific embodiment of the present application, the HBV core antigen is a truncated HBV antigen consisting of the amino acid sequence of SEQ ID NO: 7, SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86. In another specific embodiment, the HBV core antigen is encoded by the polynucleotide sequence of SEQ ID NO: 8, SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89, respectively. Preferably, the HBV core antigen consists of the amino acid sequence of SEQ ID NO: 86 and is encoded by the polynucleotide sequence of SEQ ID NO: 89. In some embodiments, the HBV core antigen consists of amino acid sequences or is encoded by polynucleotide sequences, the contents of which are incorporated herein by reference in US Patent Application Publication No. US2019/0185828 Described. (2) HBV polymerase antigen

As used herein, the term "HBV polymerase antigen", "HBV Pol antigen" or "HBV pol antigen" refers to an HBV antigen capable of inducing an immune response in an individual against HBV polymerase. The immune response can be a humoral and/or cell-mediated response. The terms "polymerase", "polymerase polypeptide", "Pol" and "pol" all refer to HBV viral DNA polymerase. The HBV viral DNA polymerase has four domains, from N-terminus to C-terminus including: the terminal protein (TP) domain that acts as a primer for negative-strand DNA synthesis; a spacer that is not essential for polymerase function; reverse transcriptase for transcription (RT) domain; and RNase H domain.

In one embodiment of the present application, the HBV antigen comprises HBV Pol antigen, or any immunogenic fragment or combination thereof. HBV Pol antigens may contain other modifications that improve the immunogenicity of the antigen, such as by introducing mutations into the active sites of the polymerase and/or ribonuclease domains to reduce or substantially eliminate certain enzymatic activities.

Preferably, the HBV Pol antigen of the present invention does not have reverse transcriptase activity and ribonuclease H activity, and is capable of inducing immune responses against at least two HBV genotypes in mammals. Preferably, the HBV Pol antigen is capable of inducing a T cell response in a mammal against at least two (preferably all) HBV genotypes A, B, C and D. More preferably, the HBV Pol antigen is capable of inducing a CD8 T cell response against at least HBV genotypes A, B, C and D in a human individual.

Thus, in some embodiments, the HBV Pol antigen is an inactive Pol antigen. In one embodiment, the inactive BV Pol antigen comprises one or more amino acid mutations in the active site of the polymerase domain. In another embodiment, the inactive HBV Pol antigen comprises one or more amino acid mutations in the active site of the ribonuclease H domain. In a preferred embodiment, the inactive HBV pol antigen comprises one or more amino acid mutations in the active site of both the polymerase domain and the RNase H domain. For example, possible nucleotide/metal ions in the polymerase domain of the HBV pol antigen can be made, e.g., by replacing one or more aspartic acid residues (D) with asparagine residues (N). Combining the mutation of the required "YXDD" motif (SEQ ID NO: 74), eliminates or reduces the metal coordination function, thereby reducing or substantially eliminating the reverse transcriptase function. Alternatively, or in addition to mutating the "YXDD" motif (SEQ ID NO: 74), one can, for example, replace one or more aspartic acid residues (D) with asparagine residues (N) and /or replace the glutamic acid residue (E) with glutamic acid (Q) to enable the " ^DEDD " motif (SEQ ID NO: 75 ) mutation, thereby reducing or substantially eliminating ribonuclease H function. In a specific embodiment, the HBV pol antigen is modified by (1) mutating the aspartic acid residue (D) in the "YXDD" motif (SEQ ID NO: 74) of the polymerase domain to asparagine amine residue (N); and (2) mutation of the first aspartic acid residue (D) in the "DEDD" motif (SEQ ID NO: 75) of the ribonuclease H domain to an asparagine residue (N) and the first glutamic acid residue (E) is mutated into a glutamic acid residue (N), thereby reducing or substantially eliminating the reverse transcriptase and ribonuclease H functions of the pol antigen.

In some embodiments, the HBV pol antigen amino acid sequence is operably linked to a signal peptide for secretion. Any suitable signal peptide can be used. In one embodiment, the HBV pol antigen is operably linked at its N-terminus to the cystin S precursor signal peptide to enhance secretion. In a specific embodiment, the cystin S precursor signal peptide has the amino acid sequence of SEQ ID NO: 77. In another specific embodiment, the coding sequence of the HBV pol antigen is operably linked to the coding sequence of the cystin S precursor signal peptide having the polynucleotide sequence of SEQ ID NO: 90.

In some embodiments, the HBV pol antigen of the present application comprises one or more T cell epitopes of an MHC class I HLA allele. In some embodiments, the HBV pol antigen comprises one or more epitopes selected from the group consisting of: HLA-A*11:01 epitope, HLA-A*24:02 epitope, HLA-A *02:01 epitope and HLA-A*A0101 epitope. Preferably, the HBV pol antigen comprises two or more, such as 2, 3 or 4, T cell epitopes selected from the group consisting of: HLA-A* 11:01 epitope, HLA-A* 24:02 epitope, HLA-A*02:01 epitope and HLA-A*A0101. More preferably, the HBV pol antigen comprises HLA-A*11:01, HLA-A*24:02, HLA-A*02:01 and HLA-A*A0101 T cell epitopes. More preferably, the HBV pol antigen comprises one or more HLA-A*11:01 epitopes.

In a preferred embodiment of the present application, the HBV pol antigen is a common antigen, preferably a common antigen derived from at least two (preferably all) of HBV genotypes A, B, C and D, more preferably It is an inactivated common antigen derived from HBV genotypes A, B, C and D. Exemplary HBV pol common antigens according to the present application comprise at least 90% identity with SEQ ID NO: 9, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5 with SEQ ID NO: 9 %, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identity, preferably at least 98% identity to SEQ ID NO: 9, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6 to SEQ ID NO: 9 %, 99.7%, 99.8%, 99.9%, or 100% identical amino acid sequences. SEQ ID NO: 9 is the pol common antigen derived from HBV genotypes A, B, C and D comprising four mutations located in the active sites of the polymerase and ribonuclease H domains. In detail, the four mutations include the mutation of aspartic acid residue (D) to asparagine residue (N) in the "YXDD" motif (SEQ ID NO: 74) of the polymerase domain; and ribose Mutation of the first aspartic acid residue (D) to asparagine residue (N) and glutamic acid residue (E) in the "DEDD" (SEQ ID NO: 75) motif of the nuclease H domain Mutation to glutamine residue (Q).

In a specific embodiment of the present application, the HBV pol antigen comprises the amino acid sequence of SEQ ID NO: 9. Preferably, the HBV pol antigen consists of the amino acid sequence of SEQ ID NO: 9. In another specific embodiment, the HBV pol antigen is encoded by the polynucleotide sequence SEQ ID NO: 10. In some embodiments, the HBV pol antigen comprises or consists of an amino acid sequence or is encoded by a polynucleotide sequence, the contents of which are incorporated herein by reference in their entirety into U.S. Patent Application Publication Described in US2019/0185828. (3) HBV surface antigen

As used herein, the terms "HBV surface antigen", "surface antigen", "HBV envelope antigen", "envelope antigen" and "env antigen" all refer to the Envelope protein immunoreactive HBV antigens. The immune response can be a humoral and/or cell-mediated response. The terms "HBV surface protein", "surface protein", "HBV envelope protein" and "envelope protein" all refer to HBV viral surface or envelope proteins. HBV expresses three surface antigens or envelope proteins. Gene S is the gene of the HBV gene body encoding the surface antigen. The surface antigen gene is one long open reading frame, but contains three in-frame "start" (ATG) codons, which divide the gene into three segments: pre-S1, pre-S2, and S. Due to the multiple start codons, three polypeptides of different sizes are produced, called large (L) or L surface antigen, medium (M) or M surface antigen, and small (S) or S surface antigen, also known as HBV L, M and S envelope proteins. Two different promoters (PreS1 and PreS2) drive transcription of the L, M and S surface antigen coding sequences, resulting in three different translated proteins: L, M and S envelope proteins. The PreS2 promoter is sometimes referred to as the PreS2/S promoter because it drives transcription of the M surface antigen and the S surface antigen, respectively. The amino acid sequence of the L surface antigen is in frame with the sequences of the M and S surface antigens. Thus, the L surface antigen contains M and S surface antigen domains, and the M surface antigen includes the S surface antigen domain. The L, M and S surface antigens share the C-terminus and share the entire S domain. Relative to S, M has an additional domain pre-S2 at its N-terminus, and relative to M, L has a pre-S1 domain.

In some embodiments, the HBV antigen is an HBV PreS1 antigen, which is encoded by a pre-S1 gene segment and contains only the Pre-S1 domain of the L antigen. PreS1 antigens can be of various lengths, such as 99 to 109 amino acids. The HBV PreS1 antigen of the present application may contain the sequence of any naturally occurring PreS1 domain, and variants or derivatives thereof.

In other embodiments, the HBV antigen is HBV PreS2.S antigen, which is encoded by pre-S2 and S gene segments and contains PreS2 domain and S domain. The PreS2 domain can be about 55 amino acids in length, and the S domain can contain about 226 amino acids. The HBV PreS2.S antigen of the present application may contain the sequence of any one of the naturally occurring PreS2 and S domains, and variants or derivatives thereof. In some embodiments, the internal signal peptide of PreS2.S remains intact to facilitate the secretion of PreS2.S protein products of HBV M and HBV S antigens. In one embodiment, the HBV PreS2.S antigen is HBV M surface antigen. In another embodiment, the HBV PreS2.S antigen is HBV S surface antigen. In yet another embodiment, the HBV PreS2.S antigen covers HBV M surface antigen and HBV S surface antigen.

In some embodiments, the HBV surface antigen amino acid sequence is operably linked to or contains a signal peptide for secretion. Any suitable signal peptide can be used. In one embodiment, the HBV Pre-S1 antigen amino acid sequence is operably linked at its N-terminus to the cystin S pre-signal peptide to enhance secretion. In a specific embodiment, the cystin S precursor signal peptide has the amino acid sequence of SEQ ID NO: 77. In another specific embodiment, the coding sequence of the HBV Pre-S1 antigen is operably linked to the coding sequence of the cystin S pre-signal peptide having the polynucleotide sequence of SEQ ID NO: 90.

In one embodiment of the present application, the HBV antigen comprises HBV surface antigen, or any immunogenic fragment or combination thereof. The HBV surface antigen can induce an individual's immune response against at least one of the L surface antigen, M surface antigen and S surface antigen proteins. Preferably, the HBV surface antigen such as the Pre-S1 or PreS2.S antigen is a common antigen, preferably a common antigen derived from at least two HBV genotypes A, B, C and D, and more preferably derived from HBV Common antigen of genotypes A, B, C and D.

In some embodiments, the HBV surface antigens of the present application comprise one or more T cell epitopes of MHC class I HLA alleles. In some embodiments, the HBV surface antigen comprises one or more T cell epitopes selected from the group consisting of HLA-A*11:01 epitopes, HLA-A*24:02 epitopes, and HLA -A*A2402 epitope. Preferably, the HBV Pre-S1 antigen comprises one or more T cell epitopes selected from the group consisting of HLA-A*11:01 epitopes and HLA-A*24:02 epitopes. More preferably, the HBV Pre-S1 antigen comprises HLA-A*11:01 and HLA-A*24:02 T cell epitopes. More preferably, the HBV Pre-S1 antigen comprises one or more HLA-A*11:01 epitopes. Preferably, the HBV PreS2.S antigen comprises one or more T cell epitopes selected from the group consisting of HLA-A*11:01 epitopes, HLA-A*24:02 epitopes and HLA -A*A2402 epitope. More preferably, the HBV PreS2.S antigen comprises HLA-A*11:01, HLA-A*24:02 and HLA-A*A2402 T cell epitopes. More preferably, the HBV PreS2.S antigen comprises one or more HLA-A*11:01 epitopes.

In some embodiments of the present application, the HBV surface antigen is Pre-S1 antigen. Exemplary Pre-S1 antigens according to the present application comprise at least 90% identity with SEQ ID NO: 1 or SEQ ID NO: 3, such as at least 90%, 91%, 92% with SEQ ID NO: 1 or SEQ ID NO: 3 %, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% amino acid sequence identity. In some embodiments of the present application, the HBV surface antigen is Pre-S2.S antigen. Exemplary Pre-S2.S antigens according to the present application comprise at least 90% identity to SEQ ID NO: 5, such as at least 90%, 91%, 92%, 93%, 94%, 95% to SEQ ID NO: 5 , 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9 % or 100% identical amino acid sequence.

In a specific embodiment of the present application, the HBV surface antigen is a Pre-S1 antigen consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3. In another specific embodiment, the HBV surface antigen is encoded by the polynucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4. In another specific embodiment, the HBV surface antigen is the Pre-S2.S antigen consisting of the amino acid sequence of SEQ ID NO: 5. In another specific embodiment, the HBV surface antigen is encoded by the polynucleotide sequence of SEQ ID NO: 6.

In some embodiments of the present application, the HBV surface antigen is S surface antigen. Exemplary S surface antigens according to the present application are at least 98% identical to the amino acid sequence SEQ ID NO: 79, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence composition. SEQ ID NO: 81 is HBV common S surface antigen derived from HBV genotypes A, B, C and D. In a specific embodiment of the present application, the S surface antigen consists of the amino acid sequence of SEQ ID NO: 79. In another specific embodiment, the HBV surface antigen is encoded by the polynucleotide sequence of SEQ ID NO: 78.

In some embodiments, the HBV surface antigen is M surface antigen, or any immunogenic fragment or combination thereof. Preferably, the M surface antigen is a common antigen, preferably a common antigen derived from at least two (preferably all) of HBV genotypes A, B, C and D, and more preferably derived from HBV genotype A , B, C and D common antigen. Preferably, the M surface antigen is capable of inducing or triggering an individual's immune response against the M surface antigen.

Exemplary M surface antigens according to the present application comprise at least 98% identity to the amino acid sequence SEQ ID NO: 82, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence or consists of the amino acid sequence. SEQ ID NO: 82 is HBV common M surface antigen derived from HBV genotypes A, B, C and D. In a specific embodiment of the present application, the M surface antigen consists of the amino acid sequence of SEQ ID NO: 82.

In some embodiments, the HBV surface antigen is an L surface antigen, or any immunogenic fragment or combination thereof. Preferably, the L surface antigen is a common antigen, preferably a common antigen derived from at least two (preferably all) of HBV genotypes A, B, C and D, and more preferably derived from HBV genotype A , B, C and D common antigen. Preferably, the L surface antigen is capable of inducing or triggering an individual's immune response against the L surface antigen.

Exemplary L surface antigens according to the present application comprise at least 98% identity with the amino acid sequence SEQ ID NO: 83, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence or consists of the amino acid sequence. SEQ ID NO: 83 is HBV common L surface antigen derived from HBV genotypes A, B, C and D. In a specific embodiment of the present application, the M surface antigen consists of the amino acid sequence of SEQ ID NO: 83.

In some embodiments, the HBV surface antigen comprises a portion of any one of L, M and S surface antigens or any combination thereof. For example, an HBV surface antigen may comprise or consist of an N-terminal L surface antigen domain. HBV surface antigens may also comprise or consist of M surface antigen domains. The HBV surface antigen may also comprise or consist of an N-terminal L surface antigen domain and an M surface antigen domain. The HBV surface antigen may also comprise or consist of part of the N-terminal L surface antigen domain, M surface antigen domain, and S surface antigen domain.

An illustrative example of such a surface antigen according to the present application consists of an amino acid sequence which is at least 98% identical to the amino acid sequence SEQ ID NO: 81, such as at least 95% identical to SEQ ID NO: 81 %, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably at least 98% identical to SEQ ID NO: 81, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% agreement. SEQ ID NO: 81 is derived from the common antigen of HBV genotypes A, B, C and D, which contains the N-terminal L surface antigen domain, the entire M surface antigen domain and the 15 amino acid C-terminal tail from the S surface antigen domain . In a specific embodiment of the present application, the HBV surface antigen consists of the amino acid sequence of SEQ ID NO: 81. In another specific embodiment, the HBV surface antigen is encoded by the polynucleotide sequence SEQ ID NO: 80 encoding the HBV surface antigen. In some embodiments, the HBV surface antigen consists of amino acid sequences or is encoded by polynucleotide sequences described in European Patent Application No. 19180926, the contents of which are incorporated herein by reference in its entirety. polynucleotides and vectors

In another general aspect, the present application provides nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding HBV antigens, and vectors comprising non-naturally occurring nucleic acids according to the present application. The nucleic acid molecule may comprise any non-naturally occurring polynucleotide sequence encoding the HBV antigen of the present application, which may be prepared according to the present invention using methods known in the art. Preferably, the non-naturally occurring polynucleotide encodes at least one of the truncated HBV core antigen, HBV polymerase antigen, HBV Pre-S1 antigen and HBV Pre-S2.S antigen of the present application. Polynucleotides can be in the form of RNA or DNA obtained by recombinant techniques (eg, cloning) or produced synthetically (eg, chemical synthesis). DNA can be single-stranded or double-stranded, or can contain portions of both double-stranded and single-stranded sequences. DNA may, for example, comprise genomic DNA, cDNA, or combinations thereof. Polynucleotides can also be DNA/RNA hybrids. The polynucleotides and vectors of the present application can be used to produce recombinant proteins, express proteins in host cells, or produce virions. Preferably, the polynucleotide is RNA.

In one embodiment of the present application, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding a truncated HBV core antigen, which is composed of SEQ ID NO: 7, SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86 is at least 90% identical, such as at least 90%, 91%, 92% identical to SEQ ID NO: 7, SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86 , 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6 %, 99.7%, 99.8%, 99.9% or 100% consistent, preferably with SEQ ID NO: 7, SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86 98%, 99% or 100% Consensus amino acid sequence composition. In a particular embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes a truncation consisting of the amino acid sequence of SEQ ID NO: 7, SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86 Short HBV core antigen. Preferably, the truncated HBV core antigen consists of SEQ ID NO: 86.

Examples of the polynucleotide sequence of the present application encoding the truncated HBV core antigen composed of the amino acid sequence SEQ ID NO: 7, SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86 include respectively But not limited to at least 90% identity with SEQ ID NO: 8, SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89, such as with SEQ ID NO: 8, SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89 at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably with SEQ ID NO: 8, SEQ ID NO: 87, SEQ ID NO : 88 or SEQ ID NO: 89 98%, 99% or 100% identical polynucleotide sequence. Exemplary non-naturally occurring nucleic acid molecules encoding truncated HBV core antigens have the polynucleotide sequence of SEQ ID NO: 8, SEQ ID NO: 87, SEQ ID NO: 88, or SEQ ID NO: 89. Preferably, the molecule encoding the truncated HBV core antigen has the polynucleotide sequence of SEQ ID NO: 89.

In one embodiment of the present application, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding an HBV polymerase antigen comprising at least 90% identity to SEQ ID NO: 9, such as to SEQ ID NO: 9 NO: 9 at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2 %, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical amino acid sequences. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes an HBV polymerase antigen consisting of the amino acid sequence of SEQ ID NO:9.

Examples of the polynucleotide sequence encoding the HBV Pol antigen of the present application comprising the amino acid sequence SEQ ID NO: 9 include, but are not limited to, at least 90% identical to SEQ ID NO: 10, such as at least 90% identical to SEQ ID NO: 10 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3% , 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably a polynucleotide sequence that is 98%, 99% or 100% identical to SEQ ID NO: 10. An exemplary non-naturally occurring nucleic acid molecule encoding an HBV pol antigen has the polynucleotide sequence of SEQ ID NO:10.

In one embodiment of the present application, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding an HBV Pre-S1 antigen, the HBV Pre-S1 antigen is composed of at least SEQ ID NO: 1 or SEQ ID NO: 3 90% identical, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5% to SEQ ID NO: 1 or SEQ ID NO: 3 , 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% consistent, preferably with SEQ ID NO: 1 Or SEQ ID NO: 3 98%, 99% or 100% identical amino acid sequence composition. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes an HBV Pre-S1 antigen consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

The polynucleotide sequence examples of the present application encoding the HBV Pre-S1 antigen composed of amino acid sequence SEQ ID NO: 1 or SEQ ID NO: 3 include but not limited to SEQ ID NO: 2 or SEQ ID NO :4 is at least 90% identical, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97% to SEQ ID NO: 2 or SEQ ID NO: 4 , 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% consistent, preferably with SEQ ID NO: 2 or SEQ ID NO: 4 98%, 99% or 100% identical polynucleotide sequence. An exemplary non-naturally occurring nucleic acid molecule encoding an HBV Pre-S1 antigen has the polynucleotide sequence of SEQ ID NO: 2 or 4.

In one embodiment of the present application, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding HBV Pre-S2.S antigen, which is composed of at least 90% of SEQ ID NO: 5 Consistent, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99% with SEQ ID NO: 5 %, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably 98%, 99% or 100% identical to SEQ ID NO: 5 Consensus amino acid sequence composition. In a specific embodiment of the present application, the non-naturally occurring nucleic acid molecule encodes the HBV Pre-S2.S antigen consisting of the amino acid sequence of SEQ ID NO: 5.

Examples of the polynucleotide sequence of the present application encoding the HBV Pre-S2.S antigen consisting of the amino acid sequence SEQ ID NO: 5 include but are not limited to at least 90% identity with SEQ ID NO: 6, such as with SEQ ID NO: 6 at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1% , 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical, preferably a polynucleus consistent with SEQ ID NO: 6 98%, 99% or 100% nucleotide sequence. An exemplary non-naturally occurring nucleic acid molecule encoding an HBV Pre-S2.S antigen has the polynucleotide sequence of SEQ ID NO:6.

In one embodiment of the present application, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence comprising from the 5' end to the 3' end: a polynucleotide sequence encoding a first HBV antigen, a first internal ribose Body entry sequence (IRES) element or a polynucleotide sequence encoding a first self-protease peptide and a polynucleotide sequence encoding a second HBV antigen, wherein at least one of the first and second HBV antigens is HBV surface antigen. In some embodiments, the non-naturally occurring polynucleotide sequence sequenced from 5' to 3' further comprises: a second IRES element or a polynucleotide sequence encoding a second autoprotease peptide operably linked to the 3' end of the polynucleotide sequence encoding the second HBV antigen; and the polynucleotide sequence encoding the third HBV antigen. In some embodiments, the non-naturally occurring polynucleotide sequence sequenced from 5' to 3' further comprises: a third IRES element or a polynucleotide sequence encoding a third autoprotease peptide, operable to linked to the 3' end of the polynucleotide sequence encoding the third HBV antigen; and the polynucleotide sequence encoding the fourth HBV antigen.

In some embodiments, each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a first HBV surface antigen comprising the amino acid sequence SEQ ID NO: 1 is at least 98% identical, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 to the amino acid sequence of SEQ ID NO: 1 %, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consisting of this amino acid sequence; (ii) a second HBV surface antigen, which comprises at least the amino acid sequence SEQ ID NO: 3 98% identity, such as at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9 to the amino acid sequence of SEQ ID NO: 3 % or 100% identical amino acid sequence, preferably consists of this amino acid sequence; (iii) a third HBV surface antigen, which comprises at least 98% identical to the amino acid sequence SEQ ID NO: 5, such as with The amino acid sequence of SEQ ID NO: 5 is at least 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical An amino acid sequence, preferably consisting of this amino acid sequence; (iv) HBV core antigen, which comprises at least 90% identity with SEQ ID NO: 7, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5% , 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consisting of this amino acid sequence; and (v) HBV polymerase antigen, which comprises the same sequence as SEQ ID NO: 9 At least 90% identical, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5 to SEQ ID NO: 9 %, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably by the amino acid sequence composition. In some embodiments, the HBV core antigen comprises at least 90% identity to SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86, such as to SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO : 86 at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2% , 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of this amino acid sequence.

In some embodiments, each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) encoding a first HBV PreS1 antigen A polynucleotide sequence having at least 90% identity with SEQ ID NO: 2, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96% with SEQ ID NO: 2 %, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% consistent (ii) a polynucleotide sequence encoding a second HBV PreS1 antigen having at least 90% identity to SEQ ID NO: 4, such as at least 90%, 91%, 92%, 93 to SEQ ID NO: 4 %, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical sequence; (iii) the polynucleotide sequence of coding HBV PreS2.S antigen, it has at least 90% identical with SEQ ID NO: 6, such as with SEQ ID NO: 6 At least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical sequence; (iv) polynucleotide sequence encoding HBV polymerase antigen, which has the same sequence as SEQ ID NO: 8 At least 90% identical, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5 to SEQ ID NO: 8 %, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical sequences; and (v) polynucleotides encoding HBV core antigen An acid sequence having at least 90% identity to SEQ ID NO: 10, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5% to SEQ ID NO: 10 , 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7% , 99.8%, 99.9% or 100% identical sequences. In some embodiments, the polynucleotide sequence encoding the HBV core antigen comprises at least 90% identity to SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89, such as to SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89 at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99 %, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence.

In some embodiments, each of the first, second, and third autoprotease peptides independently comprises a peptide sequence selected from the group consisting of: Porcine Squad Virus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), equine rhinitis virus A (ERAV) 2A (E2A), trachoma virus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), silkworm softening disease virus 2A (BmIFV2A) and its combination. Preferably, each of the first, second and third autoprotease peptides comprises a peptide sequence of P2A, such as the P2A sequence of SEQ ID NO: 11. Preferably, the polynucleotide sequence encoding the P2A peptide sequence is SEQ ID NO: 12.

In some embodiments, each of the first, second and third IRES is derived from encephalomyocarditis virus (EMCV) or enterovirus 71 (EV71), preferably, the first, second and third IRES Each of them comprises the polynucleotide sequence of SEQ ID NO: 13 or 14.

In one embodiment of the present application, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence comprising the following from the 5' end to the 3' end: (1) encoding a polynucleotide having the amino acid sequence of SEQ ID NO: 7, Preferably the polynucleotide sequence of the HBV core antigen consisting of the amino acid sequence SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11 or having a polynucleoside The IRES of the acid sequence SEQ ID NO: 13 or 14, and the polynucleotide sequence encoding the HBV polymerase antigen having the amino acid sequence SEQ ID NO: 9, preferably consisting of the amino acid sequence; (2) A polynucleotide sequence encoding an HBV polymerase antigen having an amino acid sequence of SEQ ID NO: 9, preferably consisting of the amino acid sequence, a polynucleotide encoding a P2A amino acid sequence of SEQ ID NO: 11 sequence or an IRES having the polynucleotide sequence of SEQ ID NO: 13 or 14, and encoding an IRES having the amino acid sequence of SEQ ID NO: 7, preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of the HBV core antigen; (3) the polynucleotide sequence encoding the HBV Pre-S1 antigen having the amino acid sequence of SEQ ID NO: 1 or 3, preferably consisting of the amino acid sequence, A polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11 or an IRES having a polynucleotide sequence SEQ ID NO: 13 or 14, and encoding an amino acid sequence SEQ ID NO: 5, preferably The polynucleotide sequence of the HBV PreS2.S antigen consisting of the amino acid sequence; (4) encoding the HBV PreS2.S having the amino acid sequence of SEQ ID NO: 5, preferably consisting of the amino acid sequence The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11 or the IRES having the polynucleotide sequence SEQ ID NO: 13 or 14, and the encoding having the amino acid sequence SEQ ID NO: 11 ID NO: 1 or 3, preferably the polynucleotide sequence of the HBV Pre-S1 antigen composed of the amino acid sequence; (5) encoding has the amino acid sequence SEQ ID NO: 7, preferably composed of amine The polynucleotide sequence of amino acid sequence SEQ ID NO: 84, 85 or 86 composed of HBV core antigen, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence of SEQ ID NO: 9. The polynucleotide sequence of the HBV polymerase antigen preferably composed of the amino acid sequence, encoding the polynucleotide sequence of the P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 5. HBV PreS2.S antigen preferably composed of the amino acid sequence A polynucleotide sequence encoding a P2A amino acid sequence of SEQ ID NO: 11, and encoding a polynucleotide sequence having an amino acid sequence of SEQ ID NO: 1 or 3, preferably consisting of the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen; (6) coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, is preferably made up of this amino acid sequence, A polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, encoding an HBV having the amino acid sequence of SEQ ID NO: 7, preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of the core antigen, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence of SEQ ID NO: 5, preferably consisting of the amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO: 1 or 3, preferably by the The polynucleotide sequence of the HBV Pre-S1 antigen composed of amino acid sequence; (7) coding has the amino acid sequence of SEQ ID NO: 5, preferably the HBV PreS2.S antigen composed of the amino acid sequence Polynucleotide sequence, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding has the amino acid sequence of SEQ ID NO: 1 or 3, preferably HBV consisting of the amino acid sequence The polynucleotide sequence of Pre-S1 antigen, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding has the amino acid sequence of SEQ ID NO: 7, preferably by the amino acid sequence of SEQ ID NO: The polynucleotide sequence of the HBV core antigen composed of 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO: 9 , preferably the polynucleotide sequence of the HBV polymerase antigen consisting of the amino acid sequence; (8) encoding the HBV having the amino acid sequence of SEQ ID NO: 5, preferably consisting of the amino acid sequence The polynucleotide sequence of PreS2.S antigen, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 1 or 3, preferably by the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen composed of acid sequence, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 9, preferably by The polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence encodes the P2A amino acid sequence SEQ ID The polynucleotide sequence of NO: 11, and the polynucleotide encoding the HBV core antigen having the amino acid sequence of SEQ ID NO: 7, preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86 Sequence; (9) encoding polynucleotide sequence having amino acid sequence SEQ ID NO: 7, preferably HBV core antigen composed of amino acid sequence SEQ ID NO: 84, 85 or 86, encoding P2A amino group The polynucleotide sequence of the acid sequence SEQ ID NO: 11, encoding has the amino acid sequence of SEQ ID NO: 9, preferably the polynucleotide sequence of the HBV polymerase antigen consisting of the amino acid sequence, with poly The IRES of the nucleotide sequence of SEQ ID NO: 13 encodes the polynucleotide sequence of the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, preferably consisting of the amino acid sequence, and encodes the P2A amine The polynucleotide sequence of amino acid sequence SEQ ID NO: 11, and coding has amino acid sequence SEQ ID NO: 1 or 3, preferably the polynucleoside of the HBV Pre-S1 antigen that is made up of this amino acid sequence (10) coding has amino acid sequence SEQ ID NO: 9, preferably the polynucleotide sequence of the HBV polymerase antigen that is made up of this amino acid sequence, coding P2A amino acid sequence SEQ ID NO: The polynucleotide sequence of 11, encoding the polynucleotide sequence of the HBV core antigen having the amino acid sequence of SEQ ID NO: 7, preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86, having The IRES of the polynucleotide sequence SEQ ID NO: 13, encoding the polynucleotide sequence of the HBV PreS2.S antigen with the amino acid sequence SEQ ID NO: 5, preferably composed of the amino acid sequence, encoding P2A The polynucleotide sequence of the amino acid sequence SEQ ID NO: 11, and the polynucleus encoding the HBV Pre-S1 antigen having the amino acid sequence SEQ ID NO: 1 or 3, preferably consisting of the amino acid sequence Nucleotide sequence; (11) coding has amino acid sequence SEQ ID NO: 5, preferably the polynucleotide sequence of the HBV PreS2.S antigen that is made up of this amino acid sequence, coding P2A amino acid sequence SEQ ID The polynucleotide sequence of NO: 11, coding has the amino acid sequence SEQ ID NO: 1 or 3, preferably the polynucleotide sequence of the HBV Pre-S1 antigen that is made up of this amino acid sequence, has polynucleus The IRES of the nucleotide sequence of SEQ ID NO: 13, encoding the polynucleotide of the HBV core antigen having the amino acid sequence of SEQ ID NO: 7, preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86 Sequence, coding P2A amino acid sequence SEQ ID NO: 1 1 polynucleotide sequence, and coding has amino acid sequence SEQ ID NO: 9, preferably the polynucleotide sequence of the HBV polymerase antigen that is made up of this amino acid sequence; (12) coding has amino acid sequence Acid sequence SEQ ID NO: 5. The polynucleotide sequence of HBV PreS2.S antigen preferably composed of the amino acid sequence, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding Having the amino acid sequence of SEQ ID NO: 1 or 3, preferably the polynucleotide sequence of the HBV Pre-S1 antigen consisting of the amino acid sequence, having the IRES of the polynucleotide sequence of SEQ ID NO: 13, A polynucleotide sequence encoding an HBV polymerase antigen having an amino acid sequence of SEQ ID NO: 9, preferably consisting of the amino acid sequence, a polynucleotide encoding a P2A amino acid sequence of SEQ ID NO: 11 Sequence, and coding has amino acid sequence SEQ ID NO: 7, preferably the polynucleotide sequence of the HBV core antigen that is made up of amino acid sequence SEQ ID NO: 84,85 or 86; (13) coding has amine The amino acid sequence of SEQ ID NO: 7, the polynucleotide sequence of the HBV core antigen preferably composed of the amino acid sequence of SEQ ID NO: 84, 85 or 86, encoding the P2A amino acid sequence of SEQ ID NO: 11 A polynucleotide sequence encoding a polynucleotide sequence having an amino acid sequence of SEQ ID NO: 9, preferably an HBV polymerase antigen consisting of the amino acid sequence, having a polynucleotide sequence of SEQ ID NO: The IRES of 14, encoding the polynucleotide sequence of the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, preferably consisting of the amino acid sequence, encoding the P2A amino acid sequence of SEQ ID NO: 11 The polynucleotide sequence of the polynucleotide sequence, and coding has amino acid sequence SEQ ID NO: 1 or 3, preferably the polynucleotide sequence of the HBV Pre-S1 antigen that is made up of this amino acid sequence; (14) coding has Amino acid sequence SEQ ID NO: 9, preferably the polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence, encoding the polynucleotide sequence of the P2A amino acid sequence SEQ ID NO: 11, A polynucleotide sequence encoding an HBV core antigen having the amino acid sequence of SEQ ID NO: 7, preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86, having the polynucleotide sequence of SEQ ID NO : 14 of the IRES, coding has the amino acid sequence SEQ ID NO: 5, preferably the polynucleotide sequence of the HBV PreS2.S antigen consisting of the amino acid sequence, coding P2A amino acid sequence SEQ ID NO: The polynucleotide sequence of 11, and coding has amino acid sequence SEQ ID NO: 1 or 3, preferably the polynucleotide sequence of the HBV Pre-S1 antigen composed of the amino acid sequence; (15) encoding has the amino acid sequence SEQ ID NO: 5, preferably composed of the amine The polynucleotide sequence of the HBV PreS2.S antigen composed of amino acid sequence, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 1 or 3, compared Preferably, the polynucleotide sequence of the HBV Pre-S1 antigen composed of the amino acid sequence has the polynucleotide sequence of SEQ ID NO: 14 IRES, encoding has the amino acid sequence of SEQ ID NO: 7, preferably The polynucleotide sequence of the HBV core antigen consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86, the polynucleotide sequence of the coding P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence of encoding the amino acid sequence having an amino group Acid sequence SEQ ID NO: 9, preferably the polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence; (16) encoding has the amino acid sequence SEQ ID NO: 5, preferably composed of the amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen composed of amino acid sequence, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 1 or 3, Preferably, the polynucleotide sequence of the HBV Pre-S1 antigen composed of the amino acid sequence has the IRES of the polynucleotide sequence SEQ ID NO: 14, and the encoding has the amino acid sequence SEQ ID NO: 9, compared Preferably, the polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the polynucleotide sequence having the amino acid sequence SEQ ID NO: 7. The polynucleotide sequence of the HBV core antigen preferably composed of the amino acid sequence SEQ ID NO: 84, 85 or 86; (17) encoding the amino acid sequence SEQ ID NO: 5, preferably consisting of The polynucleotide sequence of the HBV PreS2.S antigen composed of the amino acid sequence has a polynucleotide sequence of SEQ ID NO: 13 or IRES of 14, encoding an amino acid sequence of SEQ ID NO: 9, preferably The polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO: 86, Preferably, the polynucleotide sequence of the HBV core antigen composed of the amino acid sequence; (18) encoding the polynucleotide sequence of the HBV PreS2.S antigen with the amino acid sequence SEQ ID NO: 5, having a polynucleotide sequence The IRES of nucleotide sequence SEQ ID NO:14, encoding has amino acid sequence SE Q ID NO: 7. Preferably, the polynucleotide sequence of the HBV core antigen consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86, encoding the polynucleotide sequence of the P2A amino acid sequence of SEQ ID NO: 11 An acid sequence, and a polynucleotide sequence encoding an HBV polymerase antigen having an amino acid sequence of SEQ ID NO: 9, preferably consisting of the amino acid sequence; (19) encoding an amino acid sequence of SEQ ID NO : 9, preferably the polynucleotide sequence of the HBV polymerase antigen that is made up of this amino acid sequence, the polynucleotide sequence of encoding P2A amino acid sequence SEQ ID NO: 11, encoding has amino acid sequence SEQ ID NO: 7. The polynucleotide sequence of the HBV core antigen preferably consisting of the amino acid sequence of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 13 or 14, And encoding has the amino acid sequence of SEQ ID NO: 5, preferably the polynucleotide sequence of the HBV PreS2.S antigen consisting of the amino acid sequence; (20) encoding has the amino acid sequence of SEQ ID NO: 7 , preferably the polynucleotide sequence of the HBV core antigen composed of the amino acid sequence SEQ ID NO: 84, 85 or 86, encoding the polynucleotide sequence of the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having Amino acid sequence SEQ ID NO: 9, the polynucleotide sequence of the HBV polymerase antigen preferably composed of the amino acid sequence, the IRES with the polynucleotide sequence SEQ ID NO: 13 or 14, and the encoding Has the amino acid sequence of SEQ ID NO: 5, preferably the polynucleotide sequence of the HBV PreS2.S antigen composed of the amino acid sequence; (21) encoding the amino acid sequence of SEQ ID NO: 5, compared Preferably, the polynucleotide sequence of the HBV PreS2.S antigen composed of the amino acid sequence encodes the polynucleotide sequence of the P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 9. The polynucleotide sequence of the HBV polymerase antigen preferably composed of the amino acid sequence, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the polynucleotide sequence having the amino acid sequence SEQ ID NO: 11 ID NO: 7, preferably the polynucleotide sequence of the HBV core antigen composed of the amino acid sequence SEQ ID NO: 84, 85 or 86; (22) encoding the amino acid sequence of SEQ ID NO: 5, compared Preferably, the polynucleotide sequence of the HBV PreS2.S antigen composed of the amino acid sequence encodes the polynucleotide sequence of the P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 7. Preferably, the amino acid sequence of SEQ ID NO: 84, The polynucleotide sequence of the HBV core antigen composed of 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO: 9, preferably composed of The polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence; (23) coding has the amino acid sequence SEQ ID NO: 9, preferably the polynucleotide sequence of the HBV polymerase antigen composed of the amino acid sequence Nucleotide sequence, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding has amino acid sequence SEQ ID NO: 7, preferably by amino acid sequence SEQ ID NO: 84,85 Or the polynucleotide sequence of the HBV core antigen composed of 86, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, and coding has the amino acid sequence of SEQ ID NO: 5, preferably by the The polynucleotide sequence of HBV PreS2.S antigen composed of amino acid sequence; The polynucleotide sequence of the HBV core antigen composed of 86, encoding the polynucleotide sequence of P2A amino acid sequence SEQ ID NO: 11, encoding the amino acid sequence SEQ ID NO: 9, preferably by the amino acid sequence The polynucleotide sequence of the HBV polymerase antigen composed of the acid sequence, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO: 5, preferably composed of The polynucleotide sequence of the HBV PreS2.S antigen composed of the amino acid sequence.

In some embodiments, each HBV antigen is independently operably linked to or contains a signal peptide sequence for secretion. Any suitable signal peptide sequence can be used. Preferably, for each of the HBV PreS1 antigen, HBV core antigen and HBV pol antigen, a signal peptide is operably linked to the N-terminus of the antigen sequence. In some embodiments, the signal peptide contains the amino acid sequence of SEQ ID NO: 77, preferably, the signal peptide is encoded by the nucleotide sequence of SEQ ID NO: 90.

In some embodiments, the nucleic acid molecule comprises any one of the non-naturally occurring polynucleotide sequences SEQ ID NO: 15-54. In some embodiments, the nucleic acid molecule comprises at least two non-naturally occurring polynucleotide sequences of SEQ ID NO: 15-54.

The present application also relates to a vector comprising a non-naturally occurring polynucleotide encoding an HBV antigen. As used herein, a "vector" is a nucleic acid molecule used to carry genetic material into another cell where it can be replicated and/or expressed. According to the present invention, any vector known to those skilled in the art may be used. Examples of vectors include, but are not limited to, plastids, viral vectors (bacteriophage, animal viruses, and plant viruses), myxoplasts, and artificial chromosomes (eg, YAC). Preferably, the vector is a DNA plasmid. A vector can be a DNA vector or an RNA vector. Those of ordinary skill in the art can construct the vectors of the present application according to the present invention via standard recombinant techniques.

The carrier of the present application may be an expression carrier. As used herein, the term "expression vector" refers to any type of genetic construct comprising nucleic acid encoding RNA capable of transcription. Expression vectors include, but are not limited to, vectors for expression of recombinant proteins, such as DNA plastids or viral vectors, and vectors, such as DNA plastids or viral vectors, for delivery of nucleic acids into an individual for expression in the individual's tissues. Those skilled in the art will understand that the design of expression vectors may depend on factors such as the choice of host cells to be transformed, the expression level of the desired protein, and the like.

The vectors of the present application may contain a variety of regulatory sequences. As used herein, the term "regulatory sequence" means to allow, facilitate or regulate the regulation of the function of a nucleic acid molecule, including replication, repetition, transcription, splicing, Any sequence for translation, stability and/or transport. In the context of the present invention, the term encompasses promoters, enhancers and other expression control elements such as polyadenylation signals and elements affecting mRNA stability.

In some embodiments of the present application, the vector is a non-viral vector. Examples of non-viral vectors include, but are not limited to, DNA plasmids, bacterial artificial chromosomes, yeast artificial chromosomes, bacteriophage, and the like. Preferably, the non-viral vector is a DNA plasmid. "DNA plastid" is used interchangeably with "DNA plastid vector", "plastid DNA" or "plastid DNA vector" and refers to a substantially circular double-stranded DNA sequence capable of autonomous replication in a suitable host cell. DNA plasmids used to express encoded polynucleotides typically comprise an origin of replication, a multiplex colony site, and a selectable marker, such as an antibiotic resistance gene. Examples of suitable DNA plasmids that can be used include, but are not limited to, commercially available expression vectors for use in well-known expression systems, including both prokaryotic and eukaryotic systems, such as pSE420 (Invitrogen, San Diego, Calif.), which can be used to produce and/or express proteins in E. coli; pYES2 (Invitrogen, Thermo Fisher Scientific), which can be used to produce and/or express proteins in the yeast strain Saccharomyces cerevisiae; ^MAXBAC® complete baculovirus expression system ( Thermo Fisher Scientific), which can be used for production and/or expression in insect cells; pcDNA ^™ or pcDNA3 ^™ (Life Technologies, Thermo Fisher Scientific), which can be used for high-level constitutive protein expression in mammalian cells; and pVAX or pVAX-1 (Life Technologies, Thermo Fisher Scientific), which can be used to transiently express proteins of interest at high levels in most mammalian cells. The backbone of any commercially available DNA plasmid can be modified to optimize protein expression in the host cell by using conventional techniques and readily available starting materials in order to reverse certain elements such as the origin of replication and/or antibiotic resistance cassette), replacement of a plastid-endogenous promoter (such as a promoter in an antibiotic resistance cassette), and/or replacement of a polynucleotide sequence encoding a transcriptional protein (such as that of an antibiotic resistance gene sequence). (See, eg, Sambrook et al., Molecular Cloning a Laboratory Manual, Second Ed. Cold Spring Harbor Press (1989)).

Preferably, DNA plasmids are expression vectors suitable for expressing proteins in mammalian host cells. Expression vectors suitable for expressing proteins in mammalian host cells include, but are not limited to, pcDNA ^™ , pcDNA3 ^™ , pVAX, pVAX-1, ADVAX, NTC8454, and the like. Preferably, the expression vector is based on pVAX-1, which can be further modified to optimize protein expression in mammalian cells. pVAX-1 is a commonly used plastid in DNA vaccines and contains a strong human immediate early cytomegalovirus (CMV-IE) promoter followed by a bovine growth hormone (bGH)-derived polyadenylation sequence (pA). pVAX-1 further contains the pUC origin of replication and a convinyl resistance gene driven by a small prokaryotic promoter that allows bacterial plastid propagation.

The vector of the present application may also be a viral vector. In general, a viral vector is a genetically engineered virus that carries a modified viral DNA or RNA that has been rendered non-infectious but still contains a viral promoter and transgenic gene, thereby allowing viral initiation Subtranslation of the transgene. Because viral vectors often lack infectious sequences, they require helper viruses or encapsulated strains for large-scale transfection. In certain embodiments, a vector as described herein is, for example, a recombinant adenovirus, a recombinant retrovirus, a recombinant poxvirus such as a pox virus (e.g., modified vaccinia Ankara (MVA)), a recombinant pox virus such as Semliki Forest virus A recombinant alphavirus, a recombinant paramyxovirus such as a recombinant measles virus, or another recombinant virus. Examples of viral vectors that may be used include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, poxvirus vectors, enterovirus vectors, Venezuelan equine encephalitis virus vectors, Semliki Forest virus vectors, tobacco mosaic virus vectors, Lentiviral vectors, etc. In certain embodiments, vectors as described herein are MVA vectors. The vector can also be a non-viral vector.

In some embodiments, the viral vector is an adenoviral vector, such as a recombinant adenoviral vector. Recombinant adenoviral vectors may eg be derived from human adenoviruses (HAdV or AdHu), or monkey adenoviruses, such as chimpanzee or gorilla adenoviruses (ChAd, AdCh or SAdV) or rhesus monkey adenoviruses (rhAd). Preferably, the adenovirus vector is a recombinant human adenovirus vector, such as recombinant human adenovirus serotype 26, or any one of recombinant human adenovirus serotypes 5, 4, 35, 7, 48 and the like. In other embodiments, the adenoviral vector is a rhAd vector, such as rhAd51, rhAd52 or rhAd53. Recombinant viral vectors useful in this application can be prepared according to the present invention using methods known in the art. For example, considering the degeneracy of the genetic code, several nucleic acid sequences encoding the same polypeptide can be designed. Polynucleotides encoding the HBV antigens of the present application may optionally be codon optimized to ensure proper expression in host cells (eg bacterial or mammalian cells). Codon optimization is a widely used technique in the art, and methods for obtaining codon-optimized polynucleotides will be known to those skilled in the art from the present invention.

The vectors of the present application, such as DNA plasmids or viral vectors (specifically, adenoviral vectors), may contain any regulatory elements to produce the conventional functions of the vector, including but not limited to, those encoded by the polynucleotide sequence of the vector. Replication and expression of HBV antigen. Regulatory elements include, but are not limited to, promoters, enhancers, polyadenylation signals, translation stop codons, ribosome binding elements, transcription terminators, selectable markers, origins of replication, and the like. A carrier may contain one or more presentation cassettes. An "expression cassette" is the portion of a vector that directs the cellular machinery to produce RNA and protein. An expression cassette generally comprises three components: a promoter sequence, an open reading frame, and a 3' untranslated region (UTR) optionally including a polyadenylation signal. An open reading frame (ORF) is the reading frame comprising the coding sequence of a protein of interest (eg, HBV antigen) from a start codon to a stop codon. The regulatory element of the expression cassette can be operably linked to a polynucleotide sequence encoding an HBV antigen of interest. As used herein, the term "operably linked" is to be interpreted in the broadest reasonable sense and refers to the linkage of polynucleotide elements in a functional relationship. A polynucleotide is "operably linked" when it is placed in a functional relationship with another polynucleotide. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription of the coding sequence. Any of the components suitable for use in the presentation cassettes described herein may be used in any combination and in any order to prepare the vectors of the present application.

The vector may preferably contain a promoter sequence within the expression cassette to control the expression of the HBV antigen of interest. The term "promoter" is used in the conventional sense and refers to a nucleotide sequence that initiates the transcription of an operably linked nucleotide sequence. The promoters are located on the same strand adjacent to the nucleotide sequence from which they are transcribed. Promoters can be constitutive, inducible or repressible. Promoters can be naturally occurring or synthetic. Promoters can be derived from sources including viruses, bacteria, fungi, plants, insects and animals. The promoter can be a homologous promoter (ie, derived from the same gene source as the vector) or a heterologous promoter (ie, derived from a different vector or gene source). For example, if the vector to be employed is a DNA plastid, the promoter may be endogenous to the plastid (homologous) or derived from another source (heterologous). Preferably, the promoter is located upstream of the polynucleotide encoding the HBV antigen in the expression cassette.

Examples of promoters that can be used include, but are not limited to, promoters from Simian Virus 40 (SV40); mouse mammary tumor virus (MMTV) promoters; human immunodeficiency virus (HIV) promoters such as bovine immunodeficiency virus (BIV) Long terminal repeat (LTR) promoters; Moloney virus promoters; avian leukemia virus (ALV) promoters; cytomegalovirus (CMV) promoters, such as the CMV immediate early promoter (CMV-IE) ; Epstein Barr virus (Epstein Barr virus; EBV) promoter; or Rous sarcoma virus (Rous sarcoma virus; RSV) promoter. The promoter may also be from a human gene, such as a promoter for human actin, human myosin, human hemoglobin, human muscle creatine, or human metallothionein. The promoter may also be a natural or synthetic tissue specific promoter, such as a muscle or skin specific promoter. Preferably, the promoter is a 26S subgenome promoter or a T7 promoter. The nucleotide sequence of an exemplary 26S subgenic promoter is shown in SEQ ID NO:62. The nucleotide sequence of an exemplary T7 promoter is shown in SEQ ID NO:73.

The vector may contain additional polynucleotide sequences that stabilize expressed transcripts, enhance nuclear export of RNA transcripts, and/or improve transcription-translation coupling. Examples of such sequences include polyadenylation signal and enhancer sequences. The polyadenylation signal is usually located downstream of the coding sequence for the protein of interest (eg, HBV antigen) within the expression cassette of the vector. Enhancer sequences are regulatory DNA sequences that, upon binding by a transcription factor, enhance the transcription of an associated gene. The enhancer sequence is preferably located upstream of the polynucleotide sequence encoding the HBV antigen, but downstream of the promoter sequence, within the expression cassette of the vector.

According to the present invention, any polyadenylation signal known to those skilled in the art may be used. For example, the polyadenylation signal can be the SV40 polyadenylation signal (e.g., SEQ ID NO: 64), the LTR polyadenylation signal, the bovine growth hormone (bGH) polyadenylation signal, the human growth hormone (hGH ) polyadenylation signal or human β-hemoglobin polyadenylation signal. Preferably, the polyadenylation signal is an SV40 polyadenylation signal. The nucleotide sequence of an exemplary SV40 polyadenylation signal is shown in SEQ ID NO:64.

Any enhancer sequence known to those skilled in the art may be used in accordance with the present invention. For example, the enhancer sequence can be human actin, human myosin, human hemoglobin, human muscle creatine, or a viral enhancer, such as from CMV, HA, RSV or EBV. Examples of specific enhancers include, but are not limited to, woodchuck HBV post-transcriptional regulatory elements (WPRE), intron/exon sequences derived from human apolipoprotein A1 precursor (ApoAI), human T-cell leukemia virus type 1 (HTLV-1) non-translated R-U5 domain of long terminal repeat (LTR), splice enhancer, synthetic rabbit β-hemoglobin intron, or any combination thereof.

A vector may comprise a polynucleotide sequence encoding a signal peptide sequence. Preferably, the polynucleotide sequence encoding the signal peptide sequence is located upstream of the polynucleotide sequence encoding the HBV antigen. Signal peptides generally direct the localization of proteins, facilitate protein secretion from protein-producing cells, and/or improve antigen presentation and cross-presentation to antigen-presenting cells. The signal peptide may be present at the N-terminus of the HBV antigen when expressed from the vector, but is cleaved, for example, by a signal peptidase when secreted from the cell. Expressed proteins in which the signal peptide has been cleaved are often referred to as "mature proteins". According to the present invention, any signal peptide known in the art may be used. For example, the signal peptide may be a cystin S signal peptide; an immunoglobulin (Ig) secretion signal, such as a cystin S signal peptide, an Ig heavy chain gamma signal peptide SPIgG or an Ig heavy chain epsilon signal peptide SPIgE.

Vectors such as DNA plastids may also include a bacterial origin of replication and an antibiotic resistance expression cassette for selection and maintenance of plastids in bacterial cells such as E. coli. The bacterial origin of replication and the antibiotic resistance cassette can be positioned in the vector in the same orientation as the expression cassette encoding the HBV antigen or in the opposite (retro) orientation. The origin of replication (ORI) is the sequence at which replication begins that enables plastids to replicate and survive within the cell. Examples of ORIs suitable for use in this application include, but are not limited to, ColE1, pMB1, pUC, pSC101, R6K and 15A, preferably pUC.

Expression cassettes for selection and maintenance in bacterial cells typically include a promoter sequence operably linked to an antibiotic resistance gene. Preferably, the promoter sequence operably linked to the antibiotic resistance gene is different from the promoter sequence operably linked to the polynucleotide sequence encoding the protein of interest (eg, HBV antigen). Antibiotic resistance genes can be codon-optimized, and the sequence composition of antibiotic resistance genes is often adjusted for the codon usage of bacteria such as E. coli. In accordance with the present invention, any antibiotic resistance gene known to those skilled in the art may be used, including but not limited to Kanridine resistance gene (Kan ^r ), ampicillin resistance gene (Amp ^r ), and tetracycline resistance gene A gene (Tet ^r ), and a gene conferring resistance to chloramphenicol, bleomycin, spectinomycin, carbenicillin, and the like.

The polynucleotide encoding the HBV antigen of the present application and the expression vector can be prepared by any method known in the art according to the present invention. For example, polynucleotides encoding HBV antigens can be introduced or "cloned" into expression vectors using standard molecular biology techniques well known to those skilled in the art (eg, polymerase chain reaction (PCR), etc.). RNA replicon

Preferably, the vector is a self-replicating RNA replicon. As used herein, a "self-replicating RNA molecule" used interchangeably with "self-amplifying RNA molecule" or "RNA replicon" or "replicon RNA" or "saRNA" refers to A cell's RNA that allows it to direct within the cell all the genetic information it needs to self-amplify, or self-replicate. Self-replicating RNA molecules are similar to mRNA. It is single-stranded, 5' capped and 3' polyadenylated and has a positive orientation. To direct its own replication, an RNA molecule 1) encodes a polymerase, replicase, or other protein that interacts with viral or host cell-derived proteins, nucleic acids, or ribonucleoproteins to catalyze the RNA amplification process; and 2) contains a replication and A cis-acting RNA sequence required for the transcription of RNA encoded by a subgenomic replicon. Thus, the delivered RNA results in the production of multiple daughter RNAs. These daughter RNAs and collinear subgenomic transcripts may themselves be translated to provide in situ expression of the gene of interest, or may be transcribed to provide the same expression as the delivered RNA that is translated to provide in situ expression of the gene of interest. Significant other transcripts. The overall result of transcription of this sequence is a massive expansion in the number of introduced replicon RNAs, and thus the encoded gene of interest becomes the major polypeptide product of the cell.

RNA replicon 1) encodes an RNA-dependent RNA polymerase that interacts with viral or host cell-derived proteins, nucleic acids, or ribonucleoproteins to catalyze the RNA amplification process, and the nonstructural proteins nsP1, nsP2, nsP3, nsP4; and 2) Contains cis-acting RNA sequences required for replication and transcription of genosome and subgenome RNA, such as 3' and 5' untranslated regions (UTR; alphavirus nucleotides for nonstructural protein-mediated amplification sequence), and/or subgenome promoters. These sequences may be incorporated into autoencoded or non-autoencoded cell-derived proteins, nucleic acids, or ribonucleoproteins, or complexes between any of these components, during the replication process. In some embodiments, a modified RNA replicon molecule typically contains the following ordered elements: 5' viral RNA sequences required for replication in cis (e.g., 5'UTR and 5'CSE); sequences encoding biologically active nonstructural proteins (e.g. nsP1234); promoter for transcription of subgenomic RNA; 3' viral sequences required for replication in cis (e.g. 3'UTR); and polyadenylation pipeline; A sequence (or two or more sequences) encoding a heterologous protein or peptide follows or is under the control of the promoter. Additionally, the term RNA replicon may refer to a sense (or messenger sense) molecule and the length of the RNA replicon may differ from that of any known naturally occurring RNA virus. In any embodiment of the present invention, the RNA replicon may lack (or not contain) the sequence of at least one (or all) structural viral proteins (eg nucleocapsid protein C and envelope proteins P62, 6K and E1). In these embodiments, the sequence encoding one or more structural genes may be replaced by one or more heterologous sequences, such as at least one heterologous protein or peptide (or other gene of interest (GOI)) the coding sequence.

In certain embodiments, the RNA replicons of the present application are ordered from the 5' end to the 3' end comprising: (1) the 5' untranslated region (5') required for amplification mediated by non-structural proteins of RNA viruses -UTR); (2) at least one polynucleotide sequence of coding RNA virus, preferably all non-structural proteins; (3) subgenome promoter of RNA virus; (4) polynucleotide coding HBV antigen sequence; and (5) the 3' untranslated region (3'-UTR) required for nonstructural protein-mediated amplification of RNA viruses.

In certain embodiments, the self-replicating RNA molecule encodes a self-amplifying enzyme complex (replicase polymerase protein) comprising RNA-dependent RNA polymerase function, helicase, capping and polyadenylation activities. The viral structural genes downstream of the replicase under the control of subgenome promoters can be replaced by HBV antigens. Immediately after transfection, the replicase is translated, interacts with the 5' and 3' ends of the gene body RNA, and synthesizes a complementary copy of the gene body RNA. These copies serve as templates for the synthesis of novel primary, capped and polyadenylated gene body copies and subgenome transcripts. Amplification ultimately yields extremely high RNA copy numbers of up to ² x 105 copies per cell. Thus, much lower amounts of saRNA compared to conventional mRNA are sufficient for effective gene transfer and protective vaccination (Beissert et al., Hum Gene Ther. 2017, 28(12): 1138-1146).

Subgenomic RNA is an RNA molecule that is smaller in length or size than the genomic RNA from which it was derived. Viral subgenomic RNA can be transcribed from an internal promoter whose sequence is present within the genosome RNA or its complement. Transcription of subgenomic RNA can be mediated by a virally encoded polymerase associated with a host cell encoded protein, ribonucleoprotein, or a combination thereof. Many RNA viruses produce subgenomic mRNA (sgRNA) for expression of their proximal 3' genes.

In some embodiments of the invention, HBV antigens are expressed under the control of a subgenic promoter. In certain embodiments, instead of the native subgenic promoter, the subgenic RNA can be in a sequence derived from encephalomyocarditis virus (EMCV), bovine viral diarrhea virus (BVDV), poliovirus, foot-and-mouth disease virus (FMD), Under the control of the internal ribosome entry site (IRES) of enterovirus 71 (EV71) or hepatitis C virus. Subgenomic promoters range from 24 nucleotides (Sindbis virus) to over 100 nucleotides (Beet necrotic yellow vein virus) and are usually found upstream of the initiation of transcription.

In some embodiments, the RNA replicon includes coding sequences for at least one, at least two, at least three, or at least four nonstructural viral proteins (eg, nsP1, nsP2, nsP3, nsP4). The alphavirus genome encodes the nonstructural proteins nsP1, nsP2, nsP3, and nsP4, which are produced as a single polymeric protein precursor, sometimes called P1234 (or nsP1-4, or nsP1234), and are cleaved to the mature protein by proteolytic processing . nsP1 may be approximately 60 kDa in size and may possess methyltransferase activity and participate in viral capping reactions. nsP2 is about 90 kDa in size and can have helicase and protease activities, while nsP3 is about 60 kDa and contains three domains: a macrodomain, a central (or alphavirus-unique) domain, and a hypervariable domain (HVD). nsP4 is approximately 70 kDa in size and contains the core RNA-dependent RNA polymerase (RdRp) catalytic domain. Following infection, alphavirus genome RNA is translated to yield the P1234 polymeric protein, which is cleaved into individual proteins. When disclosing a nucleic acid or polypeptide sequence herein, such as the sequence of nsP1, nsP2, nsP3, nsP4, sequences which are considered to be based on or derived from the original sequence are also disclosed.

In some embodiments, the RNA replicon includes a coding sequence for a portion of at least one nonstructural viral protein. For example, an RNA replicon can include about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% of the coding sequence for at least one nonstructural viral protein , 100% or within the range between any two of these values. In some embodiments, an RNA replicon can include a coding sequence for a substantial portion of at least one nonstructural viral protein. As used herein, a "substantial portion" of a nucleic acid sequence encoding a nonstructural viral protein comprises sufficient nucleic acid sequence encoding a nonstructural viral protein to allow for manual evaluation of the sequence by a person skilled in the art or by computerized automated sequence comparison A putative identification of that protein is made and can be identified using an algorithm such as BLAST (see, eg, "Basic Local Alignment Search Tool"; Altschul S F et al., J. Mol. Biol. 215:403-410, 1993). In some embodiments, an RNA replicon can include the entire coding sequence of at least one nonstructural protein. In some embodiments, the RNA replicon comprises substantially all coding sequences for the nonstructural proteins of the protovirus. In certain embodiments, one or more nonstructural viral proteins are derived from the same virus. In other embodiments, one or more nonstructural proteins are derived from different viruses.

The RNA replicon can be derived from any suitable positive-sense RNA virus, such as an alphavirus or a flavivirus. Preferably, the RNA replicon is derived from an alphavirus. The term "alphavirus" describes enveloped single-stranded positive-sense RNA viruses of the Togaviridae family. The Alphavirus genus contains about 30 members and can infect humans as well as other animals. Alphavirions typically have a diameter of 70 nm, tend to be spherical or slightly pleomorphic, and have a 40 nm equiangular nucleocapsid. The total genome length of alphaviruses ranges between 11,000 and 12,000 nucleotides and has a 5' cap and a 3' polyA tail. There are two open reading frames (ORFs) in the nonstructural (ns) and structural gene bodies. The ns ORFs encode proteins (nsP1 to nsP4) required for the transcription and replication of viral RNA. Structure ORF encodes three structural proteins: core nucleocapsid protein C, and envelope proteins P62 and El combined into a heterodimer. Surface glycoproteins anchored to the viral membrane are responsible for receptor recognition and entry into target cells via membrane fusion. Four ns protein genes are encoded by genes in the 5' two-thirds of the gene body, while three structural proteins are translated by subgenome mRNAs that are collinear with the 3' third of the gene body.

In some embodiments, self-replicating RNA suitable for use in the present invention is an RNA replicon derived from an alphavirus species. In some embodiments, the alphavirus RNA replicon has an alphavirus belonging to the VEEV/EEEV group or the SF group or the SIN group. Non-limiting examples of alphaviruses of the SF group include Semliki Forest virus, O'Neill virus, Ross River virus, Middleburg virus, Chugong virus, Bama Forest virus, Geta virus, Mayaro virus, Heron virus, virus, Bebaru virus, and Una virus. Non-limiting examples of SIN group alphaviruses include Sindbis virus, Girdwood S. A. virus in Alaska, South African Arbovirus No. 86, Ockelbo virus virus), Aura virus, Babunki virus, Vodaro virus and Kzeragzi virus. Non-limiting examples of alphaviruses of the VEEV/EEEV group include Eastern Equine Encephalitis Virus (EEEV), Venezuelan Equine Encephalitis Virus (VEEV), Everglades Swamp Virus (EVEV), Mukambu Virus (MUCV), Pichun Navirus (PIXV), Middleburg virus (MIDV), Chikung virus (CHIKV), Onion virus (ONNV), Ross River virus (RRV), Bama Forest virus (BF), Getta virus (GET) , Heron virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV) and Una virus (UNAV).

Non-limiting examples of alphavirus species include Eastern Equine Encephalitis Virus (EEEV), Venezuelan Equine Encephalitis Virus (VEEV), Everglades Swamp Virus (EVEV), Mukambu Virus (MUCV), Semliki Forest Virus (SFV), Pichuna virus (PIXV), Middleburg virus (MIDV), Chikungun virus (CHIKV), Onion virus (ONNV), Ross River virus (RRV), Bama Forest virus (BF) , Geta virus (GET), Lushan virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus ( AURAV), Vodaro virus (WHAV), Babangi virus (BABV), Kezeragzi virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (HJV), Fort Morgan virus ( FMV), Endum virus (NDUV) and Bogey River virus. Both virulent and avirulent alphavirus strains are suitable. In some embodiments, the alphavirus RNA replicon is Sindbis virus (SIN), Semliki Forest virus (SFV), Ross River virus (RRV), Venezuelan equine encephalitis virus (VEEV), or Eastern equine encephalitis virus (VEEV). inflammatory virus (EEEV). In some embodiments, the alphavirus RNA replicon is of Venezuelan equine encephalitis virus (VEEV).

In certain embodiments, the self-replicating RNA molecule comprises a polynucleotide encoding one or more nonstructural proteins nsP1-4, a subgenome promoter (such as the 26S subgenome promoter) and an HBV antigen encoding HBV antigen described herein. Genes of interest or fragments thereof.

A self-replicating RNA molecule may have a 5' end cap (eg, 7-methylguanosine). This end cap can enhance in vivo translation of RNA.

The 5' nucleotides of self-replicating RNA molecules suitable for use in the invention may have a 5' triphosphate group. In capped RNAs, this can be via a 5'-to-5' bridge to 7-methylguanosine. 5' triphosphates enhance RIG-I binding.

Self-replicating RNA molecules can have a 3' polyadenylation tail. It may also include a polyadenylate polymerase recognition sequence (eg AAUAAA) near its 3' end.

In any of the embodiments of the invention, the RNA replicon may lack (or not contain) at least one (or all) structural viral proteins (such as nucleocapsid protein C, and envelope proteins P62, 6K, and E1 ) coding sequence. In such embodiments, the sequence encoding one or more structural genes may be replaced by one or more heterologous sequences, such as the coding sequences of the HBV antigens or fragments thereof described herein.

In certain embodiments, the self-replicating RNA vectors of the present application comprise one or more features to confer resistance to translational inhibition or otherwise increase expression of GOIs (eg, HBV antigens) by the innate immune system.

In certain embodiments, RNA sequences can be codon optimized to increase translation efficiency. RNA molecules can be prepared according to the present invention by any method known in the art, such as by adding, for example, a polyadenylation tail with at least 30 adenosine residues; and/or with modified ribonucleotides, for example 7 - Methylguanosine end cap Modification of the 5-terminus by capping to enhance stability and/or translation, which can be incorporated during RNA synthesis or enzymatically engineered after RNA transcription.

In certain embodiments, the RNA replicons of the present application are sequenced from 5' to 3', including: (1) alphavirus 5' untranslated region (5'-UTR), (2) alphavirus non-structural genes The 5' replication sequence of nsp1, (3) the downstream loop (DLP) motif of the virus species, (4) the polynucleotide sequence encoding the fourth autoprotease peptide, (5) the alphavirus nonstructural proteins nsp1, nsp2 , nsp3 and nsp4 polynucleotide sequences, (6) alpha virus subgenome promoter, (7) non-naturally occurring polynucleotide sequences encoding one or more HBV antigens of the present application, (8) Alphavirus 3' untranslated region (3' UTR), and (9) optionally polyadenylation sequences.

In certain embodiments, the self-replicating RNA vectors of the present application comprise a downstream loop (DLP) motif of a viral species. As used herein, a "downstream loop" or "DLP motif" refers to a polynucleotide sequence comprising at least one RNA stem-loop that is placed in an open loop compared to an otherwise identical construct without a DLP motif. Increased translation of the ORF is provided when the reading frame (ORF) is downstream of the initiation codon. As an example, members of the alphavirus genus can resist activation of the antiviral RNA-activated protein kinase (PKR) by virtue of prominent RNA structures present within viral 26S transcripts, allowing eIF2-independent translation initiation of these mRNAs. This structure, called the downstream loop (DLP), is located downstream of the AUG in the SINV 26S mRNA. DLP has also been detected in Semliki Forest Virus (SFV). Similar DLP structures have been reported to exist in both new world (e.g. MAYV, UNAV, EEEV (NA), EEEV (SA), AURAV) and old world (SV, SFV, BEBV, RRV, SAG, GETV, MIDV, CHIKV, and ONNV) Members of the Alphavirus genus among at least 14 other members. The predicted structures of these alphavirus 26S mRNAs were constructed based on SHAPE (Selective 2'-Hydroxylation and Primer Extension) data (Toribio et al., Nucleic Acids Res. May 19; 44(9):4368-80, 2016 ), the contents of which are incorporated herein by reference. Stable stem-loop structures were detected in all cases except CHIKV and ONNV, whereas MAYV and EEEV showed less stable DLPs (Toribio et al., 2016, supra). In the case of Sindbis virus, the DLP motif was found 150 nt before the Sindbis subgenomic RNA. The hairpin is located downstream of the AUG initiation codon of the Sindbis capsid (AUG is sequenced at nt 50 of the Sindbis subgenic RNA). Previous studies of sequence comparison and structural RNA analysis revealed the evolutionary conservation of DLP in SINV and predicted the existence of equivalent DLP structures in many members of the alphavirus genus (see e.g. Ventoso, J. Virol. 9484-9494, Vol. 86, 2012 September). Examples of self-replicating RNA vectors comprising DLP motifs are described in US Patent Application Publication US2018/0171340 and International Patent Application Publication WO2018106615, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the replicon RNA of the present application comprises a sequence exhibiting at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or DLP motifs with 100% sequence identity.

In one embodiment, the self-replicating RNA molecule also contains a nonstructural protein (such as one or more of nsP1-4) or a gene of interest (such as the HBV antigen described herein) operably linked to the downstream of the DLP motif. ) coding sequence of the autologous protease peptide upstream of the coding sequence. Examples of autologous protease peptides include, but are not limited to, peptide sequences selected from the group consisting of: Porcine Tesguvirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Cytoplasmic polyhedrosis virus 2A (T2A), Cytoplasmic polyhedrosis virus 2A (BmCPV2A), Silkworm softening disease virus 2A (BmIFV2A) and combinations thereof. In some embodiments, the replicon RNA of the present application comprises the coding sequence of P2A having the amino acid sequence of SEQ ID NO: 11. Preferably, the coding sequence exhibits at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 12.

Any of the replicons of the invention may also comprise 5' and 3' untranslated regions (UTRs). The UTR can be a wild-type New World or Old World alphavirus UTR sequence, or a sequence derived from either. In various embodiments, the 5'UTR can be of any suitable length, such as about 60 nt or 50-70 nt or 40-80 nt. In some embodiments, the 5'UTR can also have a conserved primary or secondary structure (eg, one or more stem-loops) and can participate in the replication of alphavirus or replicon RNA. In some embodiments, the 3'UTR can be up to a few hundred nucleotides, for example it can be 50 to 900 or 100 to 900 or 50 to 800 or 100 to 700 or 200 to 700 nt. The 3' UTR may also have secondary structure, such as a stepped loop, and may be followed by a polyadenylation tract or polyadenylation tail. In any of the embodiments of the invention, the 5' and 3' untranslated regions can be operably linked to any of the other sequences encoded by the replicon. A UTR can be operably linked to a promoter and/or sequence encoding a heterologous protein or peptide by providing the sequences and spacers required for recognition and transcription of other encoded sequences. According to the present invention, any polyadenylation signal known to those skilled in the art may be used. For example, the polyadenylation signal can be an SV40 polyadenylation signal, an LTR polyadenylation signal, a bovine growth hormone (bGH) polyadenylation signal, a human growth hormone (hGH) polyadenylation signal, or a human growth hormone (hGH) polyadenylation signal. Beta-hemoglobin polyadenylation signal.

In another embodiment, the self-replicating RNA replicon of the present application comprises a modified 5' untranslated region (5'-UTR), preferably, the RNA replicon does not contain the nucleic acid sequence encoding the viral structural protein at least partly. For example, a modified 5'-UTR may comprise one or more nucleotide substitutions at positions 1, 2, 4, or a combination thereof. Preferably, the modified 5'-UTR comprises a nucleotide substitution at position 2, more preferably, the modified 5'-UTR has a U->G or U->A substitution at position 2. Examples of such self-replicating RNA molecules are described in US Patent Application Publication US2018/0104359 and International Patent Application Publication WO2018075235, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the replicon RNA of the present application exhibits at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 5'-UTR with 100% sequence identity.

In some embodiments, the RNA replicons of the present application are sequenced from 5' to 3' ends comprising: (1) 5'-UTR having a polynucleotide sequence of SEQ ID NO: 55, (2) having a polynucleus The 5' copy sequence of the nucleotide sequence SEQ ID NO: 56, (3) the DLP motif comprising the polynucleotide sequence SEQ ID NO: 57, (4) the polynucleotide encoding the P2A sequence of SEQ ID NO: 11 Sequence, (5) polynucleotide sequences encoding alpha virus non-structural proteins nsp1, nsp2, nsp3 and nsp4, respectively having nucleic acid sequences SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 and SEQ ID NO : 61, (6) a subgenic body promoter having the polynucleotide sequence SEQ ID NO: 62, (7) a non-naturally occurring polynucleotide sequence as described herein, and (8) having a polynucleoside Acid sequence SEQ ID NO: 3' UTR of 63. In some embodiments, the polynucleotide sequence encoding the P2A sequence comprises SEQ ID NO: 12, the non-naturally occurring polynucleotide sequence comprises any one of the polynucleotide sequences SEQ ID NO: 15 to 54, And the RNA replicon further comprises a polyadenosine sequence. Preferably, the polyadenosine sequence has the sequence SEQ ID NO: 64 at the 3' end of the replicon.

In some preferred embodiments, the RNA replicon of the present application comprises any one of the polynucleotide sequences SEQ ID NO: 65 to 72.

In some embodiments, the RNA replicon of the present application comprises a polynucleotide sequence encoding a signal peptide sequence. Preferably, the polynucleotide sequence encoding the signal peptide sequence is located upstream or 5' to the polynucleotide sequence encoding HBV antigens (such as HBV PreS1 antigen, HBV core antigen and HBV pol antigen). Signal peptides generally direct the localization of proteins, facilitate protein secretion from protein-producing cells, and/or improve antigen presentation and cross-presentation to antigen-presenting cells. The signal peptide may be present at the N-terminus of the HBV antigen when expressed from the replicon, but is cleaved, for example, by a signal peptidase after secretion from the cell. Expressed proteins in which the signal peptide has been cleaved are often referred to as "mature proteins". According to the present invention, any signal peptide known in the art may be used. For example, the signal peptide may be a cystin S signal peptide; an immunoglobulin (Ig) secretion signal, such as a cystin S signal peptide, an Ig heavy chain gamma signal peptide SPIgG, an Ig heavy chain epsilon signal peptide SPIgE, or a short leader peptide sequence . An exemplary amino acid sequence of a signal peptide is shown in SEQ ID NO:77.

In various embodiments, the RNA replicons disclosed herein can be engineered, synthetic or recombinant RNA replicons. As used herein, the term recombinant means the manual manipulation of any molecule (eg, DNA, RNA, etc.), however indirect or resulting in a polynucleotide. By way of non-limiting example, a cDNA is a recombinant DNA molecule, such as any nucleic acid molecule that has been produced by an in vitro polymerase reaction or that has been ligated or integrated into a vector such as a cloning vector or an expression vector. As a non-limiting example, a recombinant RNA replicon may be one or more of: 1) such as using chemical or enzymatic techniques (such as by using chemical nucleic acid synthesis or by using nucleic acid molecules for replication, polymerization, nucleic acid exonuclease digestion, endonuclease digestion, ligation, reverse transcription, transcription, base modification (including, for example, methylation), or recombination (including homologous and site-specific recombination) enzymes) synthesized in vitro or 2) incorporation of a nucleotide sequence that is not associated in nature; 3) engineering using molecular breeding techniques so that it lacks one or more nucleotides relative to a naturally occurring nucleotide sequence; and 4) using Molecular breeding techniques manipulate one or more sequence changes or rearrangements relative to a naturally occurring nucleotide sequence.

Any of the components or sequences of the RNA replicon can be operably linked to any other component or sequence. Components or sequences of the RNA replicon can be operably linked to express at least one heterologous protein or peptide (or biotherapeutic agent) in the host cell or treated organism and/or to enable the replicon to self-replicate. The term "operably linked" means a functional key between two or more sequences configured to perform their common functions. Thus, a promoter or UTR operably linked to a coding sequence enables transcription and expression of the coding sequence when the appropriate enzyme is present. A promoter need not be adjacent to a coding sequence so long as it functions to direct its expression. Thus, the operable linkage between an RNA sequence encoding a heterologous protein or peptide and a regulatory sequence (such as a promoter or UTR) is a functional linkage that allows expression of the polynucleotide of interest. Operably linked may also refer to sequences such as sequences encoding nsP1-4, UTRs, promoters, and other sequences encoded in RNA replicons being linked such that they are capable of transcription and translation of biotherapeutic molecules and/or replication of the replicon . UTRs can be operably linked by providing the sequences and spacers required for ribosomal recognition and translation of other encoded sequences.

The RNA replicon of the present invention may be derived from an alphavirus genome, which means that it has some structural features of an alphavirus genome, or is similar thereto. The RNA replicon of the present invention may be a modified alphavirus genome. In some embodiments of the replicon disclosed herein, one or more sequences of the replicon may be presented "in trans", that is, the sequence of the replicon is presented on more than one RNA molecule. In other embodiments, all sequences of the replicon are present on a single RNA molecule, which can also be administered to a mammal to be treated as described herein.

As used herein, the term "percent identity" or "homology" or "consensus sequence identity" or "percent sequence identity (%)" with a nucleic acid or polypeptide sequence is defined as the sequence in alignment with the highest percent identity The percentage of nucleotide or amino acid residues in a candidate sequence that are identical to a known polynucleotide or polypeptide, after introducing gaps as necessary to achieve the maximum percentage homology. N-terminal or C-terminal insertions or deletions should not be interpreted as affecting homology, and are less than about 30, less than about 20, or less than about 10, or less than 5 amino acid residues in a nucleotide or polypeptide sequence. Internal deletions and/or insertions should not be interpreted as affecting homology. Nucleotides or amines can be determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithms used by the programs blastp, blastn, blastx, tblastn, and tblastx custom-made for sequence similarity searches Homology or identity at the amino acid sequence level (Altschul (1997), Nucleic Acids Res. 25, 3389-3402, and Karlin (1990), Proc. Natl. Acad. Sci. USA 87, 2264-2268). The methodology used by the BLAST program is to first consider similar segments (with or without gaps) between the query sequence and database sequences, then evaluate the statistical significance of all identified matches, and finally summarize only those that satisfy a preselected significance criterion. Matching of limits. For a discussion of fundamental issues in similarity searches of sequence databases, see Altschul (1994), Nature Genetics 6, 119-129. Search parameters for histograms, descriptions, alignments, expectations (ie, statistical significance thresholds for reporting matches to database sequences), cutoffs, matrices, and filters (low complexity) can be at default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff (1992), Proc. Natl. Acad. Sci. USA 89, 10915-10919), which is recommended for base or amino acid) query sequence.

For blastn designed to compare nucleotide sequences, the scoring matrix is set by the ratio of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), where the ratio of M and N The default values can be +5 and -4 respectively. The four blastn parameters can be adjusted as follows: Q = 10 (gap generation penalty); R = 10 (gap extension penalty); blink = 1 (generate a word hit at each blink location in the query); and gapw = 16 ( Sets the window width in which to generate gap alignments). An equivalent Blastp parameter set for comparing amino acid sequences would be: Q=9; R=2; blink=1; and gapw=32. BESTFIT® comparisons between sequences available in GCG Suite version 10.0 can use the DNA parameters GAP = 50 (gap creation penalty) and LEN = 3 (gap extension penalty), and the equivalent setting in protein comparisons can be GAP = 8 and LEN = 2.

When disclosing nucleic acid or polypeptide sequences herein, such as sequences of viral capsid enhancers, autoprotease peptides, subgenome promoters, nonstructural proteins, HBV antigens, sequences considered based on or derived from the original sequence are also disclosed. The disclosed sequences thus include polynucleosides having sequence identity to the full-length polynucleotide or polypeptide sequences (such as SEQ ID NO: 1-90) and fragments thereof, respectively, of any of the polynucleotide or polypeptide sequences described herein. Acid or polypeptide sequences, for example having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80% or at least 85%, for example at least 86% %, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, At least 99% or 100%, or 85-99%, or 85-95%, or 90-99%, or 95-99%, or 97-99%, or 98-99% sequence identity. Fragments or portions of any of the sequences disclosed herein are also disclosed. A fragment or part of a sequence may comprise a sequence having at least 5, or at least 7, or at least 10, or at least 20, or at least 30, at least 50, at least 75, at least 100 of the complete sequence at least 125, 150 or more, or 5-10, or 10-12, or 10-15, or 15-20, or 20-40, or 20-50, or 30-50, or 30-75, or 30-100 amino acid or nucleic acid residues, or at least 100, or at least 200, or at least 300, or at least 400, or at least 500, or At least 600, or at least 700, or at least 800, or at least 900, or at least 1000, or 100-200, or 100-500, or 100-1000, or 500-1000 amino acids or nucleic acid residues, or any of SEQ ID NO: 1-90 or any of such amounts of any fragment disclosed herein but less than 500, or less than 700, or less than 1000, or Less than 2000 consecutive amino acids or nucleic acids. Variants of such sequences and nucleic acid sequences encoding such variants are also disclosed, for example in which at least one or two or three or four or five amino acid residues have been inserted at the N-terminus and/or C-terminus into And/or within the disclosed sequences containing insertions and substitutions. Contemplated variants may additionally or alternatively include those containing predetermined mutations induced by, for example, homologous recombination or site-directed or PCR mutagenesis, as well as corresponding polypeptides or nucleic acids from other species, including but not limited to: allelic or other naturally occurring variants of the family of polypeptides or nucleic acids that contain insertions and substitutions; and/or derivatives, wherein the polypeptides have been removed by substitution, chemical, enzymatic, or other appropriate means Moieties other than naturally occurring amino acids (eg, detectable moieties, such as enzymes) are covalently modified. The nucleic acid sequences described herein may be RNA sequences. Heterologous proteins and peptides

The RNA replicon of the present invention may include an RNA sequence encoding at least one protein or peptide that is heterologous to an alphavirus and may, but not necessarily, be heterologous to a human, mammalian or animal that expresses the RNA sequence in vivo. In any embodiment, the replicon may have RNA sequences encoding two or three or four or more heterologous proteins or peptides. In some embodiments, the heterologous protein or peptide is an HBV antigen as described herein. In any embodiment, the sequence encoding the heterologous protein or peptide may be operably linked to one or more other sequences of a replicon (such as a promoter or a 5' or 3' UTR sequence) and may be in a subgenic body expression of a heterologous protein or peptide in a human, mammal or animal under the control of a subunit.

In one embodiment, the RNA replicon of the present invention may have an RNA sequence encoding a heterologous protein or peptide (such as a monoclonal antibody or a biotherapeutic protein or peptide); the RNA sequence of the amino acid sequence of the protein sequence; and the 5' and 3' UTR sequences (for non-structural protein-mediated amplification). RNA replicons may also have a 5' cap and a poly adenylate (poly-A) tail.

Immunogenicity of a heterologous protein or peptide can be determined by a variety of assays known to those of ordinary skill, such as immunostaining for intracellular cytokines or cytokines secreted by epitope-specific T cell populations, or by Quantify the frequency and total number of epitope-specific T cells and characterize their differentiation and activation status, such as short half-life effector and memory precursor effector CD8+ T cells. Immunogenicity can also be determined by measuring antibody-mediated immune responses, eg, antibody production by measuring serum IgA or IgG titers.

In addition to the HBV antigen of the present application, the RNA replicon of the present application may further encode one or more heterologous proteins or peptides of any protein or peptide, including but not limited to cytokines, growth factors, immunoglobulins , monoclonal antibody (including Fab antigen-binding fragment, Fc fusion protein), hormone, interferon, interleukin, regulatory peptide and regulatory protein.

In some embodiments, the heterologous protein or peptide can consist of at most 5 kb, or at most 6 kb, or at most 7 kb, or at most 8 kb, or at most 9 kb, or at most 10 kb, or at most 11 kb, or at most 12 kb The RNA sequence encoding. A heterologous protein can also be a single chain antibody molecule.

The alphavirus replicons of the present invention may also have subgenic promoters for expression of heterologous proteins or peptides. As used herein, the term "subgenic promoter" refers to the promoter of a subgenic mRNA of a viral nucleic acid. As used herein, an "alphavirus subgenomic promoter" is a promoter, as originally defined in the alphavirus genome, that directs the transcription of subgenomic messenger RNA as part of the alphavirus replication process.

The term "heterologous" when used in reference to a polynucleotide, gene, nucleic acid, polypeptide, protein or enzyme refers to a polynucleotide, gene, nucleic acid, polypeptide, protein or enzyme that is not derived from the host species. For example, as used herein, a "heterologous gene" or "heterologous nucleic acid sequence" refers to a gene or nucleic acid sequence from a species different from that introduced into the host organism. Heterologous sequences can also be synthetic and not derived from an organism or found in nature. When referring to sequences used to operate genes (e.g., 5' untranslated regions, 3' untranslated regions, polyadenylation addition sequences, intron sequences, splice sites, ribosome binding sites, internal ribosome entry sequences, "Heterologous" means a regulatory or auxiliary sequence or an auxiliary nucleic acid sequence, or a nucleic acid sequence encoding a protein domain, or a protein localization sequence expressed in a gene body homologous region, recombination site, etc. The sequence or positioning sequence is from a different source than the gene by which the regulatory or auxiliary nucleic acid sequences or nucleic acid sequences encoding protein domains or the positioning sequence are incorporated into the gene body, chromosome or episome. Accordingly, a promoter operably linked to a gene that is not operably linked in nature (e.g., in the genome of a non-genetically engineered organism) is referred to herein as a "heterologous promoter", even if the As can a promoter may be derived from the same species (or in some cases, the same organism) as the gene to which it is linked. Similarly, "heterologous" when referring to a protein localization sequence or protein domain of an engineered protein means that the localization sequence or protein domain is derived from a different protein than the protein into which it has been genetically engineered.

As used herein, the term "non-naturally occurring", "recombinant" or "engineered" nucleic acid molecule or polynucleotide sequence refers to a nucleic acid molecule or non-naturally occurring polynucleotide sequence that has been altered by human intervention. As non-limiting examples, recombinant nucleic acid molecules: 1) have been synthesized, e.g., using chemical or enzymatic techniques (e.g., by using chemical nucleic acid synthesis or by using for replication, polymerization, exonuclease digestion, endonuclease Digestion, ligation, reverse transcription, transcription, base modification (including, for example, methylation) or recombination (including homologous and site-specific recombination) enzymes) in vitro synthesis or modification; 2) including enzymes not found in nature The combined binding nucleotide sequence; 3) has been engineered using molecular breeding techniques so that it does not have one or more nucleotides relative to a naturally occurring nucleic acid molecule sequence; and/or 4) has been using molecular breeding techniques Manipulated to have one or more sequence changes or rearrangements relative to a naturally occurring nucleic acid sequence. As a non-limiting example, a cDNA is a recombinant DNA molecule as has been produced by an in vitro polymerase reaction or a linker has been ligated or integrated into a vector such as a cloning vector or an expression vector or has been integrated into an RNA replicon any nucleic acid molecule.

In some embodiments, the RNA replicon of the present invention is sequenced from 5' to 3' including: a 5' untranslated region (5'-UTR) required for amplification mediated by nonstructural proteins of RNA viruses; Polynucleotide sequences of at least one, preferably all, nonstructural proteins of RNA viruses; subgenomic promoters of RNA viruses; non-naturally occurring polynucleotide sequences described herein; and nonstructural protein mediators of RNA viruses This leads to amplification of the desired 3' untranslated region (3'-UTR).

In some embodiments, the RNA replicon of the present invention is sequenced from 5' end to 3' end comprising: alpha virus 5' untranslated region (5'-UTR); alpha virus non-structural gene nsp1 5' replication sequence; virus Species downstream loop (DLP) motif; polynucleotide sequence encoding a fourth autoprotease peptide; polynucleotide sequence encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3, and nsp4; alphavirus subgenomic promoter non-naturally occurring polynucleotide sequences described herein; the alphavirus 3' untranslated region (3'UTR); and optionally a polyadenylation sequence.

In some embodiments, the DLP motif is from a viral species selected from the group consisting of Eastern Equine Encephalitis Virus (EEEV), Venezuelan Equine Encephalitis Virus (VEEV), Everglades Swamp Virus (EVEV), Mukan Burdock virus (MUCV), Semliki Forest virus (SFV), Pichuna virus (PIXV), Middleburg virus (MTDV), Chikung virus (CHIKV), Onion virus (ONNV), Ross River virus (RRV), Bama Forest virus (BF), Geta virus (GET), Heron virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (U AV), Sim Debis virus (SINV), Aura virus (AURAV), Vodaro virus (WHAV), Babangi virus (BABV), Kezeragzi virus (KYZV), Western equine encephalitis virus (WEEV) , Highland J virus (HJV), Fort Morgan virus (FMV), Endum virus (NDUV) and Bogey River virus.

In some embodiments, the fourth autoprotease peptide is selected from the group consisting of Porcine Tesguvirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Cytoplasmic polyhedrosis virus 2A (T2A), Cytoplasmic polyhedrosis virus 2A (BmCPV2A), Silkworm softening disease virus 2A (BmIFV2A) and combinations thereof. Preferably, the fourth autoprotease peptide comprises the peptide sequence of P2A. The fourth autoprotease peptide comprises SEQ ID NO: 11. The polynucleotide sequence encoding the fourth self-protease peptide comprises SEQ ID NO:12. In some embodiments, the polynucleotide sequence encoding the fourth autoprotease peptide consists of SEQ ID NO:12.

In some embodiments, the RNA replicon of the present invention is ordered from the 5' end to the 3' end comprising: 5'-UTR having the polynucleotide sequence of SEQ ID NO: 55; having the polynucleotide sequence of SEQ ID NO: The 5' copy sequence of 56; the DLP motif comprising the polynucleotide sequence SEQ ID NO: 57; the polynucleotide sequence encoding the P2A sequence of SEQ ID NO: 11; encoding alpha virus non-structural proteins nsp1, nsp2, nsp3 and nsp4 (as respectively by nucleic acid sequence SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 and the polynucleotide sequence of their proteins encoded by SEQ ID NO: 61); having a polynucleotide sequence The subgenic somatic promoter of SEQ ID NO: 62; the non-naturally occurring polynucleotide sequence disclosed herein; and the 3' UTR having the polynucleotide sequence of SEQ ID NO: 63. In some embodiments, the polynucleotide sequence encoding the P2A sequence comprises SEQ ID NO: 12, the non-naturally occurring polynucleotide sequence comprises any one of the polynucleotide sequences SEQ ID NO: 15 to 54, And the RNA replicon further comprises a polyadenosine sequence. Preferably, the polyadenosine sequence has the sequence SEQ ID NO: 64 at the 3' end of the replicon.

In some embodiments, the RNA replicon of the present invention comprises any one of the polynucleotide sequences SEQ ID NO: 65-72.

In some embodiments, a nucleic acid molecule comprising a DNA sequence encoding an RNA replicon disclosed herein further comprises a T7 promoter operably linked to the 5' end of the DNA sequence. More preferably, the T7 promoter comprises the nucleotide sequence of SEQ ID NO: 73.

Also provided is a method of producing the RNA replicon of the present application comprising transcribing a nucleic acid molecule comprising a DNA sequence encoding the RNA replicon disclosed herein. In some embodiments, nucleic acid molecules are transcribed in vivo. In some embodiments, nucleic acid molecules are transcribed in vitro. Cells and Peptides

The application also provides cells, preferably isolated cells, comprising any of the polynucleotides and vectors described herein. These cells can be used, for example, for the production of recombinant proteins or for the production of virions. In some embodiments, the cells can be used to produce RNA replicons.

Host cells comprising RNA replicons or nucleic acids encoding RNA replicons of the present application also form part of the invention. HBV antigens can be produced via recombinant DNA techniques involving expression of molecules in host cells such as Chinese hamster ovary (CHO) cells, tumor cell lines, BHK cells, human cell lines such as HEK293, or in transgenic animals or plants. cells, PER.C6 cells) or yeast, fungi, insect cells and the like. In certain embodiments, the cells are from a multicellular organism, which in certain embodiments is of vertebrate or invertebrate origin. In certain embodiments, the cells are mammalian cells, such as human cells; or insect cells. Generally speaking, producing a recombinant protein (such as the HBV antigen of the present invention) in a host cell comprises introducing a heterologous nucleic acid molecule encoding an expressible protein into the host cell, cultivating the cell under conditions conducive to expressing the nucleic acid molecule, and allow protein expression in the cell. A nucleic acid molecule encoding an expressible form of protein may be in the form of an expression cassette, and generally requires sequences that enable expression of the nucleic acid, such as enhancers, promoters, polyadenylation signals, and the like. Those skilled in the art understand that a variety of promoters can be used to express genes in host cells. Promoters can be constitutive or regulated, and can be obtained from a variety of sources, including viral, prokaryotic or eukaryotic sources, or artificially designed. Other regulatory sequences can be added. Many promoters are available for expressing transgenes and are known to the skilled artisan, for example such promoters can include viral, mammalian, synthetic promoters and the like. A non-limiting example of a suitable promoter for expression in eukaryotic cells is the CMV promoter (US 5,385,839), such as the CMV immediate early promoter, for example comprising the nt.-735 to CMV immediate early gene enhancer/promoter. +95. A polyadenylation signal, such as the bovine growth hormone polyadenylation signal (US 5,122,458), may be present behind the transgene. Alternatively, several widely used expression vectors are available in the art and from commercial sources, such as pcDNA from Invitrogen and pEF vector pMSCV and pTK-Hyg from BD Sciences, pCMV-Script from Stratagene, etc. These expression vectors can be used to recombinantly express a protein of interest, or to obtain a suitable promoter and/or transcription termination sequence, polyadenylation sequence, and the like.

The cell culture can be any type of cell culture, including adherent cell cultures, such as cells attached to the surface of a culture vessel or on microcarriers, and suspension cultures. Most large-scale suspension cultures are operated as batch or fed-batch processes because they are the easiest to operate and can be scaled up. Recently, continuous processes based on the infusion principle have become more common and suitable. Suitable media are also well known to the skilled artisan and are generally available in large quantities from commercial sources or customized according to standard protocols. Culturing can be performed, for example, in petri dishes, roller bottles, or bioreactors using batch, fed-batch, continuous systems, and the like. Suitable conditions for culturing cells are known (see for example Tissue Culture, Academic Press, edited by Kruse and Paterson (1973), and R.I. Freshney, Culture of animal cells: A manual of basic technique, Fourth Edition (Wiley-Liss Inc. , 2000, ISBN 0-471-34889-9)). Cell culture media are available from a variety of suppliers, and suitable media can be routinely selected for host cell expression of a protein of interest, here an HBV antigen. Suitable media may or may not contain serum.

Therefore, the examples of the present application also relate to the method of preparing the HBV antigen of the present application. The method comprises transfecting a host cell with an expression vector comprising a polynucleotide encoding an HBV antigen of the present application operably linked to a promoter, allowing the transfected cell to grow under conditions suitable for expressing the HBV antigen, and The HBV antigens expressed in the cells are optionally purified or isolated. HBV antigens can be isolated or collected from cells by any method known in the art, including affinity chromatography, size exclusion chromatography, and the like. Techniques for expression of recombinant proteins will be well known to those of ordinary skill in the art in light of the present invention. Expression can also be studied without purification or isolation of the expressed protein, for example by analyzing supernatants of cells transfected with expression vectors encoding HBV antigens and grown under conditions suitable for expression of HBV antigens HBV antigen.

Accordingly, non-naturally occurring or recombinant polypeptides comprising the amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, 84, 85 or 86 or SEQ ID NO: 7, 84, 85 or 86 or SEQ ID NO: ID NO: 9 at least 90% identical amino acid sequence. As described above and below, this application also contemplates isolated nucleic acid molecules encoding these sequences, vectors comprising these sequences operably linked to a promoter, and compositions comprising such polypeptides, polynucleotides or vectors.

In one embodiment of the present application, the recombinant polypeptide comprises the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, 84, 85 or 86 or SEQ ID NO: 9 is at least 90% identical, such as with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, 84, 85 or 86 or SEQ ID NO: 9 90%, 91% , 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5 %, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical amino acid sequences. Preferably, the non-naturally occurring or recombinant polypeptide consists of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 84, 85 or 86 or SEQ ID NO: 9. RNAi component

In one aspect, the RNAi component comprises one or more RNAi agents. Each RNAi agent disclosed herein includes at least a sense strand and an antisense strand. Sense shares and antisense shares may be partially, substantially or fully complementary to each other. The sense and antisense strands of RNAi agents described herein can each be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17-26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 19 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. Sense shares and antisense shares may be of the same length or of different lengths. The HBV RNAi agents disclosed herein are designed to include an antisense sequence that is at least partially complementary to a sequence in the HBV genome that is conserved for most known serotypes of HBV. After delivery to cells expressing HBV, the RNAi agents described herein can inhibit the expression of one or more HBV genes in vivo or in vitro.

RNAi agents include a sense strand (also called a passenger strand) containing a first sequence, and an antisense strand (also called a leader strand) containing a second sequence. The sense strands of the HBV RNAi agents described herein include a core stretch that is at least about 85% identical to a nucleotide sequence of at least 16 contiguous nucleotides in HBV mRNA. In some embodiments, the stretch of sense strand core nucleotides having at least about 85% identity to the sequence in HBV mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length acid. The antisense strand of the HBV RNAi agent comprises a nucleotide sequence that is at least about 85% complementary to the sequence in the HBV mRNA and the corresponding sense strand over a core stretch of at least 16 contiguous nucleotides. In some embodiments, the antisense strand core nucleotide sequence having at least about 85% complementarity to a sequence in HBV mRNA or to the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

In some embodiments, the RNAi component comprises a first RNAi agent or a second RNAi agent, the first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, and SEQ ID NO: 99; and a stake comprising The nucleotide sequence of any of the following: SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106 and SEQ ID NO: 107, the second The RNAi agent comprises: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101, and a sense strand comprising the following The nucleotide sequence of any one: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 111. In some embodiments, the RNAi component comprises a first RNAi agent and a second RNAi agent, the first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99, and a stake, the stake comprising The nucleotide sequence of any one of the following: SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106 and SEQ ID NO: 107; The two RNAi agents comprise: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO: 100 and SEQ ID NO: 101, and a sense strand comprising the following The nucleotide sequence of any one: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 111.

In some embodiments, the first and second RNAi agents disclosed herein comprise any of the sequences in Table 1. Table 1. Exemplary sequences of first and second RNAi agents antonym Righteous SEQ ID NO Unmodified sequence (5' → 3') SEQ ID NO Unmodified sequence (5' → 3') 97 AGAAAAUUGAGAGAAGUCCCAC 106 GUGGACUUCUCUCAAUUUUCU 98 AGAAAAUUGAGAGAAGUCCACUU 106 GUGGACUUCUCUCAAUUUUCU 99 AGAAAAUUGAGAGAAGUCCACC 107 GGUGGACUUCUCUCAAUUUUCU 101 UACCAAUUUAUGCCUACAGCG 111 CGCUGUAGGCAUAAAUUGGUA targeting group

In some embodiments, the RNAi agent is delivered into the target cell or tissue using any oligonucleotide delivery technique known in the art. Nucleic acid delivery methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesives Microspheres, protein carriers or Dynamic Polyconjugates (DPCs) (see eg WO 2000/053722, WO 2008/0022309, WO 2011/104169 and WO 2012/083185, each of which is incorporated herein by reference). In some embodiments, the HBV RNAi agent is delivered to target cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, targeting moieties may include cellular receptor ligands, such as asialoglycoprotein receptor (ASGPr) ligands. In some embodiments, the ASGPr ligand comprises or consists of a cluster of galactose derivatives. In some embodiments, the galactose derivative cluster comprises N-acetyl-galactamine sugar trimers or N-acetyl-galactamine sugar tetramers. In some embodiments, the galactose derivative cluster is an N-acetyl-galactamine sugar trimer or an N-acetyl-galactamine sugar tetramer.

The targeting group can be attached to the 3' or 5' end of the sense or antisense strand of the HBV RNAi agent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is attached to the 5' end of the sense strand. In some embodiments, the targeting group is attached to the RNAi agent via a linker.

In some embodiments, the RNAi component comprises a combination or mixture of first and second RNAi agents having different nucleotide sequences. In some embodiments, the first and second RNAi agents are each separately and independently linked to a targeting group. In some embodiments, the first and second RNAi agents are each linked to a targeting group comprising N-acetyl-galactamine sugar. In some embodiments, when the first and second RNAi agents are included in the composition, each of the RNAi agents is linked to the same targeting group. In some embodiments, when the first and second RNAi agents are included in the composition, each of the RNAi agents is linked to a different targeting group, such as a targeting group with a different chemical structure.

In some embodiments, the targeting group is linked to the first and second RNAi agents without the use of additional linkers. In some embodiments, the targeting group is designed with a linker that is readily presented to facilitate attachment to the first or second RNAi agent. In some embodiments, when the first and second RNAi agents are included in the composition, the first and second RNAi agents can be attached to the targeting group using the same linker. In some embodiments, when the first and second RNAi agents are included in the composition, the first and second RNAi agents are attached to the targeting group using different linkers.

Examples of targeting groups and linking groups are provided in Table 2. Non-nucleotide groups can be covalently linked to the 3' and/or 5' ends of the sense and/or antisense strands. In some embodiments, the first or second RNAi agent contains a non-nucleotide group attached to the 3' and/or 5' end of the sense strand. In some embodiments, a non-nucleotide group is attached to the 5' end of the sense strand of the first or second RNAi agent. The non-nucleotide group can be linked to the first or second RNAi agent either directly or indirectly via a linker/linking group. In some embodiments, the non-nucleotide group is linked to the first or second RNAi agent via a labile, cleavable or reversible bond or linker.

經修飾核苷酸 Targeting groups and linking groups include the following, the chemical structures of which are provided in Table 2 below: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24) s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30) , (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s , (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense and/or antisense strand may have any of the targeting or linking groups listed above, as well as other targeting or linking groups, bound to the 5' and/or 3' ends of the sequence. Table 2. Structures Representing Various Modified Nucleotides, Targeting Groups, and Linking Groups

Modified Nucleotides

In some embodiments, the first or second RNAi agent contains one or more modified nucleotides. As used herein, "modified nucleotides" are nucleotides other than ribonucleotides (2'-hydroxy nucleotides). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to: deoxyribonucleotides, nucleotide mimetics, abasic nucleotides (denoted herein as Ab), 2'-modified nucleotides, 3' to 3' bonded (reverse) nucleotides (denoted herein as invdN, invN, invn, invAb), nucleotides containing unnatural bases, bridging nucleotides, peptide nucleic acid (PNA), 2' , 3' open ring nucleotide mimetic (unlocked nucleobase analog, denoted herein as N _UNA or NUNA), locked nucleotide (herein denoted as N _LNA or NLNA), 3'-O-methoxy base (2' internucleoside linkage) nucleotide (represented herein as 3'-OMen), 2'-F-arabinonucleotide (represented herein as Nf _ANA or NfANA), 5'-Me, 2 '-Fluoro nucleotides (expressed herein as 5Me-Nf), N-? Nucleotides and nucleotides containing cyclopropyl phosphonate (cPrpN). 2'-modified nucleotides (i.e., nucleotides whose group at the 2' position of the five-membered sugar ring is not a hydroxyl group) include, but are not limited to, 2'-O-methyl nucleotides (denoted herein as The lowercase letter "n" in the nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented as Nf herein, also represented as 2'-fluoro nucleotides herein) , 2'-deoxynucleotide (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotide (represented herein as NM or 2'-MOE), 2'-amino nucleotides and 2'-alkyl nucleotides. Not all positions of a given compound need be uniformly modified. Conversely, more than one modification can be incorporated into the first or second RNAi agent or even a single nucleotide thereof. The sense and antisense strands of RNAi agents can be synthesized and/or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine , 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-amino Adenine, 6-alkyl (such as 6-methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl of adenine and guanine (such as 2-methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives, 2-thiouracil, 2-thiothymine, 2-thiocytidine Pyrimidine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uridine Pyrimidine (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-sulfanyl, 8-hydroxy and other 8-substituted adenine and guanine, 5 -Halo (such as 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- Azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

In some embodiments, all or at least 90% of the nucleotides of the first or second RNAi agent are modified nucleotides. As used herein, an RNAi agent in which at least 90% of the nucleotides present are modified nucleotides is one with four or fewer (i.e., 0, 1, 2) in both the sense and antisense strands. , 3 or 4) nucleotides are RNAi agents of ribonucleotides. As used herein, a sense strand in which at least 90% of the nucleotides present are modified nucleotides has two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand Stakeholders for ribonucleotides. As used herein, an antisense strand in which at least 90% of the nucleotides present are modified nucleotides is one that has two or fewer (i.e., 0, 1, or 2) nucleosides in the sense strand Acids are the antisense strands of ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are ribonucleotides. modified internucleoside bond

In some embodiments, one or more nucleotides of the first or second RNAi agent are linked by non-standard linkages or backbones (ie, modified internucleoside linkages or modified backbones). In some embodiments, the modified internucleoside linkage is a non-phosphate containing covalent internucleoside linkage. Modified internucleoside linkages or backbones include, but are not limited to, the 5'-phosphorothioate group (represented herein as a lowercase "s"), chiral phosphorothioate, phosphorothioate, phosphorodithioate esters, phosphate triesters, aminoalkyl-phosphate triesters, alkyl phosphonates (such as methyl phosphonate or 3'-alkylene phosphonate), chiral phosphonates, phosphonites, Phosphoramidates (e.g. 3'-aminophosphoramidates, aminoalkylphosphoramidates or thiocarbonyl phosphoramidates), thiocarbonylalkyl-phosphonates, thiocarbonylalkylphosphonates, N-𠰌linyl bond, borane phosphate with normal 3'-5' bond, 2'-5' linkage analog of borane phosphate or borane phosphate with reversed polarity, where adjacent nucleosides A unit pair has 3'-5' linked to 5'-3' or 2'-5' linked to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone does not have phosphorus atoms. Modified internucleoside linkages that do not have a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatoms and alkyl or cycloalkyl intersugar linkages or one or more short chain heteroatoms or Heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, thioether backbones, sulfide backbones, sulfide backbones, formyl and thioformyl backbones, sulfide backbones, Methylformyl and thioformyl main chains, olefin-containing main chains, sulfamate main chains, methyleneimino and methylenehydrazine main chains, sulfonate and sulfonamide main chains chains, amide backbones, and other backbones with mixed N, O, S, and _CH2 components.

In some embodiments, the sense strand of the first or second RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, and the antisense strand of the first or second RNAi agent can contain 1 , 2, 3, 4, 5 or 6 phosphorothioate linkages, or both the sense and antisense strands can independently contain 1 , 2, 3, 4, 5 or 6 phosphorothioate linkages. In some embodiments, the sense strand of the first or second RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, and the antisense strand of the first or second RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages. 3 or 4 phosphorothioate linkages, or both the sense and antisense strands can independently contain 1, 2, 3 or 4 phosphorothioate linkages.

In some embodiments, the first or second RNAi agent's sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least two phosphorothioate internucleoside linkages are between nucleotides at positions 1 to 3 from the 3' end of the sense strand. In some embodiments, at least two phosphorothioate internucleoside linkages are at positions 1 to 3, 2 to 4, 3 to 5, 4 to 6, 4 to 5, or 6 to 5' from the 5' end of the sense strand. between 8 nucleotides. In some embodiments, the first or second RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1 to 3 from the 5' end of the sense strand and at positions 19 to 21, 20 to 22 from the 5' end , 21 to 23, 22 to 24, 23 to 25 or 24 to 26 nucleotides. In some embodiments, the first or second RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.

In some embodiments, the first or second RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, the 2'-modified nucleoside is combined with a modified internucleoside linkage. In some embodiments, the first and second RNAi agents disclosed herein comprise any of the modified sequences in Table 3. Table 3. Exemplary Modified Sequences of First and Second RNAi Agents antonym Righteous SEQ ID NO Modified sequence (5' → 3') SEQ ID NO Modified sequence (5' → 3') 93 asGfsasAfaAfuugagAfgAfaGfuCfcAfsc 102 gsuggacuuCfUfCfucaauuuucus 93 asGfsasAfaAfuugagAfgAfaGfuCfcAfsc 103 guggacuuCfUfCfucaauuuucus 93 asGfsasAfaAfuugagAfgAfaGfuCfcAfsc 105 guggacuuCfUfCfucaauuuucus 94 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 102 gsuggacuuCfUfCfucaauuuucus 94 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 103 guggacuuCfUfCfucaauuuucus 94 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 105 guggacuuCfUfCfucaauuuucus 95 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu 102 gsuggacuuCfUfCfucaauuuucus 95 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu 103 guggacuuCfUfCfucaauuuucus 95 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu 105 guggacuuCfUfCfucaauuuucus 96 asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc 104 gguggacuuCfUfCfucaauuuucus 100 usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg 108 cgcuguagGfCfAfuaaauuguas 100 usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg 109 csgcuguagGfCfAfuaaauuguas 100 usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg 110 cgcuguagGfCfAfuaaauuguas 112 usAfsusUfgAfgagaaGfuCfcAfcCfacsusu 113 gugguggAfCfUfucucucaauausu 114 cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu 115 cuguagGfCfAfuaaauuguas Righteous SEQ ID NO Modified sequence with targeting ligand (5' → 3') 102 (NAG25)sgsuggacuuCfUfCfucaauuuucus(invAb) 103 (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) 105 (NAG25)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) 104 (NAG37)s(invAb)sgguggacuuCfUfCfucaauuuucus(invAb) 108 (NAG37)s(invAb)scgcuguagGfCfAfuaaauuguas(invAb) 109 (NAG37)csgcuguagGfCfAfuaaauuguas(invAb) 110 (NAG25)s(invAb)scgcuguagGfCfAfuaaauuguas(invAb) 113 (NAG25)s(invAb)sgugguggAfCfUfucucucaauausu(invAb) 115 (NAG31)s(invAb)scuguagGfCfAfuaaauuguas(invAb) A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = uridine-3'-phosphate n = any 2'- OMe-modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-forma Cytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'- O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyl Uridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Nf = any 2'-fluoro-modified nucleotides Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3' -Phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine- 3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate N _UNA = 2',3'-opened nucleotide mimetic (unlocked nucleobase analog) N _LNA = locked nucleotide Nf _ANA = 2'-F-arabinonucleotide NM = 2'-methoxy Ethyl Nucleotide AM = 2'-Methoxyethyladenosine-3'-Phosphate AMs = 2'-Methoxyethyladenosine-3'-Phosphorothioate TM = 2'-Methoxy Ethyl thymidine-3'-phosphate TMs = 2'-methoxyethyl thymidine-3'-phosphorothioate R = ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = inverted (3'-3' linked) abasic deoxyribose Nucleotide, see Table 6 (invAb)s = reverse (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 6 (invn) = any reverse 2'-OMe nucleotides (3'-3' linked nucleotides) s = phosphorothioate linkage

In some embodiments, the first RNAi agent comprises SEQ ID NO: 97 and SEQ ID NO: 106. In some embodiments, the first RNAi agent comprises SEQ ID NO: 108 and SEQ ID NO: 106. In some embodiments, the first RNAi agent comprises SEQ ID NO: 99 and SEQ ID NO: 107. In some embodiments, the first RNAi agent comprises SEQ ID NO: 93 and SEQ ID NO: 102, 103 or 105. In some embodiments, the first RNAi agent comprises SEQ ID NO: 94 and SEQ ID NO: 102, 103 or 105. In some embodiments, the first RNAi agent comprises SEQ ID NO: 95 and SEQ ID NO: 102, 103 or 105. In some embodiments, the first RNAi agent comprises SEQ ID NO: 96 and SEQ ID NO: 106. In some embodiments, the second RNAi agent comprises SEQ ID NO: 101 and SEQ ID NO: 111. In some embodiments, the second RNAi agent comprises SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110.

In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 97 and SEQ ID NO: 106 and a second RNAi agent comprising SEQ ID NO: 101 and SEQ ID NO: 111. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 108 and SEQ ID NO: 106 and a second RNAi agent comprising SEQ ID NO: 101 and SEQ ID NO: 111. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 99 and SEQ ID NO: 107 and a second RNAi agent comprising SEQ ID NO: 101 and SEQ ID NO: 111.

In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 93 and SEQ ID NO: 102, 103 or 105 and a first RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110 Two RNAi agents. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 94 and SEQ ID NO: 102, 103 or 105 and a first RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110 Two RNAi agents. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 95 and SEQ ID NO: 102, 103 or 105 and a first RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110 Two RNAi agents. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 96 and SEQ ID NO: 106 and a second RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110.

In some embodiments, the RNAi component comprises the first and second RNAi agents in a ratio of about 1:1, 2:1, 3:1, 4:1, or 5:1. In some embodiments, two HBV RNAi agents are administered in a ratio of about 2:1. Throughout this application, ratios are intended to be given their ordinary meaning in the art, eg, in weight ratio form or molar ratio form.

In some embodiments, the first and second RNAi agents each independently bind to (NAG37)s, (NAG31)s, or (NAG25)s, the first RNAi agent comprising an antisense strand comprising SEQ ID NO: 94 and comprising The sense strand of SEQ ID NO: 103 or SEQ ID NO: 105, the second RNAi agent comprises the antisense strand comprising SEQ ID NO: 100 and the sense strand comprising SEQ ID NO: 108 or SEQ ID NO: 110.

In some embodiments, the first HBV RNAi agent comprises or consists of a duplex of SEQ ID NO: 94 and 103 linked to (NAG37)s shown as a sodium salt having a structure represented by:

In some embodiments, the first HBV RNAi agent comprises or consists of a duplex of SEQ ID NO: 94 and 105 linked to (NAG25)s shown as a sodium salt having a structure represented by:

In some embodiments, the first HBV RNAi agent comprises or consists of a duplex of SEQ ID NO: 94 and 103 linked to (NAG37)s displayed as the free acid having the structure represented by:

In some embodiments, the first HBV RNAi agent comprises or consists of a duplex of SEQ ID NO: 100 and 108 linked to (NAG37)s shown as a sodium salt having a structure represented by:

In some embodiments, the first HBV RNAi agent comprises or consists of a duplex of SEQ ID NO: 100 and 110 linked to (NAG25)s shown as a sodium salt having a structure represented by:

In some embodiments, the first HBV RNAi agent comprises or consists of a duplex of SEQ ID NO: 100 and 108 linked to (NAG37)s displayed as the free acid having the structure represented by:

In some embodiments, the HBV RNAi agents disclosed herein consist of or comprise a duplex SEQ ID NO: 112 and 113 linked to (NAG25)s shown as sodium having the structure represented by Salt:

In some embodiments, the HBV RNAi agents disclosed herein consist of or comprise a duplex SEQ ID NO: 114 and 115 linked to (NAG31)s shown as sodium having the structure represented by Salt:

In certain embodiments of the present application, the RNAi component is administered subcutaneously or orally (more specifically, subcutaneously) to a subject. In certain embodiments of the present application, the RNAi component is in salt form (eg, sodium salt form) or is in free acid form.

The combinations described herein can be used in any method or kit described below. combination

Also provided herein is a composition comprising an RNAi component, and a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens, wherein (a) the RNAi component comprises: (i) a first RNAi agent, it comprises: antisense strand, and this antisense strand comprises the nucleotide sequence of any one in following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96 , SEQ ID NO: 97, SEQ ID NO: 98, and SEQ ID NO: 99; and a meaningful stock, which includes the nucleotide sequence of any one of the following: SEQ ID NO: 102, SEQ ID NO : 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising: The nucleotide sequence of any one of: SEQ ID NO: 100 and SEQ ID NO: 101; and a meaningful stock, which includes the nucleotide sequence of any of the following: SEQ ID NO: 108, SEQ ID NO:109, SEQ ID NO:110 and SEQ ID NO:111; and (b) the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence sequenced from the 5' end to the 3' end comprising: (1 ) a polynucleotide sequence encoding a first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and ( 3) a polynucleotide sequence encoding a second HBV antigen, wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, And at least one of the first and second HBV antigens is HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen. Nucleic acid molecule pharmaceutical composition

The present application also relates to compositions, pharmaceutical compositions, immunogenic combinations and more particularly vaccines comprising one or more HBV antigens according to the present application, polynucleotides and/or encoding one or more Carrier of HBV antigen. Any of the HBV antigens, polynucleotides (including RNA and DNA) and/or vectors of the present application described herein can be used in the compositions, pharmaceutical compositions, immunogenic combinations and vaccines of the present application .

The present application provides, for example, a pharmaceutical composition comprising any nucleic acid molecule, vector or RNA replicon described herein and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are non-toxic and should not interfere with the efficacy of the active ingredients. A pharmaceutically acceptable carrier may include one or more excipients, such as binders, disintegrants, swelling agents, suspending agents, emulsifying agents, wetting agents, lubricants, flavoring agents, sweeteners, preservatives , dyes, solubilizers and coatings. The exact nature of the carrier or other material may depend on the route of administration, eg intramuscular, intradermal, subcutaneous, oral, intravenous, dermal, intramucosal (eg enteral), intranasal or intraperitoneal. For liquid injectable preparations, such as suspensions and solutions, suitable carriers and additives include water, glycols, oils, alcohols, preservatives, coloring agents and the like. For solid oral preparations such as powders, capsules, caplets, caplets and lozenges, suitable carriers and additives include starch, sugar, diluents, granulating agents, lubricants, binders, disintegrants and the like. For nasal spray/inhalant mixtures, aqueous solutions/suspensions may contain water, glycols, oils, emollients, stabilizers, wetting agents, preservatives, aromatics, flavorings and the like as suitable carriers and additives.

The pharmaceutical compositions of the present application can be formulated with any material suitable for administration to a subject to facilitate administration and improve efficacy, including but not limited to oral (enteral) administration and parenteral injection. Parenteral injection includes intravenous injection or infusion, subcutaneous injection, intradermal injection and intramuscular injection. The pharmaceutical compositions of the present application may also be formulated for other routes of administration, including transmucosal, ocular, rectal, long-acting implants, sublingual administration (under the tongue, from the oral mucosa bypassing the portal circulation), inhalation or intranasal administration.

In a preferred embodiment of the present application, the pharmaceutical composition of the present application is formulated for parenteral injection, preferably subcutaneous, intradermal or intramuscular injection, more preferably intramuscular injection.

In some embodiments of the present application, the pharmaceutical composition or immunogenic combination comprises one or more replicons, and the administration can be performed by transdermal injection, such as intramuscular or intradermal injection, preferably intramuscular injection. Intramuscular injection can be combined with electroporation, ie, application of an electric field to facilitate delivery of DNA plasmids into cells. As used herein, the term "electroporation" refers to the induction of microscopic pathways (pores) in biological membranes using transmembrane electric field pulses. During in vivo electroporation, an electric field of appropriate magnitude and duration is applied to cells to induce a transient state of enhanced cell membrane permeability, thereby enabling cellular uptake of molecules that cannot cross the cell membrane alone. Creating such pores by electroporation facilitates the passage of biomolecules such as plastids, oligonucleotides, siRNA, drugs, etc., across one side of the cell membrane to the other. The use of in vivo electroporation to deliver DNA vaccines has been shown to significantly increase host cell uptake of plastids, but also causes mild to moderate inflammation at the injection site.

In a typical embodiment, electroporation is combined with intramuscular injection. However, electroporation can also be combined with other forms of parenteral administration, such as intradermal injection, subcutaneous injection, and the like.

Administration of the pharmaceutical compositions, immunogenic combinations or vaccines of the present application via electroporation can be accomplished using electroporation devices that can be configured to deliver pulses of energy effective to cause the formation of reversible pores in cell membranes to the desired mammalian tissue. An electroporation device may include an electroporation assembly and an electrode assembly or a handle assembly. The electroporation assembly may include one or more of the following electroporation device components: controller, current waveform generator, impedance tester, waveform recorder, input element, status reporting element, communication port, memory element, power supply, and power supply switch. Electroporation can be achieved using an in vivo electroporation device. Examples of electroporation devices and electroporation methods that can facilitate delivery of the compositions and immunogenic combinations of the present application include CELLECTRA® (Inovio Pharmaceuticals, Blue Bell, PA), Elgen electroporators (Inovio Pharmaceuticals, Inc.), Tri-Grid ^TM delivery system (Ichor Medical Systems, Inc., San Diego, CA 92121) and U.S. Patent No. 7,664,545, U.S. Patent No. 8,209,006, U.S. Patent No. 9,452,285, U.S. Patent No. 5,273,525, U.S. Patent No. 6,110,161 , U.S. Patent No. 6,261,281, U.S. Patent No. 6,958,060 and U.S. Patent No. 6,939,862, U.S. Patent No. 7,328,064, U.S. Patent No. Patent No. 6,912,417, U.S. Patent No. 8,187,249, U.S. Patent No. 9,364,664, U.S. Patent No. 9,802,035, U.S. Patent No. 6,117,660, and International Patent Application Publication WO2017172838, each of which is incorporated herein by reference in its entirety. Other examples of in vivo electroporation devices are described in Attorney Docket No. 688097-405WO, entitled "Method and Apparatus for the Delivery of Hepatitis B Virus (HBV) Vaccines," filed on the same date as this application , the content of this case is incorporated herein by reference in its entirety. Applications for delivering the compositions and immunogenic combinations of the present application also contemplate the use of pulsed electric fields, as described, for example, in US Patent No. 6,697,669, which is incorporated herein by reference in its entirety.

In other embodiments of the present application where the pharmaceutical composition or immunogenic combination comprises one or more DNA plasmids, the method of administration is transdermal administration. Transdermal administration can be combined with epidermal abrasion to facilitate delivery of DNA plasmids to cells. For example, epidermal abrasion can be performed using a dermal patch. After the skin patch is removed, the composition or immunogenic combination can be deposited on the abraded skin.

The method of delivery is not limited to the examples described above, and any means of intracellular delivery can be used. Other methods of intracellular delivery contemplated by the methods of the present application include, but are not limited to, liposomal encapsulation, lipoplexes (lipoplexes), nanoparticles, and the like. For example, the RNA replicons of the present application can be formulated in an immunogenic composition comprising one or more lipid molecules, preferably positively charged lipid molecules. In some embodiments, RNA replicons of the invention can be formulated using one or more liposomes, lipoplexes and/or lipid nanoparticles. In some embodiments, the liposome or lipid nanoparticle formulations described herein can comprise a polycationic composition. In some embodiments, formulations comprising polycationic compositions are useful for in vivo and/or ex vivo delivery of RNA replicons described herein.

In accordance with embodiments of the present application, pharmaceutical compositions for administration will generally comprise buffered solutions in pharmaceutically acceptable carriers such as aqueous carriers, such as buffered saline and the like, such as phosphate-buffered saline Saline (PBS). If desired, such compositions and immunogenic combinations may also contain pharmaceutically acceptable substances to approximate physiological conditions, such as pH adjusting agents and buffering agents. For example, the pharmaceutical composition of the present application comprising plastid DNA may contain phosphate-buffered saline (PBS) as a pharmaceutically acceptable carrier. Plastid DNA may be present at a concentration, for example 0.5 mg/mL to 5 mg/mL, such as 0.5 mg/mL, 1 mg/mL, 2 mg/mL, 3 mg/mL, 4 mg/mL or 5 mg/mL, Preferably 1 mg/mL.

In some embodiments, the pharmaceutical composition of the present application comprising an RNA replicon can be administered at a concentration of, for example, about 20 µg/mL to about 200 µg/mL, such as 20 µg/mL, 30 µg/mL, 40 µg /mL, 50 µg/mL, 60 µg/mL, 70 µg/mL, 80 µg/mL, 90 µg/mL, 100 µg/mL, 110 µg/mL, 120 µg/mL, 130 µg/mL, 140 µg /mL, 150 µg/mL, 160 µg/mL, 170 µg/mL, 180 µg/mL, 190 µg/mL, or 200 µg/mL. In some embodiments, a pharmaceutical composition of the present application comprising an RNA replicon can be administered at a concentration of less than 20 μg/mL. In some embodiments, a pharmaceutical composition of the present application comprising an RNA replicon can be administered at a concentration greater than 200 μg/mL.

The pharmaceutical compositions of the present application can be formulated as vaccines (also referred to as "immunogenic compositions") according to methods well known in the art. Such compositions may include adjuvants to enhance the immune response. Optimum ratios of components in formulations according to the present invention can be determined by techniques well known to those skilled in the art.

In a particular embodiment of the present application, the pharmaceutical composition, composition or immunogenic combination is a DNA vaccine. DNA vaccines typically comprise bacterial plastids containing a polynucleotide encoding the antigen of interest under the control of a strong eukaryotic promoter. Following delivery of the plastid into the host's cytoplasm, the encoded antigen is produced and endogenously processed. The resulting antigens typically induce humoral and cell-mediated immune responses. DNA vaccines are advantageous at least because they offer improved safety, are temperature stable, can be readily used to express antigenic variants and are easy to manufacture. Such DNA vaccines can be prepared using any of the DNA plasmids of the present application.

In other specific embodiments of the present application, the pharmaceutical composition, composition or immunogenic combination is an RNA vaccine. RNA vaccines generally comprise at least one single-stranded RNA molecule encoding an antigen of interest (eg, an HBV antigen). Similar to DNA vaccines, following delivery of RNA into the host's cytoplasm, encoded antigens are produced and endogenously processed, inducing both humoral and cell-mediated immune responses. RNA sequences can be codon optimized to increase translation efficiency. RNA molecules can be prepared according to the invention by any method known in the art, such as by adding, for example, a polyadenylation tail with at least 30 adenosine residues; and/or with modified ribonucleotides, for example 7 - Methylguanosine end cap Modification of the 5-terminus by capping to enhance stability and/or translation, which can be incorporated during RNA synthesis or enzymatically engineered after RNA transcription. RNA vaccines can also be self-replicating RNA vaccines developed from alphavirus expression vectors. The self-replicating RNA vaccine comprises a replicase RNA molecule derived from a virus belonging to the Alphaviridae family with a subgenomic promoter controlling the replication of the HBV antigen RNA, followed by an artificial polyadenylation tail downstream of the replicase.

In certain embodiments, adjuvants are included in or co-administered with pharmaceutical compositions of the present application. Adjuvants are optionally used and may further enhance the immune response when the composition is for vaccination purposes. Adjuvants suitable for co-administration or inclusion in compositions according to the present application should preferably be those that are potentially safe, well tolerated and effective in humans. Adjuvants can be small molecules or antibodies, including but not limited to immune checkpoint inhibitors (such as anti-PD1, anti-TIM-3, etc.), toll-like receptor agonists (such as TLR7 agonists and/or TLR8 agonists ), RIG-1 agonist, IL-15 super agonist (Altor Bioscience), mutant IRF3 and IRF7 gene adjuvant, STING agonist (Aduro), FLT3L gene adjuvant, IL-12 gene adjuvant and IL -7-hyFc.

The present application also provides methods of preparing the pharmaceutical compositions and immunogenic combinations of the present application. The method of producing a pharmaceutical composition or immunogenic combination comprises mixing the isolated polynucleotides encoding HBV antigens, vectors and/or polypeptides of the present application with one or more pharmaceutically acceptable carriers. Those of ordinary skill in the art will be familiar with known techniques for preparing such compositions. Liposomes and Lipid Nanoparticles

In certain embodiments of the present application, the method of administration is a lipid composition, such as lipid nanoparticles (LNP) or liposomes. Lipid compositions, preferably lipid nanoparticles or liposomes, including but not limited to liposomes or lipid vesicles, useful for the delivery of therapeutic products such as one or more nucleic acid molecules of the invention, wherein the aqueous volume is transported by amphoteric lipids Bilayer encapsulation, or where the therapeutic product is contained within a lipid coating; or lipid aggregates or micelles, where the lipid-encapsulated therapeutic product is contained within a relatively disordered lipid mixture.

The lipid composition can provide a therapeutic product (such as one or more nucleic acid molecules of the invention) with full encapsulation, partial encapsulation, or both. In a preferred embodiment, the therapeutic product is fully encapsulated in lipid particles (eg, forming LNPs).

The lipid composition of the present invention may comprise one or more lipids selected from the group consisting of cationic lipids, anionic lipids, zwitterionic lipids, neutral lipids, steroids, polymer-conjugated lipids, phospholipids, glycolipids, and any combination of the foregoing. Lipids can be saturated or unsaturated. The mixture may contain both saturated and unsaturated lipids. Lipid compositions may be substantially free of liposomes or may contain liposomes. Liposomes are preferably prepared using at least one unsaturated lipid. If an unsaturated lipid has two tails, both tails can be unsaturated, or it can have one saturated and one unsaturated tail. Lipid and nucleic acid molecules can be mixed and arranged in any suitable structure.

In particular embodiments, lipid compositions comprise cationic lipids to encapsulate and/or facilitate delivery of nucleic acid molecules, such as DNA or RNA molecules of the invention, into target cells. A cationic lipid can be any lipid species that carries a net positive charge at a chosen pH, such as physiological pH. Without wishing to be bound by theory, cationic lipids, such as ionizable amine-based lipids, facilitate self-assembly of components into macromolecular nanoparticles that encapsulate nucleic acids (DNA and/or RNA). Nucleic acid-containing nanoparticles are effectively absorbed into target cells by internal pinocytosis. Once inside the endosome, the positively charged lipid nanoparticles interact with the negatively charged endosomal membrane, causing disruption of the compartment and release of the nucleic acid molecule into the cytoplasm, where it can be expressed.

Several cationic lipids have been described in the literature, many of which are commercially available. For example, cationic lipids suitable for use in the compositions and methods of the invention include 1,2-dioleyl-3-trimethylammonio-propane (DOTAP), 1,2-dioleyloxy-, N,N-dimethylaminopropane (DLinDMA) and 1,2-dilinolenoxy-N,N-dimethylaminopropane (DLenDMA). The pKa of formulated cationic lipids correlates with the effectiveness of lipid particles to deliver nucleic acids (see Jayaraman et al., Angewandte Chemie, International Edition (2012), 51(34), 8529-8533; Semple et al., Nature Biotechnology 28, 172-176 (2010)). A preferred pKa range is from about 5 to about 7.

式(I) 其中R ₁為由10至31個碳組成之經取代烷基，R ₂為由2至20個碳組成之直鏈烷基、烯基或炔基，R ₃為由1至6個碳組成之直鏈或分支鏈烷烴，R ₄及R ₅相同或不同，各為氫或由1至6個碳組成之直鏈或分支鏈烷基；L ₁及L ₂相同或不同，各為1至20個碳之直鏈烷烴或2至20個碳之直鏈烯烴，且X ₁為S或O；或其鹽或溶劑合物。例示性式(I)化合物、其合成及其用途描述於US2018/0169268中，其均以引用之方式併入本文中。 In one embodiment, the cationic lipid is a compound of formula (I):

Formula (I) wherein R ₁ is a substituted alkyl group consisting of 10 to 31 carbons, R ₂ is a linear alkyl, alkenyl or alkynyl group consisting of 2 to 20 carbons, R ₃ is a group consisting of 1 to 6 straight-chain or branched _- chain alkanes composed of ₂ carbons, R4 and R5 are the same or different, and each is hydrogen or a straight-chain or branched-chain alkyl group consisting of ₁ to ₆ carbons; L1 and L2 are the same or different, each is a linear alkane of 1 to 20 carbons or a linear olefin of 2 to 20 carbons, and X ₁ is S or O; or a salt or solvate thereof. Exemplary compounds of formula (I), their synthesis and their use are described in US2018/0169268, all of which are incorporated herein by reference.

式(II) 其中R ₁為8、9、10、11、12、13、14、16、17、18、19、20、21或22個碳之分支鏈、非環烷基或烯基；L ₁為1至15個碳之直鏈烷烴；R ₂為5、6、7、8、9、10、11、12、13、14或15個碳之直鏈烷基或烯基或8、9、10、11、12、13、14、16、17、18、19、20、21或22個碳之分支鏈非環烷基或烯基；L ₂為4、5、6、7、8、9、10、11、12、13、14或15個碳之直鏈烷烴；X為O或S；R ₃為1、2、3、4、5或6個碳之直鏈烷烴；且R ₄及R ₅相同或不同，各為1、2、3、4、5或6個碳之直鏈或分支鏈非環烷基；或其醫藥學上可接受之鹽或溶劑合物。例示性式(II)化合物、其合成及其用途描述於US2018/0170866中，其均以引用之方式併入本文中。 In another embodiment, the cationic lipid is a compound of formula (II):

Formula (II) wherein R ₁ is branched chain, acyclic alkyl or alkenyl of 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21 or 22 carbons; L ₁ is a straight chain alkane with ₁ to 15 carbons; R is a straight chain alkyl or alkenyl with 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 carbons or 8, 9 , 10, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21 or 22 carbon branched acyclic alkyl or alkenyl; L ₂ is 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 carbon straight chain alkane; X is O or S; _R3 is 1, 2, 3, ₄ , 5 or 6 carbon straight chain alkane; and R4 and R ₅ are the same or different, and each is a linear or branched non-cyclic alkyl group of 1, 2, 3, 4, 5 or 6 carbons; or a pharmaceutically acceptable salt or solvate thereof. Exemplary compounds of formula (II), their synthesis and their use are described in US2018/0170866, all of which are incorporated herein by reference.

其中R包含生物活性分子，且L ₁、L ₂及L ₃在每次出現時獨立地包含選自由以下組成之群的配體：碳水化合物、多肽或親脂體；其醫藥學上可接受之鹽；或其醫藥組合物。例示性式(II)、(IV)及(v)化合物、其合成及其用途描述於US2017/0028074中，其均以引用之方式併入本文中。 In another embodiment, the cationic lipid is a compound of formula (III), (IV) or (V):

wherein R comprises a biologically active molecule, and L ₁ , L ₂ and L ₃ independently comprise, at each occurrence, a ligand selected from the group consisting of carbohydrates, polypeptides or lipophiles; pharmaceutically acceptable salt; or a pharmaceutical composition thereof. Exemplary compounds of formula (II), (IV) and (v), their synthesis and their use are described in US2017/0028074, all of which are incorporated herein by reference.

式(VI) 其中X為直鏈或分支鏈伸烷基或伸烯基、單環、雙環或三環芳烴或雜芳烴；Y為一鍵、乙烯或未經取代或經取代之芳族或雜芳族環；Z為S或O；L為1至6個碳之直鏈或分支鏈伸烷基；R ₃及R ₄獨立地為1至6個碳之直鏈或分支鏈烷基；R ₁及R ₂獨立地為1至20個碳之直鏈或分支鏈烷基或烯基；r為0至6；且m、n、p及q獨立地為1至18；其中當n=q、m=p且R ₁=R ₂時，則X與Y不同；其中當X=Y、n=q、m=p時，則R ₁與R ₂不同；其中當X=Y、n=q且R ₁=R ₂時，則m與p不同；且其中當X=Y、m=p且R ₁=R ₂時，則n與q不同；或其醫藥學上可接受之鹽。例示性式(VI)化合物、其合成及其用途描述於US2017/0190661中，其均以引用之方式併入本文中。 In another embodiment, the cationic lipid is a compound of formula (VI):

Formula (VI) wherein X is a linear or branched chain alkylene or alkenene group, monocyclic, bicyclic or tricyclic aromatic or heteroaromatic; Y is a bond, vinyl or unsubstituted or substituted aromatic or heteroaromatic Aromatic ring; Z is S or O; L is a straight chain or branched chain alkylene of 1 to 6 carbons; R ₃ and R ₄ are independently a straight chain or branched chain alkyl group of 1 to 6 carbons; R ₁ and R are independently linear or branched chain alkyl or alkenyl of ₁ to 20 carbons; r is 0 to 6; and m, n, p and q are independently 1 to 18; wherein when n=q , m=p and R ₁ =R ₂ , then X and Y are different; where when X=Y, n=q, m=p, then R ₁ and R ₂ are different; where when X=Y, n=q And when R ₁ =R ₂ , then m and p are different; and wherein when X=Y, m=p and R ₁ =R ₂ , then n and q are different; or a pharmaceutically acceptable salt thereof. Exemplary compounds of formula (VI), their synthesis and their use are described in US2017/0190661, all of which are incorporated herein by reference.

式(VII) 或其醫藥學上可接受之鹽、前藥或立體異構物，其中：G ¹或G ²中之一者在每次出現時為—O(C═O)—、—(C═O)O—、—C(═O)—、—O—、—S(O) _y−、—S—S—、—C(═O)S—、SC(═O)—、—N(R ^a)C(═O)—、—C(═O)N(R ^a)—、—N(R ^a)C(═O)N(R ^a)—、—OC(═O)N(R ^a)—或—N(R ^a)C(═O)O—，且G ¹或G ²中之另一者在每次出現時為—O(C═O)—、—(C═O)O—、—C(═O)—、—O—、—S(O) _y−、—S—S‘、—C(═O)S—、—SC(═O)—、—N(R ^a)C(═O)—、—C(═O)N(R ^a)—、—N(R ^a)C(═O)N(R ^a)—、—OC(═O)N(R ^a)—或—N(R ^a)C(═O)O—或一直接鍵；L在每次出現時為˜O(C═O)—，其中˜表示與X之共價鍵；X為CR ^a；Z為烷基、環烷基或當n為1時包含至少一個極性官能基之單價部分；或Z為伸烷基、伸環烷基或在n大於1時包含至少一個極性官能基之多價部分；R ^a在每次出現時獨立地為H、C _1-C ₁₂烷基、C _1-C ₁₂羥烷基、C ₁-C ₁₂胺基烷基、C ₁-C ₁₂烷基胺基烷基、C ₁-C ₁₂烷氧基烷基、C ₁-C ₁₂烷氧基羰基、C ₁-C ₁₂烷基羰氧基、C ₁-C ₁₂烷基羰氧基烷基或C ₁-C ₁₂烷基羰基；R在每次出現時獨立地為：(a) H或C _1-C ₁₂烷基；或(b) R與其所結合之碳原子一起以及相鄰R及與其所結合之碳原子一起形成碳碳雙鍵；R ¹及R ²分別在每次出現時具有以下結構：

a ¹及a ²在每次出現時獨立地為3至12之整數；b ¹及b ²在每次出現時獨立地為0或1；c ¹及c ²在每次出現時獨立地為5至10之整數；d ¹及d ²在每次出現時獨立地為5至10之整數；y在每次出現時獨立地為0至2之整數；且n為1至6之整數，其中各烷基、伸烷基、羥烷基、胺基烷基、烷基胺基烷基、烷氧基烷基、烷氧基羰基、烷基羰氧基、烷基羰氧基烷基及烷基羰基視情況經一或多個取代基取代。 In another embodiment, the cationic lipid is a compound of formula (VII):

Formula (VII) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein: one of G ¹ or G ² is —O(C═O)—, —( C═O)O—,—C(═O)—,—O—,—S(O) _y− ,—S—S—,—C(═O)S—, SC(═O)—,— N(R ^a )C(═O)—,—C(═O)N(R ^a )—,—N(R ^a )C(═O)N(R ^a )—,—OC(═O)N (R ^a )—or—N(R ^a )C(═O)O—, and the other of G ¹ or G ² in each occurrence is —O(C═O)—,—(C═ O)O—,—C(═O)—,—O—,—S(O) _y− ,—S—S’,—C(═O)S—,—SC(═O)—,—N (R ^a )C(═O)—,—C(═O)N(R ^a )—,—N(R ^a )C(═O)N(R ^a )—,—OC(═O)N( R ^a )—or—N(R ^a )C(═O)O—or a direct bond; L in each occurrence is ˜O(C═O)—where ˜ denotes a covalent bond to X; X is CR ^a ; Z is alkyl, cycloalkyl, or a monovalent moiety containing at least one polar functional group when n is 1; or Z is alkylene, cycloalkylene, or contains at least one polar functional group when n is greater than 1 A polyvalent moiety of a group; R ^a independently at each occurrence is H, C _1- C ₁₂ alkyl, C _1- C ₁₂ hydroxyalkyl, C ₁ -C ₁₂ aminoalkyl, C ₁ -C ₁₂ Alkylaminoalkyl, C _{1 -C 12 alkoxyalkyl, C 1 -C 12 alkoxycarbonyl} , C ₁ -C ₁₂ alkylcarbonyloxy, C ₁ -C ₁₂ alkylcarbonyloxyalkane or C ₁ -C ₁₂ alkylcarbonyl; each occurrence of R is independently: (a) H or C ₁ -C ₁₂ alkyl; or (b) R together with the carbon atom to which it is bound and adjacent to R and form a carbon-carbon ^double bond together with the carbon atom to which it is bound ^; R and R have the following structures at each occurrence, respectively:

a ¹ and a ² are independently an integer from 3 to 12 at each occurrence; b ¹ and b ² are independently 0 or 1 at each occurrence; c ¹ and c ² are independently 5 at each occurrence An integer of up to 10; d ¹ and d ² are independently an integer of 5 to 10 at each occurrence; y is independently an integer of 0 to 2 at each occurrence; and n is an integer of 1 to 6, wherein each Alkyl, alkylene, hydroxyalkyl, aminoalkyl, alkylaminoalkyl, alkoxyalkyl, alkoxycarbonyl, alkylcarbonyloxy, alkylcarbonyloxyalkyl and alkyl A carbonyl group is optionally substituted with one or more substituents.

式(VIII) 或其醫藥學上可接受之鹽、前藥或立體異構物，其中：G ¹或G ²中之一者在每次出現時為—O(C═O)—、—(C═O)O—、—C(═O)—、—O—、—S(O) _y−、—S—S—、—C(═O)S—、SC(═O)—、—N(R ^a)C(═O)—、—C(═O)N(R ^a)—、—N(R ^a)C(═O)N(R ^a)—、—OC(═O)N(R ^a)—或—N(R ^a)C(═O)O—，且G ¹或G ²中之另一者在每次出現時為—O(C═O)—、—(C═O)O—、—C(═O)—、—O—、—S(O) _y−、—S—S—、—C(═O)S—、—SC(═O)—、—N(R ^a)C(═O)—、—C(═O)N(R ^a)—、—N(R ^a)C(═O)N(R ^a)—、—OC(═O)N(R ^a)—或—N(R ^a)C(═O)O—或一直接鍵；L在每次出現時為˜O(C═O)—，其中˜表示與X之共價鍵；X為CR ^a；Z為烷基、環烷基或當n為1時包含至少一個極性官能基之單價部分；或Z為伸烷基、伸環烷基或當n大於1時包含至少一個極性官能基之多價部分；R ^a在每次出現時獨立地為H、C ₁-C ₁₂烷基、C ₁-C ₁₂羥烷基、C ₁-C ₁₂胺基烷基、C ₁-C ₁₂烷基胺基烷基、C ₁-C ₁₂烷氧基烷基、C ₁-C ₁₂烷氧基羰基、C ₁-C ₁₂烷基羰氧基、C ₁-C ₁₂烷基羰氧基烷基或C ₁-C ₁₂烷基羰基；R在每次出現時獨立地為：(a) H或C _1-C ₁₂烷基；或(b) R與其所結合之碳原子一起以及相鄰R及與其所結合之碳原子一起形成碳碳雙鍵；R ¹及R ²分別在每次出現時具有以下結構：

R′在每次出現時獨立地為H或C ₁-C ₁₂烷基；a ¹及a ²在每次出現時獨立地為3至12之整數；b ¹及b ²在每次出現時獨立地為0或1；c ¹及c ²在每次出現時獨立地為2至12之整數；d ¹及d ²在每次出現時獨立地為2至12之整數；y在每次出現時獨立地為0至2之整數；且n為1至6之整數，其中a ¹、a ²、c ¹、c ²、d ¹及d ²經選擇使得a ¹+c ¹+d ¹之總和為18至30之整數，且a ²+c ²+d ²之總和為18至30之整數，且其中各烷基、伸烷基、羥烷基、胺基烷基、烷基胺基烷基、烷氧基烷基、烷氧基羰基、烷基羰氧基、烷基羰氧基烷基及烷基羰基視情況經一或多個取代基取代。 In another embodiment, the cationic lipid is a compound of formula (VIII):

Formula (VIII) or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein: one of G ¹ or G ² is —O(C═O)—, —( C═O)O—,—C(═O)—,—O—,—S(O) _y− ,—S—S—,—C(═O)S—, SC(═O)—,— N(R ^a )C(═O)—,—C(═O)N(R ^a )—,—N(R ^a )C(═O)N(R ^a )—,—OC(═O)N (R ^a )—or—N(R ^a )C(═O)O—, and the other of G ¹ or G ² in each occurrence is —O(C═O)—,—(C═ O)O—,—C(═O)—,—O—,—S(O) _y− ,—S—S—,—C(═O)S—,—SC(═O)—,—N (R ^a )C(═O)—,—C(═O)N(R ^a )—,—N(R ^a )C(═O)N(R ^a )—,—OC(═O)N( R ^a )—or—N(R ^a )C(═O)O—or a direct bond; L in each occurrence is ˜O(C═O)—where ˜ denotes a covalent bond to X; X is CR ^a ; Z is alkyl, cycloalkyl, or a monovalent moiety that contains at least one polar functional group when n is 1; or Z is alkylene, cycloalkylene, or contains at least one polar functional group when n is greater than 1 A polyvalent moiety of a group; R ^a independently at each occurrence is H, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ hydroxyalkyl, C ₁ -C ₁₂ aminoalkyl, C ₁ -C ₁₂ Alkylaminoalkyl, C _{1 -C 12 alkoxyalkyl, C 1 -C 12 alkoxycarbonyl} , C ₁ -C ₁₂ alkylcarbonyloxy, C ₁ -C ₁₂ alkylcarbonyloxyalkane or C ₁ -C ₁₂ alkylcarbonyl; each occurrence of R is independently: (a) H or C ₁ -C ₁₂ alkyl; or (b) R together with the carbon atom to which it is bound and adjacent to R and form a carbon-carbon ^double bond together with the carbon atom to which it is bound ^; R and R have the following structures at each occurrence, respectively:

R' is independently H or C ₁ -C ₁₂ alkyl at each occurrence; a ¹ and a ² are independently an integer from 3 to 12 at each occurrence; b ¹ and b ² are independently at each occurrence ground is 0 or 1; c ¹ and c ² are independently integers from 2 to 12 at each occurrence; d ¹ and d ² are independently integers from 2 to 12 at each occurrence; y is at each occurrence are independently an integer from 0 to 2; and n is an integer from 1 to 6, wherein a ¹ , a ² , c ¹ , c ² , d ¹ and d ² are selected such that the sum of a ¹ +c ¹ +d ¹ is An integer of 18 to 30, and the sum of a ² +c ² +d ² is an integer of 18 to 30, and wherein each alkyl, alkylene, hydroxyalkyl, aminoalkyl, alkylaminoalkyl, Alkoxyalkyl, alkoxycarbonyl, alkylcarbonyloxy, alkylcarbonoxyalkyl and alkylcarbonyl are optionally substituted with one or more substituents.

Exemplary compounds of formula (VII) and (VIII), their synthesis and their use are described in US20190022247, all of which are incorporated herein by reference.

Additional cationic lipids that may be used in the compositions of the present application include, but are not limited to, those described in WO2019/036030, WO2019/036028, WO2019/036008, WO2019/036000, US2016/0376224, US2017/0119904, WO2018/200943, and WO2018/191657. The relevant content of describing them, lipids, their synthesis and use is incorporated herein by reference in its entirety.

Lipid nanoparticles can be prepared by including multicomponent lipid mixtures using different ratios of one or more cationic lipids, non-cationic lipids, and polyethylene glycol (PEG)-modified or pegylated lipids, i.e., lipids are borrowed Modification by covalent attachment of polyethylene glycol. PEG provides liposomes with a coating that can impart favorable pharmacokinetic characteristics, eg, it can increase stability and prevent non-specific adsorption of liposomes. In certain embodiments, the PEG has an average molecular weight of 1 kDa to 12 kDa, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 kDa. For example, it has been reported that the length of PEG can affect the in vivo expression of encapsulated RNA, and that PEGs with a molecular weight below 1 kDa (eg, 500 or 750 Da) do not form stable liposomes. See eg US2014/0255472, the relevant content of which is incorporated herein by reference.

Lipid formulations can include anionic lipids. Anionic lipids can be any lipid species that carry a net negative charge at a chosen pH, such as physiological pH. When combined with cationic lipids, anionic lipids serve to reduce the overall surface charge of LNPs and liposomes and introduce a pH-dependent disruption of the LNP or liposome bilayer structure, facilitating nucleotide release. Several anionic lipids have been described in the literature, many of which are commercially available. For example, anionic lipids suitable for use in the compositions and methods of the invention include 1,2-dioleyl-sn-glycero-3-phosphoethanolamine (DOPE), phosphatidylglycerol, cardiolipin, diacylphosphatidyl Serine Acid, Diacylphosphatidic Acid, N-Laurylphosphatidylethanolamine, N-Butacylphosphatidylethanolamine, N-Glutarylphosphatidylethanolamine, Lysylphosphatiylglycerol and Palmitoyl Oleylphosphatidylglycerol (POPG).

Lipid formulations may also include lipid bilayer stabilizing components. Bilayer stabilizing components can be used to inhibit LNP aggregation, but bilayer stabilizing components are not limited to this function. For example, conjugated lipids such as polyPEG-lipid conjugates and cationic polymer-lipid conjugates can be used to inhibit aggregation of LNPs or liposomes. By controlling the composition and concentration of bilayer stabilizing components, we can control the rate at which bilayer stabilizing components are exchanged from liposomes and in turn control the rate at which liposomes become fusogenic. The term "fusogenic" refers to the ability of a liposome or other drug delivery system to fuse with the membrane of a cell. For example, when a polyethylene glycol-phosphatidylethanolamine conjugate or a polyethylene glycol-ceramide conjugate is used as bilayer stabilization, the rate at which liposomes become fusogenic can be determined, for example, by altering the bilayer stabilization. The concentration of the chemical component can be changed by changing the molecular weight of polyethylene glycol or by changing the chain length and degree of saturation of the acyl chain group on phosphatidylethanolamine or ceramide. Additionally, other variables including, for example, pH, temperature, ionic strength, etc. can be used to alter and/or control the rate at which liposomes become fusogenic. Other methods that can be used to control the rate at which liposomes become fusogenic will become apparent to those of skill in the art upon reading this disclosure.

LNPs and liposomes can be prepared according to the invention using methods known in the art. For example, LNPs can be prepared using ethanol injection or dilution, film hydration, freeze-thaw, French press or membrane extrusion, diafiltration, sonication, detergent dialysis, ether infusion, and reverse phase evaporation . One useful method for preparing liposomes involves mixing (i) an ethanol solution of lipids, (ii) aqueous nucleic acid solution and (iii) buffer, followed by mixing, equilibration, dilution and purification. Preferred liposomes of the present invention, such as liposomes with preferred diameters, can be obtained by this mixing process. To obtain liposomes with the desired diameter, mixing can be performed using a process as described below, in which two feed streams of aqueous nucleic acid solution are combined at the same flow rate, for example in a microfluidic channel, with one stream of ethanolic lipid solution. in a single mixing zone. Additional examples, compositions and methods of producing liposomes are described in US 2014/0255472, which is incorporated herein by reference in its entirety.

Some examples of lipids, lipid compositions and methods for generating lipid vehicles for the delivery of active nucleic acid molecules such as those of the invention are described in: US2017/0190661, US2006/0008910, US2015/0064242, US2005 /0064595, WO/2019/036030, US2019/0022247, WO/2019/036028, WO/2019/036008, WO/2019/036000, US2016/0376224, US2017/0119904, WO/2018/200943/WO19165 , US2014/0255472 and US2013/0195968, the relevant contents of each of these cases are incorporated herein by reference in their entirety.

Liposomes are microscopic vesicles comprising at least one concentric lipid bilayer. Vesicle-forming lipids are chosen to achieve a given degree of final complex fluidity or rigidity. In certain embodiments, liposomes provide a lipid composition that is an outer layer surrounding porous nanoparticles.

Liposomes can be neutral (cholesterol) or bipolar and include phospholipids such as phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and sphingomyelin (SM) and other types of bipolar Polar lipids, including dioleoylphosphatidylethanolamine (DOPE), wherein the hydrocarbon chain length is in the range of 14-22, and is either saturated or has one or more double C=C bonds. Examples of lipids capable of producing stable liposomes alone or in combination with other lipid components are phospholipids, such as hydrogenated soybean phosphatidylcholine (HSPC), lecithin, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylfilament Amino acid, phosphatidylinositol, sphingomyelin, cephalin, cardiolipin, phosphatidic acid, cerebroside, distearoylphosphatidylethanolamine (DSPE), dioleylphosphatidylethanolamine (DOPC), dipalmitone Dioleylphosphatidylcholine (DPPC), palmityl oleylphosphatidylcholine (POPC), palmityl oleyl phosphoethanolamine (POPE) and dioleyl phosphatidyl ethanolamine 4-(N-maleic di Amido-methyl)cyclohexane-1-carboxylate (DOPE-mal). Additional nonphospholipid-containing lipids that can be incorporated into liposomes include stearylamine, laurylamine, cetylamine, isopropyl myristate, triethanolamine lauryl sulfate, alkylaryl sulfate, acetyl palmitate Esters, Glyceryl Ricinoleate, Cetyl Stearate, Amphoteric Acrylic Polymer, Polyethyloxylated Fatty Acid Amide, DDAB, Dioctadecyldimethylammonium Chloride (DODAC), 1, 2-Dimyristyl-3-trimethylammoniumpropane (DMTAP), DOTAP, DOTMA, DC-Choi, Phosphatidic Acid (PA), Dipalmitylphosphatidylglycerol (DPPG), Dioleylphosphatidylglycerol Alcohol, DOPG and Dicetyl Phosphate. In specific embodiments, lipids used to generate liposomes disclosed herein include cholesterol, hydrogenated soybean phosphatidylcholine (HSPC), and the derivatized vesicle-forming lipid PEG-DSPE.

Methods of forming liposomes are described, for example, in U.S. Patent Nos. 4,229,360, 4,224,179, 4,241,046, 4,737,323, 4,078,052, 4,235,871, 4,501,728, and 4,837,028; and in Szoka et al. Ann. Rev. Biophys. Bioeng. 9:467 (1980) and Hope et al., Chem. Phys. Lip. 40:89 (1986). Prime / Boost Immunization

Embodiments of the present application also encompass administering to an individual an effective amount of a pharmaceutical composition or immunogenic combination in a so-called prime-boost regimen, and subsequently administering to the same individual another effective amount of a pharmaceutical composition or immunogenic combinations. Thus, in one embodiment, the pharmaceutical composition or immunogenic combination of the present application is a priming vaccine for eliciting an immune response. In another embodiment, the pharmaceutical composition or immunogenic combination of the present application is a booster vaccine for boosting the immune response. The priming and boosting vaccines of the present application can be used in the methods of the present application described herein. The general concept of this prime-boost regimen is well known to those skilled in the vaccine arts. Any of the pharmaceutical compositions and immunogenic combinations of the present application described herein can be used as priming and/or boosting vaccines to prime and/or boost immune responses against HBV. Preferably, the method for vaccinating an individual comprises administering to the individual a pharmaceutical composition comprising a nucleic acid molecule, vector or RNA replicon of the present application, and administering to the individual a nucleic acid molecule encoding at least one consensus HBV antigen The second composition was used as a prime-boost regimen.

In some embodiments of the present application, the pharmaceutical compositions or immunogenic combinations of the present application can be administered to elicit immunization. The pharmaceutical composition or immunogenic combination can be readministered for booster immunization. Further booster administrations of the pharmaceutical composition or vaccine combination can be added to the regimen as needed. Adjuvants may be present in the pharmaceutical composition of the present application for booster immunization, in a separate composition to be administered together with the pharmaceutical composition of the present application or the immunogenic combination for booster immunization , or administered alone as a booster immunization. In those embodiments where an adjuvant is included in the regimen, the adjuvant is preferably used for booster immunizations.

Illustrative and non-limiting examples of prime-boost regimens include administering to a subject a single dose effective amount of a pharmaceutical composition or immunogenic combination of the present application to elicit an immune response; and subsequently administering another dose effective amount of The pharmaceutical composition or immunogenic combination of the present application is to boost the immune response, wherein the booster immunization is first administered about two weeks, four weeks, six weeks, eight weeks, preferably four weeks after the initial administration to prime the immunization. Optionally, about 10 weeks, 12 weeks or 14 weeks, preferably 12 weeks after the initial administration of the priming immunization, a booster immunization of the pharmaceutical composition or immunogenic combination or other adjuvants is further administered.

The antigens in the priming and boosting compositions need not be identical, but should share antigens or be substantially similar to each other. In certain embodiments, the vector of the priming composition is a replicon, and the vector of the boosting composition is different from the priming composition, such as adenovirus vector, modified vaccinia Ankara (MVA) vector, DNA or protein. In certain embodiments, the vector of the boosting composition is a replicon, and the vector of the priming composition is different from the boosting composition, such as adenovirus vector, modified vaccinia ankara (MVA) vector, DNA or protein. The priming and boosting compositions of the invention may each comprise one, two, three, four or up to five doses. RNAi agent pharmaceutical composition

In another aspect, the present invention describes methods for the therapeutic and/or prophylactic treatment of hepatitis B virus (HBV) infection in individuals in need thereof; methods for enhancing the immune response in individuals with HBV infection ; for reducing the method for virus replication in individuals with HBV infection; for reducing the method of expression of one or more HBV polypeptides in individuals in need; for regulating hepatitis B virus in individuals with HBV infection ( HBV) capsid assembly or dissociation; and/or methods for targeted killing of hepatocytes containing integrated viral DNA or extrachromosomal viral DNA in an individual suffering from HBV infection comprising administering a or a pharmaceutical composition of multiple HBV RNAi agents, and the pharmaceutical composition may be administered in various ways depending on the need for local or systemic treatment. Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (eg, via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

In another aspect, the methods described herein comprise one or more HBV RNAi agents, wherein the one or more HBV agents are prepared in the form of a pharmaceutical composition or formulation. In some embodiments, the pharmaceutical composition includes at least one HBV RNAi agent. These pharmaceutical compositions are especially suitable for inhibiting the expression of target mRNA in target cells, cell populations, tissues or organisms. These pharmaceutical compositions are useful for treating individuals suffering from diseases or disorders that would benefit from reduced levels of target mRNA or inhibition of target gene expression. The pharmaceutical compositions are useful for treating an individual at risk of developing a disease or condition that would benefit from a reduction in the level of a target mRNA or inhibition of expression of a target gene. In one embodiment, the method comprises administering to the individual to be treated an HBV RNAi agent as described herein linked to a targeting ligand. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents and/or delivery polymers) are added to pharmaceutical compositions comprising HBV RNAi agents to form suitable Pharmaceutical formulations for in vivo delivery to humans.

The pharmaceutical compositions and methods disclosed herein that include HBV RNAi agents can reduce target mRNA levels in cells, cell groups, tissues or individuals, comprising: administering a therapeutically effective amount of the HBV RNAi agents described herein to the individual, thereby inhibiting Expression of target mRNA in individual.

In some embodiments, the described pharmaceutical compositions comprising HBV RNAi agents are used to treat or manage clinical manifestations associated with HBV infection. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to an individual in need of such treatment, prevention or management. In some embodiments, administration of any of the disclosed HBV RNAi agents can be used to reduce the number, severity, and/or frequency of symptoms of the disease in an individual.

The described pharmaceutical compositions comprising HBV RNAi agents are useful for treating at least one symptom of an individual suffering from a disease or condition that would benefit from reducing or inhibiting the expression of HBV mRNA. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an HBV RNAi agent is administered to an individual to treat symptoms. In other embodiments, a prophylactically effective amount of one or more HBV RNAi agents is administered to an individual, thereby preventing at least one symptom.

The route of administration is the route by which the HBV RNAi agent comes into contact with the body. In general, methods of administering drugs and nucleic acids to treat mammals are well known in the art and can be applied to the administration of the compositions described herein. The HBV RNAi agents disclosed herein can be administered via any suitable route in a formulation suitably tailored to a particular route. Accordingly, the pharmaceutical compositions described herein can be administered by injection (eg, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly or intraperitoneally). In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

Pharmaceutical compositions described herein that include HBV RNAi agents can be delivered to cells, cell populations, tumors, tissues, or individuals using oligonucleotide delivery techniques known in the art. In general, any suitable method recognized in the art for the delivery of nucleic acid molecules (either in vitro or in vivo) is suitable for use with the compositions described herein. For example, delivery can be achieved by local administration (such as direct injection, implantation or topical administration), systemic administration or subcutaneous, intravenous, intraperitoneal or parenteral routes, including intracranial (such as Indoor, intraparenchymal and intrathecal), intramuscular, transdermal, respiratory (aerosol), nasal, oral, rectal or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

Accordingly, in some embodiments, the pharmaceutical compositions described herein may comprise one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein can be formulated for administration to an individual.

As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic product, eg HBV RNAi agent) intended to be included in a drug delivery system. An excipient does not exert or is not intended to exert a therapeutic effect at the intended dosage. Excipients can be used to a) aid in the processing of drug delivery systems during manufacturing, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) aid in product identification, and/or d) in the Any other attribute that enhances the overall safety, effectiveness of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

Excipients include, but are not limited to: absorption enhancers, antiadherents, antifoaming agents, antioxidants, binders, buffers, vehicles, coatings, pigments, delivery enhancers, delivery polymers, dextran , dextrose, diluent, disintegrant, emulsifier, bulking agent, filler, flavoring agent, glidant, humectant, lubricant, oil, polymer, preservative, saline, salt, solvent, Sugars, suspending agents, sustained release bases, sweeteners, thickeners, tonicity agents, vehicles, water repellents and wetting agents.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate-buffered saline. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol such as glycerol, propylene glycol, and liquid polyethylene glycol, and suitable mixtures thereof. Proper fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the required particle size in the case of dispersions and by using surfactants. In many cases it will be desirable to include isotonic agents, for example, sugars, polyalcohols (such as mannitol, sorbitol), and sodium chloride in the compositions. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Formulations suitable for intra-articular administration may be in the form of sterile aqueous preparations of pharmaceuticals which may be in microcrystalline form, for example as an aqueous microcrystalline suspension. Lipid formulations or biodegradable polymer systems can also be used for intra-articular and ocular administration of the drug.

The active compounds can be prepared with carriers that will prevent rapid elimination of the compound from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. It can be prepared according to methods known to those skilled in the art, for example as described in US Patent No. 4,522,811.

For ease of administration and uniformity of dosage, HBV RNAi agents can be formulated in a composition in unit dosage form. Unit dosage form refers to physically discrete units suitable as unitary dosages for the individual to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the unit dosage forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the art of compounding such active compounds for the treatment of a subject.

The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory agents (eg, antihistamines, diphenhydramine, etc.). It is also contemplated that a cell, tissue or isolated organ expressing or comprising an RNAi agent as defined herein may be used as a "pharmaceutical composition". As used herein, "pharmacologically effective amount", "therapeutically effective amount" or simply "effective amount" refers to the amount of an RNAi agent that produces pharmacological, therapeutic or preventive results.

Generally, an effective amount of active compound will be in the range of about 0.1 to about 100 mg/kg body weight per day, for example about 1.0 to about 50 mg/kg body weight per day. In some embodiments, an effective amount of active compound will range from about 0.25 to about 5 mg per kilogram body weight per dose. In some embodiments, an effective amount of active compound will be in the range of about 40-1000 mg, more specifically about 25-400 mg, every 1 to 18 weeks or 1 to 6 months. In some embodiments, the effective amount of active compound will be in the range of 50-250 mg every 4 weeks (Q4W) or every month (Q1M). The terms "Q4W" and "Q1M", "every 4 weeks" and "every month" and variations thereof may be used interchangeably throughout this application. In some embodiments, the effective amount of active compound will be in the range of 50-250 mg every 8 weeks (Q8W) or every two months (Q2M). In some embodiments, the effective amount of active compound will be in the range of 50-250 mg every 12 weeks (Q12W) or every three months (Q3M). In some embodiments, the effective amount of active ingredient will be in the range of about 0.5 to about 3 mg per kilogram body weight per dose. In some embodiments, the effective amount of active ingredient will be in the range of about 25-400 mg per dose. In some embodiments, the effective amount of active ingredient will be in the range of about 50-125 mg per dose. In some embodiments, the effective amount of active ingredient will be about 100 mg or about 200 mg per dose. The amount administered will also likely depend on variables such as the patient's overall health, the relevant biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. Furthermore, it is understood that the initial dosage administered may be increased beyond the above upper limits in order to rapidly achieve the desired blood or tissue levels, or that the initial dosage may be less than optimal.

In some embodiments, the effective amount of the RNAi component is in the range of about 25-600 mg per dose. In some embodiments, the effective amount of the RNAi component is about 25-50 mg, about 50-75 mg, about 75-100 mg, about 100-150 mg, about 150-200 mg, about 200-250 mg per dose , about 250-300 mg, about 300-400 mg, about 400-500 mg, or about 500-600 mg. In some embodiments, the effective amount of the RNAi component is about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg per dose , about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, or about 600 mg. In some embodiments, the effective amount of the RNAi component is about 25 mg, about 35 mg, about 40 mg, about 50 mg, about 100 mg, or about 200 mg per dose.

One or more (eg, at least two) HBV RNAi agents described herein can be formulated as a single composition or as separate individual compositions. In some embodiments, the HBV RNAi agents in separate individual compositions can be formulated with the same or different excipients and carriers. In some embodiments, the HBV RNAi agents in separate individual composition agents can be administered via the same or different routes of administration. In some embodiments, the HBV RNAi agent is administered subcutaneously.

To treat a disease or to form a medicament or composition for treating a disease, the pharmaceutical compositions described herein that include an HBV RNAi agent may be combined with an excipient or with a second therapeutic agent or treatment, the second therapeutic agent or treatment Drugs include, but are not limited to: second or additional RNAi agents, small molecule drugs, antibodies, antibody fragments, and/or vaccines.

When added to a pharmaceutically acceptable excipient or adjuvant, the described HBV RNAi agents can be packaged in a kit, container, wrapper or dispenser. The pharmaceutical compositions described herein can be packaged in prefilled syringes or vials.

In some embodiments, the composition comprises an effective amount of the RNAi component in the range of about 40-1000 mg and an effective amount of the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence in the range of about 10-300 μg per dose . set

Provided herein is a kit comprising an effective amount of an RNAi component and an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens, or a pharmaceutically acceptable salt thereof.

In another aspect, the kit further comprises package inserts including, but not limited to, appropriate instructions regarding the preparation and administration of the formulations, side effects of the formulations, and any other relevant information. The instructions may be in any suitable format, including but not limited to printed matter, videotape, computer readable disk, compact disc, or instructions for Internet-based instructions.

In another aspect, there is provided a kit for treating an individual suffering from or susceptible to a condition described herein comprising a first container containing an administered amount of a composition or formulation as disclosed herein and a pharmaceutical use manual. The container can be any of those known in the art and suitable for storage and delivery of intravenous formulations. In certain embodiments, the kit further comprises a second container comprising a pharmaceutically acceptable carrier, diluent, adjuvant, etc. for preparing a formulation to be administered to an individual.

In some embodiments, the kit comprises one or more doses in the range of about 10 μg to about 300 μg per dose, more specifically in the range of about 20 μg to about 200 μg per dose, comprising an agent encoding one or more HBV antigens. A nucleic acid molecule that is not a naturally occurring polynucleotide sequence. In some embodiments, an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens can be administered to a subject in a dose of less than 10 μg. In some embodiments, an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens can be administered to a subject in a dose greater than 300 μg.

In some embodiments, the kit comprises one or more doses of the RNAi component in the range of about 25-600 mg per dose. In some embodiments, the kit comprises about 25-50 mg, about 50-75 mg, about 75-100 mg, about 100-150 mg, about 150-200 mg, about 200-250 mg, about 250- One or more doses of the RNAi component in the range of 300 mg, about 300-400 mg, about 400-500 mg, or about 500-600 mg. In some embodiments, the kit comprises about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg per dose , about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about One or more doses of 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg or about 600 mg of the RNAi component. In some embodiments, the kit comprises one or more doses of about 25 mg, about 35 mg, about 40 mg, about 50 mg, about 100 mg, or about 200 mg of the RNAi component per dose.

In some embodiments, the kit comprises: about 40-1000 mg, more specifically about 40-250 mg, more specifically 40-200 mg, more specifically 100 mg or 200 mg, more specifically A dose of 200 mg is administered to an individual once a month (or every four weeks) of an RNAi component suitable for use in the present invention, such as those described herein; and about 10-300 μg, more specifically A nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens administered to an individual at a dose of 20-200 μg, such as those described herein, wherein the dose is administered at most Five (5) times. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are administered in up to five (5) doses, up to three (3) doses, or in two (2) doses vote with. In certain embodiments, the first dose is a priming dose and the second dose is a booster dose.

In some embodiments, the kit further comprises administration of an RNAi component contained therein and a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens to treat a patient with HBV infection Instructions for individuals, especially those with chronic HBV infection. In some embodiments, the kit further comprises administration to an individual with HBV infection using the RNAi component contained therein and a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens: Instructions for enhancing immune response, reducing viral replication, reducing expression of one or more HBV polypeptides and/or increasing targeted killing of hepatocytes comprising integrated viral DNA and/or extrachromosomal viral DNA.

In another aspect, a kit may also be provided which contains sufficient doses of the compositions described herein (including pharmaceutical compositions thereof) to be administered over an extended period of time, such as 1 to 3 days, 1 to 5 days, One week, 2 weeks, 3 weeks, 4 weeks, 6 weeks, 8 weeks, 1 cycle, 2 cycles, 3 cycles, 4 cycles, 5 cycles, 6 cycles, 7 cycles, 8 cycles or more Effective treatment is provided to the individual over an extended period of time. In some embodiments, a treatment cycle is about 1 to 24 months, about 1 to 3 months, about 3 to 6 months, about 6 to 9 months, about 9 to 12 months, about 12 to 18 months months, about 18 to 21 months, or about 21 to 24 months. In some embodiments, a treatment cycle is about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, About 9 months, about 10 months, about 11 months, about 12 months, about 15 months, about 18 months, about 21 months, or about 24 months.

In some embodiments, the kit can also include multiple doses and can be packaged in quantities sufficient for storage and use by pharmacies, such as hospital pharmacies and compounding pharmacies. In certain embodiments, a kit can include an administered amount of at least one composition as disclosed herein. method

Also provided herein is a method of treating a hepatitis B virus (HBV) infection in an individual in need thereof, wherein the method comprises administering to the individual an effective amount of an RNAi component comprising a non-naturally occurring polynucleus encoding one or more HBV antigens Nucleic acid molecules of nucleotide sequences, such as those described herein. Also provided herein is a method of enhancing an immune response in an individual suffering from HBV infection, wherein the method comprises administering to the individual an effective amount of an RNAi component and a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens Nucleic acid molecules, such as those described herein. Also provided herein is a method of reducing viral replication in an individual suffering from HBV infection, wherein the method comprises administering to the individual an effective amount of an RNAi component and a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens Nucleic acid molecules, such as those described herein. Also provided is a method of reducing the expression of one or more HBV polypeptides, more particularly one or more polypeptides selected from HBsAg and HBeAg, such as those described herein, in an individual in need thereof. Also provided herein is a method of increasing targeted killing of hepatocytes comprising integrated viral DNA and/or extrachromosomal viral DNA in an individual having HBV infection, the method comprising administering to the individual an effective amount of an RNAi component and comprising Nucleic acid molecules encoding non-naturally occurring polynucleotide sequences of one or more HBV antigens, such as those described herein.

In some embodiments, the HBV infection is a chronic HBV infection. In some embodiments, administering an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens reduces Immunologic tolerance of an individual to HBV, more specifically, immunotolerance of an individual's liver to HBV. Reducing the immunotolerance of an individual to HBV or the hepatic immunotolerance of an individual to HBV infection is characterized by reactivation of the immune system of an individual with chronic HBV infection. Reactivation of the immune system can occur following administration of an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens , the administration serves to reduce or reduce the HBsAg level of the individual, thereby allowing reactivation of the immune system.

In some embodiments, an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered, at least Until the individual meets at least one, at least two, at least three, at least four or five of the following characteristics: (i) serum HBV DNA below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically low At 15 IU/mL, more specifically below 10 IU/ml; (ii) serum ALT concentration below 3 times the upper limit of normal, or below 129 U/L in the case of a male individual, or in an individual less than 108 U/L in the case of a female individual, more specifically a serum ALT concentration of less than 120 U/L in the case of a male individual or less than 105 U/L in the case of a female individual, More specifically serum ALT concentrations below 90 U/L if the subject is male or below 57 U/L if the subject is female; (iii) HBeAg negative serum; (iv) serum HBsAg level 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, more specifically 10 IU/mL or less; and (v) HBs seroconversion. In some embodiments, at least one, at least two, at least three of characteristics (i), (ii), (iii), (iv) and (v) are still met six (6) months after the end of treatment , at least four or five.

In some embodiments, an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered, at least Until the individual meets at least one, at least two, at least three or four of the following characteristics: (i) serum HBV DNA is below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL mL, more specifically less than 10 IU/ml; (ii) a serum ALT concentration less than 3 times the upper limit of normal, or less than 129 U/L if the subject is a male, or less than 129 U/L if the subject is a female less than 108 U/L in the case of a male individual, more specifically a serum ALT concentration of less than 120 U/L in the case of a male individual or less than 105 U/L in the case of a female individual, more specifically Serum ALT concentration less than 90 U/L if the subject is male or less than 57 U/L if the subject is female; (iii) HBeAg negative serum; and (iv) serum HBsAg level of 1000 IU /mL or lower, more specifically 300 IU/mL or lower, more specifically 100 IU/mL or lower, more specifically 10 IU/mL or lower. In some embodiments, at least one, at least two, at least three or four of characteristics (i), (ii), (iii) and (iv) are still met six (6) months after the end of treatment .

In some embodiments, the method comprises administering an effective amount of a pharmaceutical composition comprising an RNAi component at least until the individual's serum HBsAg level is reduced to 1000 IU/mL or less, more specifically 300 IU/mL or less Low, more specifically 100 IU/mL or less, more specifically down to 10 or less. In some embodiments, the method comprises reducing the patient's serum HBsAg level to 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, more specifically Specifically 10 IU/mL or less is followed by administration, more specifically initially administered, of an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens.

In some embodiments, compared to administering only an effective amount of the pharmaceutical composition comprising the RNAi component or administering an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide encoding one or more HBV antigens The individual of the pharmaceutical composition, the serum HBsAg level of the individual decreases at a faster rate, decreases to a greater extent and/or decreases for a longer period of time.

In some embodiments, enhancing an individual's immune response results in a strengthening of the innate immune system and/or the acquired immune system. Enhanced innate immune system makes one of interferon-stimulated gene (ISG), interferon-gamma-inducible protein 10 (IP10), interferon-alpha (IFNα), interleukin-12 (IL12) or interleukin-6 (IL-6) An increase in the performance of one or more of them.

In some embodiments, the enhancement of the acquired immune system results in increased levels of HBV-specific T cell responses and/or increased activation of HBV-specific T cells. Activation of HBV-specific T cells can be measured by any means considered suitable by one of ordinary skill in the art, for example by interferon gamma production (eg interferon gamma ELISPOT).

Increased expression of at least one of ISG, IP10, IFNa, IL12 or IL-6, increased level of HBV-specific T cell response, and/or increased activation of HBV-specific T cells can be compared to a control. The control can be from an individual prior to administering an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens The expression of ISG, IP10, IFNα, IL12 or IL-6 of the sample; the level of HBV-specific T cell response; the activation level of HBV-specific T cell. As another example, the control may be derived from the administration of an effective amount of a pharmaceutical composition comprising an RNAi component without administering an effective amount of a nucleic acid comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens The individuality of the pharmaceutical composition of molecule, or from the pharmaceutical composition comprising the nucleic acid molecule that comprises the non-naturally occurring polynucleotide sequence of encoding one or more HBV antigens of administering effective dose and not administering effective dose comprising RNAi The expression level of ISG, IP10, IFNα, IL12 or IL-6; the level of HBV-specific T cell response; and/or the level of HBV-specific T cell activation of the individual of the component pharmaceutical composition. Those skilled in the art will appreciate the methods used to measure increased expression of ISG, IP10, IFNα, IL12, or IL-6, increased levels of HBV-specific T cell responses, and/or increased levels of activation of HBV-specific T cells in an individual. Appropriate controls.

In some embodiments, enhancing the individual's immune response results in increased immunity in the individual. Improving the immunity of an individual may, for example, result in increased levels of HBV-specific T cells, B cells or NK cells in the liver and/or increased activation of HBV-specific T cells, B cells or NK cells in the liver. Enhanced immune competence of an individual may eg result in increased NK cells, T cells or B cells in the peripheral immune cell compartment and/or increased activation of NK cells, T cells or B cells in the peripheral immune cell compartment. Increased immunity of an individual may, for example, result in a reduction in myeloid-derived suppressor cells (MDSC) in the liver and/or in the surrounding immune cell compartment; and/or in the immunosuppressive activity of MDSC in the liver and/or in the surrounding immune cell compartment decreased; and/or decreased regulatory T cells (Treg) in the liver and/or peripheral immune cell compartment, and/or decreased immunosuppressive activity of Treg in the liver and/or peripheral immune cell compartment.

An increase in the level or activation of HBV-specific T cells, B cells or NK cells in the liver; an increase in the level or activation of NK cells, T cells or B cells in the peripheral immune cell compartment can be determined, for example, by comparison with a control ; reduction in the level of myeloid-derived suppressor cells (MDSC) or reduction in immunosuppressive activity in the liver and/or peripheral immune cell compartment; and/or reduction in regulatory T cells (Treg) in the liver and/or peripheral immune cell compartment decreased levels or decreased immunosuppressive activity. The control can be from an individual prior to administering an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens. Levels or activation of HBV-specific T cells, B cells, or NK cells in the sample's liver; levels or activation of NK cells, T cells, or B cells in the peripheral immune cell compartment; liver and/or peripheral immune cell compartments Levels or immunosuppressive activity of myeloid-derived suppressor cells (MDSC); and/or levels or activity of regulatory T cells (Treg) in the liver and/or peripheral immune cell compartments. As another example, the control may be derived from the administration of an effective amount of a pharmaceutical composition comprising an RNAi component without administering an effective amount of a nucleic acid comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens The individuality of the pharmaceutical composition of molecule, or from the pharmaceutical composition comprising the nucleic acid molecule that comprises the non-naturally occurring polynucleotide sequence of encoding one or more HBV antigens of administering effective dose and not administering effective dose comprising RNAi The level or activation of HBV-specific T cells, B cells or NK cells in the liver of the individual of the pharmaceutical composition of the component; the level or activation of NK cells, T cells or B cells in the peripheral immune cell compartment; the liver and/or The level or immunosuppressive activity of myeloid-derived suppressor cells (MDSC) in the peripheral immune cell compartment; and/or the level or activity of regulatory T cells (Treg) in the liver and/or peripheral immune cell compartment. Those skilled in the art will know appropriate controls for determining the following in an individual: increased levels or activation of HBV-specific T cells, B cells, or NK cells in the liver; NK cells, T cells, or B cells in the peripheral immune cell compartment; Cell levels or activation; reduction in myeloid-derived suppressor cell (MDSC) levels or immunosuppressive activity in the liver and/or peripheral immune cell compartment; and/or regulatory T cells in the liver and/or peripheral immune cell compartment ( A decrease in the level or activity of Treg).

Activation of HBV-specific NK cells can be measured by any means considered suitable by those of ordinary skill in the art, for example by interferon gamma production (eg interferon gamma ELISPOT). Activation of HBV-specific B cells can be measured by any means considered suitable by those of ordinary skill in the art, for example, by anti-HBs antibody production (eg, anti-HBs ELISPOT). The immunosuppressive activity of MDSCs can be measured by any means deemed suitable by one of ordinary skill in the art, for example, by arginase expression.

In some embodiments, the subject has reduced viral replication such that serum HBV DNA is below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL, more specifically below 10 IU/mL mL.

In some embodiments, the targeted hepatocytes comprise cccDNA. In some embodiments, the targeted hepatocytes comprise integrated HBV DNA.

In some embodiments, the RNAi component comprises: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO : 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99, and meaningful shares, which include the following The nucleotide sequence of any one: SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106 and SEQ ID NO: 107; and (ii ) a second RNAi agent, the second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO: 100 and SEQ ID NO: 101, and a sense strand , the nucleotide sequence comprising any one of the following: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110 and SEQ ID NO: 111.

In some embodiments, the first RNAi agent comprises SEQ ID NO: 97 and SEQ ID NO: 106. In some embodiments, the first RNAi agent comprises SEQ ID NO: 98 and SEQ ID NO: 106. In some embodiments, the first RNAi agent comprises SEQ ID NO: 99 and SEQ ID NO: 107. In some embodiments, the first RNAi agent comprises SEQ ID NO: 93 and SEQ ID NO: 102, 103 or 105. In some embodiments, the first RNAi agent comprises SEQ ID NO: 94 and SEQ ID NO: 102, 103 or 105. In some embodiments, the first RNAi agent comprises SEQ ID NO: 95 and SEQ ID NO: 102, 103 or 105. In some embodiments, the first RNAi agent comprises SEQ ID NO: 96 and SEQ ID NO: 104. In some embodiments, the second RNAi agent comprises SEQ ID NO: 101 and SEQ ID NO: 111. In some embodiments, the second RNAi agent comprises SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110.

In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 97 and SEQ ID NO: 106 and a second RNAi agent comprising SEQ ID NO: 101 and SEQ ID NO: 111. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 98 and SEQ ID NO: 106 and a second RNAi agent comprising SEQ ID NO: 101 and SEQ ID NO: 111. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 99 and SEQ ID NO: 107 and a second RNAi agent comprising SEQ ID NO: 101 and SEQ ID NO: 111.

In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 93 and SEQ ID NO: 102, 103 or 105 and a first RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110 Two RNAi agents. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 94 and SEQ ID NO: 102, 103 or 105 and a first RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110 Two RNAi agents. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 95 and SEQ ID NO: 102, 103 or 105 and a first RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110 Two RNAi agents. In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 96 and SEQ ID NO: 104 and a second RNAi agent comprising SEQ ID NO: 100 and SEQ ID NO: 108, 109 or 110.

In some embodiments, the RNAi component comprises a first RNAi agent comprising SEQ ID NO: 94 and SEQ ID NO: 103 or SEQ ID NO: 105 and a first RNAi agent comprising SEQ ID NO: 108 or SEQ ID NO: 110 and SEQ ID NO : 100 of the second RNAi agent.

In some embodiments, the two HBV RNAi agents are administered in a ratio of about 1:1, 2:1, 3:1, 4:1, or 5:1. In some embodiments, two HBV RNAi agents are administered in a ratio of about 2:1.

In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-75 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5: 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 35-40 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5: 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100-200 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 150-250 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300-400 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-100 mg per dose and at about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 1 or a ratio of about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-400 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-75 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 35-40 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100-200 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 125-225 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 150-250 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300-400 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100 mg per dose and are administered in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 35 mg per dose and are administered in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 40 mg per dose and are administered in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50 mg per dose and in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75 mg per dose and are administered in a ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 mg per dose and are administered in a ratio of about 2:1.

In some embodiments, the first RNAi agent is administered in an amount of about 3-650 mg per dose and the second RNAi agent is administered in an amount of about 2-325 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 15-150 mg per dose and the second RNAi agent is administered in an amount of about 5-75 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 35-265 mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 50-75 mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 15-75 mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 20-125 mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 25-50 mg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 5-40 mg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 17 mg per dose and the second RNAi agent is administered in an amount of about 8 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 23 mg per dose and the second RNAi agent is administered in an amount of about 12 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 27 mg per dose and the second RNAi agent is administered in an amount of about 13 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 33 mg per dose and the second RNAi agent is administered in an amount of about 17 mg per dose. In some embodiments, the first RNAi agent is administered in an amount of about 67 mg per dose and the second RNAi agent is administered in an amount of about 33 mg per dose.

In some embodiments, the two RNAi agents are administered at a combined dose of 25-400 mg per dose administered. In one embodiment, the two RNAi agents are administered at a combined dose of 25-400 mg, and the first RNAi agent is administered in a 1:1 ratio to the second RNAi agent. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 12 mg for a combined dose of about 25 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 17 mg for a combined dose of about 35 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 20 mg for a combined dose of about 40 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 25 mg for a combined dose of about 50 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 50 mg for a combined dose of about 100 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 100 mg for a combined dose of about 200 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 150 mg for a combined dose of about 300 mg. In one embodiment, the dose of each of the first and second RNAi agents is in an amount of about 200 mg for a combined dose of about 400 mg.

In one embodiment, the two RNAi agents are administered at a combined dose of 25-400 mg each, and the first RNAi agent is administered in a 2:1 ratio to the second RNAi agent. In one embodiment, for a combined dose of about 25 mg, the dose of the first RNAi agent is in an amount of about 16 mg, and the dose of the second RNAi agent is in an amount of about 8 mg. In one embodiment, for a combined dose of about 35 mg, the dose of the first RNAi agent is in an amount of about 24 mg, and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 40 mg, the dose of the first RNAi agent is in an amount of about 27 mg, and the dose of the second RNAi agent is in an amount of about 13 mg. In one embodiment, for a combined dose of about 50 mg, the dose of the first RNAi agent is in an amount of about 33 mg, and the dose of the second RNAi agent is in an amount of about 17 mg. In one embodiment, for a combined dose of about 100 mg, the dose of the first RNAi agent is in an amount of about 65 mg, and the dose of the second RNAi agent is in an amount of about 35 mg. In one embodiment, for a combined dose of about 200 mg, the dose of the first RNAi agent is in an amount of about 133 mg, and the dose of the second RNAi agent is in an amount of about 67 mg. In one embodiment, for a combined dose of about 300 mg, the dose of the first RNAi agent is in an amount of about 200 mg, and the dose of the second RNAi agent is in an amount of about 100 mg. In one embodiment, for a combined dose of about 400 mg, the dose of the first RNAi agent is in an amount of about 270 mg, and the dose of the second RNAi agent is in an amount of about 135 mg.

In one embodiment, the two RNAi agents are administered at a combined dose of 25-400 mg each, and the first RNAi agent is administered at a ratio of 3:1 to the second RNAi agent. In one embodiment, for a combined dose of about 25 mg, the dose of the first RNAi agent is in an amount of about 18 mg, and the dose of the second RNAi agent is in an amount of about 6 mg. In one embodiment, for a combined dose of about 35 mg, the dose of the first RNAi agent is in an amount of about 27 mg, and the dose of the second RNAi agent is in an amount of about 9 mg. In one embodiment, for a combined dose of about 40 mg, the dose of the first RNAi agent is in an amount of about 30 mg, and the dose of the second RNAi agent is in an amount of about 10 mg. In one embodiment, for a combined dose of about 50 mg, the dose of the first RNAi agent is in an amount of about 36 mg, and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 100 mg, the dose of the first RNAi agent is in an amount of about 75 mg, and the dose of the second RNAi agent is in an amount of about 25 mg. In one embodiment, for a combined dose of about 200 mg, the dose of the first RNAi agent is in an amount of about 150 mg, and the dose of the second RNAi agent is in an amount of about 50 mg. In one embodiment, for a combined dose of about 300 mg, the dose of the first RNAi agent is in an amount of about 225 mg, and the dose of the second RNAi agent is in an amount of about 75 mg. In one embodiment, for a combined dose of about 400 mg, the dose of the first RNAi agent is in an amount of about 300 mg, and the dose of the second RNAi agent is in an amount of about 100 mg.

In some embodiments, the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25-400 mg per dose administered. In some embodiments, the first RNAi agent and the second RNAi agent are administered at about 25-50 mg, 50-75 mg, 75-100 mg, 100-125 mg, 125-150 mg, 150-175 mg per dose. mg, 175-200 mg, 200-225 mg, 225-250 mg, 250-275 mg, 275-300 mg, 300-325 mg, 325-350 mg, 350-375 mg, 375-400 mg, 25-75 mg mg, 50-100 mg, 100-150 mg, 150-200 mg, 200-250 mg, 250-300 mg, 300-350 mg, 350-400 mg, 25-100 mg, 50-150 mg, 100-200 mg mg, 150-250 mg, 200-300 mg, 300-400 mg, 25-200 mg, or 200-400 mg in combination. In some embodiments, the first RNAi agent and the second RNAi agent are administered at about 25 mg, about 50 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about Combination amounts of 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, or about 400 mg are administered. In some embodiments, the first RNAi agent and the second RNAi agent are administered in a combined amount of about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose administered. In some embodiments, the first RNAi agent and the second RNAi agent are administered in a combined amount of about 25 mg, about 35 mg, about 40 mg, or about 200 mg per dose administered.

In some embodiments, two HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administered. In some embodiments, two HBV RNAi agents are administered in a combined amount of about 1-5 mg/kg per dose administered. In some embodiments, two HBV RNAi agents are administered at about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5.0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0- 6.5 mg/kg, about 6.5-7.0 mg/kg, about 7.0-7.5 mg/kg, about 7.5-8.0 mg/kg, about 8.0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9.0-9.5 mg /kg, about 9.5-10 mg/kg, about 1-2.5 mg/kg, about 2.5-5.0 mg/kg, about 5.0-7.5 mg/kg, about 7.5-10 mg/kg, about 1-5.0 mg/kg Or a combined dose of about 5.0-10 mg/kg is administered.

In some embodiments, the first RNAi agent is administered in an amount of about 0.6-7 mg/kg per dose and the second RNAi agent is administered in an amount of about 0.3-5 mg/kg per dose . In some embodiments, the second RNAi agent is administered in an amount of about 0.5-2.5 mg/kg per dose administered. In some embodiments, the second RNAi agent is administered in an amount of about 0.3-1.5 mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 0.6-5 mg/kg per dose administered. In some embodiments, the first RNAi agent is administered in an amount of about 1-2.5 mg/kg per dose administered.

In some embodiments, two RNAi agents are administered about 1 to 18 weeks apart. In some embodiments, two RNAi agents are spaced about 1 week apart, about 2 weeks apart, about 3 weeks apart, about 4 weeks apart, about 5 weeks apart, about 6 weeks apart about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks Administration is at intervals, at intervals of about 14 weeks, at intervals of about 15 weeks, at intervals of about 16 weeks, at intervals of about 17 weeks, or at intervals of about 18 weeks. In some embodiments, two RNAi agents are administered about 1 to 6 months apart. In some embodiments, the two RNAi agents are spaced about 1 month apart, about 2 months apart, about 3 months apart, about 4 months apart, about 5 months apart Dosing at intervals or at intervals of about 6 months. In some embodiments, two RNAi agents are administered about 4 weeks apart or 1 month apart. In some embodiments, the two RNAi agents are administered monthly.

In some embodiments, the first RNAi agent and the second RNAi agent are administered for a duration of about 1 to 12 months. In some embodiments, the first RNAi agent and the second RNAi agent are administered for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about A duration of 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In some embodiments, the first RNAi agent and the second RNAi agent are administered for a duration of about 1 to 18 weeks. In some embodiments, the first RNAi agent and the second RNAi agent are administered for at least about 1 week, at least about 5 weeks, at least about 10 weeks, at least about 15 weeks, at least about 20 weeks, at least about 25 weeks, at least about 30 weeks, at least about 35 weeks, at least about 40 weeks, at least about 45 weeks, at least about 50 weeks, at least about 55 weeks, at least about 60 weeks, at least about 65 weeks, at least about 70 weeks, at least about 75 weeks, at least about A duration of 80 weeks, at least about 90 weeks, or at least 96 weeks.

In some embodiments, the first RNAi agent and the second RNAi agent are administered at a combined dose of 25-400 mg per dose administered. In one embodiment, the first RNAi agent and the second RNAi agent are administered at a combined dose of 25-400 mg, and the first RNAi agent and the second RNAi agent are administered at a ratio of 1:1. In one embodiment, the dose of the first RNAi agent administered with the second RNAi agent is in an amount of about 12 mg for a combined dose of about 25 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 17 mg for a combined dose of about 35 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 20 mg for a combined dose of about 40 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 25 mg for a combined dose of about 50 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 50 mg for a combined dose of about 100 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 100 mg for a combined dose of about 200 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 150 mg for a combined dose of about 300 mg. In one embodiment, the dose of each of the first RNAi agent and the second RNAi agent is in an amount of about 200 mg for a combined dose of about 400 mg.

In one embodiment, the first RNAi agent and the second RNAi agent are administered at a combined dose of 25-400 mg each, and the first RNAi agent and the second RNAi agent are administered at a ratio of 1:2. In one embodiment, for a combined dose of about 25 mg, the dose of the first RNAi agent is in an amount of about 16 mg, and the dose of the second RNAi agent is in an amount of about 8 mg. In one embodiment, for a combined dose of about 35 mg, the dose of the second RNAi agent is in an amount of about 12 mg, and the dose of the first RNAi agent is in an amount of about 24 mg. In one embodiment, for a combined dose of about 40 mg, the dose of the first RNAi agent is in an amount of about 27 mg, and the dose of the second RNAi agent is in an amount of about 13 mg. In one embodiment, for a combined dose of about 50 mg, the dose of the first RNAi agent is in an amount of about 33 mg, and the dose of the second RNAi agent is in an amount of about 17 mg. In one embodiment, for a combined dose of about 100 mg, the dose of the second RNAi agent is in an amount of about 35 mg, and the dose of the first RNAi agent is in an amount of about 65 mg. In one embodiment, for a combined dose of about 200 mg, the dose of the second RNAi agent is in an amount of about 67 mg, and the dose of the first RNAi agent is in an amount of about 133 mg. In one embodiment, for a combined dose of about 300 mg, the dose of the second RNAi agent is in an amount of about 100 mg, and the dose of the first RNAi agent is in an amount of about 200 mg. In one embodiment, for a combined dose of about 400 mg, the dose of the second RNAi agent is in an amount of about 135 mg, and the dose of the first RNAi agent is in an amount of about 270 mg.

In one embodiment, the first RNAi agent and the second RNAi agent are administered at a combined dose of 25-400 mg each, and the second RNAi agent is administered at a ratio of 1:3 to the first RNAi agent. In one embodiment, for a combined dose of about 25 mg, the dose of the first RNAi agent is in an amount of about 18 mg, and the dose of the second RNAi agent is in an amount of about 6 mg. In one embodiment, for a combined dose of about 35 mg, the dose of the second RNAi agent is in an amount of about 9 mg, and the dose of the first RNAi agent is in an amount of about 27 mg. In one embodiment, for a combined dose of about 40 mg, the dose of the first RNAi agent is in an amount of about 30 mg, and the dose of the second RNAi agent is in an amount of about 10 mg. In one embodiment, for a combined dose of about 50 mg, the dose of the first RNAi agent is in an amount of about 36 mg, and the dose of the second RNAi agent is in an amount of about 12 mg. In one embodiment, for a combined dose of about 100 mg, the dose of the second RNAi agent is in an amount of about 25 mg, and the dose of the first RNAi agent is in an amount of about 75 mg. In one embodiment, for a combined dose of about 200 mg, the dose of the second RNAi agent is in an amount of about 50 mg, and the dose of the first RNAi agent is in an amount of about 150 mg. In one embodiment, for a combined dose of about 300 mg, the dose of the second RNAi agent is in an amount of about 75 mg, and the dose of the first RNAi agent is in an amount of about 225 mg. In one embodiment, for a combined dose of about 400 mg, the dose of the second RNAi agent is in an amount of about 100 mg, and the dose of the first RNAi agent is in an amount of about 300 mg.

In some embodiments, about 1 mg/kg (mpk) of the first RNAi agent and about 1 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 1.5 mg/kg of the first RNAi agent and about 1.5 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 2.0 mg/kg of the first RNAi agent and about 1.0 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 3.0 mg/kg of the first RNAi agent and about 1.0 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 3.2 mg/kg of the first RNAi agent and about 0.8 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 2.7 mg/kg of the first RNAi agent and about 1.3 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 4.0 mg/kg of the first RNAi agent and about 1.0 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 3.3 mg/kg of the first RNAi agent and about 1.7 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, about 0.05 to about 5 mg/kg of the first RNAi agent and about 0.05 to about 5 mg/kg of the second RNAi agent are administered to an individual in need thereof. In some embodiments, the first RNAi agent and the second RNAi agent are administered separately (eg, in separate injections). In some embodiments, separate doses of the first RNAi agent and separate doses of the second RNAi agent are administered together (eg, in the same injection). In some embodiments, separate doses of the first RNAi agent and separate doses of the second RNAi agent are prepared in a single pharmaceutical composition.

In some embodiments, monthly doses of about 40-350 mg, such as about 40-250 mg, more specifically 40-200 mg, more specifically 100 mg or 200 mg, more specifically 200 mg The individual is administered the RNAi component once.

In another aspect, the ordering of the nucleic acid molecule comprising the non-naturally occurring polynucleotide sequence from the 5' end to the 3' end comprises the following: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

As a general guide, an effective amount may range from about 10 μg nucleic acid molecule, vector or RNA replicon to about 300 μg nucleic acid molecule, vector or RNA replicon when used in conjunction with nucleic acid molecule, vector or RNA replicon. Preferably, the effective amount of the nucleic acid molecule, vector or RNA replicon is about 10 μg to about 300 μg, more specifically about 20 μg to about 200 μg. An effective amount can be from one nucleic acid molecule, vector or RNA replicon, or from multiple nucleic acid molecules, vectors or RNA replicons. An effective amount may be in a single composition or in multiple compositions, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 compositions (e.g. lozenges, capsules or injectables, or suitable for skin Intradermal delivery, such as any composition suitable for intradermal delivery using an intradermal delivery patch), wherein the administration of multiple capsules or injections together provides an effective amount to the individual. In a so-called prime-boost regimen, an effective amount can also be administered to a subject, and then another dose of the effective amount is administered to the same subject. The general concept of this prime-boost regimen is well known to those skilled in the vaccine arts. Further boosters can be added to the protocol as needed.

An immunogen comprising two vectors can be administered to an individual by mixing the two vectors (e.g., a first vector encoding a first HBV antigen and a second vector encoding a second HBV antigen) and delivering the mixture to a single anatomical site sexual combination. Alternatively, two separate immunizations can be performed, each delivering a single expression vector. In such embodiments, whether the two vectors are administered as a mixture in a single immunization or in two separate immunizations, the first vector and the second vector may be administered in a ratio of 10:1 to 1 by weight. :10, such as 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:1 by weight 2. The ratio of 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 or 1:10. Preferably, the first and second vectors are administered in a ratio of 1:1 by weight.

In some embodiments, a drug comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered at a dose ranging from about 10 μg to about 300 μg, more specifically about 20 μg to about 200 μg. nucleic acid molecule. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are administered for at least about 1 week, at least about 5 weeks, at least about 10 weeks, at least about 15 weeks, at least Duration of about 20 weeks, at least about 25 weeks, at least about 30 weeks, at least about 35 weeks, at least about 40 weeks, at least about 45 weeks, at least about 50 weeks, at least about 55 weeks. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are administered for a duration of about 12 weeks or about 24 weeks. In some embodiments, the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered once every 3 weeks, once a month (Q4W), once every six weeks (Q6W), or once every Once every eight weeks (Q8W).

In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are formulated for subcutaneous, intradermal or intramuscular injection, more preferably intramuscular injection. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are formulated in liquid form, such as suspensions, solutions, emulsions, or syrups, or may be lyophilized. In some embodiments, RNAi components are formulated for subcutaneous injection. In some embodiments, RNAi components are formulated in liquid form (such as suspensions, solutions, emulsions), or can be lyophilized.

In some embodiments, the RNAi component and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens are administered simultaneously or intermittently. In some embodiments, the RNAi component and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens are administered and formulated separately and at different dosing frequencies. In some embodiments, the RNAi component and nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens are formulated as one composition or as separate compositions. In some embodiments, the RNAi component is formulated as a solution and administered via subcutaneous injection monthly or every four weeks. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are formulated as intramuscular injections and administered in up to five (5) doses, preferably at least three doses .

In some embodiments, the RNAi component is administered monthly in an amount of about 50-250 mg via subcutaneous injection, and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered at The RNAi component is administered at a dose of about 20-200 μg in solution at least six (6) months after initiation of administration, wherein the dose is administered up to five (5) times. In some embodiments, the RNAi component is administered in an amount of about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, or about 200 mg. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are administered at a dose of about 20 μg to about 200 μg, wherein the dose is administered at most five (5 )Second-rate. In some embodiments, the RNAi component is administered by subcutaneous injection in an amount of about 100 mg once a month or once every four weeks, and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens It is administered in a solution at a dose of about 20 μg to about 200 μg at least six (6) months after initiation of administration of the RNAi component, wherein the dose is administered up to five (5) times.

In some embodiments, the RNAi component comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered by subcutaneous injection in an amount of about 25-200 mg once a month or once every four weeks. The nucleic acid molecule is administered in solution at a dose of about 20 μg to about 200 μg at least six (6) months after initiation of administration of the RNAi component, wherein the dose is administered up to five (5) times. In some embodiments, the RNAi component is administered in an amount of about 35 mg, about 40 mg, about 50 mg, about 100 mg, or about 200 mg. In some embodiments, nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens are administered in a solution at a dose of about 20 μg to about 200 μg, wherein the dose is administered at most Five (5) times. In some embodiments, the RNAi component is administered by subcutaneous injection in an amount of about 40 mg once a month or once every four weeks, and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens It is administered in a solution at a dose of about 20 μg to about 200 μg at least six (6) months after initiation of administration of the RNAi component, wherein the dose is administered up to five (5) times. In some embodiments, the RNAi component is administered by subcutaneous injection in an amount of about 100 mg once a month or once every four weeks, and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens It is administered in a solution at a dose of about 20 μg to about 200 μg at least six (6) months after initiation of administration of the RNAi component, wherein the dose is administered up to five (5) times. In some embodiments, the RNAi component is administered by subcutaneous injection in an amount of about 200 mg once a month or once every four weeks, and the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens It is administered in a solution at a dose of about 20 μg to about 200 μg at least six (6) months after initiation of administration of the RNAi component, wherein the dose is administered up to five (5) times.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens, such as any of those described herein, is present at about 20 μg to about 200 Doses in µg are administered once or twice to the subject.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered to the individual about six (6) months after initiation of administration of the RNAi component.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered to the individual about six (6) months after initiation of administration of the RNAi component, and comprising Nucleic acid molecules encoding non-naturally occurring polynucleotide sequences of one or more HBV antigens are administered to the individual up to five (5) times over a total time course of six (6) months.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered to the individual about three (3) months after initiation of administration of the RNAi component, and comprising Nucleic acid molecules encoding non-naturally occurring polynucleotide sequences of one or more HBV antigens are administered to the individual up to three (3) times over a total time course of three (3) months.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered to the individual about six (6) months after initiation of administration of the RNAi component, and comprising Nucleic acid molecules encoding non-naturally occurring polynucleotide sequences of one or more HBV antigens are administered to the individual up to three (3) times over a total time course of about three (3) months.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered to the individual about eight (8) months after initiation of administration of the RNAi component, and comprising Nucleic acid molecules encoding non-naturally occurring polynucleotide sequences of one or more HBV antigens are administered to the individual up to three (3) times over a total time course of about three (3) months.

In some embodiments, a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is administered to the individual about three (3) months after initiation of administration of the RNAi component comprising the encoding Nucleic acid molecules of non-naturally occurring polynucleotide sequences of one or more HBV antigens are administered to an individual for a total of about three (3) months, wherein administration of the RNAi component is discontinued for up to three (3) months A dose of a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is followed, for example, for about six (6) months.

Methods according to embodiments of the present application further comprise administering to the individual in need thereof another immunogenic agent (such as another HBV antigen or other antigen) or another anti-HBV agent (such as a nucleoside analog or other anti-HBV medicament) and the combination of the pharmaceutical composition of the present application. For example, another anti-HBV agent or immunogenic agent can be a small molecule or antibody, including but not limited to immune checkpoint inhibitors (such as anti-PD1, anti-PDL1, anti-TIM-3, etc.), toll-like receptor promoting Agonists (such as TLR7 agonists and/or TLR8 agonists), RIG-1 agonists, IL-15 superagonists (Altor Bioscience), mutant IRF3 and IRF7 gene adjuvants, STING agonists (Aduro ), FLT3L gene adjuvant, IL-12 gene adjuvant, IL-7-hyFc, CAR-T combined with HBV env (S-CAR cells), capsid assembly regulator, cccDNA inhibitor, HBV polymerase inhibitor ( such as entecavir and tenofovir). The one or other anti-HBV active agents can be, for example, small molecules, antibodies or antigen-binding fragments thereof, polypeptides, proteins or nucleic acids.

In some embodiments, the method further comprises administering a nucleoside analog. In some embodiments, the nucleoside analog is entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide, lamivudine, telbivudine or a combination thereof. In some embodiments, the nucleoside analog is entecavir, and it is in the form of about 0.01-5 mg, about 0.01-0.05 mg, about 0.05-0.1 mg, about 0.1-0.5 mg, about 0.5-1 mg, about 1- Daily doses are administered in amounts of 2 mg, about 2-3 mg, about 3-4 mg, or about 4-5 mg. In some embodiments, the nucleoside analog is entecavir, and it is administered in a daily dose in an amount of about 0.5 mg. In some embodiments, the nucleoside analogue is tenofovir disoproxil fumarate, and it is in the form of about 100-500 mg, about 100-150 mg, about 150-200 mg, about 200- Daily doses are administered in amounts of 250 mg, about 250-300 mg, 300-400 mg, about 400-500 mg. In some embodiments, the nucleoside analog is tenofovir disoproxil fumarate, and it is administered in a daily dose in an amount of about 300 mg. In some embodiments, the nucleoside analog is tenofovir alafenamide, and it is administered as about 5-100 mg, about 5-25 mg, about 25-50 mg, about 50-75, or about 75-100 The daily dosage in the amount of mg is administered. In some embodiments, the nucleoside analog is tenofovir alafenamide, and it is administered in a daily dose in an amount of about 25 mg. In some embodiments, the nucleoside analog is lamivudine, and it is administered as about 50-600 mg, about 50-300 mg, about 100-300 mg, about 100-500 mg, about 150-400 mg, Daily dosages are administered in amounts of about 200-350 or about 250-300 mg. In some embodiments, the nucleoside analog is lamivudine, and it is administered in a daily dose in an amount of 100 mg, 150 mg, or 300 mg. In some embodiments, the nucleoside analog is telbivudine, and it is administered as about 300-800 mg, about 400-700 mg, about 300-600 mg, about 300-400 mg, about 400-500 mg, or about A daily dose in the amount of 500-600 mg is administered. In some embodiments, the nucleoside analog is telbivudine, and it is administered in a daily dose in an amount of about 600 mg. In some embodiments, the patient has been exposed to the nucleoside analog prior to the combination therapy. In some embodiments, the patient has been administered the nucleoside analog for at least 1 month, at least 3 months, at least 6 months, or at least 1 year prior to receiving the combination therapy.

In some embodiments, the other agent is a nucleic acid polymer (NAP). The NAP may eg be selected from REP2139 or REP2165. REP2139 has the sequence (A,5'MeC) ₂₀ with each bond phosphorothioated and each ribose 2'0 methylated (which is disclosed in WO2016/04525, the contents of which are incorporated herein by reference in its entirety as SEQ ID NO: 10). REP2165 has the sequence (A,5'MeC) ₂₀ where the ribose is 2'OH with each bond phosphorothioated and 2'0 methylated on every ribose except the adenosine at positions 11, 21 and 31 (It is disclosed as SEQ ID NO: 13 in WO2016/04525).

NAP can also be other exemplary nucleic acid polymers, including but not limited to REP2006, REP2031, REP2055, STOPS ^™ (oligonucleotide polymers that inhibit S-antigen transport), and disclosed in Patent Application Publication No. WO200424919, WO201221985 and WO202097342 and US Patent Nos. 7,358,068, 8,008,269, 8,008,270 and 8,067,385, the contents of each of which are incorporated herein by reference in their entirety.

In some embodiments, patients are screened for HBeAg status prior to administration of the combination therapy. In some embodiments, the patient is HBeAg positive. In some embodiments, the patient is HBeAg negative. In some embodiments, patients are screened for immune tolerance prior to administration of the combination therapy.

In some embodiments, the patient's HBsAg level is reduced by at least about log ₁₀ 0.5, about log ₁₀ 0.75, about log ₁₀ 1, about log ₁₀ 1.25, about log ₁₀ 1.5, about log ₁₀ 1.75, about log ₁₀ 2 or about log ₁₀ 2.5. In some embodiments, the patient's HBeAg level is reduced by at least about log ₁₀ 0.5, about log ₁₀ 0.75, about log ₁₀ 1, about log ₁₀ 1.25, about log ₁₀ 1.5, about log ₁₀ 1.75, about log ₁₀ 2 or about log ₁₀ 2.5. In some embodiments, the patient's HBcrAg level is reduced by at least about log ₁₀ 0.5, about log ₁₀ 0.75, about log ₁₀ 1, about log ₁₀ 1.25, about log ₁₀ 1.5, about log ₁₀ 1.75, about log ₁₀ 2 or about log ₁₀ 2.5. In some embodiments, the patient's HBV DNA level is reduced by at least about log ₁₀ 0.5, about log ₁₀ 1, about log ₁₀ 1.5, about log ₁₀ 2, about log ₁₀ 3, about log ₁₀ 4, About log ₁₀ 5 or about log ₁₀ 7.5. In some embodiments, the patient's HBV RNA level is reduced by at least about log ₁₀ 0.5, about log ₁₀ 0.75, about log ₁₀ 1, about log ₁₀ 1.25, about log ₁₀ 1.5, about log ₁₀ 1.75, About log ₁₀ 2 or about log ₁₀ 2.5.

The present application also relates to effective amounts of RNAi components and nucleic acid molecules comprising non-naturally occurring polynucleotide sequences encoding one or more HBV antigens, optionally nucleoside analogs, each as described herein Described for the manufacture of a medicament for treating hepatitis B virus (HBV) infection in an individual; enhancing the immune response of an individual with HBV infection; reducing viral replication in an individual with HBV; reducing Expression of one or more HBV polypeptides (more specifically selected from one or more polypeptides of HBsAg and HBeAg) in an individual; and/or increased expression of HBV-infected individuals comprising integrated viral DNA and/or extrachromosomal virus DNA-targeted killing of hepatocytes. In some embodiments, the RNAi component is administered at a dose of about 40-250 mg, more specifically 40-200 mg, more specifically 100 mg or 200 mg, more specifically 200 mg, once a month or Administered to the individual every four weeks; the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens is for administration to the individual at a dose of about 20-200 μg, wherein the dose is administered Up to five (5) times. In some embodiments, the medicament is for administration to an individual infected with HBV, in particular an individual with chronic HBV infection. Example

Embodiment 1 is a combination for the treatment of hepatitis B virus (HBV) infection, more specifically chronic HBV infection (CHB), with or without viral coinfection, in an individual in need thereof, and/or For the treatment of chronic HDV infection comprising: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

Example 2 is a combination for enhancing the immune response of a virally co-infected individual with hepatitis B virus (HBV) infection, more specifically chronic HBV infection (CHB), comprising: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

Example 3 is a combination for reducing viral replication in individuals with hepatitis B virus (HBV) infection, more specifically chronic HBV infection (CHB), with or without viral co-infection, which Include: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

Embodiment 4 is a combination for reducing the expression of one or more hepatitis B virus (HBV) polypeptides, more specifically one or more polypeptides selected from HBsAg and HBeAg, in an individual in need thereof, comprising: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

Example 5 is a combination for increasing integration-containing virus in individuals with hepatitis B virus (HBV) infection, more specifically chronic HBV infection (CHB), with or without viral co-infection Targeted killing of hepatocytes by DNA or extrachromosomal viral DNA comprising: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) the polynucleotide sequence encoding the first hepatitis B virus (HBV) antigen, (2) a first internal ribosomal entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) the polynucleotide sequence encoding the second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen.

Embodiment 6 is the combination for use in any one of embodiments 1 to 5, wherein the HBV infection is chronic HBV infection.

Embodiment 7 is the combination for use in any one of embodiments 1 to 6, wherein an effective amount of the pharmaceutical composition comprising the RNAi component and an effective amount of the pharmaceutical composition comprising the nucleic acid molecule reduce the individual's immune tolerance to HBV Tolerance, more specifically the liver tolerance of an individual to HBV, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens.

Embodiment 8 is the combination for use in any one of embodiments 1 to 7, wherein an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a pharmaceutical composition comprising a non-natural protein encoding one or more HBV antigens is administered to the individual. Pharmaceutical compositions of nucleic acid molecules in which polynucleotide sequences are present, at least until the individual meets at least one, at least two, at least three, at least four, or five of the following characteristics: i. Serum HBV DNA below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL, more specifically below 10 IU/ml; ii. Serum ALT concentration less than 3 times the upper limit of normal, or less than 129 U/L in the case of a male individual, or less than 108 U/L in the case of a female individual, more specifically serum The ALT concentration is less than 120 U/L if the individual is a male or less than 105 U/L if the individual is a female, more specifically the serum ALT concentration is less than 90 if the individual is a male U/L or less than 57 U/L in the case of a female individual; iii. HBeAg negative serum; iv. Serum HBsAg levels of 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, more specifically 10 IU/mL or less; and v. HBs seroconversion.

Embodiment 9 is the combination for use as in Embodiment 8, wherein at least one, at least two, at least three of characteristics i., ii., iii., iv. and v. are still satisfied 6 months after the end of treatment , at least four or five.

Embodiment 10 is the combination as in embodiment 8, wherein the serum HBsAg level is 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, More specifically 10 IU/mL or less.

Embodiment 11 is the combination for use in any one of embodiments 1 to 10, wherein an effective amount of the pharmaceutical composition comprising the RNAi component is administered to the individual at least until the individual's serum HBsAg level is reduced to 1000 IU/mL or Lower, more specifically 300 IU/mL or lower, more specifically 100 IU/mL or lower, more specifically 10 IU/mL or lower.

Embodiment 12 is the combination for use in any one of embodiments 1 to 11, wherein the serum HBsAg level in the patient is reduced to 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically After 100 IU/mL or less, more specifically 10 IU/mL or less, an effective amount of a nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual.

Embodiment 13 is the combination for use of any one of embodiments 8-12, wherein compared to administering only an effective amount of a pharmaceutical composition comprising an RNAi component or administering an effective amount comprising a non-naturally occurring polynucleotide The individual whose serum HBsAg level decreases at a faster rate, decreases to a greater extent, and/or decreases for a longer period of time.

Embodiment 14 is the combination as in embodiment 2, wherein enhancing the immune response of the individual results in an increase in the innate immune system response and/or the acquired immune system response.

Embodiment 15 is the combination as in embodiment 14 for use, wherein the innate immune system response is increased such that interferon stimulated gene (ISG), interferon gamma inducible protein 10 (IP10), interferon alpha (IFN alpha), interleukin 12 or Expression of one or several of interleukin-6 (IL-6) is increased.

Embodiment 16 is the combination as in embodiment 14, wherein the increased adaptive immune system response results in increased HBV specific T cell response and/or increased activation of HBV specific T cells.

Embodiment 17 is the combination as in embodiment 2, wherein enhancing the immune response of the individual leads to the improvement of the immune ability of the individual.

Embodiment 18 is the combination for use as in Embodiment 17, wherein the improvement of the immunity of the individual leads to an increase in HBV-specific T cells, B cells or NK cells in the liver and/or HBV-specific T cells, B cells in the liver Or the activation of NK cells increased.

Embodiment 19 is the combination for use as in embodiments 17 or 18, wherein the individual's increased immune competence results in increased NK cells, T cells or B cells in the peripheral immune cell compartment and/or NK cells in the peripheral immune cell compartment , Increased activation of T cells or B cells.

Embodiment 20 is the combination for use according to any one of embodiments 17 to 19, wherein the enhanced immunity of the individual results in a reduction in myeloid-derived suppressor cells (MDSC) in the liver and/or in the peripheral immune cell compartment, and/or Reduced immunosuppressive activity of MDSCs in the liver and/or peripheral immune cell compartment, and/or reduced regulatory T cells (Treg) in the liver and/or peripheral immune cell compartment, and/or liver and/or peripheral immune The immunosuppressive activity of Treg in the cellular compartment is reduced.

Embodiment 21 is the combination as in embodiment 3 for use, wherein the individual has reduced viral replication such that serum HBV DNA is below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL, more specifically Specifically less than 10 IU/mL.

Embodiment 22 is the combination as in embodiment 5, wherein the targeted hepatocytes comprise cccDNA.

Embodiment 23 is the combination for use as in embodiment 5 or 22, wherein the targeted hepatocytes comprise integrated HBV DNA.

Embodiment 24 is the combination for use of any of embodiments 1-23, wherein the first or second RNAi agent comprises at least one modified nucleotide and/or at least one modified internucleoside linkage.

Embodiment 25 is the combination for use of any one of embodiments 1-24, wherein at least 90% of the nucleotides in the first and second RNAi agents are modified nucleotides.

Embodiment 26 is the combination for use of any one of embodiments 1-25, wherein the first or second RNAi agent further comprises a targeting ligand that binds to the first or second RNAi agent.

Embodiment 27 is the combination as in embodiment 26, wherein the targeting ligand comprises N-acetyl-galactamine sugar.

Embodiment 28 is the combination for use as in embodiment 27, wherein the targeting ligand is selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24 )s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30 ), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35) s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39) and (NAG39)s.

Embodiment 29 is the combination as in embodiment 28, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31 ), (NAG31 )s, (NAG37) or (NAG37)s.

Embodiment 30 is the combination for use of any one of embodiments 26-29, wherein the targeting ligand binds to the sense strand of the first or second RNAi agent.

Embodiment 31 is the combination as in embodiment 30, wherein the targeting ligand binds to the 5' end of the sense strand of the first or second RNAi agent.

Embodiment 32 is the combination for use of any one of embodiments 1-31, wherein the first and second RNAi agents independently comprise a duplex selected from the group consisting of: (a) antisense shares comprising SEQ ID NO:93 and sense shares comprising SEQ ID NO:102; (b) Antisense shares comprising SEQ ID NO:94 and sense shares comprising SEQ ID NO:103; (c) antisense shares comprising SEQ ID NO:95 and sense shares comprising SEQ ID NO:103; (d) antisense shares comprising SEQ ID NO:96 and sense shares comprising SEQ ID NO:104; (e) antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 108; (f) antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 109; (g) antisense shares comprising SEQ ID NO:94 and sense shares comprising SEQ ID NO:104; and (h) Antisense shares comprising SEQ ID NO:100 and sense shares comprising SEQ ID NO:110.

Embodiment 33 is the combination of any one of embodiments 1 to 32, wherein the first and second RNAi agents each independently bind to a targeting ligand comprising N-acetyl-galactamine sugar, and the first and the second RNAi agent independently comprising a duplex selected from the group consisting of: (a) Antisense shares comprising SEQ ID NO:94 and sense shares comprising SEQ ID NO:103; (b) Antisense shares comprising SEQ ID NO:96 and sense shares comprising SEQ ID NO:104; (c) antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 108; (d) antisense shares comprising SEQ ID NO: 94 and sense shares comprising SEQ ID NO: 105; and (e) Antisense shares comprising SEQ ID NO:100 and sense shares comprising SEQ ID NO:110.

Embodiment 34 is the combination for use of any of embodiments 1-33, wherein the weight ratio of the first RNAi agent to the second RNAi agent is in the range of about 1:2 to about 5:1.

Embodiment 35 is the combination for use according to any one of embodiments 1 to 34, wherein one of the first or second HBV antigen is HBV core or HBV pol antigen.

Embodiment 36 is the combination for use in any one of embodiments 1 to 35, wherein the sequence of the non-naturally occurring polynucleotide sequences from the 5' end to the 3' end further comprises: (4) a second IRES element or a polynucleotide sequence encoding a second self-protease peptide, which is operably linked to the 3' end of the polynucleotide sequence encoding a second HBV antigen, and (5) A polynucleotide sequence encoding a third HBV antigen, the third HBV antigen is independently selected from the group consisting of HBV core antigen, HBV pol antigen and HBV surface antigen.

Embodiment 37 is the combination for use as in embodiment 36, wherein the sequence of the non-naturally occurring polynucleotide sequences from the 5' end to the 3' end further comprises: (6) a third IRES element or a polynucleotide sequence encoding a third autoprotease peptide, which is operably linked to the 3' end of a polynucleotide sequence encoding a third HBV antigen, and (7) A polynucleotide sequence encoding a fourth HBV antigen, the fourth HBV antigen is independently selected from the group consisting of HBV core antigen, HBV pol antigen and HBV surface antigen.

Embodiment 38 is the combination as in embodiment 37, wherein each of the first, second, third and fourth HBV antigens are different from each other.

Embodiment 39 is the combination for use as in embodiment 37 or 38, wherein each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a first HBV Pre-S1 antigen comprising at least 98% identity to the amino acid sequence SEQ ID NO: 1, such as at least 98%, 98.5%, 99%, 99.1 to the amino acid sequence SEQ ID NO: 1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (ii) a second HBV Pre-S1 antigen comprising at least 98% identity to the amino acid sequence SEQ ID NO: 3, such as at least 98%, 98.5%, 99%, 99.1 to the amino acid sequence SEQ ID NO: 3 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (iii) HBV PreS2.S antigen comprising at least 98% identity to the amino acid sequence of SEQ ID NO: 5, such as at least 98%, 98.5%, 99%, 99.1%, to the amino acid sequence of SEQ ID NO: 5 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (iv) HBV core antigen comprising at least 90% identity to SEQ ID NO: 7, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96 to SEQ ID NO: 7 %, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% consistent The amino acid sequence of, preferably consists of the amino acid sequence; and (v) HBV pol antigen comprising at least 90% identity to SEQ ID NO: 9, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96 to SEQ ID NO: 9 %, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% consistent The amino acid sequence of, preferably consists of the amino acid sequence, Preferably, each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to a signal peptide, and the HBV PreS2.S antigen comprises an internal signal peptide.

Embodiment 40 is the combination as in embodiment 39, wherein the HBV core antigen comprises at least 98% identity with at least one of SEQ ID NO: 84, 85 or 86, such as at least 98% identical to SEQ ID NO: 84, 85 or 86 A 98%, at least 99% or 100% identical amino acid sequence, preferably consists of this amino acid sequence.

Embodiment 41 is the combination for use as in embodiment 39 or 40, wherein the last five C-terminal amino acids of the HBV core antigen comprise the VVR amino acid sequence, more specifically the VVRR (SEQ ID NO:91) amino acid sequence, more specifically the VVRRR (SEQ ID NO:92) amino acid sequence.

Embodiment 42 is the combination for use of embodiment 39, wherein each of the HBV surface antigen, the HBV core antigen and the HBV pol antigen comprises: (i) Consensus sequences of HBV genotypes A, B, C and D; and/or One or more antigenic determinations of HLA-A*11:01, HLA-A*24:02, HLA-A*02:01, HLA-A*A2402, HLA-A*A0101 or HLA-B*40:01 base.

Embodiment 43 is the combination as in embodiment 42, wherein each of the HBV surface antigen, the HBV core antigen and the HBV pol antigen comprises one or more epitopes of HLA-A*11:01.

Embodiment 44 is the combination for use as in embodiment 39, wherein each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) the first HBV Pre-S1 antigen consisting of the amino acid sequence of SEQ ID NO: 1; (ii) the second HBV Pre-S1 antigen consisting of the amino acid sequence SEQ ID NO: 3; (iii) HBV PreS2.S antigen consisting of amino acid sequence SEQ ID NO: 5; (iv) HBV core antigen consisting of the amino acid sequence of SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86; and (v) HBV pol antigen consisting of amino acid sequence SEQ ID NO: 9; Preferably, each of the first and second HBV Pre-S1 antigen, HBV core antigen and HBV pol antigen is independently operably linked to a signal peptide, such as a signal comprising the amino acid sequence of SEQ ID NO: 77 peptide.

Embodiment 45 is the combination for use as in any one of embodiments 37 to 44, wherein each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from Composed group: (i) a polynucleotide sequence encoding a first HBV Pre-S1 antigen having at least 90% identity to SEQ ID NO: 2, such as at least 90%, 91%, 92%, 93% to SEQ ID NO: 2 , 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9% or 100% identical sequences; (ii) a polynucleotide sequence encoding a second HBV Pre-S1 antigen having at least 90% identity with SEQ ID NO: 4, such as at least 90%, 91%, 92%, 93% with SEQ ID NO: 4 , 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9% or 100% identical sequences; (iii) a polynucleotide sequence encoding the HBV PreS2.S antigen having at least 90% identity with SEQ ID NO: 6, such as at least 90%, 91%, 92%, 93%, 94 with SEQ ID NO: 6 %, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical sequences; (iv) a polynucleotide sequence encoding HBV core antigen having at least 90% identity with SEQ ID NO: 8, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , 99.9% or 100% identical sequences; and (v) a polynucleotide sequence encoding an HBV pol antigen having at least 90% identity to SEQ ID NO: 10, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , 99.9% or 100% identical sequences; Preferably, the polynucleotide sequence encoding each of the first and second HBV Pre-S1 antigen, HBV core antigen and HBV pol antigen is independently operably linked to a polynucleotide sequence encoding a signal peptide , and the HBV PreS2.S antigen contains an internal signal peptide.

Embodiment 46 is the combination for use as in embodiment 45, wherein each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a polynucleotide sequence encoding the first HBV Pre-S1 antigen consisting of the sequence SEQ ID NO: 2; (ii) a polynucleotide sequence encoding a second HBV Pre-S1 antigen consisting of the sequence SEQ ID NO: 4; (iii) A polynucleotide sequence encoding HBV PreS2.S antigen consisting of the sequence SEQ ID NO: 6; (iv) a polynucleotide sequence encoding HBV core antigen consisting of any one of the sequences SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89; and (v) a polynucleotide sequence encoding HBV pol antigen consisting of the sequence SEQ ID NO: 10; Preferably, the polynucleotide sequence encoding each of the first and second HBV Pre-S1 antigen, HBV core antigen and HBV pol antigen is independently operably linked to a polynucleotide encoding a signal peptide, Such as a polynucleotide comprising the sequence SEQ ID NO: 90.

Embodiment 47 is the combination for use of any of embodiments 37 to 46, wherein each of the first, second and third autoprotease peptides independently comprises a peptide sequence selected from the group consisting of: porcine Tesgu virus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), trachovirus 2A (T2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A ), silkworm softening disease virus 2 A (BmIFV2A) and combinations thereof, preferably, each of the first, second and third autoprotease peptides comprises a peptide sequence of P2A, such as P2A of SEQ ID NO: 11 sequence.

Embodiment 48 is the combination for use as any one of embodiments 37 to 47, wherein each of the first, second and third IRES is derived from encephalomyocarditis virus (EMCV) or enterovirus 71 (EV71), Preferably, each of the first, second and third IRES comprises the polynucleotide sequence of SEQ ID NO: 13 or 14.

Embodiment 49 is the combination for use as in embodiment 1, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide sequence is ordered from the 5' end to the 3' end comprising: (1) coding has the polynucleotide sequence of the HBV Pre-S1 antigen of amino acid sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11 or has polynuclear An IRES with a nucleotide sequence of SEQ ID NO: 13 or 14, and a polynucleotide sequence encoding the HBV PreS2.S antigen with an amino acid sequence of SEQ ID NO: 5; (2) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, or the polynucleotide sequence with the polynucleotide sequence The IRES of the sequence SEQ ID NO: 13 or 14, and the polynucleotide sequence encoding the HBV Pre-S1 antigen with the amino acid sequence of SEQ ID NO: 1 or 3; (3) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding polynucleotide sequence with amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 or 3 The polynucleotide sequence of HBV Pre-S1 antigen; (4) The polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, the encoding having the amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 or 3 The polynucleotide sequence of HBV Pre-S1 antigen; (5) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, the encoding having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 84 , the polynucleotide sequence of any one of the HBV core antigens in 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the polynucleotide sequence having the amino acid sequence SEQ ID NO: 9 The polynucleotide sequence of the HBV polymerase antigen; (6) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, the encoding having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the HBV polymerase antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of HBV core antigen; (7) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, has the IRES of polynucleotide sequence SEQ ID NO: 13, coding has the amino acid sequence SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (8) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 13, the encoding having the amino acid sequence of SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (9) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen with the sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 13, the encoding with the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of any HBV core antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the HBV polymerase encoding the amino acid sequence SEQ ID NO: 9 the polynucleotide sequence of the antigen; (10) The polynucleotide sequence encoding the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the IRES having the polynucleotide sequence of SEQ ID NO: 13, the HBV polymerase encoding having the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV core having any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of the antigen; (11) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, has the IRES of polynucleotide sequence SEQ ID NO: 14, coding has the amino acid sequence SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (12) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 14, the encoding having the amino acid sequence of SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (13) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen with the sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 14, the encoding with the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of any HBV core antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the HBV polymerase encoding the amino acid sequence SEQ ID NO: 9 the polynucleotide sequence of the antigen; (14) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 14, the HBV polymerase encoding the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV core having any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of the antigen; (15) coding has the polynucleotide sequence of the HBV PreS2.S antigen of amino acid sequence SEQ ID NO: 5, has the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, codes has the amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV polymerase antigen of 9, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of any of the HBV core antigens; (16) The polynucleotide sequence encoding the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, the IRES having the polynucleotide sequence of SEQ ID NO: 14, encoding the polynucleotide sequence having the amino acid sequence of SEQ ID NO : the polynucleotide sequence of any one of the HBV core antigen in 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO : the polynucleotide sequence of the HBV polymerase antigen of 9; (17) The polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of any one of the HBV core antigens in SEQ ID NO: 84, 85 or 86, the IRES with the polynucleotide sequence of SEQ ID NO: 13 or 14, and the coded polynucleotide sequence with the amino acid sequence of SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5; (18) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding have the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and coding have the polynucleotide sequence of amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5; (19) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of the HBV polymerase antigen of sequence SEQ ID NO: 9, the polynucleotide sequence of encoding P2A amino acid sequence SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 84, 85 or the polynucleotide sequence of the HBV core antigen of any one of 86; (20) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of any one of the HBV core antigen in the sequence SEQ ID NO: 84, 85 or 86, the polynucleotide sequence of the coding P2A amino acid sequence SEQ ID NO: 11, and the coding sequence having the amino acid The polynucleotide sequence of the HBV polymerase antigen of sequence SEQ ID NO: 9; (21) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of any one of the HBV core antigens in SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen of SEQ ID NO: 5; or (22) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen of SEQ ID NO: 5, Preferably, the polynucleotide sequences encoding each of the first and second HBV Pre-S1 antigen, HBV core antigen and HBV pol antigen are independently operably linked to an encoding signal peptide, such as comprising the amino acid The polynucleotide sequence of the signal peptide of sequence SEQ ID NO:77.

Embodiment 50 is the combination for use as in embodiment 49, wherein the non-naturally occurring polynucleotide sequence comprises any of the sequences SEQ ID NO: 15-54.

Embodiment 51 is the combination for use of any one of embodiments 1-50, wherein the vector comprises a non-naturally occurring polynucleotide sequence.

Embodiment 52 is the combination as in embodiment 51, wherein the vector is a DNA plasmid, a DNA viral vector or an RNA viral vector.

Embodiment 53 is the combination for use of any one of embodiments 1 to 50, wherein the RNA replicon comprises a non-native polynucleotide sequence, and wherein the ordering of the RNA replicon from the 5' end to the 3' end comprises: (1) 5' untranslated region (5'-UTR) required for non-structural protein-mediated amplification of RNA viruses; (2) Polynucleotide sequences encoding at least one, preferably all, nonstructural proteins of RNA viruses; (3) subgenome promoter of RNA virus; (4) non-naturally occurring polynucleotide sequences; and (5) The 3' untranslated region (3'-UTR) required for nonstructural protein-mediated amplification of RNA viruses.

Embodiment 54 is the combination for use of any one of embodiments 1 to 50, wherein the RNA replicon comprises a non-native polynucleotide sequence, and wherein the ordering of the RNA replicon from the 5' end to the 3' end comprises: (1) Alphavirus 5' untranslated region (5'-UTR); (2) 5' copy sequence of alpha virus non-structural gene nsp1; (3) downstream loop (DLP) motifs of viral species; (4) a polynucleotide sequence encoding a fourth autoprotease peptide; (5) Polynucleotide sequences encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3 and nsp4; (6) Alphavirus subgenome promoter; (7) Non-naturally occurring polynucleotide sequences; (8) Alphavirus 3' untranslated region (3' UTR); and (9) Optional polyadenosine sequence.

Embodiment 55 is the combination for use as in Embodiment 54, wherein the DLP motif is from a virus species selected from the group consisting of Eastern Equine Encephalitis Virus (EEEV), Venezuelan Equine Encephalitis Virus (VEEV), Everglades Marsh virus (EVEV), Mukambu virus (MUCV), Semliki forest virus (SFV), Pichuna virus (PIXV), Middleburg virus (MTDV), Chikung virus (CHIKV), Onion Virus (ONNV), Ross River Virus (RRV), Barma Forest Virus (BF), Getta Virus (GET), Lushan Virus (SAGV), Bebaru Virus (BEBV), Mayaro Virus (MAYV), Uganda Virus (MAYV), Navirus (U AV), Sindbis virus (SINV), Aura virus (AURAV), Wodaro virus (WHAV), Babanki virus (BABV), Kezeragzi virus (KYZV), Western Equine Encephalitis Virus (WEEV), Highland J Virus (HJV), Fort Morgan Virus (FMV), Endum Virus (NDUV) and Bogey River Virus.

Embodiment 56 is the combination for use as in embodiment 55, wherein the fourth autoprotease peptide is selected from the group consisting of: Porcine Tsagovirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Bright Veined Flathead Moth Virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Silkworm Soft Disease Virus 2A (BmIFV2A) and combinations thereof, preferably, the second The four autoprotease peptides comprise the peptide sequence of P2A.

Embodiment 57 is the combination for use of any one of embodiments 1 to 50, wherein the RNA replicon comprises a non-native polynucleotide sequence, and wherein the ordering of the RNA replicon from the 5' end to the 3' end comprises: (1) 5'-UTR having a polynucleotide sequence of SEQ ID NO: 55; (2) having the 5' copy sequence of polynucleotide sequence SEQ ID NO: 56; (3) a DLP motif comprising the polynucleotide sequence of SEQ ID NO: 57; (4) a polynucleotide sequence encoding the P2A sequence of SEQ ID NO: 11; (5) Polynucleotide sequences encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3 and nsp4, respectively having nucleic acid sequences of SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 and SEQ ID NO: 61 ; (6) a subgenome promoter having a polynucleotide sequence of SEQ ID NO: 62; (7) non-naturally occurring polynucleotide sequences; and (8) 3' UTR having the polynucleotide sequence of SEQ ID NO: 63.

Embodiment 58 is the combination for use as Embodiment 57, wherein: (i) the polynucleotide sequence encoding the P2A sequence comprises SEQ ID NO: 12, (ii) the non-naturally occurring polynucleotide sequence comprises any one of the polynucleotide sequences SEQ ID NO: 15 to 54, and (iii) The RNA replicon further comprises a polyadenosine sequence at the 3' end of the replicon, preferably, the polyadenosine sequence has the sequence of SEQ ID NO: 64.

Embodiment 59 is the combination for use in any one of embodiments 53-58, wherein the RNA replicon comprises any one of the polynucleotide sequences SEQ ID NO: 65-72.

Embodiment 60 is the combination for use in any one of embodiments 53 to 58, wherein the nucleic acid molecule comprises a DNA sequence encoding an RNA replicon, preferably wherein the nucleic acid molecule further comprises T7 operably linked to the 5' end of the DNA sequence The promoter, more preferably, the T7 promoter comprises the nucleotide sequence of SEQ ID NO: 73.

Embodiment 61 is the combination for use in any one of embodiments 1 to 60, wherein the pharmaceutical composition comprises a nucleic acid molecule, vector or RNA replicon comprising a non-naturally occurring polynucleotide sequence, and a pharmaceutically acceptable carrier.

Embodiment 62 is the combination as in embodiment 61, wherein the pharmaceutical composition further comprises: (1) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence or have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and coding have amino acid sequence SEQ ID NO: 9, the polynucleoside of the HBV polymerase antigen that is preferably made up of this amino acid sequence acid sequence; or (2) A polynucleotide sequence encoding an HBV polymerase antigen having an amino acid sequence of SEQ ID NO: 9, preferably consisting of the amino acid sequence, a polynucleotide encoding a P2A amino acid sequence of SEQ ID NO: 11 Nucleotide sequence or have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and the polynucleoside coding has any one HBV core antigen in the amino acid sequence SEQ ID NO: 84,85 or 86 acid sequence.

Embodiment 63 is the combination for use in any one of embodiments 1-62, wherein the RNAi component is present in an amount of about 40-1000 mg, more specifically about 40-250 mg, more specifically 40-200 mg, more specifically A dose of specifically 100 mg or 200 mg, more specifically 200 mg, is administered to the subject once a month (Q4W).

Embodiment 64 is the combination for use as any one of embodiments 1 to 63, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is present at about 10-300 mg/mL, more specifically about 20-200 μg The concentration per mL is administered to an individual in a dose, wherein the dose is administered up to five (5) times.

Embodiment 65 is the combination for use of any of embodiments 1-64, wherein the RNAi component is administered to the individual via intravenous or subcutaneous injection.

Embodiment 66 is the combination for use of any one of embodiments 1-65, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual via intramuscular injection.

Embodiment 67 is the combination for use of any of embodiments 1-66, wherein the RNAi component is administered simultaneously or sequentially with the nucleic acid molecule comprising a non-naturally occurring polynucleotide.

Embodiment 68 is the combination for use as any of embodiments 1-66, wherein the RNAi component is administered separately from the nucleic acid molecule comprising the non-naturally occurring polynucleotide.

Embodiment 69 is the combination as in embodiment 68, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual about six (6) months after initiation of administration of the RNAi component.

Embodiment 70 is the combination for use as in embodiment 68 or 69, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual about six (6) months after initiation of administration of the RNAi component, and A nucleic acid molecule comprising a non-naturally occurring polynucleotide therein is administered to an individual up to five (5) times over a total time course of about six (6) months.

Embodiment 71 is the combination for use as in embodiments 68 or 69, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual about three (3) months after initiation of administration of the RNAi component, and A nucleic acid molecule comprising a non-naturally occurring polynucleotide therein is administered to an individual up to three (3) times over a total time course of about three (3) months.

Embodiment 72 is the combination for use as in embodiments 68 or 69, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual about six (6) months after initiation of administration of the RNAi component, and A nucleic acid molecule comprising a non-naturally occurring polynucleotide therein is administered to an individual up to three (3) times over a total time course of about three (3) months.

Embodiment 73 is the combination for use as in embodiments 68 or 69, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual about eight (8) months after initiation of administration of the RNAi component, and A nucleic acid molecule comprising a non-naturally occurring polynucleotide therein is administered to an individual up to three (3) times over a total time course of about three (3) months.

Embodiment 74 is the combination for use as in embodiments 68 or 69, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual about three (3) months after initiation of administration of the RNAi component, wherein A nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual up to three (3) times over a total time course of about three (3) months, and wherein the administration of the RNAi component is administered after cessation of administration comprising the non-naturally occurring polynucleotide. A nucleic acid molecule of a naturally occurring polynucleotide lasts, for example, for about six (6) months thereafter.

Embodiment 75 is the combination for use of any one of embodiments 1-74, further comprising administering to the individual a nucleoside analog or nucleotide analog.

Embodiment 76 is the combination for use as in Embodiment 75, wherein the nucleoside analogs are entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide, lamivudine, Bivudine or a combination thereof.

Embodiment 77 is the combination as in Embodiment 76, wherein entecavir is administered to the subject at a daily dose of about 0.1-5 mg.

Embodiment 78 is the combination as in Embodiment 76, wherein tenofovir is administered with about 5-50 mg tenofovir alafenamide or about 200-500 mg tenofovir disoproxil fumarate A daily dose of furoate is administered to the subject.

Embodiment 79 is the combination as in embodiment 76, wherein lamivudine is administered to the subject at a daily dose of about 100 mg, about 150 mg, or about 300 mg.

Embodiment 80 is the combination as in Embodiment 76, wherein telbivudine is administered to the subject at a daily dose of about 600 mg.

Embodiment 81 is the combination for use of any one of embodiments 1 to 80, wherein an effective amount of the pharmaceutical composition comprising the RNAi component and an effective amount of the pharmaceutical composition comprising the compound of formula (I) are administered to the individual for 10 Up to 96 weeks, more specifically 12 to 72 weeks, more specifically 12 to 60 weeks, more specifically 12 to 52 weeks, more specifically 48 weeks.

Embodiment 82 is the combination for use as in Embodiment 81, further comprising administering to the individual a nucleoside analog or nucleotide analog, such as entecavir, tenofovir disoproxil fumarate, tenofovir disoproxil, tenofovir Fuvir alafenamide, lamivudine, telbivudine, or combinations thereof, wherein upon cessation of an effective amount of a pharmaceutical composition comprising an RNAi component and an effective amount of a nucleic acid comprising a non-naturally occurring polynucleotide The pharmaceutical composition of the molecule, that is, the administration of nucleoside or nucleotide analogues is continued as appropriate.

Embodiment 83 is an RNAi component for use in the treatment of hepatitis B virus (HBV) infection, more specifically Chronic HBV infection (CHB), and/or treatment of chronic hepatitis D virus (HDV) infection, wherein RNAi components and nucleic acid molecules comprising non-naturally occurring polynucleotide sequences are as described in any one of Examples 1 to 82 defined, and wherein the RNAi component is optionally administered simultaneously, sequentially or separately with the nucleic acid molecule comprising the non-naturally occurring polynucleotide sequence.

Embodiment 84 is a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence for use in combination with an RNAi component for the treatment of hepatitis B virus (HBV) infection, more specifically Chronic HBV infection (CHB), and/or treatment of chronic hepatitis D virus (HDV) infection, wherein nucleic acid molecules and RNAi components comprising non-naturally occurring polynucleotide sequences are as described in any one of Examples 1 to 82 defined, and nucleic acid molecules comprising non-naturally occurring polynucleotides therein are indicated to be administered simultaneously, sequentially or separately from the RNAi components.

Embodiment 85 is an effective amount of an RNAi component and a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence, which is used to manufacture a medicament for inhibiting the expression of the hepatitis B virus gene of an individual in need, wherein the RNAi component and A nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence is as defined in any one of Examples 1-82. example

The following examples are provided by way of illustration and not limitation of the invention. Those skilled in the art will recognize that the following procedures can be modified using methods known to those of ordinary skill in the art.

example 1 : self-replicating RNA HBV Therapeutic vaccines and liver-specific HBV target siRNA efficacy and immunogenicity

In this study, mice were inoculated with AAV-HBV ( ¹⁰¹¹ viral genomes/mouse) to generate chronic infection. At 6 weeks post-infection, HBsAg levels were measured and animals with serum HBsAg levels (10 ³ -10 ⁴ IU/mL) reflecting infection seen in CHB patients were assigned to cohort 1 for monitoring efficacy and testing for immunogenicity The second group.

Starting 6 weeks after infection with AAV-HBV, both populations were given 3 subcutaneous administrations of siRNA (3 mg/kg) at 3-week intervals. siRNA is a mixture of the first RNAi agent and the second RNAi agent as described in Table 3 (e.g. SEQ ID NO: 94 and SEQ ID NO: 103 or SEQ ID NO: 105 duplex with SEQ ID NO: 100 and SEQ ID NO: 108 or a 2:1 molar mixture of SEQ ID NO: 110 duplexes), each of these agents independently binds to (NAG37)s or (NAG25)s at, for example, the 5' end of their respective sense strands , which can further carry an invAb at the 5' end or 3' end of the sense strand.

Provide HBV replicon therapeutic vaccine: - in the form of a mixture of two double gene constructs, wherein One of the two double gene constructs provides a core coding sequence (such as SEQ ID NO: 8) and a Pol coding sequence (such as SEQ ID NO: 8) joined by a P2A or IRES coding sequence (such as SEQ ID NO: 12, 13 or 14). ID NO: 10), and where The other of the two double gene constructs provides a PreS2.S coding sequence (eg, SEQ ID NO: 6) and a preS1 coding sequence joined by a P2A or IRES coding sequence (eg, SEQ ID NO: 12, 13 or 14) (eg SEQ ID NO: 4), For example, a mixture of the double-gene construct SEQ ID NO: 68 and the double-gene construct SEQ ID NO: 65 or 66; or a mixture of the double-gene construct SEQ ID NO: 67 and the double-gene construct SEQ ID NO: 66 or 65; or - presents the core, Pol, preS2.S and PreS1 coding sequences (SEQ ID NO: 8, 10, 6 and 4) linked together by the P2A or IRES coding sequence (eg SEQ ID NO: 12, 13 or 14) A tetracistronic construct (for example, the tetracistronic organization shown in FIG. 2B ), such as the tetracistronic construct of SEQ ID NO: 70, 71, 69 or 72.

Constructs are optionally formulated in LNP as described eg in US2014255472A1. If a rebound in HBsAg levels was observed, two 10 microgram doses of the therapeutic vaccine were administered via intramuscular injection with an optional third dose administered 6 weeks apart. The first dose of replicon vaccine was administered on the same day as the last dose of siRNA treatment. Serum was collected at the time points indicated in the study design in Figures 1A-1C to monitor serum cytokine and HBV DNA, HBsAg and HBeAg levels.

All animals of population 2 set up to test immunogenicity were sacrificed 10 days after the second administration of the replicon vaccine, and splenocytes and intrahepatic immune cells were collected. To assess the induction of HBV-specific T cell responses, IFNγ-producing cells and multifunctional CD4 were measured by flow cytometry by IFNγ ELIspot and intracellular interleukin staining (IFNγ, TNFα, and IL-2), respectively. and frequency of CD8 T cell responses to stimulation of overlapping 15mer peptide pools encompassing the HBV core, polymerase, PreS2S and PreS1 domains. Humoral responses to HBsAg were measured by anti-HBsAg ELISA.

example 2 : combination siRNA and replicon therapeutic vaccines in AAV-HBV Therapeutic efficacy and immunogenicity in mouse models.

The study design of Example 1 has been implemented with the tetra-3 construct as follows. The therapeutic efficacy of the combination of siRNA targeting HBsAg and the HBV tetra-3 replicon TxVx was evaluated in an AAV-HBV mouse model. Two populations (immunogenic and efficacy) of C57/BL6 mice were injected with 1.0× ^{10 11} genotype equivalents of AAV vector expressing HBV genotype D 1.2 genotype by IV injection. 43 days (immunogenic population) and 50 days (efficacy population) after AAV-HBV inoculation, based on serum HBsAg, serum HBV DNA and mouse weight will have clinically relevant serum HBsAg concentration (10 ³ -10 ⁴ IU/ mL; Autobio HBsAg CLIA) of 60 mice/population were randomly divided into 6 groups (Table 4; n=10 mice/group). Mice were administered three Q3W doses of siRNA (3 mg/kg) or vehicle and two Q6W doses of the replicon (10 μg; formulated in ATX-2 LNP) or vehicle as listed in Table 4. Immunogenic populations were sacrificed two weeks after the final replicon dose, and spleens and livers were harvested to assess HBV-specific, IFN-γ ⁺ T cell responses (ELISpot; Mabtech), while efficacy was monitored 14 weeks after the final replicon dose Serum HBsAg levels of the population.

Table 4 Treatment groups and administration schedule of AAV-HBV mice efficacy study Group siRNA (wk 0, 3, 6) Replicon (wk 6, 12) 1 HBV siRNA HBV tetra-3 2 alpha-1 antitrypsin siRNA HBV tetra-3 3 medium HBV tetra-3 4 HBV siRNA firefly luciferase 5 alpha-1 antitrypsin siRNA firefly luciferase 6 medium medium

HBV tetra-3 is the following construct: the polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence of SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, Coding has the polynucleotide sequence of any one of HBV core antigen in the amino acid sequence SEQ ID NO: 84, 85 or 86, has the IRES of the polynucleotide sequence SEQ ID NO: 13, codes has the amino acid sequence Sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, and coding has amino acid sequence SEQ ID NO: 1 or The polynucleotide sequence of the HBV Pre-S1 antigen of 3; and wherein HBV siRNA is S trigger (SEQ ID NO: 94 and 105) and X trigger (SEQ ID NO: 100 and 110) and GalNAc part (NAG) 2:1 (molar) mixture of 25s [wherein the sense strand of each trigger carries a GalNAc moiety at the 5' end and may further carry an invAb at both the 5' and 3' ends, e.g. (NAG25)s(invAb)sguggacuuCfUfCfucaauuuucus( invAb) is the stake of the S trigger and (NAG25)s(invAb) scgcuguagGfCfAfuaaauuggas(invAb) is the stake of the X trigger].

Two weeks after the 2nd replicon dose, mice receiving HBV siRNA + HBV tetra-3 replicon (group 1) had lower serum concentrations of HBsAg compared to mice receiving HBV siRNA + control replicon. Compared to HBV siRNA + control replicon mice (n=20; 2.21 log10 IU/mL; Mann-Whitney P value, P=0.044) when analyzing both binding efficacy and immunogenicity populations to increase statistical power ), HBV siRNA + HBV tetra-3 replicon mice (n=18; 1.97 log10 IU/mL) had significantly lower serum HBsAg concentrations, although immediately before siRNA administration (wk 0; Mann-Whitney P value, Serum HBsAg concentrations were similar, P=0.2395) and immediately before the first replicon dose (wk 6; Mann-Whitney P value, P=0.8696; Figure 3A-3C).

Indeed, two weeks after the 2nd replicon dose, 5 /18 HBV siRNA + HBV tetra-3 replicon-treated mice had serum HBsAg concentrations below the limit of quantification (0.398 log10 IU/mL), although the number of mice with serum HBsAg concentrations below the limit of quantification immediately before replicon administration Similar (3/18 HBV siRNA+HBV tetra-3 replicon mice vs. 3/20 HBV siRNA+control replicon; Fisher's exact test, P=1.0; Figure 3B). Similar trends were observed in the individual immunogenicity and efficacy populations (Figure 3D-3F).

Analysis beyond 2 weeks after the 2nd replicon dose was limited to the efficacy population because the immunogenic population was sacrificed 2 weeks after the 2nd replicon dose to assess spleen and liver HBV-specific T cell responses. HBsAg serum concentrations were significantly lower in HBV siRNA + HBV tetra-3 replicon-treated mice compared to HBV siRNA + control replicon-treated mice at various time points 2 weeks after the 2nd replicon dose, however Due to fluctuations in serum HBsAg concentration between the time mice were randomly assigned and the start of siRNA treatment, HBV siRNA + HBV tetra-3 replicated Sub-treated mice also had significantly lower baseline HBsAg serum concentrations (immediately prior to siRNA administration). To account for different HBsAg serum concentrations at baseline, the serum HBsAg concentration of each mouse was normalized to its baseline HBsAg concentration. At any time point after initiation of treatment, ΔHBsAg concentrations were not significantly different between HBV siRNA + HBV tetra-3 replicon-treated mice and HBV siRNA + control replicon-treated mice (Fig. 4B).

To determine whether HBV siRNA + HBV tetra-3 replicon combination therapy enhanced HBV-specific T cell responses compared to monotherapy, immunogenic populations were sacrificed two weeks after the second replicon dose, and spleens were harvested. Splenocytes were isolated by mechanical digestion, and HBV-specific IFNγ T cell responses were determined by ELISpot. Briefly, 200,000 cells/well were cultured for 18 to 24 hours in the presence of 2 ug/mL of overlapping peptides covering pol, core, preS1, and preS2.S (15mers overlapped by 9 amino acids) and were cultured according to the manufacturer's instructions. (Mabtech) to process ELISpot culture plates. As shown in Figure 5, HBV-specific IFNy T cells were detected only from mice that received the HBV tetra-3 replicon. Mice receiving HBV siRNA + HBV tetra-3 replicon (mean ± SD, 1172 ± 398 SFU/10 6 cells) compared to mice receiving siRNA vehicle + replicon (mean ± SD, 598 ± 491 SFU/10 ⁶ cells) /10 ⁶ cells, Mann-Whitney test, P=0.0115) or AAT siRNA + HBV tetra-3 replicon (mean ± SD, 1375 ± 530 SFU/10 ⁶ cells, Mann-Whitney test, P=0.0052) mice had significantly higher HBV-specific IFNγ T cell responses.

The combination of the siRNA and the replicon produced lower HBsAg serum concentrations two weeks after the last replicon dose compared to the combination of HBV siRNA and the control replicon or compared to the combination of the control siRNA and the HBV replicon.

The foregoing summary and the following embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. It should be understood that the invention is not limited to the precise embodiments shown in the drawings.

Figures 1A-1C show the experimental design of RNAi and RNA replicon combination therapy. Figure 1A shows the group to be tested with the combination therapy. Figure 1B shows individual and readout information for a combination therapy experiment. Figure 1C shows a schematic of the experimental design.

Figures 2A-2B show schematics of antigen design (Figure 2A) and bicistronic and tetracistronic vaccine designs (Figure 2B). The antigen design (Figure 2A) included Pol with an inactivating point mutation, a truncated core with a C-terminal deletion (SEQ ID NO: 76), PreS2.S, and a display of cystatin S signal peptide (SEQ ID NO: 77 ) of PreS1.

Figures 3A-3F show comparisons at wk 0 (immediately prior to the first siRNA dose; Figure 3A and Figure 3D), wk 6 (immediately prior to the first replicon dose; Figure 3B and Figure 3E) and wk 14 (last replicate 2 weeks after the sub-dose; Figure 3C and Figure 3F) between mice receiving HBV siRNA+control replicon (Group 4) and mice administered HBV siRNA+HBV tetra-3 replicon (Group 1) Graph of HBsAg serum concentrations (geometric mean ± 95% confidence interval). Figures 3A-3C show serum HBsAg concentrations of mice from combined efficacy and immunogenicity populations. Figures 3D-3F show HBsAg serum concentrations of mice in separate efficacy (E) and immunogenicity (I) populations.

4A-4B show graphs showing HBsAg serum concentrations over time in mice administered HBV siRNA + HBV tetra-3 replicon compared to HBV siRNA + control replicon. Figure 4A shows absolute HBsAg concentrations. Figure 4B shows ΔHBsAg concentration normalized to wk 0 HBsAg concentration. Filled circles, HBV siRNA + HBV replicons (n=8); filled squares, AAT siRNA + HBV replicons (n=10); filled triangles, vehicle + HBV replicons (n=10); filled inverted triangles, HBV siRNA + rFF replicon (n=10); solid diamonds, AAT siRNA + rFF replicon (n=10); open circles, vehicle + vehicle (n=9). Asterisks indicate statistically significant differences (P<0.05) calculated by Mann-Whitney test comparing HBV siRNA+HBV replicon and HBV siRNA+rFF replicon.

Figure 5 shows curves of HBV-specific IFNgT cell responses in mice treated with HBV siRNA+HBV tetra-3 replicon or AAT siRNA+HBV tetra-3 replicon compared to mice receiving siRNA vehicle+replicon picture. Statistical significance was determined by the Mann-Whitney test.

         
           <![CDATA[ <110> Janssen Pharmaceuticals, Inc.]]>
           <![CDATA[ <120> Combination therapy for the treatment of hepatitis B virus infection]]>
           <![CDATA[ <130> 065814.11253/68US1]]>
           <![CDATA[ <140> TW 110147590]]>
           <![CDATA[ <141> 2021-12-17]]>
           <![CDATA[ <150> US 63/127,430]]>
           <![CDATA[ <151> 2020-12-18]]>
           <![CDATA[ <160> 115 ]]>
           <![CDATA[ <170> PatentIn version 3.5]]>
           <![CDATA[ <210> 1]]>
           <![CDATA[ <211> 118]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS1 HBV antigen]]>
           <![CDATA[ <400> 1]]>
          Gly Gly Trp Ser Ser Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser
          1 5 10 15
          Val Pro Asn Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Ala
                      20 25 30
          Phe Gly Ala Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Asn Lys
                  35 40 45
          Asp His Trp Pro Asp Ala Asn Lys Val Gly Ala Gly Ala Phe Gly Pro
              50 55 60
          Gly Phe Thr Pro Pro His Gly Gly Leu Leu Gly Trp Ser Pro Gln Ala
          65 70 75 80
          Gln Gly Ile Leu Thr Thr Val Pro Ala Ala Pro Pro Pro Ala Ser Thr
                          85 90 95
          Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro Leu Ser Pro Pro Leu Arg
                      100 105 110
          Asp Thr His Pro Gln Ala
                  115
           <![CDATA[ <210> 2]]>
           <![CDATA[ <211> 357]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS1 HBV antigen coding sequence]]>
           <![CDATA[ <400> 2]]>
          ggtggatgga gctcaaagcc gcggaaaggg atgggtacta acctgtccgt accaaatccc 60
          ctgggatttt ttccagacca ccaactcgat cctgcttttg gcgcaaattc caacaatccc 120
          gactgggact ttaaccctaa caaggaccac tggcctgatg ccaacaaggt gggggcagga 180
          gcctttggtc ccggcttcac cccacccccat ggaggtcttt tgggatggtc accacaggcc 240
          cagggcatcc tgaccactgt ccctgctgct ccaccgccag cttctactaa tcgacagagc 300
          gggaggcagc cgaccccccct gagtcccccc ctgcgggata cccaccctca ggcataa 357
           <![CDATA[ <210> 3]]>
           <![CDATA[ <211> 100]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> D1-19 PreS1 HBV antigen]]>
           <![CDATA[ <400> 3]]>
          Asn Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Ala Phe Gly
          1 5 10 15
          Ala Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Asn Lys Asp His
                      20 25 30
          Trp Pro Asp Ala Asn Lys Val Gly Ala Gly Ala Phe Gly Pro Gly Phe
                  35 40 45
          Thr Pro Pro His Gly Gly Leu Leu Gly Trp Ser Pro Gln Ala Gln Gly
              50 55 60
          Ile Leu Thr Thr Val Pro Ala Ala Pro Pro Pro Ala Ser Thr Asn Arg
          65 70 75 80
          Gln Ser Gly Arg Gln Pro Thr Pro Leu Ser Pro Pro Leu Arg Asp Thr
                          85 90 95
          His Pro Gln Ala
                      100
           <![CDATA[ <210> 4]]>
           <![CDATA[ <211> 303]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> D1-19 PreS1 HBV antigen coding sequence]]>
           <![CDATA[ <400> 4]]>
          aatcccctgg gattttttcc agaccaccaa ctcgatcctg cttttggcgc aaattccaac 60
          aatcccgact gggactttaa ccctaacaag gaccactggc ctgatgccaa caaggtgggg 120
          gcaggagcct ttggtcccgg cttcacccca ccccatggag gtcttttggg atggtcacca 180
          caggcccagg gcatcctgac cactgtccct gctgctccac cgccagcttc tactaatcga 240
          cagagcggga ggcagccgac ccccctgagt ccccccctgc gggataccca ccctcaggca 300
          taa 303
           <![CDATA[ <210> 5]]>
           <![CDATA[ <211> 281]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S HBV antigen]]>
           <![CDATA[ <400> 5]]>
          Met Gln Trp Asn Ser Thr Thr Phe His Gln Thr Leu Gln Asp Pro Arg
          1 5 10 15
          Val Arg Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val
                      20 25 30
          Asn Pro Val Pro Thr Thr Ala Ser Pro Ile Ser Ser Ile Phe Ser Arg
                  35 40 45
          Thr Gly Asp Pro Ala Pro Asn Met Glu Asn Ile Thr Ser Gly Phe Leu
              50 55 60
          Gly Pro Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile
          65 70 75 80
          Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe
                          85 90 95
          Leu Gly Gly Thr Pro Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr
                      100 105 110
          Ser Asn His Ser Pro Thr Ser Cys Pro Pro Ile Cys Pro Gly Tyr Arg
                  115 120 125
          Trp Met Cys Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu
              130 135 140
          Cys Leu Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro
          145 150 155 160
          Val Cys Pro Leu Ile Pro Gly Ser Ser Thr Thr Ser Thr Gly Pro Cys
                          165 170 175
          Lys Thr Cys Thr Ile Pro Ala Gln Gly Thr Ser Met Phe Pro Ser Cys
                      180 185 190
          Cys Cys Thr Lys Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro
                  195 200 205
          Ser Ser Trp Ala Phe Ala Lys Tyr Leu Trp Glu Trp Ala Ser Val Arg
              210 215 220
          Phe Ser Trp Leu Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly
          225 230 235 240
          Leu Ser Pro Thr Val Trp Leu Ser Val Ile Trp Met Met Trp Tyr Trp
                          245 250 255
          Gly Pro Ser Leu Tyr Asn Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro
                      260 265 270
          Ile Phe Phe Cys Leu Trp Val Tyr Ile
                  275 280
           <![CDATA[ <210> 6]]>
           <![CDATA[ <211> 846]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S HBV antigen coding sequence]]>
           <![CDATA[ <400> 6]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaa 846
           <![CDATA[ <210> 7]]>
           <![CDATA[ <211> 148]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV core antigen]]>
           <![CDATA[ <400> 7]]>
          Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu Ser
          1 5 10 15
          Phe Leu Pro Ser Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp Thr
                      20 25 30
          Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser
                  35 40 45
          Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu
              50 55 60
          Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala Ser
          65 70 75 80
          Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys Ile
                          85 90 95
          Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu
                      100 105 110
          Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro
                  115 120 125
          Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu
              130 135 140
          Thr Thr Val Val
          145
           <![CDATA[ <210> 8]]>
           <![CDATA[ <211> 444]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV core antigen coding sequence]]>
           <![CDATA[ <400> 8]]>
          gacatcgacc cttacaagga gttcggcgcc agcgtggaac tgctgtcttt tctgcccagt 60
          gatttctttc cttccattcg agacctgctg gataccgcct ctgctctgta tcgggaagcc 120
          ctggagagcc cagaacactg ctccccaacac cataccgctc tgcgacaggc aatcctgtgc 180
          tggggggagc tgatgaacct ggccacatgg gtgggatcga atctggagga ccccgcttca 240
          cgggaactgg tggtcagcta cgtgaacgtc aatatgggcc tgaaaatccg ccagctgctg 300
          tggttccata ttagctgcct gacttttgga cgagagaccg tgctggaata cctggtgtcc 360
          ttcggcgtct ggattcgcac tccccctgct tatcgaccac ccaacgcacc aattctgtcc 420
          accctgcccg agaccacagt ggtc 444
           <![CDATA[ <210> 9]]>
           <![CDATA[ <211> 843]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV polymerase antigen]]>
           <![CDATA[ <400> 9]]>
          Met Pro Leu Ser Tyr Gln His Phe Arg Lys Leu Leu Leu Leu Asp Asp
          1 5 10 15
          Glu Ala Gly Pro Leu Glu Glu Glu Leu Pro Arg Leu Ala Asp Glu Gly
                      20 25 30
          Leu Asn Arg Arg Val Ala Glu Asp Leu Asn Leu Gly Asn Leu Asn Val
                  35 40 45
          Ser Ile Pro Trp Thr His Lys Val Gly Asn Phe Thr Gly Leu Tyr Ser
              50 55 60
          Ser Thr Val Pro Val Phe Asn Pro Glu Trp Gln Thr Pro Ser Phe Pro
          65 70 75 80
          Asn Ile His Leu Gln Glu Asp Ile Ile Asn Arg Cys Glu Gln Phe Val
                          85 90 95
          Gly Pro Leu Thr Val Asn Glu Lys Arg Arg Leu Lys Leu Ile Met Pro
                      100 105 110
          Ala Arg Phe Tyr Pro Asn Val Thr Lys Tyr Leu Pro Leu Asp Lys Gly
                  115 120 125
          Ile Lys Pro Tyr Tyr Pro Glu His Leu Val Asn His Tyr Phe Gln Thr
              130 135 140
          Arg His Tyr Leu His Thr Leu Trp Lys Ala Gly Ile Leu Tyr Lys Arg
          145 150 155 160
          Glu Thr Thr Arg Ser Ala Ser Phe Cys Gly Ser Pro Tyr Ser Trp Glu
                          165 170 175
          Gln Glu Leu Gln His Gly Arg Leu Val Phe Gln Thr Ser Lys Arg His
                      180 185 190
          Gly Asp Glu Ser Phe Cys Ser Gln Ser Ser Gly Ile Leu Ser Arg Ser
                  195 200 205
          Pro Val Gly Pro Cys Ile Gln Ser Gln Leu Arg Lys Ser Arg Leu Gly
              210 215 220
          Leu Gln Pro Gln Gln Gly His Leu Ala Arg Arg Gln Gln Gly Arg Ser
          225 230 235 240
          Gly Ser Ile Arg Ala Arg Val His Pro Thr Thr Arg Arg Thr Phe Gly
                          245 250 255
          Val Glu Pro Ser Gly Ser Gly His Ile Asp Asn Ser Ala Ser Ser Ser Ser
                      260 265 270
          Ser Ser Cys Leu His Gln Ser Ala Val Arg Lys Ala Ala Tyr Ser His
                  275 280 285
          Leu Ser Thr Ser Lys Arg His Ser Ser Ser Ser Gly His Ala Val Glu Leu
              290 295 300
          His Asn Ile Pro Pro Asn Ser Ala Arg Ser Gln Ser Glu Gly Pro Val
          305 310 315 320
          Phe Ser Cys Trp Trp Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser Asp
                          325 330 335
          Tyr Cys Leu Ser His Ile Val Asn Leu Leu Glu Asp Trp Gly Pro Cys
                      340 345 350
          Thr Glu His Gly Glu His His Ile Arg Ile Pro Arg Thr Pro Ala Arg
                  355 360 365
          Val Thr Gly Gly Val Phe Leu Val Asp Lys Asn Pro His Asn Thr Thr
              370 375 380
          Glu Ser Arg Leu Val Val Asp Phe Ser Gln Phe Ser Arg Gly Asn Thr
          385 390 395 400
          Arg Val Ser Trp Pro Lys Phe Ala Val Pro Asn Leu Gln Ser Leu Thr
                          405 410 415
          Asn Leu Leu Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala
                      420 425 430
          Ala Phe Tyr His Leu Pro Leu His Pro Ala Ala Met Pro His Leu Leu
                  435 440 445
          Val Gly Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn
              450 455 460
          Ser Arg Ile Ile Asn His Gln His Gly Thr Met Gln Asn Leu His Asp
          465 470 475 480
          Ser Cys Ser Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Leu Tyr Lys Thr
                          485 490 495
          Phe Gly Arg Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe
                      500 505 510
          Arg Lys Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu Leu Ala Gln
                  515 520 525
          Phe Thr Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys
              530 535 540
          Leu Ala Phe Ser Tyr Met Asn Asn Val Val Leu Gly Ala Lys Ser Val
          545 550 555 560
          Gln His Leu Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser
                          565 570 575
          Leu Gly Ile His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser
                      580 585 590
          Leu Asn Phe Met Gly Tyr Val Ile Gly Ser Trp Gly Thr Leu Pro Gln
                  595 600 605
          Glu His Ile Val Gln Lys Ile Lys Glu Cys Phe Arg Lys Leu Pro Val
              610 615 620
          Asn Arg Pro Ile Asp Trp Lys Val Cys Gln Arg Ile Val Gly Leu Leu
          625 630 635 640
          Gly Phe Ala Ala Pro Phe Thr Gln Cys Gly Tyr Pro Ala Leu Met Pro
                          645 650 655
          Leu Tyr Ala Cys Ile Gln Ser Lys Gln Ala Phe Thr Phe Ser Pro Thr
                      660 665 670
          Tyr Lys Ala Phe Leu Cys Lys Gln Tyr Leu Asn Leu Tyr Pro Val Ala
                  675 680 685
          Arg Gln Arg Pro Gly Leu Cys Gln Val Phe Ala Asn Ala Thr Pro Thr
              690 695 700
          Gly Trp Gly Leu Ala Ile Gly His Gln Arg Met Arg Gly Thr Phe Val
          705 710 715 720
          Ala Pro Leu Pro Ile His Thr Ala Gln Leu Leu Ala Ala Cys Phe Ala
                          725 730 735
          Arg Ser Arg Ser Gly Ala Lys Leu Ile Gly Thr Asp Asn Ser Val Val
                      740 745 750
          Leu Ser Arg Lys Tyr Thr Ser Phe Pro Trp Leu Leu Gly Cys Ala Ala
                  755 760 765
          Asn Trp Ile Leu Arg Gly Thr Ser Phe Val Tyr Val Pro Ser Ala Leu
              770 775 780
          Asn Pro Ala Asp Asp Pro Ser Arg Gly Arg Leu Gly Leu Tyr Arg Pro
          785 790 795 800
          Leu Leu Arg Leu Pro Phe Arg Pro Thr Thr Gly Arg Thr Ser Leu Tyr
                          805 810 815
          Ala Asp Ser Pro Ser Val Pro Ser His Leu Pro Asp Arg Val His Phe
                      820 825 830
          Ala Ser Pro Leu His Val Ala Trp Arg Pro Pro
                  835 840
           <![CDATA[ <210> 10]]>
           <![CDATA[ <211> 2529]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV polymerase antigen coding sequence]]>
           <![CDATA[ <400> 10]]>
          atgcccctgt cttaccagca ctttagaaag cttctgctgc tggacgatga agccgggcct 60
          ctggaggaag agctgccaag gctggcagac gaggggctga accggagagt ggccgaagat 120
          ctgaatctgg gaaacctgaa cgtgagcatc ccttggactc ataaagtcgg caacttcacc 180
          gggctgtaca gctccacagt gcctgtcttc aatccagagt ggcagacacc atcctttccc 240
          aacattcacc tgcaggagga catcattaat agatgcgaac agttcgtggg acctctgaca 300
          gtcaacgaaa agaggcgcct gaaactgatc atgcctgcca ggttttaccc aaatgtgact 360
          aagtatctgc cactggataa gggcatcaag ccttactatc cagagcacct ggtgaaccat 420
          tacttccaga ctagacacta tctgcatacc ctgtggaagg ccggaatcct gtacaaacga 480
          gaaactaccc ggagtgcttc attttgtggc tccccatatt cttgggaaca ggagctgcag 540
          catggcaggc tggtgttcca gaccagcaaa cgccacgggg atgagtcctt ttgcagccag 600
          tctagtggca tcctgagcag atcccccgtg gggccttgta ttcagtctca gctgcggaag 660
          agtagactgg gactgcagcc acagcaggga cacctggcac gacggcagca gggaaggtct 720
          ggcagtatcc gggctagagt gcatcccaca actagaagga ccttcggcgt cgagccatca 780
          ggaagcggcc acatcgacaa cagcgcatca agctcctcta gttgcctgca tcagtcagcc 840
          gtgagaaagg ccgcttacag ccacctgtcc acatctaaaa ggcactcaag ctccgggcat 900
          gctgtggagc tgcacaacat ccctccaaat tctgcacgca gtcagtcaga aggacccgtg 960
          ttcagctgct ggtggctgca gtttcggaac tcaaagcctt gcagcgacta ttgtctgagc 1020
          catattgtga atctgctgga ggattggggc ccttgtaccg agcacgggga acaccatatc 1080
          aggattccac gaacaccagc acgagtgact ggaggggtgt tcctggtgga caagaaccccc 1140
          cacaatacta ccgagagccg gctggtggtc gatttcagtc agttttcaag aggcaacaca 1200
          agggtgtcat ggcccaaatt cgccgtccct aatctgcaga gtctgactaa cctgctgtct 1260
          agtaatctga gctggctgtc cctggacgtg tccgcagcct tttaccacct gcctctgcat 1320
          ccagctgcaa tgccccatct gctggtgggg tcaagcggac tgagtcgcta cgtcgcccga 1380
          ctgtcctcta actcacgcat cattaatcac cagcatggca ccatgcagaa cctgcacgat 1440
          agctgttccc ggaatctgta cgtgtctctg ctgctgctgt ataagacatt cggcagaaaa 1500
          ctgcacctgt acagccatcc tatcattctg gggtttagga agatcccaat gggagtggga 1560
          ctgagcccct tcctgctggc acagtttacc tccgccattt gctctgtggt ccgccgagcc 1620
          ttcccacact gtctggcttt ttcctatatg aacaatgtgg tcctgggcgc caaatccgtg 1680
          cagcatctgg agtctctgtt cacagctgtc actaactttc tgctgagcct ggggatccac 1740
          ctgaacccaa ataagactaa acgctggggg tacagcctga atttcatggg atatgtgatt 1800
          ggatcctggg ggaccctgcc acaggagcac atcgtgcaga agatcaagga atgctttcgg 1860
          aagctgcccg tcaacagacc tatcgactgg aaagtgtgcc agcggattgt cggactgctg 1920
          ggcttcgccg ctccctttac ccagtgcggg taccccagcac tgatgcccct gtatgcctgt 1980
          atccagtcta agcaggcttt cacctttagt cctacataca aggcattcct gtgcaaacag 2040
          tacctgaacc tgtatccagt ggcaaggcag cgacctggac tgtgccaggt ctttgcaaat 2100
          gccactccta ccggctgggg gctggctatc ggacatcagc gaatgcgggg cacattcgtg 2160
          gcccccctgc ctattcacac tgctcagctg ctggcagcct gctttgctag atctaggagt 2220
          ggagcaaagc tgatcggcac cgacaatagt gtggtcctgt caagaaaata cacatccttc 2280
          ccatggctgc tgggatgtgc tgcaaactgg attctgaggg gcaccagctt cgtgtacgtc 2340
          ccctcagccc tgaatcctgc tgacgatcca tcccgcgggc gactgggact gtaccgacct 2400
          ctgctgagac tgcccttcag gcctacaact ggccggacat ctctgtatgc cgattcacca 2460
          agcgtgccct cacacctgcc tgacagagtc cactttgctt cacccctgca cgtcgcttgg 2520
          cggcctcca 2529
           <![CDATA[ <210> 11]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> P2A autoprotease]]>
           <![CDATA[ <400> 11]]>
          Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val
          1 5 10 15
          Glu Glu Asn Pro Gly Pro
                      20
           <![CDATA[ <210> 12]]>
           <![CDATA[ <211> 66]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> P2A autoprotease coding sequence]]>
           <![CDATA[ <400> 12]]>
          ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 60
          ggacct 66
           <![CDATA[ <210> 13]]>
           <![CDATA[ <211> 587]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> EMCV IRES]]>
           <![CDATA[ <400> 13]]>
          gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60
          gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120
          ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180
          gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240
          aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300
          tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360
          acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca 420
          aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480
          gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 540
          ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaacc 587
           <![CDATA[ <210> 14]]>
           <![CDATA[ <211> 747]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> EV71 IRES]]>
           <![CDATA[ <400> 14]]>
          ttaaaacagc tgtgggttgt tcccacccac agggcccact gggcgctagc actctgattt 60
          tacgaaatcc ttgtgcgcct gttttatatc ccttccctaa ttcgaaacgt agaagcaatg 120
          cgcaccactg atcaatagta ggcgtaacgc gccagttacg tcatgatcaa gcatatctgt 180
          tcccccggac tgagtatcaa tagactgctt acgcggttga aggagaaaac gttcgttatc 240
          cggctaacta cttcgagaag cccagtaaca ccatggaagc tgcagggtgtttcgctcagc 300
          acttcccccg tgtagatcag gtcgatgagc cactgcaatc cccacaggtg actgtggcag 360
          tggctgcgtt ggcggcctgc ctatggggag acccatagga cgctctaatg tggacatggt 420
          gcgaagagcc tattgagcta gttagtagtc ctccggcccc tgaatgcggc taatcctaac 480
          tgcggagcac atgccttcaa cccagagggt agtgtgtcgt aacgggcaac tctgcagcgg 540
          aaccgactac tttgggtgtc cgtgtttctt ttttattctt atattggctg cttatggtga 600
          caattacaga attgttacca tatagctatt ggattggcca tccggtgtgt aatagagctg 660
          ttatatacct atttgttggc tttgtaccac taactttaaa atctataact accctcaact 720
          ttatattaac cctcaataca gttgacc 747
           <![CDATA[ <210> 15]]>
           <![CDATA[ <211> 3174]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 15]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tcca 3174
           <![CDATA[ <210> 16]]>
           <![CDATA[ <211> 3174]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core coding sequence]]>
           <![CDATA[ <400> 16]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgt 3174
           <![CDATA[ <210> 17]]>
           <![CDATA[ <211> 3698]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core coding sequence-IRES(EMCV)-Pol coding sequence]]>
           <![CDATA[ <400> 17]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgttaag cccctctccc tccccccccc 540
          ctaacgttac tggccgaagc cgcttggaat aaggccggtg tgcgtttgtc tatatgttat 600
          tttccaccat attgccgtct tttggcaatg tgagggcccg gaaacctggc cctgtcttct 660
          tgacgagcat tcctaggggt ctttcccctc tcgccaaagg aatgcaaggt ctgttgaatg 720
          tcgtgaagga agcagttcct ctggaagctt cttgaagaca aacaacgtct gtagcgaccc 780
          tttgcaggca gcggaaccccc ccacctggcg acaggtgcct ctgcggccaa aagccacgtg 840
          tataagatac acctgcaaag gcggcacaac cccagtgcca cgttgtgagt tggatagttg 900
          tggaaagagt caaatggctc tcctcaagcg tattcaacaa ggggctgaag gatgcccaga 960
          aggtacccca ttgtatggga tctgatctgg ggcctcggtg cacatgcttt acatgtgttt 1020
          agtcgaggtt aaaaaacgtc taggcccccc gaaccacggg gacgtggttt tcctttgaaa 1080
          aacacgatga taatatggcc acaaccatgg ctcgacctct gtgtaccctg ctactcctga 1140
          tggctaccct ggctggagct ctggccagca tgcccctgtc ttaccagcac tttagaaagc 1200
          ttctgctgct ggacgatgaa gccgggcctc tggaggaaga gctgccaagg ctggcagacg 1260
          aggggctgaa ccggagagtg gccgaagatc tgaatctggg aaacctgaac gtgagcatcc 1320
          cttggactca taaagtcggc aacttcaccg ggctgtacag ctccacagtg cctgtcttca 1380
          atccagagtg gcagacacca tcctttccca aattcacct gcaggaggac atcattaata 1440
          gatgcgaaca gttcgtggga cctctgacag tcaacgaaaa gaggcgcctg aaactgatca 1500
          tgcctgccag gttttaccca aatgtgacta agtatctgcc actggataag ggcatcaagc 1560
          cttactatcc agagcacctg gtgaaccatt acttccagac tagacactat ctgcataccc 1620
          tgtggaaggc cggaatcctg tacaaacgag aaactacccg gagtgcttca ttttgtggct 1680
          ccccatattc ttgggaacag gagctgcagc atggcaggct ggtgttccag accagcaaac 1740
          gccacgggga tgagtccttt tgcagccagt ctagtggcat cctgagcaga tcccccgtgg 1800
          ggccttgtat tcagtctcag ctgcggaaga gtagactggg actgcagcca cagcagggac 1860
          acctggcacg acggcagcag ggaaggtctg gcagtatccg ggctagagtg catcccacaa 1920
          ctagaaggac cttcggcgtc gagccatcag gaagcggcca catcgacaac agcgcatcaa 1980
          gctcctctag ttgcctgcat cagtcagccg tgagaaaggc cgcttacagc cacctgtcca 2040
          catctaaaag gcactcaagc tccgggcatg ctgtggagct gcacaacatc cctccaaatt 2100
          ctgcacgcag tcagtcagaa ggacccgtgt tcagctgctg gtggctgcag tttcggaact 2160
          caaagccttg cagcgactat tgtctgagcc atattgtgaa tctgctggag gattggggcc 2220
          cttgtaccga gcacggggaa caccatatca ggattccacg aacaccagca cgagtgactg 2280
          gaggggtgtt cctggtggac aagaaccccc acaatactac cgagagccgg ctggtggtcg 2340
          atttcagtca gttttcaaga ggcaacacaa gggtgtcatg gcccaaattc gccgtcccta 2400
          atctgcagag tctgactaac ctgctgtcta gtaatctgag ctggctgtcc ctggacgtgt 2460
          ccgcagcctt ttaccacctg cctctgcatc cagctgcaat gccccatctg ctggtggggt 2520
          caagcggact gagtcgctac gtcgcccgac tgtcctctaa ctcacgcatc attaatcacc 2580
          agcatggcac catgcagaac ctgcacgata gctgttcccg gaatctgtac gtgtctctgc 2640
          tgctgctgta taagacattc ggcagaaaac tgcacctgta cagccatcct atcattctgg 2700
          ggtttaggaa gatcccaatg ggagtgggac tgagccccctt cctgctggca cagtttacct 2760
          ccgccatttg ctctgtggtc cgccgagcct tccccacactg tctggctttt tcctatatga 2820
          acaatgtggt cctgggcgcc aaatccgtgc agcatctgga gtctctgttc acaagctgtca 2880
          ctaactttct gctgagcctg gggatccacc tgaacccaaa taagactaaa cgctgggggt 2940
          acagcctgaa tttcatggga tatgtgattg gatcctgggg gaccctgcca caggagcaca 3000
          tcgtgcagaa gatcaaggaa tgctttcgga agctgcccgt caacagacct atcgactgga 3060
          aagtgtgcca gcggattgtc ggactgctgg gcttcgccgc tccctttacc cagtgcgggt 3120
          accccagcact gatgcccctg tatgcctgta tccagtctaa gcaggctttc acctttagtc 3180
          ctacatacaa ggcattcctg tgcaaacagt acctgaacct gtatccagtg gcaaggcagc 3240
          gacctggact gtgccaggtc tttgcaaatg ccactcctac cggctggggg ctggctatcg 3300
          gacatcagcg aatgcggggc aattcgtgg cccccctgcc tattcacact gctcagctgc 3360
          tggcagcctg ctttgctaga tctaggagtg gagcaaagct gatcggcacc gacaatagtg 3420
          tggtcctgtc aagaaaatac acatccttcc catggctgct gggatgtgct gcaaactgga 3480
          ttctgagggg caccagcttc gtgtacgtcc cctcagccct gaatcctgct gacgatccat 3540
          cccgcgggcg actgggactg taccgacctc tgctgagact gcccttcagg cctacaactg 3600
          gccggacatc tctgtatgcc gattcaccaa gcgtgccctc acacctgcct gacagagtcc 3660
          actttgcttc acccctgcac gtcgcttggc ggcctcca 3698
           <![CDATA[ <210> 18]]>
           <![CDATA[ <211> 3698]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol coding sequence-IRES (EMCV)-core coding sequence]]>
           <![CDATA[ <400> 18]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc cataagcccc tctccctccc ccccccctaa cgttactggc cgaagccgct 2640
          tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg 2700
          gcaatgtgag ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt 2760
          cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg 2820
          aagcttcttg aagacaaaca acgtctgtag cgaccctttg caggcagcgg aacccccccac 2880
          ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg 2940
          cacaacccca gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct 3000
          caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg 3060
          atctggggcc tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aacgtctagg 3120
          ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgataat atggccacaa 3180
          ccatggctcg acctctgtgt accctgctac tcctgatggc taccctggct ggagctctgg 3240
          ccagcgacat cgacccttac aaggagttcg gcgccagcgt ggaactgctg tcttttctgc 3300
          ccagtgattt ctttccttcc attcgagacc tgctggatac cgcctctgct ctgtatcggg 3360
          aagccctgga gagcccagaa cactgctccc cacaccatac cgctctgcga caggcaatcc 3420
          tgtgctgggg ggagctgatg aacctggcca catgggtggg atcgaatctg gaggacccccg 3480
          cttcacggga actggtggtc agctacgtga acgtcaatat gggcctgaaa atccgccagc 3540
          tgctgtggtt ccatattagc tgcctgactt ttggacgaga gaccgtgctg gaatacctgg 3600
          tgtccttcgg cgtctggatt cgcactcccc ctgcttatcg accacccaac gcaccaattc 3660
          tgtccaccct gcccgagacc acagtggtcc gtcgccgt 3698
           <![CDATA[ <210> 19]]>
           <![CDATA[ <211> 3858]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core coding sequence-IRES (EV71)-Pol coding sequence]]>
           <![CDATA[ <400> 19]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgttaat taaaacagct gtgggttgtt 540
          cccacccaca gggcccactg ggcgctagca ctctgatttt acgaaatcct tgtgcgcctg 600
          ttttatatcc cttccctaat tcgaaacgta gaagcaatgc gcaccactga tcaatagtag 660
          gcgtaacgcg ccagttacgt catgatcaag catatctgtt cccccggact gagtatcaat 720
          agactgctta cgcggttgaa ggagaaaacg ttcgttatcc ggctaactac ttcgagaagc 780
          ccagtaacac catggaagct gcagggtgtt tcgctcagca cttcccccgt gtagatcagg 840
          tcgatgagcc actgcaatcc ccacaggtga ctgtggcagt ggctgcgttg gcggcctgcc 900
          tatggggaga cccataggac gctctaatgt ggacatggtg cgaagagcct attgagctag 960
          ttagtagtcc tccggcccct gaatgcggct aatcctaact gcggagcaca tgccttcaac 1020
          ccagagggta gtgtgtcgta acgggcaact ctgcagcgga accgactact ttgggtgtcc 1080
          gtgtttcttt tttattctta tattggctgc ttatggtgac aattacagaa ttgttaccat 1140
          atagctattg gattggccat ccggtgtgta atagagctgt tatataccta tttgttggct 1200
          ttgtaccact aactttaaaa tctataacta ccctcaactt tatattaacc ctcaatacag 1260
          ttgaccatgg ctcgacctct gtgtaccctg ctactcctga tggctacccct ggctggagct 1320
          ctggccagca tgcccctgtc ttaccagcac tttagaaagc ttctgctgct ggacgatgaa 1380
          gccgggcctc tggaggaaga gctgccaagg ctggcagacg aggggctgaa ccggagagtg 1440
          gccgaagatc tgaatctggg aaacctgaac gtgagcatcc cttggactca taaagtcggc 1500
          aacttcaccg ggctgtacag ctccacagtg cctgtcttca atccagagtg gcagacacca 1560
          tcctttccca aattcacct gcaggaggac atcattaata gatgcgaaca gttcgtggga 1620
          cctctgacag tcaacgaaaa gaggcgcctg aaactgatca tgcctgccag gttttaccca 1680
          aatgtgacta agtatctgcc actggataag ggcatcaagc cttactatcc agagcacctg 1740
          gtgaaccatt acttccagac tagacactat ctgcataccc tgtggaaggc cggaatcctg 1800
          tacaaacgag aaactacccg gagtgcttca ttttgtggct ccccatattc ttgggaacag 1860
          gagctgcagc atggcaggct ggtgttccag accagcaaac gccacgggga tgagtccttt 1920
          tgcagccagt ctagtggcat cctgagcaga tcccccgtgg ggccttgtat tcagtctcag 1980
          ctgcggaaga gtagactggg actgcagcca cagcagggac acctggcacg acggcagcag 2040
          ggaaggtctg gcagtatccg ggctagagtg catcccacaa ctagaaggac cttcggcgtc 2100
          gagccatcag gaagcggcca catcgacaac agcgcatcaa gctcctctag ttgcctgcat 2160
          cagtcagccg tgagaaaggc cgcttacagc cacctgtcca catctaaaag gcactcaagc 2220
          tccgggcatg ctgtggagct gcacaacatc cctccaaatt ctgcacgcag tcagtcagaa 2280
          ggacccgtgt tcagctgctg gtggctgcag tttcggaact caaagccttg cagcgactat 2340
          tgtctgagcc atattgtgaa tctgctggag gattggggcc cttgtaccga gcacggggaa 2400
          caccatatca ggattccacg aacaccagca cgagtgactg gaggggtgtt cctggtggac 2460
          aagaaccccc acaatactac cgagagccgg ctggtggtcg atttcagtca gttttcaaga 2520
          ggcaacacaa gggtgtcatg gcccaaattc gccgtcccta atctgcagag tctgactaac 2580
          ctgctgtcta gtaatctgag ctggctgtcc ctggacgtgt ccgcagcctt ttaccacctg 2640
          cctctgcatc cagctgcaat gccccatctg ctggtggggt caagcggact gagtcgctac 2700
          gtcgcccgac tgtcctctaa ctcacgcatc attaatcacc agcatggcac catgcagaac 2760
          ctgcacgata gctgttcccg gaatctgtac gtgtctctgc tgctgctgta taagacattc 2820
          ggcagaaaac tgcacctgta cagccatcct atcattctgg ggtttaggaa gatcccaatg 2880
          ggagtgggac tgagccccctt cctgctggca cagtttacct ccgccatttg ctctgtggtc 2940
          cgccgagcct tcccacactg tctggctttt tcctatatga acaatgtggt cctgggcgcc 3000
          aaatccgtgc agcatctgga gtctctgttc acagctgtca ctaactttct gctgagcctg 3060
          gggatccacc tgaacccaaa taagactaaa cgctgggggt acagcctgaa tttcatggga 3120
          tatgtgattg gatcctgggg gaccctgcca caggagcaca tcgtgcagaa gatcaaggaa 3180
          tgctttcgga agctgcccgt caacagacct atcgactgga aagtgtgcca gcggattgtc 3240
          ggactgctgg gcttcgccgc tccctttacc cagtgcgggt accccagcact gatgcccctg 3300
          tatgcctgta tccagtctaa gcaggctttc acctttagtc ctacatacaa ggcattcctg 3360
          tgcaaacagt acctgaacct gtatccagtg gcaaggcagc gacctggact gtgccaggtc 3420
          tttgcaaatg ccactcctac cggctggggg ctggctatcg gacatcagcg aatgcggggc 3480
          acattcgtgg cccccctgcc tattcacact gctcagctgc tggcagcctg ctttgctaga 3540
          tctaggagtg gagcaaagct gatcggcacc gacaatagtg tggtcctgtc aagaaaatac 3600
          acatccttcc catggctgct gggatgtgct gcaaactgga ttctgagggg caccagcttc 3660
          gtgtacgtcc cctcagccct gaatcctgct gacgatccat cccgcgggcg actgggactg 3720
          taccgacctc tgctgagact gcccttcagg cctacaactg gccggacatc tctgtatgcc 3780
          gattcaccaa gcgtgccctc acacctgcct gacagagtcc actttgcttc acccctgcac 3840
          gtcgcttggc ggcctcca 3858
           <![CDATA[ <210> 20]]>
           <![CDATA[ <211> 3858]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol coding sequence-IRES (EV71)-core coding sequence]]>
           <![CDATA[ <400> 20]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc cataattaaa acagctgtgg gttgttccca cccacagggc ccactgggcg 2640
          ctagcactct gattttacga aatccttgtg cgcctgtttt atatcccttc cctaattcga 2700
          aacgtagaag caatgcgcac cactgatcaa tagtaggcgt aacgcgccag ttacgtcatg 2760
          atcaagcata tctgttcccc cggactgagt atcaatagac tgcttacgcg gttgaaggag 2820
          aaaacgttcg ttatccggct aactacttcg agaagcccag taacaccatg gaagctgcag 2880
          ggtgtttcgc tcagcacttc ccccgtgtag atcaggtcga tgagccactg caatccccac 2940
          aggtgactgt ggcagtggct gcgttggcgg cctgcctatggggagaccca taggacgctc 3000
          taatgtggac atggtgcgaa gagcctattg agctagttag tagtcctccg gcccctgaat 3060
          gcggctaatc ctaactgcgg agcacatgcc ttcaacccag agggtagtgtgtcgtaacgg 3120
          gcaactctgc agcggaaccg actactttgg gtgtccgtgtttctttttta ttcttatatt 3180
          ggctgcttat ggtgacaatt acagaattgt taccatatag ctattggatt ggccatccgg 3240
          tgtgtaatag agctgttata tacctatttg ttggctttgt accactaact ttaaaatcta 3300
          taactaccct caactttata ttaaccctca atacagttga ccatggctcg acctctgtgt 3360
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcgacat cgacccttac 3420
          aaggagttcg gcgccagcgt ggaactgctg tcttttctgc ccagtgattt ctttccttcc 3480
          attcgagacc tgctggatac cgcctctgct ctgtatcggg aagccctgga gagcccagaa 3540
          cactgctccc cacaccatac cgctctgcga caggcaatcc tgtgctgggg ggagctgatg 3600
          aacctggcca catgggtggg atcgaatctg gaggacccccg cttcacggga actggtggtc 3660
          agctacgtga acgtcaatat gggcctgaaa atccgccagc tgctgtggtt ccatattagc 3720
          tgcctgactt ttggacgaga gaccgtgctg gaatacctgg tgtccttcgg cgtctggatt 3780
          cgcactcccc ctgcttatcg accacccaac gcaccaattc tgtccaccct gcccgagacc 3840
          acagtggtcc gtcgccgt 3858
           <![CDATA[ <210> 21]]>
           <![CDATA[ <211> 1326]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 21]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggca 1326
           <![CDATA[ <210> 22]]>
           <![CDATA[ <211> 1326]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> preS1-2A-PreS2.S coding sequence]]>
           <![CDATA[ <400> 22]]>
          atggctaggc ccctgtgtac acttttgctc ctgatggcca ccctcgctgg agctctggca 60
          agcggtggat ggagctcaaa gccgcggaaa gggatgggta ctaacctgtc cgtaccaaat 120
          cccctgggat tttttccaga ccaccaactc gatcctgctt ttggcgcaaa ttccaacaat 180
          cccgactggg actttaaccc taacaaggac cactggcctg atgccaacaa ggtgggggca 240
          ggagcctttg gtcccggctt caccccaccc catggaggtc ttttgggatg gtcaccacag 300
          gcccagggca tcctgaccac tgtccctgct gctccaccgc cagcttctac taatcgacag 360
          agcgggaggc agccgacccc cctgagtccc cccctgcggg atacccacccc tcaggcagga 420
          agcggagcta ctaacttcag cctgctgaag caggctggag acgtggagga gaaccctgga 480
          cctatgcagt ggaactcaac tactttccat cagacccttc aggaccctag agtgcgcggg 540
          ctgtactttc ctgctggggg aagcagtagc gggaccgtta atccagtacc tacgaccgcc 600
          tctcccatat cttctatctt tagtaggact ggtgaccctg ctcccaacat ggagaatatc 660
          acctccgggt ttctggggccc actcctggtc cttcaggccg gattcttcct gctgactcga 720
          atcctcacca taccccagag cctggacagc tggtggacaa gcctgaattt tctgggagga 780
          actcctgtat gcctgggaca aaattcacag tcccctacaa gtaaccattc accgacaagt 840
          tgtcctccca tctgtcccgg atacaggtgg atgtgcctgc gaaggttcat catcttcctc 900
          ttcatcctct tgctttgcct tattttcctc ctggttcttc tggactatca gggcatgctg 960
          cctgtgtgcc cactgatacc aggatctagt actaccagca caggcccgtg taagacctgt 1020
          acaattccag cacaagggac tagtatgttc ccctcctgct gttgtactaa gccaagcgac 1080
          ggtaattgca cgtgtatccc aatcccgtcc tcctgggcgt ttgccaagta cctctgggaa 1140
          tgggcctcag tcagattttc atggcttagt cttttggtgc cgttcgtgca gtggtttgtg 1200
          ggactctctc cgactgtgtg gctcagcgtg atctggatga tgtggtactg gggcccttcc 1260
          ctttacaaca tactgtctcc attccttccc ctgctgccaa tcttcttttg cctgtgggtc 1320
          Tatatt 1326
           <![CDATA[ <210> 23]]>
           <![CDATA[ <211> 1850]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S coding sequence-IRES (EMCV)-preS1 coding sequence]]>
           <![CDATA[ <400> 23]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaagccc ctctccctcc ccccccccta acgttactgg ccgaagccgc ttggaataag 900
          gccggtgtgc gtttgtctat atgttatttt ccaccacatatt gccgtctttt ggcaatgtga 960
          gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt tcccctctcg 1020
          ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg gaagcttctt 1080
          gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca cctggcgaca 1140
          ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg gcacaaccccc 1200
          agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc tcaagcgtat 1260
          tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggatct gatctggggc 1320
          ctcggtgcac atgctttaca tgtgtttagt cgaggttaaa aaacgtctag gccccccgaa 1380
          ccacggggac gtggttttcc tttgaaaaac acgatgataa tatggccaca accatggcta 1440
          ggcccctgtg tacacttttg ctcctgatgg ccaccctcgc tggagctctg gcaagcggtg 1500
          gatggagctc aaagccgcgg aaagggatgg gtactaacct gtccgtacca aatcccctgg 1560
          gattttttcc agaccaccaa ctcgatcctg cttttggcgc aaattccaac aatcccgact 1620
          gggactttaa ccctaacaag gaccactggc ctgatgccaa caaggtgggg gcaggagcct 1680
          ttggtcccgg cttcacccca ccccatggag gtcttttggg atggtcacca caggcccagg 1740
          gcatcctgac cactgtccct gctgctccac cgccagcttc tactaatcga cagagcggga 1800
          ggcagccgac ccccctgagt ccccccctgc gggataccca ccctcaggca 1850
           <![CDATA[ <210> 24]]>
           <![CDATA[ <211> 1850]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> preS1 coding sequence-IRES (EMCV)-PreS2.S coding sequence]]>
           <![CDATA[ <400> 24]]>
          atggctaggc ccctgtgtac acttttgctc ctgatggcca ccctcgctgg agctctggca 60
          agcggtggat ggagctcaaa gccgcggaaa gggatgggta ctaacctgtc cgtaccaaat 120
          cccctgggat tttttccaga ccaccaactc gatcctgctt ttggcgcaaa ttccaacaat 180
          cccgactggg actttaaccc taacaaggac cactggcctg atgccaacaa ggtgggggca 240
          ggagcctttg gtcccggctt caccccacccc catggaggtc ttttgggatg gtcaccacag 300
          gcccagggca tcctgaccac tgtccctgct gctccaccgc cagcttctac taatcgacag 360
          agcgggaggc agccgacccc cctgagtccc cccctgcggg atacccacccc tcaggcataa 420
          gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 480
          gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 540
          ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 600
          gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 660
          aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 720
          tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 780
          acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca 840
          aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 900
          gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 960
          ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg cagtggaact 1020
          caactacttt ccatcagacc cttcaggacc ctagagtgcg cgggctgtac tttcctgctg 1080
          ggggaagcag tagcgggacc gttaatccag tacctacgac cgcctctccc atatcttcta 1140
          tctttagtag gactggtgac cctgctccca acatggagaa tatcacctcc gggtttctgg 1200
          gcccactcct ggtccttcag gccggattct tcctgctgac tcgaatcctc accatacccc 1260
          agagcctgga cagctggtgg acaagcctga attttctggg aggaactcct gtatgcctgg 1320
          gacaaaattc acaagtcccct acaagtaacc attcaccgac aagttgtcct cccatctgtc 1380
          ccggatacag gtggatgtgc ctgcgaaggt tcatcatctt cctcttcatc ctcttgcttt 1440
          gccttatttt cctcctggtt cttctggact atcagggcat gctgcctgtg tgcccactga 1500
          taccaggatc tagtactacc agcacaggcc cgtgtaagac ctgtacaatt ccagcacaag 1560
          ggactagtat gttcccctcc tgctgttgta ctaagccaag cgacggtaat tgcacgtgta 1620
          tcccaatccc gtcctcctgg gcgtttgcca agtacctctg ggaatgggcc tcagtcagat 1680
          tttcatggct tagtcttttg gtgccgttcg tgcagtggtt tgtgggactc tctccgactg 1740
          tgtggctcag cgtgatctgg atgatgtggt actggggccc ttccctttac aacatactgt 1800
          ctccattcct tcccctgctg ccaatcttct tttgcctgtg ggtctatatt 1850
           <![CDATA[ <210> 25]]>
           <![CDATA[ <211> 2010]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S coding sequence-IRES (EV71)-preS1 coding sequence]]>
           <![CDATA[ <400> 25]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaattaa aacagctgtg ggttgttcccc accacaggg cccactgggc gctagcactc 900
          tgattttacg aaatccttgt gcgcctgttt tatatccctt ccctaattcg aaacgtagaa 960
          gcaatgcgca ccactgatca atagtaggcg taacgcgcca gttacgtcat gatcaagcat 1020
          atctgttccc ccggactgag tatcaataga ctgcttacgc ggttgaagga gaaaacgttc 1080
          gttatccggc taactacttc gagaagccca gtaacaccat ggaagctgca gggtgtttcg 1140
          ctcagcactt cccccgtgta gatcaggtcg atgagccact gcaatcccca caggtgactg 1200
          tggcagtggc tgcgttggcg gcctgcctat ggggagacccc ataggacgct ctaatgtgga 1260
          catggtgcga agagcctatt gagctagtta gtagtcctcc ggcccctgaa tgcggctaat 1320
          cctaactgcg gagcacatgc cttcaaccca gagggtagtg tgtcgtaacg ggcaactctg 1380
          cagcggaacc gactactttg ggtgtccgtg tttctttttt attcttatat tggctgctta 1440
          tggtgacaat tacagaattg ttaccatata gctattggat tggccatccg gtgtgtaata 1500
          gagctgttat atacctattt gttggctttg taccactaac tttaaaatct ataactaccc 1560
          tcaactttat attaaccctc aatacagttg accatggcta ggcccctgtg tacacttttg 1620
          ctcctgatgg ccaccctcgc tggagctctg gcaagcggtg gatggagctc aaagccgcgg 1680
          aaagggatgg gtactaacct gtccgtacca aatcccctgg gattttttcc agaccaccaa 1740
          ctcgatcctg cttttggcgc aaattccaac aatcccgact gggactttaa ccctaacaag 1800
          gaccactggc ctgatgccaa caaggtgggg gcaggagcct ttggtcccgg cttcacccca 1860
          ccccatggag gtcttttggg atggtcacca caggcccagg gcatcctgac cactgtccct 1920
          gctgctccac cgccagcttc tactaatcga cagagcggga ggcagccgac ccccctgagt 1980
          ccccccctgc gggataccca ccctcaggca 2010
           <![CDATA[ <210> 26]]>
           <![CDATA[ <211> 2010]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> preS1 coding sequence-IRES (EV71)-PreS2.S coding sequence]]>
           <![CDATA[ <400> 26]]>
          atggctaggc ccctgtgtac acttttgctc ctgatggcca ccctcgctgg agctctggca 60
          agcggtggat ggagctcaaa gccgcggaaa gggatgggta ctaacctgtc cgtaccaaat 120
          cccctgggat tttttccaga ccaccaactc gatcctgctt ttggcgcaaa ttccaacaat 180
          cccgactggg actttaaccc taacaaggac cactggcctg atgccaacaa ggtgggggca 240
          ggagcctttg gtcccggctt caccccaccc catggaggtc ttttgggatg gtcaccacag 300
          gcccagggca tcctgaccac tgtccctgct gctccaccgc cagcttctac taatcgacag 360
          agcgggaggc agccgacccc cctgagtccc cccctgcggg atacccacccc tcaggcataa 420
          ttaaaacagc tgtgggttgt tccccaccac agggcccact gggcgctagc actctgattt 480
          tacgaaatcc ttgtgcgcct gttttatatc ccttccctaa ttcgaaacgt agaagcaatg 540
          cgcaccactg atcaatagta ggcgtaacgc gccagttacg tcatgatcaa gcatatctgt 600
          tcccccggac tgagtatcaa tagactgctt acgcggttga aggagaaaac gttcgttatc 660
          cggctaacta cttcgagaag cccagtaaca ccatggaagc tgcagggtgtttcgctcagc 720
          acttcccccg tgtagatcag gtcgatgagc cactgcaatc cccacaggtg actgtggcag 780
          tggctgcgtt ggcggcctgc ctatggggag acccatagga cgctctaatg tggacatggt 840
          gcgaagagcc tattgagcta gttagtagtc ctccggcccc tgaatgcggc taatcctaac 900
          tgcggagcac atgccttcaa cccagagggt agtgtgtcgt aacgggcaac tctgcagcgg 960
          aaccgactac tttgggtgtc cgtgtttctt ttttattctt atattggctg cttatggtga 1020
          caattacaga attgttacca tatagctatt ggattggcca tccggtgtgt aatagagctg 1080
          ttatatacct atttgttggc tttgtaccac taactttaaa atctataact accctcaact 1140
          ttatattaac cctcaataca gttgaccatg cagtggaact caactacttt ccatcagacc 1200
          cttcaggacc ctagagtgcg cgggctgtac tttcctgctg ggggaagcag tagcgggacc 1260
          gttaatccag tacctacgac cgcctctccc atatcttcta tctttagtag gactggtgac 1320
          cctgctccca acatggagaa tatcacctcc gggtttctgg gcccactcct ggtccttcag 1380
          gccggattct tcctgctgac tcgaatcctc accatacccc agagcctgga cagctggtgg 1440
          acaagcctga attttctggg aggaactcct gtatgcctgg gacaaaattc acagtcccct 1500
          acaagtaacc attcaccgac aagttgtcct cccatctgtc ccggatacag gtggatgtgc 1560
          ctgcgaaggt tcatcatctt cctcttcatc ctcttgcttt gccttatttt cctcctggtt 1620
          cttctggact atcagggcat gctgcctgtg tgcccactga taccaggatc tagtactacc 1680
          agcacaggcc cgtgtaagac ctgtacaatt ccagcacaag ggactagtat gttcccctcc 1740
          tgctgttgta ctaagccaag cgacggtaat tgcacgtgta tcccaatccc gtcctcctgg 1800
          gcgtttgcca agtacctctg ggaatgggcc tcagtcagat tttcatggct tagtcttttg 1860
          gtgccgttcg tgcagtggtt tgtgggactc tctccgactg tgtggctcag cgtgatctgg 1920
          atgatgtggt actggggccc ttccctttac aacatactgt ctccattcct tcccctgctg 1980
          ccaatcttct tttgcctgtg ggtctatatt 2010
           <![CDATA[ <210> 27]]>
           <![CDATA[ <211> 4566]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol-2A-PreS.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 27]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tccaggatca 3180
          ggcgctacga attttagcct tctgaagcaa gcgggagacg ttgaagaaaa cccagggcct 3240
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 3300
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 3360
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 3420
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 3480
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 3540
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 3600
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 3660
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 3720
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 3780
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 3840
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 3900
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 3960
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 4020
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 4080
          attgggtccg gagcgactaa cttttccctg ctgaaacaag cgggtgacgt cgaagagaat 4140
          ccgggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 4200
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 4260
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 4320
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 4380
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 4440
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 4500
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 4560
          caggca 4566
           <![CDATA[ <210> 28]]>
           <![CDATA[ <211> 4566]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core-2A-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 28]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgtggatca 3180
          ggcgctacga attttagcct tctgaagcaa gcgggagacg ttgaagaaaa cccagggcct 3240
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 3300
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 3360
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 3420
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 3480
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 3540
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 3600
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 3660
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 3720
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 3780
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 3840
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 3900
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 3960
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 4020
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 4080
          attgggtccg gagcgactaa cttttccctg ctgaaacaag cgggtgacgt cgaagagaat 4140
          ccgggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 4200
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 4260
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 4320
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 4380
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 4440
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 4500
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 4560
          caggca 4566
           <![CDATA[ <210> 29]]>
           <![CDATA[ <211> 4566]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1-2A-core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 29]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcaggat caggcgctac gaattttagc cttctgaagc aagcgggaga cgttgaagaa 1380
          aacccagggc ctatggctcg acctctgtgt accctgctac tcctgatggc taccctggct 1440
          ggagctctgg ccagcgacat cgacccttac aaggagttcg gcgccagcgt ggaactgctg 1500
          tcttttctgc ccagtgattt ctttccttcc attcgagacc tgctggatac cgcctctgct 1560
          ctgtatcggg aagccctgga gagcccagaa cactgctccc cacaccatac cgctctgcga 1620
          caggcaatcc tgtgctgggg ggagctgatg aacctggcca catgggtggg atcgaatctg 1680
          gaggacccccg cttcacggga actggtggtc agctacgtga acgtcaatat gggcctgaaa 1740
          atccgccagc tgctgtggtt ccatattagc tgcctgactt ttggacgaga gaccgtgctg 1800
          gaatacctgg tgtccttcgg cgtctggatt cgcactcccc ctgcttatcg accacccaac 1860
          gcaccaattc tgtccaccct gcccgagacc acagtggtcc gtcgccgtgg gtccggagcg 1920
          actaactttt ccctgctgaa acaagcgggt gacgtcgaag agaatccggg acctatggct 1980
          cgacctctgt gtaccctgct actcctgatg gctaccctgg ctggagctct ggccagcatg 2040
          cccctgtctt accagcactt tagaaagctt ctgctgctgg acgatgaagc cgggcctctg 2100
          gaggaagagc tgccaaggct ggcagacgag gggctgaacc ggagagtggc cgaagatctg 2160
          aatctgggaa acctgaacgt gagcatccct tggactcata aagtcggcaa cttcaccggg 2220
          ctgtacagct ccacagtgcc tgtcttcaat ccagagtggc aagacaccatc ctttcccaac 2280
          attcacctgc aggaggacat cattaataga tgcgaacagt tcgtgggacc tctgacagtc 2340
          aacgaaaaga ggcgcctgaa actgatcatg cctgccaggt tttacccaaa tgtgactaag 2400
          tatctgccac tggataaggg catcaagcct tactatccag agcacctggt gaaccattac 2460
          ttccagacta gacactatct gcataccctg tggaaggccg gaatcctgta caaacgagaa 2520
          actacccgga gtgcttcatt ttgtggctcc ccatattctt gggaacagga gctgcagcat 2580
          ggcaggctgg tgttccagac cagcaaacgc cacggggatg agtccttttg cagccagtct 2640
          agtggcatcc tgagcagatc ccccgtgggg ccttgtattc agtctcagct gcggaagagt 2700
          agactgggac tgcagccaca gcagggacac ctggcacgac ggcagcaggg aaggtctggc 2760
          agtatccggg ctagagtgca tcccacaact agaaggacct tcggcgtcga gccatcagga 2820
          agcggccaca tcgacaacag cgcatcaagc tcctctagtt gcctgcatca gtcagccgtg 2880
          agaaaggccg cttacagcca cctgtccaca tctaaaaggc actcaagctc cgggcatgct 2940
          gtggagctgc acaacatccc tccaaattct gcacgcagtc agtcagaagg accccgtgttc 3000
          agctgctggt ggctgcagtt tcggaactca aagccttgca gcgactattg tctgagccat 3060
          attgtgaatc tgctggagga ttggggccct tgtaccgagc acggggaaca ccatatcagg 3120
          attccacgaa caccagcacg agtgactgga ggggtgttcc tggtggaca gaacccccac 3180
          aatactaccg agagccggct ggtggtcgat ttcagtcagt tttcaagagg caacacaagg 3240
          gtgtcatggc ccaaattcgc cgtccctaat ctgcagagtc tgactaacct gctgtctagt 3300
          aatctgagct ggctgtccct ggacgtgtcc gcagcctttt accacctgcc tctgcatcca 3360
          gctgcaatgc cccatctgct ggtggggtca agcggactga gtcgctacgt cgcccgactg 3420
          tcctctaact cacgcatcat taatcaccag catggcacca tgcagaacct gcacgatagc 3480
          tgttcccgga atctgtacgt gtctctgctg ctgctgtata agacattcgg cagaaaactg 3540
          cacctgtaca gccatcctat cattctgggg tttaggaaga tcccaatggg agtggggactg 3600
          agccccttcc tgctggcaca gtttacctcc gccatttgct ctgtggtccg ccgagccttc 3660
          ccaacactgtc tggctttttc ctatatgaac aatgtggtcc tgggcgccaa atccgtgcag 3720
          catctggagt ctctgttcac agctgtcact aactttctgc tgagcctggg gatccacctg 3780
          aacccaaata agactaaacg ctgggggtac agcctgaatt tcatgggata tgtgattgga 3840
          tcctggggga ccctgccaca ggagcacatc gtgcagaaga tcaaggaatg ctttcggaag 3900
          ctgcccgtca acagacctat cgactggaaa gtgtgccagc ggattgtcgg actgctgggc 3960
          ttcgccgctc cctttaccca gtgcgggtac ccagcactga tgcccctgta tgcctgtatc 4020
          cagtctaagc aggctttcac ctttagtcct acatacaagg cattcctgtg caaacagtac 4080
          ctgaacctgt atccagtggc aaggcagcga cctggactgt gccaggtctt tgcaaatgcc 4140
          actcctaccg gctgggggct ggctatcgga catcagcgaa tgcggggcac attcgtggcc 4200
          cccctgccta ttcacactgc tcagctgctg gcagcctgct ttgctagatc taggagtgga 4260
          gcaaagctga tcggcaccga caatagtgtg gtcctgtcaa gaaaatacac atccttccca 4320
          tggctgctgg gatgtgctgc aaactggatt ctgaggggca ccagcttcgt gtacgtcccc 4380
          tcagccctga atcctgctga cgatccatcc cgcgggcgac tgggactgta ccgacctctg 4440
          ctgagactgc ccttcaggcc tacaactggc cggacatctc tgtatgccga ttcaccaagc 4500
          gtgccctcac acctgcctga cagagtccac tttgcttcac ccctgcacgt cgcttggcgg 4560
          cctcca 4566
           <![CDATA[ <210> 30]]>
           <![CDATA[ <211> 4566]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence ]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1-2A-Pol-2A-core coding sequence]]>
           <![CDATA[ <400> 30]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcaggat caggcgctac gaattttagc cttctgaagc aagcgggaga cgttgaagaa 1380
          aacccagggc ctatggctcg acctctgtgt accctgctac tcctgatggc taccctggct 1440
          ggagctctgg ccagcatgcc cctgtcttac cagcacttta gaaagcttct gctgctggac 1500
          gatgaagccg ggcctctgga ggaagagctg ccaaggctgg cagacgaggg gctgaaccgg 1560
          agagtggccg aagatctgaa tctgggaaac ctgaacgtga gcatcccttg gactcataaa 1620
          gtcggcaact tcaccggggct gtacagctcc acagtgcctg tcttcaatcc agagtggcag 1680
          aacaccatcct ttcccaacat tcacctgcag gaggacatca ttaatagatg cgaacagttc 1740
          gtgggacctc tgacagtcaa cgaaaagagg cgcctgaaac tgatcatgcc tgccaggttt 1800
          tacccaaatg tgactaagta tctgccactg gataagggca tcaagcctta ctatccagag 1860
          cacctggtga accattactt ccagactaga cactatctgc ataccctgtg gaaggccgga 1920
          atcctgtaca aacgagaaac tacccggagt gcttcatttt gtggctcccc atattcttgg 1980
          gaacaggagc tgcagcatgg caggctggtg ttccagacca gcaaacgcca cggggatgag 2040
          tccttttgca gccagtctag tggcatcctg agcagatccc ccgtggggcc ttgtattcag 2100
          tctcagctgc ggaagagtag actgggactg cagccacagc agggacacct ggcacgacgg 2160
          cagcagggaa ggtctggcag tatccgggct agagtgcatc ccacaactag aaggaccttc 2220
          ggcgtcgagc catcaggaag cggccacatc gacaacagcg catcaagctc ctctagttgc 2280
          ctgcatcagt cagccgtgag aaaggccgct tacagccacc tgtccacatc taaaaggcac 2340
          tcaagctccg ggcatgctgt ggagctgcac aacatccctc caaattctgc acgcagtcag 2400
          tcagaaggac ccgtgttcag ctgctggtgg ctgcagtttc ggaactcaaa gccttgcagc 2460
          gactattgtc tgagccatat tgtgaatctg ctggaggatt ggggcccttg taccgagcac 2520
          ggggaacacc atatcaggat tccacgaaca ccagcacgag tgactggagg ggtgttcctg 2580
          gtggacaaga accccccaa tactaccgag agccggctgg tggtcgattt cagtcagttt 2640
          tcaagaggca acacaagggt gtcatggccc aaattcgccg tccctaatct gcagagtctg 2700
          actaacctgc tgtctagtaa tctgagctgg ctgtccctgg acgtgtccgc agccttttac 2760
          cacctgcctc tgcatccagc tgcaatgccc catctgctgg tggggtcaag cggactgagt 2820
          cgctacgtcg cccgactgtc ctctaactca cgcatcatta atcaccagca tggcaccatg 2880
          cagaacctgc acgatagctg ttcccggaat ctgtacgtgt ctctgctgct gctgtataag 2940
          acattcggca gaaaactgca cctgtacagc catcctatca ttctggggtt taggaagatc 3000
          ccaatggggag tgggactgag ccccttcctg ctggcacagt ttacctccgc catttgctct 3060
          gtggtccgcc gagccttccc acactgtctg gctttttcct atatgaacaa tgtggtcctg 3120
          ggcgccaaat ccgtgcagca tctggagtct ctgttcacag ctgtcactaa ctttctgctg 3180
          agcctgggga tccacctgaa cccaaataag actaaacgct gggggtacag cctgaatttc 3240
          atgggatatg tgattggatc ctgggggacc ctgccacagg agcacatcgt gcagaagatc 3300
          aaggaatgct ttcggaagct gcccgtcaac agacctatcg actggaaagt gtgccagcgg 3360
          attgtcggac tgctgggctt cgccgctccc tttacccagt gcgggtaccc agcactgatg 3420
          cccctgtatg cctgtatcca gtctaagcag gctttcacct ttagtcctac atacaaggca 3480
          ttcctgtgca aacagtacct gaacctgtat ccagtggcaa ggcagcgacc tggactgtgc 3540
          caggtctttg caaatgccac tcctaccggc tggggggctgg ctatcggaca tcagcgaatg 3600
          cggggcacat tcgtggcccc cctgcctatt cacactgctc agctgctggc agcctgcttt 3660
          gctagatcta ggagtggagc aaagctgatc ggcaccgaca atagtgtggt cctgtcaaga 3720
          aaatacacat ccttcccatg gctgctggga tgtgctgcaa actggattct gaggggcacc 3780
          agcttcgtgt acgtcccctc agccctgaat cctgctgacg atccatcccg cgggcgactg 3840
          ggactgtacc gacctctgct gagactgccc ttcaggccta caactggccg gacatctctg 3900
          tatgccgatt caccaagcgt gccctcacac ctgcctgaca gagtccactt tgcttcaccc 3960
          ctgcacgtcg cttggcggcc tccagggtcc ggagcgacta acttttccct gctgaaacaa 4020
          gcgggtgacg tcgaagagaa tccgggacct atggctcgac ctctgtgtac cctgctactc 4080
          ctgatggcta ccctggctgg agctctggcc agcgacatcg acccttacaa ggagttcggc 4140
          gccagcgtgg aactgctgtc ttttctgccc agtgatttct ttccttccat tcgagacctg 4200
          ctggataccg cctctgctct gtatcgggaa gccctggaga gcccagaaca ctgctcccca 4260
          caccataccg ctctgcgaca ggcaatcctg tgctgggggg agctgatgaa cctggccaca 4320
          tgggtgggat cgaatctgga ggaccccgct tcacgggaac tggtggtcag ctacgtgaac 4380
          gtcaatatgg gcctgaaaat ccgccagctg ctgtggttcc atattagctg cctgactttt 4440
          ggacgagaga ccgtgctgga atacctggtg tccttcggcg tctggattcg cactccccct 4500
          gcttatcgac cacccaacgc accaattctg tccaccctgc ccgagaccac agtggtccgt 4560
          cgccgt 4566
           <![CDATA[ <210> 31]]>
           <![CDATA[ <211> 5090]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol coding sequence-IRES (EMCV)-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 31]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tccataagcc 3180
          cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa ggccggtgtg 3240
          cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg agggcccgga 3300
          aacctggccc tgtcttcttg acgagcattc ctaggggtct ttcccctctc gccaaaggaa 3360
          tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct tgaagacaaa 3420
          caacgtctgt agcgaccctt tgcaggcagc ggaaccccccc acctggcgac aggtgccctct 3480
          gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc cagtgccacg 3540
          ttgtgagttg gatagttgtg gaaagagtca aatggctctc ctcaagcgta ttcaacaagg 3600
          ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg cctcggtgca 3660
          catgctttac atgtgtttag tcgaggttaa aaaacgtcta ggccccccga accacgggga 3720
          cgtggttttc ctttgaaaaa cacgatgata atatggccac aaccatgcag tggaactcaa 3780
          ctactttcca tcagaccctt caggacccta gagtgcgcgg gctgtacttt cctgctgggg 3840
          gaagcagtag cgggaccgtt aatccagtac ctacgaccgc ctctcccata tcttctatct 3900
          ttagtaggac tggtgaccct gctcccaaca tggagaatat cacctccggg tttctgggcc 3960
          cactcctggt ccttcaggcc ggattcttcc tgctgactcg aatcctcacc ataccccaga 4020
          gcctggacag ctggtggaca agcctgaatt ttctgggagg aactcctgta tgcctgggac 4080
          aaaattcaca gtcccctaca agtaaccatt caccgacaag ttgtcctccc atctgtcccg 4140
          gatacaggtg gatgtgcctg cgaaggttca tcatcttcct cttcatcctc ttgctttgcc 4200
          ttattttcct cctggttctt ctggactatc agggcatgct gcctgtgtgc ccactgatac 4260
          caggatctag tactaccagc acaggcccgt gtaagacctg tacaattcca gcacaaggga 4320
          ctagtatgtt cccctcctgc tgttgtacta agccaagcga cggtaattgc acgtgtatcc 4380
          caatcccgtc ctcctgggcg tttgccaagt acctctggga atgggcctca gtcagatttt 4440
          catggcttag tcttttggtg ccgttcgtgc agtggtttgt gggactctct ccgactgtgt 4500
          ggctcagcgt gatctggatg atgtggtact ggggcccttc cctttacaac atactgtctc 4560
          cattccttcc cctgctgcca atcttctttt gcctgtgggt ctatattggg tccggagcga 4620
          ctaacttttc cctgctgaaa caagcgggtg acgtcgaaga gaatccggga cctatggcta 4680
          ggcccctgtg tacacttttg ctcctgatgg ccaccctcgc tggagctctg gcaagcggtg 4740
          gatggagctc aaagccgcgg aaagggatgg gtactaacct gtccgtacca aatcccctgg 4800
          gattttttcc agaccaccaa ctcgatcctg cttttggcgc aaattccaac aatcccgact 4860
          gggactttaa ccctaacaag gaccactggc ctgatgccaa caaggtgggg gcaggagcct 4920
          ttggtcccgg cttcacccca ccccatggag gtcttttggg atggtcacca caggcccagg 4980
          gcatcctgac cactgtccct gctgctccac cgccagcttc tactaatcga cagagcggga 5040
          ggcagccgac ccccctgagt ccccccctgc gggataccca ccctcaggca 5090
           <![CDATA[ <210> 32]]>
           <![CDATA[ <211> 5090]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1 coding sequence-IRES (EMCV)-core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 32]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcataag cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat 1380
          aaggccggtg tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg 1440
          tgagggcccg gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc 1500
          tcgccaaagg aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt 1560
          cttgaagaca aacaacgtct gtagcgaccc tttgcaggca gcggaaccccc ccacctggcg 1620
          acaggtgcct ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac 1680
          cccagtgcca cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg 1740
          tattcaacaa ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg 1800
          ggcctcggtg cacatgcttt acatgtgttt agtcgaggtt aaaaaacgtc taggcccccc 1860
          gaaccacggg gacgtggttt tcctttgaaa aacacgatga taatatggcc acaaccatgg 1920
          ctcgacctct gtgtaccctg ctactcctga tggctacccct ggctggagct ctggccagcg 1980
          acatcgaccc ttacaaggag ttcggcgcca gcgtggaact gctgtctttt ctgcccagtg 2040
          attctttcc ttccattcga gacctgctgg ataccgcctc tgctctgtat cgggaagccc 2100
          tggagagccc agaacactgc tccccacacc ataccgctct gcgacaggca atcctgtgct 2160
          ggggggagct gatgaacctg gccacatggg tgggatcgaa tctggaggac cccgcttcac 2220
          gggaactggt ggtcagctac gtgaacgtca atatgggcct gaaaatccgc cagctgctgt 2280
          ggttccatat tagctgcctg acttttggac gagagaccgt gctggaatac ctggtgtcct 2340
          tcggcgtctg gattcgcact ccccctgctt atcgaccacc caacgcacca attctgtcca 2400
          ccctgcccga gaccacagtg gtccgtcgcc gtgggtccgg agcgactaac ttttccctgc 2460
          tgaaacaagc gggtgacgtc gaagagaatc cgggacctat ggctcgacct ctgtgtaccc 2520
          tgctactcct gatggctacc ctggctggag ctctggccag catgcccctg tcttaccagc 2580
          actttagaaa gcttctgctg ctggacgatg aagccgggcc tctggaggaa gagctgccaa 2640
          ggctggcaga cgaggggctg aaccggagag tggccgaaga tctgaatctg ggaaacctga 2700
          acgtgagcat cccttggact cataaagtcg gcaacttcac cgggctgtac agctccacag 2760
          tgcctgtctt caatccagag tggcagacac catcctttcc caacattcac ctgcaggagg 2820
          acatcattaa tagatgcgaa cagttcgtgg gacctctgac agtcaacgaa aagaggcgcc 2880
          tgaaactgat catgcctgcc aggttttacc caaatgtgac taagtatctg ccactggata 2940
          agggcatcaa gccttactat ccagagcacc tggtgaacca ttacttccag actagacact 3000
          atctgcatac cctgtggaag gccggaatcc tgtacaaacg agaaactacc cggagtgctt 3060
          cattttgtgg ctccccatat tcttgggaac aggagctgca gcatggcagg ctggtgttcc 3120
          agaccagcaa acgccacggg gatgagtcct tttgcagcca gtctagtggc atcctgagca 3180
          gatcccccgt ggggccttgt attcagtctc agctgcggaa gagtagactg ggactgcagc 3240
          cacagcaggg acacctggca cgacggcagc agggaaggtc tggcagtatc cgggctagag 3300
          tgcatcccac aactagaagg accttcggcg tcgagccatc aggaagcggc cacatcgaca 3360
          acagcgcatc aagctcctct agttgcctgc atcagtcagc cgtgagaaag gccgcttaca 3420
          gccacctgtc cacatctaaa aggcactcaa gctccgggca tgctgtggag ctgcacaaca 3480
          tccctccaaa ttctgcacgc agtcagtcag aaggacccgt gttcagctgc tggtggctgc 3540
          agtttcggaa ctcaaagcct tgcagcgact attgtctgag ccatattgtg aatctgctgg 3600
          aggattgggg cccttgtacc gagcacgggg aacaccatat caggattcca cgaacaccag 3660
          cacgagtgac tggaggggtg ttcctggtgg acaagaaccc ccacaatact accgagagcc 3720
          ggctggtggt cgatttcagt cagttttcaa gaggcaacac aagggtgtca tggcccaaat 3780
          tcgccgtccc taatctgcag agtctgacta acctgctgtc tagtaatctg agctggctgt 3840
          ccctggacgt gtccgcagcc ttttaccacc tgcctctgca tccagctgca atgccccatc 3900
          tgctggtggg gtcaagcgga ctgagtcgct acgtcgcccg actgtcctct aactcacgca 3960
          tcattaatca ccagcatggc accatgcaga acctgcacga tagctgttcc cggaatctgt 4020
          acgtgtctct gctgctgctg tataagacat tcggcagaaa actgcacctg tacagccatc 4080
          ctatcattct ggggtttagg aagatcccaa tgggagtggg actgagcccc ttcctgctgg 4140
          cacagtttac ctccgccatt tgctctgtgg tccgccgagc cttcccacac tgtctggctt 4200
          tttcctatat gaacaatgtg gtcctgggcg ccaaatccgt gcagcatctg gagtctctgt 4260
          tcacagctgt cactaacttt ctgctgagcc tggggatcca cctgaaccca aataagacta 4320
          aacgctgggg gtacagcctg aatttcatgg gatatgtgat tggatcctgg gggaccctgc 4380
          cacaggagca catcgtgcag aagatcaagg aatgctttcg gaagctgccc gtcaacagac 4440
          ctatcgactg gaaagtgtgc cagcggattg tcggactgct gggcttcgcc gctcccttta 4500
          cccagtgcgg gtacccagca ctgatgcccc tgtatgcctg tatccagtct aagcaggctt 4560
          tcacctttag tcctacatac aaggcattcc tgtgcaaaca gtacctgaac ctgtatccag 4620
          tggcaaggca gcgacctgga ctgtgccagg tctttgcaaa tgccactcct accggctggg 4680
          ggctggctat cggacatcag cgaatgcggg gcacattcgt ggcccccctg cctattcaca 4740
          ctgctcagct gctggcagcc tgctttgcta gatctaggag tggagcaaag ctgatcggca 4800
          ccgacaatag tgtggtcctg tcaagaaaat acacatcctt cccatggctg ctgggatgtg 4860
          ctgcaaactg gattctgagg ggcaccagct tcgtgtacgt cccctcagcc ctgaatcctg 4920
          ctgacgatcc atcccgcggg cgactgggac tgtaccgacc tctgctgaga ctgcccttca 4980
          ggcctacaac tggccggaca tctctgtatg ccgattcacc aagcgtgccc tcacacctgc 5040
          ctgacagagt ccactttgct tcacccctgc acgtcgcttg gcggcctcca 5090
           <![CDATA[ <210> 33]]>
           <![CDATA[ <211> 5250]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol coding sequence-IRES (EV71)-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 33]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tccataatta 3180
          aaacagctgt gggttgttcc cacccacagg gcccactggg cgctagcact ctgattttac 3240
          gaaatccttg tgcgcctgtt ttatatccct tccctaattc gaaacgtaga agcaatgcgc 3300
          accactgatc aatagtaggc gtaacgcgcc agttacgtca tgatcaagca tatctgttcc 3360
          cccggactga gtatcaatag actgcttacg cggttgaagg agaaaacgtt cgttatccgg 3420
          ctaactactt cgagaagccc agtaacacca tggaagctgc agggtgtttc gctcagcact 3480
          tcccccgtgtagatcaggtc gatgagccac tgcaatccccacaggtgact gtggcagtgg 3540
          ctgcgttggc ggcctgccta tggggagacc cataggacgc tctaatgtgg acatggtgcg 3600
          aagagcctat tgagctagtt agtagtcctc cggcccctga atgcggctaa tcctaactgc 3660
          ggagcacatg ccttcaaccc aggggtagt gtgtcgtaac gggcaactct gcagcggaac 3720
          cgactacttt gggtgtccgt gtttcttttt tattcttata ttggctgctt atggtgacaa 3780
          ttacagaatt gttaccatat agctattgga ttggccatcc ggtgtgtaat agagctgtta 3840
          tatacctatt tgttggcttt gtaccactaa ctttaaaatc tataactacc ctcaacttta 3900
          tattaaccct caatacagtt gaccatgcag tggaactcaa ctactttcca tcagaccctt 3960
          caggacccta gagtgcgcgg gctgtacttt cctgctgggg gaagcagtag cgggaccgtt 4020
          aatccagtac ctacgaccgc ctctcccata tcttctatct ttagtaggac tggtgaccct 4080
          gctcccaaca tggagaatat cacctccggg tttctgggcc cactcctggt ccttcaggcc 4140
          ggattcttcc tgctgactcg aatcctcacc ataccccaga gcctggacag ctggtggaca 4200
          agcctgaatt ttctgggagg aactcctgta tgcctgggac aaaattcaca gtcccctaca 4260
          agtaaccatt caccgacaag ttgtcctccc atctgtcccg gatacaggtg gatgtgcctg 4320
          cgaaggttca tcatcttcct cttcatcctc ttgctttgcc ttattttcct cctggttctt 4380
          ctggactatc agggcatgct gcctgtgtgc ccactgatac caggatctag tactaccagc 4440
          acaggcccgt gtaagacctg tacaattcca gcacaaggga ctagtatgtt cccctcctgc 4500
          tgttgtacta agccaagcga cggtaattgc acgtgtatcc caatcccgtc ctcctgggcg 4560
          tttgccaagt acctctggga atgggcctca gtcagatttt catggcttag tcttttggtg 4620
          ccgttcgtgc agtggtttgt gggactctct ccgactgtgt ggctcagcgt gatctggatg 4680
          atgtggtact ggggcccttc cctttacaac atactgtctc cattccttcc cctgctgcca 4740
          atcttctttt gcctgtgggt ctatattggg tccggagcga ctaacttttc cctgctgaaa 4800
          caagcgggtg acgtcgaaga gaatccggga cctatggcta ggcccctgtg tacacttttg 4860
          ctcctgatgg ccaccctcgc tggagctctg gcaagcggtg gatggagctc aaagccgcgg 4920
          aaagggatgg gtactaacct gtccgtacca aatcccctgg gattttttcc agaccaccaa 4980
          ctcgatcctg cttttggcgc aaattccaac aatcccgact gggactttaa ccctaacaag 5040
          gaccactggc ctgatgccaa caaggtgggg gcaggagcct ttggtcccgg cttcacccca 5100
          ccccatggag gtcttttggg atggtcacca caggcccagg gcatcctgac cactgtccct 5160
          gctgctccac cgccagcttc tactaatcga cagagcggga ggcagccgac ccccctgagt 5220
          ccccccctgc gggataccca ccctcaggca 5250
           <![CDATA[ <210> 34]]>
           <![CDATA[ <211> 5250]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1 coding sequence-IRES (EV71)-core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 34]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcataat taaaacagct gtgggttgtt cccacccaca gggcccactg ggcgctagca 1380
          ctctgatttt acgaaatcct tgtgcgcctg ttttatatcc cttccctaat tcgaaacgta 1440
          gaagcaatgc gcaccactga tcaatagtag gcgtaacgcg ccagttacgt catgatcaag 1500
          catatctgtt cccccggact gagtatcaat agactgctta cgcggttgaa ggagaaaacg 1560
          ttcgttatcc ggctaactac ttcgagaagc ccagtaacac catggaagct gcagggtgtt 1620
          tcgctcagca cttcccccgt gtagatcagg tcgatgagcc actgcaatcc ccacaggtga 1680
          ctgtggcagt ggctgcgttg gcggcctgcc tatggggaga cccataggac gctctaatgt 1740
          ggacatggtg cgaagagcct attgagctag ttagtagtcc tccggcccct gaatgcggct 1800
          aatcctaact gcggagcaca tgccttcaac ccagagggta gtgtgtcgta acgggcaact 1860
          ctgcagcgga accgactact ttgggtgtcc gtgtttcttt tttattctta tattggctgc 1920
          ttatggtgac aattacagaa ttgttaccat atagctattg gattggccat ccggtgtgta 1980
          atagagctgt tatataccta tttgttggct ttgtaccact aactttaaaa tctataacta 2040
          ccctcaactt tatattaacc ctcaatacag ttgaccatgg ctcgacctct gtgtaccctg 2100
          ctactcctga tggctacccct ggctggagct ctggccagcg acatcgaccc ttacaaggag 2160
          ttcggcgcca gcgtggaact gctgtctttt ctgcccagtg atttctttcc ttccattcga 2220
          gacctgctgg ataccgcctc tgctctgtat cgggaagccc tggagagccc agaacactgc 2280
          tccccacacc ataccgctct gcgacaggca atcctgtgct ggggggagct gatgaacctg 2340
          gccacatggg tgggatcgaa tctggaggac cccgcttcac gggaactggt ggtcagctac 2400
          gtgaacgtca atatgggcct gaaaatccgc cagctgctgt ggttccatat tagctgcctg 2460
          acttttggac gagagaccgt gctggaatac ctggtgtcct tcggcgtctg gattcgcact 2520
          ccccctgctt atcgaccacc caacgcacca attctgtcca ccctgcccga gaccacagtg 2580
          gtccgtcgcc gtgggtccgg agcgactaac ttttccctgc tgaaacaagc gggtgacgtc 2640
          gaagagaatc cgggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag catgcccctg tcttaccagc actttagaaa gcttctgctg 2760
          ctggacgatg aagccgggcc tctggaggaa gagctgccaa ggctggcaga cgaggggctg 2820
          aaccggagag tggccgaaga tctgaatctg ggaaacctga acgtgagcat cccttggact 2880
          cataaagtcg gcaacttcac cgggctgtac agctccacag tgcctgtctt caatccagag 2940
          tggcagacac catcctttcc caacattcac ctgcaggagg acatcattaa tagatgcgaa 3000
          cagttcgtgg gacctctgac agtcaacgaa aagaggcgcc tgaaactgat catgcctgcc 3060
          aggttttacc caaatgtgac taagtatctg ccactggata agggcatcaa gccttatactat 3120
          ccagagcacc tggtgaacca ttacttccag actagacact atctgcatac cctgtggaag 3180
          gccggaatcc tgtacaaacg agaaactacc cggagtgctt cattttgtgg ctccccatat 3240
          tcttgggaac aggagctgca gcatggcagg ctggtgttcc agaccagcaa acgccacggg 3300
          gatgagtcct tttgcagcca gtctagtggc atcctgagca gatcccccgt ggggccttgt 3360
          attcagtctc agctgcggaa gagtagactg ggactgcagc cacagcaggg acacctggca 3420
          cgacggcagc agggaaggtc tggcagtatc cgggctagag tgcatcccac aactagaagg 3480
          accttcggcg tcgagccatc aggaagcggc cacatcgaca acagcgcatc aagctcctct 3540
          agttgcctgc atcagtcagc cgtgagaaag gccgcttaca gccacctgtc cacatctaaa 3600
          aggcactcaa gctccgggca tgctgtggag ctgcacaaca tccctccaaa ttctgcacgc 3660
          agtcagtcag aaggacccgt gttcagctgc tggtggctgc agtttcggaa ctcaaagcct 3720
          tgcagcgact attgtctgag ccatattgtg aatctgctgg aggattgggg cccttgtacc 3780
          gagcacgggg aacaccatat caggattcca cgaacaccag cacgagtgac tggaggggtg 3840
          ttcctggtgg acaagaaccc ccacaatact accgagagcc ggctggtggt cgatttcagt 3900
          cagttttcaa gaggcaacac aagggtgtca tggcccaaat tcgccgtccc taatctgcag 3960
          agtctgacta acctgctgtc tagtaatctg agctggctgt ccctggacgt gtccgcagcc 4020
          ttttaccacc tgcctctgca tccagctgca atgccccatc tgctggtggg gtcaagcgga 4080
          ctgagtcgct acgtcgcccg actgtcctct aactcacgca tcattaatca ccagcatggc 4140
          accatgcaga acctgcacga tagctgttcc cggaatctgt acgtgtctct gctgctgctg 4200
          tataagacat tcggcagaaa actgcacctg tacagccatc ctatcattct ggggtttagg 4260
          aagatcccaa tgggagtggg actgagcccc ttcctgctgg cacagtttac ctccgccatt 4320
          tgctctgtgg tccgccgagc cttcccacac tgtctggctt tttcctatat gaacaatgtg 4380
          gtcctgggcg ccaaatccgt gcagcatctg gagtctctgt tcacagctgt cactaacttt 4440
          ctgctgagcc tggggatcca cctgaaccca aataagacta aacgctgggg gtacagcctg 4500
          aatttcatgg gatatgtgat tggatcctgg gggaccctgc cacaggagca catcgtgcag 4560
          aagatcaagg aatgctttcg gaagctgccc gtcaacagac ctatcgactg gaaagtgtgc 4620
          cagcggattg tcggactgct gggcttcgcc gctcccttta cccagtgcgg gtacccagca 4680
          ctgatgcccc tgtatgcctg tatccagtct aagcaggctt tcacctttag tcctacatac 4740
          aaggcattcc tgtgcaaaca gtacctgaac ctgtatccag tggcaaggca gcgacctgga 4800
          ctgtgccagg tctttgcaaa tgccactcct accggctggg ggctggctat cggacatcag 4860
          cgaatgcggg gcacattcgt ggcccccctg cctattcaca ctgctcagct gctggcagcc 4920
          tgctttgcta gatctaggag tggagcaaag ctgatcggca ccgacaatag tgtggtcctg 4980
          tcaagaaaat acacatcctt cccatggctg ctgggatgtg ctgcaaactg gattctgagg 5040
          ggcaccagct tcgtgtacgt cccctcagcc ctgaatcctg ctgacgatcc atcccgcggg 5100
          cgactgggac tgtaccgacc tctgctgaga ctgcccttca ggcctacaac tggccggaca 5160
          tctctgtatg ccgattcacc aagcgtgccc tcacacctgc ctgacagagt ccactttgct 5220
          tcacccctgc acgtcgcttg gcggcctcca 5250
           <![CDATA[ <210> 35]]>
           <![CDATA[ <211> 5090]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core coding sequence-IRES (EMCV)-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 35]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgttaagcc 3180
          cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa ggccggtgtg 3240
          cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg agggcccgga 3300
          aacctggccc tgtcttcttg acgagcattc ctaggggtct ttcccctctc gccaaaggaa 3360
          tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct tgaagacaaa 3420
          caacgtctgt agcgaccctt tgcaggcagc ggaaccccccc acctggcgac aggtgccctct 3480
          gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc cagtgccacg 3540
          ttgtgagttg gatagttgtg gaaagagtca aatggctctc ctcaagcgta ttcaacaagg 3600
          ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg cctcggtgca 3660
          catgctttac atgtgtttag tcgaggttaa aaaacgtcta ggccccccga accacgggga 3720
          cgtggttttc ctttgaaaaa cacgatgata atatggccac aaccatgcag tggaactcaa 3780
          ctactttcca tcagaccctt caggacccta gagtgcgcgg gctgtacttt cctgctgggg 3840
          gaagcagtag cgggaccgtt aatccagtac ctacgaccgc ctctcccata tcttctatct 3900
          ttagtaggac tggtgaccct gctcccaaca tggagaatat cacctccggg tttctgggcc 3960
          cactcctggt ccttcaggcc ggattcttcc tgctgactcg aatcctcacc ataccccaga 4020
          gcctggacag ctggtggaca agcctgaatt ttctgggagg aactcctgta tgcctgggac 4080
          aaaattcaca gtcccctaca agtaaccatt caccgacaag ttgtcctccc atctgtcccg 4140
          gatacaggtg gatgtgcctg cgaaggttca tcatcttcct cttcatcctc ttgctttgcc 4200
          ttattttcct cctggttctt ctggactatc agggcatgct gcctgtgtgc ccactgatac 4260
          caggatctag tactaccagc acaggcccgt gtaagacctg tacaattcca gcacaaggga 4320
          ctagtatgtt cccctcctgc tgttgtacta agccaagcga cggtaattgc acgtgtatcc 4380
          caatcccgtc ctcctgggcg tttgccaagt acctctggga atgggcctca gtcagatttt 4440
          catggcttag tcttttggtg ccgttcgtgc agtggtttgt gggactctct ccgactgtgt 4500
          ggctcagcgt gatctggatg atgtggtact ggggcccttc cctttacaac atactgtctc 4560
          cattccttcc cctgctgcca atcttctttt gcctgtgggt ctatattggg tccggagcga 4620
          ctaacttttc cctgctgaaa caagcgggtg acgtcgaaga gaatccggga cctatggcta 4680
          ggcccctgtg tacacttttg ctcctgatgg ccaccctcgc tggagctctg gcaagcggtg 4740
          gatggagctc aaagccgcgg aaagggatgg gtactaacct gtccgtacca aatcccctgg 4800
          gattttttcc agaccaccaa ctcgatcctg cttttggcgc aaattccaac aatcccgact 4860
          gggactttaa ccctaacaag gaccactggc ctgatgccaa caaggtgggg gcaggagcct 4920
          ttggtcccgg cttcacccca ccccatggag gtcttttggg atggtcacca caggcccagg 4980
          gcatcctgac cactgtccct gctgctccac cgccagcttc tactaatcga cagagcggga 5040
          ggcagccgac ccccctgagt ccccccctgc gggataccca ccctcaggca 5090
           <![CDATA[ <210> 36]]>
           <![CDATA[ <211> 5250]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core coding sequence-IRES (EV71)-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 36]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgttaatta 3180
          aaacagctgt gggttgttcc cacccacagg gcccactggg cgctagcact ctgattttac 3240
          gaaatccttg tgcgcctgtt ttatatccct tccctaattc gaaacgtaga agcaatgcgc 3300
          accactgatc aatagtaggc gtaacgcgcc agttacgtca tgatcaagca tatctgttcc 3360
          cccggactga gtatcaatag actgcttacg cggttgaagg agaaaacgtt cgttatccgg 3420
          ctaactactt cgagaagccc agtaacacca tggaagctgc agggtgtttc gctcagcact 3480
          tcccccgtgtagatcaggtc gatgagccac tgcaatccccacaggtgact gtggcagtgg 3540
          ctgcgttggc ggcctgccta tggggagacc cataggacgc tctaatgtgg acatggtgcg 3600
          aagagcctat tgagctagtt agtagtcctc cggcccctga atgcggctaa tcctaactgc 3660
          ggagcacatg ccttcaaccc aggggtagt gtgtcgtaac gggcaactct gcagcggaac 3720
          cgactacttt gggtgtccgt gtttcttttt tattcttata ttggctgctt atggtgacaa 3780
          ttacagaatt gttaccatat agctattgga ttggccatcc ggtgtgtaat agagctgtta 3840
          tatacctatt tgttggcttt gtaccactaa ctttaaaatc tataactacc ctcaacttta 3900
          tattaaccct caatacagtt gaccatgcag tggaactcaa ctactttcca tcagaccctt 3960
          caggacccta gagtgcgcgg gctgtacttt cctgctgggg gaagcagtag cgggaccgtt 4020
          aatccagtac ctacgaccgc ctctcccata tcttctatct ttagtaggac tggtgaccct 4080
          gctcccaaca tggagaatat cacctccggg tttctgggcc cactcctggt ccttcaggcc 4140
          ggattcttcc tgctgactcg aatcctcacc ataccccaga gcctggacag ctggtggaca 4200
          agcctgaatt ttctgggagg aactcctgta tgcctgggac aaaattcaca gtcccctaca 4260
          agtaaccatt caccgacaag ttgtcctccc atctgtcccg gatacaggtg gatgtgcctg 4320
          cgaaggttca tcatcttcct cttcatcctc ttgctttgcc ttattttcct cctggttctt 4380
          ctggactatc agggcatgct gcctgtgtgc ccactgatac caggatctag tactaccagc 4440
          acaggcccgt gtaagacctg tacaattcca gcacaaggga ctagtatgtt cccctcctgc 4500
          tgttgtacta agccaagcga cggtaattgc acgtgtatcc caatcccgtc ctcctgggcg 4560
          tttgccaagt acctctggga atgggcctca gtcagatttt catggcttag tcttttggtg 4620
          ccgttcgtgc agtggtttgt gggactctct ccgactgtgt ggctcagcgt gatctggatg 4680
          atgtggtact ggggcccttc cctttacaac atactgtctc cattccttcc cctgctgcca 4740
          atcttctttt gcctgtgggt ctatattggg tccggagcga ctaacttttc cctgctgaaa 4800
          caagcgggtg acgtcgaaga gaatccggga cctatggcta ggcccctgtg tacacttttg 4860
          ctcctgatgg ccaccctcgc tggagctctg gcaagcggtg gatggagctc aaagccgcgg 4920
          aaagggatgg gtactaacct gtccgtacca aatcccctgg gattttttcc agaccaccaa 4980
          ctcgatcctg cttttggcgc aaattccaac aatcccgact gggactttaa ccctaacaag 5040
          gaccactggc ctgatgccaa caaggtgggg gcaggagcct ttggtcccgg cttcacccca 5100
          ccccatggag gtcttttggg atggtcacca caggcccagg gcatcctgac cactgtccct 5160
          gctgctccac cgccagcttc tactaatcga cagagcggga ggcagccgac ccccctgagt 5220
          ccccccctgc gggataccca ccctcaggca 5250
           <![CDATA[ <210> 37]]>
           <![CDATA[ <211> 5090]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1 coding sequence-IRES (EMCV)-Pol-2A-core coding sequence]]>
           <![CDATA[ <400> 37]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcataag cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat 1380
          aaggccggtg tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg 1440
          tgagggcccg gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc 1500
          tcgccaaagg aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt 1560
          cttgaagaca aacaacgtct gtagcgaccc tttgcaggca gcggaaccccc ccacctggcg 1620
          acaggtgcct ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac 1680
          cccagtgcca cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg 1740
          tattcaacaa ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg 1800
          ggcctcggtg cacatgcttt acatgtgttt agtcgaggtt aaaaaacgtc taggcccccc 1860
          gaaccacggg gacgtggttt tcctttgaaa aacacgatga taatatggcc acaaccatgg 1920
          ctcgacctct gtgtaccctg ctactcctga tggctacccct ggctggagct ctggccagca 1980
          tgcccctgtc ttaccagcac tttagaaagc ttctgctgct ggacgatgaa gccgggcctc 2040
          tggaggaaga gctgccaagg ctggcagacg aggggctgaa ccggagagtg gccgaagatc 2100
          tgaatctggg aaacctgaac gtgagcatcc cttggactca taaagtcggc aacttcaccg 2160
          ggctgtacag ctccacagtg cctgtcttca atccagagtg gcagacacca tcctttccca 2220
          acattcacct gcaggaggac atcattaata gatgcgaaca gttcgtggga cctctgacag 2280
          tcaacgaaaa gaggcgcctg aaactgatca tgcctgccag gttttaccca aatgtgacta 2340
          agtatctgcc actggataag ggcatcaagc cttactatcc agagcacctg gtgaaccatt 2400
          acttccagac tagacactat ctgcataccc tgtggaaggc cggaatcctg tacaaacgag 2460
          aaactacccg gagtgcttca ttttgtggct ccccatattc ttgggaacag gagctgcagc 2520
          atggcaggct ggtgttccag accagcaaac gccacgggga tgagtccttt tgcagccagt 2580
          ctagtggcat cctgagcaga tcccccgtgg ggccttgtat tcagtctcag ctgcggaaga 2640
          gtagactggg actgcagcca cagcagggac acctggcacg acggcagcag ggaaggtctg 2700
          gcagtatccg ggctagagtg catcccacaa ctagaaggac cttcggcgtc gagccatcag 2760
          gaagcggcca catcgacaac agcgcatcaa gctcctctag ttgcctgcat cagtcagccg 2820
          tgagaaaggc cgcttacagc cacctgtcca catctaaaag gcactcaagc tccgggcatg 2880
          ctgtggagct gcacaacatc cctccaaatt ctgcacgcag tcagtcagaa ggacccgtgt 2940
          tcagctgctg gtggctgcag tttcggaact caaagccttg cagcgactat tgtctgagcc 3000
          atattgtgaa tctgctggag gattggggcc cttgtaccga gcacggggaa caccatatca 3060
          ggattccacg aacaccagca cgagtgactg gaggggtgtt cctggtggac aagaaccccc 3120
          acaatactac cgagagccgg ctggtggtcg atttcagtca gttttcaaga ggcaacacaa 3180
          gggtgtcatg gcccaaattc gccgtcccta atctgcagag tctgactaac ctgctgtcta 3240
          gtaatctgag ctggctgtcc ctggacgtgt ccgcagcctt ttaccacctg cctctgcatc 3300
          cagctgcaat gccccatctg ctggtggggt caagcggact gagtcgctac gtcgcccgac 3360
          tgtcctctaa ctcacgcatc attaatcacc agcatggcac catgcagaac ctgcacgata 3420
          gctgttcccg gaatctgtac gtgtctctgc tgctgctgta taagacattc ggcagaaaac 3480
          tgcacctgta cagccatcct atcattctgg ggtttaggaa gatcccaatg ggagtgggac 3540
          tgagcccctt cctgctggca cagtttacct ccgccatttg ctctgtggtc cgccgagcct 3600
          tccccacactg tctggctttt tcctatatga acaatgtggt cctgggcgcc aaatccgtgc 3660
          agcatctgga gtctctgttc acagctgtca ctaactttct gctgagcctg gggatccacc 3720
          tgaacccaaa taagactaaa cgctgggggt acagcctgaa tttcatggga tatgtgattg 3780
          gatcctgggg gaccctgcca caggagcaca tcgtgcagaa gatcaaggaa tgctttcgga 3840
          agctgcccgt caacagacct atcgactgga aagtgtgcca gcggattgtc ggactgctgg 3900
          gcttcgccgc tccctttacc cagtgcgggt accccagcact gatgcccctg tatgcctgta 3960
          tccagtctaa gcaggctttc acctttagtc ctacatacaa ggcattcctg tgcaaacagt 4020
          acctgaacct gtatccagtg gcaaggcagc gacctggact gtgccaggtc tttgcaaatg 4080
          ccactcctac cggctggggg ctggctatcg gacatcagcg aatgcggggc aattcgtgg 4140
          cccccctgcc tattcacact gctcagctgc tggcagcctg ctttgctaga tctaggagtg 4200
          gagcaaagct gatcggcacc gacaatagtg tggtcctgtc aagaaaatac acatccttcc 4260
          catggctgct gggatgtgct gcaaactgga ttctgagggg caccagcttc gtgtacgtcc 4320
          cctcagccct gaatcctgct gacgatccat cccgcgggcg actgggactg taccgacctc 4380
          tgctgagact gcccttcagg cctacaactg gccggacatc tctgtatgcc gattcaccaa 4440
          gcgtgccctc acacctgcct gacagagtcc actttgcttc acccctgcac gtcgcttggc 4500
          ggcctccagg gtccggagcg actaactttt ccctgctgaa acaagcgggt gacgtcgaag 4560
          agaatccggg acctatggct cgacctctgt gtaccctgct actcctgatg gctaccctgg 4620
          ctggagctct ggccagcgac atcgaccctt acaaggagtt cggcgccagc gtggaactgc 4680
          tgtcttttct gcccagtgat ttctttcctt ccattcgaga cctgctggat accgcctctg 4740
          ctctgtatcg ggaagccctg gagagccccag aacactgctc cccacaccat accgctctgc 4800
          gacaggcaat cctgtgctgg ggggagctga tgaacctggc cacatgggtg ggatcgaatc 4860
          tggaggaccc cgcttcacgg gaactggtgg tcagctacgt gaacgtcaat atgggcctga 4920
          aaatccgcca gctgctgtgg ttccatatta gctgcctgac ttttggacga gagaccgtgc 4980
          tggaatacct ggtgtccttc ggcgtctgga ttcgcactcc ccctgcttat cgaccaccca 5040
          acgcaccaat tctgtccacc ctgcccgaga ccacagtggt ccgtcgccgt 5090
           <![CDATA[ <210> 38]]>
           <![CDATA[ <211> 5250]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1 coding sequence-IRES (EV71)-Pol-2A-core coding sequence]]>
           <![CDATA[ <400> 38]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcataat taaaacagct gtgggttgtt cccacccaca gggcccactg ggcgctagca 1380
          ctctgatttt acgaaatcct tgtgcgcctg ttttatatcc cttccctaat tcgaaacgta 1440
          gaagcaatgc gcaccactga tcaatagtag gcgtaacgcg ccagttacgt catgatcaag 1500
          catatctgtt cccccggact gagtatcaat agactgctta cgcggttgaa ggagaaaacg 1560
          ttcgttatcc ggctaactac ttcgagaagc ccagtaacac catggaagct gcagggtgtt 1620
          tcgctcagca cttcccccgt gtagatcagg tcgatgagcc actgcaatcc ccacaggtga 1680
          ctgtggcagt ggctgcgttg gcggcctgcc tatggggaga cccataggac gctctaatgt 1740
          ggacatggtg cgaagagcct attgagctag ttagtagtcc tccggcccct gaatgcggct 1800
          aatcctaact gcggagcaca tgccttcaac ccagagggta gtgtgtcgta acgggcaact 1860
          ctgcagcgga accgactact ttgggtgtcc gtgtttcttt tttattctta tattggctgc 1920
          ttatggtgac aattacagaa ttgttaccat atagctattg gattggccat ccggtgtgta 1980
          atagagctgt tatataccta tttgttggct ttgtaccact aactttaaaa tctataacta 2040
          ccctcaactt tatattaacc ctcaatacag ttgaccatgg ctcgacctct gtgtaccctg 2100
          ctactcctga tggctacccct ggctggagct ctggccagca tgcccctgtc ttaccagcac 2160
          tttagaaagc ttctgctgct ggacgatgaa gccgggcctc tggaggaaga gctgccaagg 2220
          ctggcagacg aggggctgaa ccggagagtg gccgaagatc tgaatctggg aaacctgaac 2280
          gtgagcatcc cttggactca taaagtcggc aacttcaccg ggctgtacag ctccacagtg 2340
          cctgtcttca atccagagtg gcagacacca tcctttccca aattcacct gcaggaggac 2400
          atcattaata gatgcgaaca gttcgtggga cctctgacag tcaacgaaaa gaggcgcctg 2460
          aaactgatca tgcctgccag gttttaccca aatgtgacta agtatctgcc actggataag 2520
          ggcatcaagc cttactatcc agagcacctg gtgaaccatt acttccagac tagacactat 2580
          ctgcataccc tgtggaaggc cggaatcctg tacaaacgag aaactacccg gagtgcttca 2640
          ttttgtggct ccccatattc ttgggaacag gagctgcagc atggcaggct ggtgttccag 2700
          accagcaaac gccacgggga tgagtccttt tgcagccagt ctagtggcat cctgagcaga 2760
          tcccccgtgg ggccttgtat tcagtctcag ctgcggaaga gtagactggg actgcagcca 2820
          cagcagggac acctggcacg acggcagcag ggaaggtctg gcagtatccg ggctagagtg 2880
          catcccacaa ctagaaggac cttcggcgtc gagccatcag gaagcggcca catcgacaac 2940
          agcgcatcaa gctcctctag ttgcctgcat cagtcagccg tgagaaaggc cgcttacagc 3000
          cacctgtcca catctaaaag gcactcaagc tccgggcatg ctgtggagct gcacaacatc 3060
          cctccaaatt ctgcacgcag tcagtcagaa ggacccgtgt tcagctgctg gtggctgcag 3120
          tttcggaact caaagccttg cagcgactat tgtctgagcc atattgtgaa tctgctggag 3180
          gattggggcc cttgtaccga gcacggggaa caccatatca ggattccacg aacaccagca 3240
          cgagtgactg gaggggtgtt cctggtggac aagaaccccc acaatactac cgagagccgg 3300
          ctggtggtcg atttcagtca gttttcaaga ggcaacacaa gggtgtcatg gcccaaattc 3360
          gccgtcccta atctgcagag tctgactaac ctgctgtcta gtaatctgag ctggctgtcc 3420
          ctggacgtgt ccgcagcctt ttaccacctg cctctgcatc cagctgcaat gccccatctg 3480
          ctggtggggt caagcggact gagtcgctac gtcgcccgac tgtcctctaa ctcacgcatc 3540
          attaatcacc agcatggcac catgcagaac ctgcacgata gctgttcccg gaatctgtac 3600
          gtgtctctgc tgctgctgta taagacattc ggcagaaaac tgcacctgta cagccatcct 3660
          atcattctgg ggtttaggaa gatcccaatg ggagtgggac tgagcccctt cctgctggca 3720
          cagtttacct ccgccatttg ctctgtggtc cgccgagcct tcccaacactg tctggctttt 3780
          tcctatatga acaatgtggt cctgggcgcc aaatccgtgc agcatctgga gtctctgttc 3840
          acagctgtca ctaactttct gctgagcctg gggatccacc tgaacccaaa taagactaaa 3900
          cgctgggggt acagcctgaa tttcatggga tatgtgattg gatcctgggg gaccctgcca 3960
          caggagcaca tcgtgcagaa gatcaaggaa tgctttcgga agctgcccgt caacagacct 4020
          atcgactgga aagtgtgcca gcggattgtc ggactgctgg gcttcgccgc tccctttacc 4080
          cagtgcgggt acccagcact gatgcccctg tatgcctgta tccagtctaa gcaggctttc 4140
          acctttagtc ctacatacaa ggcattcctg tgcaaacagt acctgaacct gtatccagtg 4200
          gcaaggcagc gacctggact gtgccaggtc tttgcaaatg ccactcctac cggctggggg 4260
          ctggctatcg gacatcagcg aatgcggggc aattcgtgg cccccctgcc tattcacact 4320
          gctcagctgc tggcagcctg ctttgctaga tctaggagtg gagcaaagct gatcggcacc 4380
          gacaatagtg tggtcctgtc aagaaaatac acatccttcc catggctgct gggatgtgct 4440
          gcaaactgga ttctgagggg caccagcttc gtgtacgtcc cctcagccct gaatcctgct 4500
          gacgatccat cccgcgggcg actgggactg taccgacctc tgctgagact gcccttcagg 4560
          cctacaactg gccggacatc tctgtatgcc gattcaccaa gcgtgccctc acacctgcct 4620
          gacagagtcc actttgcttc acccctgcac gtcgcttggc ggcctccagg gtccggagcg 4680
          actaactttt ccctgctgaa acaagcgggt gacgtcgaag agaatccggg acctatggct 4740
          cgacctctgt gtaccctgct actcctgatg gctaccctgg ctggagctct ggccagcgac 4800
          atcgaccctt acaaggagtt cggcgccagc gtggaactgc tgtcttttct gcccagtgat 4860
          ttctttcctt ccattcgaga cctgctggat accgcctctg ctctgtatcg ggaagccctg 4920
          gagagcccag aacactgctc cccacaccat accgctctgc gacaggcaat cctgtgctgg 4980
          ggggagctga tgaacctggc cacatgggtg ggatcgaatc tggaggaccc cgcttcacgg 5040
          gaactggtgg tcagctacgt gaacgtcaat atgggcctga aaatccgcca gctgctgtgg 5100
          ttccatatta gctgcctgac ttttggacga gagaccgtgc tggaatacct ggtgtccttc 5160
          ggcgtctgga ttcgcactcc ccctgcttat cgaccaccca acgcaccaat tctgtccacc 5220
          ctgcccgaga ccacagtggt ccgtcgccgt 5250
           <![CDATA[ <210> 39]]>
           <![CDATA[ <211> 4083]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol-2A-PreS2.S coding sequence]]>
           <![CDATA[ <400> 39]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tccaggatca 3180
          ggcgctacga attttagcct tctgaagcaa gcgggagacg ttgaagaaaa cccagggcct 3240
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 3300
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 3360
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 3420
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 3480
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 3540
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 3600
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 3660
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 3720
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 3780
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 3840
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 3900
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 3960
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 4020
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 4080
          att 4083
           <![CDATA[ <210> 40]]>
           <![CDATA[ <211> 4083]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core-2A-PreS2.S coding sequence]]>
           <![CDATA[ <400> 40]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgtggatca 3180
          ggcgctacga attttagcct tctgaagcaa gcgggagacg ttgaagaaaa cccagggcct 3240
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 3300
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 3360
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 3420
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 3480
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 3540
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 3600
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 3660
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 3720
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 3780
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 3840
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 3900
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 3960
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 4020
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 4080
          att 4083
           <![CDATA[ <210> 41]]>
           <![CDATA[ <211> 4083]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 41]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctcgacc tctgtgtacc ctgctactcc tgatggctac cctggctgga 960
          gctctggcca gcgacatcga cccttacaag gagttcggcg ccagcgtgga actgctgtct 1020
          tttctgccca gtgatttctt tccttccatt cgagacctgc tggataccgc ctctgctctg 1080
          tatcgggaag ccctggagag cccagaacac tgctccccac accataccgc tctgcgacag 1140
          gcaatcctgt gctgggggga gctgatgaac ctggccacat gggtgggatc gaatctggag 1200
          gaccccgctt cacgggaact ggtggtcagc tacgtgaacg tcaatatggg cctgaaaatc 1260
          cgccagctgc tgtggttcca tattagctgc ctgacttttg gacgagagac cgtgctggaa 1320
          tacctggtgt ccttcggcgt ctggattcgc actccccctg cttatcgacc acccaacgca 1380
          ccaattctgt ccaccctgcc cgagaccaca gtggtccgtc gccgtggatc aggcgctacg 1440
          aattttagcc ttctgaagca agcgggagac gttgaagaaa acccagggcc tatggctcga 1500
          cctctgtgta ccctgctact cctgatggct accctggctg gagctctggc cagcatgccc 1560
          ctgtcttacc agcactttag aaagcttctg ctgctggacg atgaagccgg gcctctggag 1620
          gaagagctgc caaggctggc agacgagggg ctgaaccgga gagtggccga agatctgaat 1680
          ctgggaaacc tgaacgtgag catcccttgg actcataaag tcggcaactt caccggggctg 1740
          tacagctcca cagtgcctgt cttcaatcca gagtggcaga caccatcctt tcccaacatt 1800
          cacctgcagg aggacatcat taatagatgc gaacagttcg tgggacctct gacagtcaac 1860
          gaaaagaggc gcctgaaact gatcatgcct gccaggtttt accccaaatgt gactaagtat 1920
          ctgccactgg ataagggcat caagccttac tatccagagc acctggtgaa ccattacttc 1980
          cagactagac actatctgca taccctgtgg aaggccggaa tcctgtacaa acgagaaact 2040
          acccggagtg cttcattttg tggctcccca tattcttggg aacaggagct gcagcatggc 2100
          aggctggtgt tccagaccag caaacgccac ggggatgagt ccttttgcag ccagtctagt 2160
          ggcatcctga gcagatcccc cgtggggcct tgtattcagt ctcagctgcg gaagagtaga 2220
          ctgggactgc agccacagca gggacacctg gcacgacggc agcagggaag gtctggcagt 2280
          atccgggcta gagtgcatcc cacaactaga aggaccttcg gcgtcgagcc atcaggaagc 2340
          ggccacatcg acaacagcgc atcaagctcc tctagttgcc tgcatcagtc agccgtgaga 2400
          aaggccgctt acagccacct gtccacatct aaaaggcact caagctccgg gcatgctgtg 2460
          gagctgcaca acatccctcc aaattctgca cgcagtcagt cagaaggacc cgtgttcagc 2520
          tgctggtggc tgcagtttcg gaactcaaag ccttgcagcg actattgtct gagccatatt 2580
          gtgaatctgc tggaggattg gggcccttgt accgagcacg gggaaccacca tatcaggatt 2640
          ccacgaacac cagcacgagt gactggaggg gtgttcctgg tggacaagaa cccccacaat 2700
          actaccgaga gccggctggt ggtcgatttc agtcagtttt caagaggcaa cacaagggtg 2760
          tcatggccca aattcgccgt ccctaatctg cagagtctga ctaacctgct gtctagtaat 2820
          ctgagctggc tgtccctgga cgtgtccgca gccttttacc acctgcctct gcatccagct 2880
          gcaatgcccc atctgctggt ggggtcaagc ggactgagtc gctacgtcgc ccgactgtcc 2940
          tctaactcac gcatcattaa tcaccagcat ggcaccatgc agaacctgca cgatagctgt 3000
          tcccggaatc tgtacgtgtc tctgctgctg ctgtataaga cattcggcag aaaactgcac 3060
          ctgtacagcc atcctatcat tctggggttt aggaagatcc caatgggagt gggactgagc 3120
          cccttcctgc tggcacagtt tacctccgcc atttgctctg tggtccgccg agccttccca 3180
          cactgtctgg ctttttccta tatgaacaat gtggtcctgg gcgccaaatc cgtgcagcat 3240
          ctggagtctc tgttcacagc tgtcactaac tttctgctga gcctggggat ccacctgaac 3300
          ccaaataaga ctaaacgctg ggggtacagc ctgaatttca tgggatatgt gattggatcc 3360
          tgggggaccc tgccacagga gcacatcgtg cagaagatca aggaatgctt tcggaagctg 3420
          cccgtcaaca gacctatcga ctggaaagtg tgccagcgga ttgtcggact gctgggcttc 3480
          gccgctccct ttacccagtg cgggtaccca gcactgatgc ccctgtatgc ctgtatccag 3540
          tctaagcagg ctttcacctt tagtcctaca tacaaggcat tcctgtgcaa acagtacctg 3600
          aacctgtatc cagtggcaag gcagcgacct ggactgtgcc aggtctttgc aaatgccact 3660
          cctaccggct gggggctggc tatcggacat cagcgaatgc ggggcacatt cgtggccccc 3720
          ctgcctattc acactgctca gctgctggca gcctgctttg ctagatctag gagtggagca 3780
          aagctgatcg gcaccgacaa tagtgtggtc ctgtcaagaa aatacacatc cttcccatgg 3840
          ctgctgggat gtgctgcaaa ctggattctg aggggcacca gcttcgtgta cgtcccctca 3900
          gccctgaatc ctgctgacga tccatcccgc gggcgactgg gactgtaccg acctctgctg 3960
          agactgccct tcaggcctac aactggccgg acatctctgt atgccgattc accaagcgtg 4020
          ccctcacacc tgcctgacag agtccacttt gcttcacccc tgcacgtcgc ttggcggcct 4080
          cca 4083
           <![CDATA[ <210> 42]]>
           <![CDATA[ <211> 4083]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-Pol-2A-core coding sequence]]>
           <![CDATA[ <400> 42]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctcgacc tctgtgtacc ctgctactcc tgatggctac cctggctgga 960
          gctctggcca gcatgcccct gtcttaccag cactttagaa agcttctgct gctggacgat 1020
          gaagccggggc ctctggagga agagctgcca aggctggcag acgaggggct gaaccggaga 1080
          gtggccgaag atctgaatct gggaaacctg aacgtgagca tcccttggac tcataaagtc 1140
          ggcaacttca ccgggctgta cagctccaca gtgcctgtct tcaatccaga gtggcagaca 1200
          ccatcctttc ccaacattca cctgcaggag gacatcatta atagatgcga acagttcgtg 1260
          ggacctctga cagtcaacga aaagaggcgc ctgaaactga tcatgcctgc caggttttac 1320
          ccaaatgtga ctaagtatct gccactggat aagggcatca agccttacta tccagagcac 1380
          ctggtgaacc attacktcca gactagacac tatctgcata ccctgtggaa ggccggaatc 1440
          ctgtacaaac gagaaactac ccggagtgct tcattttgtg gctccccata ttcttgggaa 1500
          caggagctgc agcatggcag gctggtgttc cagaccagca aacgccacgg ggatgagtcc 1560
          ttttgcagcc agtctagtgg catcctgagc agatcccccg tggggccttg tattcagtct 1620
          cagctgcgga agagtagact gggactgcag ccacagcagg gacacctggc acgacggcag 1680
          cagggaaggt ctggcagtat ccgggctaga gtgcatccca caactagaag gaccttcggc 1740
          gtcgagccat caggaagcgg ccacatcgac aacagcgcat caagctcctc tagttgcctg 1800
          catcagtcag ccgtgagaaa ggccgcttac agccacctgt ccacatctaa aaggcactca 1860
          agctccgggc atgctgtgga gctgcacaac atccctccaa attctgcacg cagtcagtca 1920
          gaaggacccg tgttcagctg ctggtggctg cagtttcgga actcaaagcc ttgcagcgac 1980
          tattgtctga gccatattgt gaatctgctg gaggattggg gcccttgtac cgagcacggg 2040
          gaacaccata tcaggattcc acgaacacca gcacgagtga ctggaggggt gttcctggtg 2100
          gacaagaacc cccacaatac taccgagagc cggctggtgg tcgatttcag tcagttttca 2160
          agaggcaaca caagggtgtc atggcccaaa ttcgccgtcc ctaatctgca gagtctgact 2220
          aacctgctgt ctagtaatct gagctggctg tccctggacg tgtccgcagc cttttaccac 2280
          ctgcctctgc atccagctgc aatgccccat ctgctggtgg ggtcaagcgg actgagtcgc 2340
          tacgtcgccc gactgtcctc taactcacgc atcattaatc accagcatgg caccatgcag 2400
          aacctgcacg atagctgttc ccggaatctg tacgtgtctc tgctgctgct gtataagaca 2460
          ttcggcagaa aactgcacct gtacagccat cctatcattc tggggtttag gaagatccca 2520
          atgggagtgg gactgagccc cttcctgctg gcacagttta cctccgccat ttgctctgtg 2580
          gtccgccgag ccttcccaca ctgtctggct ttttcctata tgaacaatgt ggtcctgggc 2640
          gccaaatccg tgcagcatct ggagtctctg ttcacagctg tcactaactt tctgctgagc 2700
          ctggggatcc acctgaaccc aaataagact aaacgctggg ggtacagcct gaatttcatg 2760
          ggatatgtga ttggatcctg ggggaccctg ccacaggagc acatcgtgca gaagatcaag 2820
          gaatgctttc ggaagctgcc cgtcaacaga cctatcgact ggaaagtgtg ccagcggatt 2880
          gtcggactgc tgggcttcgc cgctcccttt accccagtgcg ggtacccagc actgatgccc 2940
          ctgtatgcct gtatccagtc taagcaggct ttcaccttta gtcctacata caaggcattc 3000
          ctgtgcaaac agtacctgaa cctgtatcca gtggcaaggc agcgacctgg actgtgccag 3060
          gtctttgcaa atgccactcc taccggctgg gggctggcta tcggacatca gcgaatgcgg 3120
          ggcacattcg tggcccccct gcctattcac actgctcagc tgctggcagc ctgctttgct 3180
          agatctagga gtggagcaaa gctgatcggc accgacaata gtgtggtcct gtcaagaaaa 3240
          tacacatcct tcccatggct gctgggatgt gctgcaaact ggattctgag gggcaccagc 3300
          ttcgtgtacg tcccctcagc cctgaatcct gctgacgatc catcccgcgg gcgactggga 3360
          ctgtaccgac ctctgctgag actgcccttc aggcctacaa ctggccggac atctctgtat 3420
          gccgattcac caagcgtgcc ctcacacctg cctgacagag tccactttgc ttcacccctg 3480
          cacgtcgctt ggcggcctcc aggatcaggc gctacgaatt ttagccttct gaagcaagcg 3540
          ggagacgttg aagaaaaccc agggcctatg gctcgacctc tgtgtacccct gctactcctg 3600
          atggctaccc tggctggagc tctggccagc gacatcgacc cttacaagga gttcggcgcc 3660
          agcgtggaac tgctgtcttt tctgcccagt gatttctttc cttccattcg agacctgctg 3720
          gataccgcct ctgctctgta tcgggaagcc ctggagagcc cagaacactg ctccccaacac 3780
          cataccgctc tgcgacaggc aatcctgtgc tggggggagc tgatgaacct ggccacatgg 3840
          gtgggatcga atctggagga ccccgcttca cgggaactgg tggtcagcta cgtgaacgtc 3900
          aatatgggcc tgaaaatccg ccagctgctg tggttccata ttagctgcct gacttttgga 3960
          cgagagaccg tgctggaata cctggtgtcc ttcggcgtct ggattcgcac tccccctgct 4020
          tatcgaccac ccaacgcacc aattctgtcc accctgcccg agaccacagt ggtccgtcgc 4080
          cgt 4083
           <![CDATA[ <210> 43]]>
           <![CDATA[ <211> 4607]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol coding sequence-IRES (EMCV)-PreS2.S coding sequence]]>
           <![CDATA[ <400> 43]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tccataagcc 3180
          cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa ggccggtgtg 3240
          cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg agggcccgga 3300
          aacctggccc tgtcttcttg acgagcattc ctaggggtct ttcccctctc gccaaaggaa 3360
          tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct tgaagacaaa 3420
          caacgtctgt agcgaccctt tgcaggcagc ggaaccccccc acctggcgac aggtgccctct 3480
          gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc cagtgccacg 3540
          ttgtgagttg gatagttgtg gaaagagtca aatggctctc ctcaagcgta ttcaacaagg 3600
          ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg cctcggtgca 3660
          catgctttac atgtgtttag tcgaggttaa aaaacgtcta ggccccccga accacgggga 3720
          cgtggttttc ctttgaaaaa cacgatgata atatggccac aaccatgcag tggaactcaa 3780
          ctactttcca tcagaccctt caggacccta gagtgcgcgg gctgtacttt cctgctgggg 3840
          gaagcagtag cgggaccgtt aatccagtac ctacgaccgc ctctcccata tcttctatct 3900
          ttagtaggac tggtgaccct gctcccaaca tggagaatat cacctccggg tttctgggcc 3960
          cactcctggt ccttcaggcc ggattcttcc tgctgactcg aatcctcacc ataccccaga 4020
          gcctggacag ctggtggaca agcctgaatt ttctgggagg aactcctgta tgcctgggac 4080
          aaaattcaca gtcccctaca agtaaccatt caccgacaag ttgtcctccc atctgtcccg 4140
          gatacaggtg gatgtgcctg cgaaggttca tcatcttcct cttcatcctc ttgctttgcc 4200
          ttattttcct cctggttctt ctggactatc agggcatgct gcctgtgtgc ccactgatac 4260
          caggatctag tactaccagc acaggcccgt gtaagacctg tacaattcca gcacaaggga 4320
          ctagtatgtt cccctcctgc tgttgtacta agccaagcga cggtaattgc acgtgtatcc 4380
          caatcccgtc ctcctgggcg tttgccaagt acctctggga atgggcctca gtcagatttt 4440
          catggcttag tcttttggtg ccgttcgtgc agtggtttgt gggactctct ccgactgtgt 4500
          ggctcagcgt gatctggatg atgtggtact ggggcccttc cctttacaac atactgtctc 4560
          cattccttcc cctgctgcca atcttctttt gcctgtgggt ctatatt 4607
           <![CDATA[ <210> 44]]>
           <![CDATA[ <211> 4607]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S coding sequence-IRES (EMCV)-core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 44]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaagccc ctctccctcc ccccccccta acgttactgg ccgaagccgc ttggaataag 900
          gccggtgtgc gtttgtctat atgttatttt ccaccacatatt gccgtctttt ggcaatgtga 960
          gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt tcccctctcg 1020
          ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg gaagcttctt 1080
          gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca cctggcgaca 1140
          ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg gcacaaccccc 1200
          agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc tcaagcgtat 1260
          tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggatct gatctggggc 1320
          ctcggtgcac atgctttaca tgtgtttagt cgaggttaaa aaacgtctag gccccccgaa 1380
          ccacggggac gtggttttcc tttgaaaaac acgatgataa tatggccaca accatggctc 1440
          gacctctgtg taccctgcta ctcctgatgg ctaccctggc tggagctctg gccagcgaca 1500
          tcgaccctta caaggagttc ggcgccagcg tggaactgct gtcttttctg cccagtgatt 1560
          tctttccttc cattcgagac ctgctggata ccgcctctgc tctgtatcgg gaagccctgg 1620
          agagcccaga acactgctcc ccacaccata ccgctctgcg acaggcaatc ctgtgctggg 1680
          gggagctgat gaacctggcc acatgggtgg gatcgaatct ggaggacccc gcttcacggg 1740
          aactggtggt cagctacgtg aacgtcaata tgggcctgaa aatccgccag ctgctgtggt 1800
          tccatattag ctgcctgact tttggacgag agaccgtgct ggaatacctg gtgtccttcg 1860
          gcgtctggat tcgcactccc cctgcttatc gaccaccaa cgcaccaatt ctgtccaccc 1920
          tgcccgagac cacagtggtc cgtcgccgtg gatcaggcgc tacgaatttt agccttctga 1980
          agcaagcggg agacgttgaa gaaaacccag ggcctatggc tcgacctctg tgtaccctgc 2040
          tactcctgat ggctaccctg gctggagctc tggccagcat gcccctgtct taccagcact 2100
          ttagaaagct tctgctgctg gacgatgaag ccgggcctct ggaggaagag ctgccaaggc 2160
          tggcagacga ggggctgaac cggagagtgg ccgaagatct gaatctggga aacctgaacg 2220
          tgagcatccc ttggactcat aaagtcggca acttcaccgg gctgtacagc tccacagtgc 2280
          ctgtcttcaa tccagagtgg cagacaccat cctttcccaa cattcacctg caggaggaca 2340
          tcattaatag atgcgaacag ttcgtgggac ctctgacagt caacgaaaag aggcgcctga 2400
          aactgatcat gcctgccagg ttttacccaa atgtgactaa gtatctgcca ctggataagg 2460
          gcatcaagcc ttactatcca gagcacctgg tgaaccatta cttccagact agacactatc 2520
          tgcataccct gtggaaggcc ggaatcctgt acaaacgaga aactacccgg agtgcttcat 2580
          tttgtggctc cccatattct tgggaacagg agctgcagca tggcaggctg gtgttccaga 2640
          ccagcaaacg ccacggggat gagtcctttt gcagccagtc tagtggcatc ctgagcagat 2700
          cccccgtggg gccttgtatt cagtctcagc tgcggaagag tagactggga ctgcagccac 2760
          agcagggaca cctggcacga cggcagcagg gaaggtctgg cagtatccgg gctagagtgc 2820
          atcccacaac tagaaggacc ttcggcgtcg agccatcagg aagcggccac atcgacaaca 2880
          gcgcatcaag ctcctctagt tgcctgcatc agtcagccgt gagaaaggcc gcttacagcc 2940
          acctgtccac atctaaaagg cactcaagct ccgggcatgc tgtggagctg cacaacatcc 3000
          ctccaaattc tgcacgcagt cagtcagaag gacccgtgtt cagctgctgg tggctgcagt 3060
          ttcggaactc aaagccttgc agcgactatt gtctgagcca tattgtgaat ctgctggagg 3120
          attggggccc ttgtaccgag cacggggaac accatatcag gattccacga acaccagcac 3180
          gagtgactgg aggggtgttc ctggtggaca agaaccccca caatactacc gagagccggc 3240
          tggtggtcga tttcagtcag ttttcaagag gcaacacaag ggtgtcatgg cccaaattcg 3300
          ccgtccctaa tctgcagagt ctgactaacc tgctgtctag taatctgagc tggctgtccc 3360
          tggacgtgtc cgcagccttt taccacctgc ctctgcatcc agctgcaatg ccccatctgc 3420
          tggtggggtc aagcggactg agtcgctacg tcgcccgact gtcctctaac tcacgcatca 3480
          ttaatcacca gcatggcacc atgcagaacc tgcacgatag ctgttcccgg aatctgtacg 3540
          tgtctctgct gctgctgtat aagacattcg gcagaaaact gcacctgtac agccatccta 3600
          tcattctggg gtttaggaag atcccaatgg gagtggggact gagccccttc ctgctggcac 3660
          agtttacctc cgccatttgc tctgtggtcc gccgagcctt cccaacactgt ctggcttttt 3720
          cctatatgaa caatgtggtc ctgggcgcca aatccgtgca gcatctggag tctctgttca 3780
          cagctgtcac taactttctg ctgagcctgg ggatccacct gaacccaaat aagactaaac 3840
          gctgggggta cagcctgaat ttcatgggat atgtgattgg atcctggggg acccctgccac 3900
          aggagcacat cgtgcagaag atcaaggaat gctttcggaa gctgcccgtc aacagaccta 3960
          tcgactggaa agtgtgccag cggattgtcg gactgctggg cttcgccgct ccctttaccc 4020
          agtgcgggta cccagcactg atgcccctgt atgcctgtat ccagtctaag caggctttca 4080
          cctttagtcc tacatacaag gcattcctgt gcaaacagta cctgaacctg tatccagtgg 4140
          caaggcagcg acctggactg tgccaggtct ttgcaaatgc cactcctacc ggctgggggc 4200
          tggctatcgg acatcagcga atgcggggca cattcgtggc ccccctgcct attcacactg 4260
          ctcagctgct ggcagcctgc tttgctagat ctaggagtgg agcaaagctg atcggcaccg 4320
          acaatagtgt ggtcctgtca agaaaataca catccttccc atggctgctg ggatgtgctg 4380
          caaactggat tctgaggggc accagcttcg tgtacgtccc ctcagccctg aatcctgctg 4440
          acgatccatc ccgcgggcga ctgggactgt accgacctct gctgagactg cccttcaggc 4500
          ctacaactgg ccggacatct ctgtatgccg attcaccaag cgtgccctca cacctgcctg 4560
          acagagtcca ctttgcttca cccctgcacg tcgcttggcg gcctcca 4607
           <![CDATA[ <210> 45]]>
           <![CDATA[ <211> 4767]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core-2A-Pol coding sequence-IRES (EV71)-PreS2.S coding sequence]]>
           <![CDATA[ <400> 45]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcgacatcg acccttacaa ggagttcggc gccagcgtgg aactgctgtc ttttctgccc 120
          agtgatttct ttccttccat tcgagacctg ctggataccg cctctgctct gtatcgggaa 180
          gccctggaga gcccagaaca ctgctcccca caccataccg ctctgcgaca ggcaatcctg 240
          tgctgggggg agctgatgaa cctggccaca tgggtgggat cgaatctgga ggaccccgct 300
          tcacgggaac tggtggtcag ctacgtgaac gtcaatatgg gcctgaaaat ccgccagctg 360
          ctgtggttcc atattagctg cctgactttt ggacgagaga ccgtgctgga atacctggtg 420
          tccttcggcg tctggattcg cactccccct gcttatcgac cacccaacgc accaattctg 480
          tccaccctgc ccgagaccac agtggtccgt cgccgtggaa gcggagctac taacttcagc 540
          ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatggctcg acctctgtgt 600
          accctgctac tcctgatggc taccctggct ggagctctgg ccagcatgcc cctgtcttac 660
          cagcacttta gaaagcttct gctgctggac gatgaagccg ggcctctgga ggaagagctg 720
          ccaaggctgg cagacgaggg gctgaaccgg agagtggccg aagatctgaa tctgggaaac 780
          ctgaacgtga gcatcccttg gactcataaa gtcggcaact tcaccgggct gtacagctcc 840
          acagtgcctg tcttcaatcc agagtggcag acaccatcct ttcccaacat tcacctgcag 900
          gaggacatca ttaatagatg cgaacagttc gtgggacctc tgacagtcaa cgaaaagagg 960
          cgcctgaaac tgatcatgcc tgccaggttt tacccaaatg tgactaagta tctgccactg 1020
          gataagggca tcaagcctta ctatccagag cacctggtga accattactt ccagactaga 1080
          cactatctgc ataccctgtg gaaggccgga atcctgtaca aacgagaaac tacccggagt 1140
          gcttcatttt gtggctcccc atattcttgg gaacaggagc tgcagcatgg caggctggtg 1200
          ttccagacca gcaaacgcca cggggatgag tccttttgca gccagtctag tggcatcctg 1260
          agcagatccc ccgtggggcc ttgtattcag tctcagctgc ggaagagtag actgggactg 1320
          cagccacagc agggacacct ggcacgacgg cagcagggaa ggtctggcag tatccgggct 1380
          agagtgcatc ccacaactag aaggaccttc ggcgtcgagc catcaggaag cggccacatc 1440
          gacaacagcg catcaagctc ctctagttgc ctgcatcagt cagccgtgag aaaggccgct 1500
          tacagccacc tgtccacatc taaaaggcac tcaagctccg ggcatgctgt ggagctgcac 1560
          aacatccctc caaattctgc acgcagtcag tcagaaggac ccgtgttcag ctgctggtgg 1620
          ctgcagtttc ggaactcaaa gccttgcagc gactattgtc tgagccatat tgtgaatctg 1680
          ctggaggatt ggggcccttg taccgagcac ggggaacacc atatcaggat tccacgaaca 1740
          ccagcacgag tgactggagg ggtgttcctg gtggacaaga accccccaa tactaccgag 1800
          agccggctgg tggtcgattt cagtcagttt tcaagaggca acacaagggt gtcatggccc 1860
          aaattcgccg tccctaatct gcagagtctg actaacctgc tgtctagtaa tctgagctgg 1920
          ctgtccctgg acgtgtccgc agccttttac cacctgcctc tgcatccagc tgcaatgccc 1980
          catctgctgg tggggtcaag cggactgagt cgctacgtcg cccgactgtc ctctaactca 2040
          cgcatcatta atcaccagca tggcaccatg cagaacctgc acgatagctg ttcccggaat 2100
          ctgtacgtgt ctctgctgct gctgtataag attcggca gaaaactgca cctgtacagc 2160
          catcctatca ttctggggtt taggaagatc ccaatggggag tgggactgag ccccttcctg 2220
          ctggcacagt ttacctccgc catttgctct gtggtccgcc gagccttccc acactgtctg 2280
          gctttttcct atatgaacaa tgtggtcctg ggcgccaaat ccgtgcagca tctggagtct 2340
          ctgttcacag ctgtcactaa ctttctgctg agcctgggga tccacctgaa cccaaataag 2400
          actaaacgct gggggtacag cctgaatttc atgggatatg tgattggatc ctgggggacc 2460
          ctgccacagg agcacatcgt gcagaagatc aaggaatgct ttcggaagct gcccgtcaac 2520
          agacctatcg actggaaagt gtgccagcgg attgtcggac tgctgggctt cgccgctccc 2580
          tttacccagt gcgggtaccc agcactgatg cccctgtatg cctgtatcca gtctaagcag 2640
          gctttcacct ttagtcctac atacaaggca ttcctgtgca aacagtacct gaacctgtat 2700
          ccagtggcaa ggcagcgacc tggactgtgc caggtctttg caaatgccac tcctaccggc 2760
          tgggggctgg ctatcggaca tcagcgaatg cggggcacat tcgtggcccc cctgcctatt 2820
          cacactgctc agctgctggc agcctgcttt gctagatcta ggagtggagc aaagctgatc 2880
          ggcaccgaca atagtgtggt cctgtcaaga aaatacacat ccttcccatg gctgctggga 2940
          tgtgctgcaa actggattct gaggggcacc agcttcgtgt acgtcccctc agccctgaat 3000
          cctgctgacg atccatcccg cgggcgactg ggactgtacc gacctctgct gagactgccc 3060
          ttcaggccta caactggccg gacatctctg tatgccgatt caccaagcgt gccctcacac 3120
          ctgcctgaca gagtccactt tgcttcaccc ctgcacgtcg cttggcggcc tccataatta 3180
          aaacagctgt gggttgttcc cacccacagg gcccactggg cgctagcact ctgattttac 3240
          gaaatccttg tgcgcctgtt ttatatccct tccctaattc gaaacgtaga agcaatgcgc 3300
          accactgatc aatagtaggc gtaacgcgcc agttacgtca tgatcaagca tatctgttcc 3360
          cccggactga gtatcaatag actgcttacg cggttgaagg agaaaacgtt cgttatccgg 3420
          ctaactactt cgagaagccc agtaacacca tggaagctgc agggtgtttc gctcagcact 3480
          tcccccgtgtagatcaggtc gatgagccac tgcaatccccacaggtgact gtggcagtgg 3540
          ctgcgttggc ggcctgccta tggggagacc cataggacgc tctaatgtgg acatggtgcg 3600
          aagagcctat tgagctagtt agtagtcctc cggcccctga atgcggctaa tcctaactgc 3660
          ggagcacatg ccttcaaccc aggggtagt gtgtcgtaac gggcaactct gcagcggaac 3720
          cgactacttt gggtgtccgt gtttcttttt tattcttata ttggctgctt atggtgacaa 3780
          ttacagaatt gttaccatat agctattgga ttggccatcc ggtgtgtaat agagctgtta 3840
          tatacctatt tgttggcttt gtaccactaa ctttaaaatc tataactacc ctcaacttta 3900
          tattaaccct caatacagtt gaccatgcag tggaactcaa ctactttcca tcagaccctt 3960
          caggacccta gagtgcgcgg gctgtacttt cctgctgggg gaagcagtag cgggaccgtt 4020
          aatccagtac ctacgaccgc ctctcccata tcttctatct ttagtaggac tggtgaccct 4080
          gctcccaaca tggagaatat cacctccggg tttctgggcc cactcctggt ccttcaggcc 4140
          ggattcttcc tgctgactcg aatcctcacc ataccccaga gcctggacag ctggtggaca 4200
          agcctgaatt ttctgggagg aactcctgta tgcctgggac aaaattcaca gtcccctaca 4260
          agtaaccatt caccgacaag ttgtcctccc atctgtcccg gatacaggtg gatgtgcctg 4320
          cgaaggttca tcatcttcct cttcatcctc ttgctttgcc ttattttcct cctggttctt 4380
          ctggactatc agggcatgct gcctgtgtgc ccactgatac caggatctag tactaccagc 4440
          acaggcccgt gtaagacctg tacaattcca gcacaaggga ctagtatgtt cccctcctgc 4500
          tgttgtacta agccaagcga cggtaattgc acgtgtatcc caatcccgtc ctcctgggcg 4560
          tttgccaagt acctctggga atgggcctca gtcagatttt catggcttag tcttttggtg 4620
          ccgttcgtgc agtggtttgt gggactctct ccgactgtgt ggctcagcgt gatctggatg 4680
          atgtggtact ggggcccttc cctttacaac atactgtctc cattccttcc cctgctgcca 4740
          atcttctttt gcctgtgggt ctatatt 4767
           <![CDATA[ <210> 46]]>
           <![CDATA[ <211> 4767]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S coding sequence-IRES (EV71)-core-2A-Pol coding sequence]]>
           <![CDATA[ <400> 46]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaattaa aacagctgtg ggttgttcccc accacaggg cccactgggc gctagcactc 900
          tgattttacg aaatccttgt gcgcctgttt tatatccctt ccctaattcg aaacgtagaa 960
          gcaatgcgca ccactgatca atagtaggcg taacgcgcca gttacgtcat gatcaagcat 1020
          atctgttccc ccggactgag tatcaataga ctgcttacgc ggttgaagga gaaaacgttc 1080
          gttatccggc taactacttc gagaagccca gtaacaccat ggaagctgca gggtgtttcg 1140
          ctcagcactt cccccgtgta gatcaggtcg atgagccact gcaatcccca caggtgactg 1200
          tggcagtggc tgcgttggcg gcctgcctat ggggagacccc ataggacgct ctaatgtgga 1260
          catggtgcga agagcctatt gagctagtta gtagtcctcc ggcccctgaa tgcggctaat 1320
          cctaactgcg gagcacatgc cttcaaccca gagggtagtg tgtcgtaacg ggcaactctg 1380
          cagcggaacc gactactttg ggtgtccgtg tttctttttt attcttatat tggctgctta 1440
          tggtgacaat tacagaattg ttaccatata gctattggat tggccatccg gtgtgtaata 1500
          gagctgttat atacctattt gttggctttg taccactaac tttaaaatct ataactaccc 1560
          tcaactttat attaaccctc aatacagttg accatggctc gacctctgtg taccctgcta 1620
          ctcctgatgg ctaccctggc tggagctctg gccagcgaca tcgaccctta caaggagttc 1680
          ggcgccagcg tggaactgct gtcttttctg cccagtgatt tctttccttc cattcgagac 1740
          ctgctggata ccgcctctgc tctgtatcgg gaagccctgg agagcccaga acactgctcc 1800
          ccacaccata ccgctctgcg acaggcaatc ctgtgctggg gggagctgat gaacctggcc 1860
          acatgggtgg gatcgaatct gaggacccc gcttcacggg aactggtggt cagctacgtg 1920
          aacgtcaata tgggcctgaa aatccgccag ctgctgtggt tccatattag ctgcctgact 1980
          tttggacgag agaccgtgct ggaatacctg gtgtccttcg gcgtctggat tcgcactccc 2040
          cctgcttatc gaccacccaa cgcaccaatt ctgtccaccc tgcccgagac cacagtggtc 2100
          cgtcgccgtg gatcaggcgc tacgaatttt agccttctga agcaagcggg agacgttgaa 2160
          gaaaacccag ggcctatggc tcgacctctg tgtaccctgc tactcctgat ggctacctg 2220
          gctggagctc tggccagcat gcccctgtct taccagcact ttagaaagct tctgctgctg 2280
          gacgatgaag ccggggcctct ggaggaagag ctgccaaggc tggcagacga ggggctgaac 2340
          cggagagtgg ccgaagatct gaatctggga aacctgaacg tgagcatccc ttggactcat 2400
          aaagtcggca acttcaccgg gctgtacagc tccacagtgc ctgtcttcaa tccagagtgg 2460
          cagacaccat cctttcccaa cattcacctg caggaggaca tcattaatag atgcgaacag 2520
          ttcgtgggac ctctgacagt caacgaaaag aggcgcctga aactgatcat gcctgccagg 2580
          ttttacccaa atgtgactaa gtatctgcca ctggataagg gcatcaagcc ttactatcca 2640
          gagcacctgg tgaaccatta cttccagact agacactatc tgcataccct gtggaaggcc 2700
          ggaatcctgt acaaacgaga aactacccgg agtgcttcat tttgtggctc cccatattct 2760
          tgggaacagg agctgcagca tggcaggctg gtgttccaga ccagcaaacg ccacggggat 2820
          gagtcctttt gcagccagtc tagtggcatc ctgagcagat cccccgtggg gccttgtatt 2880
          cagtctcagc tgcggaagag tagactggga ctgcagccac agcagggaca cctggcacga 2940
          cggcagcagg gaaggtctgg cagtatccgg gctagagtgc atcccacaac tagaaggacc 3000
          ttcggcgtcg agccatcagg aagcggccac atcgacaaca gcgcatcaag ctcctctagt 3060
          tgcctgcatc agtcagccgt gagaaaggcc gcttacagcc acctgtccac atctaaaagg 3120
          cactcaagct ccgggcatgc tgtggagctg cacaacatcc ctccaaattc tgcacgcagt 3180
          cagtcagaag gacccgtgtt cagctgctgg tggctgcagt ttcggaactc aaagccttgc 3240
          agcgactatt gtctgagcca tattgtgaat ctgctggagg attggggccc ttgtaccgag 3300
          cacggggaac accatatcag gattccacga acaccagcac gagtgactgg aggggtgttc 3360
          ctggtggaca agaaccccca caatactacc gagagccggc tggtggtcga tttcagtcag 3420
          ttttcaagag gcaacacaag ggtgtcatgg cccaaattcg ccgtccctaa tctgcagagt 3480
          ctgactaacc tgctgtctag taatctgagc tggctgtccc tggacgtgtc cgcagccttt 3540
          taccacctgc ctctgcatcc agctgcaatg ccccatctgc tggtggggtc aagcggactg 3600
          agtcgctacg tcgcccgact gtcctctaac tcacgcatca ttaatcacca gcatggcacc 3660
          atgcagaacc tgcacgatag ctgttcccgg aatctgtacg tgtctctgct gctgctgtat 3720
          aagacattcg gcagaaaact gcacctgtac agccatccta tcattctggg gtttaggaag 3780
          atcccaatgg gagtgggact gagccccttc ctgctggcac agtttacctc cgccatttgc 3840
          tctgtggtcc gccgagcctt cccaacactgt ctggcttttt cctatatgaa caatgtggtc 3900
          ctgggcgcca aatccgtgca gcatctggag tctctgttca cagctgtcac taactttctg 3960
          ctgagcctgg ggatccacct gaacccaaat aagactaaac gctggggggta cagcctgaat 4020
          ttcatgggat atgtgattgg atcctggggg acccctgccac aggagcacat cgtgcagaag 4080
          atcaaggaat gctttcggaa gctgcccgtc aacagaccta tcgactggaa agtgtgccag 4140
          cggattgtcg gactgctggg cttcgccgct ccctttaccc agtgcgggta cccagcactg 4200
          atgcccctgt atgcctgtat ccagtctaag caggctttca cctttagtcc tacatacaag 4260
          gcattcctgt gcaaacagta cctgaacctg tatccagtgg caaggcagcg acctggactg 4320
          tgccaggtct ttgcaaatgc cactcctacc ggctgggggc tggctatcgg acatcagcga 4380
          atgcggggca cattcgtggc ccccctgcct attcacactg ctcagctgct ggcagcctgc 4440
          tttgctagat ctaggagtgg agcaaagctg atcggcaccg acaatagtgt ggtcctgtca 4500
          agaaaataca catccttccc atggctgctg ggatgtgctg caaactggat tctgaggggc 4560
          accagcttcg tgtacgtccc ctcagccctg aatcctgctg acgatccatc ccgcgggcga 4620
          ctgggactgt accgacctct gctgagactg cccttcaggc ctacaactgg ccggacatct 4680
          ctgtatgccg attcaccaag cgtgccctca cacctgcctg acagagtcca ctttgcttca 4740
          cccctgcacg tcgcttggcg gcctcca 4767
           <![CDATA[ <210> 47]]>
           <![CDATA[ <211> 4607]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core coding sequence-IRES (EMCV)-PreS2.S coding sequence]]>
           <![CDATA[ <400> 47]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgttaagcc 3180
          cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa ggccggtgtg 3240
          cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg agggcccgga 3300
          aacctggccc tgtcttcttg acgagcattc ctaggggtct ttcccctctc gccaaaggaa 3360
          tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct tgaagacaaa 3420
          caacgtctgt agcgaccctt tgcaggcagc ggaaccccccc acctggcgac aggtgccctct 3480
          gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc cagtgccacg 3540
          ttgtgagttg gatagttgtg gaaagagtca aatggctctc ctcaagcgta ttcaacaagg 3600
          ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg cctcggtgca 3660
          catgctttac atgtgtttag tcgaggttaa aaaacgtcta ggccccccga accacgggga 3720
          cgtggttttc ctttgaaaaa cacgatgata atatggccac aaccatgcag tggaactcaa 3780
          ctactttcca tcagaccctt caggacccta gagtgcgcgg gctgtacttt cctgctgggg 3840
          gaagcagtag cgggaccgtt aatccagtac ctacgaccgc ctctcccata tcttctatct 3900
          ttagtaggac tggtgaccct gctcccaaca tggagaatat cacctccggg tttctgggcc 3960
          cactcctggt ccttcaggcc ggattcttcc tgctgactcg aatcctcacc ataccccaga 4020
          gcctggacag ctggtggaca agcctgaatt ttctgggagg aactcctgta tgcctgggac 4080
          aaaattcaca gtcccctaca agtaaccatt caccgacaag ttgtcctccc atctgtcccg 4140
          gatacaggtg gatgtgcctg cgaaggttca tcatcttcct cttcatcctc ttgctttgcc 4200
          ttattttcct cctggttctt ctggactatc agggcatgct gcctgtgtgc ccactgatac 4260
          caggatctag tactaccagc acaggcccgt gtaagacctg tacaattcca gcacaaggga 4320
          ctagtatgtt cccctcctgc tgttgtacta agccaagcga cggtaattgc acgtgtatcc 4380
          caatcccgtc ctcctgggcg tttgccaagt acctctggga atgggcctca gtcagatttt 4440
          catggcttag tcttttggtg ccgttcgtgc agtggtttgt gggactctct ccgactgtgt 4500
          ggctcagcgt gatctggatg atgtggtact ggggcccttc cctttacaac atactgtctc 4560
          cattccttcc cctgctgcca atcttctttt gcctgtgggt ctatatt 4607
           <![CDATA[ <210> 48]]>
           <![CDATA[ <211> 4767]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core coding sequence-IRES (EV71)-PreS2.S coding sequence]]>
           <![CDATA[ <400> 48]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggaagcgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg 2640
          gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct gatggctacc 2700
          ctggctggag ctctggccag cgacatcgac ccttacaagg agttcggcgc cagcgtggaa 2760
          ctgctgtctt ttctgcccag tgatttcttt ccttccattc gagacctgct ggataccgcc 2820
          tctgctctgt atcgggaagc cctggagagc ccagaacact gctccccaca ccataccgct 2880
          ctgcgacagg caatcctgtg ctggggggag ctgatgaacc tggccacatg ggtgggatcg 2940
          aatctggagg accccgcttc acgggaactg gtggtcagct acgtgaacgt caatatgggc 3000
          ctgaaaatcc gccagctgct gtggttccat attagctgcc tgacttttgg acgagagacc 3060
          gtgctggaat acctggtgtc cttcggcgtc tggattcgca ctccccctgc ttatcgacca 3120
          cccaacgcac caattctgtc caccctgccc gagaccacag tggtccgtcg ccgttaatta 3180
          aaacagctgt gggttgttcc cacccacagg gcccactggg cgctagcact ctgattttac 3240
          gaaatccttg tgcgcctgtt ttatatccct tccctaattc gaaacgtaga agcaatgcgc 3300
          accactgatc aatagtaggc gtaacgcgcc agttacgtca tgatcaagca tatctgttcc 3360
          cccggactga gtatcaatag actgcttacg cggttgaagg agaaaacgtt cgttatccgg 3420
          ctaactactt cgagaagccc agtaacacca tggaagctgc agggtgtttc gctcagcact 3480
          tcccccgtgtagatcaggtc gatgagccac tgcaatccccacaggtgact gtggcagtgg 3540
          ctgcgttggc ggcctgccta tggggagacc cataggacgc tctaatgtgg acatggtgcg 3600
          aagagcctat tgagctagtt agtagtcctc cggcccctga atgcggctaa tcctaactgc 3660
          ggagcacatg ccttcaaccc aggggtagt gtgtcgtaac gggcaactct gcagcggaac 3720
          cgactacttt gggtgtccgt gtttcttttt tattcttata ttggctgctt atggtgacaa 3780
          ttacagaatt gttaccatat agctattgga ttggccatcc ggtgtgtaat agagctgtta 3840
          tatacctatt tgttggcttt gtaccactaa ctttaaaatc tataactacc ctcaacttta 3900
          tattaaccct caatacagtt gaccatgcag tggaactcaa ctactttcca tcagaccctt 3960
          caggacccta gagtgcgcgg gctgtacttt cctgctgggg gaagcagtag cgggaccgtt 4020
          aatccagtac ctacgaccgc ctctcccata tcttctatct ttagtaggac tggtgaccct 4080
          gctcccaaca tggagaatat cacctccggg tttctgggcc cactcctggt ccttcaggcc 4140
          ggattcttcc tgctgactcg aatcctcacc ataccccaga gcctggacag ctggtggaca 4200
          agcctgaatt ttctgggagg aactcctgta tgcctgggac aaaattcaca gtcccctaca 4260
          agtaaccatt caccgacaag ttgtcctccc atctgtcccg gatacaggtg gatgtgcctg 4320
          cgaaggttca tcatcttcct cttcatcctc ttgctttgcc ttattttcct cctggttctt 4380
          ctggactatc agggcatgct gcctgtgtgc ccactgatac caggatctag tactaccagc 4440
          acaggcccgt gtaagacctg tacaattcca gcacaaggga ctagtatgtt cccctcctgc 4500
          tgttgtacta agccaagcga cggtaattgc acgtgtatcc caatcccgtc ctcctgggcg 4560
          tttgccaagt acctctggga atgggcctca gtcagatttt catggcttag tcttttggtg 4620
          ccgttcgtgc agtggtttgt gggactctct ccgactgtgt ggctcagcgt gatctggatg 4680
          atgtggtact ggggcccttc cctttacaac atactgtctc cattccttcc cctgctgcca 4740
          atcttctttt gcctgtgggt ctatatt 4767
           <![CDATA[ <210> 49]]>
           <![CDATA[ <211> 4607]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-IRES (EMCV)-Pol-2A-Core]]>
           <![CDATA[ <400> 49]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaagccc ctctccctcc ccccccccta acgttactgg ccgaagccgc ttggaataag 900
          gccggtgtgc gtttgtctat atgttatttt ccaccacatatt gccgtctttt ggcaatgtga 960
          gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt tcccctctcg 1020
          ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg gaagcttctt 1080
          gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca cctggcgaca 1140
          ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg gcacaaccccc 1200
          agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc tcaagcgtat 1260
          tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggatct gatctggggc 1320
          ctcggtgcac atgctttaca tgtgtttagt cgaggttaaa aaacgtctag gccccccgaa 1380
          ccacggggac gtggttttcc tttgaaaaac acgatgataa tatggccaca accatggctc 1440
          gacctctgtg taccctgcta ctcctgatgg ctaccctggc tggagctctg gccagcatgc 1500
          ccctgtctta ccagcacttt agaaagcttc tgctgctgga cgatgaagcc gggcctctgg 1560
          aggaagagct gccaaggctg gcagacgagg ggctgaaccg gagagtggcc gaagatctga 1620
          atctgggaaa cctgaacgtg agcatccctt ggactcataa agtcggcaac ttcaccgggc 1680
          tgtacagctc cacagtgcct gtcttcaatc cagagtggca gacaccatcc tttcccaaca 1740
          ttcacctgca ggaggacatc attaatagat gcgaacagtt cgtgggacct ctgacagtca 1800
          acgaaaagag gcgcctgaaa ctgatcatgc ctgccaggtt ttacccaaat gtgactaagt 1860
          atctgccact ggataagggc atcaagcctt actatccaga gcacctggtg aaccattact 1920
          tccagactag acactatctg cataccctgt ggaaggccgg aatcctgtac aaacgagaaa 1980
          ctacccggag tgcttcattt tgtggctccc catattcttg ggaacaggag ctgcagcatg 2040
          gcaggctggt gttccagacc agcaaacgcc acggggatga gtccttttgc agccagtcta 2100
          gtggcatcct gagcagatcc cccgtggggc cttgtattca gtctcagctg cggaagagta 2160
          gactgggact gcagccacag cagggacacc tggcacgacg gcagcaggga aggtctggca 2220
          gtatccgggc tagagtgcat cccacaacta gaaggacctt cggcgtcgag ccatcaggaa 2280
          gcggccacat cgacaacagc gcatcaagct cctctagttg cctgcatcag tcagccgtga 2340
          gaaaggccgc ttacagccac ctgtccacat ctaaaaggca ctcaagctcc gggcatgctg 2400
          tggagctgca caacatccct ccaaattctg cacgcagtca gtcagaagga cccgtgttca 2460
          gctgctggtg gctgcagttt cggaactcaa agccttgcag cgactattgt ctgagccata 2520
          ttgtgaatct gctggaggat tggggccctt gtaccgagca cggggaacac catatcagga 2580
          ttccacgaac accagcacga gtgactggag gggtgttcct ggtggacaag aacccccaca 2640
          atactaccga gagccggctg gtggtcgatt tcagtcagtt ttcaagaggc aacacaaggg 2700
          tgtcatggcc caaattcgcc gtccctaatc tgcagagtct gactaacctg ctgtctagta 2760
          atctgagctg gctgtccctg gacgtgtccg cagcctttta ccacctgcct ctgcatccag 2820
          ctgcaatgcc ccatctgctg gtggggtcaa gcggactgag tcgctacgtc gcccgactgt 2880
          cctctaactc acgcatcatt aatcaccagc atggcaccat gcagaacctg cacgatagct 2940
          gttcccggaa tctgtacgtg tctctgctgc tgctgtataa gacattcggc agaaaactgc 3000
          acctgtacag ccatcctatc attctggggt ttaggaagat cccaatggga gtggggactga 3060
          gccccttcct gctggcacag tttacctccg ccatttgctc tgtggtccgc cgagccttcc 3120
          cacactgtct ggctttttcc tatatgaaca atgtggtcct gggcgccaaa tccgtgcagc 3180
          atctggagtc tctgttcaca gctgtcacta actttctgct gagcctgggg atccacctga 3240
          acccaaataa gactaaacgc tgggggtaca gcctgaattt catgggatat gtgattggat 3300
          cctgggggac cctgccacag gagcacatcg tgcagaagat caaggaatgc tttcggaagc 3360
          tgcccgtcaa cagacctatc gactggaaag tgtgccagcg gattgtcgga ctgctgggct 3420
          tcgccgctcc ctttacccag tgcgggtacc cagcactgat gcccctgtat gcctgtatcc 3480
          agtctaagca ggctttcacc tttagtccta catacaaggc attcctgtgc aaacagtacc 3540
          tgaacctgta tccagtggca aggcagcgac ctggactgtg ccaggtcttt gcaaatgcca 3600
          ctcctaccgg ctgggggctg gctatcggac atcagcgaat gcggggcaca ttcgtggccc 3660
          ccctgcctat tcacactgct cagctgctgg cagcctgctt tgctagatct aggagtggag 3720
          caaagctgat cggcaccgac aatagtgtgg tcctgtcaag aaaatacaca tccttcccat 3780
          ggctgctggg atgtgctgca aactggattc tgaggggcac cagcttcgtg tacgtcccct 3840
          cagccctgaa tcctgctgac gatccatccc gcgggcgact gggactgtac cgacctctgc 3900
          tgagactgcc cttcaggcct acaactggcc ggacatctct gtatgccgat tcaccaagcg 3960
          tgccctcaca cctgcctgac agagtccact ttgcttcacc cctgcacgtc gcttggcggc 4020
          ctccaggatc aggcgctacg aattttagcc ttctgaagca agcgggagac gttgaagaaa 4080
          acccagggcc tatggctcga cctctgtgta ccctgctact cctgatggct accctggctg 4140
          gagctctggc cagcgacatc gacccttaca aggagttcgg cgccagcgtg gaactgctgt 4200
          cttttctgcc cagtgatttc tttccttcca ttcgagacct gctggatacc gcctctgctc 4260
          tgtatcggga agccctggag agcccagaac actgctcccc acaccatacc gctctgcgac 4320
          aggcaatcct gtgctggggg gagctgatga acctggccac atgggtggga tcgaatctgg 4380
          aggacccccgc ttcacgggaa ctggtggtca gctacgtgaa cgtcaatatg ggcctgaaaa 4440
          tccgccagct gctgtggttc catattagct gcctgacttt tggacgagag accgtgctgg 4500
          aatacctggt gtccttcggc gtctggattc gcactccccc tgcttatcga ccacccaacg 4560
          caccaattct gtccaccctg cccgagacca cagtggtccg tcgccgt 4607
           <![CDATA[ <210> 50]]>
           <![CDATA[ <211> 4767]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S coding sequence-IRES (EV71)-Pol-2A-core coding sequence]]>
           <![CDATA[ <400> 50]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          atttaattaa aacagctgtg ggttgttcccc accacaggg cccactgggc gctagcactc 900
          tgattttacg aaatccttgt gcgcctgttt tatatccctt ccctaattcg aaacgtagaa 960
          gcaatgcgca ccactgatca atagtaggcg taacgcgcca gttacgtcat gatcaagcat 1020
          atctgttccc ccggactgag tatcaataga ctgcttacgc ggttgaagga gaaaacgttc 1080
          gttatccggc taactacttc gagaagccca gtaacaccat ggaagctgca gggtgtttcg 1140
          ctcagcactt cccccgtgta gatcaggtcg atgagccact gcaatcccca caggtgactg 1200
          tggcagtggc tgcgttggcg gcctgcctat ggggagacccc ataggacgct ctaatgtgga 1260
          catggtgcga agagcctatt gagctagtta gtagtcctcc ggcccctgaa tgcggctaat 1320
          cctaactgcg gagcacatgc cttcaaccca gagggtagtg tgtcgtaacg ggcaactctg 1380
          cagcggaacc gactactttg ggtgtccgtg tttctttttt attcttatat tggctgctta 1440
          tggtgacaat tacagaattg ttaccatata gctattggat tggccatccg gtgtgtaata 1500
          gagctgttat atacctattt gttggctttg taccactaac tttaaaatct ataactaccc 1560
          tcaactttat attaaccctc aatacagttg accatggctc gacctctgtg taccctgcta 1620
          ctcctgatgg ctaccctggc tggagctctg gccagcatgc ccctgtctta ccagcacttt 1680
          agaaagcttc tgctgctgga cgatgaagcc gggcctctgg aggaagagct gccaaggctg 1740
          gcagacgagg ggctgaaccg gagagtggcc gaagatctga atctgggaaa cctgaacgtg 1800
          agcatccctt ggactcataa agtcggcaac ttcaccgggc tgtacagctc cacagtgcct 1860
          gtcttcaatc cagagtggca gacaccatcc tttcccaaca ttcacctgca ggaggacatc 1920
          attaatagat gcgaacagtt cgtgggacct ctgacagtca acgaaaagag gcgcctgaaa 1980
          ctgatcatgc ctgccaggtt ttacccaaat gtgactaagt atctgccact ggataagggc 2040
          atcaagcctt actatccaga gcacctggtg aaccattact tccagactag acactatctg 2100
          cataccctgt ggaaggccgg aatcctgtac aaacgagaaa ctacccggag tgcttcattt 2160
          tgtggctccc catattcttg ggaacaggag ctgcagcatg gcaggctggt gttccagacc 2220
          agcaaacgcc acggggatga gtccttttgc agccagtcta gtggcatcct gagcagatcc 2280
          cccgtggggc cttgtattca gtctcagctg cggaagagta gactgggact gcagccacag 2340
          cagggacacc tggcacgacg gcagcaggga aggtctggca gtatccgggc tagagtgcat 2400
          cccacaacta gaaggacctt cggcgtcgag ccatcaggaa gcggccacat cgacaacagc 2460
          gcatcaagct cctctagttg cctgcatcag tcagccgtga gaaaggccgc ttacagccac 2520
          ctgtccacat ctaaaaggca ctcaagctcc gggcatgctg tggagctgca caacatccct 2580
          ccaaattctg cacgcagtca gtcagaagga cccgtgttca gctgctggtg gctgcagttt 2640
          cggaactcaa agccttgcag cgactattgt ctgagccata ttgtgaatct gctggaggat 2700
          tggggccctt gtaccgagca cggggaacac catatcagga ttccacgaac accagcacga 2760
          gtgactggag gggtgttcct ggtggacaag aacccccaca atactaccga gagccggctg 2820
          gtggtcgatt tcagtcagtt ttcaagaggc aacacaaggg tgtcatggcc caaattcgcc 2880
          gtccctaatc tgcagagtct gactaacctg ctgtctagta atctgagctg gctgtccctg 2940
          gacgtgtccg cagcctttta ccacctgcct ctgcatccag ctgcaatgcc ccatctgctg 3000
          gtggggtcaa gcggactgag tcgctacgtc gcccgactgt cctctaactc acgcatcatt 3060
          aatcaccagc atggcaccat gcagaacctg cacgatagct gttcccggaa tctgtacgtg 3120
          tctctgctgc tgctgtataa gacattcggc agaaaactgc acctgtacag ccatcctatc 3180
          attctggggt ttaggaagat cccaatggga gtgggactga gccccttcct gctggcacag 3240
          tttacctccg ccatttgctc tgtggtccgc cgagccttcc cacactgtct ggctttttcc 3300
          tatatgaaca atgtggtcct gggcgccaaa tccgtgcagc atctggagtc tctgttcaca 3360
          gctgtcacta actttctgct gagcctgggg atccacctga acccaaataa gactaaacgc 3420
          tggggggtaca gcctgaattt catgggatat gtgattggat cctgggggac cctgccacag 3480
          gagcacatcg tgcagaagat caaggaatgc tttcggaagc tgcccgtcaa cagacctatc 3540
          gactggaaag tgtgccagcg gattgtcgga ctgctgggct tcgccgctcc ctttacccag 3600
          tgcgggtacc cagcactgat gcccctgtat gcctgtatcc agtctaagca ggctttcacc 3660
          tttagtccta catacaaggc attcctgtgc aaacagtacc tgaacctgta tccagtggca 3720
          aggcagcgac ctggactgtg ccaggtcttt gcaaatgcca ctcctaccgg ctgggggctg 3780
          gctatcggac atcagcgaat gcggggcaca ttcgtggccc ccctgcctat tcacactgct 3840
          cagctgctgg cagcctgctt tgctagatct aggagtggag caaagctgat cggcaccgac 3900
          aatagtgtgg tcctgtcaag aaaatacaca tccttcccat ggctgctggg atgtgctgca 3960
          aactggattc tgaggggcac cagcttcgtg tacgtcccct cagccctgaa tcctgctgac 4020
          gatccatccc gcgggcgact gggactgtac cgacctctgc tgagactgcc cttcaggcct 4080
          acaactggcc ggacatctct gtatgccgat tcaccaagcg tgccctcaca cctgcctgac 4140
          agagtccact ttgcttcacc cctgcacgtc gcttggcggc ctccaggatc aggcgctacg 4200
          aattttagcc ttctgaagca agcgggagac gttgaagaaa acccagggcc tatggctcga 4260
          cctctgtgta ccctgctact cctgatggct accctggctg gagctctggc cagcgacatc 4320
          gacccttaca aggagttcgg cgccagcgtg gaactgctgt cttttctgcc cagtgatttc 4380
          tttccttcca ttcgagacct gctggatacc gcctctgctc tgtatcggga agccctggag 4440
          agcccagaac actgctcccc acaccatacc gctctgcgac aggcaatcct gtgctggggg 4500
          gagctgatga acctggccac atgggtggga tcgaatctgg aggacccccgc ttcacgggaa 4560
          ctggtggtca gctacgtgaa cgtcaatatg ggcctgaaaa tccgccagct gctgtggttc 4620
          catattagct gcctgacttt tggacgagag accgtgctgg aatacctggt gtccttcggc 4680
          gtctggattc gcactccccc tgcttatcga ccaccaacg caccaattct gtccaccctg 4740
          cccgagacca cagtggtccg tcgccgt 4767
           <![CDATA[ <210> 51]]>
           <![CDATA[ <211> 3987]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 51]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc caggatcagg cgctacgaat tttagccttc tgaagcaagc gggagacgtt 2640
          gaagaaaacc cagggcctat gcagtggaac tcaactactt tccatcagac ccttcaggac 2700
          cctagagtgc gcgggctgta ctttcctgct gggggaagca gtagcgggac cgttaatcca 2760
          gtacctacga ccgcctctcc catatcttct atctttagta ggactggtga ccctgctccc 2820
          aacatggaga atatcacctc cgggtttctg ggccactcc tggtccttca ggccggattc 2880
          ttcctgctga ctcgaatcct caccataccc cagagcctgg acagctggtg gacaagcctg 2940
          aattttctgg gaggaactcc tgtatgcctg ggacaaaatt cacagtcccc tacaagtaac 3000
          cattcaccga caagttgtcc tcccatctgt cccggataca ggtggatgtg cctgcgaagg 3060
          ttcatcatct tcctcttcat cctcttgctt tgccttattt tcctcctggt tcttctggac 3120
          tatcagggca tgctgcctgt gtgcccactg ataccaggat ctagtactac cagcacaggc 3180
          ccgtgtaaga cctgtacaat tccagcacaa gggactagta tgttcccctc ctgctgttgt 3240
          actaagccaa gcgacggtaa ttgcacgtgt atcccaatcc cgtcctcctg ggcgtttgcc 3300
          aagtacctct gggaatgggc ctcagtcaga ttttcatggc ttagtctttt ggtgccgttc 3360
          gtgcagtggt ttgtggggact ctctccgact gtgtggctca gcgtgatctg gatgatgtgg 3420
          tactggggcc cttcccttta caacatactg tctccattcc ttcccctgct gccaatcttc 3480
          ttttgcctgt gggtctatat tgggtccgga gcgactaact tttccctgct gaaacaagcg 3540
          ggtgacgtcg aagagaatcc gggacctatg gctaggcccc tgtgtacact tttgctcctg 3600
          atggccaccc tcgctggagc tctggcaagc ggtggatgga gctcaaagcc gcggaaaggg 3660
          atgggtacta acctgtccgt accaaatccc ctgggatttt ttccagacca ccaactcgat 3720
          cctgcttttg gcgcaaattc caacaatccc gactgggact ttaaccctaa caaggaccac 3780
          tggcctgatg ccaacaaggt gggggcagga gcctttggtc ccggcttcac cccacccccat 3840
          ggaggtcttt tgggatggtc accacaggcc cagggcatcc tgaccactgt ccctgctgct 3900
          ccaccgccag cttctactaa tcgacagagc gggaggcagc cgacccccct gagtcccccc 3960
          ctgcgggata cccaccctca ggcataa 3987
           <![CDATA[ <210> 52]]>
           <![CDATA[ <211> 3987]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1-2A-Pol coding sequence]]>
           <![CDATA[ <400> 52]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcaggat caggcgctac gaattttagc cttctgaagc aagcgggaga cgttgaagaa 1380
          aacccagggc ctatggctcg acctctgtgt accctgctac tcctgatggc taccctggct 1440
          ggagctctgg ccagcatgcc cctgtcttac cagcacttta gaaagcttct gctgctggac 1500
          gatgaagccg ggcctctgga ggaagagctg ccaaggctgg cagacgaggg gctgaaccgg 1560
          agagtggccg aagatctgaa tctgggaaac ctgaacgtga gcatcccttg gactcataaa 1620
          gtcggcaact tcaccggggct gtacagctcc acagtgcctg tcttcaatcc agagtggcag 1680
          aacaccatcct ttcccaacat tcacctgcag gaggacatca ttaatagatg cgaacagttc 1740
          gtgggacctc tgacagtcaa cgaaaagagg cgcctgaaac tgatcatgcc tgccaggttt 1800
          tacccaaatg tgactaagta tctgccactg gataagggca tcaagcctta ctatccagag 1860
          cacctggtga accattactt ccagactaga cactatctgc ataccctgtg gaaggccgga 1920
          atcctgtaca aacgagaaac tacccggagt gcttcatttt gtggctcccc atattcttgg 1980
          gaacaggagc tgcagcatgg caggctggtg ttccagacca gcaaacgcca cggggatgag 2040
          tccttttgca gccagtctag tggcatcctg agcagatccc ccgtggggcc ttgtattcag 2100
          tctcagctgc ggaagagtag actgggactg cagccacagc agggacacct ggcacgacgg 2160
          cagcagggaa ggtctggcag tatccgggct agagtgcatc ccacaactag aaggaccttc 2220
          ggcgtcgagc catcaggaag cggccacatc gacaacagcg catcaagctc ctctagttgc 2280
          ctgcatcagt cagccgtgag aaaggccgct tacagccacc tgtccacatc taaaaggcac 2340
          tcaagctccg ggcatgctgt ggagctgcac aacatccctc caaattctgc acgcagtcag 2400
          tcagaaggac ccgtgttcag ctgctggtgg ctgcagtttc ggaactcaaa gccttgcagc 2460
          gactattgtc tgagccatat tgtgaatctg ctggaggatt ggggcccttg taccgagcac 2520
          ggggaacacc atatcaggat tccacgaaca ccagcacgag tgactggagg ggtgttcctg 2580
          gtggacaaga accccccaa tactaccgag agccggctgg tggtcgattt cagtcagttt 2640
          tcaagaggca acacaagggt gtcatggccc aaattcgccg tccctaatct gcagagtctg 2700
          actaacctgc tgtctagtaa tctgagctgg ctgtccctgg acgtgtccgc agccttttac 2760
          cacctgcctc tgcatccagc tgcaatgccc catctgctgg tggggtcaag cggactgagt 2820
          cgctacgtcg cccgactgtc ctctaactca cgcatcatta atcaccagca tggcaccatg 2880
          cagaacctgc acgatagctg ttcccggaat ctgtacgtgt ctctgctgct gctgtataag 2940
          acattcggca gaaaactgca cctgtacagc catcctatca ttctggggtt taggaagatc 3000
          ccaatggggag tgggactgag ccccttcctg ctggcacagt ttacctccgc catttgctct 3060
          gtggtccgcc gagccttccc acactgtctg gctttttcct atatgaacaa tgtggtcctg 3120
          ggcgccaaat ccgtgcagca tctggagtct ctgttcacag ctgtcactaa ctttctgctg 3180
          agcctgggga tccacctgaa cccaaataag actaaacgct gggggtacag cctgaatttc 3240
          atgggatatg tgattggatc ctgggggacc ctgccacagg agcacatcgt gcagaagatc 3300
          aaggaatgct ttcggaagct gcccgtcaac agacctatcg actggaaagt gtgccagcgg 3360
          attgtcggac tgctgggctt cgccgctccc tttacccagt gcgggtaccc agcactgatg 3420
          cccctgtatg cctgtatcca gtctaagcag gctttcacct ttagtcctac atacaaggca 3480
          ttcctgtgca aacagtacct gaacctgtat ccagtggcaa ggcagcgacc tggactgtgc 3540
          caggtctttg caaatgccac tcctaccggc tggggggctgg ctatcggaca tcagcgaatg 3600
          cggggcacat tcgtggcccc cctgcctatt cacactgctc agctgctggc agcctgcttt 3660
          gctagatcta ggagtggagc aaagctgatc ggcaccgaca atagtgtggt cctgtcaaga 3720
          aaatacacat ccttcccatg gctgctggga tgtgctgcaa actggattct gaggggcacc 3780
          agcttcgtgt acgtcccctc agccctgaat cctgctgacg atccatcccg cgggcgactg 3840
          ggactgtacc gacctctgct gagactgccc ttcaggccta caactggccg gacatctctg 3900
          tatgccgatt caccaagcgt gccctcacac ctgcctgaca gagtccactt tgcttcaccc 3960
          ctgcacgtcg cttggcggcc tccataa 3987
           <![CDATA[ <210> 53]]>
           <![CDATA[ <211> 4508]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1 coding sequence-IRES (EMCV)-Pol coding sequence]]>
           <![CDATA[ <400> 53]]>
          atgcagtgga actcaactac tttccatcag acccttcagg accctagagt gcgcgggctg 60
          tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac gaccgcctct 120
          cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga gaatatcacc 180
          tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct gactcgaatc 240
          ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct gggaggaact 300
          cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc gacaagttgt 360
          cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat cttcctcttc 420
          atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg catgctgcct 480
          gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa gacctgtaca 540
          attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc aagcgacggt 600
          aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct ctgggaatgg 660
          gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg gtttgtggga 720
          ctctctccga ctgtgtggct cagcgtgatc tggatgatgt ggtactgggg cccttccctt 780
          tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct gtgggtctat 840
          attggaagcg gagctactaa cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac 900
          cctggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac cctcgctgga 960
          gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac taacctgtcc 1020
          gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt tggcgcaaat 1080
          tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga tgccaacaag 1140
          gtggggggcag gagcctttgg tcccggcttc accccacccc atggaggtct tttgggatgg 1200
          tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc agcttctact 1260
          aatcgacaga gcgggaggca gccgacccccc ctgagtcccc ccctgcggga tacccaccct 1320
          caggcataag cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat 1380
          aaggccggtg tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg 1440
          tgagggcccg gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc 1500
          tcgccaaagg aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt 1560
          cttgaagaca aacaacgtct gtagcgaccc tttgcaggca gcggaaccccc ccacctggcg 1620
          acaggtgcct ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac 1680
          cccagtgcca cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg 1740
          tattcaacaa ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg 1800
          ggcctcggtg cacatgcttt acatgtgttt agtcgaggtt aaaaaacgtc taggcccccc 1860
          gaaccacggg gacgtggttt tcctttgaaa aacacgatga taatatggcc acaaccatgg 1920
          ctcgacctct gtgtaccctg ctactcctga tggctacccct ggctggagct ctggccagca 1980
          tgcccctgtc ttaccagcac tttagaaagc ttctgctgct ggacgatgaa gccgggcctc 2040
          tggaggaaga gctgccaagg ctggcagacg aggggctgaa ccggagagtg gccgaagatc 2100
          tgaatctggg aaacctgaac gtgagcatcc cttggactca taaagtcggc aacttcaccg 2160
          ggctgtacag ctccacagtg cctgtcttca atccagagtg gcagacacca tcctttccca 2220
          acattcacct gcaggaggac atcattaata gatgcgaaca gttcgtggga cctctgacag 2280
          tcaacgaaaa gaggcgcctg aaactgatca tgcctgccag gttttaccca aatgtgacta 2340
          agtatctgcc actggataag ggcatcaagc cttactatcc agagcacctg gtgaaccatt 2400
          acttccagac tagacactat ctgcataccc tgtggaaggc cggaatcctg tacaaacgag 2460
          aaactacccg gagtgcttca ttttgtggct ccccatattc ttgggaacag gagctgcagc 2520
          atggcaggct ggtgttccag accagcaaac gccacgggga tgagtccttt tgcagccagt 2580
          ctagtggcat cctgagcaga tcccccgtgg ggccttgtat tcagtctcag ctgcggaaga 2640
          gtagactggg actgcagcca cagcagggac acctggcacg acggcagcag ggaaggtctg 2700
          gcagtatccg ggctagagtg catcccacaa ctagaaggac cttcggcgtc gagccatcag 2760
          gaagcggcca catcgacaac agcgcatcaa gctcctctag ttgcctgcat cagtcagccg 2820
          tgagaaaggc cgcttacagc cacctgtcca catctaaaag gcactcaagc tccgggcatg 2880
          ctgtggagct gcacaacatc cctccaaatt ctgcacgcag tcagtcagaa ggacccgtgt 2940
          tcagctgctg gtggctgcag tttcggaact caaagccttg cagcgactat tgtctgagcc 3000
          atattgtgaa tctgctggag gattggggcc cttgtaccga gcacggggaa caccatatca 3060
          ggattccacg aacaccagca cgagtgactg gaggggtgtt cctggtggac aagaaccccc 3120
          acaatactac cgagagccgg ctggtggtcg atttcagtca gttttcaaga ggcaacacaa 3180
          gggtgtcatg gcccaaattc gccgtcccta atctgcagag tctgactaac ctgctgtcta 3240
          gtaatctgag ctggctgtcc ctggacgtgt ccgcagcctt ttaccacctg cctctgcatc 3300
          cagctgcaat gccccatctg ctggtggggt caagcggact gagtcgctac gtcgcccgac 3360
          tgtcctctaa ctcacgcatc attaatcacc agcatggcac catgcagaac ctgcacgata 3420
          gctgttcccg gaatctgtac gtgtctctgc tgctgctgta taagacattc ggcagaaaac 3480
          tgcacctgta cagccatcct atcattctgg ggtttaggaa gatcccaatg ggagtgggac 3540
          tgagcccctt cctgctggca cagtttacct ccgccatttg ctctgtggtc cgccgagcct 3600
          tccccacactg tctggctttt tcctatatga acaatgtggt cctgggcgcc aaatccgtgc 3660
          agcatctgga gtctctgttc acagctgtca ctaactttct gctgagcctg gggatccacc 3720
          tgaacccaaa taagactaaa cgctgggggt acagcctgaa tttcatggga tatgtgattg 3780
          gatcctgggg gaccctgcca caggagcaca tcgtgcagaa gatcaaggaa tgctttcgga 3840
          agctgcccgt caacagacct atcgactgga aagtgtgcca gcggattgtc ggactgctgg 3900
          gcttcgccgc tccctttacc cagtgcgggt accccagcact gatgcccctg tatgcctgta 3960
          tccagtctaa gcaggctttc acctttagtc ctacatacaa ggcattcctg tgcaaacagt 4020
          acctgaacct gtatccagtg gcaaggcagc gacctggact gtgccaggtc tttgcaaatg 4080
          ccactcctac cggctggggg ctggctatcg gacatcagcg aatgcggggc aattcgtgg 4140
          cccccctgcc tattcacact gctcagctgc tggcagcctg ctttgctaga tctaggagtg 4200
          gagcaaagct gatcggcacc gacaatagtg tggtcctgtc aagaaaatac acatccttcc 4260
          catggctgct gggatgtgct gcaaactgga ttctgagggg caccagcttc gtgtacgtcc 4320
          cctcagccct gaatcctgct gacgatccat cccgcgggcg actgggactg taccgacctc 4380
          tgctgagact gcccttcagg cctacaactg gccggacatc tctgtatgcc gattcaccaa 4440
          gcgtgccctc acacctgcct gacagagtcc actttgcttc acccctgcac gtcgcttggc 4500
          ggcctcca 4508
           <![CDATA[ <210> 54]]>
           <![CDATA[ <211> 4508]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol coding sequence-IRES (EMCV)-PreS2.S-2A-preS1 coding sequence]]>
           <![CDATA[ <400> 54]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agcatgcccc tgtcttacca gcactttaga aagcttctgc tgctggacga tgaagccggg 120
          cctctggagg aagagctgcc aaggctggca gacgaggggc tgaaccggag agtggccgaa 180
          gatctgaatc tgggaaacct gaacgtgagc atcccttgga ctcataaagt cggcaacttc 240
          accgggctgt acagctccac agtgcctgtc ttcaatccag agtggcagac accatccttt 300
          cccaacattc acctgcagga ggacatcatt aatagatgcg aacagttcgt gggacctctg 360
          acagtcaacg aaaagaggcg cctgaaactg atcatgcctg ccaggtttta cccaaatgtg 420
          actaagtatc tgccactgga taagggcatc aagccttatact atccagagca cctggtgaac 480
          cattacttcc agactagaca ctatctgcat accctgtgga aggccggaat cctgtacaaa 540
          cgagaaacta cccggagtgc ttcattttgt ggctccccat attcttggga acaggagctg 600
          cagcatggca ggctggtgtt ccagaccagc aaacgccacg gggatgagtc cttttgcagc 660
          cagtctagtg gcatcctgag cagatccccc gtggggcctt gtattcagtc tcagctgcgg 720
          aagagtagac tgggactgca gccacagcag ggacacctgg cacgacggca gcaggaagg 780
          tctggcagta tccgggctag agtgcatccc acaactagaa ggaccttcgg cgtcgagcca 840
          tcaggaagcg gccacatcga caacagcgca tcaagctcct ctagttgcct gcatcagtca 900
          gccgtgagaa aggccgctta cagccacctg tccacatcta aaaggcactc aagctccggg 960
          catgctgtgg agctgcacaa catccctcca aattctgcac gcagtcagtc agaaggaccc 1020
          gtgttcagct gctggtggct gcagtttcgg aactcaaagc cttgcagcga ctattgtctg 1080
          agccatattg tgaatctgct ggaggattgg ggcccttgta ccgagcacgg ggaacaccat 1140
          atcaggattc cacgaacacc agcacgagtg actggagggg tgttcctggt ggacaagaac 1200
          ccccacaata ctaccgagag ccggctggtg gtcgatttca gtcagttttc aagaggcaac 1260
          acaagggtgt catggcccaa attcgccgtc cctaatctgc agagtctgac taacctgctg 1320
          tctagtaatc tgagctggct gtccctggac gtgtccgcag ccttttacca cctgcctctg 1380
          catccagctg caatgcccca tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc 1440
          cgactgtcct ctaactcacg catcattaat caccagcatg gcaccatgca gaacctgcac 1500
          gatagctgtt cccggaatct gtacgtgtct ctgctgctgc tgtataagac attcggcaga 1560
          aaactgcacc tgtacagcca tcctatcatt ctggggttta ggaagatccc aatgggagtg 1620
          ggactgagcc ccttcctgct ggcacagttt acctccgcca tttgctctgt ggtccgccga 1680
          gccttcccac actgtctggc tttttcctat atgaacaatg tggtcctggg cgccaaatcc 1740
          gtgcagcatc tggagtctct gttcacagct gtcactaact ttctgctgag cctggggatc 1800
          cacctgaacc caaataagac taaacgctgg gggtacagcc tgaatttcat gggatatgtg 1860
          attggatcct gggggaccct gccacaggag cacatcgtgc agaagatcaa ggaatgcttt 1920
          cggaagctgc ccgtcaacag acctatcgac tggaaagtgt gccagcggat tgtcggactg 1980
          ctgggcttcg ccgctccctt taccccagtgc gggtacccag cactgatgcc cctgtatgcc 2040
          tgtatccagt ctaagcaggc tttcaccttt agtcctacat acaaggcatt cctgtgcaaa 2100
          cagtacctga acctgtatcc agtggcaagg cagcgacctg gactgtgcca ggtctttgca 2160
          aatgccactc ctaccggctg ggggctggct atcggacatc agcgaatgcg gggcacattc 2220
          gtggcccccc tgcctattca cactgctcag ctgctggcag cctgctttgc tagatctagg 2280
          agtggagcaa agctgatcgg caccgacaat agtgtggtcc tgtcaagaaa atacacatcc 2340
          ttcccatggc tgctgggatg tgctgcaaac tggattctga ggggcaccag cttcgtgtac 2400
          gtcccctcag ccctgaatcc tgctgacgat ccatcccgcg ggcgactggg actgtaccga 2460
          cctctgctga gactgccctt caggcctaca actggccgga catctctgta tgccgattca 2520
          ccaagcgtgc cctcacacct gcctgacaga gtccactttg cttcacccct gcacgtcgct 2580
          tggcggcctc cataagcccc tctccctccc ccccccctaa cgttactggc cgaagccgct 2640
          tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg 2700
          gcaatgtgag ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt 2760
          cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg 2820
          aagcttcttg aagacaaaca acgtctgtag cgaccctttg caggcagcgg aacccccccac 2880
          ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg 2940
          cacaacccca gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct 3000
          caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg 3060
          atctggggcc tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aacgtctagg 3120
          ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgataat atggccacaa 3180
          ccatgcagtg gaactcaact actttccatc agacccttca ggaccctaga gtgcgcgggc 3240
          tgtactttcc tgctggggga agcagtagcg ggaccgttaa tccagtacct acgaccgcct 3300
          ctcccatatc ttctatcttt agtaggactg gtgaccctgc tcccaacatg gagaatatca 3360
          cctccgggtt tctgggccca ctcctggtcc ttcaggccgg attcttcctg ctgactcgaa 3420
          tcctcaccat accccagagc ctggacagct ggtggacaag cctgaatttt ctgggaggaa 3480
          ctcctgtatg cctgggacaa aattcacagt cccctacaag taaccattca ccgacaagtt 3540
          gtcctcccat ctgtcccgga tacaggtgga tgtgcctgcg aaggttcatc atcttcctct 3600
          tcatcctctt gctttgcctt attttcctcc tggttcttct ggactatcag ggcatgctgc 3660
          ctgtgtgccc actgatacca ggatctagta ctaccagcac aggcccgtgt aagacctgta 3720
          caattccagc acaagggact agtatgttcc cctcctgctg ttgtactaag ccaagcgacg 3780
          gtaattgcac gtgtatccca atcccgtcct cctgggcgtt tgccaagtac ctctgggaat 3840
          gggcctcagt cagattttca tggcttagtc ttttggtgcc gttcgtgcag tggtttgtgg 3900
          gactctctcc gactgtgtgg ctcagcgtga tctggatgat gtggtactgg ggcccttccc 3960
          tttacaacat actgtctcca ttccttcccc tgctgccaat cttcttttgc ctgtgggtct 4020
          atattgggtc cggagcgact aacttttccc tgctgaaaca agcgggtgac gtcgaagaga 4080
          atccgggacc tatggctagg cccctgtgta cacttttgct cctgatggcc accctcgctg 4140
          gagctctggc aagcggtgga tggagctcaa agccgcggaa agggatgggt actaacctgt 4200
          ccgtaccaaa tcccctggga ttttttccag accaccaact cgatcctgct tttggcgcaa 4260
          attccaacaa tcccgactgg gactttaacc ctaacaagga ccactggcct gatgccaaca 4320
          aggtgggggc aggagccttt ggtcccggct tcaccccacc ccatggaggt cttttgggat 4380
          ggtcaccaca ggcccagggc atcctgacca ctgtccctgc tgctccaccg ccagcttcta 4440
          ctaatcgaca gagcgggagg cagccgaccc ccctgagtcc ccccctgcgg gatacccacc 4500
          ctcaggca 4508
           <![CDATA[ <210> 55]]>
           <![CDATA[ <211> 44]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> 5' UTR]]>
           <![CDATA[ <400> 55]]>
          ataggcggcg catgagagaa gcccagacca attacctacc caaa 44
           <![CDATA[ <210> 56]]>
           <![CDATA[ <211> 195]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> 5' copy sequence]]>
           <![CDATA[ <400> 56]]>
          taggagaaag ttcacgttga catcgaggaa gacagcccat tcctcagagc tttgcagcgg 60
          agcttcccgc agtttgaggt agaagccaag caggtcactg ataatgacca tgctaatgcc 120
          agagcgtttt cgcatctggc ttcaaaactg atcgaaacgg aggtggaccc atccgacacg 180
          atccttgaca ttgga 195
           <![CDATA[ <210> 57]]>
           <![CDATA[ <211> 142]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> DLP capsid enhancer]]>
           <![CDATA[ <400> 57]]>
          atagtcagca tagtacattt catctgacta atactacaac accacccacca tgaatagagg 60
          attctttaac atgctcggcc gccgccccctt cccggccccc actgccatgt ggaggccgcg 120
          gagaaggagg caggcggccc cg 142
           <![CDATA[ <210> 58]]>
           <![CDATA[ <211> 1602]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> nsp1 coding sequence]]>
           <![CDATA[ <400> 58]]>
          gagaaagttc acgttgacat cgaggaagac agccattcc tcagagcttt gcagcggagc 60
          ttcccgcagt ttgaggtaga agccaagcag gtcactgata atgaccatgc taatgccaga 120
          gcgttttcgc atctggcttc aaaactgatc gaaacggagg tggacccatc cgacacgatc 180
          cttgacattg gaagtgcgcc cgcccgcaga atgtattcta agcacaagta tcattgtatc 240
          tgtccgatga gatgtgcgga agatccggac agattgtata agtatgcaac taagctgaag 300
          aaaaactgta aggaaataac tgataaggaa ttggacaaga aaatgaagga gctcgccgcc 360
          gtcatgagcg accctgacct ggaaactgag actatgtgcc tccacgacga cgagtcgtgt 420
          cgctacgaag ggcaagtcgc tgtttaccag gatgtatacg cggttgacgg accgacaagt 480
          ctctatcacc aagccaataa gggagttaga gtcgcctact ggataggctt tgacaccacc 540
          ccttttatgt ttaagaactt ggctggagca tatccatcat actctaccaa ctgggccgac 600
          gaaaccgtgt taacggctcg taacataggc ctatgcagct ctgacgttat ggagcggtca 660
          cgtagaggga tgtccattct tagaaagaag tatttgaaac catccaacaa tgttctattc 720
          tctgttggct cgaccatcta ccacgagaag agggacttac tgaggagctg gcacctgccg 780
          tctgtatttc acttacgtgg caagcaaaat tacacatgtc ggtgtgagac tatagttagt 840
          tgcgacgggt acgtcgttaa aagaatagct atcagtccag gcctgtatgg gaagccttca 900
          ggctatgctg ctacgatgca ccgcgaggga ttcttgtgct gcaaagtgac agacacattg 960
          aacggggaga gggtctcttt tcccgtgtgc acgtatgtgc cagctacatt gtgtgaccaa 1020
          atgactggca tactggcaac agatgtcagt gcggacgacg cgcaaaaact gctggttggg 1080
          ctcaaccagc gtatagtcgt caacggtcgc accccagagaa acaccaatac catgaaaaat 1140
          taccttttgc ccgtagtggc ccaggcattt gctaggtggg caaaggaata taaggaagat 1200
          caagaagatg aaaggccact aggactacga gatagacagt tagtcatggg gtgttgttgg 1260
          gcttttagaa ggcacaagat aacatctatt tataagcgcc cggataccca aaccatcatc 1320
          aaagtgaaca gcgatttcca ctcattcgtg ctgcccagga taggcagtaa cacattggag 1380
          atcgggctga gaacaagaat caggaaaatg ttagaggagc acaaggagcc gtcacctctc 1440
          attaccgccg aggacgtaca agaagctaag tgcgcagccg atgaggctaa ggaggtgcgt 1500
          gaagccgagg agttgcgcgc agctctacca cctttggcag ctgatgttga ggagcccact 1560
          ctggaagccg atgtcgactt gatgttacaa gaggctgggg cc 1602
           <![CDATA[ <210> 59]]>
           <![CDATA[ <211> 2382]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> nsp2 coding sequence]]>
           <![CDATA[ <400> 59]]>
          ggctcagtgg agacaccctcg tggcttgata aaggttacca gctacgatgg cgaggacaag 60
          atcggctctt acgctgtgct ttctccgcag gctgtactca agagtgaaaa attatcttgc 120
          atccaccctc tcgctgaaca agtcatagtg ataacacact ctggccgaaa agggcgttat 180
          gccgtggaac cataccatgg taaagtagtg gtgccagagg gacatgcaat acccgtccag 240
          gactttcaag ctctgagtga aagtgccacc attgtgtaca acgaacgtga gttcgtaaac 300
          aggtacctgc accatattgc cacacatgga ggagcgctga acactgatga agaatattac 360
          aaaactgtca agcccagcga gcacgacggc gaatacctgt acgacatcga caggaaacag 420
          tgcgtcaaga aagaactagt cactgggcta gggctcacag gcgagctggt ggatcctccc 480
          ttccatgaat tcgcctacga gagtctgaga acacgaccag ccgctcctta ccaagtacca 540
          accatagggg tgtatggcgt gccaggatca ggcaagtctg gcatcattaa aagcgcagtc 600
          accaaaaaag atctagtggt gagcgccaag aaagaaaact gtgcagaaat tataagggac 660
          gtcaagaaaa tgaaagggct ggacgtcaat gccagaactg tggactcagt gctcttgaat 720
          ggatgcaaac accccgtaga gaccctgtat attgacgaag cttttgcttg tcatgcaggt 780
          actctcagag cgctcatagc catttataaga cctaaaaagg cagtgctctg cggggatccc 840
          aaacagtgcg gtttttttaa catgatgtgc ctgaaagtgc attttaacca cgagatttgc 900
          acacaagtct tccacaaaag catctctcgc cgttgcacta aatctgtgac ttcggtcgtc 960
          tcaaccttgt tttacgacaa aaaaatgaga acgacgaatc cgaaagagac taagattgtg 1020
          attgacacta ccggcagtac caaacctaag caggacgatc tcattctcac ttgtttcaga 1080
          gggtgggtga agcagttgca aatagattac aaaggcaacg aaataatgac ggcagctgcc 1140
          tctcaagggc tgacccgtaa aggtgtgtat gccgttcggt acaaggtgaa tgaaaatcct 1200
          ctgtacgcac ccacctctga acatgtgaac gtcctactga cccgcacgga ggaccgcatc 1260
          gtgtggaaaa cactagccgg cgacccatgg ataaaaacac tgactgccaa gtaccctggg 1320
          aatttcactg ccacgataga ggagtggcaa gcagagcatg atgccatcat gaggcacatc 1380
          ttggagagac cggaccctac cgacgtcttc cagaataagg caaacgtgtg ttgggccaag 1440
          gctttagtgc cggtgctgaa gaccgctggc atagacatga ccactgaaca atggaacact 1500
          gtggattatt ttgaaacgga caaagctcac tcagcagaga tagtattgaa ccaactatgc 1560
          gtgaggttct ttggactcga tctggactcc ggtctatttt ctgcacccac tgttccgtta 1620
          tccattagga ataatcactg ggataactcc ccgtcgccta acatgtacgg gctgaataaa 1680
          gaagtggtcc gtcagctctc tcgcaggtac ccacaactgc ctcgggcagt tgccactgga 1740
          agagtctatg acatgaacac tggtacactg cgcaattatg atccgcgcat aaacctagta 1800
          cctgtaaaca gaagactgcc tcatgcttta gtcctccacc ataatgaaca cccacagagt 1860
          gacttttctt cattcgtcag caaattgaag ggcagaactg tcctggtggt cggggaaaag 1920
          ttgtccgtcc caggcaaaat ggttgactgg ttgtcagacc ggcctgaggc taccttcaga 1980
          gctcggctgg atttaggcat cccaggtgat gtgcccaaat atgacataat atttgttaat 2040
          gtgaggaccc catataaata ccatcactat cagcagtgtg aagaccatgc cattaagctt 2100
          agcatgttga ccaagaaagc ttgtctgcat ctgaatcccg gcggaacctg tgtcagcata 2160
          ggttatggtt acgctgacag ggccagcgaa agcatcattg gtgctatagc gcggcagttc 2220
          aagttttccc gggtatgcaa accgaaatcc tcacttgaag agacggaagt tctgtttgta 2280
          ttcattgggt acgatcgcaa ggcccgtacg cacaatcctt acaagctttc atcaaccttg 2340
          accaacattt atacaggttc cagactccac gaagccggat gt 2382
           <![CDATA[ <210> 60]]>
           <![CDATA[ <211> 1671]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> nsp3 coding sequence]]>
           <![CDATA[ <400> 60]]>
          gcaccctcat atcatgtggt gcgaggggat attgccacgg ccaccgaagg agtgattata 60
          aatgctgcta acagcaaagg acaacctggc ggaggggtgt gcggagcgct gtataagaaa 120
          ttcccggaaa gcttcgattt acagccgatc gaagtaggaa aagcgcgact ggtcaaaggt 180
          gcagctaaac atatcattca tgccgtagga ccaaacttca acaaagtttc ggaggttgaa 240
          ggtgacaaac agttggcaga ggcttatgag tccatcgcta agattgtcaa cgataacaat 300
          tacaagtcag tagcgattcc actgttgtcc accggcatct tttccgggaa caaagatcga 360
          ctaacccaat cattgaacca tttgctgaca gctttagaca ccactgatgc agatgtagcc 420
          atatactgca gggacaagaa atgggaaatg actctcaagg aagcagtggc taggagaa 480
          gcagtggagg agatatgcat atccgacgac tcttcagtga cagaacctga tgcagagctg 540
          gtgagggtgc atccgaagag ttctttggct ggaaggaagg gctacagcac aagcgatggc 600
          aaaactttct catatttgga agggaccaag tttcaccagg cggccaagga tatagcagaa 660
          attaatgcca tgtggcccgt tgcaacggag gccaatgagc aggtatgcat gtatatcctc 720
          ggagaaagca tgagcagtat taggtcgaaa tgccccgtcg aagagtcgga agcctccaca 780
          ccacctagca cgctgccttg cttgtgcatc catgccatga ctccagaaag agtacagcgc 840
          ctaaaagcct cacgtccaga acaaattact gtgtgctcat cctttccatt gccgaagtat 900
          agaatcactg gtgtgcagaa gatccaatgc tcccagccta tattgttctc accgaaagtg 960
          cctgcgtata ttcatccaag gaagtatctc gtggaaacac caccggtaga cgagactccg 1020
          gagccatcgg cagagaacca atccacagag gggacacctg aacaaccacc acttataacc 1080
          gaggatgaga ccaggactag aacgcctgag ccgatcatca tcgaagagga agaagaggat 1140
          agcataagtt tgctgtcaga tggcccgacc caccaggtgc tgcaagtcga ggcagacatt 1200
          cacgggccgc cctctgtatc tagctcatcc tggtccattc ctcatgcatc cgactttgat 1260
          gtggacagtt tatccatact tgacaccctg gagggagcta gcgtgaccag cggggcaacg 1320
          tcagccgaga ctaactctta cttcgcaaag agtatggagt ttctggcgcg accggtgcct 1380
          gcgcctcgaa cagtattcag gaaccctcca catcccgctc cgcgcacaag aacaccgtca 1440
          cttgcaccca gcagggcctg ctcgagaacc agcctagttt ccaccccgcc aggcgtgaat 1500
          agggtgatca ctagagagga gctcgaggcg cttaccccgt cacgcactcc tagcaggtcg 1560
          gtctcgagaa ccagcctggt ctccaacccg ccaggcgtaa atagggtgat tacaagagag 1620
          gagtttgagg cgttcgtagc acaacaacaa tgacggtttg atgcgggtgc a 1671
           <![CDATA[ <210> 61]]>
           <![CDATA[ <211> 1821]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> nsp4 coding sequence]]>
           <![CDATA[ <400> 61]]>
          tacatctttt cctccgacac cggtcaaggg catttacaac aaaaatcagt aaggcaaacg 60
          gtgctatccg aagtggtgtt ggagaggacc gaattggaga tttcgtatgc cccgcgcctc 120
          gaccaagaaa aagaagaatt actacgcaag aaattacagt taaatcccac acctgctaac 180
          agaagcagat accagtccag gaaggtggag aacatgaaag ccataacagc tagacgtatt 240
          ctgcaaggcc tagggcatta tttgaaggca gaaggaaaag tggagtgcta ccgaaccctg 300
          catcctgttc ctttgtattc atctagtgtg aaccgtgcct tttcaagccc caaggtcgca 360
          gtggaagcct gtaacgccat gttgaaagag aactttccga ctgtggcttc ttactgtatt 420
          attccagagt acgatgccta tttggacatg gttgacggag cttcatgctg cttagacact 480
          gccagttttt gccctgcaaa gctgcgcagc tttccaaaga aacactccta tttggaaccc 540
          acaatacgat cggcagtgcc ttcagcgatc cagaacacgc tccagaacgt cctggcagct 600
          gccacaaaaa gaaattgcaa tgtcacgcaa atgagagaat tgcccgtatt ggattcggcg 660
          gcctttaatg tggaatgctt caagaaatat gcgtgtaata atgaatattg ggaaacgttt 720
          aaagaaaacc ccatcaggct tactgaagaa aacgtggtaa attacattac caaattaaaa 780
          gcaccaaaag ctgctgctct ttttgcgaag acacataatt tgaatatgtt gcaggacata 840
          ccaatggaca ggtttgtaat ggacttaaag agagacgtga aagtgactcc aggaacaaaa 900
          catactgaag aacggcccaa ggtacaggtg atccaggctg ccgatccgct agcaacagcg 960
          tatctgtgcg gaatccaccg agagctggtt aggagattaa atgcggtcct gcttccgaac 1020
          attcataacac tgtttgatat gtcggctgaa gactttgacg ctattatagc cgagcacttc 1080
          cagcctgggg attgtgttct ggaaactgac atcgcgtcgt ttgataaaag tgaggacgac 1140
          gccatggctc tgaccgcgtt aatgattctg gaagacttag gtgtggacgc agagctgttg 1200
          acgctgattg aggcggcttt cggcgaaatt tcatcaatac atttgcccac taaaactaaa 1260
          tttaaattcg gagccatgat gaaatctgga atgttcctca cactgtttgt gaacacagtc 1320
          attaacattg taatcgcaag cagagtgttg agagaacggc taaccggatc accatgtgca 1380
          gcattcattg gagatgacaa tatcgtgaaa ggagtcaaat cggacaaatt aatggcagac 1440
          aggtgcgcca cctggttgaa tatggaagtc aagattatag atgctgtggt gggcgagaaa 1500
          gcgccttattctgtggagg gtttattttg tgtgactccg tgaccggcac agcgtgccgt 1560
          gtggcagacc ccctaaaaag gctgtttaag cttggcaaac ctctggcagc agacgatgaa 1620
          catgatgatg acaggagaag ggcattgcat gaagagtcaa cacgctggaa ccgagtgggt 1680
          attctttcag agctgtgcaa ggcagtagaa tcaaggtatg aaaccgtagg aacttccatc 1740
          atagttatgg ccatgactac tctagctagc agtgttaaat cattcagcta cctgagaggg 1800
          gcccctataa ctctctacgg c 1821
           <![CDATA[ <210> 62]]>
           <![CDATA[ <211> 24]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> 26S subgenic promoter]]>
           <![CDATA[ <400> 62]]>
          ctctctacgg ctaacctgaa tgga 24
           <![CDATA[ <210> 63]]>
           <![CDATA[ <211> 117]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> 3' UTR]]>
           <![CDATA[ <400> 63]]>
          atacagcagc aattggcaag ctgcttacat agaactcgcg gcgattggca tgccgcttta 60
          aaattttttttatttttc ttttcttttc cgaatcggat tttgttttta atatttc 117
           <![CDATA[ <210> 64]]>
           <![CDATA[ <211> 40]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Polyadenosine]]>
           <![CDATA[ <400> 64]]>
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 40
           <![CDATA[ <210> 65]]>
           <![CDATA[ <211> 11338]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Core-2A-Pol Replicon]]>
           <![CDATA[ <400> 65]]>
          ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60
          ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120
          aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180
          tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240
          tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300
          ttctttaaca tgctcggccg ccgcccccttc ccggccccca ctgccatgtg gaggccgcgg 360
          agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420
          ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480
          ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540
          actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600
          acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660
          tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720
          ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780
          gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840
          atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900
          gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960
          gcctactgga taggctttga caccaccccct tttatgttta agaacttggc tggagcatat 1020
          ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080
          tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140
          ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200
          gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260
          acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320
          agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380
          ttgtgctgca aagtgacaga cacattgaac ggggagagggg tctcttttcc cgtgtgcacg 1440
          tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500
          gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560
          cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620
          aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680
          agacagttag tcatggggtg ttgttggggct tttagaaggc acaagataac atctatttat 1740
          aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800
          cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860
          gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920
          gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980
          ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040
          gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100
          gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160
          ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220
          gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagagggg acatgcaata 2280
          cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340
          ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400
          gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460
          aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520
          gatcctccct tccatgaatt cgcctacgag agtctgagaa cacgaccagc cgctccttac 2580
          caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640
          agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700
          ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760
          ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820
          catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880
          ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940
          gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000
          tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060
          aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120
          tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180
          gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240
          gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300
          gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360
          taccctggga atttcactgc cacgatagag gagtggcaag cagagcatga tgccatcatg 3420
          aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480
          tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540
          tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600
          caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660
          gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720
          ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780
          gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840
          aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900
          ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960
          ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020
          accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080
          tttgttaatg tgaggaccccc atataaatac catcactatc agcagtgtga agaccatgcc 4140
          attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200
          gtcagcatag gttatggtta cgctgacagg gccagcgaaa gcatcattgg tgctatagcg 4260
          cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320
          ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380
          tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440
          tatcatgtgg tgcgaggggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500
          aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560
          agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620
          catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680
          cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740
          gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800
          tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860
          agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920
          gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980
          catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040
          tcatatttgg aagggaccaa gtttcaccag gcggccaagg atatagcaga aattaatgcc 5100
          atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160
          atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220
          acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280
          tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340
          ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400
          attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460
          gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520
          accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580
          ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640
          ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700
          ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760
          actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820
          acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880
          agcagggcct gctcgagaac cagcctagtt tccaccccgc caggcgtgaa tagggtgatc 5940
          actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000
          accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060
          gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120
          accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180
          ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240
          ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300
          aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360
          tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420
          tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480
          atgttgaaag agaactttcc gactgtggct tcttactgta ttaattccaga gtacgatgcc 6540
          tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600
          aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660
          ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720
          aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggcctttaa tgtggaatgc 6780
          ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840
          cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900
          ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960
          atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020
          aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080
          cgagagctgg ttaggagatt aaatgcggtc ctgcttccga aattcatac actgtttgat 7140
          atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200
          ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260
          ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320
          ttcggcgaaa tttcatcaat aatttgccc actaaaacta aatttaaatt cggagccatg 7380
          atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440
          agcagagtgttgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500
          aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560
          aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttctgtgga 7620
          gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680
          aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740
          agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800
          aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860
          actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920
          ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgg ctcgacctct 7980
          gtgtaccctg ctactcctga tggctaccct ggctggagct ctggccagcg acatcgaccc 8040
          ttacaaggag ttcggcgcca gcgtggaact gctgtctttt ctgcccagtg atttctttcc 8100
          ttccattcga gacctgctgg ataccgcctc tgctctgtat cgggaagccc tggagagccc 8160
          agaacactgc tccccacacc ataccgctct gcgacaggca atcctgtgct ggggggagct 8220
          gatgaacctg gccacatggg tgggatcgaa tctggaggac cccgcttcac gggaactggt 8280
          ggtcagctac gtgaacgtca atatggggcct gaaaatccgc cagctgctgt ggttccatat 8340
          tagctgcctg acttttggac gagagaccgt gctggaatac ctggtgtcct tcggcgtctg 8400
          gattcgcact ccccctgctt atcgaccacc caacgcacca attctgtcca ccctgcccga 8460
          gaccacagtg gtccgtcgcc gtggaagcgg agctactaac ttcagcctgc tgaagcaggc 8520
          tggagacgtg gaggagaacc ctggacctat ggctcgacct ctgtgtaccc tgctactcct 8580
          gatggctacc ctggctggag ctctggccag catgcccctg tcttaccagc actttagaaa 8640
          gcttctgctg ctggacgatg aagccgggcc tctggaggaa gagctgccaa ggctggcaga 8700
          cgaggggctg aaccggagag tggccgaaga tctgaatctg ggaaacctga acgtgagcat 8760
          cccttggact cataaagtcg gcaacttcac cgggctgtac agctccacag tgcctgtctt 8820
          caatccagag tggcagacac catcctttcc caacattcac ctgcaggagg acatcattaa 8880
          tagatgcgaa cagttcgtgg gacctctgac agtcaacgaa aagaggcgcc tgaaactgat 8940
          catgcctgcc aggttttacc caaatgtgac taagtatctg ccactggata agggcatcaa 9000
          gccttactat ccagagcacc tggtgaacca ttacttccag actagacact atctgcatac 9060
          cctgtggaag gccggaatcc tgtacaaacg agaaactacc cggagtgctt cattttgtgg 9120
          ctccccatat tcttgggaac aggagctgca gcatggcagg ctggtgttcc agaccagcaa 9180
          acgccacggg gatgagtcct tttgcagcca gtctagtggc atcctgagca gatcccccgt 9240
          ggggccttgt attcagtctc agctgcggaa gagtagactg ggactgcagc cacagcaggg 9300
          acacctggca cgacggcagc agggaaggtc tggcagtatc cgggctagag tgcatcccac 9360
          aactagaagg accttcggcg tcgagccatc aggaagcggc cacatcgaca acagcgcatc 9420
          aagctcctct agttgcctgc atcagtcagc cgtgagaaag gccgcttaca gccacctgtc 9480
          cacatctaaa aggcactcaa gctccgggca tgctgtggag ctgcacaaca tccctccaaa 9540
          ttctgcacgc agtcagtcag aaggacccgt gttcagctgc tggtggctgc agtttcggaa 9600
          ctcaaagcct tgcagcgact attgtctgag ccatattgtg aatctgctgg aggattgggg 9660
          cccttgtacc gagcacgggg aacaccatat caggattcca cgaacaccag cacgagtgac 9720
          tggagggtg ttcctggtgg acaagaaccc ccacaatact accgagagcc ggctggtggt 9780
          cgatttcagt cagttttcaa gaggcaacac aagggtgtca tggcccaaat tcgccgtccc 9840
          taatctgcag agtctgacta acctgctgtc tagtaatctg agctggctgt ccctggacgt 9900
          gtccgcagcc ttttaccacc tgcctctgca tccagctgca atgccccatc tgctggtggg 9960
          gtcaagcgga ctgagtcgct acgtcgcccg actgtcctct aactcacgca tcattaatca 10020
          ccagcatggc accatgcaga acctgcacga tagctgttcc cggaatctgt acgtgtctct 10080
          gctgctgctg tataagacat tcggcagaaa actgcacctg tacagccatc ctatcattct 10140
          ggggtttagg aagatcccaa tgggagtggg actgagcccc ttcctgctgg cacagtttac 10200
          ctccgccatt tgctctgtgg tccgccgagc cttccccacac tgtctggctt tttcctatat 10260
          gaacaatgtg gtcctgggcg ccaaatccgt gcagcatctg gagtctctgt tcacagctgt 10320
          cactaacttt ctgctgagcc tggggatcca cctgaaccca aataagacta aacgctgggg 10380
          gtacagcctg aatttcatgg gatatgtgat tggatcctgg gggaccctgc cacaggagca 10440
          catcgtgcag aagatcaagg aatgctttcg gaagctgccc gtcaacagac ctatcgactg 10500
          gaaagtgtgc cagcggattg tcggactgct gggcttcgcc gctcccttta cccagtgcgg 10560
          gtacccagca ctgatgcccc tgtatgcctg tatccagtct aagcaggctt tcacctttag 10620
          tcctacatac aaggcattcc tgtgcaaaca gtacctgaac ctgtatccag tggcaaggca 10680
          gcgacctgga ctgtgccagg tctttgcaaa tgccactcct accggctggg ggctggctat 10740
          cggacatcag cgaatgcggg gcacattcgt ggcccccctg cctattcaca ctgctcagct 10800
          gctggcagcc tgctttgcta gatctaggag tggagcaaag ctgatcggca ccgacaatag 10860
          tgtggtcctg tcaagaaaat acacatcctt cccatggctg ctgggatgtg ctgcaaactg 10920
          gattctgagg ggcaccagct tcgtgtacgt cccctcagcc ctgaatcctg ctgacgatcc 10980
          atcccgcggg cgactgggac tgtaccgacc tctgctgaga ctgcccttca ggcctacaac 11040
          tggccggaca tctctgtatg ccgattcacc aagcgtgccc tcacacctgc ctgacagagt 11100
          ccactttgct tcacccctgc acgtcgcttg gcggcctcca taaggcgcgc cgtttaaacg 11160
          gccggcctta attaagtaac gatacagcag caattggcaa gctgcttaca tagaactcgc 11220
          ggcgattggc atgccgcttt aaaattttta ttttattttt cttttctttt ccgaatcgga 11280
          ttttgttttt aatatttcaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 11338
           <![CDATA[ <210> 66]]>
           <![CDATA[ <211> 11862]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-IRES (EMCV)-core replicon]]>
           <![CDATA[ <400> 66]]> ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60 ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120 aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180 tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240 tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300 ttctttaaca tgctcggccg ccgccccttc ccggccccca ctgccatgtg gaggccgcgg 360 agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420 ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480 ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540 actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600 acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660 tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720 ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780 gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840 atgtgcctc c acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900 gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960 gcctactgga taggctttga caccacccct tttatgttta agaacttggc tggagcatat 1020 ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080 tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140 ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200 gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260 acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320 agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380 ttgtgctgca aagtgacaga cacattgaac ggggagaggg tctcttttcc cgtgtgcacg 1440 tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500 gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560 cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620 aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680 agacagttag tcatgg ggtg ttgttgggct tttagaaggc acaagataac atctatttat 1740 aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800 cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860 gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920 gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980 ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040 gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100 gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160 ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220 gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagaggg acatgcaata 2280 cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340 ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400 gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460 aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520 gatcctccct tccatgaatt c gcctacgag agtctgagaa cacgaccagc cgctccttac 2580 caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640 agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700 ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760 ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820 catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880 ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940 gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000 tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060 aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120 tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180 gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240 gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300 gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360 taccctggga atttcactgc cacgata gag gagtggcaag cagagcatga tgccatcatg 3420 aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480 tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540 tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600 caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660 gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720 ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780 gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840 aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900 ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960 ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020 accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080 tttgttaatg tgaggacccc atataaatac catcactatc agcagtgtga agaccatgcc 4140 attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200 gtcagcatag gttatggtta cgctgacagg gc cagcgaaa gcatcattgg tgctatagcg 4260 cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320 ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380 tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440 tatcatgtgg tgcgagggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500 aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560 agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620 catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680 cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740 gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800 tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860 agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920 gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980 catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040 tcatatttgg aagggaccaa gtttcaccag gcggccaa gg atatagcaga aattaatgcc 5100 atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160 atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220 acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280 tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340 ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400 attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460 gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520 accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580 ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640 ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700 ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760 actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820 acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880 agcagggcct gctcgagaac cagcctagtt tccaccccgc cag gcgtgaa tagggtgatc 5940 actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000 accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060 gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120 accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180 ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240 ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300 aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360 tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420 tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480 atgttgaaag agaactttcc gactgtggct tcttactgta ttattccaga gtacgatgcc 6540 tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600 aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660 ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720 aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggccttta a tgtggaatgc 6780 ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840 cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900 ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960 atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020 aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080 cgagagctgg ttaggagatt aaatgcggtc ctgcttccga acattcatac actgtttgat 7140 atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200 ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260 ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320 ttcggcgaaa tttcatcaat acatttgccc actaaaacta aatttaaatt cggagccatg 7380 atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440 agcagagtgt tgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500 aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560 aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttc tgtgga 7620 gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680 aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740 agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800 aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860 actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920 ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgg ctcgacctct 7980 gtgtaccctg ctactcctga tggctaccct ggctggagct ctggccagca tgcccctgtc 8040 ttaccagcac tttagaaagc ttctgctgct ggacgatgaa gccgggcctc tggaggaaga 8100 gctgccaagg ctggcagacg aggggctgaa ccggagagtg gccgaagatc tgaatctggg 8160 aaacctgaac gtgagcatcc cttggactca taaagtcggc aacttcaccg ggctgtacag 8220 ctccacagtg cctgtcttca atccagagtg gcagacacca tcctttccca acattcacct 8280 gcaggaggac atcattaata gatgcgaaca gttcgtggga cctctgacag tcaacgaaaa 8340 gaggcgcctg aaactgatca tgcctgccag gttttaccca aatgtgacta agtatctgcc 8400 actggataag ggcatcaagc cttactatcc agagcacctg gtgaaccatt acttccagac 8460 tagacactat ctgcataccc tgtggaaggc cggaatcctg tacaaacgag aaactacccg 8520 gagtgcttca ttttgtggct ccccatattc ttgggaacag gagctgcagc atggcaggct 8580 ggtgttccag accagcaaac gccacgggga tgagtccttt tgcagccagt ctagtggcat 8640 cctgagcaga tcccccgtgg ggccttgtat tcagtctcag ctgcggaaga gtagactggg 8700 actgcagcca cagcagggac acctggcacg acggcagcag ggaaggtctg gcagtatccg 8760 ggctagagtg catcccacaa ctagaaggac cttcggcgtc gagccatcag gaagcggcca 8820 catcgacaac agcgcatcaa gctcctctag ttgcctgcat cagtcagccg tgagaaaggc 8880 cgcttacagc cacctgtcca catctaaaag gcactcaagc tccgggcatg ctgtggagct 8940 gcacaacatc cctccaaatt ctgcacgcag tcagtcagaa ggacccgtgt tcagctgctg 9000 gtggctgcag tttcggaact caaagccttg cagcgactat tgtctgagcc atattgtgaa 9060 tctgctggag gattggggcc cttgtaccga gcacggggaa caccatatca ggattccacg 9120 aacaccagca cgagtgactg gaggggtgtt cctggtggac aagaaccccc acaatactac 9180 cgagagccgg ctggtggtcg atttcagtca gttttcaaga ggcaacacaa gggtgtcatg 9240 gcccaaattc gccgtcccta atctgcagag tctgactaac ctgctgtcta gtaatctgag 9300 ctggctgtcc ctggacgtgt ccgcagcctt ttaccacctg cctctgcatc cagctgcaat 9360 gccccatctg ctggtggggt caagcggact gagtcgctac gtcgcccgac tgtcctctaa 9420 ctcacgcatc attaatcacc agcatggcac catgcagaac ctgcacgata gctgttcccg 9480 gaatctgtac gtgtctctgc tgctgctgta taagacattc ggcagaaaac tgcacctgta 9540 cagccatcct atcattctgg ggtttaggaa gatcccaatg ggagtgggac tgagcccctt 9600 cctgctggca cagtttacct ccgccatttg ctctgtggtc cgccgagcct tcccacactg 9660 tctggctttt tcctatatga acaatgtggt cctgggcgcc aaatccgtgc agcatctgga 9720 gtctctgttc acagctgtca ctaactttct gctgagcctg gggatccacc tgaacccaaa 9780 taagactaaa cgctgggggt acagcctgaa tttcatggga tatgtgattg gatcctgggg 9840 gaccctgcca caggagcaca tcgtgcagaa gatcaaggaa tgctttcgga agctgcccgt 9900 caacagacct atcgactgga aagtgtgcca gcggattgtc ggactgctgg gcttcgccgc 9960 tccctttacc cagtgcgggt acccagcact gatgcccctg tatgcctgta tccagtctaa 10020 gcaggctttc acctttagtc ctacatacaa ggcattcctg tgcaaacagt acctgaacct 10080 gtatccagtg gcaaggcagc gacctggact gtgccaggtc tttgcaaatg ccactcctac 10140 cgg ctggggg ctggctatcg gacatcagcg aatgcggggc acattcgtgg cccccctgcc 10200 tattcacact gctcagctgc tggcagcctg ctttgctaga tctaggagtg gagcaaagct 10260 gatcggcacc gacaatagtg tggtcctgtc aagaaaatac acatccttcc catggctgct 10320 gggatgtgct gcaaactgga ttctgagggg caccagcttc gtgtacgtcc cctcagccct 10380 gaatcctgct gacgatccat cccgcgggcg actgggactg taccgacctc tgctgagact 10440 gcccttcagg cctacaactg gccggacatc tctgtatgcc gattcaccaa gcgtgccctc 10500 acacctgcct gacagagtcc actttgcttc acccctgcac gtcgcttggc ggcctccata 10560 agcccctctc cctccccccc ccctaacgtt actggccgaa gccgcttgga ataaggccgg 10620 tgtgcgtttg tctatatgtt attttccacc atattgccgt cttttggcaa tgtgagggcc 10680 cggaaacctg gccctgtctt cttgacgagc attcctaggg gtctttcccc tctcgccaaa 10740 ggaatgcaag gtctgttgaa tgtcgtgaag gaagcagttc ctctggaagc ttcttgaaga 10800 caaacaacgt ctgtagcgac cctttgcagg cagcggaacc ccccacctgg cgacaggtgc 10860 ctctgcggcc aaaagccacg tgtataagat acacctgcaa aggcggcaca accccagtgc 10920 cacgttgtga gttggatagt tgtggaaaga gtcaaatggc tctcctcaag cgtattcaac 1 0980 aaggggctga aggatgccca gaaggtaccc cattgtatgg gatctgatct ggggcctcgg 11040 tgcacatgct ttacatgtgt ttagtcgagg ttaaaaaacg tctaggcccc ccgaaccacg 11100 gggacgtggt tttcctttga aaaacacgat gataatatgg ccacaaccat ggctcgacct 11160 ctgtgtaccc tgctactcct gatggctacc ctggctggag ctctggccag cgacatcgac 11220 ccttacaagg agttcggcgc cagcgtggaa ctgctgtctt ttctgcccag tgatttcttt 11280 ccttccattc gagacctgct ggataccgcc tctgctctgt atcgggaagc cctggagagc 11340 ccagaacact gctccccaca ccataccgct ctgcgacagg caatcctgtg ctggggggag 11400 ctgatgaacc tggccacatg ggtgggatcg aatctggagg accccgcttc acgggaactg 11460 gtggtcagct acgtgaacgt caatatgggc ctgaaaatcc gccagctgct gtggttccat 11520 attagctgcc tgacttttgg acgagagacc gtgctggaat acctggtgtc cttcggcgtc 11580 tggattcgca ctccccctgc ttatcgacca cccaacgcac caattctgtc caccctgccc 11640 gagaccacag tggtccgtcg ccgttaaggc gcgccgttta aacggccggc cttaattaag 11700 taacgataca gcagcaattg gcaagctgct tacatagaac tcgcggcgat tggcatgccg 11760 ctttaaaatt tttattttat ttttcttttc ttttccgaat cggattttgt tttt aatatt 11820 tcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 11862 <![CDATA[ <210> 67]]>
           <![CDATA[ <211> 9490]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> preS1-2A-PreS2.S replicon]]>
           <![CDATA[ <400> 67]]>
          ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60
          ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120
          aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180
          tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240
          tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300
          ttctttaaca tgctcggccg ccgcccccttc ccggccccca ctgccatgtg gaggccgcgg 360
          agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420
          ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480
          ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540
          actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600
          acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660
          tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720
          ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780
          gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840
          atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900
          gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960
          gcctactgga taggctttga caccaccccct tttatgttta agaacttggc tggagcatat 1020
          ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080
          tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140
          ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200
          gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260
          acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320
          agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380
          ttgtgctgca aagtgacaga cacattgaac ggggagagggg tctcttttcc cgtgtgcacg 1440
          tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500
          gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560
          cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620
          aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680
          agacagttag tcatggggtg ttgttggggct tttagaaggc acaagataac atctatttat 1740
          aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800
          cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860
          gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920
          gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980
          ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040
          gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100
          gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160
          ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220
          gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagagggg acatgcaata 2280
          cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340
          ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400
          gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460
          aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520
          gatcctccct tccatgaatt cgcctacgag agtctgagaa cacgaccagc cgctccttac 2580
          caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640
          agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700
          ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760
          ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820
          catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880
          ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940
          gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000
          tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060
          aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120
          tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180
          gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240
          gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300
          gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360
          taccctggga atttcactgc cacgatagag gagtggcaag cagagcatga tgccatcatg 3420
          aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480
          tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540
          tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600
          caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660
          gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720
          ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780
          gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840
          aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900
          ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960
          ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020
          accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080
          tttgttaatg tgaggaccccc atataaatac catcactatc agcagtgtga agaccatgcc 4140
          attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200
          gtcagcatag gttatggtta cgctgacagg gccagcgaaa gcatcattgg tgctatagcg 4260
          cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320
          ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380
          tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440
          tatcatgtgg tgcgaggggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500
          aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560
          agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620
          catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680
          cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740
          gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800
          tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860
          agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920
          gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980
          catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040
          tcatatttgg aagggaccaa gtttcaccag gcggccaagg atatagcaga aattaatgcc 5100
          atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160
          atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220
          acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280
          tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340
          ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400
          attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460
          gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520
          accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580
          ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640
          ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700
          ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760
          actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820
          acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880
          agcagggcct gctcgagaac cagcctagtt tccaccccgc caggcgtgaa tagggtgatc 5940
          actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000
          accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060
          gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120
          accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180
          ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240
          ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300
          aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360
          tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420
          tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480
          atgttgaaag agaactttcc gactgtggct tcttactgta ttaattccaga gtacgatgcc 6540
          tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600
          aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660
          ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720
          aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggcctttaa tgtggaatgc 6780
          ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840
          cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900
          ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960
          atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020
          aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080
          cgagagctgg ttaggagatt aaatgcggtc ctgcttccga aattcatac actgtttgat 7140
          atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200
          ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260
          ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320
          ttcggcgaaa tttcatcaat aatttgccc actaaaacta aatttaaatt cggagccatg 7380
          atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440
          agcagagtgttgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500
          aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560
          aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttctgtgga 7620
          gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680
          aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740
          agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800
          aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860
          actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920
          ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgg ctaggcccct 7980
          gtgtacactt ttgctcctga tggccaccct cgctggagct ctggcaagcg gtggatggag 8040
          ctcaaagccg cggaaaggga tgggtactaa cctgtccgta ccaaatcccc tgggattttt 8100
          tccagaccac caactcgatc ctgcttttgg cgcaaattcc aacaatcccg actgggactt 8160
          taaccctaac aaggaccact ggcctgatgc caacaaggtg ggggcaggag cctttggtcc 8220
          cggcttcacc ccacccccatggaggtcttttgggatggtca ccacaggccc agggcatcct 8280
          gaccactgtc cctgctgctc caccgccagc ttctactaat cgacagagcg ggaggcagcc 8340
          gacccccctg agtccccccc tgcgggatac ccaccctcag gcaggaagcg gagctactaa 8400
          cttcagcctg ctgaagcagg ctggagaacgt ggaggagaac cctggaccta tgcagtggaa 8460
          ctcaactact ttccatcaga cccttcagga ccctagagtg cgcgggctgt actttcctgc 8520
          tgggggaagc agtagcggga ccgttaatcc agtacctacg accgcctctc ccatatcttc 8580
          tatctttagt aggactggtg accctgctcc caacatggag aatatcacct ccgggtttct 8640
          gggcccactc ctggtccttc aggccggatt cttcctgctg actcgaatcc tcaccatacc 8700
          ccagagcctg gacagctggt ggacaagcct gaattttctg ggaggaactc ctgtatgcct 8760
          gggacaaaat tcacagtccc ctacaagtaa ccattcaccg acaagttgtc ctcccatctg 8820
          tcccggatac aggtggatgt gcctgcgaag gttcatcatc ttcctcttca tcctcttgct 8880
          ttgccttatttcctcctgg ttcttctgga ctatcagggc atgctgcctg tgtgcccact 8940
          gataccagga tctagtacta ccagcacagg cccgtgtaag acctgtacaa ttccagcaca 9000
          agggactagt atgttcccct cctgctgttg tactaagcca agcgacggta attgcacgtg 9060
          tatcccaatc ccgtcctcct gggcgtttgc caagtacctc tgggaatggg cctcagtcag 9120
          attttcatgg cttagtcttt tggtgccgtt cgtgcagtgg tttgtgggac tctctccgac 9180
          tgtgtggctc agcgtgatct ggatgatgtg gtactggggc ccttcccttt acaacatact 9240
          gtctccattc cttcccctgc tgccaatctt cttttgcctg tgggtctata tttaaggcgc 9300
          gccgtttaaa cggccggcct taattaagta acgatacagc agcaattggc aagctgctta 9360
          catagaactc gcggcgattg gcatgccgct ttaaaatttt tattttttttcttttctt 9420
          ttccgaatcg gattttgttt ttaatatttc aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 9480
          aaaaaaaaaa 9490
           <![CDATA[ <210> 68]]>
           <![CDATA[ <211> 10174]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-IRES (EV71)-preS1 replicon]]>
           <![CDATA[ <400> 68]]>
          ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60
          ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120
          aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180
          tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240
          tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300
          ttctttaaca tgctcggccg ccgcccccttc ccggccccca ctgccatgtg gaggccgcgg 360
          agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420
          ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480
          ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540
          actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600
          acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660
          tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720
          ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780
          gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840
          atgtgcctcc acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900
          gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960
          gcctactgga taggctttga caccaccccct tttatgttta agaacttggc tggagcatat 1020
          ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080
          tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140
          ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200
          gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260
          acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320
          agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380
          ttgtgctgca aagtgacaga cacattgaac ggggagagggg tctcttttcc cgtgtgcacg 1440
          tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500
          gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560
          cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620
          aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680
          agacagttag tcatggggtg ttgttggggct tttagaaggc acaagataac atctatttat 1740
          aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800
          cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860
          gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920
          gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980
          ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040
          gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100
          gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160
          ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220
          gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagagggg acatgcaata 2280
          cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340
          ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400
          gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460
          aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520
          gatcctccct tccatgaatt cgcctacgag agtctgagaa cacgaccagc cgctccttac 2580
          caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640
          agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700
          ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760
          ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820
          catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880
          ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940
          gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000
          tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060
          aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120
          tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180
          gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240
          gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300
          gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360
          taccctggga atttcactgc cacgatagag gagtggcaag cagagcatga tgccatcatg 3420
          aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480
          tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540
          tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600
          caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660
          gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720
          ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780
          gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840
          aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900
          ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960
          ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020
          accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080
          tttgttaatg tgaggaccccc atataaatac catcactatc agcagtgtga agaccatgcc 4140
          attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200
          gtcagcatag gttatggtta cgctgacagg gccagcgaaa gcatcattgg tgctatagcg 4260
          cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320
          ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380
          tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440
          tatcatgtgg tgcgaggggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500
          aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560
          agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620
          catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680
          cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740
          gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800
          tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860
          agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920
          gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980
          catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040
          tcatatttgg aagggaccaa gtttcaccag gcggccaagg atatagcaga aattaatgcc 5100
          atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160
          atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220
          acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280
          tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340
          ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400
          attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460
          gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520
          accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580
          ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640
          ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700
          ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760
          actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820
          acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880
          agcagggcct gctcgagaac cagcctagtt tccaccccgc caggcgtgaa tagggtgatc 5940
          actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000
          accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060
          gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120
          accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180
          ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240
          ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300
          aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360
          tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420
          tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480
          atgttgaaag agaactttcc gactgtggct tcttactgta ttaattccaga gtacgatgcc 6540
          tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600
          aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660
          ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720
          aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggcctttaa tgtggaatgc 6780
          ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840
          cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900
          ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960
          atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020
          aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080
          cgagagctgg ttaggagatt aaatgcggtc ctgcttccga aattcatac actgtttgat 7140
          atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200
          ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260
          ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320
          ttcggcgaaa tttcatcaat aatttgccc actaaaacta aatttaaatt cggagccatg 7380
          atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440
          agcagagtgttgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500
          aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560
          aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttctgtgga 7620
          gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680
          aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740
          agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800
          aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860
          actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920
          ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgc agtggaactc 7980
          aactactttc catcagaccc ttcaggaccc tagagtgcgc gggctgtact ttcctgctgg 8040
          gggaagcagt agcgggaccg ttaatccagt acctacgacc gcctctccca tatcttctat 8100
          ctttagtagg actggtgacc ctgctcccaa catggagaat atcacctccg ggtttctggg 8160
          cccactcctg gtccttcagg ccggattctt cctgctgact cgaatcctca ccatacccca 8220
          gagcctggac agctggtgga caagcctgaa ttttctggga ggaactcctg tatgcctggg 8280
          acaaaattca cagtccccta caagtaacca ttcaccgaca agttgtcctc ccatctgtcc 8340
          cggatacagg tggatgtgcc tgcgaaggtt catcatcttc ctcttcatcc tcttgctttg 8400
          ccttattttc ctcctggttc ttctggacta tcagggcatg ctgcctgtgt gcccactgat 8460
          accaggatct agtactacca gcacaggccc gtgtaagacc tgtacaattc cagcacaagg 8520
          gactagtatg ttcccctcct gctgttgtac taagccaagc gacggtaatt gcacgtgtat 8580
          cccaatcccg tcctcctggg cgtttgccaa gtacctctgg gaatgggcct cagtcagatt 8640
          ttcatggctt agtcttttgg tgccgttcgt gcagtggttt gtgggactct ctccgactgt 8700
          gtggctcagc gtgatctgga tgatgtggta ctggggccct tccctttaca acatactgtc 8760
          tccattcctt cccctgctgc caatcttctt ttgcctgtgg gtctatattt aattaaaaca 8820
          gctgtgggtt gttcccaccc acagggccca ctgggcgcta gcactctgat tttacgaaat 8880
          ccttgtgcgc ctgttttata tcccttccct aattcgaaac gtagaagcaa tgcgcaccac 8940
          tgatcaatag taggcgtaac gcgccagtta cgtcatgatc aagcatatct gttcccccgg 9000
          actgagtatc aatagactgc ttacgcggtt gaaggagaaa acgttcgtta tccggctaac 9060
          tacttcgaga agcccagtaa caccatggaa gctgcagggt gtttcgctca gcacttcccc 9120
          cgtgtagatc aggtcgatga gccactgcaa tccccacagg tgactgtggc agtggctgcg 9180
          ttggcggcct gcctatgggg agacccatag gacgctctaa tgtggacatg gtgcgaagag 9240
          cctattgagc tagttagtag tcctccggcc cctgaatgcg gctaatccta actgcggagc 9300
          acatgccttc aacccagagg gtagtgtgtc gtaacgggca actctgcagc ggaaccgact 9360
          actttgggtg tccgtgtttc ttttttatc ttatattggc tgcttatggt gacaattaca 9420
          gaattgttac catatagcta ttggattggc catccggtgt gtaatagagc tgttatatac 9480
          ctatttgttg gctttgtacc actaacttta aaatctataa ctacccctcaa ctttatatta 9540
          accctcaata cagttgacca tggctaggcc cctgtgtaca cttttgctcc tgatggccac 9600
          cctcgctgga gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac 9660
          taacctgtcc gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt 9720
          tggcgcaaat tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga 9780
          tgccaacaag gtgggggcag gagcctttgg tcccggcttc accccacccc atggaggtct 9840
          tttgggatgg tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc 9900
          agcttctact aatcgacaga gcgggaggca gccgaccccc ctgagtcccc ccctgcggga 9960
          tacccaccct caggcataag gcgcgccgtt taaacggccg gccttaatta agtaacgata 10020
          cagcagcaat tggcaagctg cttacataga actcgcggcg attggcatgc cgctttaaaa 10080
          tttttatttt atttttcttt tcttttccga atcggatttt gtttttaata tttcaaaaaa 10140
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 10174
           <![CDATA[ <210> 69]]>
           <![CDATA[ <211> 12730]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223>PreS2.S-2A-preS1-2A-core-2A-Pol replicon]]>
           <![CDATA[ <400> 69]]> ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60 ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120 aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180 tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240 tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300 ttctttaaca tgctcggccg ccgccccttc ccggccccca ctgccatgtg gaggccgcgg 360 agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420 ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480 ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540 actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600 acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660 tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720 ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780 gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840 atgtgcctc c acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900 gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960 gcctactgga taggctttga caccacccct tttatgttta agaacttggc tggagcatat 1020 ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080 tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140 ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200 gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260 acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320 agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380 ttgtgctgca aagtgacaga cacattgaac ggggagaggg tctcttttcc cgtgtgcacg 1440 tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500 gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560 cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620 aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680 agacagttag tcatgg ggtg ttgttgggct tttagaaggc acaagataac atctatttat 1740 aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800 cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860 gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920 gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980 ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040 gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100 gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160 ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220 gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagaggg acatgcaata 2280 cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340 ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400 gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460 aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520 gatcctccct tccatgaatt c gcctacgag agtctgagaa cacgaccagc cgctccttac 2580 caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640 agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700 ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760 ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820 catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880 ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940 gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000 tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060 aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120 tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180 gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240 gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300 gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360 taccctggga atttcactgc cacgata gag gagtggcaag cagagcatga tgccatcatg 3420 aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480 tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540 tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600 caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660 gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720 ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780 gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840 aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900 ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960 ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020 accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080 tttgttaatg tgaggacccc atataaatac catcactatc agcagtgtga agaccatgcc 4140 attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200 gtcagcatag gttatggtta cgctgacagg gc cagcgaaa gcatcattgg tgctatagcg 4260 cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320 ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380 tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440 tatcatgtgg tgcgagggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500 aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560 agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620 catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680 cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740 gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800 tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860 agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920 gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980 catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040 tcatatttgg aagggaccaa gtttcaccag gcggccaa gg atatagcaga aattaatgcc 5100 atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160 atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220 acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280 tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340 ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400 attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460 gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520 accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580 ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640 ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700 ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760 actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820 acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880 agcagggcct gctcgagaac cagcctagtt tccaccccgc cag gcgtgaa tagggtgatc 5940 actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000 accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060 gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120 accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180 ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240 ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300 aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360 tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420 tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480 atgttgaaag agaactttcc gactgtggct tcttactgta ttattccaga gtacgatgcc 6540 tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600 aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660 ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720 aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggccttta a tgtggaatgc 6780 ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840 cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900 ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960 atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020 aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080 cgagagctgg ttaggagatt aaatgcggtc ctgcttccga acattcatac actgtttgat 7140 atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200 ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260 ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320 ttcggcgaaa tttcatcaat acatttgccc actaaaacta aatttaaatt cggagccatg 7380 atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440 agcagagtgt tgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500 aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560 aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttc tgtgga 7620 gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680 aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740 agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800 aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860 actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920 ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgc agtggaactc 7980 aactactttc catcagaccc ttcaggaccc tagagtgcgc gggctgtact ttcctgctgg 8040 gggaagcagt agcgggaccg ttaatccagt acctacgacc gcctctccca tatcttctat 8100 ctttagtagg actggtgacc ctgctcccaa catggagaat atcacctccg ggtttctggg 8160 cccactcctg gtccttcagg ccggattctt cctgctgact cgaatcctca ccatacccca 8220 gagcctggac agctggtgga caagcctgaa ttttctggga ggaactcctg tatgcctggg 8280 acaaaattca cagtccccta caagtaacca ttcaccgaca agttgtcctc ccatctgtcc 8340 cggatacagg tggatgtgcc tgcgaaggtt catcatcttc ctcttcatcc tcttgctttg 8400 ccttattttc ctcctggttc ttctggacta tcagggcatg ctgcctgtgt gcccactgat 8460 accaggatct agtactacca gcacaggccc gtgtaagacc tgtacaattc cagcacaagg 8520 gactagtatg ttcccctcct gctgttgtac taagccaagc gacggtaatt gcacgtgtat 8580 cccaatcccg tcctcctggg cgtttgccaa gtacctctgg gaatgggcct cagtcagatt 8640 ttcatggctt agtcttttgg tgccgttcgt gcagtggttt gtgggactct ctccgactgt 8700 gtggctcagc gtgatctgga tgatgtggta ctggggccct tccctttaca acatactgtc 8760 tccattcctt cccctgctgc caatcttctt ttgcctgtgg gtctatattg gaagcggagc 8820 tactaacttc agcctgctga agcaggctgg agacgtggag gagaaccctg gacctatggc 8880 taggcccctg tgtacacttt tgctcctgat ggccaccctc gctggagctc tggcaagcgg 8940 tggatggagc tcaaagccgc ggaaagggat gggtactaac ctgtccgtac caaatcccct 9000 gggatttttt ccagaccacc aactcgatcc tgcttttggc gcaaattcca acaatcccga 9060 ctgggacttt aaccctaaca aggaccactg gcctgatgcc aacaaggtgg gggcaggagc 9120 ctttggtccc ggcttcaccc caccccatgg aggtcttttg ggatggtcac cacaggccca 9180 gggcatcctg accactgtcc ctgctgctcc accgccagct tctactaatc gacagagcgg 9240 gaggcagccg acccccctga gtccccccct gcgggatacc caccctcagg caggatcagg 9300 cgctacgaat tttagccttc tgaagcaagc gggagacgtt gaagaaaacc cagggcctat 9360 ggctcgacct ctgtgtaccc tgctactcct gatggctacc ctggctggag ctctggccag 9420 cgacatcgac ccttacaagg agttcggcgc cagcgtggaa ctgctgtctt ttctgcccag 9480 tgatttcttt ccttccattc gagacctgct ggataccgcc tctgctctgt atcgggaagc 9540 cctggagagc ccagaacact gctccccaca ccataccgct ctgcgacagg caatcctgtg 9600 ctggggggag ctgatgaacc tggccacatg ggtgggatcg aatctggagg accccgcttc 9660 acgggaactg gtggtcagct acgtgaacgt caatatgggc ctgaaaatcc gccagctgct 9720 gtggttccat attagctgcc tgacttttgg acgagagacc gtgctggaat acctggtgtc 9780 cttcggcgtc tggattcgca ctccccctgc ttatcgacca cccaacgcac caattctgtc 9840 caccctgccc gagaccacag tggtccgtcg ccgtgggtcc ggagcgacta acttttccct 9900 gctgaaacaa gcgggtgacg tcgaagagaa tccgggacct atggctcgac ctctgtgtac 9960 cctgctactc ctgatggcta ccctggctgg agctctggcc agcatgcccc tgtcttacca 10020 gcactttaga aagcttctgc tgctggacga tgaagccggg cctctggagg aagagctgcc 10080 aaggctggca gacgaggggc tgaaccggag agtggccgaa gatctgaatc tgggaaacct 10140 gaa cgtgagc atcccttgga ctcataaagt cggcaacttc accgggctgt acagctccac 10200 agtgcctgtc ttcaatccag agtggcagac accatccttt cccaacattc acctgcagga 10260 ggacatcatt aatagatgcg aacagttcgt gggacctctg acagtcaacg aaaagaggcg 10320 cctgaaactg atcatgcctg ccaggtttta cccaaatgtg actaagtatc tgccactgga 10380 taagggcatc aagccttact atccagagca cctggtgaac cattacttcc agactagaca 10440 ctatctgcat accctgtgga aggccggaat cctgtacaaa cgagaaacta cccggagtgc 10500 ttcattttgt ggctccccat attcttggga acaggagctg cagcatggca ggctggtgtt 10560 ccagaccagc aaacgccacg gggatgagtc cttttgcagc cagtctagtg gcatcctgag 10620 cagatccccc gtggggcctt gtattcagtc tcagctgcgg aagagtagac tgggactgca 10680 gccacagcag ggacacctgg cacgacggca gcagggaagg tctggcagta tccgggctag 10740 agtgcatccc acaactagaa ggaccttcgg cgtcgagcca tcaggaagcg gccacatcga 10800 caacagcgca tcaagctcct ctagttgcct gcatcagtca gccgtgagaa aggccgctta 10860 cagccacctg tccacatcta aaaggcactc aagctccggg catgctgtgg agctgcacaa 10920 catccctcca aattctgcac gcagtcagtc agaaggaccc gtgttcagct gctggtggct 1 0980 gcagtttcgg aactcaaagc cttgcagcga ctattgtctg agccatattg tgaatctgct 11040 ggaggattgg ggcccttgta ccgagcacgg ggaacaccat atcaggattc cacgaacacc 11100 agcacgagtg actggagggg tgttcctggt ggacaagaac ccccacaata ctaccgagag 11160 ccggctggtg gtcgatttca gtcagttttc aagaggcaac acaagggtgt catggcccaa 11220 attcgccgtc cctaatctgc agagtctgac taacctgctg tctagtaatc tgagctggct 11280 gtccctggac gtgtccgcag ccttttacca cctgcctctg catccagctg caatgcccca 11340 tctgctggtg gggtcaagcg gactgagtcg ctacgtcgcc cgactgtcct ctaactcacg 11400 catcattaat caccagcatg gcaccatgca gaacctgcac gatagctgtt cccggaatct 11460 gtacgtgtct ctgctgctgc tgtataagac attcggcaga aaactgcacc tgtacagcca 11520 tcctatcatt ctggggttta ggaagatccc aatgggagtg ggactgagcc ccttcctgct 11580 ggcacagttt acctccgcca tttgctctgt ggtccgccga gccttcccac actgtctggc 11640 tttttcctat atgaacaatg tggtcctggg cgccaaatcc gtgcagcatc tggagtctct 11700 gttcacagct gtcactaact ttctgctgag cctggggatc cacctgaacc caaataagac 11760 taaacgctgg gggtacagcc tgaatttcat gggatatgtg attggatcct gggg gaccct 11820 gccacaggag cacatcgtgc agaagatcaa ggaatgcttt cggaagctgc ccgtcaacag 11880 acctatcgac tggaaagtgt gccagcggat tgtcggactg ctgggcttcg ccgctccctt 11940 tacccagtgc gggtacccag cactgatgcc cctgtatgcc tgtatccagt ctaagcaggc 12000 tttcaccttt agtcctacat acaaggcatt cctgtgcaaa cagtacctga acctgtatcc 12060 agtggcaagg cagcgacctg gactgtgcca ggtctttgca aatgccactc ctaccggctg 12120 ggggctggct atcggacatc agcgaatgcg gggcacattc gtggcccccc tgcctattca 12180 cactgctcag ctgctggcag cctgctttgc tagatctagg agtggagcaa agctgatcgg 12240 caccgacaat agtgtggtcc tgtcaagaaa atacacatcc ttcccatggc tgctgggatg 12300 tgctgcaaac tggattctga ggggcaccag cttcgtgtac gtcccctcag ccctgaatcc 12360 tgctgacgat ccatcccgcg ggcgactggg actgtaccga cctctgctga gactgccctt 12420 caggcctaca actggccgga catctctgta tgccgattca ccaagcgtgc cctcacacct 12480 gcctgacaga gtccactttg cttcacccct gcacgtcgct tggcggcctc cataaggcgc 12540 gccgtttaaa cggccggcct taattaagta acgatacagc agcaattggc aagctgctta 12600 catagaactc gcggcgattg gcatgccgct ttaaaatttt tatttta ttt ttcttttctt 12660 ttccgaatcg gattttgttt ttaatatttc aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 12720 aaaaaaaaaa 12730 <![CDATA[ <210> 70]]>
           <![CDATA[ <211> 12730]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> PreS2.S-2A-preS1-2A-Pol-2A-core replicon]]>
           <![CDATA[ <400> 70]]> ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60 ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120 aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180 tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240 tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300 ttctttaaca tgctcggccg ccgccccttc ccggccccca ctgccatgtg gaggccgcgg 360 agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420 ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480 ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540 actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600 acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660 tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720 ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780 gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840 atgtgcctc c acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900 gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960 gcctactgga taggctttga caccacccct tttatgttta agaacttggc tggagcatat 1020 ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080 tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140 ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200 gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260 acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320 agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380 ttgtgctgca aagtgacaga cacattgaac ggggagaggg tctcttttcc cgtgtgcacg 1440 tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500 gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560 cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620 aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680 agacagttag tcatgg ggtg ttgttgggct tttagaaggc acaagataac atctatttat 1740 aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800 cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860 gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920 gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980 ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040 gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100 gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160 ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220 gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagaggg acatgcaata 2280 cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340 ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400 gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460 aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520 gatcctccct tccatgaatt c gcctacgag agtctgagaa cacgaccagc cgctccttac 2580 caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640 agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700 ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760 ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820 catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880 ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940 gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000 tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060 aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120 tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180 gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240 gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300 gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360 taccctggga atttcactgc cacgata gag gagtggcaag cagagcatga tgccatcatg 3420 aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480 tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540 tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600 caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660 gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720 ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780 gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840 aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900 ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960 ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020 accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080 tttgttaatg tgaggacccc atataaatac catcactatc agcagtgtga agaccatgcc 4140 attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200 gtcagcatag gttatggtta cgctgacagg gc cagcgaaa gcatcattgg tgctatagcg 4260 cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320 ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380 tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440 tatcatgtgg tgcgagggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500 aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560 agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620 catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680 cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740 gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800 tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860 agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920 gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980 catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040 tcatatttgg aagggaccaa gtttcaccag gcggccaa gg atatagcaga aattaatgcc 5100 atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160 atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220 acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280 tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340 ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400 attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460 gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520 accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580 ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640 ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700 ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760 actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820 acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880 agcagggcct gctcgagaac cagcctagtt tccaccccgc cag gcgtgaa tagggtgatc 5940 actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000 accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060 gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120 accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180 ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240 ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300 aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360 tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420 tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480 atgttgaaag agaactttcc gactgtggct tcttactgta ttattccaga gtacgatgcc 6540 tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600 aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660 ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720 aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggccttta a tgtggaatgc 6780 ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840 cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900 ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960 atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020 aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080 cgagagctgg ttaggagatt aaatgcggtc ctgcttccga acattcatac actgtttgat 7140 atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200 ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260 ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320 ttcggcgaaa tttcatcaat acatttgccc actaaaacta aatttaaatt cggagccatg 7380 atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440 agcagagtgt tgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500 aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560 aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttc tgtgga 7620 gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680 aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740 agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800 aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860 actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920 ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgc agtggaactc 7980 aactactttc catcagaccc ttcaggaccc tagagtgcgc gggctgtact ttcctgctgg 8040 gggaagcagt agcgggaccg ttaatccagt acctacgacc gcctctccca tatcttctat 8100 ctttagtagg actggtgacc ctgctcccaa catggagaat atcacctccg ggtttctggg 8160 cccactcctg gtccttcagg ccggattctt cctgctgact cgaatcctca ccatacccca 8220 gagcctggac agctggtgga caagcctgaa ttttctggga ggaactcctg tatgcctggg 8280 acaaaattca cagtccccta caagtaacca ttcaccgaca agttgtcctc ccatctgtcc 8340 cggatacagg tggatgtgcc tgcgaaggtt catcatcttc ctcttcatcc tcttgctttg 8400 ccttattttc ctcctggttc ttctggacta tcagggcatg ctgcctgtgt gcccactgat 8460 accaggatct agtactacca gcacaggccc gtgtaagacc tgtacaattc cagcacaagg 8520 gactagtatg ttcccctcct gctgttgtac taagccaagc gacggtaatt gcacgtgtat 8580 cccaatcccg tcctcctggg cgtttgccaa gtacctctgg gaatgggcct cagtcagatt 8640 ttcatggctt agtcttttgg tgccgttcgt gcagtggttt gtgggactct ctccgactgt 8700 gtggctcagc gtgatctgga tgatgtggta ctggggccct tccctttaca acatactgtc 8760 tccattcctt cccctgctgc caatcttctt ttgcctgtgg gtctatattg ggtccggagc 8820 gactaacttt tccctgctga aacaagcggg tgacgtcgaa gagaatccgg gacctatggc 8880 taggcccctg tgtacacttt tgctcctgat ggccaccctc gctggagctc tggcaagcgg 8940 tggatggagc tcaaagccgc ggaaagggat gggtactaac ctgtccgtac caaatcccct 9000 gggatttttt ccagaccacc aactcgatcc tgcttttggc gcaaattcca acaatcccga 9060 ctgggacttt aaccctaaca aggaccactg gcctgatgcc aacaaggtgg gggcaggagc 9120 ctttggtccc ggcttcaccc caccccatgg aggtcttttg ggatggtcac cacaggccca 9180 gggcatcctg accactgtcc ctgctgctcc accgccagct tctactaatc gacagagcgg 9240 gaggcagccg acccccctga gtccccccct gcgggatacc caccctcagg caggatcagg 9300 cgctacgaat tttagccttc tgaagcaagc gggagacgtt gaagaaaacc cagggcctat 9360 ggctcgacct ctgtgtaccc tgctactcct gatggctacc ctggctggag ctctggccag 9420 catgcccctg tcttaccagc actttagaaa gcttctgctg ctggacgatg aagccgggcc 9480 tctggaggaa gagctgccaa ggctggcaga cgaggggctg aaccggagag tggccgaaga 9540 tctgaatctg ggaaacctga acgtgagcat cccttggact cataaagtcg gcaacttcac 9600 cgggctgtac agctccacag tgcctgtctt caatccagag tggcagacac catcctttcc 9660 caacattcac ctgcaggagg acatcattaa tagatgcgaa cagttcgtgg gacctctgac 9720 agtcaacgaa aagaggcgcc tgaaactgat catgcctgcc aggttttacc caaatgtgac 9780 taagtatctg ccactggata agggcatcaa gccttactat ccagagcacc tggtgaacca 9840 ttacttccag actagacact atctgcatac cctgtggaag gccggaatcc tgtacaaacg 9900 agaaactacc cggagtgctt cattttgtgg ctccccatat tcttgggaac aggagctgca 9960 gcatggcagg ctggtgttcc agaccagcaa acgccacggg gatgagtcct tttgcagcca 10020 gtctagtggc atcctgagca gatcccccgt ggggccttgt attcagtctc agctgcggaa 10080 gagtagactg ggactgcagc cacagcaggg acacctggca cgacggcagc agggaaggtc 10140 tgg cagtatc cgggctagag tgcatcccac aactagaagg accttcggcg tcgagccatc 10200 aggaagcggc cacatcgaca acagcgcatc aagctcctct agttgcctgc atcagtcagc 10260 cgtgagaaag gccgcttaca gccacctgtc cacatctaaa aggcactcaa gctccgggca 10320 tgctgtggag ctgcacaaca tccctccaaa ttctgcacgc agtcagtcag aaggacccgt 10380 gttcagctgc tggtggctgc agtttcggaa ctcaaagcct tgcagcgact attgtctgag 10440 ccatattgtg aatctgctgg aggattgggg cccttgtacc gagcacgggg aacaccatat 10500 caggattcca cgaacaccag cacgagtgac tggaggggtg ttcctggtgg acaagaaccc 10560 ccacaatact accgagagcc ggctggtggt cgatttcagt cagttttcaa gaggcaacac 10620 aagggtgtca tggcccaaat tcgccgtccc taatctgcag agtctgacta acctgctgtc 10680 tagtaatctg agctggctgt ccctggacgt gtccgcagcc ttttaccacc tgcctctgca 10740 tccagctgca atgccccatc tgctggtggg gtcaagcgga ctgagtcgct acgtcgcccg 10800 actgtcctct aactcacgca tcattaatca ccagcatggc accatgcaga acctgcacga 10860 tagctgttcc cggaatctgt acgtgtctct gctgctgctg tataagacat tcggcagaaa 10920 actgcacctg tacagccatc ctatcattct ggggtttagg aagatcccaa tgggagtggg 1 0980 actgagcccc ttcctgctgg cacagtttac ctccgccatt tgctctgtgg tccgccgagc 11040 cttcccacac tgtctggctt tttcctatat gaacaatgtg gtcctgggcg ccaaatccgt 11100 gcagcatctg gagtctctgt tcacagctgt cactaacttt ctgctgagcc tggggatcca 11160 cctgaaccca aataagacta aacgctgggg gtacagcctg aatttcatgg gatatgtgat 11220 tggatcctgg gggaccctgc cacaggagca catcgtgcag aagatcaagg aatgctttcg 11280 gaagctgccc gtcaacagac ctatcgactg gaaagtgtgc cagcggattg tcggactgct 11340 gggcttcgcc gctcccttta cccagtgcgg gtacccagca ctgatgcccc tgtatgcctg 11400 tatccagtct aagcaggctt tcacctttag tcctacatac aaggcattcc tgtgcaaaca 11460 gtacctgaac ctgtatccag tggcaaggca gcgacctgga ctgtgccagg tctttgcaaa 11520 tgccactcct accggctggg ggctggctat cggacatcag cgaatgcggg gcacattcgt 11580 ggcccccctg cctattcaca ctgctcagct gctggcagcc tgctttgcta gatctaggag 11640 tggagcaaag ctgatcggca ccgacaatag tgtggtcctg tcaagaaaat acacatcctt 11700 cccatggctg ctgggatgtg ctgcaaactg gattctgagg ggcaccagct tcgtgtacgt 11760 cccctcagcc ctgaatcctg ctgacgatcc atcccgcggg cgactgggac tgta ccgacc 11820 tctgctgaga ctgcccttca ggcctacaac tggccggaca tctctgtatg ccgattcacc 11880 aagcgtgccc tcacacctgc ctgacagagt ccactttgct tcacccctgc acgtcgcttg 11940 gcggcctcca ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga 12000 ggagaaccct ggacctatgg ctcgacctct gtgtaccctg ctactcctga tggctaccct 12060 ggctggagct ctggccagcg acatcgaccc ttacaaggag ttcggcgcca gcgtggaact 12120 gctgtctttt ctgcccagtg atttctttcc ttccattcga gacctgctgg ataccgcctc 12180 tgctctgtat cgggaagccc tggagagccc agaacactgc tccccacacc ataccgctct 12240 gcgacaggca atcctgtgct ggggggagct gatgaacctg gccacatggg tgggatcgaa 12300 tctggaggac cccgcttcac gggaactggt ggtcagctac gtgaacgtca atatgggcct 12360 gaaaatccgc cagctgctgt ggttccatat tagctgcctg acttttggac gagagaccgt 12420 gctggaatac ctggtgtcct tcggcgtctg gattcgcact ccccctgctt atcgaccacc 12480 caacgcacca attctgtcca ccctgcccga gaccacagtg gtccgtcgcc gttaaggcgc 12540 gccgtttaaa cggccggcct taattaagta acgatacagc agcaattggc aagctgctta 12600 catagaactc gcggcgattg gcatgccgct ttaaaatttt tatttta ttt ttcttttctt 12660 ttccgaatcg gattttgttt ttaatatttc aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 12720 aaaaaaaaaa 12730 <![CDATA[ <210> 71]]>
           <![CDATA[ <211> 13254]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core-IRES (EMCV)-PreS2.S-2A-preS1 replicon]]>
           <![CDATA[ <400> 71]]> ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60 ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120 aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180 tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240 tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300 ttctttaaca tgctcggccg ccgccccttc ccggccccca ctgccatgtg gaggccgcgg 360 agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420 ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480 ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540 actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600 acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660 tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720 ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780 gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840 atgtgcctc c acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900 gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960 gcctactgga taggctttga caccacccct tttatgttta agaacttggc tggagcatat 1020 ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080 tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140 ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200 gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260 acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320 agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380 ttgtgctgca aagtgacaga cacattgaac ggggagaggg tctcttttcc cgtgtgcacg 1440 tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500 gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560 cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620 aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680 agacagttag tcatgg ggtg ttgttgggct tttagaaggc acaagataac atctatttat 1740 aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800 cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860 gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920 gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980 ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040 gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100 gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160 ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220 gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagaggg acatgcaata 2280 cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340 ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400 gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460 aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520 gatcctccct tccatgaatt c gcctacgag agtctgagaa cacgaccagc cgctccttac 2580 caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640 agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700 ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760 ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820 catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880 ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940 gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000 tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060 aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120 tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180 gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240 gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300 gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360 taccctggga atttcactgc cacgata gag gagtggcaag cagagcatga tgccatcatg 3420 aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480 tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540 tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600 caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660 gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720 ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780 gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840 aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900 ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960 ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020 accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080 tttgttaatg tgaggacccc atataaatac catcactatc agcagtgtga agaccatgcc 4140 attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200 gtcagcatag gttatggtta cgctgacagg gc cagcgaaa gcatcattgg tgctatagcg 4260 cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320 ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380 tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440 tatcatgtgg tgcgagggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500 aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560 agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620 catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680 cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740 gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800 tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860 agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920 gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980 catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040 tcatatttgg aagggaccaa gtttcaccag gcggccaa gg atatagcaga aattaatgcc 5100 atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160 atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220 acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280 tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340 ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400 attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460 gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520 accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580 ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640 ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700 ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760 actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820 acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880 agcagggcct gctcgagaac cagcctagtt tccaccccgc cag gcgtgaa tagggtgatc 5940 actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000 accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060 gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120 accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180 ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240 ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300 aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360 tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420 tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480 atgttgaaag agaactttcc gactgtggct tcttactgta ttattccaga gtacgatgcc 6540 tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600 aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660 ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720 aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggccttta a tgtggaatgc 6780 ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840 cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900 ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960 atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020 aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080 cgagagctgg ttaggagatt aaatgcggtc ctgcttccga acattcatac actgtttgat 7140 atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200 ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260 ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320 ttcggcgaaa tttcatcaat acatttgccc actaaaacta aatttaaatt cggagccatg 7380 atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440 agcagagtgt tgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500 aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560 aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttc tgtgga 7620 gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680 aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740 agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800 aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860 actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920 ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgg ctcgacctct 7980 gtgtaccctg ctactcctga tggctaccct ggctggagct ctggccagca tgcccctgtc 8040 ttaccagcac tttagaaagc ttctgctgct ggacgatgaa gccgggcctc tggaggaaga 8100 gctgccaagg ctggcagacg aggggctgaa ccggagagtg gccgaagatc tgaatctggg 8160 aaacctgaac gtgagcatcc cttggactca taaagtcggc aacttcaccg ggctgtacag 8220 ctccacagtg cctgtcttca atccagagtg gcagacacca tcctttccca acattcacct 8280 gcaggaggac atcattaata gatgcgaaca gttcgtggga cctctgacag tcaacgaaaa 8340 gaggcgcctg aaactgatca tgcctgccag gttttaccca aatgtgacta agtatctgcc 8400 actggataag ggcatcaagc cttactatcc agagcacctg gtgaaccatt acttccagac 8460 tagacactat ctgcataccc tgtggaaggc cggaatcctg tacaaacgag aaactacccg 8520 gagtgcttca ttttgtggct ccccatattc ttgggaacag gagctgcagc atggcaggct 8580 ggtgttccag accagcaaac gccacgggga tgagtccttt tgcagccagt ctagtggcat 8640 cctgagcaga tcccccgtgg ggccttgtat tcagtctcag ctgcggaaga gtagactggg 8700 actgcagcca cagcagggac acctggcacg acggcagcag ggaaggtctg gcagtatccg 8760 ggctagagtg catcccacaa ctagaaggac cttcggcgtc gagccatcag gaagcggcca 8820 catcgacaac agcgcatcaa gctcctctag ttgcctgcat cagtcagccg tgagaaaggc 8880 cgcttacagc cacctgtcca catctaaaag gcactcaagc tccgggcatg ctgtggagct 8940 gcacaacatc cctccaaatt ctgcacgcag tcagtcagaa ggacccgtgt tcagctgctg 9000 gtggctgcag tttcggaact caaagccttg cagcgactat tgtctgagcc atattgtgaa 9060 tctgctggag gattggggcc cttgtaccga gcacggggaa caccatatca ggattccacg 9120 aacaccagca cgagtgactg gaggggtgtt cctggtggac aagaaccccc acaatactac 9180 cgagagccgg ctggtggtcg atttcagtca gttttcaaga ggcaacacaa gggtgtcatg 9240 gcccaaattc gccgtcccta atctgcagag tctgactaac ctgctgtcta gtaatctgag 9300 ctggctgtcc ctggacgtgt ccgcagcctt ttaccacctg cctctgcatc cagctgcaat 9360 gccccatctg ctggtggggt caagcggact gagtcgctac gtcgcccgac tgtcctctaa 9420 ctcacgcatc attaatcacc agcatggcac catgcagaac ctgcacgata gctgttcccg 9480 gaatctgtac gtgtctctgc tgctgctgta taagacattc ggcagaaaac tgcacctgta 9540 cagccatcct atcattctgg ggtttaggaa gatcccaatg ggagtgggac tgagcccctt 9600 cctgctggca cagtttacct ccgccatttg ctctgtggtc cgccgagcct tcccacactg 9660 tctggctttt tcctatatga acaatgtggt cctgggcgcc aaatccgtgc agcatctgga 9720 gtctctgttc acagctgtca ctaactttct gctgagcctg gggatccacc tgaacccaaa 9780 taagactaaa cgctgggggt acagcctgaa tttcatggga tatgtgattg gatcctgggg 9840 gaccctgcca caggagcaca tcgtgcagaa gatcaaggaa tgctttcgga agctgcccgt 9900 caacagacct atcgactgga aagtgtgcca gcggattgtc ggactgctgg gcttcgccgc 9960 tccctttacc cagtgcgggt acccagcact gatgcccctg tatgcctgta tccagtctaa 10020 gcaggctttc acctttagtc ctacatacaa ggcattcctg tgcaaacagt acctgaacct 10080 gtatccagtg gcaaggcagc gacctggact gtgccaggtc tttgcaaatg ccactcctac 10140 cgg ctggggg ctggctatcg gacatcagcg aatgcggggc acattcgtgg cccccctgcc 10200 tattcacact gctcagctgc tggcagcctg ctttgctaga tctaggagtg gagcaaagct 10260 gatcggcacc gacaatagtg tggtcctgtc aagaaaatac acatccttcc catggctgct 10320 gggatgtgct gcaaactgga ttctgagggg caccagcttc gtgtacgtcc cctcagccct 10380 gaatcctgct gacgatccat cccgcgggcg actgggactg taccgacctc tgctgagact 10440 gcccttcagg cctacaactg gccggacatc tctgtatgcc gattcaccaa gcgtgccctc 10500 acacctgcct gacagagtcc actttgcttc acccctgcac gtcgcttggc ggcctccagg 10560 aagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 10620 acctatggct cgacctctgt gtaccctgct actcctgatg gctaccctgg ctggagctct 10680 ggccagcgac atcgaccctt acaaggagtt cggcgccagc gtggaactgc tgtcttttct 10740 gcccagtgat ttctttcctt ccattcgaga cctgctggat accgcctctg ctctgtatcg 10800 ggaagccctg gagagcccag aacactgctc cccacaccat accgctctgc gacaggcaat 10860 cctgtgctgg ggggagctga tgaacctggc cacatgggtg ggatcgaatc tggaggaccc 10920 cgcttcacgg gaactggtgg tcagctacgt gaacgtcaat atgggcctga aaatccgcca 1 0980 gctgctgtgg ttccatatta gctgcctgac ttttggacga gagaccgtgc tggaatacct 11040 ggtgtccttc ggcgtctgga ttcgcactcc ccctgcttat cgaccaccca acgcaccaat 11100 tctgtccacc ctgcccgaga ccacagtggt ccgtcgccgt taagcccctc tccctccccc 11160 ccccctaacg ttactggccg aagccgcttg gaataaggcc ggtgtgcgtt tgtctatatg 11220 ttattttcca ccatattgcc gtcttttggc aatgtgaggg cccggaaacc tggccctgtc 11280 ttcttgacga gcattcctag gggtctttcc cctctcgcca aaggaatgca aggtctgttg 11340 aatgtcgtga aggaagcagt tcctctggaa gcttcttgaa gacaaacaac gtctgtagcg 11400 accctttgca ggcagcggaa ccccccacct ggcgacaggt gcctctgcgg ccaaaagcca 11460 cgtgtataag atacacctgc aaaggcggca caaccccagt gccacgttgt gagttggata 11520 gttgtggaaa gagtcaaatg gctctcctca agcgtattca acaaggggct gaaggatgcc 11580 cagaaggtac cccattgtat gggatctgat ctggggcctc ggtgcacatg ctttacatgt 11640 gtttagtcga ggttaaaaaa cgtctaggcc ccccgaacca cggggacgtg gttttccttt 11700 gaaaaacacg atgataatat ggccacaacc atgcagtgga actcaactac tttccatcag 11760 acccttcagg accctagagt gcgcgggctg tactttcctg ctgggggaag cagt agcggg 11820 accgttaatc cagtacctac gaccgcctct cccatatctt ctatctttag taggactggt 11880 gaccctgctc ccaacatgga gaatatcacc tccgggtttc tgggcccact cctggtcctt 11940 caggccggat tcttcctgct gactcgaatc ctcaccatac cccagagcct ggacagctgg 12000 tggacaagcc tgaattttct gggaggaact cctgtatgcc tgggacaaaa ttcacagtcc 12060 cctacaagta accattcacc gacaagttgt cctcccatct gtcccggata caggtggatg 12120 tgcctgcgaa ggttcatcat cttcctcttc atcctcttgc tttgccttat tttcctcctg 12180 gttcttctgg actatcaggg catgctgcct gtgtgcccac tgataccagg atctagtact 12240 accagcacag gcccgtgtaa gacctgtaca attccagcac aagggactag tatgttcccc 12300 tcctgctgtt gtactaagcc aagcgacggt aattgcacgt gtatcccaat cccgtcctcc 12360 tgggcgtttg ccaagtacct ctgggaatgg gcctcagtca gattttcatg gcttagtctt 12420 ttggtgccgt tcgtgcagtg gtttgtggga ctctctccga ctgtgtggct cagcgtgatc 12480 tggatgatgt ggtactgggg cccttccctt tacaacatac tgtctccatt ccttcccctg 12540 ctgccaatct tcttttgcct gtgggtctat attgggtccg gagcgactaa cttttccctg 12600 ctgaaacaag cgggtgacgt cgaagagaat ccgggaccta tggctag gcc cctgtgtaca 12660 cttttgctcc tgatggccac cctcgctgga gctctggcaa gcggtggatg gagctcaaag 12720 ccgcggaaag ggatgggtac taacctgtcc gtaccaaatc ccctgggatt ttttccagac 12780 caccaactcg atcctgcttt tggcgcaaat tccaacaatc ccgactggga ctttaaccct 12840 aacaaggacc actggcctga tgccaacaag gtgggggcag gagcctttgg tcccggcttc 12900 accccacccc atggaggtct tttgggatgg tcaccacagg cccagggcat cctgaccact 12960 gtccctgctg ctccaccgcc agcttctact aatcgacaga gcgggaggca gccgaccccc 13020 ctgagtcccc ccctgcggga tacccaccct caggcataag gcgcgccgtt taaacggccg 13080 gccttaatta agtaacgata cagcagcaat tggcaagctg cttacataga actcgcggcg 13140 attggcatgc cgctttaaaa tttttatttt atttttcttt tcttttccga atcggatttt 13200 gtttttaata tttcaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaa 13254 <![CDATA[ <210> 72]]>
           <![CDATA[ <211> 13414]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Pol-2A-core-IRES (EV71)-PreS2.S-2A-preS1 replicon]]>
           <![CDATA[ <400> 72]]> ataggcggcg catgagagaa gcccagacca attacctacc caaataggag aaagttcacg 60 ttgacatcga ggaagacagc ccattcctca gagctttgca gcggagcttc ccgcagtttg 120 aggtagaagc caagcaggtc actgataatg accatgctaa tgccagagcg ttttcgcatc 180 tggcttcaaa actgatcgaa acggaggtgg acccatccga cacgatcctt gacattggaa 240 tagtcagcat agtacatttc atctgactaa tactacaaca ccaccaccat gaatagagga 300 ttctttaaca tgctcggccg ccgccccttc ccggccccca ctgccatgtg gaggccgcgg 360 agaaggaggc aggcggcccc gggaagcgga gctactaact tcagcctgct gaagcaggct 420 ggagacgtgg aggagaaccc tggacctgag aaagttcacg ttgacatcga ggaagacagc 480 ccattcctca gagctttgca gcggagcttc ccgcagtttg aggtagaagc caagcaggtc 540 actgataatg accatgctaa tgccagagcg ttttcgcatc tggcttcaaa actgatcgaa 600 acggaggtgg acccatccga cacgatcctt gacattggaa gtgcgcccgc ccgcagaatg 660 tattctaagc acaagtatca ttgtatctgt ccgatgagat gtgcggaaga tccggacaga 720 ttgtataagt atgcaactaa gctgaagaaa aactgtaagg aaataactga taaggaattg 780 gacaagaaaa tgaaggagct cgccgccgtc atgagcgacc ctgacctgga aactgagact 840 atgtgcctc c acgacgacga gtcgtgtcgc tacgaagggc aagtcgctgt ttaccaggat 900 gtatacgcgg ttgacggacc gacaagtctc tatcaccaag ccaataaggg agttagagtc 960 gcctactgga taggctttga caccacccct tttatgttta agaacttggc tggagcatat 1020 ccatcatact ctaccaactg ggccgacgaa accgtgttaa cggctcgtaa cataggccta 1080 tgcagctctg acgttatgga gcggtcacgt agagggatgt ccattcttag aaagaagtat 1140 ttgaaaccat ccaacaatgt tctattctct gttggctcga ccatctacca cgagaagagg 1200 gacttactga ggagctggca cctgccgtct gtatttcact tacgtggcaa gcaaaattac 1260 acatgtcggt gtgagactat agttagttgc gacgggtacg tcgttaaaag aatagctatc 1320 agtccaggcc tgtatgggaa gccttcaggc tatgctgcta cgatgcaccg cgagggattc 1380 ttgtgctgca aagtgacaga cacattgaac ggggagaggg tctcttttcc cgtgtgcacg 1440 tatgtgccag ctacattgtg tgaccaaatg actggcatac tggcaacaga tgtcagtgcg 1500 gacgacgcgc aaaaactgct ggttgggctc aaccagcgta tagtcgtcaa cggtcgcacc 1560 cagagaaaca ccaataccat gaaaaattac cttttgcccg tagtggccca ggcatttgct 1620 aggtgggcaa aggaatataa ggaagatcaa gaagatgaaa ggccactagg actacgagat 1680 agacagttag tcatgg ggtg ttgttgggct tttagaaggc acaagataac atctatttat 1740 aagcgcccgg atacccaaac catcatcaaa gtgaacagcg atttccactc attcgtgctg 1800 cccaggatag gcagtaacac attggagatc gggctgagaa caagaatcag gaaaatgtta 1860 gaggagcaca aggagccgtc acctctcatt accgccgagg acgtacaaga agctaagtgc 1920 gcagccgatg aggctaagga ggtgcgtgaa gccgaggagt tgcgcgcagc tctaccacct 1980 ttggcagctg atgttgagga gcccactctg gaagccgatg tcgacttgat gttacaagag 2040 gctggggccg gctcagtgga gacacctcgt ggcttgataa aggttaccag ctacgatggc 2100 gaggacaaga tcggctctta cgctgtgctt tctccgcagg ctgtactcaa gagtgaaaaa 2160 ttatcttgca tccaccctct cgctgaacaa gtcatagtga taacacactc tggccgaaaa 2220 gggcgttatg ccgtggaacc ataccatggt aaagtagtgg tgccagaggg acatgcaata 2280 cccgtccagg actttcaagc tctgagtgaa agtgccacca ttgtgtacaa cgaacgtgag 2340 ttcgtaaaca ggtacctgca ccatattgcc acacatggag gagcgctgaa cactgatgaa 2400 gaatattaca aaactgtcaa gcccagcgag cacgacggcg aatacctgta cgacatcgac 2460 aggaaacagt gcgtcaagaa agaactagtc actgggctag ggctcacagg cgagctggtg 2520 gatcctccct tccatgaatt c gcctacgag agtctgagaa cacgaccagc cgctccttac 2580 caagtaccaa ccataggggt gtatggcgtg ccaggatcag gcaagtctgg catcattaaa 2640 agcgcagtca ccaaaaaaga tctagtggtg agcgccaaga aagaaaactg tgcagaaatt 2700 ataagggacg tcaagaaaat gaaagggctg gacgtcaatg ccagaactgt ggactcagtg 2760 ctcttgaatg gatgcaaaca ccccgtagag accctgtata ttgacgaagc ttttgcttgt 2820 catgcaggta ctctcagagc gctcatagcc attataagac ctaaaaaggc agtgctctgc 2880 ggggatccca aacagtgcgg tttttttaac atgatgtgcc tgaaagtgca ttttaaccac 2940 gagatttgca cacaagtctt ccacaaaagc atctctcgcc gttgcactaa atctgtgact 3000 tcggtcgtct caaccttgtt ttacgacaaa aaaatgagaa cgacgaatcc gaaagagact 3060 aagattgtga ttgacactac cggcagtacc aaacctaagc aggacgatct cattctcact 3120 tgtttcagag ggtgggtgaa gcagttgcaa atagattaca aaggcaacga aataatgacg 3180 gcagctgcct ctcaagggct gacccgtaaa ggtgtgtatg ccgttcggta caaggtgaat 3240 gaaaatcctc tgtacgcacc cacctctgaa catgtgaacg tcctactgac ccgcacggag 3300 gaccgcatcg tgtggaaaac actagccggc gacccatgga taaaaacact gactgccaag 3360 taccctggga atttcactgc cacgata gag gagtggcaag cagagcatga tgccatcatg 3420 aggcacatct tggagagacc ggaccctacc gacgtcttcc agaataaggc aaacgtgtgt 3480 tgggccaagg ctttagtgcc ggtgctgaag accgctggca tagacatgac cactgaacaa 3540 tggaacactg tggattattt tgaaacggac aaagctcact cagcagagat agtattgaac 3600 caactatgcg tgaggttctt tggactcgat ctggactccg gtctattttc tgcacccact 3660 gttccgttat ccattaggaa taatcactgg gataactccc cgtcgcctaa catgtacggg 3720 ctgaataaag aagtggtccg tcagctctct cgcaggtacc cacaactgcc tcgggcagtt 3780 gccactggaa gagtctatga catgaacact ggtacactgc gcaattatga tccgcgcata 3840 aacctagtac ctgtaaacag aagactgcct catgctttag tcctccacca taatgaacac 3900 ccacagagtg acttttcttc attcgtcagc aaattgaagg gcagaactgt cctggtggtc 3960 ggggaaaagt tgtccgtccc aggcaaaatg gttgactggt tgtcagaccg gcctgaggct 4020 accttcagag ctcggctgga tttaggcatc ccaggtgatg tgcccaaata tgacataata 4080 tttgttaatg tgaggacccc atataaatac catcactatc agcagtgtga agaccatgcc 4140 attaagctta gcatgttgac caagaaagct tgtctgcatc tgaatcccgg cggaacctgt 4200 gtcagcatag gttatggtta cgctgacagg gc cagcgaaa gcatcattgg tgctatagcg 4260 cggcagttca agttttcccg ggtatgcaaa ccgaaatcct cacttgaaga gacggaagtt 4320 ctgtttgtat tcattgggta cgatcgcaag gcccgtacgc acaatcctta caagctttca 4380 tcaaccttga ccaacattta tacaggttcc agactccacg aagccggatg tgcaccctca 4440 tatcatgtgg tgcgagggga tattgccacg gccaccgaag gagtgattat aaatgctgct 4500 aacagcaaag gacaacctgg cggaggggtg tgcggagcgc tgtataagaa attcccggaa 4560 agcttcgatt tacagccgat cgaagtagga aaagcgcgac tggtcaaagg tgcagctaaa 4620 catatcattc atgccgtagg accaaacttc aacaaagttt cggaggttga aggtgacaaa 4680 cagttggcag aggcttatga gtccatcgct aagattgtca acgataacaa ttacaagtca 4740 gtagcgattc cactgttgtc caccggcatc ttttccggga acaaagatcg actaacccaa 4800 tcattgaacc atttgctgac agctttagac accactgatg cagatgtagc catatactgc 4860 agggacaaga aatgggaaat gactctcaag gaagcagtgg ctaggagaga agcagtggag 4920 gagatatgca tatccgacga ctcttcagtg acagaacctg atgcagagct ggtgagggtg 4980 catccgaaga gttctttggc tggaaggaag ggctacagca caagcgatgg caaaactttc 5040 tcatatttgg aagggaccaa gtttcaccag gcggccaa gg atatagcaga aattaatgcc 5100 atgtggcccg ttgcaacgga ggccaatgag caggtatgca tgtatatcct cggagaaagc 5160 atgagcagta ttaggtcgaa atgccccgtc gaagagtcgg aagcctccac accacctagc 5220 acgctgcctt gcttgtgcat ccatgccatg actccagaaa gagtacagcg cctaaaagcc 5280 tcacgtccag aacaaattac tgtgtgctca tcctttccat tgccgaagta tagaatcact 5340 ggtgtgcaga agatccaatg ctcccagcct atattgttct caccgaaagt gcctgcgtat 5400 attcatccaa ggaagtatct cgtggaaaca ccaccggtag acgagactcc ggagccatcg 5460 gcagagaacc aatccacaga ggggacacct gaacaaccac cacttataac cgaggatgag 5520 accaggacta gaacgcctga gccgatcatc atcgaagagg aagaagagga tagcataagt 5580 ttgctgtcag atggcccgac ccaccaggtg ctgcaagtcg aggcagacat tcacgggccg 5640 ccctctgtat ctagctcatc ctggtccatt cctcatgcat ccgactttga tgtggacagt 5700 ttatccatac ttgacaccct ggagggagct agcgtgacca gcggggcaac gtcagccgag 5760 actaactctt acttcgcaaa gagtatggag tttctggcgc gaccggtgcc tgcgcctcga 5820 acagtattca ggaaccctcc acatcccgct ccgcgcacaa gaacaccgtc acttgcaccc 5880 agcagggcct gctcgagaac cagcctagtt tccaccccgc cag gcgtgaa tagggtgatc 5940 actagagagg agctcgaggc gcttaccccg tcacgcactc ctagcaggtc ggtctcgaga 6000 accagcctgg tctccaaccc gccaggcgta aatagggtga ttacaagaga ggagtttgag 6060 gcgttcgtag cacaacaaca atgacggttt gatgcgggtg catacatctt ttcctccgac 6120 accggtcaag ggcatttaca acaaaaatca gtaaggcaaa cggtgctatc cgaagtggtg 6180 ttggagagga ccgaattgga gatttcgtat gccccgcgcc tcgaccaaga aaaagaagaa 6240 ttactacgca agaaattaca gttaaatccc acacctgcta acagaagcag ataccagtcc 6300 aggaaggtgg agaacatgaa agccataaca gctagacgta ttctgcaagg cctagggcat 6360 tatttgaagg cagaaggaaa agtggagtgc taccgaaccc tgcatcctgt tcctttgtat 6420 tcatctagtg tgaaccgtgc cttttcaagc cccaaggtcg cagtggaagc ctgtaacgcc 6480 atgttgaaag agaactttcc gactgtggct tcttactgta ttattccaga gtacgatgcc 6540 tatttggaca tggttgacgg agcttcatgc tgcttagaca ctgccagttt ttgccctgca 6600 aagctgcgca gctttccaaa gaaacactcc tatttggaac ccacaatacg atcggcagtg 6660 ccttcagcga tccagaacac gctccagaac gtcctggcag ctgccacaaa aagaaattgc 6720 aatgtcacgc aaatgagaga attgcccgta ttggattcgg cggccttta a tgtggaatgc 6780 ttcaagaaat atgcgtgtaa taatgaatat tgggaaacgt ttaaagaaaa ccccatcagg 6840 cttactgaag aaaacgtggt aaattacatt accaaattaa aaggaccaaa agctgctgct 6900 ctttttgcga agacacataa tttgaatatg ttgcaggaca taccaatgga caggtttgta 6960 atggacttaa agagagacgt gaaagtgact ccaggaacaa aacatactga agaacggccc 7020 aaggtacagg tgatccaggc tgccgatccg ctagcaacag cgtatctgtg cggaatccac 7080 cgagagctgg ttaggagatt aaatgcggtc ctgcttccga acattcatac actgtttgat 7140 atgtcggctg aagactttga cgctattata gccgagcact tccagcctgg ggattgtgtt 7200 ctggaaactg acatcgcgtc gtttgataaa agtgaggacg acgccatggc tctgaccgcg 7260 ttaatgattc tggaagactt aggtgtggac gcagagctgt tgacgctgat tgaggcggct 7320 ttcggcgaaa tttcatcaat acatttgccc actaaaacta aatttaaatt cggagccatg 7380 atgaaatctg gaatgttcct cacactgttt gtgaacacag tcattaacat tgtaatcgca 7440 agcagagtgt tgagagaacg gctaaccgga tcaccatgtg cagcattcat tggagatgac 7500 aatatcgtga aaggagtcaa atcggacaaa ttaatggcag acaggtgcgc cacctggttg 7560 aatatggaag tcaagattat agatgctgtg gtgggcgaga aagcgcctta tttc tgtgga 7620 gggtttattt tgtgtgactc cgtgaccggc acagcgtgcc gtgtggcaga ccccctaaaa 7680 aggctgttta agcttggcaa acctctggca gcagacgatg aacatgatga tgacaggaga 7740 agggcattgc atgaagagtc aacacgctgg aaccgagtgg gtattctttc agagctgtgc 7800 aaggcagtag aatcaaggta tgaaaccgta ggaacttcca tcatagttat ggccatgact 7860 actctagcta gcagtgttaa atcattcagc tacctgagag gggcccctat aactctctac 7920 ggctaacctg aatggactac gacatagtct agtccgccaa gatatcatgg ctcgacctct 7980 gtgtaccctg ctactcctga tggctaccct ggctggagct ctggccagca tgcccctgtc 8040 ttaccagcac tttagaaagc ttctgctgct ggacgatgaa gccgggcctc tggaggaaga 8100 gctgccaagg ctggcagacg aggggctgaa ccggagagtg gccgaagatc tgaatctggg 8160 aaacctgaac gtgagcatcc cttggactca taaagtcggc aacttcaccg ggctgtacag 8220 ctccacagtg cctgtcttca atccagagtg gcagacacca tcctttccca acattcacct 8280 gcaggaggac atcattaata gatgcgaaca gttcgtggga cctctgacag tcaacgaaaa 8340 gaggcgcctg aaactgatca tgcctgccag gttttaccca aatgtgacta agtatctgcc 8400 actggataag ggcatcaagc cttactatcc agagcacctg gtgaaccatt acttccagac 8460 tagacactat ctgcataccc tgtggaaggc cggaatcctg tacaaacgag aaactacccg 8520 gagtgcttca ttttgtggct ccccatattc ttgggaacag gagctgcagc atggcaggct 8580 ggtgttccag accagcaaac gccacgggga tgagtccttt tgcagccagt ctagtggcat 8640 cctgagcaga tcccccgtgg ggccttgtat tcagtctcag ctgcggaaga gtagactggg 8700 actgcagcca cagcagggac acctggcacg acggcagcag ggaaggtctg gcagtatccg 8760 ggctagagtg catcccacaa ctagaaggac cttcggcgtc gagccatcag gaagcggcca 8820 catcgacaac agcgcatcaa gctcctctag ttgcctgcat cagtcagccg tgagaaaggc 8880 cgcttacagc cacctgtcca catctaaaag gcactcaagc tccgggcatg ctgtggagct 8940 gcacaacatc cctccaaatt ctgcacgcag tcagtcagaa ggacccgtgt tcagctgctg 9000 gtggctgcag tttcggaact caaagccttg cagcgactat tgtctgagcc atattgtgaa 9060 tctgctggag gattggggcc cttgtaccga gcacggggaa caccatatca ggattccacg 9120 aacaccagca cgagtgactg gaggggtgtt cctggtggac aagaaccccc acaatactac 9180 cgagagccgg ctggtggtcg atttcagtca gttttcaaga ggcaacacaa gggtgtcatg 9240 gcccaaattc gccgtcccta atctgcagag tctgactaac ctgctgtcta gtaatctgag 9300 ctggctgtcc ctggacgtgt ccgcagcctt ttaccacctg cctctgcatc cagctgcaat 9360 gccccatctg ctggtggggt caagcggact gagtcgctac gtcgcccgac tgtcctctaa 9420 ctcacgcatc attaatcacc agcatggcac catgcagaac ctgcacgata gctgttcccg 9480 gaatctgtac gtgtctctgc tgctgctgta taagacattc ggcagaaaac tgcacctgta 9540 cagccatcct atcattctgg ggtttaggaa gatcccaatg ggagtgggac tgagcccctt 9600 cctgctggca cagtttacct ccgccatttg ctctgtggtc cgccgagcct tcccacactg 9660 tctggctttt tcctatatga acaatgtggt cctgggcgcc aaatccgtgc agcatctgga 9720 gtctctgttc acagctgtca ctaactttct gctgagcctg gggatccacc tgaacccaaa 9780 taagactaaa cgctgggggt acagcctgaa tttcatggga tatgtgattg gatcctgggg 9840 gaccctgcca caggagcaca tcgtgcagaa gatcaaggaa tgctttcgga agctgcccgt 9900 caacagacct atcgactgga aagtgtgcca gcggattgtc ggactgctgg gcttcgccgc 9960 tccctttacc cagtgcgggt acccagcact gatgcccctg tatgcctgta tccagtctaa 10020 gcaggctttc acctttagtc ctacatacaa ggcattcctg tgcaaacagt acctgaacct 10080 gtatccagtg gcaaggcagc gacctggact gtgccaggtc tttgcaaatg ccactcctac 10140 cgg ctggggg ctggctatcg gacatcagcg aatgcggggc acattcgtgg cccccctgcc 10200 tattcacact gctcagctgc tggcagcctg ctttgctaga tctaggagtg gagcaaagct 10260 gatcggcacc gacaatagtg tggtcctgtc aagaaaatac acatccttcc catggctgct 10320 gggatgtgct gcaaactgga ttctgagggg caccagcttc gtgtacgtcc cctcagccct 10380 gaatcctgct gacgatccat cccgcgggcg actgggactg taccgacctc tgctgagact 10440 gcccttcagg cctacaactg gccggacatc tctgtatgcc gattcaccaa gcgtgccctc 10500 acacctgcct gacagagtcc actttgcttc acccctgcac gtcgcttggc ggcctccagg 10560 aagcggagct actaacttca gcctgctgaa gcaggctgga gacgtggagg agaaccctgg 10620 acctatggct cgacctctgt gtaccctgct actcctgatg gctaccctgg ctggagctct 10680 ggccagcgac atcgaccctt acaaggagtt cggcgccagc gtggaactgc tgtcttttct 10740 gcccagtgat ttctttcctt ccattcgaga cctgctggat accgcctctg ctctgtatcg 10800 ggaagccctg gagagcccag aacactgctc cccacaccat accgctctgc gacaggcaat 10860 cctgtgctgg ggggagctga tgaacctggc cacatgggtg ggatcgaatc tggaggaccc 10920 cgcttcacgg gaactggtgg tcagctacgt gaacgtcaat atgggcctga aaatccgcca 1 0980 gctgctgtgg ttccatatta gctgcctgac ttttggacga gagaccgtgc tggaatacct 11040 ggtgtccttc ggcgtctgga ttcgcactcc ccctgcttat cgaccaccca acgcaccaat 11100 tctgtccacc ctgcccgaga ccacagtggt ccgtcgccgt taattaaaac agctgtgggt 11160 tgttcccacc cacagggccc actgggcgct agcactctga ttttacgaaa tccttgtgcg 11220 cctgttttat atcccttccc taattcgaaa cgtagaagca atgcgcacca ctgatcaata 11280 gtaggcgtaa cgcgccagtt acgtcatgat caagcatatc tgttcccccg gactgagtat 11340 caatagactg cttacgcggt tgaaggagaa aacgttcgtt atccggctaa ctacttcgag 11400 aagcccagta acaccatgga agctgcaggg tgtttcgctc agcacttccc ccgtgtagat 11460 caggtcgatg agccactgca atccccacag gtgactgtgg cagtggctgc gttggcggcc 11520 tgcctatggg gagacccata ggacgctcta atgtggacat ggtgcgaaga gcctattgag 11580 ctagttagta gtcctccggc ccctgaatgc ggctaatcct aactgcggag cacatgcctt 11640 caacccagag ggtagtgtgt cgtaacgggc aactctgcag cggaaccgac tactttgggt 11700 gtccgtgttt cttttttatt cttatattgg ctgcttatgg tgacaattac agaattgtta 11760 ccatatagct attggattgg ccatccggtg tgtaatagag ctgttatata ccta tttgtt 11820 ggctttgtac cactaacttt aaaatctata actaccctca actttatatt aaccctcaat 11880 acagttgacc atgcagtgga actcaactac tttccatcag acccttcagg accctagagt 11940 gcgcgggctg tactttcctg ctgggggaag cagtagcggg accgttaatc cagtacctac 12000 gaccgcctct cccatatctt ctatctttag taggactggt gaccctgctc ccaacatgga 12060 gaatatcacc tccgggtttc tgggcccact cctggtcctt caggccggat tcttcctgct 12120 gactcgaatc ctcaccatac cccagagcct ggacagctgg tggacaagcc tgaattttct 12180 gggaggaact cctgtatgcc tgggacaaaa ttcacagtcc cctacaagta accattcacc 12240 gacaagttgt cctcccatct gtcccggata caggtggatg tgcctgcgaa ggttcatcat 12300 cttcctcttc atcctcttgc tttgccttat tttcctcctg gttcttctgg actatcaggg 12360 catgctgcct gtgtgcccac tgataccagg atctagtact accagcacag gcccgtgtaa 12420 gacctgtaca attccagcac aagggactag tatgttcccc tcctgctgtt gtactaagcc 12480 aagcgacggt aattgcacgt gtatcccaat cccgtcctcc tgggcgtttg ccaagtacct 12540 ctgggaatgg gcctcagtca gattttcatg gcttagtctt ttggtgccgt tcgtgcagtg 12600 gtttgtggga ctctctccga ctgtgtggct cagcgtgatc tggatga tgt ggtactgggg 12660 cccttccctt tacaacatac tgtctccatt ccttcccctg ctgccaatct tcttttgcct 12720 gtgggtctat attgggtccg gagcgactaa cttttccctg ctgaaacaag cgggtgacgt 12780 cgaagagaat ccgggaccta tggctaggcc cctgtgtaca cttttgctcc tgatggccac 12840 cctcgctgga gctctggcaa gcggtggatg gagctcaaag ccgcggaaag ggatgggtac 12900 taacctgtcc gtaccaaatc ccctgggatt ttttccagac caccaactcg atcctgcttt 12960 tggcgcaaat tccaacaatc ccgactggga ctttaaccct aacaaggacc actggcctga 13020 tgccaacaag gtgggggcag gagcctttgg tcccggcttc accccacccc atggaggtct 13080 tttgggatgg tcaccacagg cccagggcat cctgaccact gtccctgctg ctccaccgcc 13140 agcttctact aatcgacaga gcgggaggca gccgaccccc ctgagtcccc ccctgcggga 13200 tacccaccct caggcataag gcgcgccgtt taaacggccg gccttaatta agtaacgata 13260 cagcagcaat tggcaagctg cttacataga actcgcggcg attggcatgc cgctttaaaa 13320 tttttatttt atttttcttt tcttttccga atcggatttt gtttttaata tttcaaaaaa 13380 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaa 13414 <![CDATA[ <210> 73]]>
           <![CDATA[ <211> 18]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> T7 promoter]]>
           <![CDATA[ <400> 73]]>
          taatacgact cactatag 18
           <![CDATA[ <210> 74]]>
           <![CDATA[ <211> 4]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> YXDD motif]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <221> misc_feature]]>
           <![CDATA[ <222> (2)..(2)]]>
           <![CDATA[ <223> Xaa can be any naturally occurring amino acid]]>
           <![CDATA[ <400> 74]]>
          Tyr Xaa Asp Asp
          1               
           <![CDATA[ <210> 75]]>
           <![CDATA[ <211> 4]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> DEDD motif]]>
           <![CDATA[ <400> 75]]>
          Asp Glu Asp Asp
          1               
           <![CDATA[ <210> 76]]>
           <![CDATA[ <211> 32]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> C-terminal deletion of core antigen]]>
           <![CDATA[ <400> 76]]>
          Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg Arg Arg
          1 5 10 15
          Ser Gln Ser Pro Arg Arg Arg Arg Arg Ser Gln Ser Arg Glu Ser Gln Cys
                      20 25 30
           <![CDATA[ <210> 77]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> cystin S signal peptide]]>
           <![CDATA[ <400> 77]]>
          Met Ala Arg Pro Leu Cys Thr Leu Leu Leu Leu Met Ala Thr Leu Ala
          1 5 10 15
          Gly Ala Leu Ala Ser
                      20
           <![CDATA[ <210> 78]]>
           <![CDATA[ <211> 681]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223>S surface antigen coding sequence]]>
           <![CDATA[ <400> 78]]>
          atggagaata tcacctccgg gtttctgggc ccactcctgg tccttcaggc cggattcttc 60
          ctgctgactc gaatcctcac cataccccag agcctggaca gctggtggac aagcctgaat 120
          tttctgggag gaactcctgt atgcctggga caaaattcac agtcccctac aagtaaccat 180
          tcaccgacaa gttgtcctcc catctgtccc ggatacaggt ggatgtgcct gcgaaggttc 240
          atcatcttcc tcttcatcct cttgctttgc cttattttcc tcctggttct tctggactat 300
          cagggcatgc tgcctgtgtg cccactgata ccaggatcta gtactaccag cacaggcccg 360
          tgtaagacct gtacaactcc agcacaaggg actagtatgt tcccctcctg ctgttgtact 420
          aagccatcag acggtaattg cacgtgtatc ccaatcccgt cctcctgggc gtttgccaag 480
          tttctctggg aatgggcctc agtcagattt tcatggctta gtcttttggt gccgttcgtg 540
          cagtggtttg tgggactctc tccgactgtg tggctcagcg tgatctggat gatgtggtac 600
          tggggccctt ccctttacaa catactgtct ccattccttc ccctgctgcc aatcttcttt 660
          tgcctgtggg tctatatta a 681
           <![CDATA[ <210> 79]]>
           <![CDATA[ <211> 226]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> S surface antigen]]>
           <![CDATA[ <400> 79]]>
          Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln
          1 5 10 15
          Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu
                      20 25 30
          Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr Pro Val Cys
                  35 40 45
          Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser
              50 55 60
          Cys Pro Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe
          65 70 75 80
          Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val
                          85 90 95
          Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly
                      100 105 110
          Ser Ser Thr Thr Ser Ser Thr Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala
                  115 120 125
          Gln Gly Thr Ser Met Phe Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp
              130 135 140
          Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys
          145 150 155 160
          Phe Leu Trp Glu Trp Ala Ser Val Arg Phe Ser Trp Leu Ser Leu Leu
                          165 170 175
          Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu
                      180 185 190
          Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Asn Ile
                  195 200 205
          Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val
              210 215 220
          Tyr Ile
          225
           <![CDATA[ <210> 80]]>
           <![CDATA[ <211> 567]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> LM surface antigen coding sequence]]>
           <![CDATA[ <400> 80]]>
          ggtggatgga gctcaaagcc gcggaaaggg atgggtacta acctgtccgt accaaatccc 60
          ctgggatttt ttccagacca ccaactcgat cctgcttttg gcgcaaattc caacaatccc 120
          gactgggact ttaaccctaa caaggacacc tggcctgatg ccaacaaggt gggggcagga 180
          gcctttggtc ccggcttcac cccacccccat ggaggtcttt tgggatggtc accacaggcc 240
          cagggcatcc tgaccactgt ccctgctgct ccaccgccag cttctactaa tcgacagagc 300
          gggaggcagc cgaccccccct gagtcccccc ctgcgggata cccaccctca ggcaatgcag 360
          tggaactcaa ctactttcca tcagaccctt caggacccta gagtgcgcgg gctgtacttt 420
          cctgctgggg gaagcagtag cgggaccgtt aatccagtac ctacgaccgc ctctcccata 480
          tcttctatct ttagtaggac tggtgaccct gctcccaaca tggaaaatat aactagcggc 540
          ttcctgggcc cccttctcgt cctgtaa 567
           <![CDATA[ <210> 81]]>
           <![CDATA[ <211> 188]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> LM surface antigen]]>
           <![CDATA[ <400> 81]]>
          Gly Gly Trp Ser Ser Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser
          1 5 10 15
          Val Pro Asn Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Ala
                      20 25 30
          Phe Gly Ala Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Asn Lys
                  35 40 45
          Asp Thr Trp Pro Asp Ala Asn Lys Val Gly Ala Gly Ala Phe Gly Pro
              50 55 60
          Gly Phe Thr Pro Pro His Gly Gly Leu Leu Gly Trp Ser Pro Gln Ala
          65 70 75 80
          Gln Gly Ile Leu Thr Thr Val Pro Ala Ala Pro Pro Pro Ala Ser Thr
                          85 90 95
          Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro Leu Ser Pro Pro Leu Arg
                      100 105 110
          Asp Thr His Pro Gln Ala Met Gln Trp Asn Ser Thr Thr Phe His Gln
                  115 120 125
          Thr Leu Gln Asp Pro Arg Val Arg Gly Leu Tyr Phe Pro Ala Gly Gly
              130 135 140
          Ser Ser Ser Gly Thr Val Asn Pro Val Pro Thr Thr Ala Ser Pro Ile
          145 150 155 160
          Ser Ser Ile Phe Ser Arg Thr Gly Asp Pro Ala Pro Asn Met Glu Asn
                          165 170 175
          Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu
                      180 185
           <![CDATA[ <210> 82]]>
           <![CDATA[ <211> 280]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> M surface antigen]]>
           <![CDATA[ <400> 82]]>
          Gln Trp Asn Ser Thr Thr Phe His Gln Thr Leu Gln Asp Pro Arg Val
          1 5 10 15
          Arg Gly Leu Tyr Phe Pro Ala Gly Gly Ser Ser Ser Gly Thr Val Asn
                      20 25 30
          Pro Val Pro Thr Thr Ala Ser Pro Ile Ser Ser Ser Ile Phe Ser Arg Thr
                  35 40 45
          Gly Asp Pro Ala Pro Asn Met Glu Asn Ile Thr Ser Gly Phe Leu Gly
              50 55 60
          Pro Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu
          65 70 75 80
          Thr Ile Pro Gln Ser Leu Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu
                          85 90 95
          Gly Gly Thr Pro Val Cys Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser
                      100 105 110
          Asn His Ser Pro Thr Ser Cys Pro Pro Ile Cys Pro Gly Tyr Arg Trp
                  115 120 125
          Met Cys Leu Arg Arg Phe Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys
              130 135 140
          Leu Ile Phe Leu Leu Val Leu Leu Asp Tyr Gln Gly Met Leu Pro Val
          145 150 155 160
          Cys Pro Leu Ile Pro Gly Ser Ser Thr Thr Ser Thr Gly Pro Cys Lys
                          165 170 175
          Thr Cys Thr Thr Pro Ala Gln Gly Thr Ser Met Phe Pro Ser Cys Cys
                      180 185 190
          Cys Thr Lys Pro Ser Asp Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser
                  195 200 205
          Ser Trp Ala Phe Ala Lys Phe Leu Trp Glu Trp Ala Ser Val Arg Phe
              210 215 220
          Ser Trp Leu Ser Leu Leu Val Pro Phe Val Gln Trp Phe Val Gly Leu
          225 230 235 240
          Ser Pro Thr Val Trp Leu Ser Val Ile Trp Met Met Trp Tyr Trp Gly
                          245 250 255
          Pro Ser Leu Tyr Asn Ile Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile
                      260 265 270
          Phe Phe Cys Leu Trp Val Tyr Ile
                  275 280
           <![CDATA[ <210> 83]]>
           <![CDATA[ <211> 399]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> L surface antigen]]>
           <![CDATA[ <400> 83]]>
          Gly Gly Trp Ser Ser Lys Pro Arg Lys Gly Met Gly Thr Asn Leu Ser
          1 5 10 15
          Val Pro Asn Pro Leu Gly Phe Phe Pro Asp His Gln Leu Asp Pro Ala
                      20 25 30
          Phe Gly Ala Asn Ser Asn Asn Pro Asp Trp Asp Phe Asn Pro Asn Lys
                  35 40 45
          Asp Thr Trp Pro Asp Ala Asn Lys Val Gly Ala Gly Ala Phe Gly Pro
              50 55 60
          Gly Phe Thr Pro Pro His Gly Gly Leu Leu Gly Trp Ser Pro Gln Ala
          65 70 75 80
          Gln Gly Ile Leu Thr Thr Val Pro Ala Ala Pro Pro Pro Ala Ser Thr
                          85 90 95
          Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro Leu Ser Pro Pro Leu Arg
                      100 105 110
          Asp Thr His Pro Gln Ala Met Gln Trp Asn Ser Thr Thr Phe His Gln
                  115 120 125
          Thr Leu Gln Asp Pro Arg Val Arg Gly Leu Tyr Phe Pro Ala Gly Gly
              130 135 140
          Ser Ser Ser Gly Thr Val Asn Pro Val Pro Thr Thr Ala Ser Pro Ile
          145 150 155 160
          Ser Ser Ile Phe Ser Arg Thr Gly Asp Pro Ala Pro Asn Met Glu Asn
                          165 170 175
          Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln Ala Gly Phe
                      180 185 190
          Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp Ser Trp
                  195 200 205
          Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr Pro Val Cys Leu Gly Gln
              210 215 220
          Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser Cys Pro Pro
          225 230 235 240
          Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile Phe
                          245 250 255
          Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu Leu Asp
                      260 265 270
          Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Ser Thr
                  275 280 285
          Thr Ser Thr Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala Gln Gly Thr
              290 295 300
          Ser Met Phe Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly Asn Cys
          305 310 315 320
          Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys Phe Leu Trp
                          325 330 335
          Glu Trp Ala Ser Val Arg Phe Ser Trp Leu Ser Leu Leu Val Pro Phe
                      340 345 350
          Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser Val Ile
                  355 360 365
          Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Asn Ile Leu Ser Pro
              370 375 380
          Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr Ile
          385 390 395
           <![CDATA[ <210> 84]]>
           <![CDATA[ <211> 149]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core antigen]]>
           <![CDATA[ <400> 84]]>
          Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu Ser
          1 5 10 15
          Phe Leu Pro Ser Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp Thr
                      20 25 30
          Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser
                  35 40 45
          Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu
              50 55 60
          Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala Ser
          65 70 75 80
          Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys Ile
                          85 90 95
          Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu
                      100 105 110
          Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro
                  115 120 125
          Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu
              130 135 140
          Thr Thr Val Val Arg
          145
           <![CDATA[ <210> 85]]>
           <![CDATA[ <211> 150]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core antigen]]>
           <![CDATA[ <400> 85]]>
          Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu Ser
          1 5 10 15
          Phe Leu Pro Ser Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp Thr
                      20 25 30
          Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser
                  35 40 45
          Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu
              50 55 60
          Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala Ser
          65 70 75 80
          Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys Ile
                          85 90 95
          Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu
                      100 105 110
          Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro
                  115 120 125
          Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu
              130 135 140
          Thr Thr Val Val Arg Arg
          145 150
           <![CDATA[ <210> 86]]>
           <![CDATA[ <211> 151]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> core antigen]]>
           <![CDATA[ <400> 86]]>
          Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Val Glu Leu Leu Ser
          1 5 10 15
          Phe Leu Pro Ser Asp Phe Phe Pro Ser Ile Arg Asp Leu Leu Asp Thr
                      20 25 30
          Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser
                  35 40 45
          Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu
              50 55 60
          Met Asn Leu Ala Thr Trp Val Gly Ser Asn Leu Glu Asp Pro Ala Ser
          65 70 75 80
          Arg Glu Leu Val Val Ser Tyr Val Asn Val Asn Met Gly Leu Lys Ile
                          85 90 95
          Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu
                      100 105 110
          Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro
                  115 120 125
          Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu
              130 135 140
          Thr Thr Val Val Arg Arg Arg
          145 150
           <![CDATA[ <210> 87]]>
           <![CDATA[ <211> 447]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Core antigen coding sequence]]>
           <![CDATA[ <400> 87]]>
          gacatcgacc cttacaagga gttcggcgcc agcgtggaac tgctgtcttt tctgcccagt 60
          gatttctttc cttccattcg agacctgctg gataccgcct ctgctctgta tcgggaagcc 120
          ctggagagcc cagaacactg ctccccaacac cataccgctc tgcgacaggc aatcctgtgc 180
          tggggggagc tgatgaacct ggccacatgg gtgggatcga atctggagga ccccgcttca 240
          cgggaactgg tggtcagcta cgtgaacgtc aatatgggcc tgaaaatccg ccagctgctg 300
          tggttccata ttagctgcct gacttttgga cgagagaccg tgctggaata cctggtgtcc 360
          ttcggcgtct ggattcgcac tccccctgct tatcgaccac ccaacgcacc aattctgtcc 420
          accctgcccg agaccacagt ggtccgt 447
           <![CDATA[ <210> 88]]>
           <![CDATA[ <211> 450]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Core antigen coding sequence]]>
           <![CDATA[ <400> 88]]>
          gacatcgacc cttacaagga gttcggcgcc agcgtggaac tgctgtcttt tctgcccagt 60
          gatttctttc cttccattcg agacctgctg gataccgcct ctgctctgta tcgggaagcc 120
          ctggagagcc cagaacactg ctccccaacac cataccgctc tgcgacaggc aatcctgtgc 180
          tggggggagc tgatgaacct ggccacatgg gtgggatcga atctggagga ccccgcttca 240
          cgggaactgg tggtcagcta cgtgaacgtc aatatgggcc tgaaaatccg ccagctgctg 300
          tggttccata ttagctgcct gacttttgga cgagagaccg tgctggaata cctggtgtcc 360
          ttcggcgtct ggattcgcac tccccctgct tatcgaccac ccaacgcacc aattctgtcc 420
          accctgcccg agaccacagt ggtccgtcgc 450
           <![CDATA[ <210> 89]]>
           <![CDATA[ <211> 456]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Core antigen coding sequence]]>
           <![CDATA[ <400> 89]]>
          gacatcgacc cttacaagga gttcggcgcc agcgtggaac tgctgtcttt tctgcccagt 60
          gatttctttc cttccattcg agacctgctg gataccgcct ctgctctgta tcgggaagcc 120
          ctggagagcc cagaacactg ctccccaacac cataccgctc tgcgacaggc aatcctgtgc 180
          tggggggagc tgatgaacct ggccacatgg gtgggatcga atctggagga ccccgcttca 240
          cgggaactgg tggtcagcta cgtgaacgtc aatatgggcc tgaaaatccg ccagctgctg 300
          tggttccata ttagctgcct gacttttgga cgagagaccg tgctggaata cctggtgtcc 360
          ttcggcgtct ggattcgcac tccccctgct tatcgaccac ccaacgcacc aattctgtcc 420
          accctgcccg agaccacagt ggtccgtcgc cgttaa 456
           <![CDATA[ <210> 90]]>
           <![CDATA[ <211> 63]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> cystin S signal peptide coding sequence]]>
           <![CDATA[ <400> 90]]>
          atggctcgac ctctgtgtac cctgctactc ctgatggcta ccctggctgg agctctggcc 60
          agc 63
           <![CDATA[ <210> 91]]>
           <![CDATA[ <211> 4]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV core antigen C-terminal]]>
           <![CDATA[ <400> 91]]>
          Val Val Arg Arg
          1               
           <![CDATA[ <210> 92]]>
           <![CDATA[ <211> 5]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV core antigen C-terminal]]>
           <![CDATA[ <400> 92]]>
          Val Val Arg Arg Arg
          1 5
           <![CDATA[ <210> 93]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 93]]>
          agaaaauuga gagaagucca c 21
           <![CDATA[ <210> 94]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 94]]>
          agaaaauuga gagaagucca c 21
           <![CDATA[ <210> 95]]>
           <![CDATA[ <211> 23]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 95]]>
          agaaaauuga gagaagucca cuu 23
           <![CDATA[ <210> 96]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 96]]>
          agaaaauuga gagaagucca cc 22
           <![CDATA[ <210> 97]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense unmodified sequence]]>
           <![CDATA[ <400> 97]]>
          agaaaauuga gagaagucca c 21
           <![CDATA[ <210> 98]]>
           <![CDATA[ <211> 23]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense unmodified sequence]]>
           <![CDATA[ <400> 98]]>
          agaaaauuga gagaagucca cuu 23
           <![CDATA[ <210> 99]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense unmodified sequence]]>
           <![CDATA[ <400> 99]]>
          agaaaauuga gagaagucca cc 22
           <![CDATA[ <210> 100]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 100]]>
          uaccaauuua ugccuacagc g 21
           <![CDATA[ <210> 101]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense unmodified sequence]]>
           <![CDATA[ <400> 101]]>
          uaccaauuua ugccuacagc g 21
           <![CDATA[ <210> 102]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 102]]>
          guggacuucu cucaauuuuc u 21
           <![CDATA[ <210> 103]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 103]]>
          guggacuucu cucaauuuuc u 21
           <![CDATA[ <210> 104]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 104]]>
          gguggacuuc ucucaauuuu cu 22
           <![CDATA[ <210> 105]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 105]]>
          guggacuucu cucaauuuuc u 21
           <![CDATA[ <210> 106]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has unmodified sequence of the sense strand]]>
           <![CDATA[ <400> 106]]>
          guggacuucu cucaauuuuc u 21
           <![CDATA[ <210> 107]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has unmodified sequence of the sense strand]]>
           <![CDATA[ <400> 107]]>
          gguggacuuc ucucaauuuu cu 22
           <![CDATA[ <210> 108]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 108]]>
          cgcuguaggc auaaauuggu a 21
           <![CDATA[ <210> 109]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 109]]>
          cgcuguaggc auaaauuggu a 21
           <![CDATA[ <210> 110]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 110]]>
          cgcuguaggc auaaauuggu a 21
           <![CDATA[ <210> 111]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has unmodified sequence of the sense strand]]>
           <![CDATA[ <400> 111]]>
          cgcuguaggc auaaauuggu a 21
           <![CDATA[ <210> 112]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 112]]>
          uauugagaga aguccaccac uu 22
           <![CDATA[ <210> 113]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 113]]>
          gugguggacu ucucucaaua uu 22
           <![CDATA[ <210> 114]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent antisense strand modified sequence]]>
           <![CDATA[ <400> 114]]>
          uaccaauuua ugccuacagu u 21
           <![CDATA[ <210> 115]]>
           <![CDATA[ <211> 19]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> HBV RNAi agent has a modified sequence of the sense strand]]>
           <![CDATA[ <400> 115]]>
          cuguaggcau aaauugua 19
          
      

Claims (84)

A combination for the treatment of hepatitis B virus (HBV) infection, more particularly chronic HBV infection (CHB), with or without viral co-infection, and/or for the treatment of chronic HBV infection (CHB) in an individual in need thereof HDV infection, the combination contains: (a) an effective amount of a pharmaceutical composition comprising an RNAi component having: (i) a first RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any one of the following: SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98 and SEQ ID NO: 99; and a meaningful share comprising the nucleotide sequence of any one of the following: SEQ ID NO: 102. SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107; and (ii) a second RNAi agent comprising: an antisense strand comprising the nucleotide sequence of any of the following: SEQ ID NO: 100 and SEQ ID NO: 101; and a sense strand, the The sense strand comprises the nucleotide sequence of any one of: SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, and SEQ ID NO: 111; and (b) an effective amount of a nucleic acid molecule comprising, sequenced from the 5' end to the 3' end, a non-naturally occurring polynucleotide sequence comprising: (1) a polynucleotide sequence encoding a first hepatitis B virus (HBV) antigen, (2) a first internal ribosome entry sequence (IRES) element or a polynucleotide sequence encoding a first autoprotease peptide, and (3) a polynucleotide sequence encoding a second HBV antigen, Wherein the first HBV antigen and the second HBV antigen are each independently selected from the group consisting of HBV core antigen, HBV polymerase (pol) antigen and HBV surface antigen, and at least one of the first and second HBV antigens HBV surface antigen, preferably HBV Pre-S1 antigen or HBV PreS2.S antigen. Combination for use according to claim 1, wherein the combination enhances the immune response of an individual suffering from hepatitis B virus (HBV) infection, more particularly chronic HBV infection (CHB), with or without viral co-infection . Combination for use according to claim 1, wherein the combination reduces viral replication in individuals with hepatitis B virus (HBV) infection, more particularly chronic HBV infection (CHB), with or without viral co-infection . The combination for use according to claim 1, wherein the combination reduces the expression of one or more hepatitis B virus (HBV) polypeptides, more specifically one or more polypeptides selected from HBsAg and HBeAg, in an individual in need thereof. Combination for use according to claim 1, wherein the combination increases containment integration in individuals with hepatitis B virus (HBV) infection, more specifically chronic HBV infection (CHB), with or without viral co-infection Targeted killing of hepatocytes with viral DNA or extrachromosomal viral DNA. The combination for use according to any one of claims 1 to 5, wherein the HBV infection is chronic HBV infection. The combination for use according to any one of claims 1 to 6, wherein the effective amount of the pharmaceutical composition comprising the RNAi component and the effective amount of the pharmaceutical composition comprising the nucleic acid molecule reduce the individual's exposure to HBV Tolerizing, more particularly tolerizing the subject's liver to HBV, the nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens. The combination for use according to any one of claims 1 to 7, wherein the effective amount of the pharmaceutical composition comprising the RNAi component and the effective amount of the pharmaceutical composition comprising the nucleic acid molecule are administered to the individual, The nucleic acid molecule comprises a non-naturally occurring polynucleotide sequence encoding one or more HBV antigens at least until the individual meets at least one, at least two, at least three, at least four, or five of the following characteristics: i. Serum HBV DNA below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL, more specifically below 10 IU/ml; ii. Serum ALT concentration below 3 times the upper limit of normal, or below 129 U/L if the individual is male, or below 108 U/L if the individual is female, more specifically The serum ALT concentration is lower than 120 U/L if the individual is a male individual or lower than 105 U/L if the individual is a female individual, more specifically the serum ALT concentration is lower than 105 U/L if the individual is a male individual less than 90 U/L in the case of a female or less than 57 U/L in the case of a female individual; iii. HBeAg negative serum; iv. A serum HBsAg level of 1000 IU/mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, more specifically 10 IU/mL or less; and v. HBs seroconversion. Combination for use according to claim 8, wherein at least one, at least two, at least three, at least four of characteristics i., ii., iii., iv. and v. are still satisfied 6 months after the end of treatment one or five. The combination for use according to claim 8, wherein the serum HBsAg level is 1000 IU/mL or lower, more specifically 300 IU/mL or lower, more specifically 100 IU/mL or lower, more specifically 10 IU/mL or less. The combination for use according to any one of claims 1 to 10, wherein the effective amount of the pharmaceutical composition comprising the RNAi component is administered to the individual at least until the serum HBsAg level of the individual is reduced to 1000 IU/ mL or less, more specifically 300 IU/mL or less, more specifically 100 IU/mL or less, more specifically 10 IU/mL or less. The combination for use according to any one of claims 1 to 11, wherein the serum HBsAg level in the patient is reduced to 1000 IU/mL or lower, more specifically 300 IU/mL or lower, more specifically 100 After IU/mL or less, more specifically 10 IU/mL or less, the effective amount of the nucleic acid molecule comprising a non-naturally occurring polynucleotide is administered to the individual. The combination for use according to any one of claims 8 to 12, wherein compared to administering only an effective amount of the pharmaceutical composition comprising the RNAi component or administering an effective amount of the pharmaceutical composition comprising the non-naturally occurring polynucleotide In the individual of the nucleic acid molecule, the serum HBsAg level of the individual decreases at a faster rate, decreases to a greater extent, and/or decreases for a longer period of time. The combination for use according to claim 2, wherein enhancing the immune response of the individual results in an increase in the innate immune system response and/or the acquired immune system response. The combination for use according to claim 14, wherein the innate immune system response is increased such that interferon stimulated gene (ISG), interferon gamma inducible protein 10 (IP10), interferon alpha (IFN alpha), interleukin 12 or interleukin Increased expression of one or several of -6 (IL-6). The combination for use according to claim 14, wherein the increased acquired immune system response results in increased HBV-specific T-cell response and/or increased activation of HBV-specific T-cells. The combination for use according to claim 2, wherein enhancing the immune response of the individual increases the immunity of the individual. The combination for use according to claim 17, wherein the increased immunity of the individual results in increased HBV-specific T cells, B cells or NK cells in the liver and/or HBV-specific T cells, B cells or NK cells in the liver increased activation. The combination for use according to claim 17 or 18, wherein the improvement of the immunity of the individual results in an increase of NK cells, T cells or B cells in the peripheral immune cell compartment and/or NK cells, T cells in the peripheral immune cell compartment Increased activation of cells or B cells. The combination for use according to any one of claims 17 to 19, wherein the increased immunity of the individual results in a reduction in myeloid-derived suppressor cells (MDSC) in the liver and/or in the peripheral immune cell compartment, and/or in the liver Reduced immunosuppressive activity of MDSCs in the central and/or peripheral immune cell compartment, and/or reduced regulatory T cells (Treg) in the liver and/or peripheral immune cell compartment, and/or liver and/or peripheral immune cell The immunosuppressive activity of Treg in the compartment was reduced. The combination for use according to claim 3, wherein the individual has reduced viral replication such that serum HBV DNA is below the lower limit of quantitation (LLoQ) or below 20 IU/mL, more specifically below 15 IU/mL, more specifically Less than 10 IU/mL. The combination for use according to claim 5, wherein the targeted hepatocytes comprise cccDNA. The combination for use according to claim 5 or 22, wherein the targeted hepatocytes comprise integrated HBV DNA. The combination for use according to any one of claims 1 to 23, wherein the first or the second RNAi agent comprises at least one modified nucleotide and/or at least one modified internucleoside linkage. The combination for use according to any one of claims 1 to 24, wherein at least 90% of the nucleotides in the first and the second RNAi agents are modified nucleotides. The combination for use according to any one of claims 1 to 25, wherein the first or the second RNAi agent further comprises a targeting ligand binding to the first or the second RNAi agent. The combination for use according to claim 26, wherein the targeting ligand comprises N-acetyl-galactamine sugar. The combination for use as claimed in claim 27, wherein the targeting ligand is selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, ( NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30 )s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36 ), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39) and (NAG39)s. The combination for use according to claim 28, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31 ), (NAG31 )s, (NAG37) or (NAG37)s. The combination for use according to any one of claims 26 to 29, wherein the targeting ligand binds to the sense strand of the first or the second RNAi agent. The combination for use according to claim 30, wherein the targeting ligand binds to the 5' end of the sense strand of the first or the second RNAi agent. The combination for use according to any one of claims 1 to 31, wherein the first and the second RNAi agents independently comprise a duplex selected from the group consisting of: (a) antisense shares comprising SEQ ID NO:93 and sense shares comprising SEQ ID NO:102; (b) Antisense shares comprising SEQ ID NO:94 and sense shares comprising SEQ ID NO:103; (c) antisense shares comprising SEQ ID NO:95 and sense shares comprising SEQ ID NO:103; (d) antisense shares comprising SEQ ID NO:96 and sense shares comprising SEQ ID NO:104; (e) antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 108; (f) antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 109; (g) antisense shares comprising SEQ ID NO:94 and sense shares comprising SEQ ID NO:104; and (h) Antisense shares comprising SEQ ID NO:100 and sense shares comprising SEQ ID NO:110. The combination for use according to any one of claims 1 to 32, wherein the first and the second RNAi agents are each independently bound to a targeting ligand comprising N-acetyl-galactamine sugar, and the first One and the second RNAi agent independently comprise a duplex selected from the group consisting of: (a) Antisense shares comprising SEQ ID NO:94 and sense shares comprising SEQ ID NO:103; (b) Antisense shares comprising SEQ ID NO:96 and sense shares comprising SEQ ID NO:104; (c) antisense shares comprising SEQ ID NO: 100 and sense shares comprising SEQ ID NO: 108; (d) antisense shares comprising SEQ ID NO: 94 and sense shares comprising SEQ ID NO: 105; and (e) Antisense shares comprising SEQ ID NO:100 and sense shares comprising SEQ ID NO:110. The combination for use according to any one of claims 1 to 33, wherein one of the first or second HBV antigen is HBV core or HBV pol antigen. The combination for use according to any one of claims 1 to 34, wherein the sequence of the non-naturally occurring polynucleotide sequence from the 5' end to the 3' end further comprises: (4) a second IRES element or a polynucleotide sequence encoding a second autoprotease peptide, which is operably linked to the 3' end of the polynucleotide sequence encoding the second HBV antigen, and (5) A polynucleotide sequence encoding a third HBV antigen, the third HBV antigen is independently selected from the group consisting of HBV core antigen, HBV pol antigen and HBV surface antigen. The combination for use according to claim 35, wherein the sequence of the non-naturally occurring polynucleotide sequence from the 5' end to the 3' end further comprises: (6) a third IRES element or a polynucleotide sequence encoding a third autoprotease peptide, which is operably linked to the 3' end of the polynucleotide sequence encoding the third HBV antigen, and (7) A polynucleotide sequence encoding a fourth HBV antigen, the fourth HBV antigen is independently selected from the group consisting of HBV core antigen, HBV pol antigen and HBV surface antigen. The combination for use according to claim 36, wherein each of the first, second, third and fourth HBV antigens are different from each other. The combination for use according to claim 36 or 37, wherein each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a first HBV Pre-S1 antigen comprising at least 98% identity to the amino acid sequence SEQ ID NO: 1, such as at least 98%, 98.5%, 99%, 99.1 to the amino acid sequence SEQ ID NO: 1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (ii) a second HBV Pre-S1 antigen comprising at least 98% identity to the amino acid sequence SEQ ID NO: 3, such as at least 98%, 98.5%, 99%, 99.1 to the amino acid sequence SEQ ID NO: 3 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (iii) HBV PreS2.S antigen comprising at least 98% identity to the amino acid sequence of SEQ ID NO: 5, such as at least 98%, 98.5%, 99%, 99.1%, to the amino acid sequence of SEQ ID NO: 5 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical amino acid sequence, preferably consists of the amino acid sequence; (iv) HBV core antigen comprising at least 90% identity to SEQ ID NO: 7, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96 to SEQ ID NO: 7 %, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% consistent The amino acid sequence of, preferably consists of the amino acid sequence; and (v) HBV pol antigen comprising at least 90% identity to SEQ ID NO: 9, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96 to SEQ ID NO: 9 %, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% consistent The amino acid sequence of, preferably consists of the amino acid sequence, Preferably, each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to a signal peptide, and the HBV PreS2.S antigen comprises an internal signal peptide. The combination for use as claimed in claim 38, wherein the HBV core antigen comprises at least 98% identity with at least one of SEQ ID NO: 84, 85 or 86, such as at least 98% with SEQ ID NO: 84, 85 or 86, An amino acid sequence that is at least 99% or 100% identical, preferably consists of this amino acid sequence. The combination for use as claimed in claim 38 or 39, wherein the last five C-terminal amino acids of the HBV core antigen comprise a VVR amino acid sequence, more specifically a VVRR (SEQ ID NO: 91) amino acid sequence, more Specifically the amino acid sequence of VVRRR (SEQ ID NO: 92). The combination for use according to claim 38, wherein each of the HBV surface antigen, the HBV core antigen and the HBV pol antigen comprises: (ii) consensus sequences of HBV genotypes A, B, C and D; and/or One or more antigenic determinations of HLA-A*11:01, HLA-A*24:02, HLA-A*02:01, HLA-A*A2402, HLA-A*A0101 or HLA-B*40:01 base. The combination for use according to claim 41, wherein each of the HBV surface antigen, the HBV core antigen and the HBV pol antigen comprises one or more epitopes of HLA-A*11:01. The combination for use according to claim 38, wherein each of the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (vi) the first HBV Pre-S1 antigen consisting of the amino acid sequence of SEQ ID NO: 1; (vii) the second HBV Pre-S1 antigen consisting of the amino acid sequence SEQ ID NO: 3; (viii) HBV PreS2.S antigen consisting of amino acid sequence SEQ ID NO: 5; (ix) HBV core antigen consisting of the amino acid sequence of SEQ ID NO: 84, SEQ ID NO: 85 or SEQ ID NO: 86; and (x) HBV pol antigen consisting of the amino acid sequence SEQ ID NO: 9; Preferably, each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to a signal peptide, such as comprising the amino acid sequence SEQ ID NO: 77 signal peptide. The combination for use according to any one of claims 36 to 43, wherein each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from the following Composed group: (i) a polynucleotide sequence encoding a first HBV Pre-S1 antigen having at least 90% identity to SEQ ID NO: 2, such as at least 90%, 91%, 92%, 93% to SEQ ID NO: 2 , 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9% or 100% identical sequences; (ii) a polynucleotide sequence encoding a second HBV Pre-S1 antigen having at least 90% identity with SEQ ID NO: 4, such as at least 90%, 91%, 92%, 93% with SEQ ID NO: 4 , 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9% or 100% identical sequences; (iii) a polynucleotide sequence encoding the HBV PreS2.S antigen having at least 90% identity with SEQ ID NO: 6, such as at least 90%, 91%, 92%, 93%, 94 with SEQ ID NO: 6 %, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical sequences; (iv) a polynucleotide sequence encoding HBV core antigen having at least 90% identity with SEQ ID NO: 8, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , 99.9% or 100% identical sequences; and (v) a polynucleotide sequence encoding an HBV pol antigen having at least 90% identity to SEQ ID NO: 10, such as at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , 99.9% or 100% identical sequences; Preferably, the polynucleotide sequences encoding each of the first and second HBV Pre-S1 antigens, the HBV core antigen and the HBV pol antigen are independently operably linked to a polynucleotide encoding a signal peptide Nucleotide sequence, and the HBV PreS2.S antigen contains an internal signal peptide. The combination for use according to claim 44, wherein each of the polynucleotide sequences encoding the first, second, third and fourth HBV antigens is independently selected from the group consisting of: (i) a polynucleotide sequence encoding the first HBV Pre-S1 antigen consisting of the sequence SEQ ID NO: 2; (ii) a polynucleotide sequence encoding a second HBV Pre-S1 antigen consisting of the sequence SEQ ID NO: 4; (iii) A polynucleotide sequence encoding HBV PreS2.S antigen consisting of the sequence SEQ ID NO: 6; (iv) a polynucleotide sequence encoding HBV core antigen consisting of any one of the sequences SEQ ID NO: 87, SEQ ID NO: 88 or SEQ ID NO: 89; and (v) a polynucleotide sequence encoding HBV pol antigen consisting of the sequence SEQ ID NO: 10; Preferably, the polynucleotide sequence encoding each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to a polynucleotide encoding a signal peptide Nucleotides, such as polynucleotides comprising the sequence SEQ ID NO: 90. The combination for use according to any one of claims 36 to 45, wherein each of the first, second and third autoprotease peptides independently comprises a peptide sequence selected from the group consisting of: Paleovirus-1 2A (porcine teschovirus-1 2A; P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (Equine Rhinitis A Virus; ERAV) 2A (E2A), Mingvein scorpion moth virus 2A ( Thosea asigna virus 2A; T2A), cytoplasmic polyhedrosis virus 2A (cytoplasmic polyhedrosis virus 2A; BmCPV2A), silkworm softening disease virus 2A (Flacherie Virus 2A; BmIFV2A) and combinations thereof, preferably, the first, second and second Each of the triautoprotease peptides comprises a peptide sequence of P2A, such as the P2A sequence of SEQ ID NO: 11. The combination for use according to any one of claims 36 to 46, wherein each of the first, second and third IRES is derived from encephalomyocarditis virus (EMCV) or enterovirus 71 (EV71), preferably Preferably, each of the first, second and third IRES comprises the polynucleotide sequence of SEQ ID NO: 13 or 14. The combination for use according to claim 1, wherein the nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence is sequenced from the 5' end to the 3' end comprising: (1) coding has the polynucleotide sequence of the HBV Pre-S1 antigen of amino acid sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11 or has polynuclear An IRES with a nucleotide sequence of SEQ ID NO: 13 or 14, and a polynucleotide sequence encoding the HBV PreS2.S antigen with an amino acid sequence of SEQ ID NO: 5; (2) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, or the polynucleotide sequence with the polynucleotide sequence The IRES of the sequence SEQ ID NO: 13 or 14, and the polynucleotide sequence encoding the HBV Pre-S1 antigen with the amino acid sequence of SEQ ID NO: 1 or 3; (3) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding polynucleotide sequence with amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 or 3 The polynucleotide sequence of HBV Pre-S1 antigen; (4) The polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, the encoding having the amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 or 3 The polynucleotide sequence of HBV Pre-S1 antigen; (5) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, the encoding having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 84 , the polynucleotide sequence of any one of the HBV core antigens in 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the polynucleotide sequence having the amino acid sequence SEQ ID NO: 9 The polynucleotide sequence of the HBV polymerase antigen; (6) The polynucleotide sequence encoding the HBV PreS2.S antigen with the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, the encoding having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the polynucleotide sequence of coding P2A amino acid sequence SEQ ID NO: 11, coding has the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the HBV polymerase antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of HBV core antigen; (7) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, has the IRES of polynucleotide sequence SEQ ID NO: 13, coding has the amino acid sequence SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (8) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 13, the encoding having the amino acid sequence of SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (9) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen with the sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 13, the encoding with the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of any HBV core antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the HBV polymerase encoding the amino acid sequence SEQ ID NO: 9 the polynucleotide sequence of the antigen; (10) The polynucleotide sequence encoding the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having the amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the IRES having the polynucleotide sequence of SEQ ID NO: 13, the HBV polymerase encoding having the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV core having any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of the antigen; (11) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding has the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, has the IRES of polynucleotide sequence SEQ ID NO: 14, coding has the amino acid sequence SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (12) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of the HBV core antigen of any one of SEQ ID NO: 84, 85 or 86, the IRES having the polynucleotide sequence of SEQ ID NO: 14, the encoding having the amino acid sequence of SEQ ID NO: 5 The polynucleotide sequence of the HBV PreS2.S antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV Pre-S1 with the amino acid sequence SEQ ID NO: 1 or 3 the polynucleotide sequence of the antigen; (13) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen with the sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 14, the encoding with the amino acid sequence of SEQ ID NO: 84, 85 or 86 The polynucleotide sequence of any HBV core antigen, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the HBV polymerase encoding the amino acid sequence SEQ ID NO: 9 the polynucleotide sequence of the antigen; (14) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of the HBV Pre-S1 antigen of sequence SEQ ID NO: 1 or 3, the IRES with the polynucleotide sequence of SEQ ID NO: 14, the HBV polymerase encoding the amino acid sequence of SEQ ID NO: 9 The polynucleotide sequence of the antigen, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding the HBV core having any one of the amino acid sequence SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of the antigen; (15) coding has the polynucleotide sequence of the HBV PreS2.S antigen of amino acid sequence SEQ ID NO: 5, has the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, codes has the amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV polymerase antigen of 9, the polynucleotide sequence encoding the P2A amino acid sequence of SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 84, 85 or 86 the polynucleotide sequence of any of the HBV core antigens; (16) The polynucleotide sequence encoding the HBV PreS2.S antigen having the amino acid sequence of SEQ ID NO: 5, the IRES having the polynucleotide sequence of SEQ ID NO: 14, encoding the polynucleotide sequence having the amino acid sequence of SEQ ID NO : the polynucleotide sequence of any one of the HBV core antigen in 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and encoding the amino acid sequence SEQ ID NO : the polynucleotide sequence of the HBV polymerase antigen of 9; (17) The polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with amino acid sequence The polynucleotide sequence of any one of the HBV core antigens in SEQ ID NO: 84, 85 or 86, the IRES with the polynucleotide sequence of SEQ ID NO: 13 or 14, and the coded polynucleotide sequence with the amino acid sequence of SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5; (18) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, coding have the polynucleotide sequence of the HBV polymerase antigen of amino acid sequence SEQ ID NO: 9, have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and coding have the polynucleotide sequence of amino acid sequence SEQ ID NO: The polynucleotide sequence of the HBV PreS2.S antigen of 5; (19) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of the HBV polymerase antigen of sequence SEQ ID NO: 9, the polynucleotide sequence of encoding P2A amino acid sequence SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 84, 85 or the polynucleotide sequence of the HBV core antigen of any one of 86; (20) The polynucleotide sequence encoding the HBV PreS2.S antigen with amino acid sequence SEQ ID NO: 5, the polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence having amino acid sequence The polynucleotide sequence of any one of the HBV core antigen in the sequence SEQ ID NO: 84, 85 or 86, the polynucleotide sequence of the coding P2A amino acid sequence SEQ ID NO: 11, and the coding sequence having the amino acid The polynucleotide sequence of the HBV polymerase antigen of sequence SEQ ID NO: 9; (21) The polynucleotide sequence encoding the HBV polymerase antigen with the amino acid sequence SEQ ID NO: 9, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, encoding the polynucleotide sequence with the amino acid sequence The polynucleotide sequence of any one of the HBV core antigens in SEQ ID NO: 84, 85 or 86, the polynucleotide sequence encoding the P2A amino acid sequence SEQ ID NO: 11, and the polynucleotide sequence encoding the amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen of SEQ ID NO: 5; or (22) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence, polynucleotide sequence encoding the HBV polymerase antigen with amino acid sequence SEQ ID NO: 9, polynucleotide sequence encoding P2A amino acid sequence SEQ ID NO: 11, and encoding polynucleotide sequence with amino acid sequence The polynucleotide sequence of the HBV PreS2.S antigen of SEQ ID NO: 5, Preferably, the polynucleotide sequence encoding each of the first and second HBV Pre-S1 antigen, the HBV core antigen and the HBV pol antigen is independently operably linked to an encoding signal peptide, such as The polynucleotide sequence of the signal peptide comprising the amino acid sequence of SEQ ID NO: 77. The combination for use according to claim 48, wherein the non-naturally occurring polynucleotide sequence comprises any one of the sequences SEQ ID NO: 15 to 54. The combination for use according to any one of claims 1 to 49, wherein the vector comprises the non-naturally occurring polynucleotide sequence. The combination for use according to claim 50, wherein the vector is a DNA plasmid, a DNA viral vector or an RNA viral vector. The combination for use according to any one of claims 1 to 49, wherein the RNA replicon comprises the non-natural polynucleotide sequence, and wherein the RNA replicon is sequenced from the 5' end to the 3' end comprising: (1) 5' untranslated region (5'-UTR) required for non-structural protein-mediated amplification of RNA viruses; (2) a polynucleotide sequence encoding at least one, preferably all, nonstructural proteins of the RNA virus; (3) the subgenome promoter of the RNA virus; (4) the non-naturally occurring polynucleotide sequence; and (5) The 3' untranslated region (3'-UTR) required for nonstructural protein-mediated amplification of the RNA virus. The combination for use according to any one of claims 1 to 49, wherein the RNA replicon comprises the non-natural polynucleotide sequence, and wherein the RNA replicon is sequenced from the 5' end to the 3' end comprising: (1) Alphavirus 5' untranslated region (5'-UTR); (2) 5' copy sequence of alpha virus non-structural gene nsp1; (3) downstream loop (DLP) motifs of viral species; (4) a polynucleotide sequence encoding a fourth autoprotease peptide; (5) Polynucleotide sequences encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3 and nsp4; (6) Alphavirus subgenome promoter; (7) the non-naturally occurring polynucleotide sequence; (8) Alphavirus 3' untranslated region (3' UTR); and (9) Optional polyadenosine sequence. The combination for use as claimed in claim 53, wherein the DLP motif system is from a virus species selected from the group consisting of: Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (Venezuelan equine encephalitis virus; VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki forest virus (Semliki forest virus; SFV), Pichuna virus (Pixuna virus; PIXV) ), Middleburg virus (MTDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Pakistan Barmah Forest virus (BF), Getah virus (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV) ), Una virus (U AV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki Babanki virus (BABV), Kyzylagach virus (KYZV), Western equine encephalitis virus (WEEV), Highland J virus (Highland J virus; HJV), Fort Morgan virus ( Fort Morgan virus (FMV), Ndumu (NDUV) and Buggy Creek virus. The combination for use as claimed in claim 54, wherein the fourth autologous protease peptide is selected from the group consisting of: Porcine Tesgu Virus-1 2A (P2A), Foot-and-Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Rhinovirus 2A (T2A), Cytoplasmic polyhedrosis virus 2A (BmCPV2A), Silkworm softening disease virus 2A (BmIFV2A) and combinations thereof, preferably, the fourth self Protease peptides comprise the peptide sequence of P2A. The combination for use according to any one of claims 1 to 49, wherein the RNA replicon comprises the non-natural polynucleotide sequence, and wherein the RNA replicon is sequenced from the 5' end to the 3' end comprising: (1) 5'-UTR having a polynucleotide sequence of SEQ ID NO: 55; (2) having the 5' copy sequence of polynucleotide sequence SEQ ID NO: 56; (3) a DLP motif comprising the polynucleotide sequence of SEQ ID NO: 57; (4) a polynucleotide sequence encoding the P2A sequence of SEQ ID NO: 11; (5) Polynucleotide sequences encoding alphavirus nonstructural proteins nsp1, nsp2, nsp3 and nsp4, respectively having nucleic acid sequences of SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60 and SEQ ID NO: 61 ; (6) a subgenome promoter having a polynucleotide sequence of SEQ ID NO: 62; (7) the non-naturally occurring polynucleotide sequence; and (8) 3' UTR having the polynucleotide sequence of SEQ ID NO: 63. A combination for use as claimed in claim 56, wherein: (iv) the polynucleotide sequence encoding the P2A sequence comprises SEQ ID NO: 12, (v) the non-naturally occurring polynucleotide sequence comprises any one of the polynucleotide sequences SEQ ID NO: 15 to 54, and (vi) The RNA replicon further comprises a polyadenosine sequence at the 3' end of the replicon, preferably, the polyadenosine sequence has the sequence SEQ ID NO: 64. The combination for use according to any one of claims 52 to 57, wherein the RNA replicon comprises any one of the polynucleotide sequences SEQ ID NO: 65 to 72. The combination for use according to any one of claims 52 to 57, wherein the nucleic acid molecule comprises a DNA sequence encoding the RNA replicon, preferably, wherein the nucleic acid molecule further comprises a DNA sequence operably linked to the 5' end of the DNA sequence T7 promoter, more preferably, the T7 promoter comprises the nucleotide sequence of SEQ ID NO: 73. The combination for use according to any one of claims 1 to 59, wherein the pharmaceutical composition comprises the nucleic acid molecule, the vector or the RNA replicon comprising the non-naturally occurring polynucleotide sequence, and a pharmaceutically acceptable carrier. The combination for use according to claim 60, wherein the pharmaceutical composition further comprises: (1) A polynucleotide sequence encoding the HBV core antigen of any one of the amino acid sequence SEQ ID NO: 84, 85 or 86, a polynucleotide encoding the P2A amino acid sequence SEQ ID NO: 11 Sequence or have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and coding have amino acid sequence SEQ ID NO: 9, the polynucleoside of the HBV polymerase antigen that is preferably made up of this amino acid sequence acid sequence; or (2) A polynucleotide sequence encoding an HBV polymerase antigen having an amino acid sequence of SEQ ID NO: 9, preferably consisting of the amino acid sequence, a polynucleotide encoding a P2A amino acid sequence of SEQ ID NO: 11 Nucleotide sequence or have the IRES of polynucleotide sequence SEQ ID NO: 13 or 14, and the polynucleoside coding has any one HBV core antigen in the amino acid sequence SEQ ID NO: 84,85 or 86 acid sequence. A combination for use according to any one of claims 1 to 61, wherein the RNAi component is in the form of about 40-1000 mg, more specifically about 40-250 mg, more specifically 40-200 mg, more specifically A dose of 100 mg or 200 mg, more specifically 200 mg, is administered to the subject once a month (Q4W). The combination for use according to any one of claims 1 to 62, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is at about 10-300 mg/mL, more specifically about 20-200 μg/mL The concentration of is administered to the subject in a dose, wherein the dose is administered up to five (5) times. The combination for use according to any one of claims 1 to 63, wherein the RNAi component is administered to the individual via intravenous or subcutaneous injection. The combination for use according to any one of claims 1 to 64, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual via intramuscular injection. The combination for use according to any one of claims 1 to 65, wherein the RNAi component is administered simultaneously or sequentially with the nucleic acid molecule comprising the non-naturally occurring polynucleotide. The combination for use of any one of claims 1 to 65, wherein the RNAi component is administered separately from the nucleic acid molecule comprising the non-naturally occurring polynucleotide. The combination for use according to claim 67, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual about six (6) months after initiation of administration of the RNAi component. The combination for use according to claim 67 or 68, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual about six (6) months after initiation of administration of the RNAi component, and wherein The nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual up to five (5) times over a total period of about six (6) months. The combination for use according to claim 67 or 68, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual about three (3) months after initiation of administration of the RNAi component, and wherein The nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual up to three (3) times over a total period of about three (3) months. The combination for use according to claim 67 or 68, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual about six (6) months after initiation of administration of the RNAi component, and wherein The nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual up to three (3) times over a total period of about three (3) months. The combination for use according to claim 67 or 68, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual about eight (8) months after initiation of administration of the RNAi component, and wherein The nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual up to three (3) times over a total period of about three (3) months. The combination for use according to claim 67 or 68, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide is administered to the individual about three (3) months after initiation of administration of the RNAi component, comprising The nucleic acid molecule of the non-naturally occurring polynucleotide is administered to the individual up to three (3) times over a total time course of about three (3) months, and wherein the administration of the RNAi component occurs after cessation of administration For example about six (6) months thereafter with the nucleic acid molecule comprising the non-naturally occurring polynucleotide. The combination for use according to any one of claims 1 to 73, further comprising administering a nucleoside analog or a nucleotide analog to the individual. The combination for use as claimed in item 74, wherein the nucleoside analogs are entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide alafenamide), lamivudine, telbivudine, or a combination thereof. The combination for use according to claim 75, wherein entecavir is administered to the subject at a daily dose of about 0.1-5 mg. The combination for use as claimed in item 75, wherein tenofovir is with about 5-50 mg of tenofovir alafenamide or about 200-500 mg of tenofovir disoproxil fumarate per A daily dose is administered to the individual. The combination for use as claimed in claim 75, wherein lamivudine is administered to the individual at a daily dose of about 100 mg, about 150 mg, or about 300 mg. The combination for use as claimed in claim 75, wherein telbivudine is administered to the individual at a daily dose of about 600 mg. A combination for use according to any one of claims 1 to 79, wherein the duration is 10 to 96 weeks, more specifically 12 to 72 weeks, more specifically 12 to 60 weeks, more specifically 12 to 52 weeks, more specifically Specifically, for 48 weeks, an effective amount of the pharmaceutical composition comprising the RNAi component and an effective amount of a pharmaceutical composition comprising the compound of formula (I) are administered to the individual. The combination for use according to claim 80, which further comprises administering to the individual a nucleoside analog or a nucleotide analog, such as entecavir, tenofovir disoproxil fumarate, tenofovir ax Lafenamide, lamivudine, telbivudine, or a combination thereof, wherein an effective amount of the pharmaceutical composition comprising the RNAi component and an effective amount of the pharmaceutical composition comprising the non-naturally occurring polynucleotide are administered once cessation of administration. The pharmaceutical composition of the nucleic acid molecule is optionally continued with the administration of the nucleoside or nucleotide analog. An RNAi component in combination with a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence for the treatment of hepatitis B virus (HBV) infection, more particularly chronic HBV infection, with or without viral co-infection (CHB), and/or treating chronic hepatitis D virus (HDV) infection, wherein the RNAi component and the nucleic acid molecule comprising the non-naturally occurring polynucleotide sequence are as defined in any one of claims 1 to 81 , and wherein the RNAi component is optionally administered simultaneously, sequentially or separately from the nucleic acid molecule comprising the non-naturally occurring polynucleotide sequence. A nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence for use in combination with an RNAi component for the treatment of hepatitis B virus (HBV) infection, more particularly chronic HBV infection, with or without viral co-infection (CHB), and/or treating chronic hepatitis D virus (HDV) infection, wherein the nucleic acid molecule comprising the non-naturally occurring polynucleotide sequence and the RNAi component are as defined in any one of claims 1 to 81 , and the nucleic acid molecule comprising the non-naturally occurring polynucleotide therein is indicated to be administered simultaneously, sequentially, or separately from the RNAi component. An effective amount of RNAi component and a nucleic acid molecule comprising a non-naturally occurring polynucleotide sequence for the manufacture of a drug for inhibiting the expression of hepatitis B virus genes in an individual in need, wherein the RNAi component and the non-natural The nucleic acid molecule of a naturally occurring polynucleotide sequence is as defined in any one of claims 1 to 81.

Images