TW202242145A - Transcription factor binding site analysis of nucleosome depleted circulating cell free chromatin fragments - Google Patents

Abstract

The invention relates to methods for detecting disease in a subject by means of a minimally invasive body fluid test for non-nucleosomal cell free DNA fragments. The invention also relates to the measurement or detection of circulating cell free DNA fragments that include a transcription factor binding site sequence as an indicator of the presence of disease in a subject.

Description

Transcription factor binding site analysis of nucleosome-depleted circular cell-free chromatin fragments

The present invention relates to a method for detecting disease in a subject through a minimally invasive blood test to detect transcription factor occupancy of cell-free DNA fragments.

Cancer is a common disease with a high mortality rate. The biology of the disease is understood to involve the progression from a precancerous state to stage I, II, III and eventually stage IV cancer. For most cancer diseases, mortality rates vary widely, depending on whether the disease is detected at an early local stage, when effective treatment options are available, or when the disease may have spread into or beyond affected organs, making it more difficult to treat detected at a late stage. Advanced cancer has a wide variety of symptoms, including visible blood in the stool, blood in the urine, blood from a cough, blood from the vagina, unexplained weight loss, persistent unexplained lumps (for example, in the breast), indigestion, difficulty swallowing , changing warts or moles, and many other possible symptoms, depending on the type of cancer. However, most cancers diagnosed due to these symptoms are already advanced and difficult to treat. Most cancers are asymptomatic or present with nonspecific symptoms that do not help diagnosis in their early stages. Therefore, cancer detection should ideally be used to detect cancer early.

To meet the need for simple routine cancer blood tests, many blood-borne proteins have been investigated as potential cancer biomarkers, including carcinoembryonic antigen (CEA) for CRC, alpha-fetoprotein (AFP) for liver cancer ), CA125 for ovarian cancer, CA19-9 for pancreatic cancer, CA15-3 for breast cancer, and PSA for prostate cancer. However, their clinical accuracy is too low for routine diagnostic use and they are considered more suitable for monitoring patients.

Recently, workers in the field have investigated circulating tumor DNA (ctDNA) as a blood biomarker for cancer detection. Cell-free DNA (cfDNA) circulates in the blood as chromatin fragments thought to arise from cell death (mainly apoptosis) in large numbers of cells each day. During apoptosis, chromatin fragments into mononucleosomes and oligonucleosomes, some of which are released from the cell to circulate as free nucleosomes. Each circulating cell-free nucleosome is associated with small DNA fragments less than 200 base pairs (bp) in length. Similarly, circulating cell-free chromatin fragments composed of DNA-bound transcription factors or other nonhistone chromatin proteins have been inferred from fragmentomics analysis. In healthy subjects, circulating chromatin fragments are thought to be of hematopoietic origin and are present at very low levels. Elevated levels of circulating nucleosomes and thus cfDNA fragments are found in subjects with a variety of diseases, including many cancers, autoimmune diseases, inflammatory diseases, stroke, and myocardial infarction (Holdenrieder & Stieber, 2009).

At least some cfDNA in the blood of cancer patients is thought to arise from the release of nucleosomes and other chromatin fragments into circulation by dying or dying cancer cells (ie, cfDNA includes some ctDNA). Studies of matched blood and tissue samples from cancer patients show that cancer-associated mutations are present in the patient's tumor (but not in his or her healthy cells) and also in cfDNA in blood samples taken from the same patient Medium (Newman et al , 2014). Similarly, DNA sequences that are differentially methylated (epigenetically altered through methylation of cytosine residues) in cancer cells can also be detected as methylated sequences in circulating cfDNA. Furthermore, the proportion of circulating cfDNA composed of ctDNA is associated with tumor burden, thus allowing disease progression to be monitored quantitatively by the proportion of ctDNA present and qualitatively by its genetic and/or epigenetic composition. Analysis of ctDNA can yield very useful and clinically accurate data that correlates with DNA originating from all or many different tumor clones within a tumor, thus spatially integrating tumor communities. Furthermore, repeated blood sampling over time is a more practical and economical option than, for example, repeated tissue biopsies. ctDNA analysis has the potential to revolutionize tumor detection and monitoring, as well as early detection of relapse and acquired drug resistance by studying tumor DNA for tumor treatment selection without the need for invasive tissue biopsy procedures. This ctDNA test can be used to investigate all types of cancer-associated DNA abnormalities (such as point mutations, nucleotide modification status, translocations, gene copy number, microsatellite abnormalities, and DNA strand integrity) and can be applied in routine cancer screening, Regular and more frequent monitoring and periodic review of optimal treatment options (Zhou et al , 2017).

Plasma is commonly used as a substrate for ctDNA detection. cfDNA fragments (including any ctDNA) are extracted from plasma (thus removed from binding to nucleosomes, transcription factors, or other proteins) and analyzed for nucleotide base sequence. Any method of DNA analysis can be used, but typically analysis is performed by deep sequencing using a Next Generation Sequencer.

Since DNA abnormalities are a feature of all cancer diseases, and ctDNA has been observed in all cancer diseases studied, ctDNA testing is applicable to all cancer diseases. Cancers studied include, but are not limited to, bladder cancer, breast cancer, colorectal cancer, melanoma, ovarian cancer, prostate cancer, lung and liver cancer, endometrial cancer, ovarian cancer, lymphoma, oral cancer, leukemia, head and neck cancer, and osteosarcoma ( Crowley et al , 2013; Zhou et al , 2017; Jung et al , 2010).

An exemplary method of cfDNA analysis involves identifying the tissue or cellular origin of cfDNA fragments in a subject. This approach is based on the assumption that all cfDNA fragments present in circulation are protected from nuclease digestion during cell death or circulation because they are protected from nucleases through protein binding within the nucleosome. The method involves determining the nucleosome fragmentation pattern of cfDNA in a blood sample taken from a subject and mapping the genomic location of the cfDNA fragments in a reference genome. Fragmentation patterns vary across cell types and can be used to identify the cell of origin of the subject's cfDNA.

This approach involves extraction of cfDNA (including any ctDNA) from plasma samples and genome-wide sequencing of the DNA to detect nucleosome-bound DNA patterns presented by cfDNA fragments. The endpoint sequences of the cfDNA fragments are analyzed in silico using bioinformatics to map their genomic positions in a reference genome or genome. The genomic location of cfDNA endpoints within the reference genome provides a map of the nucleosome-protected cfDNA coverage of the genome.

By computer analysis using bioinformatics as described in WO2017012592, comparison of the nucleosome fragmentation pattern of a subject with a calibration sample comprising cfDNA from different cell sources of known relative abundance can also determine different cell types or tissue pairs. Proportional contribution of subject cfDNA.

The cfDNA fragments attached to nucleosome-containing chromatin fragments are typically 120–200 bp in length. However, protein binding and protection of cfDNA is not limited to histone binding of cfDNA in nucleosomes. Other cfDNA fragments, including active gene promoter sequences, are associated with transcription factors, cofactors, or other non-histone chromatin proteins in addition to nucleosomes, or in the absence of any nucleosomes. In the absence of nucleosomes, these proteins typically bind and protect shorter cfDNA fragments in the 35–80 bp range. However, these shorter DNA fragments can only be observed experimentally if the DNA fragment library preparation method used is suitable for the isolation, amplification, and sequencing of short DNA fragments less than 100 base pairs in length. cfDNA fragments (Snyder et al , 2016).

The protein binding involved may be of different types. For example, some cfDNA sequences (including some inactive DNA sequences) bind histones in a nucleosomal conformation. The length of cfDNA fragments attached to nucleosome-containing chromatin fragments is usually about 120-200 bp. Other cfDNA fragments (containing active gene promoter sequences) are bound to transcription factors, cofactors, or other chromatin proteins that typically bind and protect shorter cfDNA fragments in the 35-80 bp range. However, these shorter cfDNA fragments can only be observed experimentally if the DNA fragment library preparation method used is suitable for the isolation, amplification, and sequencing of short fragments.

Since different DNA sequences (including different promoter sequences and gene sequences) are active in different cells, the protein binding pattern of DNA in the genome in living cells varies by cell type. The protein binding pattern of DNA in any cell type can be determined by nuclease accessible site (Nuclease Accessible Site) mapping by digesting chromatin extracted from cells with nucleases and analyzing the resulting protein-protected chromatin fragments. Undigested DNA was sequenced. Therefore, if cfDNA fragments in blood are considered as products of nuclease digestion in vivo, the cfDNA sequences found should correspond to protein-bound DNA sequences in the cell from which the cfDNA originated. Thus, in principle, the pattern of cfDNA fragment sequences in blood should be similar to that of chromatin fragment sequences in primitive cells generated by mapping nuclease-accessible sites. Thus, fragmentation patterns of cfDNA sequences determined from blood samples can be compared to known DNA fragmentation patterns generated by nuclease-accessible site analysis of cells of known tissue or cancer types using bioinformatics methods to determine Source tissue of cfDNA. Results in samples collected from healthy subjects indicated that the cfDNA-derived cells were hematopoietic. Results of this approach in samples taken from cancer patients showed that cfDNA and ctDNA originate from a mixture of cells including hematopoietic and other cells. In many cases, the non-hematopoietic cell type referred to was tissue-associated with the patient's cancer disease (Snyder et al , 2016).

Other workers have used a similar approach to end-point analysis of cfDNA fragments, but focused bioinformatics in silico analysis on transcription factor binding site (TFBS) sequences. The aim of this approach was to determine the accessibility of TFBS and to identify TFBS DNA sequences with altered accessibility in plasma samples taken from cancer patients (Ulz et al , 2019). In this approach, plasma samples are collected from subjects and cfDNA is extracted and amplified using a DNA library preparation method suitable for small DNA fragments less than 100 bp in length. DNA libraries were sequenced using next-generation sequencing methods. Sequencing data were used to identify cfDNA fragmentation patterns in genomic regions near TFBS using bioinformatics methods. This analysis involves determining the nucleosome positioning profile of cfDNA fragments on TFBS and their flanking sequences in gene promoter sequences to determine whether TFBS binds transcription factors in cfDNA-containing chromatin fragments. The method is complex, but can be summarized as follows:

If the cfDNA fragmentation pattern observed in the DNA sequence spanning the TFBS and the flanking sequences of the genome shows a periodicity of approximately 200 bp, this is consistent with a stronger protein-binding protection of the DNA from degradation (in the center of the nucleosome binding site ) and an alternation of weaker protein-bound protection (between DNA-unbound and unprotected nucleosomes). In this case, TFBS and flanking sequences were presumed to be nucleosomes covering the chromatin fragments that comprise cfDNA in plasma samples.

If there is a pattern of cfDNA fragmentation showing protection from protein binding of TFBS and its flanking sequences, but no (or attenuated) nucleosome-associated periodicity, this is associated with transcriptional regulatory protein binding of TFBS and its flanking sequences. In this case, TFBS was hypothesized to have bound to one or more transcription factors and/or other regulatory proteins in cfDNA-containing chromatin fragments in plasma samples.

In healthy subjects, the patterns of cfDNA fragmentation found generally correlate with patterns obtained experimentally at nuclease-accessible sites of hematopoietic cells. Thus, TFBS sequences bound to transcription factors in cfDNA or covered by nucleosomes were associated with transcription factors expressed or not expressed in hematopoietic cells. In cancer patients, this pattern involves a mix of cell types, where TFBS likely binds transcription factors in cancer cell types and nucleosomes in hematopoietic cell types. However, fragment-omics bioinformatics approaches have been developed to separate the small transcription factor-protected TFBS fragment signal present in ctDNA from the larger, superimposed nucleosome periodic signal present in cfDNA components of hematopoietic origin. Fragomic analysis indicated that the mixed pattern contained cfDNA TFBS sequences bound to transcription factors not expressed in hematopoietic cells but expressed by cancerous tissues.

We have previously described immunoassay tests targeting circulating cell-free nucleosomes containing specific epigenetic signals, including specific post-translational modifications, histone isoforms, modified nucleotides and Non-histone chromatin proteins (as described in WO2005019826, WO2013030577, WO2013030579 and WO2013084002). We also describe immunoassay tests of chromatin fragments including transcription factor binding DNA for detection of cancer (as described in WO2017162755).

We now report an improved method for the analysis of circulating cell-free TFBS DNA sequences in cfDNA, from which background periodic nucleosomal signaling is removed. These methods are suitable for use in bodily fluid samples as non-invasive or minimally invasive assays for diseases including cancer, autoimmune and inflammatory diseases.

According to a first aspect of the present invention, there is provided a method for detecting a cell-free DNA chromatin fragment comprising a transcription factor binding site sequence in a body fluid sample obtained from a human or animal subject All or part of, optionally comprising flanking sequences, the method comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes; and (ii) analyzing DNA from the body fluid sample not bound to the binding agent in step (i).

According to a second aspect of the present invention, there is provided a method for detecting a cell-free DNA chromatin fragmentation pattern in a body fluid sample obtained from a human or animal subject, comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes; and (ii) analyzing DNA from the body fluid sample not bound to the binding agent in step (i).

According to another aspect of the present invention, there is provided a method of detecting a disease in a human or animal subject, comprising the steps of: (i) contacting a sample of bodily fluid obtained from the human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) selectively amplifying the isolated DNA; (iv) determine the sequence of the DNA; and (v) using a transcription factor binding site DNA sequence and optionally flanking DNA sequences present in the DNA as a biomarker to determine the presence and/or nature of the disease in the subject.

According to another aspect of the present invention, there is provided a method of detecting a disease in a human or animal subject, comprising the steps of: (i) contacting a sample of bodily fluid obtained from the human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) selectively amplifying the isolated DNA; (iv) DNA testing; and (v) using the DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (iv) as an indicator of the presence and/or nature of the disease in the subject.

According to another aspect of the present invention, there is provided a method for detecting a disease in a human or animal subject, comprising the following steps: (i) contacting a sample of bodily fluid obtained from the human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) detection of isolated DNA using hybridization methods; and (iv) using the presence or amount of hybridized DNA as an indicator of the presence and/or nature of disease in a subject.

According to another aspect of the present invention, there is provided a method for detecting or diagnosing a disease in an animal or human subject, comprising the steps of: (i) removing nucleosomes from a sample of body fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; and (iii) using the DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (ii) to identify a disease state in the subject.

According to another aspect of the present invention, there is provided a method of assessing the suitability of an animal or human subject for medical treatment, comprising the steps of: (i) removing nucleosomes from a sample of body fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; and (iii) using the DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (ii) as parameters for selecting an appropriate treatment for the subject.

According to another aspect of the invention, there is provided a method for monitoring treatment of an animal or human subject comprising the steps of: (i) removing nucleosomes from a sample of body fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; (iii) on one or more occasions, repeatedly detecting, analyzing, or measuring DNA associated with cell-free chromatin fragments in the remaining sample after removal of nucleosomes from a sample of bodily fluid obtained from the subject; and (iv) using any change in DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (iii) compared to step (ii) as a parameter for any change in the subject's condition.

According to another aspect of the present invention, a kit for detecting cfDNA fragment sequence is provided, including a nucleosome binding agent and used for amplification and/or sequencing and/or Fragmentation formats, optionally also instructions for use of the kits in the methods described herein.

According to another aspect of the present invention, there is provided a method of treating a disease in a subject in need thereof, wherein said method comprises the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) detecting or measuring DNA fragments not bound to the binding agent in step (i); (iii) using the presence, sequence, amount, or pattern of fragmentation of DNA fragments as an indicator of the presence of disease in the subject; and (iv) administering treatment if the subject is determined to have the disease in step (iii).

According to another aspect of the present invention, there is provided a method for detecting a fetal disease state in a body fluid sample taken from a pregnant human or animal subject, comprising the steps of: (i) exposing the sample of maternal body fluid to a binding agent that binds to nucleosomes; (ii) analyzing DNA not bound to the binding agent in step (i); and (iii) using the presence, amount, sequence and/or fragmentation pattern of the DNA as an indicator of the subject's fetal disease state.

Transcription factors are implicated in cancer, accounting for about 20% of all known oncogenes (Lambert et al , 2018). We have previously described the use of chromatin fragments containing tissue-specific transcription factors as biomarkers in serum to detect or diagnose cancer in subjects. Tissue specificity of transcription factors can be used to indicate the tissue of cancer origin. For example, the transcription factor TTF-1 has been reported to be expressed in thyroid and lung tissues, but not in other tissues. Thus, the presence of circulating chromatin fragments containing TTF-1 indicates that the tissue of origin is lung or thyroid. We also describe an immunoassay for the measurement of circulating cell-free chromatin fragments containing transcription factors. This immunoassay involves a double antibody (or other binding agent) approach, in which one binding agent binds to the transcription factor and the other binds to DNA associated with the transcription factor or to nucleosomes contained in chromatin fragments Element. In one embodiment, the binding agent targeting the transcription factor is immobilized on a solid phase to separate the chromatin fragment containing the transcription factor (ie, immunoprecipitate the chromatin fragment). The isolated chromatin fragments are then detected using a second binder that binds to the DNA. This immunoassay method is simple, low cost and non-invasive. We now report the use of a modified cfDNA assay to detect the disease. The principle of the method involves removing nucleosome-containing chromatin fragments from bodily fluid samples prior to analysis of cfDNA fragments associated with remaining chromatin fragments. In this way, the nucleosomal component of the cfDNA fragmentation pattern is removed from the sample, leaving behind small cfDNA fragments that do not include nucleosomes. The presence of TFBS sequences in cfDNA after nucleosome removal indicates that this sequence is protected (and not bound to nucleosomes) by binding to the transcription factor and/or other regulatory proteins in question. This method for TFBS profile analysis does not require the identification of cfDNA fragment endpoints and/or their genomic locations and/or complex bioinformatics methods for unraveling fragmentomics signals of mixed nucleosome and transcription factor binding , and facilitated previously impossible ctDNA testing methods.

The total cfDNA fragmentation pattern of a sample is formed by all chromatin fragments present in the sample, including those that contain or do not contain nucleosomes. The chromatin fragments of primary interest in the present invention are those that do not contain nucleosomes. Therefore, the present invention is primarily concerned with non-nucleosomal cfDNA fragments.

The basic principle of the present invention involves the detection of cfDNA regulatory sequences bound to regulatory proteins in a sample, such as TFBS sequences bound to transcription factors, after nucleosome removal. TFBS can bind transcription factors expressed at elevated levels in cells of diseased tissues, but not in hematopoietic tissues bound to nucleosomes. Thus, chromatin fragments containing such TFBS sequences bound by transcription factors likely originated from cells associated with active genes in diseased tissues. On the other hand, the same TFBS sequence will bind to nucleosomes in chromatin fragments of hematopoietic origin where the gene is inactive. Thus, cfDNA fragments bound to nucleosomes were removed from the sample, leaving transcription factor-occupied TFBS cfDNA fragments in place. The presence or amount of TFBS sequences (optionally with flanking sequences) in the remaining cfDNA is sufficient to establish that TFBS is transcription factor-bound in the sample, without the need for identification of fragment endpoint sequences or their genomic location or complex determination of the periodicity of nucleosome binding strength and explain. Furthermore, removal of most of the total chromatin fragments means that TFBS sequences (optionally with flanking sequences) can be more easily detected in the remaining cfDNA due to lower background.

The method removes healthy hematopoietic cell-derived nucleosomes at all positions genome-wide prior to DNA analysis, and therefore removes the periodic cfDNA fragmentation patterns produced by their nucleosomes. After removal of nucleosomes, the remaining cfDNA fragments will contain non-histone-bound sequences in diseased cells, such as TFBS sequences bound by one or more transcription factors. This is useful because many transcription factors expressed in cancer cells and other diseased cells are not expressed in hematopoietic cells, and the presence of their binding sequences in cfDNA prior to nucleosome removal is indicative of disease origin. cfDNA tissue or cells. For example, if transcription factors and corresponding transcription factor binding sites that are expressed in cancer cells but not in hematopoietic cells are selected, any TFBS detected in a patient sample that contains all or part of the TFBS sequence (optionally Also flanking sequences) are indicators of the presence of cancerous disease in patients (since those derived from healthy hematopoietic cells containing all or part of the same TFBS and flanking sequences have been covered by nucleosomes and removed).

This method has the following advantages: (i) higher analytical sensitivity for detection of transcription factor-bound cfDNA fragments, (ii) higher analytical sensitivity for disease-derived cfDNA fragmentation patterns, (iii) avoidance of enables complex bioinformatics analysis of mixed signals from mixed cellular origins, (iv) removes most of the sequencing requirement (for removed nucleosomes), which makes the method more suitable for routine clinical use, e.g. through the use of PCR primer amplification TFBS-seq instead of next-generation whole-genome sequencing, (v) reduces sequencing costs and importantly (vi) increases the clinical accuracy and utility of the method.

The methods of the present invention involve the isolation or removal of nucleosome-bound cfDNA fragments prior to the identification of TFBS sequences in the remaining cfDNA. This is achieved by immunoprecipitation of all or a majority of nucleosomes in bodily fluid samples prior to extraction and/or amplification and/or cfDNA sequencing. Immunoprecipitation can be achieved using any nucleosome binding agent, including anti-nucleosome antibodies or other nucleosome binding agents such as those described in WO2021038010.

We have developed immunoprecipitation methods to remove all or most nucleosomes (both healthy and diseased cell sources) from bodily fluid samples prior to extraction and/or amplification and/or sequencing of the remaining cfDNA in the sample. Immunoprecipitation can be achieved by using anti-nucleosome antibodies that bind to the nucleosome itself or to all or most nucleosomes. We developed this isolation method, which involves anti-nucleosome antibody-linked magnetic beads, and showed the quantitative removal of nucleosomes from plasma samples.

Thus, according to a first aspect of the present invention, there is provided a method of detecting a cell-free DNA chromatin fragment comprising a transcription factor binding site (TFBS) in a body fluid sample obtained from a human or animal subject. ) (or other non-histone binding site) sequence, optionally including flanking sequences, the method comprising the steps of: (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; and (ii) analyzing DNA in the body fluid sample not bound to the binding agent in step (i).

In a second aspect of the invention, cfDNA fragmentation patterns in bodily fluid samples taken from a subject can be analyzed, for example to detect disease and identify affected cells or tissues. Preliminary removal of nucleosomes from samples facilitates the analysis of cfDNA fragmentation patterns around active transcription factor binding sites by eliminating the interference of nucleosome fragmentation patterns. Therefore, according to a second aspect of the present invention, there is provided a method for detecting a cell-free DNA chromatin fragmentation pattern in a body fluid sample obtained from a human or animal subject, comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes; and (ii) analyzing DNA from the body fluid sample not bound to the binding agent in step (i).

In one embodiment, the detected chromatin fragmentation pattern can be compared to known DNA/chromatin fragmentation patterns (ie reference fragmentation patterns), for example by bioinformatics methods. Known reference fragmentation patterns can be generated by performing Nuclease Accessible Site analysis on cells from known tissues or cancer types. This comparison can be used to determine the tissue source of cfDNA.

In another embodiment, detected chromatin fragmentation patterns can be compared (e.g., by bioinformatics methods) to known DNA/chromatin fragmentation patterns generated from previous studies of patients with known The study of patients in a disease state such as healthy patients or patients with known cancer disease. This comparison can be used to determine the disease state of the subject.

Therefore, in another aspect of the present invention, cfDNA fragments in body fluids, which are not bound to nucleosomes, having a TFBS sequence, optionally including flanking sequences, are provided as biomarkers for disease.

In one embodiment, a plurality of cfDNA fragments in bodily fluids that do not bind to nucleosomes are provided that comprise combinations or patterns of TFBS sequences, optionally including flanking sequences, for use together as biomarkers for disease.

It will be clear to those skilled in the art that removal of nucleosomes derived from healthy and/or hematopoietic cells or tissues may be sufficient for the purposes of the present invention. It is known in the art that cell-free nucleosomes from diseased or fetal cells or tissues are associated with DNA fragments approximately 147 bp in length. These nucleosomes do not contain linker DNA. In contrast, cell-free nucleosomes from healthy and/or hematopoietic cells or tissues are linked to a longer DNA fragment size of approximately 167 bp, which does contain linker DNA. Surprisingly, isolation of cell-free nucleosomes linked to longer DNA fragment sizes (containing linker DNA) can be achieved. We have demonstrated this previously by using a nucleosome binder that binds to nucleosomes containing linker DNA (the size of the linked cfDNA fragment is approximately 167 bp), but not to nucleosomes that do not contain linker DNA. Body binding (the size of the connected cfDNA fragment is about 147bp). These binders can be used to immunoprecipitate healthy cell-derived nucleosomes containing a 167bp cfDNA fragment, while leaving diseased or fetal-derived nucleosomes in solution linked to smaller DNA fragments approximately 147bp in size, free of Linker DNA (as described in WO2021038010).

Thus, in one embodiment, the binding agent binds to a nucleosome containing linker DNA.

In one embodiment, there is provided a method for detecting cell-free DNA fragments comprising all or part of a TFBS sequence (or other non-histone binding sites) optionally comprising flanking sequences in a body fluid sample obtained from a human or animal subject, including step: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes containing linker DNA; and (ii) analyzing the DNA in the bodily fluid sample not bound to the binding agent in step (i).

In another embodiment, there is provided a method of detecting a pattern of cell-free DNA fragmentation in a bodily fluid sample obtained from a human or animal subject, comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes containing linker DNA; and (ii) analyzing the DNA in the bodily fluid sample not bound to the binding agent in step (i).

In preferred embodiments, the binding agent that binds to nucleosomes containing linker DNA is all or part of a histone H1 moiety or a chromatin binding protein, including but not limited to: chromatin helicase DNA binding (Chromodomain Helicase DNA Binding, CHD) protein, DNA (cytosine-5)-methyltransferase (DNMT) protein, high mobility group or high mobility group box protein (HMG or HMGB), poly[ADP-ribose] Polymerase (PARP) proteins, or proteins containing a methyl-CpG binding domain (MBD), such as MECP2. In one embodiment, the binding agent binds to histone HI or a component thereof. In another preferred embodiment, the binding agent is attached to a solid support or pellet such that bound nucleosomes can be removed from the sample (i.e., a sample not bound to the binding agent is collected and the associated DNA analyzed, as described herein described).

As mentioned above, the present invention facilitates the identification of regulatory DNA sequences that regulate protein binding in a sample based on the presence of sequences in cfDNA after nucleosome removal. Therefore, according to an embodiment of the present invention, there is provided a method for detecting a regulatory DNA sequence (optionally including flanking sequences) bound to a regulatory protein in cell-free DNA obtained from a body fluid sample of a human or animal subject, comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes; and (ii) Analyzing the DNA in step (i) that has not been bound by the binding agent to detect regulatory sequences (optionally including flanking sequences).

DNA analysis methods may involve DNA isolation and amplification. Accordingly, in one embodiment, there is provided a method of detecting chromatin fragmentation patterns in cell-free DNA in a bodily fluid sample obtained from a human or animal subject, comprising the steps of: (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; (ii) extracting DNA from the body fluid sample that has not been bound to the binding agent in step (i); and (iii) Analysis of extracted DNA to detect chromatin fragmentation patterns.

In one embodiment, linked DNA analysis involves identifying the presence of cfDNA fragments comprising transcription factor binding site (TFBS) sequences and/or flanking sequences. In another preferred embodiment, the binding agent is attached to a solid support or precipitated such that it and its attached nucleosomes can be removed from the sample.

The DNA sequence in the nucleosome-depleted cfDNA sample can be analyzed by any method known in the art. In a preferred embodiment, the cfDNA library generated by ligation of adapter oligonucleotides and DNA fragments is amplified by PCR method. The adapter oligonucleotides may include primer sequences to facilitate amplification of the library by PCR.

Accordingly, in one embodiment of the present invention, there is provided a method of detecting cell-free DNA chromatin fragments comprising TFBS (or other non-histone binding sites) in a body fluid sample obtained from a human or animal subject point) all or part of the sequence, optionally including flanking sequences, the method comprises the steps of: (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; (ii) isolating DNA fragments not bound to the binding agent in step (i); (iii) ligating the adapter oligonucleotides to the DNA fragments isolated in step (ii); (iv) amplified DNA fragments; and (v) Detection of all or part of a TFBS (or other non-histone binding site) sequence, optionally including flanking sequences, in amplified DNA.

In another embodiment of the present invention, there is provided a method for detecting a cell-free DNA fragmentation pattern in a bodily fluid sample obtained from a human or animal subject, comprising the steps of; (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; (ii) isolating DNA fragments not bound to the binding agent in step (i); (iii) ligating the adapter oligonucleotides to the DNA fragments isolated in step (ii); (iv) amplifying the DNA fragment; (v) sequence the DNA fragment; and (vi) Detection of cell-free DNA fragmentation patterns.

In other embodiments, PCR primers are used for DNA amplification. Degenerate primers can be designed to amplify all DNA sequences isolated in step (ii), or specific primers can be designed using software known in the art to amplify specific DNA sequences associated with the TFBS of transcription factors, selectively The land also includes flanking areas. The use of sequence-specific primers means that cfDNA can be analyzed for any specific TFBS sequence, optionally including flanking sequences, without sequencing the entire cfDNA library.

Accordingly, in one embodiment of the present invention, a method is provided for detecting in vivo cell-free DNA fragments comprising all or part of TFBS (or other non-histone binding sites) in a body fluid sample obtained from a human or animal subject ) sequence, optionally including flanking sequences, comprising the steps; (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) amplifying the isolated DNA by PCR method using sequence-specific primers; (iv) detection of amplified DNA; and (v) Use the presence or amount of amplified DNA as an indicator of the presence in the sample of cfDNA fragments that include all or part of the TFBS (or other non-histone binding site) sequence, optionally including flanking sequences.

A common method of identifying DNA fragments of a selected sequence is through hybridization of the DNA to a complementary DNA sequence. Accordingly, in another aspect of the invention, there is provided a method of detecting cell-free DNA fragments comprising all or part of TFBS (or other non-histone bound proteins) in a body fluid sample obtained from a human or animal subject. site) sequences, optionally comprising flanking sequences, the method comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) selectively amplifying the DNA isolated in step (ii); (iii) detection of DNA by hybridization; and (iv) Use the presence or amount of DNA hybridization as an indicator of the presence in the sample of cfDNA fragments that include all or part of the TFBS (or other non-histone binding site) sequence, optionally including flanking sequences.

The present invention also provides a method for enriching or purifying TFBS sequences protected by transcription factors in cfDNA in body fluid samples by removing nucleosomal cfDNA prior to cfDNA analysis.

In one embodiment of the present invention, there is provided a method for detecting cfDNA sequences and/or flanking sequences protected by transcription factors (or other non-histone proteins) in body fluid samples obtained from human or animal subjects, comprising the steps of: (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; and (ii) Analyzing the cfDNA fragments in step (i) not bound by the binding agent for the presence of DNA sequences present in the TFBS (or other non-histone-binding sequences) and/or flanking sequences.

It should be understood that any non-histone protein that binds to DNA in chromatin may be suitable for use in the methods of the invention, including transcription factors as well as other non-histone chromatin, including chromatin modifying proteins, genetic and epigenetic readouts, Write and delete proteins, proteins involved in RNA transcription (such as RNA polymerase molecules), and architectural or structural chromatin proteins (such as DNA bending proteins).

In one embodiment of the present invention, a method for detecting DNA sequences protected by non-histone proteins in body fluid samples obtained from human or animal subjects is provided, comprising the steps of: (i) exposing the bodily fluid sample to a binding agent that binds to nucleosomes; and (ii) analyzing, measuring or sequencing cfDNA fragments not bound to the binding agent in step (i).

In preferred embodiments, the binding agent is an antibody that binds to a nucleosome or a component thereof or a chromatin protein binding agent to a nucleosome.

In preferred embodiments, the binding agent is attached directly or indirectly (e.g., via a streptavidin/biotin linker system) to a solid phase such as plastic, magnetoplastic, dextran, agarose, or Other solid supports known in the art. In other embodiments, the binding agent is added in liquid form and isolated by cross-linking and the use of polyethylene glycol (PEG) to precipitate the bound nucleosomes, which can then be isolated as a solid phase precipitate (e.g., by centrifugation or filter). Many immunoprecipitation methods are known in the art, and any such method can be used in the methods of the invention.

Compared to previous methods described in the literature, the method of the present invention increases the sensitivity of the analysis of TFBS sequences occupied by transcription factors by reducing the competing background signal for the detection of cfDNA fragmentation patterns at or near the TFBS sequences and flanking sequences Spend. This is because disease-derived cfDNA fragmentation patterns close to TFBS sequences may be difficult to detect when masked by nucleosome fragmentation patterns derived from healthy hematopoietic cells. Improvements in assay sensitivity are important because some circulating cfDNA fragments containing TFBS sequences may occur at low levels, near or below the detection limit of fragment endpoint assays and other methods known in the art.

The methods of the present invention also provide improved tissue-of-origin specificity for cfDNA over previous methods described in the literature by detecting the occupancy of cfDNA transcription factors at or near the TFBS sequence and flanking sequences through an improved method through two (i) by facilitating simultaneous multiple TFBS analysis, and (ii) because a single transcription factor can regulate different genes by binding different DNA sequences in different gene promoters in the genome in different cells. Thus, the presence of TFBS and its flanking sequences in cfDNA indicates the cell type of origin, such as the transcription factor TTF-1, but also the different promoter sequences of different genes with different cofactors and other transcription factors binding to different tissues, as shown in Fig. 1 Show.

Gene expression is regulated by the specific binding of transcription factors to short TFBS DNA sequences, also known as response units or binding motifs. The binding site is usually, but not necessarily, located in the gene promoter region near the transcription start site of the regulated gene. Transcription factors bind to DNA in a sequence-specific manner through the DNA Binding Domain (DBD). Typically, the TFBS sequence is 5-15 bp in length within the promoter of its target gene, and transcription factor proteins can usually bind to a group of similar DNA sequences with varying degrees of binding affinity. The length of the DNA segment attached to a circular chromatin segment containing a transcription factor will vary depending on whether the segment also includes other DNA protection sequences bound by other transcription factors, cofactors, nucleosomes, or other chromatin proteins. Many of these chromatin fragments have been reported to contain cfDNA fragments in the 35–80 bp range (Snyder et al , 2016). Furthermore, we noted that this size range is similar to that of chromatin fragments produced by nuclease digestion of chromatin extracted from cancer patient cells (Corces et al , 2018). We conclude that these 35-80 bp cfDNA fragments are longer than typical DNA reaction units and thus include flanking DNA sequences. However, the size of DNA fragments associated with nucleosomes usually exceeds 100 bp DNA. Therefore, we conclude that cfDNA fragments shorter than 100 bp do not include intact nucleosomal DNA fragments. It is this repertoire of chromatin fragments composed of transcription factors and other DNA-binding chromatin proteins that do not contain nucleosomes and that are associated with cfDNA fragments in the 35-80 bp size range, all or most of which are not Nucleosomes are removed from the sample regardless of their linker DNA composition or tissue origin.

It has been reported that most or most of the short cfDNA fragments less than 100 bp in length do not originate from chromatin fragments including regulatory proteins, but from nucleosome-associated DNA, one or both strands of which are cleaved of or broken. In this case, a short cfDNA fragment may represent, for example, a 150bp DNA fragment attached to a nucleosome that is cleaved at one or more positions to generate two or more smaller cfDNA fragments (e.g. two 75bp fragments ), rather than a single 150bp cfDNA fragment (Sanchez et al , 2018). Thus, the method of the present invention has the additional advantage of removing short cfDNA fragments of less than 100 bp originating from nucleosome-associated nicking DNA. This further reduces the background of nucleosome-associated cfDNA signals in the sample, thereby increasing the sensitivity of the method to cfDNA fragments linked to sequences bound by transcription factors (or other non-histone proteins).

The method of the present invention removes nucleosomal DNA with intact or nicked DNA and is therefore superior to existing methods in the art for separating (isolated) DNA fragments based on DNA size, which are expensive and impractical for high-throughput applications , these methods fail to remove short cfDNA fragments from nicked DNA in cell-free nucleosomes.

Embodiments of the present invention employ a method that removes all or most nucleosomes to address cfDNA fragments of disease origin, regardless of the size of the conjoined DNA fragments typical of nucleosome-associated DNA fragments.

In the embodiment of the present invention, the method of removing nucleosomes containing linker DNA is mainly used to solve the size of cfDNA fragments whose length is less than 147 bp.

Response units for transcription factors may be repeated at many locations within the genome, and for some transcription factors thousands of locations. Thus, the same transcription factor has the potential to bind at many locations within cellular chromatin. This means that, in principle, the death of a single cell could generate large numbers of circulating chromatin fragments containing the same transcription factor.

In addition, transcription factors often do not act alone, but rather cooperate with other transcription factors or cofactors or other moieties that are required to regulate specific genes. Thus, transcription factors can bind to response units in the promoters of a large number of different genes, each working in concert with a different transcription factor. Thus, the DNA flanking sequences surrounding the same or similar TFBS sequence or response unit, for the same transcription factor, are different in the promoters of different genes because they contain binding motifs for different combinations of transcription factors. This applies to all or most transcription factors.

In addition, the binding sequence of the response unit itself can be degenerated (degenerate), so transcription factors can bind a variety of different motif sequences. For example, the transcription factor TTF-1 is expressed in a tissue-specific manner in healthy lung and healthy thyroid tissue. In the lung, two proteins, TTF-1 factors, bind to the promoter region of the lung-specific Surfactant Protein B (SPB) gene. The DNA binding sequence or binding motif of TTF-1 in the SPB promoter is GCNCTNNAG (SEQ ID NO: 1) (where A, C, G and T represent the DNA bases adenine, cytosine, guanine and thymine, respectively, N represents any of these bases). The broader consensus promoter DNA sequence surrounding TTF-1 binding is (118)GATCAAGCACCTGGAGGGCTCTTCAGAGCAAAGACAAACACTGAGGTCGCTGCCA(-64) (SEQ ID NO: 2), where (-64) represents the base pair distance from the SPB transcription start site . In the SPB promoter in lung tissue, TTF-1 binds to the transcription factor Hepatocyte Nuclear Factor 3 (HNF3), as shown in Figure 1 (Matys et al , 2006 and Bohinski et al , 1994).

In the thyroid, TTF-1 regulates a number of genes, including thyroglobulin, thyroid stimulating hormone receptor, and thyroid peroxidase. The consensus binding sequence for TTF-1 in the promoter region of the thyroglobulin gene is different from that in lung and was reported as TGGCCACACGAGTGCCCTCA (SEQ ID NO: 3). In the promoter of the thyroglobulin gene, TTF-1 cooperates with TTF-2, PAX8, and Runx2 transcription factors, and a broader sequence at the 5' and 3' ends comprising 50 bp flanking sequences is CCCACCCCGTTCTGTTCCCCCACAGTTTAGACAAGATCCTCATGCTCCACTGGCCACACGAGTGCCCTCAGGAGGAGTAGACACAGGTGGAGGGAGGCTCCTTTTGACCAGCAGAGAAAAC (SEQ ID NO: 4). Similarly, TTF-1 also binds to the promoter regions of the thyrotropin receptor and thyroid peroxidase genes, in each case cooperating with different co-transcription factors. Therefore, not only the DNA sequence around the TTF-1 binding site in the promoter sequence of the regulated gene in the thyroid or lung tissue is different, but also the cofactor linked to TTF-1 is different, and therefore the surrounding DNA sequence is different in the same tissue Binding to different genes in is also different, as shown in Figure 1 (Matys et al , 2006 and Maenhaut et al , 2015). This demonstrates that the detection of TFBS sequences and flanking DNA sequences in the subject's cfDNA by the method of the present invention is sufficient to identify the origin of the chromatin fragments as lung or thyroid.

There are approximately 1000-3000 human transcription factors, each of which binds to a specific location in the genome, resulting in dynamic transcriptional changes that drive a multitude of cellular processes. We took TTF-1 as an example to illustrate the principle of the present invention. However, any transcription factor can in principle be used in the methods of the invention. Furthermore, transcription factors that are ubiquitously expressed in many cell types and bind discrete DNA sequences (such as Hox protein transcription factors) cooperate with cofactors to uniquely bind different sequences to regulate different genes in different tissues (Merabet and Mann, 2016, Mann et al , 2009). This means that all or most transcription factors can be used in the methods of the invention. For example, the estrogen receptor-α (ERα) transcription factor binds to more than a thousand binding sites or estrogen response elements (EREs) in the human genome, unlike at least 60 other transcription factors at different genomic locations. The combination of factors is consistent (Lin et al , 2007). Similarly, the androgen receptor (AR) binds to androgen response elements (AREs) associated with thousands of genes, consistent with other cooperating transcription factors at thousands of different sequence loci. Therefore, even if these transcription factors are expressed in multiple tissues, the method of the present invention can identify the tissue origin of the chromatin fragment containing ERα or AR through the sequence of the related DNA. This holds true for many other transcription factors, including CTCF.

Furthermore, the DNA loci bound in cancer cells are often different from those bound in healthy cells, thus identification of cfDNA fragments in circulation containing TFBS sequences (optionally including flanking sequences) by the methods of the present invention can identify patients with Cancer subjects and identify cancer types such as prostate or lung cancer (Pomerantz et al 2015). This is because chromatin is remodeled during tumorigenesis, and this remodeling involves upregulation of tumor-associated proteins through remodeled transcription factor binding patterns in cancer cells. As such, the expression of many transcription factors is upregulated in cancer cells. This is a broad phenomenon, but can be illustrated with some non-limiting examples. For example, the well-known cancer-associated transcription factors c-Myc and p53 are upregulated in most cancers. The binding site sequence bound by AR is highly variable in prostate cancer (Pomerantz et al 2015). Similarly, epithelial-mesenchymal transition (EMT), which is associated with metastasis and therapy resistance in cancer cells, involves the upregulation of the Jun/Fos family of transcription factors, including Fosll, Fosb, Fos, and Junb. The ETS (E26 Transformation Specific) family as well as Runxl, Tead and Nfkb transcription factors were also found to be highly enriched in the open chromatin of tumor cells. In addition, p63, Klf, Grhl, and Cepba were reported to be upregulated in tumor cells, and their binding sites were enriched in open chromatin regions. Klf5 and p63 transcription factors are associated with cancer and act as drivers in lung and head and neck cancers. Other transcription factors associated with EMT include bHLH, Runx, Nfat, Tbx1, Tcf7I1, and Smad2 (Latil et al , 2017)

The regulation of gene transcription in eukaryotes involves multiple regulatory proteins that bind to multiple regulatory DNA sequences located near the transcription start site (TSS) of the genome in the transcription complex and distal to the TSS in the genome, e.g., as shown in picture 2. Distal regulatory sequences in DNA may be located a few hundred to a million bases from the TSS, or possibly farther. Transcription complexes often involve DNA loops, which may involve DNA bending proteins, where more distal regulatory sequences and the regulatory proteins bound to them contact proteins bound to regulatory sequences closer to the TSS, for example, as shown in Figure 2. The TATA box is so named because it contains repeating thymine/adenine nucleotide sequences that bind general transcription factors required for transcription. Expression of specific genes also requires other gene-specific transcription factors (for example, those required for expression of the surface tensin B, thyroglobulin, thyroid peroxidase, and TSH receptor genes, as shown in Figure 1). In addition, a variety of other proteins are required, including for example but not limited to: cofactors, mediators, activators, coactivators, repressors, co-repressors, chromatin remodeling proteins, DNA bending proteins, insulators, and the like. This complex may also include lengths of nucleosome-protected DNA. The transcription complex can be stabilized to facilitate high-volume transcription. Thus, circulating chromatin fragments of healthy and/or disease origin may include large protein/DNA complexes containing multiple proteins that may be resistant to nuclease activity. As shown in Figure 2, some large transcriptional complexes involving proximal and distal regulatory sequences are called super-enhancers. Super-enhancers are large clusters with high levels of transcription factor binding that are central to driving the expression of genes involved in the control of cellular identity. Super-enhancers are also central to stimulating oncogene transcription in cancer. Cancer cells acquire super-enhancers, and the cancerous phenotype relies on aberrant transcription driven by super-enhancers. Thus, detection of the presence of chromatin fragments, including all or part of super-enhancer complexes and/or combinations of cfDNA fragment sequences corresponding to proximal and distal regulatory sequences of super-enhancers, by the methods described herein provides a Methods of identifying the cellular origin of chromatin fragments, including cancer cells of origin.

The DNA loops in such chromatin fragments can in principle be intact, or they can be digested at one or more positions, resulting in (i) two circular chromatin fragments corresponding to proximal and distal regulatory sequences; or ( ii) A large chromatin fragment containing two DNA segments. Thus, cfDNA may include small DNA fragments corresponding to proximal and distal regulatory sequences of genes.

In one embodiment, the disease is selected from cancer, autoimmune disease or inflammatory disease. In another embodiment, the disease is cancer. In another embodiment, the autoimmune disease is selected from: systemic lupus erythematosus (SLE) and rheumatoid arthritis. In another embodiment, the inflammatory disease is selected from the group consisting of: Crohn's disease, colitis, endometriosis and chronic obstructive pulmonary disease (COPD).

In preferred embodiments, the disease is cancer. In another embodiment, the cancer is selected from the group consisting of breast cancer, bladder cancer, colorectal cancer, skin cancer, melanoma, ovarian cancer, prostate cancer, lung cancer, pancreatic cancer, colorectal cancer, bowel cancer, liver cancer, endometrial cancer cancer, lymphoma, oral cavity cancer, pharyngeal cancer, head and neck cancer, leukemia, lymphoma and osteosarcoma.

In another embodiment, the tissue affected by the disease is the organ of origin, eg, the organ of origin of a cancer.

In another aspect of the present invention, a method of detecting a disease in a human or animal subject is provided, comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) amplifying the isolated DNA, for example by PCR methods; (iv) determine the sequence of the amplified DNA; and (v) Using the transcription factor binding site DNA sequences and optionally flanking DNA sequences present in the amplified DNA as biomarkers to determine the presence and/or nature of a disease in a subject.

It is also clear to those skilled in the art that multiple TFBS sequences can be obtained corresponding to the various loci bound by one or more transcription factors with flanking sequences associated with the multiplicity of gene promoters or other loci, and can Data on various sequences are integrated to determine the nature of the disease and/or the tissues affected by the disease.

DNA can be detected and analyzed using methods known in the art. Thus, in one embodiment, DNA is analyzed by PCR. For example, DNA can be detected using PCR methods, such as PCR methods using adapters, degenerate primers, or sequence-specific primers. Alternatively, DNA can be detected using hybridization methods, eg, using complementary sequences to capture target sequences by hybridization.

In another aspect of the present invention, a method for detecting a disease in a human or animal subject is provided, comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) amplifying the isolated DNA, for example by PCR methods; (iv) detection of amplified DNA; and (v) using the presence or amount of amplified DNA as an indicator of the presence and/or nature of the subject disease.

The DNA sequence isolated in step (ii) can be amplified by any method known in the art. In preferred embodiments, the isolated DNA is amplified using a PCR method employing adapters ligated to the DNA fragments. In other embodiments, PCR primers are used for DNA amplification. Degenerate primers can be designed to amplify all DNA sequences isolated in step (ii), or specific primers can be designed using software known in the art to amplify specific DNA sequences related to the sequence of the transcription factor's response unit, Optionally flanking regions are also included.

Therefore, in another aspect of the present invention, a method for detecting a disease in a human or animal subject is provided, comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) amplify the isolated DNA by PCR method using sequence-specific primers; (iv) detection of amplified DNA; and (v) Use the presence or amount of amplified DNA as an indicator of the presence and/or nature of the subject disease.

The presence or amount of DNA can be detected by hybridization methods. Therefore, in one embodiment of the present invention, a method for detecting a disease in a human or animal subject is provided, comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) detection of DNA by hybridization; and (iv) using the presence or amount of hybridized DNA as an indicator of the presence and/or nature of disease in a subject.

In preferred embodiments, the isolated DNA is amplified prior to hybridization. In preferred embodiments, the hybridization is a multiplex method in which multiple DNA sequences are immobilized on a solid phase to simultaneously bind multiple TFBS sequences, optionally including flanking sequences. This allows testing of multiple TFBS sequences and multiple disease conditions in a single multiplex format. In preferred embodiments, the multiplex hybridization method is a DNA microarray or DNA chip method. Any multiplex method suitable for studying polygenic sequences can be used in the methods of the invention. Many such methods are known in the art, including the Luminex bead method (Dunbar, 2006).

A further method for detecting the presence of cfDNA fragments comprising TFBS sequences in a cfDNA sample involves contacting the cfDNA sample with the transcription factor protein itself. The transcription factor will then bind to any DNA sequence that contains one or more of its TFBS sequences. DNA bound to a transcription factor can be detected by any method known in the art, including but not limited to the use of DNA binding agents (eg, anti-DNA antibodies or DNA chelators) or by PCR or hybridization methods. In one example, general DNA binding agents such as anti-DNA antibodies or DNA chelators or intercalators such as ethidium bromide, and cyanine dyes such as SYBR green and SYBR gold are used.

For example, the presence of the prostate-specific NKX3.1 TFBS sequence in a library of DNA fragments prepared from a sample of a subject after nucleosome removal indicates that the subject is positive for prostate cancer. Thus, a library of DNA fragments can be contacted with the solid-phase immobilized transcription factor NKX3.1 to bind DNA fragments containing the NKX3.1 TFBS sequence. Binding of DNA from the library to NKX3.1 is indicative of prostate cancer.

Therefore, in another aspect of the present invention, a method for detecting a disease in a human or animal subject is provided, comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) DNA that was not bound to the binding agent in step (i) was isolated; (iii) optionally, amplifying the DNA isolated in step (ii); (iv) contacting the DNA obtained in step (ii) or (iii) with a transcription factor protein; and (v) using the presence, amount or sequence of DNA bound to a transcription factor as an indicator of the presence and/or nature of a disease in a subject.

In one embodiment, DNA not bound to the nucleosome binding agent isolated in step (ii) is contacted with multiple (ie more than one) transcription factor proteins such that multiple sets of TFBS are captured and can be analyzed in a multiplex assay. This approach enables testing of multiple transcription factors and multiple diseases in a single patient sample. For example, testing DNA fragments that bind to multiple transcription factors, each of which is specific for one or more cancer diseases, selectively, in addition to the identification of tissues other than transcription factors that are expressed in many cancers Detect many different cancer diseases cancer in one blood test. Methods for multiplex testing are well known in the art, for example, but not limited to, Luminex Corporation's multiplex beads system can be used to perform a large number of separate assays in a single sample (Dunbar, 2006).

Therefore, in another aspect of the present invention, a method for detecting a disease in a human or animal subject is provided, comprising the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) optionally, amplifying the DNA isolated in step (ii); (iv) contacting the DNA obtained in step (ii) or (iii) with a plurality of transcription factors; and (v) Use the presence, amount or sequence of DNA bound to different transcription factors as an indicator of the presence, nature, location and/or affected tissues of the subject disease.

In one embodiment, the methods described herein are used to identify the tissue of origin of a tumor of unknown origin. This can be performed in body fluid assays as described above, or can be performed on libraries of chromatin fragments generated by fragmentation of tumor tissue chromatin material obtained during biopsy or surgery. Methods for chromatin fragmentation are well known in the art and include, but are not limited to, by digestion with nucleases and by sonication. In the specific case of testing tissue, it may not be necessary to remove nucleosomes prior to exposure to transcription factors (provided the sample is not contaminated with chromatin from healthy cells).

Accordingly, in another aspect of the invention, there is provided a method of detecting a disease in a tissue sample from a human or animal subject, comprising the steps of: (i) isolating chromatin from a tissue biopsy sample; (ii) fragmenting the chromatin isolated in step (i); (iii) extracting DNA from the chromatin fragment obtained in step (ii); (iv) contacting the DNA isolated in step (iii) with one or more transcription factors; and (v) Using the presence, amount or sequence of DNA bound to a transcription factor as an indicator of the presence and/or tissue of origin of a disease in a subject.

The cfDNA fragmentation pattern of bodily fluid samples obtained from a subject can be analyzed to detect disease and identify affected cells or tissues. Removal of nucleosomes facilitates the analysis of cfDNA fragmentation patterns around active transcription factor binding sites while removing nucleosome fragmentation patterns. Therefore, according to another aspect of the present invention, there is provided a method of detecting the presence and/or tissue of origin of a disease in a human or animal subject, comprising the steps of: (i) contacting a sample of bodily fluid obtained from the subject with a binding agent that binds to nucleosomes; (ii) analyzing the DNA in step (i) that has not been bound to the binding agent to detect cfDNA fragmentation patterns; and (iii) Use of total or partial cfDNA fragmentation patterns as indicators of host disease presence and/or tissue of origin.

In preferred embodiments, the disease is cancer. In another embodiment, the nature of the disease is tissue affected by cancer.

It is well known in the art that cfDNA of fetal origin (eg, containing Y-chromosomal DNA sequences from (XY) male fetuses) circulates in the blood of pregnant animals and human (XX) mothers. Similarly, it has been reported that this cfDNA contains cfDNA fragments of the expected length for nucleosome-protected DNA fragments (approximately 160 bp) as well as shorter cfDNA fragments in the range above 50 bp (Hu et al ; 2019). Thus, the methods of the present invention are applicable not only to the disease state of the subject from which the sample is taken, but also to maternal/fetal research, including prenatal testing of fetal status in maternal blood samples.

Accordingly, in one embodiment of the present invention, there is provided a method for detecting a fetal disease state in a body fluid sample obtained from a pregnant human or animal subject, comprising the steps of: (i) exposing the sample of maternal body fluid to a binding agent that binds to nucleosomes; (ii) analysis of DNA not bound to the binding agent in step (i); and (iii) using the presence, quantity, sequence, or pattern of fragmentation of DNA as an indicator of the subject's fetal disease state.

nucleosome binding agent

Any moiety that binds to nucleosomes can be used in the methods of the invention. In a preferred embodiment of the present invention, all or most of nucleosomes are removed prior to analysis of cfDNA, and the nucleosome binding agent is an antibody that specifically binds to nucleosomes. Antibodies can bind to any nucleosomal epitope or any component of a nucleosome. In preferred embodiments, the selected antibody binds to a component present in all or most circulating cell-free nucleosomes, thereby removing all or most nucleosomes from a bodily fluid sample prior to cfDNA analysis by the methods described herein. body.

In preferred embodiments, the nucleosome binding agent binds to a nucleosome core epitope. Core histones H2A, H2B, H3 and H4 all have a core domain and a histone tail approximately 20-30 amino acids in length. The histone tails of circulating cell-free nucleosomes can be removed in whole or in part to produce "clipped" histones. This is generally thought to be caused by the action of the endopeptidase histone-L (cathepsin-L), which is involved in the initiation of protein degradation. For example, histone-L removes the histone H3 tail at amino acid position 21. Therefore, antibodies that bind to histone H3 (an epitope between amino acids 1-21) may fail to remove nucleosomes containing histone H3 in which the tail has been truncated. In our own experiments, we observed that antibodies binding to histone H3 epitopes (at amino acid positions 4–8 on the histone tail) were less effective than antibodies binding to epitopes greater than amino acid position 21, Fewer nucleosomes are bound. Similar restrictions apply to the other core histones (i.e. H2A, H2B and H4). In our own method development we used antibodies that bind the core histone H2A and H2B epitopes as well as the histone H3 epitope located at amino acids 30-33.

In one embodiment, the method further comprises using the presence, amount or sequence of the DNA as an indicator of the subject's disease state. Therefore, in a preferred embodiment of the present invention, a method for detecting a disease state in a body fluid sample obtained from a human or animal subject is provided, comprising the steps of: (i) exposing the bodily fluid sample to a binding agent that binds to a nucleosome core epitope; (ii) analyzing the DNA not bound to the binding agent in step (i); and (iii) Use the presence, quantity, sequence, or fragmentation pattern of DNA as an indicator of the subject's disease state.

In one embodiment of the present invention, nucleosomes containing linker DNA are removed prior to cfDNA analysis, and the binding agent that binds to nucleosomes containing linker DNA is all or part of a histone H1 moiety Chromatin proteins or chromatin-binding proteins, including but not limited to: chromatin helicase DNA-binding protein (CHD), DNA (cytosine-5)-methyltransferase (DNMT), high mobility family or high mobility Group box proteins (HMG or HMGB), poly[ADP-ribose] polymerase (PARP), or proteins containing a methyl-CpG binding domain (MBD), such as MECP2. The binding agent can also be an antibody or other binding agent that binds histone HI.

The binding agent used in the method of the present invention can be coated on a solid support such as agarose gel, dextran gel, plastic or magnetic beads. In one embodiment, the solid support comprises a porous material. In another embodiment, the binding agent is derivatized to include a tag or linker that can be used to attach the binding agent to a suitable support that has been derivatized to bind the tag. Many such tags and supports are known in the art (e.g., Sortag, Click Chemistry, biotin/streptavidin, his-tag/nickel or cobalt, GST-tag/GSH, antibody/epitope tags, etc. Wait). Isolation of the binding agent can then be performed before, simultaneously with, or after reaction of the binding agent with the nucleosome. For ease of use, the coated support can be included in a device, such as a microfluidic device.

In other embodiments, the binding agent is added to the solution and isolated by cross-linking and precipitating the bound nucleosomes with a precipitating agent such as polyethylene glycol (PEG). The precipitated precipitate can then be separated into separate phases, for example by centrifugation or filtration. Many immunoprecipitation methods are known in the art, and any such method can be used in the methods of the invention.

DNA sequencing

Many methods of analyzing or identifying DNA sequences are known in the art, and any DNA analysis method can be used in the methods of the present invention, including but not limited to: next generation sequencing methods, isothermal DNA amplification, cold PCR (at lower Co-amplification PCR at denaturing temperature), MAP (MIDI-activated pyrophosphorylation), PARE (Personalized Recombination Analysis), DNA hybridization methods (including gene chip method and in situ hybridization method). In addition, genetically altered DNA sequences can be analyzed by epigenetic DNA sequencing analysis (e.g., for sequences containing 5-methylcytosine, bisulfite is used to convert unmodified cytosine for uracil). Thus, in one embodiment, cfDNA is analyzed using DNA sequencing, for example selected from: next generation sequencing (targeted or whole genome) and methylated DNA sequencing analysis, BEAMing, PCR including digital PCR and cold PCR (in co-amplification-PCR), isothermal amplification, hybridization, MIDI-activated pyrophosphate cleavage (MAP) or personalized recombination analysis (PARE) at lower denaturing temperatures.

DNA library preparation

cfDNA present in a sample after nucleosome removal can be amplified for detection and sequencing using PCR methods. Methods for preparing cfDNA fragment libraries are well known in the art and generally involve ligation of adapter oligonucleotides to cfDNA fragments. The adapter oligonucleotide-ligated library of DNA fragments is then amplified, typically by PCR. Degenerate PCR primer oligosets can also be used to amplify cfDNA.

In principle, any library preparation method can be adapted for use in the methods of the invention. Library preparation methods may involve amplification of single- or double-stranded adapter-ligated cfDNA fragments. A preferred library preparation method involves ligation of single-stranded cfDNA adapters. The preferred library preparation method is highly efficient for the amplification and isolation of small DNA fragments less than 100 bp in length. Many such library preparation methods are known in the art, including, for example, (i) 20-25 assays for 5-10 ng of loaded DNA using the TruSeq DNA Sample preparation Kit (Illumina) according to the manufacturer's protocol. PCR cycling (Ulz et al , 2019), (ii) using the MagMAX cfDNA Isolation Kit (Applied Biosystems), followed by library preparation using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) (Ulz et al , 2019), (iii) ) using the experimental protocol for blood and body fluids using the Qiagen QIAamp DSP DNA Blood Mini Kit and PCR amplification using the Life technologies Ion Plus Fragment Library Kit (Hu et al , 2019). Other methods include Sanchez et al , 2018, Skene and Henikoff, 2017, Snyder et al , 2016, and Liu et al , 2019. In preferred embodiments, adapter oligonucleotides are ligated to the DNA fragments and used to amplify all of the adapter-ligated DNA fragments in the library. These methods are well known in the art.

PCR primers for DNA amplification can also be of random sequence to amplify all sequences present in the library, or can be designed using software known in the art to amplify specific DNA linked to the sequence of the transcription factor's responsive unit sequence, optionally also containing flanking regions.

Alternatively, specific primer oligonucleotides designed by methods known in the art can be used to amplify specific cfDNA sequences, eg, linked to transcription factor response units, optionally including flanking regions. In this example, cfDNA fragments comprising TFBS sequences, optionally including flanking sequences, can be detected without sequencing itself (eg, next-generation sequencing).

Sample Preparation

The sample can be any bodily fluid in which chromatin fragments can be detected. Chromatin fragments are known to be present in blood, feces, urine, and cerebrospinal fluid. We also detected chromatin fragments in sputum. In preferred embodiments, the bodily fluid sample is a blood, serum or plasma sample. In highly preferred embodiments, the sample is a plasma sample, including plasma samples collected in EDTA blood collection tubes or in tubes recommended for cfDNA analysis. Such tubes include, but are not limited to, cell-free DNA blood collection tubes produced by Roche, PAXgene, Norgene, LBgard, and the like. These samples can be used to measure and analyze circulating cfDNA fragments. For example, plasma samples (eg, EDTA plasma samples) can be used in the methods of the invention. Plasma can be used fresh or frozen until analysis. In our own method development, we used plasma samples collected in standard EDTA blood collection tubes and centrifuged within 2 hours. Our experimental results indicate that cell-free DNA blood collection tubes are also applicable.

transcription factors and their DNA binding sites

Regulation of gene transcription in eukaryotes can be very complex, involving DNA bending and looping to bring together multiple regulatory DNA sequences bound by multiple regulatory proteins into a regulatory transcription complex, as shown in Figure 2. Therefore, the term "transcription factor" used herein refers to a regulatory protein that directly or indirectly binds to gene regulatory sequences in the genome to regulate gene transcription, including but not limited to: general transcription factors and specific transcription factors related to specific gene regulation and enhancers , co-enhancer, repressor, co-repressor, mediator, DNA bending protein, chromatin remodeling protein, DNA damage repair protein, RNA polymerase protein or other transcriptional regulatory protein. Similarly, the term "transcription factor binding site" (TFBS) as used herein refers to the DNA binding site of a regulatory protein associated with the transcriptional regulation of a gene, including but not limited to distal or proximal enhancer and repressor sequences, such as Figure 2 shows.

The length of the TFBS sequence is usually less than 10bp, so a cfDNA fragment of 35-80bp will cover the TFBS flanking sequence. The term "flanking sequence" as used herein refers to a DNA sequence present in the genome near the TFBS. For example, DNA sequences within 20 or 50 or 100 or 200 bp upstream or downstream of TFBS. It will be clear to those skilled in the art that the flanking sequences of a particular TFBS in the genome, for example within a gene promoter sequence, may include binding sites for other regulatory proteins.

Appropriate TFBS sequences can be determined experimentally, eg, using classical nuclease-accessible site mapping methods to identify DNA sequences linked to transcription factors of interest in a tissue of interest. In a typical experiment, chromatin is extracted from cells of interest (such as cancer cells, healthy cells of the same tissue, and hematopoietic cells) and digested with an appropriate nuclease. Chromatin fragments generated by digestion are exposed to antibodies that specifically bind the transcription factor of interest, and antibody-bound DNA fragments are isolated and sequenced to determine the TFBS sequence (optionally including flanking sequences) that binds the transcription factor. Classical nuclease accessibility methods have recently been refined and the technique now includes methods such as CUT&RUN and others that are easier to perform and provide improved results (Skene and Henikoff, 2017). Any such method is suitable for use in identifying suitable DNA sequences for use in the present invention.

Suitable transcription factors and TFBS sequences and flanking sequences for use in the methods of the invention can also be selected using various genome, transcription factor, and cancer databases, such as: , which provides annotated genome sequences for many species, including humans. ENSEMBL database, Encyclopedia of DNA Elements or (ENCODE) database (https://www.encodeproject.org), transcription factor (TRANSFAC) database (Matys et al , 2006), gene transcription regulation database (GTRD) 18.01 version (http://gtrd.biouml.org), Human Transcription Factor Database version 1.01 (http://humantfs.ccbr.utoronto.ca), NIH Genomics Data Commons (https://gdc.cancer. gov), The Cancer Genome Atlas (TCGA) (https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga), UCSC Xena Browser (https://atcseq.xenahubs.net ) and the Human Protein Atlas database (https://www.proteinatlas.org), which provides transcription factors expressed in healthy tissues and their expression in cancer diseases, among others.

The use of these libraries (characterization of transcription factors and associated TFBS sequences and flanking sequences for use in the methods of the invention) can be illustrated with reference to some of these libraries. The TRANSFAC database provides information on thousands of human and other eukaryotic transcription factors. Detailed information provided for each transcription factor includes the number of TFBSs it binds in the genome, the list of genes it regulates transcription, the sequence and genomic location of the TFBSs associated with each regulated gene, and other genes that regulate transcription with it in a coordinated manner. Details of transcription factors, consensus TFBS DNA sequences, DBD details, and cancer associations. For purposes of illustration, the use of data in the context of the present invention is exemplified below for the transcription factors CDX2 and c-JUN. The TRANSFAC database lists 48 human CDX2 TFBS that regulate 26 specific genes. The CDX2 TFBS sequences are provided along with their genomic locations and the genes regulated by each sequence. The flanking sequence of each CDX2 TFBS can be determined by referring to the ENSEMBL human genome database to determine the sequence of each genomic position. Consensus CDX2 TFBS sequences are also provided. Similarly, the TRANSFAC database lists 265 human c-JUN TFBS that regulate 166 specific genes. The c-JUN TFBS sequences are provided along with their genomic locations and the genes regulated by each sequence. The flanking sequences of each c-JUN TFBS can be sequenced at each genomic position by referring to the ENSEMBL Human Genome Database. The consensus c-JUN TFBS sequence is also provided.

CTCF (also known as CCCTC-binding factor) is an evolutionarily conserved zinc finger transcription factor, which binds to a large number of sites in the genome through a combination of 11 zinc fingers and plays a key role in genome function. A study of CTCF binding sites in the human genome identified 77,811 distinct binding sites in 19 different cell types (Wang et al , 2012). Across all 19 cell types studied, 27,662 of 77,811 binding sites were found to be occupied. CTCF binding of the remaining 50,149 binding sites exhibited tissue specificity. The 19 cell types studied included 12 normal cell types and 7 cancer or EBV-immortalized cell lines representing colorectal cancer (Caco-2), cervical cancer (HeLa-S3), hepatocellular carcinoma (HepG2), Neuroblastoma (SK-N-SH_RA), retinoblastoma (WERI-RB-1) and EBV-transformed lymphoplasma (GM06990). The binding of CTCF at 1,236 binding sites was found to be specific to cancer cell lines. Occupation of 1041 of these binding sites occurred in immortalized cancer cell lines but not in normal cells (including epithelial cells, fibroblasts, and endothelial cells) (Liu et al , 2017).

Accordingly, transcription factors and/or TFBSs can be selected experimentally or from the literature and/or databases (eg, the Human Protein Atlas database) for use in the methods of the invention. A transcription factor may be characterized in terms of (i) its expression in healthy and diseased tissues, (ii) the genes regulated in those cells or tissues, (iii) the TFBS sequences it binds in those tissues , and (iv) other factors that regulate transcription by co-binding on TFBS. Through the methods described herein, this characterization can be used to identify the healthy or diseased tissue or cell origin of chromatin fragments and/or cfDNA fragments in bodily fluid samples.

Similarly, experimental data related to chromatin fragments and/or cfDNA sequences in bodily fluid samples can be interpreted using these databases to identify all or part of the TFBS sequences (optionally including flanking sequences) contained in the cfDNA fragments. This profile can then be used to identify the tissue or cellular origin of the cfDNA fragments.

In addition, there are many publications in the literature on transcription factors and cancer that list transcription factors that can be used in the methods of the invention. For example, Lambert et al , 2018 listed 294 known oncogenic transcription factors and regulators. Gurel et al , 2010 describe the transcription factor NKX3.1 as a marker for prostate cancer. Darnell, 2002 listed many oncogenic transcription factors, including STAT3, 5, STAT-STAT, GR, IRF, TCF/LEF, β-catenin (β-catenin), NF-ĸB, NOTCH (NICD), GLI, c -JUN, bZip proteins (including c-JUN, JUNB, JUND, c-FOS, FRA, ATF and CREB-CREM families), cEBP family, ETS proteins and MAD-box family. Vaquerizas et al , 2009 describe a number of tissue-specific transcription factors that can be used in the methods of the present invention. Ulz et al , 2019 describe transcription factors such as the epithelial transcription factor GRHL2 (which is present in many cancer types but not blood tissues) as well as AR (androgen receptor), NKX3-1 and HOXB13. Corces et al , 2018 describe a number of cancer-specific and tissue-specific transcription factors, including NR5A1, TP63, GRHL1, FOXA1, GATA3, NFIC, CDX2, RFX2, ASCL1, PAX2, HNF1A, NKX2.A, PHOX2B, DRGX, HOXB13 , AR, MITF, HNF4 and POU5F1. Said references are incorporated herein by reference.

Suitable TFBS sequences (optionally including flanking sequences) for use in the present invention can also be determined experimentally. For example, the pattern of small (eg, 35-80 bp) cfDNA fragments present in samples obtained from patients diagnosed with or without a known disease state can be determined experimentally. The data can be used to generate TFBS loci or patterns of TFBS loci that are selectively present in samples obtained from diseased patients. This will generate a cfDNA TFBS biomarker or biomarker panel signature for disease.

It is well known that the expression of transcription factors is altered in disease. Thus, the methods of the present invention may involve the expression of transcription factors that are upregulated in disease and/or inappropriately expressed in diseased tissue (e.g. cancerous tissue) while generally not highly expressed in said (healthy) tissue which performed.

Chromatin fragments present in circulation in healthy subjects are primarily of hematopoietic origin. Thus, the methods of the present invention also involve the inappropriate presence of circulating chromatin fragments comprising transcription factors and associated DNA that are absent or underexpressed in healthy hematopoietic tissues but are expressed in diseased or non- Manifested in hematopoietic tissues. After removal of nucleosome-bound cfDNA by the method of the present invention, the presence of transcription factors and associated DNA in a sample can be inferred by detection of cfDNA sequences (optionally including flanking DNA sequences) associated with its TFBS.

For example, many cancerous diseases arise from epithelial tissue. The epithelial GRHL2 transcription factor is expressed in many epithelial tissues as well as in many epithelial-derived cancer diseases, but not in hematopoietic tissues. The presence of GRHL2 in the circulation is indicative of cancers of epithelial origin, such as colorectal, prostate, lung or breast cancer. Thus, the method of the invention can be used to detect the presence of cancer itself, which can be used in conjunction with the analysis of other TFBS sequences (and optionally flanking sequences) for lineage-specific transcription factors and/or transcription factors in bodily fluid samples lineage-specific combinations to identify the organ of origin of cancer. Thus, any transcription factor is useful in the methods of the invention by virtue of its sequence of binding sites in the genome. Preferred embodiments utilize TFBS sequences (optionally including flanking sequences) present in chromatin segments associated with transcription factors that are present at elevated levels in the body fluids of diseased subjects (over and above those found in other subjects) content), and are partially or fully tissue and/or disease specific, and have multiple response units across the genome.

Thus, in one embodiment, the transcription factor used is disease-specific (ie, the levels of circulating cfDNA fragments comprising their TFBS sequences are elevated in disease). In one embodiment, the transcription factor is tissue specific. In one embodiment, the transcription factor binds to more than one location in the genome, eg, more than 5, more than 10, more than 100, or more than 1000 locations in the genome.

Transcription factors can be classified by binding domain (see, eg, Vaquerizas et al , 2009, which is incorporated herein by reference). In one embodiment, the transcription factor comprises a DNA binding domain selected from the group consisting of homeodomain, HLH, bZip, NHR, Forkhead, P53, HMG, ETS, aIPT/TIG, POU, MAD, aSAND, IRF, TDP, DM, Heat shock, STAT, CP2, RFX, AP2 or zinc finger (eg zinc finger C2H2 or zinc finger GATA) binding domain.

Transcription factors currently considered to be particularly important in cancer fall into three main groups. The first group is the nuclear hormone receptor group, including estrogen receptors, androgen receptors, progesterone receptors, glucocorticoid receptors, thyroid receptors, and retinoic acid receptors. The nuclear hormone receptor group of transcription factors are cell surface receptors that can be considered as inactive or latent transcription factors that can be activated by ligand binding. For example, estrogen receptors are activated by binding to estrogen. Ligand binding causes the nuclear hormone receptor to migrate to the nucleus, where it binds to a target DNA sequence (eg, estrogen receptor binds to an estrogen response unit) and upregulates or downregulates genes associated with the DNA target sequence (eg, estrogen receptor hormone-regulated genes).

A second group of transcription factors known to be important in the initiation and progression of cancer are the signal transmitters and activators (STATs). These are latent cytoplasmic transcription factors that can be activated by a variety of molecular triggers in the cytoplasm and/or cell surface. STAT activation typically involves a cascade of biochemical events in the cytoplasm, such as kinase reactions, proteolytic reactions, and protein-protein interactions that lead to the entry of proteins or protein complexes into the nucleus to regulate the transcription of target genes. The biochemical cascade leading to transcriptional activation is often triggered by the binding of ligands to receptors on the cell surface, including, for example, the binding of cytokine receptors to cytokine moieties, or the interaction of growth factors (such as epidermal growth factor or platelet-derived growth factor) with growth Binding of factor receptors, or binding of peptides or proteins to G protein-coupled receptors.

A third important group of transcription factors in cancer are resident nuclear proteins, whose transcription is often activated by a cascade of biochemical events involving serine kinase responses. There are hundreds of serine kinase moieties and hundreds of nucleoproteins that are targets of serine kinases.

It will be clear to those skilled in the art that cfDNA fragments include (i.e. contain or contain) TFBS associated with any transcription factor involved in the initiation, development or maintenance of cancer (such as transcription factors in the above three groups), in the method of the present invention will be useful. Some transcription factors or families of transcription factors that have known roles in cancer or are known to be elevated in cancer disease include, for example (but not limited to): STATs, particularly STAT3, STAT5 and STAT-STAT dimer portions, NF- ƙB, β-catenin, γ-catenin, Notch and Notch intracellular domain (NICD), GLI, c-JUN, JUNB, JUND, c-FOS, FRA, ATF, CREB-CREM, cEBP, ETS, MYC , N-MYC, MAX, E2F, Interferon Regulatory Factor (IRF), T Cell Factor (TCF), Lymphocyte Enhancer Factor (LEF), EN2, GATA3, CDX2, PAX8, WT1, NKX3.1, P63 (TP63) or P40, and helix-loop-helix proteins (Darnell, 2002). All of these transcription factors will be useful in the methods of the invention.

Many transcription factors have been found to be lineage specific and associated with specific and/or tissues, e.g.; one is always or usually expressed in some tissues or cancers but rarely or never expressed in others transcription factor. The methods of the invention can be used to detect TFBS sequences (optionally including flanking sequences), which can be used as tissue-specific and/or cancer-specific biomarkers.

Thyroid transcription factor 1 (TTF-1) is selectively expressed in thyroid, diencephalon, and airway epithelial cells during embryonic development. TTF-1 is expressed in tissue samples taken from neuroendocrine and non-neuroendocrine lung cancers, but its expression frequency varies significantly between different histological subtypes. Therefore, TFBS sequences found in ctDNA by the method of the present invention can also be used to identify cancer types.

PAX8 is a transcription factor involved in embryonic development of the thyroid, kidney and Müllerian system. PAX8 is abundantly expressed in tissue samples taken from non-mucinous ovarian, serous, endometrial, clear cell and transitional cell carcinomas. PAX8 is also expressed in endometrioid, uterine serous, endometrial clear cell, and ductal and lobular breast cancer tissues.

CDX2 is a lineage-specific transcription factor that plays a key role in controlling the proliferation and differentiation of intestinal epithelial cells and is expressed in almost all colorectal adenocarcinoma tissue samples.

NKX3.1 is required for normal prostate development and is a known marker expressed in almost all prostate cancers.

GATA3 transcription begins as early as the fourth week of human gestation. GATA3 is highly expressed in tissue samples obtained from breast cancer, particularly estrogen receptor-positive breast cancer tissue samples, as well as urothelial and transitional cell carcinomas.

WT1 plays an important role in embryonic development. WT1 is a good marker for ovarian cancer tissues and is expressed in a limited range of healthy adult tissues.

EN2 plays a role in embryonic development and is expressed in a range of cancers but in a minority of adult healthy tissues. The presence of EN2 in urine has been used as the basis for a urine test to detect prostate cancer.

Other transcription factor binding sites can be used in the methods of the invention. For example, upstream binding factor (UBF) is a transcription factor that binds ribosomal RNA gene promoters and activates transcription mediated by RNA polymerase I. UBF expression is known to be elevated in tissues of certain cancers. Many other such examples undoubtedly exist and are suitable transcription factors for use in the methods of the invention. In addition, RNA polymerase I and RNA polymerase III are also elevated in cancer. These segments are responsible for the transcription of tRNA and ribosomal RNA genes to provide the cellular machinery required for increased and rapid protein production, growth, and cellular replication characteristic of cancer cells and tissues. In another embodiment of the present invention, there is provided a method for detecting or measuring the binding of UBF, RNA polymerase I or RNA polymerase III in a cell-free chromatin fragment in a bodily fluid sample.

In some embodiments, the presence of protein transcription factors in bodily fluid chromatin fragments is not specific to a particular tissue or disease because transcription factors can be expressed in a variety of cell and tissue types. Thus, the methods of the invention are also capable of detecting ubiquitously expressed TFBSs associated with transcription factors, ie transcription factors expressed in more than 5, more than 10, more than 15, more than 20 or more than 30 tissue types. Also useful in the methods of the invention is the detection of TFBS sequences linked to such transcription factors, wherein the TFBS sequences occur at different genomic locations, for example in different gene promoters, in different tissues or in different disease states . Thus, the TFBS sequence and TFBS flanking sequences confer tissue and/or disease specificity to the methods of the invention. An advantage of this embodiment is that the number of such locations can be large. For example, 1041 CTCF TFBS positions are specifically occupied in cancer diseases. Similarly, differential occupancy of a large number of positions occurs for other highly expressed transcription factors including, for example, but not limited to, c-myc, n-myc, ER, AR, PR, and many others.

Transcription factors and their DNA target sequences bind in a highly coordinated manner to many other factors, including other transcription factors, cofactors, coactivators, corepressors, RNA polymerase moieties, elongation factors, chromatin remodeling factors, mediators, STAT section, UBF and others. This means that circulating chromatin fragments may contain larger gene regulatory complexes including: any or all DNA-attached nucleosomes, nuclear hormone receptors, steroid or other hormone receptors that bind nuclear hormones, other transcription factors , cofactor, co-activator, co-repressor, RNA polymerase moiety, elongation factor, chromatin remodeling factor, mediator, STAT moiety or cytokine or cytokine-related factor that binds to a STAT moiety, upstream binding factor (UBF) or any other part associated with such gene regulatory or transcriptional complexes.

In addition, any non-histone protein that binds to DNA in chromatin is suitable for use in the methods of the invention, including chromatin remodeling proteins, genetic and epigenetic read, write and delete proteins, proteins involved in RNA transcription (e.g. RNA polymerase proteins), chromatin architectural proteins, and chromatin structural proteins (such as DNA bending proteins).

The term "binding agent" as used herein refers to a ligand or binding agent, such as a naturally occurring, recombinant, or chemically synthesized compound, which is capable of specifically binding to a nucleosome. Ligands or binding agents according to the invention may comprise peptides, proteins, antibodies or fragments thereof, or synthetic ligands (e.g. plastic antibodies), or aptamers or oligonucleotides capable of specifically binding to nucleosomes or other targets. oligonucleotides, or molecular rubbing surfaces or devices. The ligands or binding agents of the invention may be labeled with detectable labels such as luminescent, fluorescent, enzymatic or radioactive labels; alternatively or additionally, affinity tags may be used to label Ligand, the affinity tag such as: biotin, avidin, streptavidin, his (eg hexa-His) tag. In one embodiment, the binding agent is selected from: antibodies, antibody fragments or aptamers. In another embodiment, the binding agent used is an antibody. The terms "antibody", "binding agent" or "binder" are used interchangeably herein.

In one embodiment, the sample is a biological fluid (which is used interchangeably with the term "body fluid" herein). Any bodily fluid sample type can be used in the present invention, including but not limited to: blood, plasma, menstrual blood, endometrial fluid, feces, urine, saliva, mucus, semen, and breath (e.g. condensed breath), or extracts or purifications thereof substances, or dilutions. Biological samples also include samples from living or autopsies. Samples can for example be prepared at appropriate dilutions or concentrations and stored in a conventional manner. In a preferred embodiment, the biological fluid sample is selected from: blood or serum or plasma. It will be clear to those skilled in the art that detection of chromatin fragments in bodily fluids has the advantage of a minimally invasive approach that does not require biopsy.

In one embodiment, the subject is a mammalian subject. In another embodiment, the subject is selected from a human or animal (eg, companion animal or mouse) subject. In yet another embodiment, the subject is a human subject. In one embodiment, the subject is pregnant. In one embodiment, the human subject is a non-embryonic subject (ie, a human being at any stage of development other than an embryo). In another embodiment, the human subject is an adult subject, ie greater than 16 years of age, such as greater than 18, 21 or 25 years of age. In an alternative embodiment, the subject is an animal subject. In another embodiment, the animal subject is selected from the group consisting of rodents (e.g., mice, rats, hamsters, gerbils, or chipmunks), felines (i.e., cats), canines (i.e., dogs), equines (i.e., i.e. horse), pig (i.e. pig) or bovine (i.e. cow) subject.

It should be understood that the uses and methods of the invention can be performed in vitro or ex vivo.

According to another aspect of the present invention, there is provided a method for detecting or diagnosing a disease in an animal or human subject, comprising the steps of: (i) removing nucleosomes from a sample of bodily fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; and (iii) using the DNA content and/or DNA sequence detected in step (ii) to identify the disease state of the subject.

In one embodiment of the invention, the presence of DNA fragments in a sample is used to determine the best treatment regimen for a desired subject.

According to another aspect of the present invention, there is provided a method for assessing whether an animal or human subject is suitable for medical treatment, comprising the steps of: (i) removing nucleosomes from a sample of bodily fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with fragments of cell-free chromatin in the remaining sample; and (iii) using the DNA content and/or DNA sequence detected in step (ii) as parameters for selecting an appropriate treatment for the subject.

According to another aspect of the invention, there is provided a method for monitoring treatment of an animal or human subject comprising the steps of: (i) removing nucleosomes from a sample of bodily fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; (iii) on one or more occasions, repeatedly detecting, analyzing, or measuring DNA associated with cell-free chromatin fragments in the remaining sample after removal of nucleosomes from a sample of bodily fluid obtained from the subject; and (iv) using any change in DNA content and/or DNA sequence detected in step (iii) compared to step (ii) as a parameter for any change in the subject's condition.

The amount and/or DNA sequence detected in a test sample associated with cell-free chromatin fragments containing transcription factors, compared to the amount or sequence measured in a previous test sample previously obtained in the same test subject , the resulting change can be used as an indicator of a beneficial effect, such as stabilization or amelioration of the condition or suspected condition by the treatment. In addition, once treatment is complete, the methods of the invention can be repeated periodically to monitor for recurrence of the disease.

In one embodiment, the treatment is for the treatment of cancer, autoimmune disease or inflammatory disease.

The cfDNA sequences linked to TFBS or other regulatory binding sites detected by the method of the present invention can be detected or measured as one of the measurement kits. Thus, in one embodiment, DNA content and/or DNA sequence is detected or measured as one of a set of measurements. For example, in combination with other DNA markers or any other biomarkers.

According to another aspect of the invention, there is provided a method for detecting or measuring a DNA sequence in a DNA fragment associated with a non-nucleosomal cell-free chromatin fragment (alone or as part of a set of measurements) for determining or For the purpose of assessing the suitability of an animal or human subject for medical treatment, or monitoring the treatment of an animal or human subject, such as in a subject with actual or suspected cancer or benign tumors.

The term "detection" or "diagnosis" as used herein encompasses the identification, confirmation and/or characterization of a disease state. The detection, monitoring and diagnostic methods according to the present invention can be used to identify persons at high risk of disease (for example, hemoglobin in stool is associated with increased risk of colorectal cancer) to confirm the presence of disease, monitor by assessing onset and progression Development of disease, or assessment of improvement or regression of disease. Detection, monitoring and diagnostic methods can also be used to assess clinical screening, prognosis, treatment selection, methods to assess the effectiveness of treatment, ie for drug screening and drug development.

Effective diagnostic and monitoring methods provide very powerful "patient solutions" with the potential to improve outcomes, by establishing the correct diagnosis, the most appropriate treatment can be quickly identified (thus reducing exposure to unnecessary harmful drug side effects), and Reduce recurrence rate.

It will be appreciated that identification and/or quantification may be performed by any method suitable for identifying the presence and/or amount of DNA or specific DNA sequences in a biological sample or a purification or extract or dilution of a biological sample from a patient. In the methods of the invention, identification and/or quantification can be performed by sequencing or by measuring the concentration or frequency of the TFBS sequence in one or more samples. Biological samples that can be tested with the methods of the invention include those as defined above. Samples can for example be prepared at appropriate dilutions or concentrations and stored in a conventional manner.

TFBS-specific DNA fragments can be detected directly. Alternatively, it can be measured directly or indirectly through the interaction of a ligand or ligands that specifically bind to a TFBS-specific DNA segment, such as a DNA molecule, transcription factor, or other ligand or fragment thereof . Suitable ligands include DNA molecules that can bind the complement of cfDNA by hybridization. A ligand or binding agent may have a detectable label, such as a luminescent, fluorescent or radioactive label, and/or an affinity tag.

For example, detection and/or quantification can be performed by one or more methods selected from: PCR, DNA sequencing, gene chip hybridization analysis or analysis by SELDI (-TOF), MALDI (-TOF), one-dimensional electrophoresis (1-D gel-based analysis), two-dimensional electrophoresis analysis (2-D gel-based analysis), mass spectrometry (MS), reverse phase (RP) LC, size permeation (gel filtration), ion exchange, affinity, HPLC , UPLC, and other LC- or LC-MS-based techniques. Suitable LC-MS techniques include ICAT® (Applied Biosystems, CA, USA) or iTRAQ® (Applied Biosystems, CA, USA). Liquid chromatography (eg high pressure liquid chromatography (HPLC) or low pressure liquid chromatography (LPLC)), thin layer chromatography, NMR (nuclear magnetic resonance) spectroscopy may also be used.

It should be understood that detecting and/or measuring DNA may include, for example, hybridization or sequencing as described herein.

Using immunological methods as described herein, including immunoprecipitation and removal of nucleosomes, may involve selective binding to any moiety of nucleosomes, including antibodies capable of specifically binding to nucleosomes, or Fragments, or nucleosome-binding chromatin proteins or peptides, or processed binders capable of specifically binding to nucleosomes.

The use of binder moieties that bind linker DNA-containing nucleosomes as described herein may comprise selectively binding any moiety of linker DNA-containing nucleosomes, including naturally derived proteins or peptides, expressed Protein, processed protein, or reprocessed protein. Furthermore, it may not be necessary to use intact proteins and truncated proteins or peptides can be used.

According to another aspect of the invention there is provided a biomarker identified by the methods described herein.

Provided herein are diagnostic or monitoring kits for practicing the methods of the invention. Such kits will suitably contain nucleosome binding agents, and selective reagents for DNA isolation, DNA library preparation, DNA amplification reagents, and selective reagents for DNA sequencing or analysis, optionally There are also ligands for detecting and/or quantifying the cfDNA or biomarker of interest, optionally together with instructions for using the kit. Biomarker monitoring methods, biosensors, and kits are also critical as patient monitoring tools, enabling physicians to determine whether relapses are due to worsening disease. If medical therapy is assessed to be inadequate, therapy may be resumed or increased; therapy may be altered if appropriate. As biomarkers are sensitive to disease state, they provide an indicator of the impact of drug treatment.

According to another aspect of the present invention, there is provided a kit for detecting the sequence of a cfDNA fragment, which comprises a nucleosome binding agent and a reagent for amplifying and/or sequencing DNA related to the cfDNA sequence, selectively Also provided are instructions for using the kit according to the methods described herein.

Another aspect of the invention is a kit for detecting the presence of a disease state comprising a biosensor capable of detecting and/or quantifying one or more biomarkers as defined herein.

According to another aspect, there is provided the use of a kit as defined herein for the diagnosis of cancer. According to another aspect, there is provided a kit as defined herein for use in the diagnosis of an inflammatory disease. According to another aspect, there is provided the use of a kit as defined herein for the diagnosis of a prenatal disease.

According to another aspect, there is provided a method of treating a disease in a subject in need thereof, wherein the method comprises the steps of: (a) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to specific nucleosomes; (b) detecting or measuring DNA fragments that are not bound to the binding agent in step (a); (c) using the presence, sequence or quantity of DNA fragments as an indicator of the presence of disease in a subject; and (d) administering treatment if it is determined in step (c) that the subject has the disease.

In one embodiment, the disease is cancer, an autoimmune disease or an inflammatory disease (eg, as described above). In another embodiment, the disease is cancer.

In one embodiment, the therapy administered is selected from the group consisting of surgery, radiation therapy, chemotherapy, immunotherapy, hormone therapy and biological therapy.

According to another aspect of the present invention, there is provided a method of treating cancer in a subject in need thereof, wherein said method comprises the steps of: (a) detecting or diagnosing cancer in the subject according to the methods described herein; then (b) subjecting said individual to anticancer therapy, surgery or drugs.

In one embodiment, the subject is a human or animal subject.

We now illustrate the invention by the following examples.

Example 1

We coat Dynabeads M280 Tosyl Activated Magnetic Beads with an antibody that binds to the histone H3 epitope at amino acid positions 30-33. This antibody was selected from many tested antibodies because it was observed to bind to nucleosomes containing intact histone tails and to nucleosomes with truncated histone tails.

We added anti-H3 antibody-coated magnetic beads (1 mg) to solutions containing a range of concentrations of recombinant mononucleosomes (0.5 ml). Incubate the beads with nucleosomes for 1 hr at room temperature while gently rolling the tube to keep the beads in suspension. The beads are magnetically separated and washed. Nucleosomes adsorbed to the beads were then removed by elution and analyzed by western blotting. The results showed that magnetic beads adsorbed nucleosomes from solution in a dose-dependent manner, as shown in Figure 3.

Example 2

Anti-H3 antibody coated magnetic beads were prepared and used as described in Example 1. We added anti-H3 antibody coated magnetic beads as well as uncoated magnetic beads to 8 human EDTA plasma samples and solutions containing a range of concentrations of recombinant mononucleosomes. The recombinant mononucleosome concentration range was chosen to encompass levels typically observed in human clinical samples.

Preferred embodiments of the invention involve removing all or most of the nucleosomes present in the sample prior to DNA analysis. Therefore, to detect the presence of nucleosomes left in solution after incubation with magnetic beads, we used an ELISA against nucleosomes with an optical density (OD) readout. The results shown in Figure 4 indicate that after adsorption with anti-H3 antibody-coated magnetic beads, the amount of recombinant mononucleosomes remaining in the solution was undetectable (similar to that of the control solution without nucleosomes). OD), while solutions incubated with uncoated magnetic beads were not affected, resulting in a normalized ELISA dose-response curve. Similarly, the amount of nucleosomes remaining in solution was also low or undetectable in eight human plasma samples tested after adsorption with anti-H3 antibody-coated magnetic beads, but not affected by uncoated magnetic beads. The influence of cultivation. These results demonstrate that it is possible to quantitatively remove nucleosomes from human plasma samples using the method of the present invention.

Example 3

Plasma samples were taken from healthy subjects and subjects with various cancer diseases, including but not limited to lung cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, liver cancer, kidney cancer, bladder cancer, thyroid cancer, head and neck cancer, oral cancer, throat cancer Cancer of the esophagus, stomach, ovary, uterus, endometrium, skin and hematopoietic tissues (lymphoma and leukemia). Nucleosomes in the samples were depleted as described in Example 2, and the remaining plasma samples were analyzed. DNA was isolated from nucleosome-depleted plasma samples, amplified to generate libraries and sequenced. Analysis of DNA sequencing results to identify transcription factor binding site (TFBS) sequences and flanking sequences that are selectively present at elevated levels in samples from cancer patients but not in samples from healthy patients Absent or present in low levels. Some of these DNA sequences were present in samples taken from a variety of cancer disease types. Other DNA sequences are present in samples taken from patients with cancer of a particular organ or type of cancer. The results are used to select transcription factors and TFBS sequences and flanking sequences for use in the methods of the invention, for association with cancer itself or with specific cancer disease types.

Example 4

The experiments described in Example 3 were repeated, but the DNA sequencing results were analyzed for patterns of chromatin fragmentation that characterize cancer or specific cancer disease types.

Example 5

Plasma samples were taken from healthy subjects and subjects with prostate cancer. Nucleosomes in the samples were depleted as described in Example 2. DNA is then isolated from the plasma sample, amplified and sequenced using a next-generation sequencing instrument. The sequencing results were analyzed for the presence of TFBS and flanking sequences for the transcription factors NKX3.1 and GRHL2. NKX3.1 and GRHL2 TFBS sequences were detected in plasma samples taken from prostate cancer patients but not or at low levels in samples taken from healthy subjects.

Example 6

The experiment described in Example 5 was repeated, but the isolated DNA was amplified using sequence-specific primers designed to amplify multiple promoter sequences, including TFBS and the transcription factors NKX3.1 and GRHL2 flanking sequence. The results showed that the content of DNA comprising at least one amplified TFBS sequence was higher in samples taken from prostate cancer patients and lower in samples taken from healthy subjects.

Example 7

An experiment similar to that described in Example 6 was performed, but using lung cancer samples and TFBS linked to TTF-1 and GRHL2 and flanking sequences. The results showed that the content of DNA comprising at least one amplified TFBS sequence was higher in samples taken from lung cancer patients and lower in samples taken from healthy subjects.

Example 8

An experiment similar to that described in Example 6 was performed, but using colorectal cancer samples and TFBS and flanking sequences linked to CDX-2 and GRHL2. The results showed that the DNA content comprising at least one amplified TFBS sequence was higher in samples taken from colorectal cancer patients and lower in samples taken from healthy subjects.

Example 9

An experiment similar to that described in Example 6 was performed, but using breast cancer samples and TFBS linked to GATA3 and GRHL2 and flanking sequences. The results showed that the amount of DNA comprising at least one amplified TFBS sequence was higher in samples taken from breast cancer patients and lower in samples taken from healthy subjects.

Example 10

The experiment described in Example 5 was repeated, but the isolated DNA was contacted with the immobilized transcription factor NKX3.1 and the immobilized transcription factor GRHL2 on the magnetic solid phase. The amount of DNA bound to the two magnetic transcription factors was measured by PCR. The results showed that the amount of DNA comprising at least one amplified TFBS sequence was higher in samples taken from prostate cancer patients and lower in samples taken from healthy subjects.

Example 11

Plasma samples were taken from healthy subjects and subjects with prostate, breast or lung cancer. Nucleosomes in the samples were depleted as described in Example 2. DNA was then isolated from the plasma samples, amplified and contacted with various transcription factors immobilized on Luminex beads. Transcription factors NKX3.1, GATA3, TTF-1, CDX-2, and GRHL2 were immobilized on beads of different colors according to the manufacturer's protocol. Labeled anti-DNA antibodies were used to measure the amount of DNA bound to each transcription factor. The results showed that the amount of DNA bound to beads coated with NKX3.1 and GRHL2 was elevated in samples taken from prostate cancer patients, while the amount bound to other beads was lower; DNA bound to beads coated with GATA3 and GRHL2 The amount of DNA bound to beads coated with TTF-1 and GRHL2 was elevated in samples taken from patients with breast cancer, while the amount bound to other beads was lower; Binding to other beads is low. In contrast, the amount bound to all beads was lower in samples taken from healthy subjects.

Example 12

The experiment described in Example 11 was repeated with similar results, but immobilized NKX3.1, GATA3, TTF-1, CDX-2 and GRHL2 bound DNA was measured by PCR.

Example 13

We coated histone H3-binding monoclonal antibodies on magnetic beads (MyOne TosylActivated DynabeadsTM) using standard methods. Briefly, monoclonal antibodies were incubated with magnetic beads (40 μg antibody/mg beads) in 0.1M Borate Buffer pH 9.5 containing 1M ammonium sulfate in roller bottles at 37°C for 18 hours to Keep the beads in suspension. Pellet the beads and decant the supernatant. Beads were resuspended and incubated in blocking buffer in phosphate-buffered saline pH 7.4 (PBS) containing 0.1% Tween 20 and 1% bovine serum albumin (BSA) for 1 hour at 37°C. Beads were then pelleted, washed twice with PBS containing 0.1% Tween 20 and 1% BSA, and stored in PBS containing 0.1% Tween 20, 1% BSA and preservatives.

EDTA plasma samples (2.5 mL) collected from patients diagnosed with CRC were incubated with magnetic beads (0.15 mL, 10 mg/ml) in tubes for 1 hour at room temperature, rolling to keep particles in suspension. Magnetic particles are precipitated and removed. Keep the remaining nucleosome-depleted samples.

DNA was then extracted from nucleosome-depleted samples as well as from raw unprocessed plasma samples using a commercially available DNA extraction kit (Qiagen QIAamp DSP circulating NA kit) according to the manufacturer's instructions.

Extracted cfDNA was amplified to generate single-stranded libraries for sequencing using a commercially available kit (Claret Bio SRSLY NGS Library Prep Kit) according to the manufacturer's instructions.

The amplified cfDNA library was sequenced by Next Generation Illumina NovaSeq sequencing.

Using the Illumina DRAGEN Bioinformatics pipeline (https://emea.illumina.com/products/by-type/informatics-products/dragen-bio-it-platform.html), each sequenced read representing a cfDNA fragment was aligned with a human reference The genome GRCh38/hg38 was compared. The resulting aligned BAM files were used to create subsets of different fragment sizes (35-80bp, 135-155bp, and 156-180bp) using Sequence Alignment/Map SAMtools (Li et al , 2009). Read coverage (number of fragments found covering a specific locus) was calculated using a bin size of 1 bp (highest resolution possible). Read coverage was normalized to the total number of reads mapped to the human genome using RPGC (reads per genome coverage) using deepTools bamCoverage.

CTCF is often used as a model transcription factor because it is excellently characterized by the 9780 known and published CTCF TFBS sequences (Kelly et al , 2012). Coverage results for short cfDNA fragments of 35-80 bp at the locus of 9,780 published CTCF-binding sites are consistent with expected CTCF-associated DNA fragment sizes compared to coverage of longer cfDNA fragments , consistent with the expected size (135–155 bp and 156–180 bp) bound to circulating mononucleosomes, as shown in Fig. 5(a). Coverage is shown to be within 5000 bp, encompassing 2500 bases upstream and downstream of the CTCF binding site position. We observed strong coverage peaks bound by small 35-80bp cfDNA fragments at the genomic location of the CTCF TFBS locus reported by Kelly et al , 2012. Because the sequenced library was generated from cfDNA after nucleosome removal, the cfDNA library contained few nucleosomes and had low nucleosome localization signal. The amplitude of the 35–80 bp cfDNA fragment coverage peak in the genome at the CTCF TFBS locus (approximately 5 in Fig. 5(a)) was much larger than that of the periodic nucleosome positioning peak (approximately 0.25). This low background property produces an enhanced 35-80bp signal.

In contrast, the 35–80 bp cfDNA fragment coverage peak at the CTCF TFBS locus in the genome from a cfDNA library obtained from the same sample that had not been treated to remove nucleosomes showed a smaller amplitude peak (Fig. 5(b ), which is about 0.7 in ), which is similar to the amplitude of the periodic nucleosome positioning peak (about 0.25). This indicates that the method of the present invention successfully removes nucleosome-associated background cfDNA signals from liquid biopsy methods, thereby providing improved sensitivity for fragmentomics cfDNA analysis methods and other cfDNA analysis methods.

We then repeated the analysis for 1041 CTCF TFBS, which are known to be selectively occupied in immortalized cancer cells (Liu et al , 2017), but not in healthy cells. The results shown in Figure 6(a) show that there are clear fragment coverage peaks for 35-80 bp cfDNA fragments bound to 1041 cancer-specific CTCF TFBS sequences, with low background nucleosome periodicity signal. This points to CTCF occupancy of cancer-specific TFBS loci and thus the tumor cell origin of these cfDNA fragments. Likewise, a cfDNA library obtained from the same sample that had not been treated to remove nucleosomes showed 35–80 bp cfDNA fragment coverage peaks at 1041 CTCF TFBS loci that were less clear and smaller amplitude peaks (Fig. 6( b)).

The demonstration by ChIP-Seq of CTCF-linked cfDNA fragments in body fluids binding to cancer-specific TFBS loci is an indicator of the presence of cancer disease in the subjects studied and can be used in this way as a biomarker. We conclude that the method of the present invention successfully identifies disease-associated TFBS in plasma as a biomarker of disease.

References Active Motif, Nat. Methods 3: 658 (2006), doi:10.1038/NMETH907 Bohinski et al . Molecular and Cellular Biology, 14(9): 5671 (1994) Corces et al . Science, 362(6413): eaav1898 (2018), doi:10.1126/science.aav1898. Crowley et al . Nat. Rev. Clin. Oncol. 10: 472-484 (2013), doi:10.1038/nrclinonc.2013.110 Darnell, Nat. Rev. Cancer 2: 740 -749 (2002), doi:10.1038/nrc906 Deligezer et al . Clinical Chemistry 54:7 1125–1131 (2008) Dunbar, Clinica Chimica Acta 363 (1-2): 71-82 (2006), doi.org/10.1016 /j.cccn.2005.06.023 Gurel et al . Am J Surg Pathol, 34(8):1097-105 (2010), doi:10.1097/PAS.0b013e3181e6cbf3. Heinz et al . Mol. Cell 38(4): 576 Hu et al . J. Trans. Med. 17: 124 (2019), doi:10.1186/s12967-019-1871-x Jung et al . Clin. Chim. Acta 411 (21-22): 1611-24 (2010), doi:10.1016/j.cca.2010.07.032 Kelly et al . Genome Res. 22: 2497-2506 (2012), doi :10.1101/gr.143008.112. Klenova et al . Nucleic Acids Res. 25(3): 466–473 (1997), doi.org/10.1093/nar/25.3.466 Lambert et al . Cell 172(4):650- 665 (2018), doi:10.1016/j.cell.2018.01.029 Latil et al . Cell Stem Cell 20(2): 191-204.e5 (2017), doi:10.1016/j.stem.2016.10.018. Lee et al . J. Mol. Med. (Berl). 85(12):1393-404 (2007), doi: 10.1007/s00109-007-0237-7 Li et al . Bioinformatics 25(16): 2078–2079 ( 2009), doi: 10.1093/bioinformatics/btp352 Lin et al . PLoS Genet. 3(6):e87 (2007), doi: 10.1371/journal.pgen.0030087.eor Liu et al . Oncotarget 8(69): 114183- 114194 (2017), doi: 10.18632/oncotarget.23172 Liu et al . EBioMedicine 41: 345-356 (2019), doi: 10.1016/j.ebiom.2019.02.010 Maenhaut et al . 2015 In: Alcet, Feingold, Anaw et al ., editors. Endotext. https://www.ncbi.nlm.nih.gov/books/NBK285554/ Mann et al . Curr. Top Dev. Biol. 88: 63-101 (2009), doi:10.1016/ S0070-2153(09)88003-4. Mansson et al . Mol. Oncol. 15(11): 2868-2876 (2021), doi:10.1002/1878-0261.13093 Matys et al . Nucl eic Acids Res. 34: D108–D110 (2006), doi:10.1093/nar/gkj143 Merabet and Mann, Trends Genet. 32(6): 334-347 (2016), doi:10.1016/j.tig.2016.03.004 . Newman et al . Nat. Med. 20(5): 548-54 (2014), doi:10.1038/nm.3519 Park et al . Oncol. Lett. 3(4): 921-926 (2012), doi: 10.3892/ol.2012.592 Pomerantz et al . Nat. Genet. 47(11): 1346-51 (2015), doi:10.1038/ng.3419. Poorey et al . Science 342(6156): 369-72 (2013), doi:10.1126/science.1242369. Ramírez et al . Nucleic Acids Res. 44(W1): W160-5 (2016), doi: 10.1093/nar/gkw257 Ralston, Do transcription factors actually bind DNA? DNA footprinting and gels shift assay . Nature Education 1(1): 121 (2008) Sadeh et al . Nat. Biotechnol. 39: 586–598 (2021), doi.org/10.1038/s41587-020-00775-6 Sanchez et al . NPJ Genom. Med . 3: 31 (2018), doi:10.1038/s41525-018-0069-0 Skene and Henikoff, eLife 6:e21856 (2017), doi:10.7554/eLife.21856.002 Snyder et al . Cell 164 (1-2): 57-68 (2016), doi:10.1016/j.cell.2015.11.050 Ulz et al . Nat. Commun. 10(1): 4666 (2019), doi:10.1038/s41467-019-12714-4 Vad-Nielsen et al . Lung Cancer 147 : P244-251 (2020), doi.org/10.1016/j.lungcan.2020.07.023 Vaquerizas et al . Nat. Rev. Genet . 10(4): 252-63 (2009), doi:10.1038/nrg2538 Wang et al . Genome Res. 22(9): 1680-8 (2012), doi: 10.1101/gr.136101.111 Zhang et al . Genome Biol . 9(9): R137 (2008), doi: 10.1186/gb-2008-9-9-r137 Zhou et al . BMC Genomics 18(1):724 (2017), doi: 10.1186/s12864-017-4115- 6

none

Figure 1: Expression of various transcription factors in the genes for surface tension protein B (surfactant protein B), thyroglobulin (thyroglobulin), thyroid peroxidase (thyroperoxidase), and thyrotropin receptor (TSH receptor) Cartoon illustration of co-binding of promoter sites. CRE: cyclic adenosine monophosphate response element (cyclic adenosine monophosphate response element); GABP: GA-binding protein (GA-binding protein); HNF-3: hepatocyte nuclear factor 3 (Hepatocyte nuclear factor 3); NF-1: nuclear factor 1 (Nuclear factor 1); PAX-8: Paired box gene 8 (Paired box gene 8); Runx2: Runt-related transcription factor 2 (Runt-related transcription factor 2); TRα/RXR dimer: Thyroid hormone receptor α / Retinoid X receptor dimer (TRα/RXR dimer: Thyroid hormone receptor α/Retinoid X receptor dimer); TTF-1: Thyroid transcription factor 1 (also known as NK2 homeobox 1, NKX2-1); TTF-2: Thyroid transcription factor 2. Figure 2: Cartoon diagram of an example of a DNA loop structure of a transcription complex to illustrate the co-binding of some of the various regulatory proteins involved in the transcription complex, including but not limited to: general transcription factor (GTF), gene-specific Transcription factors (TFs), cofactors, activators, repressors, mediators, DNA bending proteins, and RNA polymerases. Regulatory proteins bind to regulatory DNA sequences located near the gene as well as regulatory sequences remote from the gene, including promoter sequences, TATA box sequences, enhancer sequences, and repressor sequences. Other regulatory proteins, such as chromatin remodeling proteins, as well as other regulatory sequences are possible. Figure 3: Western blot analysis of recombinant mononucleosomes adsorbed to magnetic beads coated with an antibody that binds to histone H3. The results demonstrate dose-dependent adsorption of mononucleosomes by the method of the invention. Figure 4: Nucleosome ELISA results from human plasma samples and recombinant mononucleosome solutions, which were immunoprecipitated from nucleosomes using uncoated magnetic beads or magnetic beads coated with an antibody that binds to histone H3 Rear. The results showed that neither circulating human nucleosomes nor recombinant nucleosomes naturally occurring in solution were affected by uncoated beads, but were quantified by immunoprecipitation using magnetic beads coated with an antibody that binds histone H3. remove. Figure 5: Normalized coverage of 9780 published CTCF TFBS loci by short cfDNA fragments (35-80bp) or larger cfDNA fragments (135-155bp or 156-180bp). (a) Coverage of the CTCF TFBS locus by the cfDNA sequence library obtained by the method of the present invention from plasma samples collected from nucleosome-depleted CRC patients. (b) Coverage without nucleosome depletion in the same samples. Figure 6: Normalization of 1041 published CTCF TFBS loci occupied by CTCF in cancer cells but not normal cells by short cfDNA fragments (35-80bp) or larger cfDNA fragments (135-155bp or 156-180bp) Coverage. (a) Coverage of cancer-associated CTCF TFBS loci in a cfDNA sequence library obtained by the method of the present invention from plasma samples collected from nucleosome-depleted CRC patients. (b) Coverage without nucleosome depletion in the same samples.

none

Claims (27)

A method of detecting a cell-free DNA chromatin fragment comprising all or a portion of a transcription factor binding site sequence, optionally including flanking sequence, the method includes the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes; and (ii) analyzing DNA from the body fluid sample not bound to the binding agent in step (i). A method of detecting chromatin fragmentation patterns in cell-free DNA in a body fluid sample obtained from a human or animal subject, comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to nucleosomes; and (ii) analyzing DNA from the body fluid sample not bound to the binding agent in step (i). The method according to claim 1 or 2, wherein the binding agent binds to nucleosome core epitopes. The method according to claim 1 or 2, wherein the binding agent binds to nucleosomes containing linker DNA. The method according to claim 4, wherein the binding agent is all or a part of histone H1 or a chromatin binding protein. The method according to claim 4, wherein the binding agent binds to histone H1 or a component thereof. The method according to any one of claims 1 to 6, wherein the binding agent is attached to a solid support. The method according to any one of claims 2 to 7, wherein the DNA is analyzed for the presence of a transcription factor binding site and/or flanking sequences. The method according to any one of claims 1 to 8, wherein the DNA is analyzed by PCR. The method according to any one of claims 1 to 9, wherein the method further comprises using the presence, content, sequence or fragmentation pattern of the DNA as an indicator of the subject's disease state. A method of detecting chromatin fragmentation patterns in cell-free DNA in a body fluid sample obtained from a human or animal subject, comprising the steps of: (i) contacting the bodily fluid sample with a binding agent that binds to a nucleosome containing linker DNA; and (ii) analyzing DNA from the body fluid sample not bound to the binding agent in step (i). A method of detecting disease in a human or animal subject, comprising the steps of: (i) contacting a sample of bodily fluid obtained from the human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) selectively amplifying the isolated DNA; (iv) determine the sequence of the DNA; and (v) using a transcription factor binding site DNA sequence and optionally flanking DNA sequences present in the DNA as a biomarker to determine the presence and/or nature of the disease in the subject. A method of detecting disease in a human or animal subject, comprising the steps of: (i) contacting a sample of bodily fluid obtained from the human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) selectively amplifying the isolated DNA; (iv) DNA testing; and (v) using the DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (iv) as an indicator of the presence and/or nature of the disease in the subject. The method according to claim 13, wherein the amplification is performed by a PCR method using sequence-specific primers. A method of detecting disease in a human or animal subject comprising the steps of: (i) contacting a sample of bodily fluid obtained from the human or animal subject with a binding agent that binds to nucleosomes; (ii) isolating DNA not bound to the binding agent in step (i); (iii) detection of isolated DNA using hybridization methods; and (iv) using the presence or amount of hybridized DNA as an indicator of the presence and/or nature of disease in a subject. The method of claim 15, wherein the isolated DNA is amplified before hybridization. The method according to any one of claims 1 to 16, wherein the body fluid sample is a blood, serum or plasma sample. A method of detecting or diagnosing disease in an animal or human subject comprising the steps of: (i) removing nucleosomes from a sample of body fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; and (iii) using the DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (ii) to identify a disease state in the subject. The method according to any one of claims 15 to 18, wherein the disease is selected from cancer, autoimmune disease or inflammatory disease. A method of assessing the suitability of an animal or human subject for medical treatment comprising the steps of: (i) removing nucleosomes from a sample of body fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; and (iii) using the DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (ii) as parameters for selecting an appropriate treatment for the subject. A method for monitoring treatment of an animal or human subject comprising the steps of: (i) removing nucleosomes from a sample of body fluid obtained from the subject; (ii) detecting, analyzing or measuring DNA associated with cell-free chromatin fragments in the remaining sample; (iii) on one or more occasions, repeatedly detecting, analyzing, or measuring DNA associated with cell-free chromatin fragments in the remaining sample after removal of nucleosomes from a sample of bodily fluid obtained from the subject; and (iv) using any change in DNA content and/or DNA sequence and/or DNA fragmentation pattern detected in step (iii) compared to step (ii) as a parameter for any change in the subject's condition. The method of claim 20 or 21, wherein the treatment is for the treatment of cancer, autoimmune disease or inflammatory disease. The method of any one of claims 18 to 22, wherein DNA content and/or DNA sequence is detected or measured as one of a set of measurements. A kit for detecting cfDNA fragment sequences, comprising a nucleosome binding agent and for amplification and/or sequencing and/or fragmentation patterns of DNA linked to the cfDNA sequences, optionally also on request Instructions for use of the kit in the method of any one of items 1 to 23. A method of treating a disease in a subject in need thereof, wherein the method comprises the steps of: (i) contacting a sample of bodily fluid obtained from a human or animal subject with a binding agent that binds to nucleosomes; (ii) detecting or measuring DNA fragments not bound to the binding agent in step (i); (iii) using the presence, sequence, amount, or pattern of fragmentation of DNA fragments as an indicator of the presence of disease in the subject; and (iv) administering treatment if the subject is determined to have the disease in step (iii). The method of claim 25, wherein the treatment administered is selected from the group consisting of surgery, radiation therapy, chemotherapy, immunotherapy, hormone therapy and biological therapy. A method of detecting a fetal disease state in a sample of bodily fluid obtained from a pregnant human or animal subject, comprising the steps of: (i) exposing the sample of maternal body fluid to a binding agent that binds to nucleosomes; (ii) analyzing DNA not bound to the binding agent in step (i); and (iii) using the presence, amount, sequence and/or fragmentation pattern of the DNA as an indicator of the subject's fetal disease state.

Images